Probes for detecting and identifying Helicobacter pylori

Abstract

DNA probes for detecting the presence of Helicobacter pylori are provided. These isolated, purified oligonucleotide probes are useful in assays for the specific detection of Helicobacter pylori because they specifically hybridize to the DNA of H. pylori.

Description

TECHNICAL FIELD

The present invention relates to probes useful for detecting and identifying Helicobacter pylori , the causative bacteria of the digestive diseases including gastritis, gastric ulcer, duodenal ulcer or the like.

BACKGROUND ART

Since Warren's group reported the existence of Helicobacter pylori [Former Name: Campylobacter pylori ] in the human gastric mucosal (Warren J. R. et al., “Unidentified curved bacilli on gastric epithelium in active chronic gastritis”, Lancet 1: 1273-1275 (1983)), numerous researches have been performed with regard to the biochemical properties thereof, in particular, the correlation between Helicobacter pylori and digestive diseases including gastric ulcer, duodenal ulcer or the like.

In view of the focus that Helicobacter pylori have been separated/detected at a high rate from the human gastric mucosa of the gastritis patients or the gastriculcer patients [e.g., there are reports that they were detected at a rate of 50˜80% in the cases of chronic gastritis, superficial gastritis, atrophic gastritis, erosive gastritis or the like], and the symptom of these digestive diseases are alleviated with sterilization by administration of drugs, accordingly, the correlation between Helicobacter pylori and the digestive diseases were suggested.

Helicobacter pylori would not make an invasion upon mucosal cells, but stay on the epithelial mucosa surface and/or the intercellular space and grow (proliferate) thereat. Then, it is thought that PAS (Periodic Acid-Sciff) reaction positive layer in the gastric mucosa are thinned through growth of Helicobacter pylori , thereby, effects of mucin which protects mucosa are declined, and potency on defense factor of the gastric mucosa are also declined (T. Ito, “Recent findings on Helicobacter pylori ”, Medical Technology, 19 (10), pp. 892-893 (September 1991)).

Then, the mechanism was also reported that Helicobacter pylori arrive and stay in gastric mucosal epithelium, then ammonia were produced through degradation of urea in the stomach by urease from Helicobacter pylori , the ammonia so produced damage gastric mucosa and generate reverse diffusion of the hydrogen ion, and, tumors are thereby formed (Tsujii, M. et al., “Mechanism of gastric mucosal damage Induced by ammonia”, Gastroenterology 107: pp. 1881-1888 (1992)).

In general, conventional diagnosis of Helicobacter pylori , which is correlative to the human digestive diseases, includes:

(1) Direct proof on presence of Helicobacter pylori in a part of mucosa [Smear, Tissue-Microscopy, Cultivation],

(2) Detection utilizing character of Helicobacter pylori including urease activities, and

(3) Seroimmunodiagnosis (T. Shirai et al., “Diagnosis on Presence of Campylobacter pylori ”, Saishin-Igaku, 44 (2), 284-288 (1989)).

Of the methods aforenoted, a method (cultivation method) for detecting Helicobacter pylori through micro-aerobic cultivation of biopsy sample on gastric mucosa is the most reliable and accurate method. But, this method usually needs about one hour for a cultivation to grow the bacteria, the longer time would therefore be necessary to obtain the test results.

Then, in consideration of urease productivity by Helicobacter pylori , a method for directly detecting urease in samples of gastric biopsy have also been utilized (T. Ito, “Special diagnosis for bacterial infection/4. Campylobacter pylori ”, Rinnshoui, 15 (supplement), pp. 367-369 (1989). However, since these are methods to test the biopsy samples with an endoscope, the methods need the skilled operation and the patients will suffer from the unbearable pain.

Further, since urea in the stomach are degraded into ammonia and 14 CO 2 , there is a diagnosis including evaluation of such 14 CO 2 by a scintillation counter. But, this method also needs a skilled work to handle radioisotope.

DISCLOSURE OF INVENTION

In view of the aforenoted problems in the art, the present invention was established to develop technology for easily, specifically and effectively detect Helicobacter pylori without introducing into patient's body any medical instrument like an endoscope.

Then, the merit of the invention is directed to probes having specific reactivities to DNAs or RNAs of Helicobacter pylori which is the causative bacteria of the digestive diseases including gastritis, gastric ulcer, duodenal ulcer or the like, and to analysis of base sequences in the probes concerning the characteristic gene portion of Helicobacter pylori.

That is to say, DNAs of the subject bacteria, Helicobacter pylori , can significantly be detected by the specificity between the probes of the present invention and the bacteria DNAs, thereby, Helicobacter pylori can be detected/identified rapidly and exactly without cultivating/growing Helicobacter pylori.

Then, if primers are designed based on base-sequence information of these probes, Helicobacter pylori can be identified by amplifying DNAs with PCR techniques without performing any hybridization procedure.

