The invention comprises a process for the bioconversion of a fermentable carbon source to n-butanol at high yield by a metabolically engineered microorganism.
n-Butanol is a colorless, neutral liquid of medium volatility with restricted miscibility (about 7-8%) in water, but freely miscible with all common solvents such as glycols, ketones, alcohol, aldehydes, ethers, and aromatic and aliphatic hydrocarbons. n-Butanol is used i) to make other chemicals, ii) as a solvent and iii) as an ingredient in formulated products such as cosmetics. The major uses of n-butanol as a feed-stock are in the synthesis of acrylate/methacrylate esters, glycol ethers, n-Butyl acetate, amino resins and n-Butylamines. Currently more than 9 millions tons of n-Butanol are consumed annually in the world.
More recently it has been shown that n-butanol is a better bio fuel than ethanol due to lower vapour pressure, higher energy content (closer to that of gasoline) and lesser susceptibility to separation in the presence of water. Furthermore, n-butanol can be blended at higher concentrations than ethanol for use in standard vehicle engines and it does not require automakers to compromise on performance to meet environmental regulations; it is also suitable for transport in pipelines and as a result it has the potential to be introduced into gasoline quickly and avoid the need for additional large-scale supply infrastructures.
n-butanol can be produced as an acetone/n-butanol/ethanol (ABE) mixture by the fermentation of carbohydrate by solventogenic Clostridia. The ABE fermentations are biphasic. During the first acidogenic phase, high growth rate is accompanied by acetic and butyric acids production. In the second solventogenic phase growth rate decrease and the solvents (ABE) are produced with the concomitant consumption of the organic acids produced in the first phase. Carbon dioxide and hydrogen are produced throughout the fermentation.
The biological production of n-butanol, presented in
Clostridium acetobutylicum strains with an inactivated buk gene (obtained by single crossing over with a non-replicable plasmid) have already been described in the article (Green et al., 1996). The non-replicable vector pJC4BK, with a 0.8 kb internal buk fragment was integrated into the chromosomal buk gene which leaded to an inactivation of the endogenous gene. The obtained strain was named “mutant PJC4BK” from the name of the plasmid. As precised in this article, this gene integration did not completely eliminate enzyme activity nor butyrate formation due to the instability of this type of gene inactivation that can reverse to wild type by plasmid excision. This mutant strain was then used in several studies (Green and Bennett, 1998; Desai and Harris, 1999; Harris et al., 2000).
Traditionally, the commercial ABE fermentation was conducted only in a batch mode due to continuous cultures instability of the producing Clostridia. Several solvent yielding fermentation processes have been described. These processes yield n-butanol, acetone and ethanol in a ratio of 6:3:1. Solvent yields of 29-34% (18-25% for n-butanol only) of fermentable carbon source have been reported in the literature. A total solvent concentration of 16-24 g/l and a n-butanol concentration of 10-14 g/l is generally the limit due to toxicity of n-butanol produced. However, these low titers of solvent no longer seem to be an economical limitation to the process as it has recently been demonstrated that solvents can be recovered during fermentation by the use of the “low cost” gas striping technology.
The problem to be solved by the present invention is to obtain a stable mutant strain with no butyrate kinase activity, that could be cultureD for several generations without any possibility of reversion to the wild type genotype. This strain would be useful for the biological production of n-butanol at high yield, from an inexpensive carbon substrate such as glucose or other sugars, by genetically stable cultures of Clostridia. The number of biochemical steps to inactivate and the complexity of the regulation of the metabolism necessitate, for an industrial feasible process of n-butanol production, the use of a metabolically engineered whole cell catalyst.
Applicants have solved the stated problem and the present invention provides a method for bioconverting a fermentable carbon source to n-butanol as a major product by genetically stable cultures of Clostridia. Glucose is used as a model substrate and recombinant Clostridium acetobutylicum is used as the model host. In one aspect of this invention, a stable recombinant C. acetobutylicum unable to metabolize butyryl-CoA to butyrate is constructed by deleting the gene coding for the butyrate kinase (buk). In another aspect of this invention, a recombinant C. acetobutylicum unable to produce acetone is constructed by deleting the genes coding for the CoA-transferase (ctfAB). In a further aspect of this invention a recombinant strain unable to produce lactate is constructed by deleting the gene coding for the lactate dehydrogenase (ldh). Furthermore, a recombinant C. acetobutylicum unable to produce acetate is constructed by deleting the genes coding for the phosphotransacetylase and/or acetate kinase (pta and ack). In a final aspect of this invention, the flux of hydrogen production is decreased and then the flux of reducing equivalent redirected toward n-butanol production by attenuating the gene encoding the hydrogenase (hydA).
