Patent Application
20210130864
This application claims priority and the benefit of Korean Application No. 10-2019-0136416, filed Oct. 30, 2019; and Korean Application No. 10-2020-0077146, filed Jun. 24, 2020; each of which is incorporated by reference in its entirety for all purposes.
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Oct. 29, 2020, is named 106739-1206866-000110US_SL.txt and is 15,352 bytes in size.
The present invention relates to production of nucleic acids or polypeptides in a cell free system.
RNA is currently used in therapeutic applications that redirect mutated targets from proteins to RNA in the genome through the use of RNA interference. The unique ability of RNA moieties to serve both as a genetic source code and the catalytic repertoire makes them excellent drug targets beyond their use as a behavior blueprint for regulatory protein production. However, the practical applications of RNAs have been considerably limited due to its intrinsic chemical instability and low yield of production facilities.
Hydrogels are supra molecular assemblies hosting aqueous media, possessing both solute transport properties of a liquid and also mechanical properties of a solid. Hydrogels are useful especially for biomedical applications because of their high water content, favorable structural features, and biocompatibility. Although nucleic acid hydrogels are generally known, the conventional methods for producing nucleic acid hydrogels typically require complicated procedures such as covalent crosslinking. As a result, these techniques were unable to produce RNA hydrogels with sufficient yield that is required for commercial production. The stability, mechanical performance, and functional properties of the current RNA hydrogels are also inadequate.
In some embodiments, disclosed herein a circular DNA template comprising (i) a promoter sequence and (ii) a sequence complementary to a first G-quadruplex motif.
In some embodiments, the promoter sequence is hybridized to a complementary nucleic acid sequence to form a first partially double-stranded DNA molecule; the first partially double-stranded DNA molecule comprises a double-stranded region and a single-stranded region; the double-stranded region comprises the first promoter sequence hybridized to the complementary nucleic acid sequence; and the single-stranded region comprises the sequence complementary to the first G-quadruplex motif.
In some embodiments, the circular DNA template further comprises a spacer, wherein the spacer comprises poly thymines (i.e., two or more thymines). In some embodiments, the first circular DNA template comprises a coding sequence of a polypeptide of interest. In some embodiments, the sequence complementary to the first G-quadruplex motif comprises a sequence of ACCCTAACCCTA (SEQ ID NO: 1). In some embodiments, the first promoter sequence is selected from the group consisting of a T7 promoter, a T3 promoter, a Lac promoter, an araBad promoter, a Trp promoter, a Tac promoter, and an SP6 promoter.
Also provided herein is a nucleic acid concatemer comprising a plurality of monomers, wherein each monomer comprises (i) a G-quadruplex motif, and (ii) a spacer comprising poly thymines or a coding sequence for a polypeptide of interest. In some embodiments, the nucleic acid concatemer is an RNA concatemer, wherein the G-quadruplex motif comprises UAGGGUUAGGGU (SEQ ID NO: 2). In some embodiments, the G-quadruplex motif comprises TAGGGTTAGGGT (SEQ ID NO: 20).
Also provided herein is a nucleic acid hydrogel comprising the nucleic acid concatemer of any of the embodiments above.
Also provided herein is a protein expression system comprising the nucleic acid hydrogel disclosed above, a ribosome, and/or a mixture of amino acids.
Also provided herein is a composition comprising a first circular DNA template and a second circular DNA template, wherein the first circular DNA template comprises (i) a first promoter sequence, (ii) a sequence complementary to a first G-quadruplex motif, and (iii) a spacer comprising poly thymines, wherein the second circular DNA template comprises (i) a second promoter sequence, (ii) a sequence complementary to a second G-quadruplex motif, and (iii) a coding sequence of a polypeptide of interest; and wherein the molar fraction of the first circular DNA template relative to the total amount of first and second circular DNA templates ranges from 25% to 75%.
In some embodiments, the first promoter sequence is hybridized to a complementary nucleic acid sequence to form a first partially double-stranded DNA molecule. The first partially double-stranded DNA molecule comprises a double-stranded region and a single-stranded region. The double-stranded region of the first partially double-stranded DNA molecule comprises the first promoter sequence hybridized to the complementary nucleic acid sequence, and the single-stranded region of the first partially double-stranded DNA molecule comprises the sequence complementary to the first G-quadruplex motif.
