The present invention is in the field of glycobiology and protein engineering. More specifically, the present invention relates to polysialylated polypeptides produced in plants and plant cells and to plants and plant cells capable to produce such polypeptides.
Recombinant proteins like monoclonal antibodies (mAbs), hormones, growth factors etc. hold great promise as therapeutic agents against a variety of diseases. However, the efficacy of protein drugs is often compromised by short in vivo half-lives. This limitation arises from susceptibility to proteolytic degradation, immunocomplex formation or clearance from the bloodstream. As a consequence, the efficacy of these drugs depends on frequent administration in large doses leading to high costs and serious side effects.
Efforts have been made to overcome these problems including the conjugation of polymers to the protein to improve the residence time and reduce the immunogenicity. One common modification is the attachment of polyethylene glycol (PEG) which affects the physicochemical features of the protein leading, for example, to improved solubility. While PEGylation of therapeutic proteins can increase the circulating half-life, PEG is not metabolized leading to accumulation in tissues and PEGylated proteins can elicit the formation of unwanted anti-PEG antibodies. Due to the concerns related to the use of PEGylated drugs alternative methods are explored to improve the pharmacokinetic properties of recombinant proteins. The attachment of glycan polymers like polysialic acid to proteins represents another approach to increase the half-life of therapeutic proteins. Polysialic acid has similar physicochemical properties like PEG. In contrast to the synthetic PEG, polysialic acid is naturally occurring in mammals on a small number of proteins, it is biodegradable and nonimmunogenic.
Polysialic acid is either chemically or enzymatically conjugated to amino acids of proteins or to glycans. Both methods require the separate production of the recombinant protein, the polysialic acid (for chemical conjugation) or the polysialyltransferase (for enzymatic conjugation). These in vitro processes are therefore technically challenging and expensive limiting the broadly use of polysialic acids for improving the therapeutic efficacy. Consequently, in vivo generation of polysialic acid on therapeutically relevant recombinant proteins can provide an advantage over existing technologies.
The polysialylation of polypeptides comprising a polysialylation domain or motif in plants and plant cells has been recently described by Kallolimath S et al. (PNAS 113(2016):9498-9503; doi:10.1073/pnas.1604371113). However, many proteins and polypeptides, in particular therapeutic polypeptides, lack a polysialylation domain or motif. Therefore, an object of the present invention is the provision of means and methods to polysialylate in vivo recombinant (glyco)proteins or polypeptides lacking a polysialylation domain or motif.
The present invention relates to a plant or plant cell being capable to produce polysialylated glycoproteins comprising at least one recombinant nucleic acid sequence operably linked to a promoter, said recombinant nucleic acid sequence encoding for a polypeptide lacking a polysialyltransferase binding motif and comprising at least one glycosylation site.
It was surprisingly found that plant cells which are able to produce polysialylated glycoproteins (see e.g. Kallolimath S et al. (PNAS 2016, doi:10.1073/pnas.1604371113) can be used to polysialylate polypeptides lacking a polysialyltransferase binding motif and comprising at least one glycosylation site. Such polypeptides are usually not polysialylated in mammalian cells which are known to comprise a polysialylation machinery to polysialylate proteins and polypeptides comprising a polysialyltransferase binding motif.
A further aspect of the present invention relates to a method for producing a polysialylated polypeptide comprising the step of cultivating a plant or plant cell as defined above.
The plants or plant cells of the present invention can be used to produce polysialylated polypeptides lacking a polysialyltransferase binding motif and comprising at least one glycosylation site.
Another aspect of the present invention relates to a polysialylated polypeptide obtainable by a method according to the present invention.
The present invention relates to a plant or plant cell being capable to produce polysialylated glycoproteins comprising at least one recombinant nucleic acid sequence operably linked to a promoter, said recombinant nucleic acid sequence encoding for a polypeptide lacking a polysialyltransferase binding motif and comprising at least one glycosylation site.
It was surprisingly found that a plant or plant cell being capable to produce polysialylated glycoproteins and comprising at least one recombinant nucleic acid sequence operably linked to a promoter, said recombinant nucleic acid sequence encoding for a polypeptide lacking a polysialyltransferase binding motif and comprising at least one glycosylation site, can be used to polysialylate said polypeptide.
A “plant or plant cell being capable to produce polysialylated glycoproteins”, as defined herein, refers to plants or parts thereof and plant cells which are able to polysialylate proteins and polypeptides typically comprising a polysialyltransferase binding motif/domain. Since plants and plant cells are known to not sialylate such proteins and polypeptides as plants lack mammalian-type sialic acids as shown for instance by Zeleny et al. (Planta 224(2006):222-227, doi:10.1007/s00425-005-0206-8) nucleic acid molecules encoding enzymes involved in the sialylation and polysialylation of proteins from other organisms, like mammalian or human cells or bacteria, have to be introduced in said plants and plant cells. Enzymes required may include enzymes involved in the biosynthesis of sialic acids and enzymes involved in the attachment of a sialic acid to a core sugar structure present on a protein or polypeptides and the formation of a sialic acid chain thereon. Such plants and plant cells are described, for instance, in Kallolimath S et al. (PNAS 2016, doi:10.1073/pnas.1604371113).
With the plants and plant cells of the present invention polysialylated glycoproteins can be produced which have, i.a., increased half-life time when administered to a mammal compared to a non-polysialylated glycoprotein. One of the major advantages of polysialic acid chains attached to proteins is that these chains are biodegradable and non-immunogenic whereas PEG does not have these advantages. With the present invention it is now possible to polysialylate proteins and glycoproteins which do not comprise a polysialyltransferase binding motif.
“Polysialylated glycoproteins” or “polysialylated proteins”, as used herein, refers to proteins and polypeptides comprising a sugar chain N-linked onto an asparagine residue of a protein or polypeptide. The polysialic acid chain is generated by stepwise transfer of alpha-linked sialic acid added onto a core carbohydrate sequence.