The present invention may be generally applied to include any carbon substrate that is readily converted to acetyl-coA.
Accordingly it is an object of the present invention to provide a recombinant organism, useful for the production of n-butanol comprising: (a) at least deletion of one of the two genes involved in the conversion of butyryl-CoA to butyrate and (b) at least deletion of one of the two genes encoding the CoA-transferase activity. Optionally the recombinant organism may comprise i) inactivating mutations in endogenous genes selected from the group consisting of: (a) a gene encoding a polypeptide having lactate dehydrogenase activity (b) a gene encoding a polypeptide having phospho-transacetylase or actate kinase activity and ii) attenuation in a gene encoding a polypeptide having hydrogenase activity.
In another embodiment the invention provides a stable process for the production of n-butanol at high yield from a recombinant organism comprising: (a) contacting the recombinant organism of the present invention with at least one carbon source selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and single-carbon substrates whereby n-butanol is produced; optionally (b) recovering the n-butanol during the production through a step of gas striping and (c) purifying n-butanol from the condensate by distillation.
The accompanying drawing which is incorporated in and constitutes a part of this specification exemplifies the invention and together with the description, serve to explain the principles of this invention.
1: Pyruvate-ferredoxin oxydoreductase; 2: Thiolase; 3: β-Hydroxybutyryl-CoA dehydrogenase; 4: Crotonase; 5: Butyryl-CoA dehydrogenase; 6: Lactate dehydrogenase; 7: Phospho-transacetylase; 8: Acetate kinase; 9: Acetaldehyde deshydrogenase; 10: Ethanol dehydrogenase; 11: CoA transférase (Acetoacetyl-CoA:acetate/butyrate:CoA transferase); 12: Acetoacetate decarboxylase; 13: Phospho-transbutyrylase; 14: Butyrate kinase; 15: Butyraldehyde-Butanol dehydrogenase; 16: hydrogenase.
As used herein the following terms may be used for interpretation of the claims and specification.
The term “microorganism” refers to all kind of unicellular organisms, including prokaryotic organisms like bacteria, and eukaryotic organisms like yeasts.
The expression “appropriate culture medium” refers to a culture medium adapted for the used microorganism as it is well known by the man skilled in the art.
The term “carbon substrate” or “source of carbon” means any carbon source capable of being metabolized by a microorganism wherein the substrate contains at least one carbon atom. Authors refer particularly to renewable, inexpensive and fermentable carbon sources such as monosaccharides, oligosaccharides, polysaccharides, single-carbon substrates, and polyols such as glycerol. Single carbon substrate are defined as carbon molecules that contain only one carbon atom such as methanol.
Monosaccharides of the formula (CH2O)n are also called oses or “simple sugars”; monosaccharides include saccharose, fructose, glucose, galactose and mannose.
Other carbon sources comprising more than one monosaccharide are called disaccharides, trisaccharides, oligosaccharides and polysaccharides. Disaccharides include saccharose (sucrose), lactose and maltose. Starch and hemicellulose are polysaccharides, also known as “complex sugars”.
Therefore, the term “source of carbon” means any product cited above, and mixture thereof.
The term “attenuation” refers to a decreased expression of a gene or a decreased activity of the protein, product of the gene. The man skilled in the art knows numerous means to obtain this result, and for example:
The term “deleted gene” means that a substantial part of the coding sequences of said gene was removed. Preferably, at least 50% of the coding sequence was removed, and more preferably at least 80%.
In the description of the present invention, enzymes are identified by their specific activities. This definition thus includes all polypeptides that have the defined specific activity also present in other organisms, more particularly in other microorganisms. Often enzymes with similar activities can be identified by their grouping to certain families defined as PFAM or COG.
PFAM (protein families database of alignments and hidden Markov models; http://www.sanger.ac.uk/Software/Pfam/) represents a large collection of protein sequence alignments. Each PFAM makes it possible to visualize multiple alignments, see protein domains, evaluate distribution among organisms, gain access to other databases, and visualize known protein structures.
