Patent Grant
9309503
This application is the U.S. national phase of International Application No. PCT/EP2008/058731, filed 4 Jul. 2008, which designated the U.S. and claims priority to European Application No(s). 07013092.7, filed 4 Jul. 2007, and 08000828.7, filed 17 Jan. 2008, the entire contents of each of which are hereby incorporated by reference.
The present invention relates to a method for the preparation of a protein with esterase activity comprising expression of a gene encoding such a protein in an Escherichia coli (E. coli) strain.
High level expression of proteins with Pig Liver Esterase activity is not easily realized. Reports by Lange et al (2001) [1] indicate low but detectable production of the γ-isoenzyme of Pig Liver Esterase (γ-rPLE) in Pichia pastoris. More recently a method has been described by Böttcher et al. (2007) [2]. These authors showed that the expression of the γ-isoenzyme of Pig Liver Esterase (γ-rPLE) in an E. coli strain was not a straightforward process. Such expression failed completely if no additional measures were taken. These measures imply not only proper selection of a suitable E. coli strain, but also co-expression of chaperone proteins. In particular, preparation of functional γ-rPLE turned out to be possible only in the E. coli strain Origami, co-expressing considerable amounts of the chaperone proteins designated as GroEL and GroES.
At least part of the problems encountered in proper expression of γ-rPLE relates to the occurrence of multiple disulfide bonds in the protein.
Very surprisingly and against the teaching reported by Böttcher et al. (2007) [1] it was discovered according to the present invention that functional expression of a protein with pig liver esterase (PLE) activity could be achieved without the extensive additional measures disclosed by Böttcher et al. (2007) [1] and in particular without co-expression of additional genes.
Accordingly, the present invention relates to a method for the preparation of a protein with esterase activity comprising expression of a gene encoding such protein in an E. coli strain, characterized in that the gene encoding the protein with esterase activity has at least 70% identity, preferably at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity and most preferably at least 99% identity to the polynucleotide of SEQ ID NO 11, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42 or SEQ ID NO 44 and encodes a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to SEQ ID NO 12, SEQ ID NO 33, SEQ ID NO 35, SEQ ID NO 37, SEQ ID NO 39, SEQ ID NO 41, SEQ ID NO 43 or SEQ ID NO 45, respectively. It is an advantage of the invention that correctly folded esterases are obtained, without the need to co-express GroEL and/or GroES from a plasmid. In a preferred embodiment the expression takes place without coexpression of GroEL and/or GroES from a plasmid.
In the framework of this invention, identity is calculated as described in Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbial Lett. 174:247-250, using the following standard parameters at Hypertext Transfer Protocol Secure://world wide web ncbi.nlm.nih.gov/BLAST/bl2seq/wblast2.cgi
for Protein sequences:
Matrix: BLOSUM62
Open gap: 5
extension gap: 2
Penalties gap x_dropoff: 11
Expected: 10
word size: 11
for nucleotide sequences:
Reward for match: 1
Penalty for mismatch: −2
Open gap: 11
extension gap: 1
Penalties gap x_dropoff: 50
Expected: 10
word size: 3
More preferably, the invention relates to a method for the preparation of a protein with esterase activity comprising expression of a gene encoding such protein in an E. coli strain, characterized in that the gene encoding the protein with esterase activity has at least 70% identity, preferably at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity and most preferably at least 99% identity to the polynucleotide of SEQ ID NO 11, and encodes a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to SEQ ID NO 12.
According to a further embodiment the present invention relates to a method for the preparation of a protein with esterase activity comprising expression of a gene encoding such protein in an E. coli strain, characterized in that the gene encodes a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to. SEQ ID NO 12. SEQ ID NO 12 represents the amino acid sequence of APLE.
According to another embodiment the present invention relates to a recombinant E. coli strain suitable for the preparation of a protein with esterase activity, characterized in that the organism contains a gene encoding the protein with esterase activity which has at least 70% identity, preferably 80% identity, more preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity and most preferably at least 99% identity to the polynucleotide of SEQ ID NO 11 SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42 or SEQ ID NO 44, and encodes a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to SEQ ID NO 12 SEQ ID NO 33, SEQ ID NO 35, SEQ ID NO 37, SEQ ID NO 39, SEQ ID NO 41, SEQ ID NO 43 or SEQ ID NO 45, respectively. In a preferred embodiment, the recombinant E. coli strains do not comprise a plasmid for co-expression of GroEL and/or GroES and are capable of producing proteins with esterase activity.
In particular, the present invention relates to a recombinant E. coli strain suitable for the preparation of a protein with esterase activity according to the method described above, wherein the organism contains a gene coding for a protein with esterase activity wherein the gene has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, at least 95% identity, preferably 98% identity and most preferably at least 99% identity to the polynucleotide of SEQ ID NO 11, and encodes a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to SEQ ID NO 12.
