Patent Application
20220177966
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jan. 4, 2022, is named 13001US02CON_SL.txt and is 166,033 bytes in size.
The present invention relates to a probe that can be utilized for nucleic acid detection with high specificity, a method for designing the same, and a method for detecting nucleic acid by utilizing the probe.
In recent years, small non-coding RNAs (ncRNAs) containing about 20 bases of microRNAs (miRNAs) have attracted attention because of their various functions. In particular, when these ncRNA levels correlate with diseases, ncRNAs can be utilized as markers.
When binding a target DNA or RNA to a probe by hybridization, a sequence of a binding part of a target DNA or RNA (hereinafter referred to as a “binding sequence”) in which a large number of any one of guanine or cytosine having strong binding power is continuous, may be present in some case. In such a case, a phenomenon occurs in which false positives are likely to be generated due to a probe binding also to non-target DNAs or RNAs which have the same contiguous sequence as this sequence. In the related art, when a probe is bound to a long-chain target DNA or RNA which has such sequences that easily induce a false positive, a probe for a site that does not contain any sequence in which a large number of any one of guanine or cytosine is continuous was designed to be used. In general, it is perceived that a probe length of about 18-mer is necessary for detection of specific sequences by hybridization. However, in a case of detecting a target sequence composed of a short chain length of about 20-mer, such as an miRNA, it is not possible to design a probe that does not contain any sequence in which a large number of any one of guanine or cytosine is continuous, and therefore occurrence of false positives could not be avoided.
For this reason, as a method for detecting an ncRNA containing an miRNA, a method not based on detection of a specific sequence by hybridization, for example, a method utilizing polymerase chain reaction (PCR), oligonucleotide ligation assay (OLA), or ligase chain reaction (LCR) (Patent Document 1), and the like have been used.
In addition, as a method for improving specificity of miRNA measurement, a method using LNA with high affinity (Patent Document 2) is known. However, although this method increases binding power in hybridization, sequences in which a large number of any one of guanine or cytosine is continuous are generated, and therefore false positives could not be avoided.
Patent Document 3 discloses a method of irradiating a double-stranded oligonucleotide with light and detecting a SNP by using a difference in light absorption with use of a probe bound to a light-responsive organic group. The document discloses that any of a sequence in which an SNP site is not mutated and a sequence in which an SNP site is mutated can be used as a probe in the present document. In addition, Patent Document 3 discloses a probe in which a SNP site is substituted with a mutant as a probe for SNP. However, because the mutation is inserted in the SNP site in a target sequence itself to be bound, the sequences of these probes are designed as sequences complementary to the target sequence.
Peptide nucleic acid (PNA) is a DNA/RNA mimetic having a pseudopeptide skeleton in which N-(2-aminoethyl) glycine is bound by an amide bond instead of a sugar chain in DNA or RNA. PNA can be used as a new probe because it can forma double strand with DNA/RNA (Non-patent Document 1 and Non-patent Document 2).
Patent Document 4 discloses a method including a step of forming a double strand with PNA in which a part of bases is deleted and with nucleic acids; a step of reversibly binding by contacting a tagged base to a base-deleted portion (a portion where no pair is formed with a nucleic acid) of double-stranded PNA; and a step of detecting a target nucleic acid by detecting the tagged base. In this method, the label is attached to the tagged base rather than the PNA, and the target nucleic acid is detected by the binding of the tagged base to the PNA.
Non-Patent Document 3 discloses that a 15-mer DNA probe in which single base substitution, abasic site creation, or phenyl-substitution is performed has a lower Tm value, and thus lowers stability of the double strand as compared to a fully complementary probe. In particular, it has been reported that, in a case of a DNA and DNA double helix in which an abasic or phenyl-substituted DNA probe is used, a Tm value is reduced by about 40%, and therefore stability of the double helix is decreased. Non-Patent Document 4 discloses that, when a PNA and DNA double helix is formed, and a Tm value is measured by using an abasic or phenyl-substituted 15-mer PNA probe as above, the Tm value was 4° C. for the case of abasic site creation, and the Tm value was 6.5° C. for the case of phenyl substitution, which are a decrease in the Tm values, and therefore stability is decreased similarly to the DNA probe. In Non-patent document 5, one base of a 19-mer PNA probe is substituted with anthraquinone (AQ) having absorbance at 330 nm for the purpose of modifying the inside of a double helix structure. AQ has been shown to fit within the double strand while maintaining relatively high Tm values, whereas an abasic site has been shown to lower stability of double-strand formation.
An object of the present invention is to provide a means capable of detecting a target nucleic acid and a means capable of quantitatively determining a target nucleic acid with a low false positive rate (high specificity) through double-strand formation by hybridization of a probe and a target nucleic acid in detection of a short-chain target nucleic acid having a sequence in which any one of guanine or cytosine is continuous, without requiring complicated procedures such as ligation and amplification which have been employed in the related art. More specifically, an object of the present invention is to reduce a false positive rate in complementary strand formation by hybridization between a probe and a target nucleic acid in which one of guanine and cytosine has a contiguous sequence, so as to improve specificity. In particular, an object of the present invention is to provide a probe which is capable of reducing non-specific binding to a non-target nucleic acid in double-strand formation with a nucleic acid having a 10- to 50-mer target sequence having a sequence in which any one of guanine or cytosine is continuous, and thereby detecting or quantitatively determining a target nucleic acid with high specificity, which was difficult to perform with high specificity. As one example, the target nucleic acid is a miRNA having a sequence in which guanine or cytosine is continuous.
In general, making a sequence that is not complementary to a part of a target sequence by substituting a base of a probe or creating an abasic site reduces binding power to a target nucleic acid. It has been exceptionally reported that binding power is relatively maintained in an example in which one base of a PNA probe is substituted with a specific anthraquinone (AQ) such as 3,6-diaza(N3-Boc-aminoethyl)-4,7-dioxo-7-(2-anthraquinoyl)-heptanoic acid for labeling. However, a sequence that is not complementary to a part of a target sequence has not been adopted in the field of general nucleic acid detection and nucleic acid analysis, the sequence being obtained by substituting a base, creating an abasic site, or cleaving a sequence in a probe for detecting a nucleic acid by double-strand formation. In addition, there has been no concept of suppressing binding to a non-target sequence by substituting a base, creating an abasic site, or cleaving a sequence in a completely complementary probe. Furthermore, PNA has been known to stably form a double strand while being more sensitive to mismatches compared to DNA (described by Michael et al.).
The inventors of the present invention have attempted to design a probe via various approaches without being bound by such a common-sense idea in the field of genetic engineering. As a result, the inventors of the present invention have found that, when bases having strong binding power are continuous even in a case of a short-chain probe, binding power to non-target nucleic acids can be dramatically reduced while maintaining binding power to target nucleic acids by cleaving or substituting a part thereof or creating an abasic site. In addition, the inventors of the present invention have found that such a probe particularly has different binding power between a non-target nucleic acid and a target nucleic acid to the extent that false positives and positives can be distinguished in the detection of target nucleic acids in which bases (guanine and cytosine) with strong binding power are continuous. As a result, obtaining a probe useful for detecting target nucleic acids in which bases (guanine and cytosine) with strong binding power are continuous, and designing the same have been achieved. The present invention has been made based on such findings, and specifically relates to the following inventions.