When non-radioactive probes, for example, biotinylated probes are employed for hybridization, since such probes can be detected with an optical microscope in a conventional laboratory without facilities to handle radioisotype, thereby, a process for detecting bacteria can perform rapidly and simply.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 is a view showing positional relation between well in the well-plate and the samples (blotted strain DNAs).

FIG. 2 is a view showing results of dot-hybridization on reactivities between the probes of the present invention and DNAs from various strains.

BEST MODE FOR CARRYING OUT THE INVENTION

Although examples of the probes prepared from Helicobacter pylori according to the present invention are illustrated as follows, the present invention shall not be limited due to disclosures of Examples.

EXAMPLE 1

DNA Probes Prepared from Helicobacter pylori

(1) Preparation of DNA probes from Helicobacter pylori

Firstly, Skirrow medium containing the components listed in the following Table 1 was prepared.

	TABLE 1
	Blucella broth (Difco Co.,)	14	g
	Distilled Water	500	ml
	Polymyxin B	1250	Unit
	Vancomycin	5	mg
	Tripetoprim	2.5	mg
	Horse Serum (Difco Co.,)	50	ml
	Agar	5	g

Then, clinically isolated Helicobacter pylori were cultured in said Blucella broth (Difco Co., ) and said Skirrow medium under micro-aerobic condition [mixed gas consisting of 2% hydrogen, 5% oxygen, 7% carbon dioxide, 86% nitrogen (respectively expressed as volume %); relative humidity 90%] at 37° C. for five days to separate and grow Helicobacter pylori.

After the cultivation, the cultured bacteria were collected. Then, they were applied to the modified method based on Saito-Miura methodology (“Preparation of transforming deoxyribonucleic acid by phenol treatment”, Biochem, Biophys. Acta vol. 72, pp. 619-629 (1963)) employing proteinase K (Merck)-0.1% SDS and utilizing an isolation method for nucleic acid, and the genomic DNAs thereof were extracted. Extracted DNAs were completely digested with the restriction enzyme HindIII, and were randomly cloned into vector pGEM-3Z (Promega).

Eight probes comprising DNA fragments, which specifically react with Helicobacter pylori , were selected from the clones so obtained, and each of which was designated as probe HP-32, probe HP-34, probe HP-49, probe HP-55 (down), probe HP-55 (up), probe HP-60, probe HP-64 and probe HP-66 (SEQ ID NOS: 3 - 10 , respectively).

(2) Study on Species-Specificity of DNA Probes Prepared from Helicobacter pylori

Reactivities between each probe selected in Example 1 (1) and DNAs from various causative strains of infectious diseases were tested according to the following method.

First of all, as subject strains for the test, the clinically isolated strains and the deposited strains listed respectively in Table 2 were collected. In Table 2, Human Genomic DNA is Human Genomic DNA obtained from the human leukocytes of single healthy adult male (30 years old), while the control is Escherichia coli K-12, JM109 strain having plasmid pGEM-3Z (Seikagaku Kogyo).

TABLE 2
Strain No.	Strain Name	Source
1	Helicobacter pylori	ATCC 43629
2	Helicobacter pylori	Clinical Isolates
3	Helicobacter cineadi	ATCC 35683
4	Helicobacter fennelliae	ATCC 35684
5	Helicobacter mustelae	ATCC 43772
6	Campylobacter jejuni	CIP 702
7	Campylobacter coli	CIP 7080
8	Campylobacter fetus	CIP 5396
9	Streptococcus aureus	ATCC 25923
10	Streptococcus epidermidis	Clinical Isolates
11	Escherichia coli	ATCC 25922
12	Klebsiella pneumoniae	Clinical Isolates
13	Streptococcus pneumoniae	NYSDH DP-2
14	Pseudomonas aeruginosa	Clinical Isolates
15	Enterobacter cloacae	Clinical Isolates
16	Haemophilis influenzae	Clinical Isolates
17	Candida albicans	ATCC 48130
18	Aspergillus fumigatus	TIMM 0063
19	Cryptococcus neoformans	TIMM 0354
20	Mucor spinosus	TIMM 1322
21	Absidia corymbifera	TIMM 2435
22	Human Genomic DNA
24	Control
	(Escherichia coli K-12,
	JM109(pGEM-3Z))
Abbreviation
ATCC; American Type Culture Collection (Maryland, USA)
NYSDH; New York State Department of Health (Albany, New York, USA)
CIP; Collection of the Institute Pasteur (Paris, FRANCE)
TIMM; Teikyo University Institute of Medical Mycology (Tokyo, JAPAN)

Chromosomal DNAs in each strain were extracted according to the method of Example 1 (1) for the species belonged to Helicobacter genus referred to in Table 2 and according to Saito-Miura methodology (supra) employing lytic enzymes (lysostaphyn (Sigma), lysozyme (Sigma), acetylmuramidase SG (Seikagaku Kogyo)] for the other strains.