In particular, the present invention also relates to a recombinant E. coli strain suitable for the preparation of a protein with esterase activity according to the method described above, wherein the organism contains a gene coding for a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to SEQ ID NO. 12.
According to a further embodiment the present invention relates to a recombinant E. coli strain suitable for the preparation of a protein with esterase activity, characterized in that the expression of glutathione reductase and/or thioredoxin reductase is abolished, e.g. by a mutation.
According to a further embodiment of the present invention the expression of both glutathione reductase and thioredoxin reductase of the recombinant E. coli strain is abolished.
Prinz et al (1997) [3] have taught that the activity of a protein containing disulfide bridges (in particular alkaline phosphatase) expressed in E. coli is higher if this protein has been produced in a strain in which the activity of a reductase has been abolished. It was shown also that if both reductases have been abolished spontaneous mutations will take place which enable growth under aerobic conditions. Beckwith et al. (2005) [4] identified a possible spontaneous mutation which restores the ability of the organism to grow under aerobic conditions. They claimed that a mutation in the AhpC gene, comprising an insertion of three nucleotides in the TCT triplet rich region at about codons 36-39 of this gene provides this effect.
Bessette et al. (1999) [5] have analyzed the expression system described by Prinz et al. (1997) in further detail and have shown that the co-expression of the helper protein DsbC (disulfide bond isomerase) enhances the expression of active tissue plasminogen activator and of active alkaline phosphatase. In addition it was disclosed that intracellular expression of a truncated version of DsbC resulted in a functional disulfide bond isomerase protein.
According to a further embodiment of the present invention the recombinant E. coli has been further modified so as to produce a low molecular weight helper protein which is capable to introduce disulfide bonds for a proper folding of proteins requiring disulfide bonds and or is capable to correct misfolding caused by inappropriate disulfide bonds.
Suitable low molecular weight helper proteins referred to above are disulfide isomerases. In a particularly preferred embodiment the helper protein is a protein indicated as DsbC of E. coli (Bessette et al (1999)).
E. coli strains which suitably can be used according to the present invention have the property of a less reductive intracellular environment than wild-type E. coli strains. A particular example of such E. coli strain is the E. coli Origami strain which possesses mutations in the glutathione reductase gene and the thioredoxin reductase gene (Terpe (2006)[6]. When functionally expressed, these genes are counteracting disulfide bond formation in the cytoplasm. Thus heterologous expression of proteins containing disulfide bonds was hitherto considered to require elimination of glutathione and thioredoxin reductase activities, respectively.
However, it was discovered that only one of the mutations is sufficient to have increased functional expression of proteins with PLE activity.
Surprisingly, suitable esterase encoding genes are polynucleotides which encode esterase proteins, and which have codon usage adapted to Pichia.
More in particular, the present invention relates to genes encoding functional esterase protein and which have nucleotide sequence with at least 70% identity, preferably at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity and most preferably at least 99% at least 95% identity compared to the polynucleotide of SEQ ID NO 11, and encodes a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to SEQ ID NO 12.
In an embodiment of the invention, the invention relates to an isolated polynucleotide encoding a functional protein with esterase activity which has a nucleotide sequence of at least 70% identity, preferably at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity and most preferably at least 99% identity to the polynucleotide of SEQ ID NO 11, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42, or SEQ ID NO 44 and encodes a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to SEQ ID NO 12, SEQ ID NO 33, SEQ ID NO 35, SEQ ID NO 37, SEQ ID NO 39, SEQ ID NO 41, SEQ ID NO 43 or SEQ ID NO 45, respectively.
Production of proteins in large amounts can be achieved by expression of the gene encoding the protein of interest in inter alia microbial hosts like bacteria and yeasts, that are amenable to large scale fermentative production. Bacterial protein expression systems have recently been reviewed by Terpe (2006).
According to the present invention such a gene encoding the protein of interest is expressed in a transformed E. coli strain. Transformation of E. coli with the heterologous gene can be accomplished by any suitable method, such as by electroporation, by heat shock transformation, or by chemical transformation.
For transformation of E. coli the gene encoding the protein with esterase activity can be part of a vector, such as a plasmid, a bacteriophage or a phagemid.
The invention also relates to vectors suitable for replication and expression in E. coli containing a polynucleotide encoding a protein with esterase activity which has a nucleotide sequence with at least 70% identity, preferably at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity and most preferably at least 99% identity to the polynucleotide of SEQ ID NO 11, SEQ ID NO 32, SEQ ID NO 34, SEQ ID NO 36, SEQ ID NO 38, SEQ ID NO 40, SEQ ID NO 42, or SEQ ID NO 44 and encodes a protein that has at least 80% identity, preferably at least 85% identity, preferably at least 90% identity, preferably at least 95% identity, preferably at least 98% identity, more preferably at least 99% identity to SEQ ID NO 12, SEQ ID NO 33, SEQ ID NO 35, SEQ ID NO 37, SEQ ID NO 39, SEQ ID NO 41, SEQ ID NO 43 or SEQ ID NO 45, respectively.