A “polysialic acid chain” or a “polysialic acid” (PSA), as used herein, refers to a glycan chain comprising at least two sialic acid molecules linked alpha-(2-8) and/or alpha-(2-9) to each other.
Polysialic acids (PSAs) are unbranched polymers of sialic acid produced by certain bacterial strains and in mammals in certain cells and on certain proteins. They can be produced in various degrees of polymerization from about 2 to about 400 or more sialic acid molecules. The polysialic acid chain attached to the polysialylated glycoprotein of the present invention comprises preferably sialic acid molecules of, e.g., about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 75, about 100, about 150, about 200, about 250, about 300, about 350 or about 400. According to another preferred embodiment of the present invention the polysialic acid chain comprises sialic acid molecules of, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350 or at least 400. According to a further embodiment of the present invention the polysialic acid chain disclosed herein comprises sialic acid molecules of, e.g., at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 15, at most 20, at most 25, at most 30, at most 35, at most 40, at most 45, at most 50, at most 75, at most 100, at most 150, at most 200, at most 250, at most 300, at most 350 or at most 400.
According to a preferred embodiment of the present invention the polysialic acid chain on the glycoprotein of the present invention comprises sialic acid molecules in the range of, e.g., about 2 to about 400, about 2 to about 350, about 2 to about 300, about 2 to about 250, about 2 to about 200, about 2 to about 150, about 2 to about 100, about 2 to about 75, about 2 to about 50, about 2 to about 40, about 2 to about 30, about 2 to about 25, about 2 to about 20, about 2 to about 15, about 2 to about 10, about 5 to about 400, about 5 to about 350, about 5 to about 300, about 5 to about 250, about 5 to about 200, about 5 to about 150, about 5 to about 100, about 5 to about 75, about 5 to about 50, about 5 to about 40, about 5 to about 30, about 5 to about 25, about 5 to about 20, about 5 to about 15, about 5 to about 10, about 10 to about 400, about 10 to about 350, about 10 to about 300, about 10 to about 250, about 10 to about 200, about 10 to about 150, about 10 to about 100, about 10 to about 75, about 10 to about 50, about 10 to about 40, about 10 to about 30, about 10 to about 25, about 10 to about 20, about 10 to about 15, about 50 to about 400, about 50 to about 350, about 50 to about 300, about 50 to about 250, about 50 to about 200, about 50 to about 150, about 50 to about 100, about 50 to about 75, about 100 to about 400, about 100 to about 350, about 100 to about 300, about 100 to about 250, about 100 to about 200, about 150 to about 400, about 150 to about 350, about 150 to about 300, about 150 to about 250, about 150 to about 200, about 200 to about 400, about 200 to about 350, about 200 to about 300 or about 200 to about 250.
The plant and plant cell of the present invention comprise at least one, preferably at least two, more preferably at least three, more preferably at least five, recombinant nucleic acid sequences/molecules which encode for a polypeptide lacking a polysialyltransferase binding motif/domain. In order to allow the biosynthesis of recombinant proteins and polypeptides within a cell the respective nucleic acid sequence has to be operably linked at least to a promoter.
“Recombinant”, as used herein, indicates that the cell replicates heterologous nucleic acid molecules or expresses a polypeptide or protein encoded by a heterologous nucleic acid. Recombinant nucleic acid sequences are not found within the native (non-recombinant) form of the cell or plant. A “recombinant polypeptide” is expressed by transcription of a recombinant nucleic acid sequence.
Expression of a polypeptide, as used herein, indicates stable transformation leading to integration of the transgene into the genome as well as transient expression using techniques like agroinfiltration. Respective methods and means to be used in these methods are well known to a person skilled in the art.
As used herein, “operably linked” refers to a functional linkage between a promoter and the nucleic acid molecule encoding the polypeptide of the present invention, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to said nucleic acid molecule.
The term “promoter”, as used herein, refers to a region of a nucleic acid molecule upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. Promoters are able to control (initiate) transcription in a cell. Plant promoters are able of initiating transcription in plant cells whether or not its origin is a plant cell. Such promoters include promoters obtained from plants, plant viruses and bacteria which comprise genes expressed in plant cells such Agrobacterium or Rhizobium. The promoter used in the vector of the present invention can be “inducible” or “repressible”, i.e. under environmental control. Such promoters can be controlled by changing the cultivation conditions (e.g. temperature) or by adding specific substances. Of course, the promoter used in the vectors of the present invention may be a “constitutive” promoter. Constitutive promoters are active under most environmental conditions and express continuously a protein or polypeptide of interest.
According to a preferred embodiment of the present invention the promoter is selected from the group consisting of promoters active in plants and plant cells, like the cauliflower mosaic virus 35S promoter, opine (octopine, nopaline, etc.) synthase promoters, actin promoter, ubiquitin promoter, etc.
In order to prevent transcriptional activation of down-stream nucleic acid sequences by upstream promoters the vector of the present invention may comprise a “terminator” or “terminator sequence”. According to a preferred embodiment of the present invention the vector comprises a terminator which is preferably a g7T terminator, a octopine synthase terminator, a manopine synthase terminator, a nopaline synthase or agropine synthase terminator.
“Polysialyltransferase”, as used herein, refers to enzymes that are able to produce polysialic acid chains, preferably homopolymers of alpha-2,8-linked sialic acid molecules, homopolymers of alpha-2,9-linked sialic acid molecules or co-polymers of alpha-2,8/alpha-2,9-linked sialic acid molecules on proteins and polypeptides acting as acceptor and using activated nucleotide sugars (uridine, guanosine and cytidine monophosphate derivatives of sugars (UMP, GMP and CMP, respectively) or diphosphate derivatives sugars (UDP, GDP and CDP, respectively)) as donors.