Samples for dot-blot-hybridization were obtained by spotting certain amount (e.g., 0.1 μg/5 μl) of the extracted DNAs onto nylon filters (Pauldyne) and selecting alkaline-denatured DNAs.

Samples of Human Genomic DNA were prepared by applying the previously obtained human leukocytes to Saito-Miura methodology (supra).

On the other hand, the controls were prepared by applying Escherichia coli K-12, JM109, which have plasmid pGEM-3Z (Promega) and was employed previously for cloning the probes, to the preparing method of the plasmid DNA to be referred to in the following Example 2 (1).

Then, with regard to the each sample, in accordance with Maniatis's manual (T. Maniatis, et al., “Molecular Cloning (A Laboratory Manual)”, Cold Spring Harbour Laboratory (1982)), overnight hybridization was performed, under the condition of 45% formamido (Merck), 5×SSC and 42° C., using DNA probes which were prepared from Helicobacter pylori and were labelled with Digoxigenin-11-dUTP (Boehringer Mannheim).

After the overnight hybridization, the samples were washed twice with 0.1×SSC, 0.1% SDS for 20 minutes at 55° C., then were color-developed and detected with Anti-Dig-ALP conjugates (Boehringer Mannheim), and hybridization-specificities thereon had been confirmed.

Experimental results on reactivities between each probe and DNAs from each clinically isolated strains are shown in FIG. 2 . Then, positional relation between well in the well-plate and samples (blotted strain DNAs) to be blotted thereto were shown in FIG. 1 . Namely, position numbers denoted in the schematic view of well-plate shown in FIG. 1 are corresponding to the sample (strain) numbers listed in Table 2.

Apparently from reaction results shown in FIG. 2 , all of the tested probes have reacted only with DNAs from Helicobacter pylori (Strains Nos. 1 and 2), but not reacted (not hybridized) with any DNA from strains belonged to Helicobacter genus except from Helicobacter pylori , accordingly, their specificities have been confirmed.

EXAMPLE 2

Analysis of Base Sequence

Base sequences of DNA probes (total 8 probes), species-specificities of which have been confirmed in Example 1, were sequenced according to the following method.

(1) Preparation of Plasmid DNA

Escherichia coli K-12, JM109 comprising pGEM-3Z (Promega) incorporated thereinto the subcloned insert fragments (to be sequenced) was inoculated in 5 ml Luria-Bactani Medium (bacto-tryptone, 10 g/1 L; bacto-yeast extract, 5 g/1 L; NaCl, 10 g/1 L; pH 7.0 adjusted with 5 N NaOH) and was cultivated overnight.

Culture liquid was centrifuged (5,000 rpm, 5 min.) and the bacteria were collected. 100 μl solution of 50 mM glucose/25 mM Tris-HCl (pH 8.0)/10 mM EDTA containing 2.5 mg/ml lysozyme (Sigma) was added to the precipitates, and they were left at room temperature for five minutes. 0.2 M NaOH solution containing 1% sodium dodecyl sulfate (Sigma) was added to the suspension so obtained, and they were mixed. 150 μl of 5 M pottasium acetate solution (pH 4.8) was further added thereto, then they were mixed and were cooled with ice for 15 minutes.

Mix solution of water and phenol/chloroform (CHCl 3 ) (volume ratio of water:phenol/chloroform=1:1) was added to equivalent volume of supernatant obtained through the centrifugation (15,000 rpm, 15 min.) of the cooled solution, and they were mixed. Double volume of ethanol was added to the supernatant obtained from such mixed solution, then they were mixed, and precipitates were obtained through further centrifugation (12,000 rpm, 5 min.). These precipitates were dissolved in 100 μl solution of 10 mM Tris-HCl (pH 7.5)/0.1 mM EDTA, then 10 mg/ml RNaseA (Sigma) solution were further added thereto, and they were left at room temperature for 15 minutes.

300 μl of 0.1 M sodium acetate solution (pH 4.8) was added to such preparation, then, equivalent volume of mix solution consisting of water and phenol/chloroform (CHCl 3 )(volume ratio of water:phenol/chloroform=1:1) was added thereto, and they were mixed. Double volume of ethanol was further added to the supernatant obtained from such mixed solution, and precipitates were obtained. DNA samples were prepared by drying these precipitates and dissolving them in 10 μl distilled water.

(2) Pretreatment for Sequencing

Pretreatment for sequencing was performed with AutoRead™ Sequencing Kit (Pharmasia).

Concentration of DNA for a template was adjusted to 5-10 μg in 32 μl solution. 32 μl of template DNA solution was transferred to 1.5 ml mini-tube (Eppendolf), then 8 μl of 2 M NaOH solution was added thereto, and they were mixed gently. After light centrifugation, they were left at room temperature for 10 minutes.