(1) A polynucleobase probe including, in a sequence complementary to a target sequence having at least one sequence of any one of SEQ ID NOs: 1 to 10, a sequence in which at least one of bases in a portion complementary to any one sequence of SEQ ID NOs: 1 to 10 in the target sequence becomes abasic and/or is substituted; and/or a sequence which is cleaved to have, on an end, at least one sequence complementary to a sequence of 2 bases or less in any one sequence of SEQ ID NOs: 1 to 10 in the target sequence.
(2) The polynucleobase probe according to (1), which is 10- to 50-mer.
(3) The polynucleobase probe according to (2), which is 15- to 28-mer.
(4) The polynucleobase probe according to anyone of (1) to (3), to which a label is bound.
(5) The polynucleobase probe according to anyone of (1) to (4), in which, in the portion complementary to any one sequence of SEQ ID NOs: 1 to 10 in the target sequence, at least one of the bases which become abasic or are substituted is located inside the portion complementary to any one sequence of SEQ ID NOs: 1 to 10 in the target sequence.
(6) The polynucleobase probe according to anyone of (1) to (5), in which, in the sequence complementary to any one sequence of SEQ ID NOs: 1 to 10 in the target sequence, a ratio of at least one of the bases which become abasic or are substituted with respect to any one of 3 to 5 guanines and cytosines is 1.
(7) The polynucleobase probe according to anyone of (1) to (6), in which the target nucleic acid is a 10- to 50-mer DNA or RNA.
(8) The polynucleobase probe according to (7), in which the target nucleic acid is a miRNA.
(9) The polynucleobase probe according to anyone of (1) to (8), which is a DNA, RNA, LNA, GNA, BNA, or PNA.
(10) A method for designing a polynucleobase probe sequence which is capable of binding to a target sequence having at least one sequence of any one of SEQ ID NOs: 1 to 10 with high specificity, the method including:
A) selecting a 10- to 50-mer sequence fully complementary to the target sequence as a fully complementary probe sequence; and
B) (i) in the fully complementary probe sequence, designing the polynucleobase probe sequence by substituting and/or making at least one of bases abasic in a portion complementary to any one sequence of SEQ ID NOs: 1 to 10 in the target sequence, and/or
(ii) in the fully complementary probe sequence, designing the polynucleobase probe sequence by cleaving an end of the fully complementary probe sequence such that a portion complementary to anyone sequence of SEQ ID NOs: 1 to 10 in the target sequence becomes 2 bases or less.
(11) The method according to (10), in which the polynucleobase probe is 15- to 28-mer.
(12) The method according to (10) or (11), in which design of the polynucleobase probe sequence is performed by creating an abasic site, substituting, or cleaving such that a polynucleobase complementary to anyone sequence of SEQ ID NOs: 1 to 10 in the target sequence becomes 2 bases or less.
(13) A method for detecting a target nucleic acid having at least one sequence of any one of SEQ ID NOs: 1 to 10 in a test sample with high specificity, the method including:
preparing the test sample to detect the target nucleic acid;
bringing at least one kind of the polynucleobase probes according to any one of (1) to (9) in contact with the test sample; and
detecting the target nucleic acid bound to the polynucleobase probe.
(14) A method for quantitatively determining a target nucleic acid having at least one sequence of any one of SEQ ID NOs: 1 to 10 in a test sample with high specificity, the method including:
preparing the test sample to quantitatively determine the target nucleic acid;
contacting at least one kind of the polynucleobase probes according to any one of (1) to (9) with the test sample; and
quantitatively determining the target nucleic acid bound to the polynucleobase probe.
In the present specification, a “sequence in which any one of guanine or cytosine is continuous for 3 or more bases” or a “GC contiguous sequence” means the same as each other, and means GGGGGGG (SEQ ID NO: 1), CCCCCCC (SEQ ID NO: 2), GGGGGG (SEQ ID NO: 3), CCCCCC (SEQ ID NO: 4), GGGGG (SEQ ID NO: 5), CCCCC (SEQ ID NO: 6), GGGG (SEQ ID NO: 7), CCCC (SEQ ID NO: 8), GGG (SEQ ID NO: 9), and CCC (SEQ ID NO: 10). However, the term “GC contiguous sequence” in the words “substitution/abasic probe GC contiguous sequence” or “substituted/abasic probe GC contiguous sequence” means that a sequence before substitution/becoming abasic is a sequence in which any one of guanine or cytosine is continuous for 3 or more bases.
Because guanine and cytosine are complementary, a probe complementary thereto also has a GC contiguous sequence in a case where a target nucleic acid has a GC contiguous sequence. In the present specification, the term “GC contiguous sequence” is used both when the sequence is present in a target nucleic acid and when the sequence is present in a probe. In particular, a GC contiguous sequence present in a target nucleic acid/sequence is referred to as a “sequence of any one of SEQ ID NOs: 1 to 10 in a target nucleic acid/sequence” or a “target GC contiguous sequence”. In addition, a GC contiguous sequence complementary to the target GC contiguous sequence present in the probe, in particular, a GC contiguous sequence which is complementary to a target GC contiguous sequence and is present in the probe fully complementary to a target sequence before cleavage, abasic site creation, or substitution, is referred to as a “probe GC contiguous sequence” or a “sequence portion complementary to any one sequence of SEQ ID NOs: 1 to 10 in a target sequence”. Such a probe sequence that is fully complementary to a target sequence before cleavage, abasic site creation, or substitution may be referred to as a “fully complementary probe sequence”. On the other hand, a probe sequence in which guanine or cytosine in the probe GC contiguous sequence becomes abasic or is substituted is referred to as a “substituted/abasic probe sequence”. A sequence corresponding to a probe GC contiguous sequence in the substituted/abasic probe sequence is referred to as a “substituted/abasic probe GC contiguous sequence”. For example, the probe of
In the present invention, the term “nucleobase” includes nucleotide analogs in addition to naturally occurring nucleotides. Naturally occurring nucleotides are deoxyribonucleotides or ribonucleotides having bases of adenine (A), guanine (G), cytosine (C), thymine (T), and/or uracil (U). Nucleotide analogues mean artificial nucleotides or nucleotide mimetics which have the same base as the naturally occurring deoxyribonucleotide or ribonucleotide described above, but in which a ribose chemical structure and/or a phosphodiester bond chemical structure is artificially modified. Examples thereof include glycol nucleic acid (GNA), bridged nucleic acid (BNA), 2′,4′-locked nucleic acid (LNA), peptide nucleic acid (PNA), threose nucleic acid (TNA), and morpholino nucleic acids. In the present specification, GNA, BNA, LNA, PNA, TNA, and morpholino nucleic acids may be interpreted as monomers or as polymers depending on context.