A polypeptide “lacking a polysialyltransferase binding motif” or “lacking a polysialyltransferase binding domain”, as used herein, refers to a polypeptide or protein which does not contain a polysialyltransferase binding motif or domain recognized by a polysialyltransferase in an animal cell, preferably a mammalian cell, known to produce polysialylated proteins. A polypeptide “lacking a polysialyltransferase binding motif” or “lacking a polysialyltransferase binding domain” can be simply identified by recombinantly expressing said polypeptide in an animal cell, preferably a mammalian cell, producing polysialylated proteins. If no polysialic acid chains are attached to said polypeptide, the polypeptide can be considered as “lacking a polysialyltransferase binding motif” or “lacking a polysialyltransferase binding domain”.
The mammalian polysialyltransferases are active on a limited number of glycoproteins including the neural cell adhesion molecule (NCAM), neuropilin-2, the CD-36 scavenger receptor, the alpha-subunit of the voltage-dependent sodium channel, the synaptic cell adhesion molecule (SynCAM1),the central chemokine receptor CCR7 and on themselves leading to autopolysialylation. Together with the inability of polysialyltransferases to act on free N-glycans, these findings indicate that polysialylation in mammalian cells is a protein-specific modification event requiring initial protein-protein interaction between a polysialyltransferase and its substrate glycoprotein. The first fibronectin type III repeat (FN1) of NCAM is required for binding polysialyltransferases and for polysialylation of N-glycans on the NCAM Ig5 immunoglobulin domain (Thompson et al., JBC 286(2011):4525-4535; DOI 10.1074/jbc.M110.200386). The NCAM FN1 domain represents a polysialyltransferase binding domain. Within this domain an acidic surface patch, an alpha-helix and the QVQ sequence play a role in polysialyltransferase recognition and positioning (Mendiratta et al., JBC 280(2005):32340-32348; DOI 10.1074/jbc.M506217200; Mendiratta et al., JBC 281(2006):36052-36059; DOI 10.1074/jbc.M608073200). A polybasic region within mammalian polysialyltransferases (residues 71-105 in ST8-Sia-IV and residues 86-120 in ST8-Sia-II) interacts with NCAM (Zapater et al., JBC 287(2012):6441-6453, DOI 10.1074/jbc.M111.322024).
The term “plant”, as used herein, encompasses plants at any stage of maturity or development, as well as any tissues or organs (“plant parts”) taken or derived from any such plant. Plant parts include, but are not limited to, plant cells, stems, roots, flowers, ovules, stamens, seeds, leaves, embryos, meristematic regions, callus tissue, anther cultures, gametophytes, sporophytes, pollen, microspores, protoplasts, hairy root cultures and/or the like. As used herein, a “plant cell” includes, but is not limited to, a protoplast, gamete producing cell, and a cell that regenerates into a whole plant. Tissue culture of various tissues of plants and regeneration of plants therefrom is well known in the art and is widely published.
According to a preferred embodiment of the present invention the plant or plant cell comprises at least one nucleic acid sequence encoding for at least one polysialyltransferase operably linked to at least one promoter.
Polysialyltransferases catalyze the formation of polysialic acid chains by linking sialic acid molecules to each other.
According to a further preferred embodiment of the present invention the at least one polysialyltransferase is a eukaryotic, preferably mammalian, more preferably human, polysialyltransferase or bacterial polysialyltransferase or a variant thereof.
A “variant” of a polysialyltransferase includes molecules having an amino acid sequence that has at least 60%, preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, amino acid sequence identity, preferably over a region of over a region of at least about 75, at least about 100, at least about 200 or at least about 300 amino acid residues, to an amino acid sequence encoded by a naturally occurring polysialyltransferase nucleic acid or to a naturally occurring amino acid sequence of a polysialyltransferase protein.
“Identity”, as used herein, refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using sequence comparison algorithms. It is particularly preferred to use BLAST and BLAST 2.0 algorithms (see e.g. Altschul et al. J. MoI. Biol. 215(1990): 403-410 and Altschul et al. Nucleic Acids Res. 25(1977): 3389-3402) using standard or default parameters. For amino acid sequences, the BLASTP program (see http://blast.ncbi.nlm.nih.gov/Blast.cgi) uses as defaults a wordlength (W) of 6, an expectation (E) of 10 and the BLOSUM62 scoring matrix (see Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89(1989):10915) using Gap Costs Existance:11 Extension:1.
According to a particular preferred embodiment of the present invention the plant or plant cell comprises at least one nucleic acid sequence encoding for a bacterial polysialyltransferase which enables the plant or plant cell to produce polysialic acids in the absence of any additional mammalian alpha2,3- or alpha2,6-sialyltransferases.
The at least one polysialyltransferase is preferably a alpha2,8-polysialyltransferase.
According to a preferred embodiment of the present invention the at least one polysialyltransferase is selected from the group consisting of ST8Sia-II (e.g. GenBank Acc. No. U33551), ST8Sia-IV (e.g. GenBank Acc. No. L41680) and variants thereof.
These mammalian enzymes are Golgi-resident type II membrane proteins composed of a short N-terminal cytoplasmic tail, a single transmembrane domain and a stem region linked to the large catalytic domain which faces the Golgi lumen. Variants include truncated variants of polysialyltransferases lacking N-terminal targeting and retention sequences. Other variants include, for example, mutations near a sialylmotif like the E141K substitution in ST8Sia-II that affects polysialyltransferase activity and results in shorter polysialic acid chains (Isomura et al., JBC 286(2011):21535-21545, DOI 10.1074/jbc.M111.221143).
According to a further preferred embodiment of the present invention a cytoplasmic transmembrane stem (CTS) region of the at least one polysialyltransferase is replaced by a heterologous CTS region, preferably by a plant CTS region.
Particularly preferred plant CTS regions to be used herein include a CTS region from betal,3-galactosyltransferases 1 (GALT1; Strasser et al., Plant Cell 19(2007):2278-2292; http://dx.doi.org/10.1105/tpc.107.052985), from beta 1,3-galactosyltransferase 3 (GALT3; e.g. Acc. No. At3g06440), from betal,2-xylosyltransferase (XylT), betal,2-N-acetylglucosaminyltransferase (GntII) or from plant fucosyltransferases (e.g. FUT11 to FUT13).