COGs (clusters of orthologous groups of proteins; http://www.ncbi.nlm.nih.gov/COG/) are obtained by comparing protein sequences from 43 fully sequenced genomes representing 30 major phylogenic lines. Each COG is defined from at least three lines, which permits the identification of former conserved domains.
The means of identifying homologous sequences and their percentage homologies are well known to those skilled in the art, and include in particular the BLAST programs, which can be used from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that website. The sequences obtained can then be exploited (e.g., aligned) using, for example, the programs CLUSTALW (http://www.ebi.ac.uk/clustalw/) or MULTALIN (http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl), with the default parameters indicated on those websites.
Using the references given on GenBank for known genes, those skilled in the art are able to determine the equivalent genes in other organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. This routine work is advantageously done using consensus sequences that can be determined by carrying out sequence alignments with genes derived from other microorganisms, and designing degenerate probes to clone the corresponding gene in another organism. These routine methods of molecular biology are well known to those skilled in the art, and are described, for example, in Sambrook et al. (Molecular Cloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1989.).
The present invention provides a method for the fermentative batch or continuous production of n-butanol by culturing a microorganism in an appropriate culture medium comprising a carbon source and the simultaneous recovery of n-butanol from the culture medium wherein at least one gene involved in butyrate formation is deleted in the microorganism.
A specific embodiment of the invention provides a method wherein the microorganism is modified to be unable to convert butyryl-CoA to butyrate due to the deletion of at least one gene encoding for phospho-transbutyrylase (ptb) or butyrate kinase (buk). Deletion of genes in Clostridia can be done using the method recently described in patent application PCT/EP2006/066997 allowing the i) replacement of the gene to delete with an erythromycin resistance gene and ii) removal of the erythromycin resistance gene with a recombinase.
In another embodiment of the invention, the microorganism is unable to produce acetone due to an attenuation or a deletion of at least one of the gene encoding for CoA-transferase (ctfAB) or acetoacetate decarboxylase (adc). Deletion of one of these genes can be done using the method recently described in patent application PCT/EP2006/066997.
In a further embodiment of the invention, the microorganism used in the method of the invention is unable to produce lactate. In particular this can be due to a deletion of the gene ldh encoding for lactate dehydrogenase. Deletion of ldh can be done using the method recently described in patent application PCT/EP2006/066997.
In another embodiment, the microorganism is modified in such a way to be unable to produce acetate. This result can be achieved by deletion of at least one of the genes encoding for phospho-transacetylase (pta) or acetate kinase (ack). Deletion of one of these genes can be done using the method recently described in patent application PCT/EP2006/066997.
An embodiment of the invention also provides a microorganism with a decreased flux of hydrogen production and then a redirection of the flux of reducing equivalent toward n-butanol production; this can be done by attenuating the gene encoding the hydrogenase (hydA), an enzyme that provides a sink for reducing equivalent in the form of hydrogen production. Attenuation of hydA can be done by replacing the natural promoter by a low strength promoter or by element destabilizing the corresponding messenger RNA or the protein. If needed, complete attenuation of the gene can also be achieved by a deletion of the corresponding DNA sequence.
Preferably, the used microorganism is selected among the group consisting of C. acetobutylicum, C. beijerinckii, C. saccharoperbutylacetonicum or C. saccharobutylicum.
In another embodiment of the invention, the culture is continuous and stable.
In another embodiment, the method according to the invention comprises the following steps:
Those skilled in the art are able to define the culture conditions for the microorganisms according to the invention. In particular the clostridia are fermented at a temperature between 20° C. and 55° C., preferentially between 25° C. and 40° C., and more specifically about 35° C. for C. acetobutylicum.
The fermentation is generally conducted in fermentors with an inorganic culture medium of known defined composition adapted to the bacteria used, containing at least one simple carbon source, and if necessary a co-substrate necessary for the production of the metabolite.
The invention is also related to the microorganism as described previously. Preferably, this microorganism is selected among the group consisting of C. acetobutylicum, C. beijerinckii, C. saccharoperbutylacetonicum or C. saccharobutylicum.