7 μl of 3 M sodium acetate (pH 4.8) and 4 μl distilled water were added thereto, then 120 μl ethanol was further added, and they were mixed and were left for 15 minutes on dry ice. DNAs precipitated through 15-minutes centrifugation were collected, and supernatants were removed carefully. The precipitates so obtained were washed with 70% ethanol and were centrifuged for 10 minutes. Then, the supernatants were removed carefully again and the precipitates were dried under the reduced pressure.

Precipitates were dissolved in 10 μl distilled water, then 2 μl fluorescent primer [Fluorescent Primer, M13 Universal Primer; 5′-Fluorescein-d[CGACGTTGTAAAACGACGGCCAGT (SEQ ID NO: 1 )]-3′ (1.6 pmol/μl; 0.42 A 260 unit/ml); M13 Reverse Primer, 5′-Fluorescein-d[CAGGAAACAGCTATG AC(SEQ ID NO: 2 )]-3′ (2.1 pmol/μl; 0.42 A 260 unit/ml)] (0.42 A 260 unit/ml, 4˜6 pmol) and 2 μl annealing buffer were added thereto, and they were mixed gently.

After light centrifugation, they were heated at 65° C. for 5 minutes, then were rapidly put under temperature of 37° C. and were kept the temperature for 10 minutes. Thereafter, they were left at room temperature for 10 minutes or more and were centrifuged lightly. Then, the samples were prepared by adding thereto 1 μl elongation buffer and 3 μl dimethyl sulfoxide.

Four mini-tubes have been marked with single symbol of “A”, “C”, “G” or “T”, and, according to the written symbol, 2.5 μl of A Mix (ddATP dissolved together with dATP, dCTP, dGTP and dTTP), C Mix (ddCTP dissolved together with dATP, dCTP, dGTP and dTTP), G Mix (ddGTP dissolved together with dATP, dCTP, dGTP and dTTP), or T Mix (ddTTP dissolved together with dATP, dCTP, dGTP and dTTP) were poured into each tube. Each solution was preserved in ice until the use, and the solution was heated at 37° C. for one minute or more when it is actually used.

2 μl diluted T7DNA polymerase (Pharmacia; 6-8 units/2 μl) was added to each DNA sample, and was completely mixed by pipetting or gently mixing them. Immediately after completing the mixing, 4.5 μl of each of these mix solution were poured into prewarmed those four mix-solution respectively. Fresh tips were used at the time of pouring of these mix solution.

The solution was warmed for five minutes at 37° C., then 5 μl of termination solution attached to the previously noted AutoRead™ Sequencing Kit (Pharmacia) were poured into each reaction-solution. Fresh tips were also used at this pouring procedure.

The solution was warmed for two to three minutes at 90° C., and was immediately cooled on ice. 4-6 μl/lane of the solution was applied to the electrophoresis.

(3) Sequencing on Base Sequence

Base sequences of probes disclosed in Example 1 specific for Helicobacter pylori were sequenced with A. L. F. DNA Sequencer System (Pharmacia) under an electrophoresis condition of 45° C. for 6 hours.

As a result thereof, base sequences of probe HP-32 (SEQ ID NO: 3 ), probe HP-34 (SEQ ID NO: 4 ), probe HP-49 (SEQ ID NO: 5 ), probe HP-55 (down) (SEQ ID NO: 6 ), probe HP-55 (up) (SEQ ID NO: 7 ), probe HP-60 (SEQ ID NO: 8 ), probe HP-64 (SEQ ID NO: 9 ) and probe SP-66 (SEQ ID NO: 10 ) were clarified respectively.

INDUSTRIAL APPLICABILITY

According to the probes of the present invention, Helicobacter pylori can be directly detected and can rapidly/exactly be identified without using any invasive-medical instrument and growing the bacteria. That is to say, according to the diagnosis using the present probes, the detection rate would remarkably be improved, and the bacteria can be identified with single specimen, thereby, necessary time for diagnosis will be reduced to about one to two day(s). Therefore, an effective therapy will be able to plan in the early stage of the diseases and can immediately start.

Then, since the base sequences of the present probes, which are specific for DNAs of Helicobacter pylori involved closely with the human digestive diseases, have been clarified, these probes are able to prepare artifically. Further, causative bacteria DNAs in the clinical specimen can amplify with PCR techniques employing primers prepared by making use of a part of the analyzed base sequences, as a result thereof, Helicobacter pylori will rapidly be detected and the present probes can therefore be practically utilized in the diagnosis.

Further, by comparing base sequences of Genomic DNAs in the clinical specimen with those analyzed by the present invention, the causative bacteria species of digestive diseases will rapidly be identified.