According to a further preferred embodiment of the present invention a cytoplasmic transmembrane stem (CTS) region of the at least one polysialyltransferase is replaced by a heterologous CTS region from a mammalian Golgi-resident glycosyltransferase, preferably by the CTS region from rat alpha 2,6-sialyltransferase (ST6), human alpha 2,6-sialyltransferase (ST6) or human alpha2,3-sialyltransferase (ST3).
The exchange of a naturally occurring CTS region of a protein or polypeptide with a CTS region of another polypeptide or protein allows to direct the enzymatic activity of the at least one polysialyltransferase to a specific compartment within a cell. This may have an influence on the polysialylation capability and capacity of the plant or plant cell so that the polysialylation efficiency can be increased.
As used herein, a “cytoplasmic transmembrane stem (CTS) region” and a “CTS region” or a “cytoplasmic transmembrane stem (CTS) domain” and a “CTS domain” comprises the cytoplasmic tail, transmembrane domain and stem region of Golgi-resided proteins and polypeptides (see e.g.
CTS regions of Golgi-resident proteins can be identified using methods well-known in the art, such as, for example, hydropathy plot analysis and sequence alignments with known CTS regions. A CTS region may consist of a substantial part of a CTS region, such as at least 50% or at least 60% or at least 70% or at least 80% or at least 90% of a CTS region. The CTS region/domain may consist of 1 to 100, preferably 5 to 90, more preferably 10 to 80, more preferably 15 to 70, more preferably 15 to 60, more preferably 20 to 50, more preferably 25 to 45, more preferably 30 to 40, amino acid residues located at the C- or N-terminus of a Golgi-resident protein or polypeptide.
The term “replaced by”, as used herein, means that the cytoplasmic transmembrane stem (CTS) region of a wild-type polysialyltransferase is at least partially, preferably entirely, exchanged by a heterologous CTS region, whereby “heterologous” means that the CTS region is not naturally occurring in said wild-type polysialyltransferase. Thus, also CTS regions or domains of a polysialyltransferase of another organism are considered as heterologous.
In addition to CTS regions from Golgi resident enzymes, the use of N-terminal membrane anchoring sequences for post-Golgi targeting and retention (e.g. to the Trans Golgi Network) or to other post-Golgi organelles may be beneficial and used to replace the CTS region from the polysialyltransferases.
According to a preferred embodiment of the present invention the plant or plant cell of the present invention may be able to express one or more bacterial polysialyltransferases. Bacterial polysialyltransferases do not contain any cytoplasmic tail and transmembrane domain region. Thus, it is preferred that a heterologous CTS region is attached to such bacterial polysialyltransferases (see e.g.
According to a particularly preferred embodiment of the present invention the heterologous CTS region is selected from the group consisting of SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23 and SEQ ID No. (see also
Preferably, the bacterial polysialyltransferase is selected from the group of gram-negative bacteria including Neisseria meningitides, Escherichia coli, Mannheimia haemolytica, Pasteurella haemolytica and Moraxella nonliquefaciens. According to a preferred embodiment of the present invention the bacterial polysialyltransferase is from N. meningitides serogroup B PSTNmB (e.g. GenBank: AAA20478.1) and may carry an amino acid substitution (K69Q) that alters the size distribution of the product.
According to a further preferred embodiment of the present invention the plant or plant cell comprises at least one nucleic acid sequence encoding for at least one bifunctional bacterial alpha2,3-/alpha2,8-sialyltransferase CstII (GenBank: AAL36462.1) from Campylobacter jejuni, which enables the plant or plant cell to generate disialic acid containing glycoproteins. Glycans with disialic acid can serve as substrates for the generation of polysialic acids. In addition, disialic acids may also increase the half-life of therapeutic proteins because they can slow down the stepwise removal of terminal monosaccharides that is required for binding to specific lectin receptors and subsequent clearance.
According to a further preferred embodiment the bacterial CstII amino acid sequence carries the I53S substitution and a C-terminal truncation (Gilbert et al., JBC, 2002, doi: 10.1074/jbc.M108452200; Chiu et al., Nat Struct Mol Biol. 11(2004):163-170, doi:10.1038/nsmb720; Lindhout et al., PNAS 108(2011):7397-7402, doi: 10.1073/pnas.1019266108; Cheng et al., Glycobiology 18(2008):686-697; doi: 10.1093/glycob/cwn047) to alter the enzyme activity .
According to a further preferred embodiment the disialic acid can be further elongated using bacterial or mammalian polysialyltransferases to form oligosialic or polysialic acid polymers.
According to a further preferred embodiment the formation of the disialic acid is increased by combined expression with other bacterial or mammalian polysialyltransferases.
According to a further preferred embodiment of the present invention the N-terminal cytoplasmic tail and transmembrane domain of the at least one polysialyltransferase, preferably mammalian polysialyltransferase, are replaced by a signal peptide sequence (see e.g.
According to a further preferred embodiment of the present invention a signal peptide sequence for secretion to the apoplast is attached to a bacterial polysialyltransferase.
In order to facilitate expression of all recombinant proteins and polypeptides within the plant and plant cell codon-optimized variants of the respective nucleic acid sequences are introduced into the plant or plant cell. In particular, nucleic acid molecules encoding for bacterial sialyltransferases are codon-optimized. Methods for codon optimization are well known in the art. According to a further preferred embodiment of the present invention the plant or plant cell comprises nucleic acid sequences encoding for enzymes involved in the synthesis of a sialic acid precursor operably linked to at least one promoter.
The polysialylation of polypeptides and proteins requires the presence of sialic acid, in particular of sialic acid precursors, within a plant or plant cell. In order to enable a plant and plant cell to produce sialic acids the plant or plant cell may comprise nucleic acid sequences which encode for proteins that are involved in the synthesis of a sialic acid precursor. These nucleic acid sequences may be recombinantly introduced into a plant or plant cell.