To delete the buk gene, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the gene concerned. The buk deletion cassette in pCons::upp was constructed as follows.
gaccagtg
gtaatctatacatgttaacattcctcca
c
cacttgcagaaggtggac
tgccccccc
Two DNA fragments surrounding buk were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers BUK 1-BUK 2 and BUK 3-BUK 4, two DNA fragments were respectively obtained. Both primers BUK 1 and BUK 4 introduce a BamHI site while primers BUK 2 and BUK 3 have a complementary region which introduces a NruI site. DNA fragments BUK 1-BUK 2 and BUK 3-BUK 4 were joined in a PCR fusion experiment with primers BUK 1 and BUK 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO:buk. At the unique StuI site of pTOPO:buk, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the StuI fragment of pUC18-FRT-MLS2. The BUK deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPΔBUK::upp plasmid.
The pREPΔBUK::upp plasmid was used to transform by electroporation C. acetobutylicum MGCΔcac15Δupp strain. After selection on Petri plate for clones resistant to erythromycin (40 μg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 μg/ml and 100 μl of undiluted culture was plated on RCA with erythromycin at 40 μg/ml and 5-FU at 400 μM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers BUK 0 and BUK 5 located outside of the buk deletion cassette). The Δcac15ΔuppΔbuk::mlsR strain which have lost pREPΔbuk::upp was isolated.
The Δcac15ΔuppΔbuk::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 μg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 μg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 μg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers BUK 0 and BUK 5. Two successive 24 hours cultures of the Δcac15ΔuppΔbuk strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The Δcac15ΔuppΔbuk strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
To delete the ctfAB genes, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the genes concerned. The ctfAB deletion cassette in pCons::upp was constructed as follows.
ttaggtggtacccc
aagtagttgaaatatgaaggtttaaggt
tg
tgaacttagacccatggctg
aaataaataggactagaggcg
Two DNA fragments surrounding ctfAB were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers CTF 1-CTF 2 and CTF 3-CTF 4, two DNA fragments were respectively obtained. Both primers CTF 1 and CTF 4 introduce a BamHI site while primers CTF 2 and CTF 3 have a complementary region which introduces a StuI site. DNA fragments CTF 1-CTF 2 and CTF 3-CTF 4 were joined in a PCR fusion experiment with primers CTF 1 and CTF 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO:CTF. At the unique StuI site of pTOPO:CTF, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the StuI fragment of pUC18-FRT-MLS2. The UPP deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPΔCTF::upp plasmid.
The pREPΔCTF::upp plasmid was used to transform by electroporation C. acetobutylicum MGCΔcac15ΔuppΔbuk strain. After selection on Petri plate for clones resistant to erythromycin (40 μg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 μg/ml and 100 μA of undiluted culture was plated on RCA with erythromycin at 40 μg/ml and 5-FU at 400 μM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers CTF 0 and CTF 5 located outside of the ctfAB deletion cassette). The Δcac15ΔuppΔbuk ΔctfΔB::mlsR strain which have lost pREPΔCTF::upp was isolated.
The Δcac15ΔuppΔbukΔctfAB::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 μg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 μg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 μg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers CTF 0 and CTF 5. Two successive 24 hours cultures of the Δcac15ΔuppΔbukΔctfAB strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The Δcac15ΔuppΔbukΔctfAB strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
To delete the ldh gene, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the genes concerned. The ldh deletion cassette in pCons::upp was constructed as follows.
AAAAGGATCCGCTTTAAAATTTGGAAAGAGG
AAGTTGTG
Two DNA fragments surrounding ldh (CAC267) were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers LDH 1-LDH 2 and LDH 3-LDH 4, 1135 by and 1177 by DNA fragments were respectively obtained. Both primers LDH 1 and LDH 4 introduce a BamHI site while primers LDH 2 and LDH 3 have a complementary region which introduces a StuI site. DNA fragments LDH 1-LDH 2 and LDH 3-LDH 4 were joined in a PCR fusion experiment with primers LDH 1 and LDH 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO:LDH. At the unique StuI site of pTOPO:LDH, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the 1372 by StuI fragment of pUC18-FRT-MLS2. The UPP deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPΔLDH::upp plasmid.
The pREPΔLDH::upp plasmid was used to transform by electroporation C. acetobutylicum MGCΔcac15ΔuppΔbukΔctfAB strain. After selection on Petri plate for clones resistant to erythromycin (40 μg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 μg/ml and 100 μA of undiluted culture was plated on RCA with erythromycin at 40 μg/ml and 5-FU at 400 μM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers LDH 0 and LDH 5 located outside of the ldh deletion cassette). The Δcac15ΔuppΔbuk ΔctfAB Δldh::mlsR strain which have lost pREPΔLDH::upp was isolated.