The vector should contain the necessary functional elements suitable for e.g. selection, replication, gene regulation transcription (initiation and termination) and the cloning of the desired gene sequence.
The selection of an E. coli strain, a vector, the vector elements, the method of transfection, the culturing of the transfected organisms and the harvesting and isolation of the desired polypeptide suitable for use according to the present invention will be obvious for the man skilled in the art.
Commercial Pig Liver Esterase (PLE) preparations, obtained from animal sources by extraction of pig liver, are widely used in synthetic organic chemistry.
The commercial enzyme preparation has been shown to at least consist of several PLE isozymes possibly with different substrate specificities.
Commercial PLE is used in a variety of biocatalytic reactions exploiting the broad substrate specificity and enantioselectivity of the ester hydrolysis.
E.g. WO 01/09079 describes the use of animal derived PLE for the selective hydrolysis of the (R)-enantiomer of (4E)-5-chloro-2-isopropylpent-4-enoic acid methylester.
As for pharmaceuticals production the interest in using only non animal derived raw materials is increasing due to concerns with respect to transmissible diseases caused by among others viruses and prions, microbial production of esterases using recombinant DNA technology can provide a solution for this issue.
Based on available information (Matsushima et al (1991) [7]., Lange et al. (2001)) on identification and expression of the PLE major (γ-) isozyme, cDNA from pig liver was prepared and screened for PLE γ-isozyme related sequences. For this purpose, PCR primers were designed that recognize cDNA fragments encoding PLE γ-isozyme related proteins. By DNA sequencing of a number of these γ-PLE related cDNA fragments, as expected the known γ-PLE encoding DNA sequence was retrieved, but in addition a second PLE isozyme was identified that differed from the mature γ-PLE protein in 21 out of 548 amino acids. This new PLE isozyme was called APLE for Alternative Pig Liver Esterase.
For functional characterization of both the γ-PLE and APLE isozymes with respect to substrate specificity, both γ-PLE and APLE encoding DNA sequences were inserted in expression cassettes designed for secreted protein production in Pichia pastoris, similar as described by Lange et al. In contrast to the latter publication, successful expression of both proteins was accomplished even when the C-terminal amino acid sequence HAEL was present in the encoded protein. Esterase activity was identified by activity determination using a general esterase assay using alpha-naphtylacetate.
Surprisingly, although having a more than 95% identity in amino acid sequence, a distinct difference between γ-PLE and APLE was observed with respect to the hydrolysis of 5-halogen-2-alkylpent-4-enoic acid esters. APLE was able to hydrolyze racemic (4E)-5-chloro-2-isopropylpent-4-enoic acid methylester very efficiently, whereas γ-PLE did not hydrolyze this compound at all. Moreover, it could be shown that the hydrolysis of racemic (4E)-5-chloro-2-isopropylpent-4-enoic acid methylester was by selective hydrolysis of the R-enantiomer only: APLE showed no reactivity towards (2S,4E)-5-chloro-2-isopropylpent-4-enoic acid methylester. It can be concluded that the known enantioselective hydrolysis of 5-chloro-2-isopropylpent-4-enoic acid methylester by animal derived PLE as described in WO 01/09079 can be attributed to a minor isozyme, APLE, present in the commercial pig liver extract.
For large scale production of a non-animal derived esterase preparation capable of enantioselective hydrolysis of 5-halogen-2-alkylpent-4-enoic acid esters, the Pichia pastoris based expression levels of APLE insufficient. Therefore alternative protein production systems were contemplated, taking into account that fast and reliable production at industrial scales will be required for economic production.
PLE isozymes are structurally very related, and it is known that the protein requires intramolecular disulfide bonds for maintaining its structural integrity and activity. Many attractive microbial protein expression systems will only allow disulfide bonds to be formed when the protein is targeted to the extracellular environment, essentially as described above for Pichia pastoris. Most bacteria, notably Escherichia coli, maintain a reducing environment intracellularly; however, mutants of E. coli in which disulfide bonds can be formed in proteins expressed in the cytoplasm have been described (Prinz et al. (1997)), and various strains are available commercially (E. coli Origami, Novagen).
Böttcher et al. have made use of such E. coli strains, and have shown that γ-PLE can be successfully produced provided that additional measures are taken to ensure proper folding of the γ-PLE protein by overexpression of heat shock proteins; these heat shock proteins, or chaperones, function as folding or refolding helpers to assist proteins to attain their natural conformation. Böttcher et al. (2007) report that no expression of active γ-PLE was observed in the absence of large amounts of the chaperone proteins.
Surprisingly APLE, with only 21 differences out of 548 amino acids when compared to γ-PLE, can be produced as an active esterase enzyme in E. coli Origami strains without requiring concomitant overexpression of chaperone proteins; even in the presence of various overexpressed chaperones no effect on APLE activity level is noticed.