The sialic acid precursor produced within the plant or plant cell is preferably N-acetylneuraminic acid (Neu5Ac), preferably CMP-N-acetylneuraminic acid (CMP-Neu5Ac), or N-glycolylneuraminic acid (Neu5Gc), preferably CMP-N-glycolylneuraminic acid (Neu5Gc). These enzymes and the nucleic acid sequences encoding said enzymes are preferably of mammalian, more preferably of human, origin.
According to a preferred embodiment of the present invention the plant or plant cell comprises at least one nucleic acid sequence encoding for at least one enzyme involved in the synthesis of a sialic acid precursor, wherein the enzymes are preferably selected from the group consisting of UDP-GlcNAc 2-epimerase/N-acetylmannosamine kinase (GNE), N-acetylneuraminic acid phosphate synthase (NANS), CMP-sialic acid synthetase (CMAS) and variants thereof. These enzymes and the nucleic acid sequences encoding said enzymes are preferably of mammalian, more preferably of human, origin and may comprise or consist of the amino acid sequences deposited under UniProtKB Acc.Nos. Q9Y223 (human GNE), Q91WG8 (murine GNE), Q9NR45 (human NANS) and Q8NFW8 (human CMAS).
According to a further preferred embodiment of the present invention the plant or plant cell comprises at least one nucleic acid sequence encoding for at least one enzyme involved in the synthesis of a sialic acid precursor, wherein the mammalian GNE enzyme comprises a mutation at arginine position 263, preferably a R263L mutation to prevent feedback inhibition (see Kallolimath S et al.; PNAS 2016, doi:10.1073/pnas.1604371113).
According to a further preferred embodiment of the present invention genes encoding beta 1,2-xylosyltransferase (XylT; e.g. GenBank Acc. No. EF562628) and/or core alpha 1,3-fucosyltransferase (FucT; e.g. GenBank Acc. No. EF562630) and/or beta-hexosaminidases (HEXOs; e.g. GenBank Acc. No. KX192074) and/or beta 1,3-galactosyltransferases (GALTs; e.g. GenBank Acc. No. NM_001332728) and/or alpha 1,4-fucosyltransferase (e.g. GenBank Acc. No. NM_105857) occurring in the plant or plant cell are mutated, silenced or inhibited to reduce their enzymatic activity within said plant or plant cell.
In order to reduce or even to abolish the formation of plant specific N-glycans (glycan chains attached to an asparagine of a polypeptide or protein) one or more of the genes encoding the above mentioned enzymes are mutated, silenced (e.g. using siRNA or RNAi) or inhibited in the plant or plant cell. As a consequence thereof the respective plants and plant cells are not able to produce N-glycans comprising plant specific beta 1,2-xylose and core alpha 1,3-fucose in an extent as the corresponding wild-type plants and plant cells. Likewise, the formation of N-glycans with Lewis a-type elongations (Fuc alphal,4-(Gal betal,3-)GlcNAc) will be prevented or reduced. The mutation may include deletion or substitution of the respective gene(s) or parts thereof (e.g. promoter, coding region), whereby deletion is most preferred. Alternatively, insertions within the respective genes that cause a frame shift in the open reading frame or substitutions of nucleotides leading to nonsense or missense mutations may be used. According to a further preferred embodiment such mutations are carried out using targeted genome editing technologies including CRISPR/Cas9, TALENs or Zinc finger nucleases (Vazquez-Vilar et al., Plant Methods 12(2016):10; doi: 10.1186/s13007-016-0101-2; Li et al., Plant Biotechn. J. 14(2016):533-542, doi: 10.1111/pbi.12403) According to a further preferred embodiment the formation of plant specific N-glycans is abolished by sequence specific targeting of mRNAs (gene silencing approaches using hairpin constructs, antisense sequences, RNAi technology, artificial microRNAs, virus-induced gene silencing and the like). An example for gene silencing using a hairpin construct is shown in Strasser et al. (Plant Biotechn. J 6(2008):392-402, doi: 10.1111/j.1467-7652.2008.00330).
According to a further preferred embodiment the amount of complex N-glycans carrying terminal GlcNAc that is used as acceptor substrate for further elongations with beta 1,4-linked galactose and subsequently with sialic acid is increased by inhibition or inactivation of beta-hexosaminidases from plants. Three different types of beta-hexosaminidases are present in plants, inactivation of beta-hexosaminidase 3 (HEXO3; e.g. GenBank Acc. No. KX192074) has been shown to increase the amounts of complex N-glycans with terminal GlcNAc residues at both branches of secreted recombinant glycoproteins (Castilho et al., Plant Physiol. 166(2014):1839-1851, doi: 10.1104/pp. 114.250720; Shin et al., Plant Biotechn. J. 2016, doi: 10.1111/pbi.12602).
The plant or plant cell comprises preferably nucleic acid sequences encoding for betal,4-galactosyltransfease (GalT; e.g. GenBank Acc. No. X55415), CMP-sialic acid transporter (CST; e.g. GenBank Acc. No. D87969), alpha2,6-sialyltransferase (ST6; e.g. GenBank Acc. No. M18769), alpha2,3-sialyltransferase (ST3; e.g. GenBank Acc. No. L23767) and/or variants thereof operably linked to at least one promoter. These enzymes and the nucleic acid sequences encoding said enzymes are preferably of mammalian, more preferably of human, origin.
The polysialic acid chain is produced by attaching single sialic acid molecules to each other. This process involves polysialyltransferases. However, these polysialyltransferase are usually not able to attach the first sialic acid of the chain to any acceptor. Therefore, the plant and plant cells are preferably able to produce the aforementioned enzymes to form those structures which form the core region of the N-glycan comprising the polysialic acid chain. Particularly preferred core regions comprise the following structures: di-antennary: NaNa, ANaiso, GnNaiso, MNaiso (see
According to another preferred embodiment of the present invention the plant or plant cell comprises a nucleic acid sequence encoding for at least one fucosyltransferase, preferably an alpha 1,6-fucosyltransferase (FUT8; e.g. GenBank Acc. No. NM_178155), operably linked to at least one promoter. This enzyme and the nucleic acid sequence encoding said enzyme is preferably of mammalian, more preferably of human, origin.