In the present invention, the term “polynucleobase” means a polymer compound in which the above-mentioned nucleobase is linearly polymerized. The polynucleobase may be a homopolymer composed of only one type of nucleobase (such as only a naturally occurring polynucleotide, or only a constituent unit of PNA). In addition, the polynucleobase may also be a copolymer of two or more types of nucleobases (such as a naturally occurring polynucleotide and PNA, or BNA and LNA). Accordingly, polynucleotides such as DNA and RNA, and polymers of GNA, BNA, LNA, PNA, TNA, and morpholino nucleic acids are also included in the polynucleobase. In the present specification, the polynucleobase may contain a pyrrole-imidazole polyamide (Peter B. Dervan et. Al., Nature (1998) 391-468; P. B. Dervan and R. W. Burli, Current Opinion in Chemical Biology 3 (1999) 688-693; P. B. Dervan, Bioorganic & Medicinal Chemistry 9 (2001) 215-2235.). In this case, a base in the present specification can be substituted with pyrrole and/or imidazole.
In the present specification, a “probe” and a “polynucleobase probe” are the same meaning, and mean a polynucleobase used to form a double strand by hybridization with a target sequence. The polynucleobase probe of the present invention includes a sequence in which at least one base in a probe GC contiguous sequence in a fully complementary probe sequence becomes abasic or is substituted (substituted/abasic probe sequence), or a sequence in which all bases from at least one base in the probe GC contiguous sequence to one end of a fully complementary probe are cleaved, as a portion that binds to a target sequence based on a fully complementary probe sequence complementary to a target sequence having at least one target GC contiguous sequence. In the present specification, the term “cleavage” means that a probe is designed such that only 2 or less bases of amino acids constituting the probe GC contiguous sequence are left at the end of the probe in the design stage of the probe. It is not necessary to perform “cleavage” in an actual production process of the probe. Accordingly, a “sequence cleaved to have, at the end, at least one sequence complementary to a sequence of 2 bases or less in anyone sequence of SEQ ID NOs: 1 to 10 in the target sequence” means a sequence in which remaining bases excluding 2 or less bases located at the one end of a “probe GC contiguous sequence portion” contained in the fully complementary probe, and all bases up to one end of a “fully complementary probe” which are adjacent to the remaining bases are missing, or a sequence that contains, at the end of the probe, 2 or less bases derived from the end of the probe GC contiguous sequence portion.
When two or more target GC contiguous sequences are present in a target sequence, cleavage, substitution, or abasic site creation at a probe may be performed in any one of the probe GC contiguous sequences, or may be performed in two or more probe GC contiguous sequences. Preferably, the probe of the present invention is cleaved or substituted, or becomes abasic in the probe GC contiguous sequences at all locations. For example, when two or more target GC contiguous sequences are present in the target sequence, the probe of the present invention may be cleaved in any one of the probe GC contiguous sequences, and may be substituted or become abasic in the other probe GC contiguous sequence. Alternatively, when two or more target GC contiguous sequences are present in the target sequence, the probe of the present invention may be cleaved at two probe GC contiguous sequences, and when another probe GC contiguous sequence is present, the probe of the present invention may be substituted or become abasic at the probe GC contiguous sequence. Alternatively, when two or more target GC contiguous sequences are present in the target sequence, the probe of the present invention may be substituted or become abasic in probe GC contiguous sequences at all locations. In other words, only one of cleavage, substitution, and abasic site creation may be used in probe GC contiguous sequences at all locations, or any one of cleavage, substitution, and abasic site creation is used for each of a plurality of probe GC contiguous sequences present in one probe so that cleavage, substitution, and abasic site creation are used in combination in one probe as a result. Furthermore, cleavage, substitution, and abasic site creation may be used in combination in one probe GC contiguous sequence. The probe of the present invention preferably does not have a probe GC contiguous sequence as a result of cleavage, substitution, or abasic site creation in probe GC contiguous sequences at all locations in an initially selected fully complementary probe sequence.
Furthermore, the probe or the polynucleobase probe of the present invention may have a portion that does not bind to a target sequence in addition to the above-described portion that binds to the target sequence. Such a portion that does not bind to the target sequence may be a label or a linker, may be bound to another molecule, or may be used for the purpose of improving stability. For example, such a portion that does not bind to the target sequence may contain a polynucleobase that is not complementary to the target sequence such as a tag sequence or a linker sequence, or may be bound a low molecular weight compound or proteins. In one example, a portion that does not bind to the target sequence is “modification” to be described later.
In the present specification, the phrase “becoming abasic” means that no base portion is present in a nucleobase. In an abasic site of DNA or RNA, no base is bound to the 1′ position of the sugar, but a hydroxyl group, a hydrogen atom, a lower acyl group (such as an acetyl group), or a lower alkyl group (such as a methyl group) is bound thereto. In a case of an abasic site of PNA, a substituent of a methyl carbonyl group bound to tertiary amine of a glycine skeleton is a hydroxyl group, a hydrogen atom, a lower acyl group (such as an acetyl group), or a lower alkyl group (such as a methyl group) instead of a base. Alternatively, in the case of an abasic site of PNA, a nitrogen atom of a glycine skeleton is substituted with a carbon atom (which may have a lower acyl group (such as an acetyl group) or a lower alkyl group (such as a methyl group) as a substituent).
In addition, in the present specification, a case in which a base is “substituted” includes a case in which a base portion in a nucleobase is substituted with a non-complementary base. In addition, a case in which a base in a probe sequence is “substituted” includes a case in which a base portion in a nucleobase is substituted with a group other than adenine, guanine, cytosine, uracil, and thymine (for example, a phenyl group, an anthraquinone group, and the like). A group introduced by base substitution is preferably a group that does not inhibit double-strand formation with a target sequence by another non-substituted base in the probe sequence.
A position of a base to become abasic or be substituted in the probe GC contiguous sequence is not particularly limited. For example, a base may be in the inside of the probe GC contiguous sequence (such as G*G and C*CC. Herein, “*” represents a base to become abasic or be substituted. The same applies in the present specification), or at the end (such as GG* and *CC). Preferably, guanine or cytosine in the middle of the inside of the probe GC contiguous sequence becomes abasic or is substituted (such as C*C and GG*GG). For example, in a case where the probe GC contiguous sequence is GGG, G*G is preferable, and similarly, in a case of CCC, C*C is preferable. In addition, preferably, the GC contiguous sequence after substitution or becoming abasic does not have a sequence in which G or C is continuous for 3 or more bases.
The number of bases to become abasic or be substituted in the probe GC contiguous sequence is not particularly limited as long as binding power with a target sequence is maintained. For example, a ratio may be 2 or 3 bases to 6 to 7 guanines or cytosines, 1 or 2 bases to 3 to 5 guanines or cytosines, 1 base to 3 to 4 guanines or cytosines, or 1 base to 3 guanines or cytosines.