In some embodiments, the second promoter sequence is hybridized to a complementary nucleic acid sequence to form a second partially double-stranded DNA molecule. The second partially double-stranded DNA molecule comprises a double-stranded region and a single-stranded region. The double-stranded region of the second partially double-stranded DNA molecule comprises the second promoter sequence hybridized to the complementary nucleic acid sequence, and the single-stranded region of the second partially double-stranded DNA molecule comprises the sequence complementary to the second G-quadruplex motif.
In some embodiments, the first G-quadruplex motif and the second G-quadruplex motif comprise the same nucleotide sequence. The first promoter sequence and the second promoter sequence may comprise the same or different nucleotide sequence. In some embodiments, the spacer comprises 30-120 thymines (SEQ ID NO: 32). In some embodiments, the coding sequence has a length that is within a range from 20 to 300 nucleotides. In some embodiments, the length ratio of the coding sequence to the spacer is within a ranges from 1:0.2 to 1:2. In some embodiments, the polypeptide of interest is selected from the group consisting of insulin, Trans-activating transcriptional activator (TAT), HiBiT, and a single domain antibody.
The composition of any of the embodiments described above may further comprise one or more RNA polymerases, a mixture of ribonucleotides, and/or a buffer. In some embodiments, the composition further comprises a DNA polymerase having a strand replacement activity and thus is capable of performing a rolling circle amplification.
Also provided herein is a composition comprising a circular DNA template and a double-stranded DNA construct, and the circular DNA template comprises (i) a first promoter sequence, (ii) a sequence complementary to a first G-quadruplex motif, and (iii) a spacer comprising poly thymines. The double-stranded DNA construct comprises (i) a second promoter sequence, (ii) a sequence complementary to a second G-quadruplex motif, and (iii) a coding sequence of a polypeptide of interest.
Also provided herein is a nucleic acid hydrogel comprising a first nucleic acid concatemer and a second nucleic acid concatemer. The first nucleic acid concatemer is produced by rolling circle transcription or amplification of the first circular DNA template provided in this disclosure, and the second nucleic acid concatemer is produced by rolling circle transcription or amplification of the second circular DNA template provided in this disclosure.
Also provided herein is a nucleic acid hydrogel comprising a first RNA molecule and a second RNA molecule, wherein the first RNA molecule comprises (i) a first G-quadruplex motif, and (ii) a spacer comprising poly adenines (i.e., two or more adenines), and wherein the second RNA molecule comprises (i) a second G-quadruplex motif, and (ii) a coding sequence for a polypeptide of interest.
In some embodiments, the first RNA molecule is an RNA concatemer comprising a plurality of monomers and wherein each monomer comprising the first G-quadruplex motif, and the spacer comprising poly adenines or a coding sequence for a polypeptide of interest.
Also disclosed herein is a protein expression system comprising any nucleic acid hydrogel disclosed herein, a ribosome, and/or a mixture of amino acids.
Also disclosed herein is a kit for expressing a polypeptide of interest, and the kit comprises (1) a first DNA molecule capable of forming a first circular DNA template by hybridizing to a first splint oligonucleotide, wherein the first circular DNA template comprises (i) a first promoter sequence, (ii) a sequence complementary to a first G-quadruplex motif, and (iii) a spacer comprising poly thymines, (2) the first splint oligonucleotide that is complementary to the first promoter sequence, wherein the first DNA template can hybridize to first splint oligonucleotide and be circularized to form a first circular DNA template, and/or (3) a second DNA molecule capable of forming a second circular DNA template by hybridizing to a second splint oligonucleotide, wherein the second circular DNA template comprises (i) a second promoter sequence, (ii) a sequence complementary to a second G-quadruplex motif, and (iii) a coding sequence of the polypeptide of interest, and (4) the second splint oligonucleotide that is complementary to the second promoter sequence, wherein the second DNA template can hybridize to the second splint oligonucleotide and be circularized to form a second circular DNA template.
In some embodiments, the kit comprises any composition comprising a first circular DNA template and second circular DNA template as disclosed herein. In some embodiments, the first G-quadruplex motif and the second G-quadruplex motif have the same or different sequence. In some embodiments, the first promoter sequence and the second promoter sequence are the same or different. In some embodiments, the spacer comprises 30-120 thymines (SEQ ID NO: 32). In some embodiments, the coding sequence has a length that ranges from 20 to 300 nucleotides. In some embodiments, the length ratio of the coding sequence to the spacer is within a range from 1:0.2 to 1:2. In some embodiments, the polypeptide of interest is selected from the group consisting of insulin, HiBiT, a Trans-activating transcriptional activator (TAT), and a single domain antibody. In some embodiments, the kit further comprises one or more DNA ligases, RNA polymerases, a mixture of ribonucleotides, and/or one or more buffers. In some embodiments, the kit further comprises a DNA polymerase having a strand replacement activity and thus is capable of performing a rolling circle amplification.