Mammalian and in particular human glycoproteins contain usually fucose residues linked alpha 1,6 to the first Glc-NAc residue of their N-glycans. Alpha 1,6-fucosyltransferase directs the addition of fucose to aspar-agine-linked GlcNAc moieties.
According to a preferred embodiment of the present invention the plant or plant cell comprises a nucleic acid sequence encoding for at least one N-acetylglucosaminyltransferase, preferably a beta 1,6-N-acetylglucosaminyltransferase (GnTV; e.g. GenBank Acc. No. NM_002410) or a beta 1,4-N-acetylglucosaminyltransferase (GnTIV; e.g. GenBank Acc. No. NM_012214) or a beta 1,2-N-acetylglucosaminyltransferase (GnTII; e.g. GenBank Acc. No. NM_002408) operably linked to at least one promoter. These enzymes and the nucleic acid sequences encoding said enzymes are preferably of mammalian, more preferably of human, origin. GnTIV and GnTV will generate tri- and tetra-antennary N-glycans (also termed branched N-glycans) (Castilho et al., Glycobiology 21(2011):813-823; doi:10.1093/glycob/cwr009) and provide additional terminal GlcNAc residues at the non-reducing end that can be further extended with beta 1,4-galactose, alpha2,3/alpha2,6-liked sialic acid (Castilho et al., Plos One 8(2013):e54836, doi:10.1371/journal.pone.0054836) and serve as acceptor for the attachment of polysialic acid. GnTII is also present in plants. However, on some recombinant glycoproteins, endogenous plant GnTII is not capable to modify all N-glycans very efficiently resulting in mono-antennary N-glycans (Dicker et al., Front Plant Sci. 29(2016):18, doi:10.3389/fpls.2016.00018). Heterologous expression of an animal GnTII enzyme, preferably human GnTII, in such plants will increase the amount of processed complex N-glycans and thus the potential acceptor glycan substrates for polysialylation.
It is particularly preferred that the polysialic acid chain is linked to the polypeptide or protein via a mannose comprising core sugar. In order to attach GlcNAc residues on mannose, for instance, N-acetylglucosaminyltransferases are required.
According to a preferred embodiment of the present invention the plant or plant cell comprises a nucleic acid sequence encoding for at least one core alphal,3-fucosyltransferase operably linked to at least one promoter. This enzyme and the nucleic acid sequence encoding said enzyme is preferably of plant (Arabidopsis thaliana, maize, etc.), insect, nematode, trematode or snail origin. It has been shown that the presence of core alpha 1,3-fucose can facilitate more efficient sialylation of recombinant glyco-proteins when expressed in plants (Castilho et al, mAbs 7(2015):863-870, DOI: 10.1080/19420862.2015.1053683). More efficient sialylatation (capping of terminal beta 1,4-galactose) is beneficial as it will provide more acceptor substrates for polysialylation.
According to a preferred embodiment of the present invention the plant or plant cell comprises a nucleic acid sequence encoding at least one polypeptide:N-acetylgalactosaminyltransferase (GalNAc-T; e.g. GenBank Acc. No. NM_003774), preferably a human GalNAc-T (e.g. GenBank Acc. No. BC041120) for initiation of mucin-type O-glycan biosynthesis. Mucin-type O-glycans are another type of acceptor substrates that can be used by polysialyltransferases to polysialylate polypeptides. NCAM and dendritic cell neuropolin-2 (Foley et al., JBC 285(2010):35056-35067, doi: 10.1074/jbc.M110.170209; Rollenhagen et al., JBC 288(2013):22880-22892, doi:10.1074/jbc.M113.463927; Bhide et al., JBC 291(2016):9444-9457, DOI 10.1074/jbc.M116.714329) can carry polysialylated mucin type O-glycans. Mucin-type O-glycans are not present in plants. In order to initiate the formation and elongate the O-glycans a GalNAc-T and other animal glycosyltransferases have to be recombinantly expressed in plants (see
According to a further preferred embodiment of the present invention an N-linked trisaccharide consisting of NeuAc-Hexose-HexNAc is used as acceptor substrate for polysialyltransferases. Particularly, the trisaccharide structure is Neu5Ac-alpha2,3-galactose-beta1,4-GlcNAc or Neu5Ac-alpha2,6-galactose-beta1,4-GlcNAc. To generate this N-linked acceptor, a nucleic acid sequence encoding for at least one endo-beta-N-acetylglucosaminidase operably linked to at least one promoter is recombinantly expressed in plants. Preferably, the endo-beta-N-acetylglucosaminidase is an endo T as described for mammalian cells (Meuris et al., Nature Biotechnology 32(2015):485-489, doi:10.1038/nbt.2885) and plants (Piron et al., Nature Bio-technology 33(2015):1135-1137, doi:10.1038/nbt.3359). The resulting N-linked GlcNAc is extended by recombinant expression of beta 1,4-galactosyltransferase and alpha 2,3-or alpha 2,6-sialyltransferase resulting in the generation of a (mono)sialylated trisaccharide that serves as acceptor for polysialylation.
According to a further preferred embodiment of the present invention the polysialyltransferase binding motif is a fibronectin type III domain or a fragment thereof like the FN1 acidic patch, preferably an acidic batch including the core acidic residues Asp520, Glu521, and Glu523 (present in the DEPE motif).
The glycosylation site is preferably a N-glycosylation site (Asn-X-Ser/Thr, where X can be any amino acid except proline) or a mucin-type O-glycosylation site (GalNAc linked to Ser/Thr).
The polysialic acid chain and its core structure are attached to a protein or polypeptide via an asparagine, serine or threonine residue.