Examples of substituted/abasic probe GC contiguous sequences include G*GG*GG (SEQ ID NO: 11), GG*G*GG (SEQ ID NO: 12), GG*GG*G (SEQ ID NO: 13), *G*G*GG (SEQ ID NO: 14), *G*GG*G (SEQ ID NO: 15), *GG*G*G (SEQ ID NO: 16), *GG*GG* (SEQ ID NO: 17), G*G*G*G (SEQ ID NO: 18), G*GG*G* (SEQ ID NO: 19), G*G*GG* (SEQ ID NO: 20), GG*G*G* (SEQ ID NO: 21), C*CC*CC (SEQ ID NO: 22), CC*C*CC (SEQ ID NO: 23), CC*CC*C (SEQ ID NO: 24), *C*C*CC (SEQ ID NO: 25), *C*CC*C (SEQ ID NO: 26), *CC*C*C (SEQ ID NO: 27), *CC*CC* (SEQ ID NO 28), C*C*C*C (SEQ ID NO 29), C*C*CC* (SEQ ID NO: 30), C*CC*C* (SEQ ID NO: 31), CC*C*C* (SEQ ID NO: 32), *GG*GG (SEQ ID NO: 33), G*G*GG (SEQ ID NO: 34), G*GG*G (SEQ ID NO: 35), GG*G*G (SEQ ID NO: 36), GG*GG* (SEQ ID NO: 37), *G*G*G (SEQ ID NO: 38), *G*GG* (SEQ ID NO: 39), *GG*G* (SEQ ID NO: 40), G*G*G* (SEQ ID NO: 41), *CC*CC (SEQ ID NO: 42), C*C*CC (SEQ ID NO: 43), C*CC*C (SEQ ID NO: 44), CC*C*C (SEQ ID NO: 45), CC*CC* (SEQ ID NO: 46), *C*C*C (SEQ ID NO: 47), *C*CC* (SEQ ID NO: 48), *CC*C* (SEQ ID NO: 49), C*C*C* (SEQ ID NO: 50), GG*GG (SEQ ID NO: 51), *G*GG (SEQ ID NO: 52), *GG*G (SEQ ID NO: 53), G*G*G (SEQ ID NO: 54), G*GG* (SEQ ID NO: 55), GG*G* (SEQ ID NO: 56), CC*CC (SEQ ID NO: 57), *C*CC (SEQ ID NO: 58), *CC*C (SEQ ID NO: 59), C*C*C (SEQ ID NO: 60), C*CC* (SEQ ID NO: 61), CC*C* (SEQ ID NO: 62), G*GG (SEQ ID NO: 63), GG*G (SEQ ID NO: 64), *G*G (SEQ ID NO: 65), *GG* (SEQ ID NO: 66), G*G* (SEQ ID NO: 67), C*CC (SEQ ID NO: 68), CC*C (SEQ ID NO: 69), *C*C (SEQ ID NO: 70), *CC* (SEQ ID NO: 71), C*C* (SEQ ID NO: 72), *GG (SEQ ID NO: 73), G*G (SEQ ID NO: 74), GG* (SEQ ID NO: 75), *G* (SEQ ID NO: 76), *CC (SEQ ID NO: 77), C*C (SEQ ID NO: 78), CC* (SEQ ID NO: 79), and *C* (SEQ ID NO: 80).
In the polynucleobase probe of the present invention, a chain length of a portion binding to a target sequence is a length such that a binding rate (a false positive rate) with a nucleic acid having a sequence other than a target sequence is increased due to the presence of a probe GC contiguous sequence, and is specifically is 10- to 50-mer. For example, a chain length of a portion binding to a target sequence in the polynucleobase probe of the present invention can be 10-mer or more, 11-mer or more, 12-mer or more, 13-mer or more, 14-mer or more, 15-mer or more, 16-mer or more, 17-mer or more, or 18-mer or more.
In addition, a chain length of a portion binding to a target sequence in the polynucleobase probe of the present invention can be 50-mer or less, 45-mer or less, 40-mer or less, 35-mer or less, 30-mer or less, 29-mer or less, 28-mer or less, 27-mer or less, 26-mer or less, or 25-mer or less.
For example, a chain length of a portion binding to a target sequence in the polynucleobase probe of the present invention can be 10- to 40-mer, 13- to 30-mer, 15- to 28-mer, or 18- to 25-mer.
The above-mentioned “chain length of a portion binding to a target sequence in the polynucleobase probe of the present invention” may be read as a chain length of the polynucleobase probe.
The nucleobase probe in the present specification may be appropriately “modified”. For example, the modification includes a label for detection, a functional group for binding, and the like. Any label can be used without particular limitation as long as it can be used in the field of nucleic acid detection. For example, various methods such as radioactive substance (RI), enzyme (biotin and the like), hapten (digoxigenin (DIG) and the like), affinity tag, and fluorescent colorants are known.
As fluorescent colorants, various types of red, orange, yellow, green, blue, and purple are known. It is possible to use dansyl, TRITC, fluorescein, rhodamine, Texas red, IAEDANS, cyanine dyes (Cy3, Cy3.5, Cy5, Cy5.5, Cy7), Hoechst, BFP, CFP, WGFP, GFP, YFP, RFP, EGFP, FITC, AlexaFluor, tdTomato, TRITC, TXRED, mCherry-A, mCherry-C, and the like.
In addition, the probe of the present invention may be immobilized on a solid phase. For example, the probe may be bound to an array, a bead, or a chip.
A “functional group for binding” is not particularly limited as long as it is a group used for binding the nucleobase probe in the present specification to a solid phase or another substance, and examples thereof include a hydroxyl group, a halogen atom, an amino group, an amido group, an imide group, a guanidine group, a urea group, an alkene, an alkyne, a sulfonic acid, a carboxylic acid group, an ester group, and the like.
The term “target nucleic acid” in the present specification means a nucleic acid having a GC contiguous sequence, which is a target nucleic acid of which the presence is to be detected or quantitatively determined by the probe of the present invention. For example, in a case where the probe of the present invention is used for the purpose of diagnosing a disease or disorder, a target nucleic acid means DNA or RNA derived from a living body. A target nucleic acid may have 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 GC contiguous sequence.
A length of the target nucleic acid is not particularly limited, but a target nucleic acid of 50-mer or less, 45-mer or less, 40-mer or less, 35-mer or less, 30-mer or less, 29-mer or less, 28-mer or less, 27-mer or less, 26-mer or less, or 25-mer or less are preferable from the viewpoint of the probe of the present invention being particularly effective for double-strand formation with a target nucleic acid for which a probe avoiding a target GC contiguous sequence cannot be designed. For example, a chain length of the target nucleic acid can be 10-mer or more, 11-mer or more, 12-mer or more, 13-mer or more, 14-mer or more, 15-mer or more, 16-mer or more, 17-mer or more, or 18-mer or more. As an example, a chain length of the target nucleic acid is 10- to 50-mer, 10- to 40-mer, 13- to 30-mer, 15- to 28-mer, or 18- to 25-mer.
A representative example of target nucleic acids includes an miRNA having a GC contiguous sequence. Examples of such sequences include sequences described in the following table. In the table, the underline indicates a GC contiguous sequence. The numerical values beside the sequence represent, in order, a full length of the sequence, the number of target GC contiguous sequences contained in the target nucleic acid, and a length of the longest target GC contiguous sequence contained in the target nucleic acid.