Also disclosed herein is a method of preparing a nucleic acid hydrogel comprising: (1) providing a first circular DNA template comprising (i) a first promoter sequence, and (ii) a sequence complementary to a first G-quadruplex motif; and (2) performing a rolling circle transcription or amplification on the first circular template to produce a first nucleic acid concatemer, wherein the first nucleic acid concatemer forms a nucleic acid hydrogel.
In some embodiments, the first circular DNA template further comprises a spacer comprising poly thymines, wherein the step (1) further comprises providing a second circular DNA template comprising (i) a second promoter sequence, (ii) a second G-quadruplex motif, and (iii) a coding sequence of a polypeptide of interest, and wherein the step (2) further comprises performing a rolling circle transcription or amplification of the second circular DNA template to produce a second nucleic acid concatemer, wherein the first and second nucleic acid concatemers form the nucleic acid hydrogel.
Also disclosed herein is a method for producing a protein in a cell-free synthesis system, and the method comprises combining any of the nucleic acid hydrogels disclosed herein with a cell-free synthesis system under conditions permitting translation of the polypeptide of interest. In some embodiments, the cell-free synthesis system comprises a ribosome and/or a mixture of amino acids.
This application provides methods and compositions related to constructing nucleic acid hydrogels (e.g., RNA hydrogels) from nucleic acid concatemers having repetitive monomer units. Each monomer unit includes one or more G-quadruplex sequences. These G-quadruplex sequences cross-link the nucleic acid concatemer, such that the concatemer self-assembles (i.e., without the need for any external crosslinkers) into a hydrogel. The nuclei acid concatemer can be produced by rolling circle amplification or rolling circle transcription of a circular DNA template. In some embodiments, each monomeric unit of the nucleic acid concatemer comprises a coding sequence for a polypeptide of interest. The nucleic acid hydrogel formed by the nucleic acid concatemer can be used for expressing the polypeptide in high quantities. In some embodiments, at least two RNA concatemers comprising G-quadruplex sequences are produced, one further comprising a spacer and the other further comprising a sequence encoding a polypeptide of interest. These two RNA concatemers are combined and self assembled to form a single RNA hydrogel, referred to as a wideband RNA hydrogel in this disclosure.
The nucleic acid hydrogels (e.g., RNA hydrogels) can be molded in different dimensions and shapes, and these nucleic acid hydrogels exhibit good, soft mechanical properties and excellent physicochemical stability. The nucleic acid hydrogels disclosed herein can serve as a platform for a wide range of biological applications (e.g., catalysis, protein expression). The RNA hydrogel protein production system closely resembles an intracellular environment, in which RNAs are produced from a bundle of DNA and proteins expressed abruptly within a limited space in cytoplasm surrounded by cytoskeletons (42). The gel matrix in the hydrogel mimics the role of a cytoskeleton that provides mechanical support to the cell. The nucleic acid hydrogel has sufficient aqueous space, which is beneficial for enzymatic reactions (e.g., during protein expression). The nucleic acid hydrogels have the useful features of porosity and close vicinity of the protein-encoding sequences, which allow the free-access of ribosomes to the RNA template in the nucleic acid hydrogels. These features allow the nucleic acid hydrogels disclosed herein to serve as ideal cell-free protein production platforms.
Producing proteins using the nucleic acid hydrogels disclosed herein is a straightforward and streamlined procedure that is easy to follow. The nucleic acid hydrogel protein production system can also be configured to produce proteins in a continuous mode in a longer reaction period to improve protein production efficiency and versatility further. With multifarious engineered functionalities, the nucleic acid hydrogels could expand the scope of state-of-the-art applications in several fields, such as multiplex real-time pathogen detection; bio-fuel cells for non-toxic, non-flammable, eco-friendly energy sources; and bio-implants and antibody-drug conjugates.
As used in herein, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “an antibody” optionally includes a combination of two or more such molecules, and the like.