As stated above, according to the present invention, contemplated probes specific for Helicobacter pylori are provided, and excellent utilities thereof are also expected as a guide factor for preparing PCR primers and as a standard sequence suitable for the comparison with Genomic DNAs in the clinical specimen. The present invention may further offer an effect to provide valuable hints for preparing and developing the other useful probes, which are specific for DNAs of Helicobacter pylori which is the causative bacteria of the digestive diseases. Then, since the base sequences disclosed in the present application were obtained by random-cloning the Genomic DNAs of clinically isolated strains, utilities of the base sequences of the present invention shall be extended to the complementary strands thereof.

It is naturally understood that DNAs of the wild strains contain the mutated portion. But, apparently from the disclosure of the illustrative Examples above, such mutated portions would not affect the specificity of the present probes as well as any utility for the clinical utility thereof (e.g., use of which to design PCR primers).

10 1 24 DNA Artificial Sequence Description of Artificial Sequence Synthesized DNA 1cgacgttgta aaacgacggc cagt 24 2 17 DNA Artificial Sequence Description of Artificial Sequence Synthesized DNA 2caggaaacag ctatgac 17 3 1778 DNA Helicobacter pylori At position 1529, n = any nucleotide (g, a, c or t) 3aagcttctag taaagaaatc actctttttt gctgttccaa tagtgcgtct atcttggcac 60tcaaacgatt tattttactt tccatgcgtt caatactaac cactaaaaat aaatagctat 120ttaatcatta aaaatgatta ttttaatacc atgctcttaa attaagatgt gtttttatga 180tcatgctaca ataaaaacac aaaatgattt caaagaaaaa gggtttaaaa tgaaaacttt 240tgaagtaatg attcaaaccg attcaaaagg gtatttggac gctaaatttg gcggtacgct 300cctagagggt ttctcaatcc aaacggctta cccacttatt cgcctaaaat ctcatggcaa 360aaagtagaag gcgctcaaag ctatgcacta gaactcatcg atcatgacgc tcaaaaagtg 420tgtggcatgt cgtttgtcat tgggtcgtgg gcaatatttc ttataatgtt ttagaagaaa 480acgcttccat gatggataaa agaattgttc aaggggtcaa ttcgctcact caaggcttta 540tccgttcccc acttaatgaa agcgaaaaac aacgctccaa tctcaataac agcacctata 600tcggccccat gccccctaat ggcgatcacc attacttaat ccaagtgtat gccctagaca 660ttcctaaact cgccttaaaa gccccgtttt tcttaggcga tttgcatgac agaatgcgcg 720gacatatcat cgccataggg agaaaagaat ttttatacaa gcagtttgtg aggaaatagg 780ctactgcttg tagctattct ttcgctaaat tgaatttttg atacatctct aaaattctct 840tttcatctag catgctttct tcaatccttg tgcctatcaa atcggcatgg tgctttttaa 900aatcttttaa agggattaaa tcattatcaa caagagcgtt tcgcctcttt ttagctaaag 960ggaagtgcca ttgcacgagt tctttatcct taaatatggt gtttatcctt aagccttaaa 1020gttttataag catcaccatt atattgccaa atttcaaaag gctcacaatc gttataaaat 1080aaccaatgat ctccccatgc gtctaaaaat ccaaaatccc catcattacg cataaacacc 1140tcaaaatctt gcaccacaaa attaatacgc gaatacatca caacctcttt aatgctctta 1200gggatataaa aactttcata aagtttttta gcgtcataaa tatgatcaca atcaattttg 1260ataacccact catttttagg gataaaagaa agcgtataat tatagtaatg atagagttgg 1320tgccacaaac tcgggcaatc ctttagtatg acttcataag gatagctgat agggataaat 1380gaggggaact ttttacaaaa ctctaaaatc acttctttag agccatcatc gcaatcatta 1440aaaccaatga cccccctttg aatggcagga agcatagaaa acaaactctc ttctaaagta 1500acgatttcat ttttgactct aataaaagnc catgggttta gagggctttt agggttttga 1560cttttttatc atagtcaaaa