Examples of target sequences having GC contiguous sequences or sequences complementary to the target sequences or miRNAs are as follows:
GGGAUAUGAAGAAAAAU,
GGGAGUCUACAGCAGGG,
GGGAUUCUGUAGCUUCCU,
CCCAGCAGGACGGGAGCG ,
GGGUGAGGGCAGGUGGUU ,
CCCUGAGACCCUAACCUUAA ,
CCCGGAGCCAGGAUGCAGCUC ,
CCCAGAUAAUGGCACUCUCAA ,
GGGAAGAGCUGUACGGCCUUC ,
GGGACUAGGAUGCAGACCUCC ,
GGGACCAUCCUGCCUGCUGUGG ,
GGGAGGUGUGAUCUCACACUCG ,
GGGAGCCAGGAAGUAUUGAUGU ,
CCCUGUGCCCGGCCCACUUCUG ,
CCCAGUGUUCAGACUACCUGUUC ,
CCCAGUGUUUAGACUAUCUGUUC ,
GGGUUUGUAGCUUUGCUGGCAUG ,
CCCGGACAGGCGUUCGUGCGACGU ,
GGGCGACAAAGCAAGACUCUUUCUU ,
GGGGCGCGGCCGGAUCG ,
CCCCGCCACCGCCUUGG ,
GGGGUGGUCUGUUGUUG ,
GGGGCUGGGCGCGCGCC ,
GGGAGAAGGGUCGGGGC,
CCCCGGGGAGCCCGGCG ,
GGGCUCACAUCACCCCAU ,
CCCCUGGGCCGGCCUUGG ,
GGGUGCGGGCCGGCGGGG ,
GGGGCCUGGCGGUGGGCGG ,
GGGGAGCGAGGGGCGGGGC ,
GGGGAGCUGUGGAAGCAGUA ,
CCCCAGGGCGACGCGGCGGG ,
GGGCUGGGGCGCGGGGAGGU ,
CCCCACCUCCUCUCUCCUCAG ,
CCCUUGGGUCUGAUGGGGUAG ,
GGGGCUGUGAUUGACCAGCAGG ,
CCCUCUCUGGCUCCUCCCCAAA ,
GGGUGGGGAUUUGUUGCAUUAC ,
GGGGUUCCUGGGGAUGGGAUUU ,
GGGACCCGGGGAGAGAUGUAAG ,
GGGGCUGGGGCCGGGACAGAGC ,
GGGGAAAGCGAGUAGGGACAUUU ,
CCCCGGUGUUGGGGCGCGUCUGC ,
CCCAGGGCUUGGAGUGGGGCAAGGUU ,
GGGGGAAGAAAAGGUGGGG ,
GGGAAAAGGAAGGGGGAGGA ,
GGGCAUCUGCUGACAUGGGGG ,
GGGCUAGGGCCUGCUGCCCCC ,
GGGGGUCCCCGGUGCUCGGAUC ,
CCCCCACAACCGCGCUUGACUAGCU ,
GGGUCCCGGGGAGGGGGG,
GGGGGGAUGUGCAUGCUGGUU ,
The term “target sequence” in the present specification is a sequence contained in a target nucleic acid to which a probe binds, and is a sequence having at least one target GC contiguous sequence. In another expression, the target sequence means a sequence intended to form a double strand with the probe of the present invention, that is, a sequence complementary to a fully complementary probe sequence. The target sequence may be a full length sequence of a target nucleic acid or a partial sequence of a target nucleic acid. For example, the target sequence may have 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 target GC contiguous sequence. In a case where the target sequence has two or more target GC contiguous sequences, these target GC contiguous sequences may be present at a location separated from each other or may be present adjacent to each other as in the example of SEQ ID NO: 873 or SEQ ID NO: 965. A length of the target sequence is 10- to 50-mer. For example, a chain length of the target sequence of the present invention can be 10-mer or more, 11-mer or more, 12-mer or more, 13-mer or more, 14-mer or more, 15-mer or more, 16-mer or more, 17-mer or more, or 18-mer or more. In addition, a chain length of the target sequence of the present invention can be 50-mer or less, 45-mer or less, 40-mer or less, 35-mer or less, 30-mer or less, 29-mer or less, 28-mer or less, 27-mer or less, 26-mer or less, or 25-mer or less. A chain length of the target sequence of the present invention can be 10- to 40-mer, 13- to 30-mer, 15- to 28-mer, or 18- to 25-mer.
The term “non-target nucleic acid” in the present specification means a nucleic acid of which the presence is not intended to be detected by the probe of the present invention or is intended to be quantitatively determined by the probe of the present invention, and means a nucleic acid having the same GC contiguous sequence as that of a target sequence. The phrase “the same GC contiguous sequence as that of a target sequence” means the same sequence as the GC contiguous sequence that the target sequence has, and means a GC contiguous sequence longer or shorter by one to several bases than the GC contiguous sequence that the target sequence has.
In addition, the term “non-target sequence” means a sequence that a non-target nucleic acid has, and means a sequence having the same GC contiguous sequence as that of the target sequence.
In the present specification, the term “specificity” means a proportion of a probe that mistakenly did not bind to a non-target nucleic acid (negative) in a case of binding the probe to a target nucleic acid, and is represented by (the number of non-target nucleic acids that did not bind to probe)/(total number of non-target nucleic acids).
Furthermore, in the present specification, the term “false positive” means that a probe mistakenly binds to a non-target nucleic acid. In addition, the term “false positive rate” means a rate at which non-target nucleic acids are mistakenly detected as target nucleic acids, and is represented by 1—(specificity), or (the number of non-target nucleic acids to which probe is mistakenly bound)/(total number of non-target nucleic acids). In the present specification, the term “non-specific binding” means that the probe binds to non-target nucleic acids. The term “specific binding” refers to binding of the probe to a target nucleic acid without binding to a non-target nucleic acid. The phrase “the probe does not bind to non-target nucleic acids” is synonymous with “specificity is high” or “high specificity” and “a false positive rate is low”. For example, the phrase may mean that a rate of detecting (or quantitatively determining) non-target sequences as a false positive by the probe is low compared to a fully complementary probe, or mean specificity of 0.8, 0.9, 0.95, 0.98, 0.99, or 0.999.
The probe of the present invention enables detection or quantitative determination with a low false positive rate in nucleic acid detection, because binding to non-specific sequences occurs less as compared to a probe having a sequence fully complementary to a target sequence. In particular, the probe of the present invention can detect or quantitatively determine short-chain nucleic acids with high specificity by simple double-strand formation without requiring complex processes such as ligation and amplification, because the probe increases a difference in binding power between a target sequence and a non-target sequence by changing binding activity of the probe itself.
1. Method for Designing Polynucleobase Probe
In one embodiment, the present invention relates to a method for designing a polynucleobase probe sequence that is capable of binding, with high specificity, to a target nucleic acid having a target sequence having at least one sequence of SEQ ID NOs: 1 to 10 (a GC contiguous sequence), the method including:
A) selecting a 10- to 50-mer sequence fully complementary to the target sequence as a fully complementary probe sequence; and
B) (i) in the fully complementary probe sequence, designing the polynucleobase probe by substituting or making at least one of bases abasic in a portion complementary to the GC contiguous sequence in the target sequence, and/or
B) (ii) in the fully complementary probe sequence, designing the polynucleobase probe sequence by cleaving the fully complementary probe sequence such that a portion complementary to the GC contiguous sequence in the target sequence becomes 2 bases or less.