The term “about” as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field, for example 20%, 10%, or 5%, are within the intended meaning of the recited value.
As used herein, the term “comprising” or “comprise” is open-ended. When used in connection with a subject nucleic acid (or amino acid sequence), it refers to a nucleic acid sequence (or an amino acid sequence) that includes the subject sequence as a part or as its entire sequence.
The terms “nucleic acid” and “polynucleotide” are used interchangeably and as used herein refer to both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. In particular embodiments, a nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide, and combinations thereof. The terms also include, but is not limited to, single- and double-stranded forms of DNA. In addition, a polynucleotide disclosed herein, e.g., a circular DNA template, a nucleic acid concatemer disclosed herein, may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages. The nucleic acid molecules may be modified chemically or biochemically or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analogue, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, and the like), charged linkages (e.g., phosphorothioates, phosphorodithioates, and the like), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, and the like), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, and the like). The above term is also intended to include any topological conformation, including single-stranded, double-stranded, partially duplexed, triplex, hairpinned, circular and padlocked conformations. A reference to a nucleic acid sequence encompasses its complement unless otherwise specified. Thus, a reference to a nucleic acid molecule having a particular sequence should be understood to encompass its complementary strand, with its complementary sequence. The term also includes codon-optimized nucleic acids that encode the same polypeptide sequence.
As used herein, the term “concatemer,” refers to a nucleic acid molecule comprising tandem repeats of a nucleic acid sequence. Nucleic acid concatemer can be produced by nucleic acid synthesis, or by, for example, a rolling circle amplification or rolling circle transcription of a circular DNA template.
As used herein, the term “cell-free synthesis,” refers to the in vitro synthesis of nucleic acids, polypeptides, small molecules and/or viral particles in a reaction mix comprising biological extracts and/or defined reagents. The reaction mix will comprise a template for production of the macromolecule, e.g., DNA, mRNA, and the like; monomers for the macromolecule to be synthesized, e.g., amino acids, nucleotides, and the like; and co-factors, enzymes and other reagents that are necessary for the synthesis, e.g., ribosomes, uncharged tRNAs, tRNAs charged with natural and/or unnatural amino acids, polymerases, transcriptional factors, tRNA synthetases, and the like
The term “lysate” is any cell derived preparation comprising the components required for protein synthesis machinery, wherein such cellular components are capable of expressing a nucleic acid encoding a desired protein where a majority of the biological components are present in concentrations resulting from the lysis of the cells rather than having been reconstituted. A lysate may be further altered such that the lysate is supplemented with additional cellular components, e.g., amino acids, nucleic acids, enzymes, and the like. The lysate may also be altered such that additional cellular components are removed or degraded following lysis.
As used herein the term “RGx,” refers to a non-G quadruplex structure formed by a RNA concatemer.
As used herein, the term “RGx concatemer,” used interchangeably with “sGx,” refers to the RNA concatemer that forms the RGx. In one embodiment, the RGx concatemer comprises multiple copies of SEQ ID NO: 13.
As used herein, the term “RGx solution,” refers to the viscous solution formed by the RGx.
As used herein the term “RG4,” refers to an RNA G-quadruplex formed by an RNA concatemer. In some embodiments, the RNA concatemer is produced by rolling circle transcription.
As used herein the term “RG4 concatemer,” used interchangeably with “sG4,” refers to the RNA concatemer that forms the RG4.
As used herein, the term “RG4 hydrogel,” used interchangeably with “RG4 gel,” refers to the hydrogel resulted from gelation of the RG4.
As used herein, the term “H-RG4 hydrogel” or “H-RG4 gel” refers to a hydrogel formed by an RNA concatemer produced from rolling circle transcription of a DNA template comprising the sequence of SEQ ID NO: 14.
As used herein, the term “W-RG4 hydrogel,” or “wideband RG4 hydrogel,” refers to a hydrogel formed by two different RNA molecules, at least one of which is an RG4 concatemer. In one embodiment, both RNA molecules are RG4 concatemers, one comprising poly adenines and the other encoding a polypeptide of interest. In one embodiment, one of the two RNA molecules is an RG4 concatemer comprising poly adenines and the other is an RNA molecule that encodes a polypetide of interest.