More surprisingly, altering the codon usage of the native APLE gene (as isolated from pig liver cDNA) provided an additional boost to APLE expression in E. coli Origami strains. Still more surprisingly, particularly altering the codon usage to resemble a set of Pichia pastoris genes proved more efficient than performing “codon optimization” towards E. coli (for codon tables see:) Hypertext Transfer Protocol Secure://world wide web KAZUSA.OR.JP. This result indicates that there is a direct effect of the DNA and derived messenger RNA sequence on the folding efficiency yielding active APLE protein, rather than optimal codon induced increased translation efficiency and protein production level.
Further improvement of active APLE enzyme production was achieved by overexpressing an E. coli endogenous disulfide bond isomerase (DsbC); as already shown by Bessette et al. (1999), truncated versions of DsbC protein can be constructed, that result in intracellular localization of this protein. Combining expression of such truncated DsbC protein results in a considerable increase in APLE activity expressed by the various recombinant E. coli hosts.
Functional expression of APLE did not absolutely require a full non-reducing environment in the E. coli cell caused by disruption of both trxB and gor genes. Active APLE expression is possible in E. coli BL21 Star (full reducing environment !), and in E. coli strains in which only one of the genes trxB or gor were inactivated.
The gene structure of the optimal APLE gene, C8P, has been used to construct various esterase isoforms, allowing their high level production in simple and scalable industrial E. coli fermentation processes.
A. Plate-assay of P. pastoris strain X-33 transformed with an APLE or γ-PLE expression cassette using racemic (4E)-5-chloro-2-isopropylpent-4-enoic acid methyl ester as a substrate.
B. Plate-assay of P. pastoris strain X33 transformed with an APLE or γ-PLE expression cassette using (2S,4E)-5-chloro-2-isopropylpent-4-enoic acid methyl ester as a substrate.
A. Functional map of expression plasmid pMS470_C8P;
B. Functional map of expression plasmid pMS470_dsbC_C8P.
Plate-assay using racemic (4E)-5-chloro-2-isopropylpent-4-enoic acid methyl ester as a substrate and cell-free extract of E. coli BL21 Star strains as a source of APLE.
A. Coomassie-stained SDS-PAGE.
B. Western blot using polyclonal antibody against PLE.
Qualitative plate assay of various esterase gene constructs using dimethyl methylsuccinate as substrate (both γ-PLE and APLE are reactive towards this substrate).
0.7 g fresh pig liver from a local slaughterhouse was frozen in liquid nitrogen and homogenized using mortar and pestle. mRNA was extracted from the homogenate using the Fast Track® 2.0 mRNA Isolation Kit (Invitrogen, Carlsbad, USA) according to the manufacturer's instructions. The extraction protocol yielded 13 μg mRNA. 0.26 μg mRNA was taken as template for cDNA synthesis using SuperScript™ III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, USA), according to the manufacturer's instructions.
The cDNA obtained was used as a template in a PCR reaction using specific primers fw-PLE and rv-PLE designed to amplify pig liver esterase/amidase sequences related to the gene described by Matsushima et al. (GenBank Accession No X63323; SEQ ID NO 1).
introducing EcoRI restriction sites (Italics) for cloning purposes. Sequences homologous to known pig liver esterase/amidase sequences are underlined.
Amplification was performed using 1 U Phusion DNA Polymerase (Finnzymes, Espoo, Finland), with 500 ng cDNA as template, 20 μmol of each forward and reverse primer according to the Phusion High-Fidelity DNA Polymerase Manuals (Finnzymes). PCR conditions: 30 s denaturation at 98° C., followed by 30 cycles (10 s 98° C., 20 s 68° C., 1 min 72° C.) for amplification, and a final incubation for 8 min at 72° C. to ensure full-length amplification products.
The resulting 1.7 kbp DNA fragment was cleaned using QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany), digested using EcoRI restriction endonuclease, inserted into plasmid vectors pHILZ and pHIL-D2 (Invitrogen, Carlsbad, USA), and transformed into electrocompetent E. coli TOP10 cells.
DNA sequencing of plasmid DNA from randomly selected transformants revealed two different DNA fragments, one of which was completely identical to the gene described by Matsushima et al., which was later also identified as γ-PLE encoding gene by Böttcher et al.; the second fragment had the nucleotide sequence SEQ ID NO 5 and encoded a protein (APLE; SEQ ID NO 6) that differed from γ-PLE at 21 out of 548 amino acids of the mature protein sequence.
Both γ-PLE and APLE genes were adapted for secretory expression in Pichia pastoris by fusion with the α-mating factor secretion signal sequence as present in vector pPICZα (Invitrogen, Carlsbad, USA).
The α-mating factor secretion signal sequence and the γ-PLE and APLE genes were first amplified separately:
PCR 1: α-mating factor secretion signal sequence using the primers:
PCR 2 (γ-PLE) and PCR 3 (APLE) using the primers:
EcoRI restriction sites for cloning purposes are italicized, whereas sequences homologous to templates are underlined.