Preferably, the polynucleobase probe sequence of the present invention is designed by creating an abasic site, substituting, or cleaving such that the number of bases in which any one of guanine or cytosine is contiguous becomes two bases or less, in the polynucleobase sequence (a probe GC contiguous sequence) complementary to a target GC contiguous sequence in the probe sequence.
In the method of the present invention, a target sequence is contained in a target nucleic acid, and any sequence containing at least one GC contiguous sequence can be selected. A length of the target sequence is not particularly limited as long as specific detection of a target nucleic acid is possible, and can be a length of the target sequence described above. The fully complementary probe sequence can be obtained as a polynucleobase sequence that is fully complementary to the target sequence.
As a position and the number of bases to become abasic or be substituted, it is possible to adopt any of substitution/abasic site in the above-mentioned probe GC contiguous sequence of the present invention. “Abasic site creation” can be carried out by substituting a base site with a hydrogen atom, a hydroxyl group, a lower alkyl group, a lower acyl group. or the like. In a case of PNA, creating an abasic site may be carried out by substituting a nitrogen atom of a glycine skeleton with a carbon atom (which may have a lower acyl group (such as an acetyl group) or a lower alkyl group (such as a methyl group) as a substituent). In addition, “substitution” can be carried out by substituting a base site with a non-complementary base (such as a natural base or an artificial base), or may be carried out by substituting a base site with a group such as a phenyl group and an anthraquinone group, which does not inhibit the formation of a double helix structure with another base. A substituted/abasic probe sequence is preferably designed to not to have a probe GC contiguous sequence.
Cleavage of a fully complementary probe sequence is carried out by cleaving the fully complementary probe sequence within a probe GC contiguous sequence. Cleavage is performed at a position at which a fragment intended to be utilized as a polynucleobase probe has, at the end thereof, two or less bases of guanine or cytosine derived from a probe GC contiguous sequence, among fragments obtained by cleavage. Accordingly, a polynucleobase probe obtained by cleavage has one or two bases of guanine or one or two bases of cytosine at one or both ends.
In a case where the fully complementary probe sequence has two or more probe GC contiguous sequences, a polynucleobase probe sequence may be designed by performing the substitution, creating an abasic site, and cleavage described above alone or in combination at the two or more GC contiguous sequences. The substitution, creating an abasic site, and cleavage are preferably performed in all probe GC contiguous sequences in the probe in the design of the present invention. Accordingly, the polynucleobase probe sequence is preferably designed to not to have a probe GC contiguous sequence.
In the present specification, “binding, detecting, or quantitatively determining with high specificity” or “specifically detecting/binding” a target sequence having at least one GC contiguous sequence means detection (or quantitative determination) of a non-target sequence as a false positive at a low rate, compared to a probe (in which substituting or creating an abasic site has not been performed) complementary to a target sequence (a probe having a fully complementary probe sequence, hereinafter referred to as a “fully complementary probe”). Regarding whether or not a rate at which a test probe detects (or quantitatively determines) non-target sequences as false positives is low compared to a fully complementary probe, for example, in a case where a Tm value of the test probe is lower than a Tm value of the fully complementary probe by measuring a temperature at which 50% of double strands dissociate into single strands (melting temperature: Tm value) when binding of both probes to non-target sequences; or in a case where a Tm value of the test probe cannot be measured (no formation of a double strand), it can be determined that a rate at which the test probe detects (or quantitatively determines) non-target sequences as false positives is low compared to the fully complementary probe. Alternatively, this may mean binding, detecting, or quantitatively determining with a specificity of 0.8, 0.9, 0.95, 0.98, 0.99, 0.999, or the like.
2. Production of Polynucleobase Probe
As the polynucleobase probe according to the present invention, a probe designed by the above-described design method can be produced by utilizing methods known in the technical field. In particular, methods of chemical synthesis in which polynucleobases such as DNA/RNA, PNA, and LNA are bound one by one are well known, and such methods can be adopted. For example, in a case of PNA, using an Fmoc solid phase synthesis method, abase can be substituted with a carbon skeleton by elongating with 5-[(9-Fluorenylmethoxycarbonyl) amino] pentanoic acid, instead of elongating a site to become abasic with a base. In addition, if necessary, a synthesized polynucleobase probe can be bound to a modifier such as a solid phase or a label.
3. Method for Detecting or Quantitatively Determining Target Nucleic Acid Having GC Contiguous Sequence Using Polynucleobase Probe According to the Present Invention
In another aspect, the present invention relates to a method for detecting a target nucleic acid having at least one sequence of anyone of SEQ ID NOs: 1 to 10 in a test sample with high specificity, the method including:
preparing the test sample to detect the target nucleic acid;
contacting at least one kind of the polynucleobase probes according to the present invention with the test sample; and
detecting the target nucleic acid bound to the polynucleobase probe.
In another aspect, the present invention relates to a method for quantitatively determining a target nucleic acid having at least one sequence of any one of SEQ ID NOs: 1 to 10 in a test sample with high specificity, the method including:
preparing the test sample to quantitatively determine the target nucleic acid;
contacting at least one kind of the polynucleobase probes according to the present invention with the test sample; and
quantitatively determining the target nucleic acid bound to the polynucleobase probe.
In the detection method and quantitative determination method of the present invention, a test sample can be prepared by using a target sample from which the presence or an amount of a target nucleic acid that is to be detected or quantitatively determined is examined. For example, for diagnostic purposes, the target sample is not particularly limited as long as it is a sample from which DNA or RNA can be detected, and it is possible to use body fluids or tissues such as lymph fluid, blood (serum, plasma), urine, feces, saliva, spinal fluid, tears, biopsy, hair, skin, nails, leachates, and cells (such as circulating tumor cells in blood (CTC)); exosomes; or cell-free DNA. These samples are appropriately prepared as samples suitable for detection of DNA or RNA.
Contact between at least one type of the polynucleobase probes according to the present invention and the test sample can be performed by, for example, mixing the polynucleobase probe according to the present invention and the test sample in a buffer. In particular, in a case where the polynucleobase probe according to the present invention is bound to a solid phase, the polynucleobase probe can be brought into contact in a static state, or can be dynamically brought into contact by a microfluidic device or the like.
For detection or quantitative determination of a target nucleic acid bound to a polynucleobase probe, methods widely known in the field of nucleic acid detection can be adopted. In a case where a label is bound to the probe, a detection method and a quantitative determination method can be adopted according to the type of the label. In addition, in a case where the label is not bound to the probe, it is possible to perform electrical detection or quantitative determination by using an intercalating agent inserted into a double strand (refer to, for example, Japanese Unexamined Patent Publication No. 2006-061061).