taacctgaat gcgtgggatt gggtagagtt aaagtgggat 1620ggataaccct atcttctaaa tgcccccccc ccccccataa ttataattaa gagaactatt 1680tttataaata ctcttattgc gttcaatgaa actttcatta tttaaagaag cgatagccaa 1740aaacacgctt tcttgatggt catggttgaa taaagctt 1778 4 1426 DNA Helicobacter pylori 4aagctttacc tctaatagcg ttttaaactt ttttgtggtt ttgtctttca tcacgatagg 60gctagttttt ttctttttgc gttcccaacc cactagcgtg gtctctaaag aaaatattcc 120taaaattgaa ttagaaaatt ttaaagcgtt tcaaatcaac gataaaatcc ttgatctgtc 180catagagggc aaaaaagctc tacaatacga tgatcatgag atcttttttg attccaaaat 240caagcgttat gatgaagaca cgatagaaag cgttgaatcc cctaaagcca aacggcagca 300ggatttgtat ttcttcccta atggggtaac ttataaaaga agcgatgatt ctagtttttg 360gagtgaaaca gggatttaca accataagga gcaaaatttt aaaggcaagg gccgtttcat 420tctcactcaa aggacagcaa ggttgaaggg cttgacattt cttattcgca tgctttagcc 480attattgaag cccaaagcat tcaagctaat ttattcttag atgaaatcaa acaaagccag 540aaagaaaaga aaaaattccc cactttcaaa ggaggggttt taatgcgttg gtggtgtgtt 600cttgtgtgtt gttttggaat tttaagcgtg atgaacgctc aaaaaacaga caataaaggt 660ttgaaaaaag aaagagaaac ttttagaaat taccggcaac aaattcgtag cgaacgacaa 720aacaaaaacc gccgttattc aaggcaatgt gcagatcaaa aaaggtaaag accggttgtt 780tgcggataag gtgagcgtgt ttttaaacga taaacgaaag ccagagcgct atgaagccac 840agggaacacg cattttaaca tctttacaga ggataatcgt gaaatcagcg ggagtgctga 900caagctcatt tataacgcac tgaatgggga atacaaatta ttgcaaaatg cggtggttag 960agaagtgggg aaatctaatg ttattaccgg tgatgagatc attttaaaca aagctaaggg 1020ttatgctgat gtgttgggga gcacgaaacg gcccgctaaa tttgtgtttg atatggaaga 1080cattaatgaa gaaaatcgta aggccaaatt gaagaagaaa ggcgctaagg aaaaaccatg 1140atcgctatta aagacgctca ttttctcact tcttctagcc aactttcgca atgccctgcg 1200agcttgactt ctgaaatggt cattttaggg cgcagcaatg tcggtaaaag ctcgtttatt 1260aataccttgt taggaaaaaa tctcgctaaa agttcagcaa cgcctggaaa aacccgttta 1320gtgaattttt tttccaccac ttgggaagat aaagaaaacg ccttaagggc cacttttaat 1380gtgattgatt tgcctgggtt tgctacgcta aagtttctaa aagctt 1426 5 723 DNA Helicobacter pylori 5aagctttgcc aactttacca acacaacaaa gatttagtag caagtatatg attttggtca 60aatcaaatga gttatactat gcaataggta gtgctattaa tcaagattta agctcttctc 120ctatcttcaa aacaaatgtt tccccaaaca aattgatgct gtataaaaat ggaaaaattt 180catctatgat caaaggagaa aaagggtttg ggggtcatga aggttctgag atagtagatg 240ctactgagct agctacagga tttatgaacc acattgtccc tattcttagt tataaactag 300attgtccata ttcttaatta taaactagcg gaaatctatt atgaagcata tgtcgaaact 360aatcgtcttt taacgaaaat caaaggctac tcgcacaaca aaacactttt gttacccaac 420aaattaatgc cttaaaagct aaaactaaat ttctccaaaa agtttataag gatatttctc 480aaatttctaa aagtgatgtt ttgatacaat caacatgcac aaatttacaa agaatacgca 540ttgaactaga tgaaattttt tataatttta tatcccaaat aaatcaagga ctaatggtaa 600aaaactttaa tgatgtaagt ggtaactaca tttgtgcaag atacgctctt tctcattata 660tttttgcgtt ggttttagaa tatgttgttg caggactcat tgataatgag agcatggaag 720ctt 723 6 339 DNA Helicobacter pylori 6aagcttttgc ctggcacggc tatgcctaga gtggggttga gcgaacaggc tcaaaaacaa 60gtcatcgcat atttggaaaa agcgggcgat aggaaaaaac atgaaaggaa caccttaggg 120ataaaaatca tgattttctt tgcggtgctg tcgttcttgg cttatgcgtg gaaaagaaag 180gtttggagcg aagtgcattg aattaaaaaa agggggaggg catggtttta tgatttttga 240tctatggtgg ggtgtttgaa tggcgttttc aaaacaacct ttattttagg attttattat 300tactaatacc cctataagga ttttatggct acaaagctt 339 7 925 DNA Helicobacter pylori 7aagcttgaaa tattaatgct tcaaatgagt ttggtttaat