The Δcac15ΔuppΔbukΔctfABΔldh::mlsR strain was transformed with pCLF 1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 μg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 μg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 μg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers LDH 0 and LDH 5. Two successive 24 hours cultures of the Δcac15ΔuppΔbukΔctfAB Δldh strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The Δcac15ΔuppΔbukΔctfABΔldh strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
To delete the pta and ack genes, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the genes concerned. The pta-ack deletion cassette in pCons::upp was constructed as follows.
cccaataaaatactggg
catttgtattttctcccttcataatg
cc
ttgcatgcttatataataaattatgg
ctgcg
caagatttaaagcc
Two DNA fragments surrounding pta-ack were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers PA 1-PA 2 and PA 3-PA 4, two DNA fragments were respectively obtained. Both primers PA 1 and PA 4 introduce a BamHI site while primers PA 2 and PA 3 have a complementary region which introduces a StuI site. DNA fragments PA 1-PA 2 and PA 3-PA 4 were joined in a PCR fusion experiment with primers PA 1 and PA 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO:PA. At the unique StuI site of pTOPO:PA, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the StuI fragment of pUC18-FRT-MLS2. The UPP deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPΔPA::upp plasmid. The pREPΔPA::upp plasmid was used to transform by electroporation C. acetobutylicum MGCΔcac15ΔuppΔbukΔctfABΔldh strain. After selection on Petri plate for clones resistant to erythromycin (40 μg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 μg/ml and 100 μl of undiluted culture was plated on RCA with erythromycin at 40 μg/ml and 5-FU at 400 μM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers PA 0 and PA 5 located outside of the pta-ack deletion cassette). The Δcac15ΔuppΔbuk ΔctfABΔldhΔpta-ack::mlsR strain which have lost pREPΔPA::upp was isolated.
The Δcac15ΔuppΔbukΔctfABΔldh Δpta-ack::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 μg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 μg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 μg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers PA 0 and PA 5. Two successive 24 hours cultures of the Δcac15ΔuppΔbukΔctfABΔldhΔpta-ack strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The Δcac15ΔuppΔbukΔctfABΔldhΔpta-ack strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
To delete the hydA gene, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the genes concerned. The hydA deletion cassette in pCons::upp was constructed as follow.
Two DNA fragments surrounding hydA (CACO28) were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers HYD 1-HYD 2 and HYD 3-HYD 4, 1269 by and 1317 by DNA fragments were respectively obtained. Both primers HYD 1 and HYD 4 introduce a BamHI site while primers HYD 2 and HYD 3 have a complementary region which introduces a StuI site. DNA fragments HYD 1-HYD 2 and HYD 3-HYD 4 were joined in a PCR fusion experiment with primers HYD 1 and HYD 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO:HYD. At the unique StuI site of pTOPO:HYD, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the 1372 by StuI fragment of pUC18-FRT-MLS2. The UPP deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPΔHYD::upp plasmid.
The pREPΔHYD::upp plasmid was used to transform by electroporation C. acetobutylicum MGCΔcac15ΔuppΔbukΔctfABΔldh strain. After selection on Petri plate for clones resistant to erythromycin (40 μg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 μg/ml and 100 μl of undiluted culture was plated on RCA with erythromycin at 40 μg/ml and 5-FU at 400 μM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers HYD 0 and HYD 5 located outside of the hydA deletion cassette). The Δcac15ΔuppΔbukΔctfABΔldhΔhydA::mlsR strain which have lost pREPΔHYD::upp was isolated.
The Δcac15ΔuppΔbukΔctfABΔldhΔhydA::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 μg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 μg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 μg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 μg/ml and RCA with thiamphenicol at 50 μg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers HYD 0 and HYD 5. Two successive 24 hours cultures of the Δcac15ΔuppΔbukΔctfABΔldhΔhydA strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The Δcac15ΔuppΔbukΔctfABΔldhΔhydA strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
Strains were initially analyzed in anaerobic flask cultures in the synthetic medium described by Soni et al (Soni et al, 1987, Appl. Microbiol. Biotechnol. 27:1-5) supplemented with 2.5 g/l of ammonium acetate. An overnight culture at 35° C. was used to inoculate a 30 ml culture to an OD600 of 0.05. After incubation of the culture for 3 days at 35° C., glucose, organic acids and solvents were analyzed by HPLC using a Biorad HPX 97H column for the separation and a refractometer for the detection.