The polypeptide lacking a polysialyltransferase binding motif is preferably selected from the group consisting of antibodies, like IgG, IgA, IgM, IgD, IgE and fragments thereof including single chain antibodies (scFvs), heavy chain antibodies, Fab-fragments, nanobodies, Fcabs and similar truncated or engineered antibody formats. For instance, small antibody fragments or variants like single chain Fv (ScFv) fragments are rapidly cleared from the blood. Polysialylation of such antibody fragments can increase the in vivo circulating half-life (Chen et al., Bio-conjugate Chem 23(2012):1524-1533, dx.doi.org/10.1021/bc200624a). Another important class of polypeptides lacking polysialyltransferase motifs represents immunoglobulins of the IgA type including monomeric, dimeric and secretory variants as well as the subclasses IgA1 and IgA2.
According to a preferred embodiment of the present invention the polypeptide lacking a polysialyltransferase binding domain is selected from the group consisting of antigen-binding non-immunoglobulin proteins or scaffolds including designed ankyrin repeat proteins (DARPins) or affibodies.
According to a preferred embodiment of the present invention the polypeptide lacking a polysialyltransferase binding domain is selected from the group consisting of erythropoietin, α1-Antitrypsin, transferrin, butyrylcholinesterase, granulocyte colony-stimulating factor, DNAse 1, clotting factors, in particular factor VII, factor VIII, factor IX or von Willebrand factor, follicle-stimulating hormone, luteinizing hormone, thyroid-stimulating hormone, interferons, in particular interferon alpha, interferon beta or interferon gamma, tumor necrosis factor-alpha inhibitors, in particular etanercept, viral proteins, viral antigens, and fragments, mutants or variants thereof.
According to a preferred embodiment of the present invention the polypeptide lacking a polysialyltransferase binding domain is selected from the group consisting of insulin or other non-glycosylated protein therapeutics. To facilitate polysialylation of such proteins (including also non-glycosylated antibody fragments and non-glycosylated non-immunoglobulin scaffolds) an N-glycosylation site (Asn-X-Ser/Thr) or Ser/Thr O-glycosylation site is introduced by site-directed mutagenesis or by insertion or attachment of amino acid residues, small peptides or protein domains.
According to another preferred embodiment of the present invention the plant is selected from the group consisting of the genera Nicotiana, Arabidopsis, Lemna, Physcomitrella, Zea, Oryza, Triticum, Pisum, Lotus, Taxus and Brassica or selected from the group consisting of algae safflower, alfalfa, lettuce, barley, rapeseed, soybean, sugar beet, sugar cane, potato, tomato, spinach, ginseng, gingko and carrots and the plant cell is derived from said plants.
Particularly preferred are plants and plant cells of the genera Nicotiana, Arabidopsis or Oryza.
According to a further preferred embodiment of the present invention the plant is selected from the group of plant species consisting of Nicotiana benthamiana, Nicotiana tabacum, Arabidopsis thaliana, Lemna minor, Physcomitrella patens, Zea mays, Oryza sativa, Triticum aestivum, Pisum sativum, Lotus japonicas, Taxus cuspidate, and Brassica napus.
Particularly preferred are plants and plant cells of Nicotiana benthamiana, Nicotiana tabacum or Arabidopsis thaliana.
According to a preferred embodiment of the present invention the plant cell is selected from the group consisting of tobacco BY2 cells, medicago cells, carrot cells and rice cells.
The plant cell of the present invention and used in the methods of the present invention can be derived from the above mentioned plants, plant genera and plant species. The cells may be derived from any part of these plants.
However, it is particularly preferred that the plant cell is a cambial meristematic cell.
Another aspect of the present invention relates to a method for producing a polysialylated polypeptide comprising the step of cultivating a plant or plant cell according to the present invention.
The plants or plant cells of the present invention can be used to produce polysialylated polypeptides or proteins. Thereby these plants and plant cells are cultivated with methods as described for Nicotiana benthamiana plants (Chen et al., Adv Tech Biol Med 1(2013):103, http://dx.doi.org/10.4172/atbm.1000103) or Arabidopsis thaliana (Arabidopsis Protocols, Methods in Molecular Biology, Volume 1062, 2014, DOI 10.1007/978-1-62703-580-4).
According to a preferred embodiment of the present invention the plant cell is cultivated in suspension culture as described, for example, for tobacco BY2 cells (Nagata et al., Int. Rev. Cytol. 1992, DOI: 10.1016/S0074-7696(08)62452-3)
Plant cell cultures can be grown as cell suspension cultures in a liquid medium or as callus cultures on a solid medium. Sterile explants are usually placed on the surface of a sterile solid culture medium, but can also be placed directly into a sterile liquid medium, particularly when a cell suspension culture is desired. Explants can be taken from different parts of a plant, including portions of shoots, leaves, stems, flowers, roots, single undifferentiated cells and from many types of mature cells provided are they still contain living cytoplasm and nuclei and are able de-differentiate and resume cell division. Plant cells are, however, preferably cultivated in cell suspension. Suspension cell cultures have several advantages over conventional isolation of products from the intact plants, such as stable supply, freedom from disease and vagaries of climates, closer relationship between supply and demand, and growth of large amount of plant cells in minimal space.
According to a preferred embodiment of the present invention the nucleic acid sequences are introduced into the plant or plant cell by agroinfiltration of the plant cell, plants or parts thereof including leaves, in order to transiently express the polypeptides encoded by said nucleic acid sequences.
A further aspect of the present invention relates to a polysialylated polypeptide obtainable by a method according to the present invention.
The polysialylated polypeptide or protein of the present invention has a unique glycan structure because these polypeptides and proteins are usually not polysialylated by mammalian cells or any other cells since they lack a polysialyltransferase binding motif/domain. Furthermore, the glycan chains comprising the polysialic acid chains comprise a core structure which is usually found in naturally occurring glycoproteins.