PCR conditions for all reactions: 50 μl reaction mix with 2 ng template DNA, 0.5 μM of each primer, 0.2 mM dNTPs, 1× Phusion HF buffer and 1 U of Phusion DNA-Polymerase, according to Phusion High-Fidelity DNA Polymerase Manual (Finnzymes), 3 min denaturation at 85° C., amplification in 30 cycles (30 s 95° C., 30 s 57° C., 15 s 72° C.), and a final incubation of 7 min at 72° C.
Template for the α-mating factor secretion signal amplification (PCR1) was plasmid pPICZα; template for the γ-PLE and APLE gene amplification (PCR2 and PCR3, respectively) were the cDNA's in pHILZ vectors described in example 1.
Subsequently, the separate fragments obtained were combined in fusion reactions between the α-mating factor fragment and each of the pig liver esterase genes, as follows: α-mating factor fragment (PCR1)+γ-PLE fragment (PCR2); α-mating factor fragment (PCR1)+APLE fragment (PCR3).
Reactions were started in a total volume of 45 μl with 3 μl each from PCR1 and PCR2 or PCR3, respectively, 0.2 mM dNTPs, 1× Phusion HF buffer, and 1 U of Phusion DNA-Polymerase, 3 min at 95° C. followed by 10 cycles of 30 s at 95° C. and 45 s at 72° C. Subsequently, primers fw-alpha and rv-PLE were added to 0.5 μM final concentration and full-length product amplification was achieved by 3 min denaturation at 95° C., amplification in 30 cycles (30 s 95° C., 30 s 57° C., 15 s 72° C.), and a final incubation of 7 min at 72° C.
The resulting fragments were purified using the QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany), and after digestion with EcoRI inserted into vector pGAPZ A (Invitrogen, Carlsbad, USA), resulting in plasmids pGAPZA_γ-PLE and pGAPZA_APLE.
DNA of plasmids pGAPZA_γ-PLE and pGAPZA_APLE was linearized and introduced into Pichia pastoris X-33 according to the Pichia Expression Kit manual (Invitrogen, Carlsbad, USA). Transformants were selected on YPD-agar containing 100 mg/l Zeocin.
Pichia pastoris transformants carrying pGAPZA_γ-PLE and pGAPZA_APLE were streaked onto YPD agar supplemented with 100 mg/l Zeocin and grown for 48 h at 30° C. Cell material was then lifted onto Whatman 541 hardened ashless 70 mmØ filters (Whatman International Ltd., Maidstone, Great Britain) and dried. Then, filters were soaked in a mixture of 6 mg α-naphthylacetate (Sigma, dissolved in 500 μl acetone), 2.5 mg Fast Blue Salt BN (Sigma, dissolved in 125 μl water) and 5 ml 0.1 M potassium phosphate buffer, pH 7.0, incubated to visualize esterase activity by hydrolysis of α-naphthylacetate resulting in a colored product. All Pichia pastoris strains transformed with γ-PLE and APLE expression cassettes showed increased esterase activity when compared to the non-transformed Pichia pastoris X-33 parent strain.
A similar set-up as described for the general esterase assay was developed to determine activity of γ-PLE and APLE towards 5-halogen-2-alkylpent-4-enoic acid esters. The filters were now soaked in assay mixture consisting of 14 mM potassium phosphate buffer, pH 8.0, 10% (v/v) racemic (4E)-5-chloro-2-isopropylpent-4-enoic acid methyl ester (DSM Fine Chemicals Austria Nfg GmbH & Co KG, Linz, Austria), 1% (v/v) Emulgen 913 detergent (Kao Corporation, Tokyo, Japan), 2 mg/ml phenol red. Enzyme activity is indicated by a color change from red (basic and neutral pH) to yellow (acidic pH), caused by the hydrolysis of (4E)-5-chloro-2-isopropylpent-4-enoic acid methyl ester and the associated liberation of acidic groups.
As shown in
Based on the amino acid sequence of mature APLE (SEQ ID NO 6) derived from the APLE encoding gene (SEQ ID NO 5), synthetic genes with altered codon usage and lacking the native secretion signal sequence were designed and chemically synthesized (supplier: DNA2.0, Menlo Park, USA). Synthetic APLE gene variants C8P (SEQ ID NO 11), C8A (SEQ ID NO 13), C8 CpO (SEQ ID NO 14), and C8E (SEQ ID NO 15) all encode mature APLE protein with an additional N-terminal Methionine as a required translation startcodon (SEQ ID NO 12).
For expression studies in E. coli, synthetic APLE genes were inserted into plasmid pMS470 (Balzer et al. (1992) [8]). PCR amplification (for conditions see Example 1) was used to add an NdeI restriction site (including an ATG startcodon) to the 5′ end and a HindIII restriction site to the 3′ end, respectively, using the following primers:
For gene APLE C8P the following PCR primers were designed
For gene APLE C8A the following PCR primers were designed
For gene APLE C8 CpO the following PCR primers were designed
For gene APLE C8E the following PCR primers were designed
NdeI and HindIII restriction sites for cloning purposes are in italics, sequences homologous to the gene templates are underlined.