ctttaattaa agaaaaagtc 60atcaaactag cccaaacatt aggaatcaac atgatcattg gcgggcctcc ctgtcaaggc 120ttttctaata aagggaaaaa tttagggcta aaagactcta ggaatttttt atttttagaa 180tatatagaga tagtaaaagc cttaaaacca gaaattttta tcattaaaaa catgaaaaac 240ctcatctctt gcgctaaagg ctatttttta gaagaaatta aagaaagatt gaacgcttta 300gggtatcaat taagctatca aatcctaaat gctaaagatt atggcgtgcc tcaaaacaga 360gagagggcct ttattgtggg ggctagtcgt tttagttttg atttcaatct tttagagcct 420tctcaaagcg tgaatgttca ggatgcgata agcgatttag cctatcttgt tctaatgagg 480gggcgtttga aagcgattat ttaaacccta tccaatcaag ctatcaagcc ttgatgcgaa 540aagatagccc taaattatac aaccatcaag ccaccaacca ctcgcaagcc gctttagaga 600aattaaagct cattaacaaa gagcaaggca aagaatgctt gcctaaaaac ttgcatggca 660aacagcaatt caaaagcaca tgggggcgtt tgaattggaa taaaatcagc cccaccatag 720acacacgatt tgacactcca agtaatggca ccaactccca ccctgaattg caccgctcta 780tcacgcccag agaagccgct aggatacaaa gttttagcga taattatatc ttttatggca 840ataaaacgag cgtttgcaag caaatcggta acgctgtgcc ccctcttcta gccctagctt 900taggcaaagc gatcttaaaa agctt 925 8 2393 DNA Helicobacter pylori 8aagcttgaag gtgcgttaaa atgaaaatct ctttatttgg gcatggcaaa accactctag 60ccttagggcg tttttttaga aaaaaccata acgaagtcaa attttttgac gaccaattca 120ctgcatcttt taaagatagc gagggttttg tttgctatcc cagtaaggat ttcaacccta 180atgattccca actagagata gtcagccctg gcattagctt cacgcaccct ttagtcataa 240aagccaagca tttagtgagc gaatacgatt atattgatag cttgtttgat ttggttttca 300cgcctactat aataagtatt agcggcacta atggtaaaac caccacgaca gaaatgctca 360ccatgctttt agaagatttt aaggctgtga atggggggaa tatcggcacg cccttgattg 420aattgtttga aaaacaatcg cccttgtggg tgttagaaac aagctccttt tctttgcatt 480acactaataa ggcttaccct ttaatctact tgctcatcaa tgtggaagct gatcatttga 540cttggcattg caattttgaa aattatttga acgctaaact caaggtttta acattgatgc 600ctaaaacttc actcgctatc ctccctttaa aattcaaaga acattcaagc gttcaaaatt 660cgcaagcgca aaaaatcttt tttgacaaaa gcgaagaggt tttagagcgt ttaaaaatcc 720cttctaacgc cctttttttt aaaggagcgt ttttattaga cgctgcatta gcccttttag 780tttacgagca atttttaaaa ataaagaatt taaaatggca agattataga gaaaacgccc 840ttaaaagact gaacgctttt aaaatcggct cgcataaaat ggaagaattt agggataaac 900aagggcgttt gtgggtagat gacagcaaag ccacaaacat tgatgccacc ttgcaagccc 960taaaaacctt taaaaaccaa aaaatccatt tgattttagg gggcgatatt aaaggggtca 1020atttaacccc cctttttgaa gaatttaaaa atcatgaaat aagcctttat gccataggat 1080caagcgcttt tattatccaa tccttagcat tagaatttaa tgtttcttgt caggtttgtt 1140tggagttaga aaaagcggtt caagaaatta aaagcgtttt atcgcaaaat gaaattgctt 1200tgctttcacc cagcgcagcc agtttggatc aattttcttc gtataaagaa aggggtgaaa 1260gatttaaagc gtttgtttta aaagattaaa gcacatgcac cacttggtct aattgtgaaa 1320ttttttgaaa aatctcgttc cgttcttctt catttgaaac ttccatagaa acattaaagc 1380tataaaattt agcgttttta gaagtgtttt ttaattccaa tttaaagggg cgttggtagg 1440tttctaaaag ctcttttaac acgcttgtat ctttagtagt cataatcacc ctataatccc 1500aaagacaagg gtaaataata gtgggttttc ctgaatcaga tggcattgaa cagctcctta 1560aacactttag gaatggcaat agggctgtat gtagagcgat tgacaaagcc aaacttgatt 1620tctgaagcaa agaccttaaa aggcttcata ggctctaaag aagcgttttg gatgcaataa 1680atttcttgaa aaagcaccac aaaaaccttt cttaattctt taatttgcgt tcttatttct 1740aagacctgcc caaggcttgc gggggtgaaa aaatccgctt tgatagagcg gataacaaac 1800acgccttctt cattttctgg caagacattt tgtttaaaaa aaaactcgct cctagccctt 1860tcgcaatatt tcaaataatt cgcatgatag accacgcctt cagagtcggt atcttcgtaa 1920tataccctac