Strains with the correct phenotype were subsequently tested under production conditions in 300 ml fermentors (DASGIP) using an anaerobic batch protocol.
For this purpose the fermentor was filled with 250 ml of synthetic medium, sparged with nitrogen for 30 min and inoculated with 25 ml of preculture to an optical density (OD600 nm) between 0.05 and 0.1.
The temperature of the culture was maintained constant at 35° C. and the pH was permanently adjusted at 5.5 using an NH4OH solution. The agitation rate was maintained at 300 rpm during the fermentation.
The best n-butanol producing strain was analyzed in chemostat cultures in the synthetic medium described by Soni et al (Soni et al, 1987, Appl. Microbiol. Biotechnol. 27:1-5). An overnight culture at 35° C. was used to inoculate a 300 ml fermentors (DASGIP) using an anaerobic chemostat protocol.
For this purpose the fermentor was filled with 250 ml of synthetic medium, sparged with nitrogen for 30 min and inoculated with 25 ml of preculture to an optical density (OD600 nm) between 0.05 and 0.1. After 12 hours of batch culture at 35° C., pH 5.5 (regulated using an NH4OH solution) and an agitation rate of 300 rpm, the fermentor was continuously fed with oxygen free synthetic medium at a dilution rate of 0.05 h-1 while the volume was kept constant by sequential removal of fermentated medium. Stability of the culture was followed by products analysis using the HPLC protocol previously described.
Production strains were evaluated in small flasks. 10% of thawed cultures (typically 3 ml) were used to inoculate 30 ml of synthetic medium (MSL4). A 15 minutes thermal shock at 80° C. was applied to kill any vegetative cells present before the initiation of growth. The cultures were then grown at 37° C. for 6 to 7 days. Extra-cellular compounds were quantified by HPLC using the following parameters: Eluent (H2SO4) concentration: 0.25 mM; Flow: 0.5 ml/min; Temperature: 25° C., Time: 50 minutes.
As can be seen in table 2, upon deletion of the gene coding for the butyrate kinase (buk) the maximum butyrate concentration detected in the medium decreases from 3.13 g/l after 2 days of culture in the C. acetobutylicum Δcac15 Δupp strain, to 0.43 g/l after 5 days of culture in the C. acetobutylicum Δcac15 Δupp Δbuk::MSLr strain. Notably, the alcohol/glucose yield (Ybu+Yet) increases significantly, whereas the acetone/glucose yield (Yac) decreases significantly.
C. acetobutylicum ATCC
C. acetobutylicum ATCC
Desai R P, Harris L M, Welker N E, Papoutsakis E T.
Metabolic flux analysis elucidates the importance of the acid-formation pathways in regulating solvent production by Clostridium acetobutylicum.
Metab Eng. 1999, 1:206-13.
Green E M, Bennett G N.
Genetic manipulation of acid and solvent formation in clostridium acetobutylicum ATCC 824
Biotechnol Bioeng. 1998, 58:215-21.
Green E M, Boynton Z L, Harris L M, Rudolph F B, Papoutsakis E T, Bennett G N.
Genetic manipulation of acid formation pathways by gene inactivation in Clostridium acetobutylicum ATCC 824.
Microbiology. 1996, 142 :2079-86.
Harris L M, Desai R P, Welker N E, Papoutsakis E T.
Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation mutant: need for new phenomenological models for solventogenesis and butanol inhibition?
Biotechnol Bioeng. 2000, 67:1-11.
Soni B. K., Soucaille P. Goma G.
Continuous acetone butanol fermentation: influence of vitamins on the metabolic activity of Clostridium acetobutylicum.
Appl. Microbiol. Biotechnol. 1987. 27 : 1-5.
Number | Date | Country | Kind |
---|---|---|---|
PCT/EP2006/067993 | Oct 2006 | EP | regional |
Number | Date | Country | |
---|---|---|---|
Parent | 12447726 | Jun 2009 | US |
Child | 14321173 | US |