The resulting fragments were inserted into NdeI/HindIII digested pMS470 creating the plasmids pMS470_C8P, pMS470_C8A, pMS470_C8 CpO, and pMS470_C8E. A map of plasmid pMS470_C8P is depicted in
Natural sequences of APLE and γ-PLE were obtained as cDNA from pig liver as described in example 1. These natural genes were amplified and transferred to E. coli expression vectors using the following primers:
NdeI and HindIII restriction sites for cloning purposes are in italics, sequences homologous to templates are underlined.
Because these natural genes have an internal HindIII restriction site, a two-step ligation was necessary: first the longer fragment with NdeI and HindIII was inserted into pMS470, subsequently each gene was completed by adding the 3′ HindIII fragment, resulting in the final expression vectors pMS470_γ-PLE and pMS470_APLE, respectively.
For analyzing esterase expression in E. coli, the following procedures were used for cultivation and preparation of cells for activity analysis.
For plate assays, E. coli strains harboring various expression plasmids were streaked onto LB-agar plates containing 100 μg/ml I ampicillin and 0.1 mM IPTG, and incubated for 16 h at 37° C.
For liquid culture assays, E. coli strains carrying the respective expression plasmid was inoculated in 5 ml of Luria-Bertani (LB) broth with 100 μg/ml ampicillin and incubated at 28° C. under continuous shaking for 16 hrs. This culture was then used to inoculate 250 ml LB broth with 100 μg/ml ampicillin, in 1 L baffled shake flasks. When the culture reached an optical density of 0.6 to 0.8 at 600 nm, IPTG was added to a final concentration of 0.1 mM to induce gene expression. Cells were harvested after 16 to 20 h incubation at 28° C.
Plate assays: Assay on cells grown on agar plates have been described in Example 2 with various esterase substrates.
Activity analysis on liquid E. coli cultures: Esterase activity was quantitatively determined on cell suspensions in MOPS buffer (100 mM) with 5 mM p-nitrophenyl acetate as substrate. The amount of p-nitrophenol released was determined spectrophotometrically at 405 nm. One unit (U) of esterase activity is defined as the amount of enzyme that liberates 1 micromole p-nitrophenol per minute under the conditions of the test (pH 7.5, 37° C.).
The expression cassettes for the different APLE encoding genes were transformed to various E. coli strains: both regular gene expression strains like E. coli BL21 strains, and specifically engineered E. coli strains that allow functional intracellular expression of proteins requiring intramolecular disulfide bonds for correct folding and enzymatic activity (Prinz et al., Bessette et al.) were used as expression host strains. For this purpose, commercially available E. coli strains of the Origami family (Novagen) were used, notably Origami 1, Origami 2, and Origami B.
Functional expression of APLE (SEQ ID NO 12) was observed in standard expression strain E. coli BL21 Star (
E. coli Origami strains were transformed with the respective expression vectors, and selected transformants were subsequently evaluated for esterase expression either by plating on substrate specific assay plates or via shake flask cultures.
The expression levels of several APLE gene variants are summarized in
E. coli host strain
A series of experiments was executed to assess whether co-expression of various heat shock chaperones contributed to APLE expression. The results (summarized in table 2) show that heat shock protein/chaperone expression does not significantly affect APLE production.
E. coli host
With no effect observed of co-expressed heat shock proteins, it was investigated whether other cofactors like overexpression of the E. coli endogenous disulfide-isomerase gene dsbC (Bessette et al.) would affect expression of APLE in E. coli.
E. coli Top10F′ chromosomal DNA was used as a template to amplify a truncated version of the E. coli dsbC gene (native DsbC protein is secreted to the periplasm, the truncated DsbC protein remains in the intracellular compartment) by polymerase chain reaction (PCR) with Phusion™ High-Fidelity DNA Polymerase (Finnzymes, Espoo, Finland), using Phusion HF-Buffer and the following conditions: 5 minutes denaturation at 95° C., amplification in 30 cycles (10 s 98° C., 30 s 66° C., 30 s 72° C.), and a final incubation of 8 min at 72° C. Primers used were designed to include a Shine-Dalgarno sequence in front of truncated DsbC coding sequence:
The PCR product was digested with BamHI and inserted in the BamHI restriction site of the APLE expression plasmid pMS470_C8P. DsbC and C8P are separated by 49 bp. The constructs were verified by sequencing. The construct was named pMS470_dsbC_C8P and improved expression of APLE drastically (see
E. coli host strain
To confirm that the observed esterase activity was indeed due to functional expression of the APLE encoding gene Western blotting experiments were performed. After fermentation, E. coli cells were centrifuged at 5.000 g for 10 min. The resulting pellet was resuspended in 4 volumes of 20 mM potassium phosphate buffer, pH 8.0, and 2-2.5 μl of the cell suspension were combined with 17.5-18 μl SDS loading buffer, heated at 95° C. for 10-15 min and loaded onto a 12.5% SDS-PAGE gel. APLE was detected by Western blot analysis using a rabbit polyclonal antibody against porcine liver esterase (abcam, Cambridge, UK) as primary antibody and goat-anti-rabbit polyclonal antibody conjugated with alkaline phosphatase (Leinco Technologies Inc., St. Louis, USA) as secondary antibody. Western blot detection was done by Lumi-Phos™ WB Chemiluminescent Substrate (AP) (Pierce, Rockford, USA) and chemiluminescence detection in a G:Box HR (Syngene, Cambridge, UK) or by BCIP/NBT detection solution (CALBIOCHEM; La Jolla; USA) and direct staining of the nitrocellulose membrane (Hybond-ECL™, Amersham Biosciences, Uppsala, Sweden).