agcgcattga ttccccttac tcaaataatg aaattttctt gaaattatac 1980aactatgtaa cttaactata gtataatcta ggggcgttgc ttatattttt taggtatttt 2040taaagtggtt tttgtggttt ttttcttaaa tcttaagatc tttaaagatt ttagaaaact 2100aatacagcaa tagttggacg attaaagaca ttgctcttta attttaatca tttataagga 2160gtttggtagt taagatatgg gtaatcattt ttctaaatta ggatttgttt tagccgcatt 2220aggaagcgcg ataggtttag ggcatatctg gcgattcccc tatatgaccg gggtgagtgg 2280tgggggtgct tttgttttat tgtttttatt tttatcttta agcgttggcg cggcgatgtt 2340tatcgctgaa atgctattag gacaaagcac gcaaaaaaat gtaacagaag ctt 2393 9 926 DNA Helicobacter pylori 9aagctttagt gcgagattcc aatttgattt ctgctaaagc ccaagcggtg cctattgttt 60tgcaattgca tgcgctatac aatgaagaaa acaattacac gcaatacctt ttaagcgtga 120tgctgccttg catgtggctt attttgattg cgattggcat gctcaatttc attcaaaaag 180cctctaacat gcacgagctt ttaatcagta ttttagcgaa tatgtgcgtg tttagttttt 240gggggatggg catggcgttt tattttaatc tcattggcat ggagggacat tatgcgcatt 300tgtcattggt ctttttggcg gtcgttttaa tggcgctcat tatgagcggg tttgtggtgt 360tggtttatgg cgtttcaaaa agcgttattg aaaccgctgg cgcaattggg gtctataccg 420ctccaagttt tgcgtttgct ggggttactt acccgcaaaa taacatggaa atttttggga 480gtttttggag ccattgcttg cctattagcc attttatgaa gttcttttta caagaggcct 540attataagac ggattttaca gagtctttaa attctctaat gccgcttgcg ttctttttaa 600tctttttagt cttagggctt ttgatttttt atttttcttt taaaaaaggc aaggctagcg 660catgaatttt tttaaaatcc ttttaatgga gttaagggct attgtttctc ataagggcgt 720tttgttaatc cttataggcg cgcctttaat ctatggctta ttataccctt tgccttattt 780aaaagacatc gtaacgcagc aaaaaatcgc cccttgtaga tgaagacaat tcctttcttt 840ccaggcaatt agccttcatg gtgcaaagct ccaacgagtt agaaatcgct ttttttagcc 900cctctatgct ggaagccaaa aagctt 926 10 1219 DNA Helicobacter pylori 10aagcttatgg ggtttatgaa agcagctatt tgcaagaagt ccctagagat caatttgaag 60gcattgaatt ggaaaaaggc atgagcgttt ttgggcaaac tgaagaccac aaaaccattc 120aagccactat caaagacttt agcagcacgc atgtgatggt ggattataac catccgttag 180ccgggaaaac tttagcgttt cgtttcaagg ttttgggctt tagggaagtg agcgaagaag 240aaattttagc ttcacaccat ggcggtggga caggttgctg tggcggtcat gggggtcatg 300gcggaaagaa aggtgggggc tgtggttgct catgttcgca tgggtagtag ggtataggag 360catttaaaag gcaaggtcat gaatagttct aatctcaaaa attggctgtt ccctaccatt 420tgcttttttt tgttttgtta tattttaatt tttttgatgt tttttatgtt taaaagtttg 480caatcgcaat cttttggctc tgtggcagaa accggaaaaa aacccatcac caccaccaag 540aaatttggta aggaattgca aaaacagatt tcaaagatcc attaactttt tttctttttt 600gccgatactt gccgtaatgg aatgaatatc aaattaaagg attttacaat gatcaatgcc 660gtttcttctc tttctccggt gcaatctgtg gggaattaca agcgtgtgga aaagaatgaa 720aaagttgaaa atagcgaggc cgctcttgat agggtggctg aaatcaagca agctattgaa 780aacaaccagt ataaaatcaa cttgcatgag acttctcaca aaatggcaca ggatttattg 840gggataggct aagggtttta agggcttcat ttctaggggg ggttattctt gctgtcgttt 900tgtttttcat taaattttag tttctttatg ttttgagttt tttgctctct taaatagggc 960gtgtttttgt tgcgtgttag gaatgattga ttgggaattt taacttttat ggatttttgt 1020tctggtattg gtggaggccg tttgggcttg gagcaatgcc atttaaaatg cgtagggcat 1080gcagaaatca atcatgaagc cattagaact tatggattat tttttaaaga tacccataat 1140tttggggatt tgatgcgaat caaccctaat gatttacccg attttgatgc gctcattagc 1200gggtttcctt gtcaagctt 1219

Claims

1. An isolated and purified probe consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOS:3 through 10, wherein said probe specifically hybridizes with the DNA of Helicobacter pylori.