4. Another Method for Utilizing Polynucleobase Probe According to the Present Invention
In addition to the detection and quantitative determination methods in which direct measurement is performed after hybridization as described above, the probe of the present invention can also be used in detection and quantitative determination methods by utilizing amplification and ligation after utilizing hybridization. In particular, in a case of utilizing amplification, the probe can be used as a primer. In addition, the probe of the present invention can be used as an antisense DNA. Such an antisense DNA can be used for knockout/knockdown of gene expression. Furthermore, such an antisense DNA can be used for therapeutic purposes, for example, for gene therapy.
For example, the probe according to the present invention can be used in the following method:
A method for detecting or quantitatively determining a target nucleic acid in a test sample with high specificity, compared to detection and quantitative determination which use a probe (primer) complementary to a target sequence having at least one sequence of any one of SEQ ID NOs: 1 to 10, the method including:
preparing the test sample to quantitatively determine the target nucleic acid;
contacting at least one kind of the polynucleobase probes (primers) according to the present invention with the test sample;
amplifying a nucleic acid complementary to the target nucleic acid; and
detecting or quantitatively determining the amplified target nucleic acid.
Alternatively, the probe according to the present invention can be used in the following method:
A method for detecting or quantitatively determining a target nucleic acid in a test sample with high specificity, compared to detection and quantitative determination which use a probe complementary to a target sequence having at least one sequence of any one of SEQ ID NOs: 1 to 10, the method including:
preparing the test sample to quantitatively determine the target nucleic acid;
contacting, with the test sample, (i) at least one type of the polynucleobase probes according to the present invention, and (ii) a complementary probe that does not have a target sequence overlapping with the polynucleobase probe according to the present invention, in which bases separated by one to several bases from the target sequence of the polynucleobase probe according to the present invention are at the end of the target sequence;
binding by ligation of two types of probes forming a complementary strand with the target nucleic acid; and
detecting or quantitatively determining a bound substance of the two types of probes.
Hereinafter, the present invention will be specifically explained based on examples, but the present invention is not limited thereto. The present application claims priority right based on Japanese Patent Application No. 2017-030553 filed Feb. 22, 2017, and the contents described in the application are incorporated in the present specification by reference in their entirety. In addition, the contents described in all of the patents, patent applications, and documents cited in the present application are incorporated in the present specification by reference in their entirety.
Absorbance at 260 nm and 320 nm of each cell was measured while changing a temperature, and a Tm value of a double strand formed by a probe and a target was determined from the obtained data of absorbance with respect to a temperature. A measuring device of an amount of change in absorbance, and conditions were as follows. Absorbance measurements were performed during annealing and Tm value measurements according to measurement software settings.
Measuring device
Spectrophotometer UV-2600 (manufactured by Shimadzu Corporation)
Temperature controller TMSPC-8 (manufactured by Shimadzu Corporation)
8 Multicell 208-92097-11 (manufactured by Shimadzu Corporation)
Measurement software UVProbe ver. 2.52 (manufactured by Shimadzu Corporation)
Constant Temperature Bath CCA-1111 (manufactured by EYERA)
Measurement software setting
Standby time before absorbance measurement: 4 minutes
Absorbance measurement interval: 1° C.
Slit width: 1.0 nm
Cumulative time: 3
Temperature blank
SSC (1×)
20% DMSO aqueous solution
Measurement sample
SSC (1×)
20% DMSO aqueous solution
Probe 2 μM
Target 2 μM
SSC: Saline Sodium Citrate Buffer
Specifically, cells to which a nucleic acid sample in which each of probes/targets to be measured are combined, or a temperature blank is added were allowed to stand by before annealing at 95° C. for 10 minutes, and then cooled from 95° C. to 20° C. at 0.5° C./min to be annealed. Thereafter, after standing by before Tm value measurement at 20° C. for 60 minutes, the temperature was raised from 20° C. to 95° C. at 0.5° C./min to measure the Tm value. A baseline was measured using a temperature blank. Using the data of the temperature blank cell, baseline correction was performed on a wavelength range of 330 nm to 250 nm.
Based on the obtained absorbance at two wavelengths (260 nm and 320 nm), two-wavelength correction was performed by subtracting environment-dependent absorbance variation A320 (n, T) from absorbance A260 (n, T) of the nucleic acid in the sample, and temperature-corrected absorbance Aw was calculated.
Aw(n,T)=A260(n,T)−A320(n,T)
n: Cell number (n=1, 2, . . . , 8)
T: Temperature at measurement (T=20, 21, . . . , 95)
Aw (n, T): Temperature-corrected absorbance at temperature T of cell number n
A260 (n, T): Absorbance at a wavelength of 260 nm at temperature T of cell number n
A320 (n, T): Absorbance at a wavelength of 320 nm at temperature T of cell number n
Furthermore, in order to remove the absorbance variation due to the temperature change of the solvent, temperature correction was performed by subtracting Aw (1, T) of the temperature blank cell from Aw (n, T) of the nucleic acid sample, and temperature-blank-corrected absorbance At was calculated.
At(n,T)=Aw(n,T)−Aw(1,T)
At (n, T): Temperature-blank-corrected absorbance of cell number n
Standardized absorbance A was calculated by standardizing the obtained At (n, T) such that a maximum value thereof became 1. Accordingly, Max (A (n, T))=1.
A(n,T)=At(n,T)/Max(At(n,T))
A (n, T): Standardized absorbance
Max (At (n, T)): Maximum value of cell number n at At (n, T)
Based on A (n, T) obtained by the above calculation, an amount of change in absorbance [%] Δ abs (n) of cell number n showing an amount of base pairs formed, and a maximum value Tm (n) of a first derivative due to a temperature of cell number n which shows a Tm value [° C.] were obtained according to the following equation. In the following equation, Min (At (n, T)) represents a minimum value at At (n, T) of cell number n.
Δabs(n)=(Max(A(n,T))−Min(A(n,T)))*100
Tm(n)=Max(dA(n,T)/dT)
Abasic site creation was performed by substituting a part of the probe using PNA which is one embodiment of the present invention with 5-aminopentanoic acid (hereinafter Ape). Hereinafter, the term “Linker” represents a structure including a thiol group for binding a probe to a gold electrode. A target GC contiguous sequence in the present example was GGG, and the probe GC contiguous sequence was CCC. A substitution site with Ape is indicated by “*”.
In order to confirm effects of abasic sites, using four types of probes 1 to 4 which have the following sequences, Tm values with respect to base pair formation by a target sequence (a sequence complementary to a probe) and a non-target sequence (a sequence not complementary to a probe) were measured by the method described above. Non-target sequences have sequences that are not complementary to the probe, but contain the same GC contiguous sequence (GGG) as the target sequence. For this reason, non-target sequences are likely to form base pairs with the probes, and base pair formation by non-target sequences and the probes means a false positive.
The results of measuring Tm values of eight combinations of the probe and the target/non-target sequences by the method shown in Example 1 are shown in
As described in Example 2 above, it was shown that an abasic site of a GC contiguous sequence effectively enables detection with low false positive rate by an experiment using an abasic probe in which bases in the sequence are deleted. Based on the above description, it was examined whether or not detection with low false positive rate is possible with a probe in which a sequence length was shortened by cleaving in the middle of the GC contiguous sequence, in the sequence in which the GC contiguous sequence is present near the end.