Escherichia coli K12 strain RV308 ΔtrxB; Δgor was constructed starting from E. coli strain RV308 (ATCC 31608). Similarly as described by Prinz et al., two genes involved in intracellular disulfide reduction were inactivated. These two genes, trxB and gor encoding thioredoxin reductase and glutathione oxidoreductase, respectively, were inactivated through deletion using site directed recombination technology according to the procedures described by Datsenko et al. (2000) [9].
The initial result of this modification is that the E. coli strain is no longer capable of growing aerobically, except in the presence of a reducing agent; however, suppressor mutations restoring aerobic growth in the absence of a reductant are easily selected. These properties and phenotypic change have been described previously in E. coli strains in which the genes trxB and gor were inactivated using a different approach.
In detail: deletion cassettes were obtained by PCR using the following primers and plasmid pKD3 as a template:
Application in this reaction of fw-trxB (SEQ ID NO 28): 5′-GTAAATTCCCTACAATCCTGCCCATTGTCTGCCAACAACTATGGGGATCTTGTGTA GGCTGGAGCTGCTTC-3′ and rv-trxB (SEQ ID NO 29): 5′-CCCATAGTCGCATGGTGTCGCCTTCTTTACTTTTGTTACTGATTTGTAAAACATATG AATATCCTCCTTAG-3′ results in a deletion cassette for the gene trxB Application in this reaction of fw-gor (SEQ ID NO 30): 5′-CCTATTACGTCTCGCGCTACAATCGCGGTAATCAACGATAAGGACACTTTGTCTGT GTAGGCTGGAGCTGCTTC-3′ and rv-gor (SEQ ID NO): 5′-CTGATAGCGGAAACGTAATTAAGGGCTAAGAGCACACTACTCTTAGCCCTTTAACC ATATGAATATCCTCCTTAG-3′ results in a deletion cassette for the gene gor.
The trxB and gor deletion cassettes were transformed separately to an E. coli RV308 strain that already contains plasmid pKD46, and successful transformants were selected based on their acquired resistance towards the antibiotic chloramphenicol. Correct exchange of the trxB gene or the gor gene by the respective deletion cassettes was confirmed by PCR controls and Southern blotting. The chloramphenicol resistance gene was subsequently removed by transformation with plasmid pCP20, encoding a FLP recombinase enzyme [reference 6]. The resulting E. coli strain RV308 ΔtrxB was checked again for a clean deletion of trxB using PCR and Southern blotting. Similarly the clean deletion of the gor gene in E. coli strain RV308 confirmed.
Starting from strain E. coli strain RV308 ΔtrxB exactly the same set of reactions was carried out to perform a clean deletion of the gene gor. Because the initial result of this second modification, as described by Prinz et al. is that this E. coli RV308 strain having both trxB and gor deleted is no longer capable of growing aerobically except in the presence of a reducing agent, growth of E. coli strains that were assumed to also have the gor deletion was conducted in the presence of the reducing agent DTT. Finally, spontaneous RV308 ΔtrxB; Δgor mutants could be selected that for aerobic growth were no longer dependent on the presence DTT.
Transformation of E. coli strain RV308 ΔtrxB; Δgor and intermediate strains with only a single reductase deletion were transformed with selected APLE expression plasmids and evaluated in shake flask for APLE production (Table 4).
E. coli host
Additional synthetic genes were chemically synthesized that encoded various natural isoforms of pig liver esterase protein. For production of a new esterase protein, a Bos taurus γ-PLE like gene was synthesized.
Other new genes encoded known the PLE esterases γ-PLE and PICE; also hybrids between the APLE and γ-PLE isoforms were designed. The common feature of the latter set was that all are based on the APLE C8P template. Starting from APLE C8P, only the codons required to obtain the isoforms or hybrid proteins were changed.