According to a preferred embodiment of the present invention the polysialylated polypeptide comprises a polysialic acid chain comprising at least 2, preferably at least 4, more preferably at least 8, sialic acid units. The length of the polysialic acid chain may be influenced by modulating the acceptor substrate binding pocket of the polysialyltransferases. Changes in single amino acid residues (for instance K69Q, H78L and N100I) of the bacterial polysialyltransferase from Neisseria meningitides serogroup B resulted in altered product length (Keys et al., Nature Chem Biol, 2014, doi:10.1038/nchembio.1501). A mutant variant of human ST8Sia-II (E141K substitution) affects polysialyltransferase activity resulting in shorter polysialic acid chains (Isomura et al., JBC, 2011, DOI 10.1074/jbc.M111.221143).
According to a further preferred embodiment of the present invention the polysialylated polypeptide comprises a polysialic acid chain comprising 2 to 400, preferably 2 to 300, more preferably 2 to 250, sialic acid units.
Another aspect of the present invention relates to the use of a plant or plant cell according to the present invention for producing a polysialylated polypeptide from a polypeptide lacking a polysialyltransferase binding motif and comprising at least one glycosylation site.
The present invention is further illustrated by the following examples, however, without being restricted thereto.
The triple gene vectors pC144 and pG371 containing the expression cassettes for the UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine-kinase (GNE), N-acetylneuraminic acid phosphate-synthase (NANS), CMP-Neu5Ac synthetase (CMAS), CMP-Neu5Ac transporter (CST), 131,4-galactosyltransfease fused to the cytoplasmic tail, trans-membrane domain and stem region of the α2,6-sialyltransferase (STGalT) and α2,6-sialyltransferase (ST6) were described previously (Castilho A, et al. PLoS One 8(2013):e54836.). Here these vectors have been modified in order to use them for co-transformation of N. benthamiana ΔXTFT glycosylation mutant (Strasser R, et al. Plant Biotechnol J 6(2008):392-402.).
In pC144 an expression cassette encoding glyphosate-resistant 5-enolpyruvoylshikimate-3-phosphate synthase (EP-SPS) gene for glyphosate-tolerance was introduced. Annealed Epsps F1/R1 primers (Table 1) were cloned into pC144 to insert AvrII-NcoI restriction sites. These sites were used to introduce the epsps expression cassette as an AvrII-NcoI fragment (
cggatggctccacgtggccccatcg
cggatggctccattgctttacacac
Restriction sites are in italic and strep-tag sequence in bold.
Also, GNE expression cassette was replaced by a mutated version to prevent feedback inhibition. A point mutation on the GNE gene (R263L, GNER→L) was introduced in pSAT1-GNE (Castilho A, et al., PLoS One 8(2013):e54836) using the QuikChange II XL Site-directed Mutagenesis Kit (Strategene, USA) and the primers GNEmut F/R (Table 1), according to manufacturer's instructions. This pSAT1-GNER→L expression cassette was assembled in pCe144 as Ascl-Ascl fragment replacing the existing one. Also, an expression cassette for glufosinate ammonium resistance (Basta®) was transferred into pG371 (
cDNA from the human α2,3-sialyltransferase (IMAGE clone IRAD p970E0336D; Life sciences source bioscience, UK) was PCR amplified with primer pair ST3 F1/R1 (Table 1) and digested with XbaI/BamHI and cloned into the binary vector pPT2M (Strasser R, et al. Biochem J 387(2005):385-391) digested the same way. cDNA sequences of two human polysialyltransferases ST8Sia-II (IMAGE clone IRCMp5012E1027D) and ST8Sia-IV (IMAGE clone IRATp970A1079D) (both Life sciences source bioscience, UK) were amplified with a C-terminal Strep II-tag using primer pairs ST8Sia-II F1/R1 and ST8Sia-IV F1/R1 respectively (Table 1). Resulting PCR products were digested with XbaI/BglII (ST8Sia-II) or XbaI/BamHI (ST8Sia-IV) and cloned into pPT2M digested with XbaI/BglII or Xbal/BamHI. The resulting vectors pST3, pST8Sia-II and pST8Sia-IV (
Agrobacterium-mediated leaf disc transformation of N. benthamiana ΔXTFT was performed by a standard protocol (Horsch R B, et al. Science 227(1985):1229-1231). After selection with Basta® (3 mg mL−1) and Glyphosate (200 μM) transgenic plantlets were screened by PCR for the genomic insertion of the 6 mammalian genes. Positive plants were propagated for homozygosity (ΔXTFTSia). N. benthamiana ΔXTFT and ΔXTFTSia plants were grown in a growth chamber at 22° C. with a 16 h light/8 h dark photoperiod.
Material and Methods
Transient Protein Expression
Agro-infiltration experiments were carried using four-to-five-week old plants. For modulation of the N-glycosylation profiles towards sialylation or polysialylation, recombinant proteins were either expressed in ΔXTFTSia or co-expressed in ΔXTFT with the necessary constructs (see Kallolimath S et al. (PNAS 2016, doi:10.1073/pnas.1604371113). Agrobacteria were infiltrated using optical density (OD600) 0.05-0.1. Protein expression was monitored 3-5 days post infiltration.
Protein Extraction and Immunoblotting
Total soluble proteins were extracted in 1:2 w/v extraction buffer (100 mM Tris, 1 mM EDTA, 500mM NaCl, 40 mM ascorbic acid). Total proteins were extracted the same way in extract buffer containing 1% v/v Triton X-100. Secreted proteins were collected from the intracellular fluid (IF) as described previously. Proteins were fractionated in 8 or 12% SDS-PAGE under reducing conditions and gels were either stained with Coomassie Brilliant Blue or used for immunoblotting. Western blotting was carried out using anti-polySia antibodies (1:750 dilution anti-polysialic acid mAb735). Detection was performed using HRP-conjugated anti-mouse-IgG A2554, diluted 1:10,000 (Sigma Aldrich, St. Louis, Mo., USA). Clarity™ Western enhanced chemiluminescence reagents from (Bio-Rad, Life Science, Hercules, Calif., USA) were used as substrates.
Results
Various therapeutically interesting proteins (see
Number | Date | Country | Kind |
---|---|---|---|
16193002.9 | Oct 2016 | EP | regional |
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/EP2017/075747 | 10/10/2017 | WO | 00 |