Specifically, the GC contiguous sequence in the probe using PNA, which is one embodiment of the present invention, was cleaved, and three types of probes which have different chain lengths and have the following sequences were prepared. Tm values were measured by the method described above with respect to base pair formation by target sequences (sequences complementary to probes) and non-target sequences (sequences not complementary to probes). Non-target sequences have sequences that are not complementary to the probe, but contain the same GC contiguous sequence (GGG) as the target sequence. For this reason, non-target sequences are likely to form base pairs with the probes, and base pair formation with the probes means a false positive. A target GC contiguous sequence in the present example was GGG, and the complementary probe GC contiguous sequence was CCC.
The results of measuring Tm values of six combinations of the probe and the target/non-target sequences by the method shown in Example 1 are shown in
A large difference is shown in Δabs with respect to non-target sequences between probe 23-mer and probe 18-mer or probe 17-mer. However, no difference is shown between the probe 18-mer and the probe 17-mer, and it was shown that a base pair with a non-target sequence is hardly formed merely by making one base short from three consecutive cytosines. On the other hand, a Tm value for the target sequence tended to decrease as a chain length was shortened, but in the 17-mer probe, the Tm value is 70° C., and Δabs is also high. Accordingly, it was confirmed that a double strand was formed with the target. Therefore, it is shown that, in a case where GC contiguous sequences are present near the end of the probe or target sequence, an effect of reducing non-specific base pair formation (a false positive) with non-target sequences is exhibited by shortening of a probe chain length. In probe 18-mer and probe 17-mer, the variation of dA (n, T)/dT in base pair formation with a non-target sequence is a noise level, and a Tm value could not be obtained. Accordingly, probe 18-mer and probe 17-mer are perceived not to bind to a non-target sequence at any temperature. Therefore, it was shown that detection of a target sequence with a low false positive rate is possible by appropriately controlling a temperature using a short chain probe.
In the present example, the term “modification” refers to a process of dropwise adding of a corresponding solution on a working electrode by a pipette and then allowing it to stand at a designated temperature for a designated time. In addition, in the present example, the term “washing” refers to a process of washing a surface of a gold electrode with a designated washing solution at a designated temperature.
(1) Adjustment of Measurement Solution
A pH of a sodium dihydrogen phosphate aqueous solution was adjusted to become 7.0 with sodium hydroxide, and then sodium perchlorate and potassium hexacyanoferrate (II) were added thereto. A final concentration of the measurement solution was 2.5 mM of sodium dihydrogen phosphate, 5 mM of sodium perchlorate, and 1 mM of potassium hexacyanoferrate (II).
(2) Measurement Method
The electrochemical measurement in the present example was performed by the following steps. In the following table, RT represents room temperature (about 25° C.), TFA represents trifluoroacetic acid, DMSO represents dimethyl sulfoxide, and Milli-Q represents ultra pure water.
As a sample, a solution containing any one of a target nucleic acid or a non-target nucleic acid which has a specified concentration was used. The measurement was carried out by cyclic voltammetry (hereinafter, CV) by using working electrode: gold electrode with a diameter of 300 μm, counter electrode: Pt counter electrode of 5 cm manufactured by BAS, reference electrode: RE-1B aqueous reference electrode (Ag/AgCl) manufactured by BAS, Potentiostat (miniSTAT 100 manufactured by BioDevice Technology). The measurement conditions (miniStat 100 setting contents) were as follows.
(3) Measurement 1
A surface of the working electrode was modified with a probe and 6-Hydroxy-1-hexanethiol (HHT) (
(4) Measurement 2: Non-Target Nucleic Acid
An electrode was modified with a sample containing a non-target nucleic acid (hereinafter, non-complementary electrode). The marker reached a surface of the electrode as in the initial state (
(5) Measurement 2: Target Nucleic Acid
Next, an electrode was modified with a sample containing a target nucleic acid (hereinafter, complementary electrode). Because the probe and target nucleic acid hybridized, the marker received repulsion due to a negative charge of the nucleic acid, and therefore it was difficult for the marker to reach the surface of the electrode (
(6) Determination of Hybridization Determination Method
Based on the above results, whether the measured electrode was a complementary electrode or a non-complementary electrode was determined from a current value at the voltage value V1 at which the maximum current value i1 was recorded in measurement 1. A current value ratio i2/i1 obtained in measurements 1 and 2 is ideally 1 for a case of non-complementary electrodes, and is smaller than 1 for a case of complementary electrodes. Practically, in consideration of measurement error, an electrode was determined to be a non-complementary electrode when a current value ratio was i2/i1≥0.9, and was determined to be a complementary electrode when a current value ratio was i2/i1<0.9.
Using the CV measurement method described above, measurements of hybridization of probes 1 to 4 with respect to the following target sequence and non-target sequences were performed.
Target sequence and probes 1 to 4: Because all current value ratios of measurement 2 to measurement 1 decreased to 0.1 or less, hybridization was correctly performed with the target sequence.
Non-target sequence and probe 1: A current value ratio is 0.3, and mishybridization with the non-target sequence was caused.
Non-target sequence and probes 2 and 3: Current ratios are 0.4 and 0.7, which are higher than the current ratio of probe 1 which is 0.3, and therefore the effect of reducing mishybridization by making one site of the GC contiguous sequence abasic was observed.
Non-target sequence and probe 4: A current value ratio was 0.9 and did not cause mishybridization. The effect obtained by making two sites of the GC contiguous sequence abasic was observed.
Using the CV measurement method described above, measurements of hybridization of probes 1 to 4 with respect to the following target sequence and non-target sequences were performed.
Target sequence and probe 23-mer: A current value ratio decreased to 0.0, and hybridization occurred correctly with the target sequence.
Target sequence and probe 18-mer and probe 17-mer: As the chain length decreases, the current value ratio increases, but the ratio is suppressed to 0.2. This means that the hybridization with the target sequence is reduced as compared with the full length, but the current value ratio is sufficiently reduced for the complementation determination.
Non-target sequence and probe 23-mer: A current value ratio is 0.7, and mishybridization with the non-target sequence was caused.
Non-target sequence and probe 18-mer and probe 17-mer: A current value ratio was 1.0, and mishybridization was completely suppressed. The effect obtained by cleaving the GC contiguous sequence so that the GC contiguous sequence has less than 3 consecutive bases is observed.
TN17G016PC ST25.txt
| Number | Date | Country | Kind |
|---|---|---|---|
| 2017-030553 | Feb 2017 | JP | national |
This application is a continuation of U.S. application Ser. No. 16/487,713, filed Aug. 21, 2019, which is a national stage (under 35 U.S.C. 371) of International Patent Application No. PCT/JP2018/005964, filed Feb. 20, 2018, claiming priority to Japanese Patent Application No. 2017-030553, filed Feb. 22, 2017, each of which are herein incorporated by reference in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16487713 | Aug 2019 | US |
| Child | 17592525 | US |