The genes with their encoded proteins are represented by:
Natural isoforms: New hypothetical Bos taurus γ-PLE like gene (SEQ ID NO 32)
C8P encoded natural esterases: C8P-γ-PLE (SEQ ID NO 34) and C8P-PICE (SEQ ID NO 36).
C8P encoded hybrid esterases: C8P-H1 (SEQ ID NO 38), C8P-H2 (SEQ ID NO 40), C8P-H3 (SEQ ID NO 42), and C8P-H4 (SEQ ID NO 44).
All sequences were inserted in the E. coli expression vector of
The results of the qualitative plate assay (see example 2) using dimethyl methylsuccinate as a substrate confirm that each of the designed genes encodes an active esterase (
| Number | Date | Country | Kind |
|---|---|---|---|
| 07013092 | Jul 2007 | EP | regional |
| 08000828 | Jan 2008 | EP | regional |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/EP2008/058731 | 7/4/2008 | WO | 00 | 7/1/2010 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2009/004093 | 1/8/2009 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 6872563 | Beckwith et al. | Mar 2005 | B1 |
| 20040161836 | Bornscheur et al. | Aug 2004 | A1 |
| 20100112662 | Bornscheuer et al. | May 2010 | A1 |
| 20100151541 | Steinbauer et al. | Jun 2010 | A1 |
| Number | Date | Country |
|---|---|---|
| 2004055177 | Jul 2004 | WO |
| 2007073847 | Jul 2007 | WO |
| Entry |
|---|
| Witkowski et al.; Conversion of beta-ketoacyl Synthase to a Malonyl Decarboxylase by Replacement of the Active-site Cysteine with Glutamine; Biochemistry 38:11643-11650, 1999). |
| Seffernick et al.; Melanine Deaminase and Atrazine Chlorohydrolase: 98 percent Identical but Functionally Different; J. Bacteriol. 183(8):2405-2410, 2001). |
| Branden et al.; Introduction to Protein Structure, Garland Publishing Inc., New York, p. 247 (1991)). |
| International Search Report for PCT/EP2008/056841, mailed Oct. 7, 2008. |
| Written Opinion of the International Searching Authority for PCT/EP2008/056841, mailed Oct. 7, 2008. |
| Boettcher at al., “Functional Exprssion of the Gamma-Isoenzyme of PIG Liver Carboxyl Esterase in Escherichia Coli”, Applied Microbiology and Biotechnology, Springer Verlag, Berlin, DE, vol, 73, No. 6, Sep. 8, 2006, pp. 1282-1289, XP002456633. |
| Kay, “Overview of Bacterial Expression Systems for Heterologous Protein Production; from Molecular and Biochemical Fundamentals to Commercial Systems”, Applied Microbiology and Biotechnology, Springer-Verlag, BE, vol. 72, No. 2, Jun. 22, 2006, pp. 211-222, XP019422070. |
| S. Lange at al., “Cloning, Functional Expression, and Characterization of Recombinant Pig Lever Esterase”, Chembiocem, vol. 2, 2001, pp. 576-582, XP002483884. |
| Matsushima et al., “The Nucleotide and Deduced Amino Acid Sequences of Porcine Liver Proline-Beta-Naphthylamidase. Evidence for the Identity with Carboxylesterase”, FEBS Letters, Elsevier, Amsterdam, NL, vol. 293, No. 1-2, Nov. 18, 1991, pp. 37-41, XP002209303. |
| R. Novy et al., “Overcoming the Codon Bias of E. coli for Enhanced Protein Expression”, Innovations, vol. 12, Jun. 2001, pp. 1-3, XP002483885. |
| Bessette et al., “Efficient Folding of Proteins with Multiple Disulfide Bonds in the Escherichia coli Cytoplasm”, Proceedings of the National Academy of Sciences of USA, National Academy of Science, Washington, DC, vol. 96, No. 24, Nov. 23, 1999, pp. 13703-13708, XP002233564. |
| Bruesehaber et al., “Identification of Pig Liver Esterase Variants by Tandem Mass Spectroscopy Analysis and Their Characterization”, Applied Microbiology and Biotechnology, Springer Verlag, Berlin, DE, vol. 76, Jun. 26, 2007, pp. 853-859, XP002456632. |
| Aslund et al., “Efficient Production of Disulfide Bonded Proteins in the Cytoplasm in Oxidizing Mutants of E. coli”, Innovations, XX, XX, vol. 10, Nov. 1, 1999, pp. 11-12, XP002456634. |
| Prinz, W.A., Aslund, F., Holmgren, A. and Beckwith, J. (1997) J. Biol.Chem. 272: 15661-15667. |
| Balzer D, Ziegelin G, Pansegrau W, Kruft V, Lanka E. (1992). Nucleic Acids Res.20, 1851-1858. |
| Datsenko, K.A. & Wanner, B.L. (2000) PNAS 97, 6640-6645. |
| Number | Date | Country | |
|---|---|---|---|
| 20110177553 A1 | Jul 2011 | US |