As used herein, the term “nT RG4,” refers to an RNA concatemer produced from rolling circle transcription of a DNA template comprising n thymines. For example, the term “30T RG4,” “60T RG4,” “90T RG4,” “120T RG4,” or “150T RG4,” refers to an RNA concatemer produced from rolling circle transcription of a DNA template comprising 30 (SEQ ID NO: 33), 60 (SEQ ID NO: 34), 90 (SEQ ID NO: 35), 120 (SEQ ID NO: 36), or 150 thymines (SEQ ID NO: 37). N can be any integer. In some embodiments, n is in a range from 3 to 400, for example, from 10 to 300, from 20 to 200, from 25 to 180, or from 30 to 150. A DNA template that is transcribed to produce an nT RG4 is referred to as a spacer template for the nT RG4. In one example, a spacer template for 30T RG4 comprises the sequence of SEQ ID NO: 6.
Throughout the disclosure, the term “gel” and the term “hydrogel” are used interchangeably.
As used herein, the term “coding sequence,” “protein encoding sequence,” “protein coding sequence,” refers to a DNA sequence, which can be transcribed to form a RNA transcript, and said RNA transcript can be translated to produce a polypeptide of interest. Depending on the context, a coding sequence for a protein of interest or a coding sequence encoding a protein of interest, referred to herein, may be the sequence of the sense strand that encodes a protein of interest (e.g., SEQ ID NO: 26), or the sequence of the anti-sense strand (e.g., SEQ ID NO: 21). A coding sequence used herein is also referred to as a target sequence.
As used herein, the term “non-coding sequence,” refers to a genomic sequence that can be transcribed but cannot be translated.
As used herein, the term “molar fraction,” refers to the percentage of the molar number of a reagent in a mixture. For example, a molar fraction of 75% of the spacer template in a mixture containing both the spacer template and coding template molecules refers to that the percentage of the molar number of spacer template molecules is 75% and the percentage of the molar number of the coding template molecules is 25%.
A G-quadruplex motif disclosed herein comprises at least two, at least three, or at least four consecutive guanines (Gs). In some cases, at least 20%, at least 30%, at least 40%, or at least 50% of the nucleotides in the G quadruplex motif are guanines. Nonlimiting examples of G-quadruplex motifs are disclosed in Phan, FEBS J. 277, 1107-1117 (2010) and Platella et al., Biochimica et Biophysica Acta 1861 (2017) 1429-1447, the entire disclosures of which are herein incorporated by reference.
In some embodiments, the G-quadruplex motif is a RNA sequence (RNA G-quadruplex motif). Nonlimiting examples of RNA G-quadruplex motifs include UAGGGUUAGGGU (SEQ ID NO: 2) and GGGUUAGGGU (SEQ ID NO: 22). In some embodiments, the G-quadruplex motif is a DNA sequence (DNA G-quadruplex motif). Nonlimiting examples of DNA G-quadruplex motifs include TAGGGTTAGGGT (SEQ ID NO: 20).
Also encompassed in this disclosure are RNA G-quadruplex motifs that can be derived from corresponding DNA G-quadruplex motifs disclosed herein or incorporated by reference. For example, an RNA G-quadruplex motifs can be derived from a DNA G-quadruplex motif by, e.g., replacing deoxyribonucleotides in the DNA G-quadruplex motif with respective corresponding ribonucleotides and replacing the nitrogenous base thymines with uracils. By way of an example, UAGGGUUAGGGU (SEQ ID NO: 2) can be derived from TAGGGTTAGGGT (SEQ ID NO: 20) using the above approach. Conversely, DNA G-quadruplex motifs can also be derived from any of the RNA G-quadruplex motifs disclosed herein or incorporated by reference by, e.g., replacing the ribonucleotides with respective corresponding deoxyribonucleotides and replacing the nitrogenous base uracil with thymine. These DNA G-quadruplex motifs are also encompassed in this disclosure.
Production of RNA Concatemers with G-Quadruplex Motifs
In some embodiments, methods and compositions in this disclosure can be used to produce RNA concatemers by rolling circle transcription.
A circular DNA template used in the rolling circle transcription may be produced from a single-stranded linear DNA, and said linear DNA comprising the sequence that is complementary to the desired RNA sequence. The single-stranded linear DNA may be prepared by any method known to those of skill in the art, including chemical synthesis isolation from a nucleic acid library, or by recombinant technology.
The single-stranded linear DNA can be circularized to form a circular DNA template by a DNA ligase with the help of a splint oligonucleotide. The splint oligonucleotide comprises a first sequence that is complementary to one end of the DNA and a second sequence that is complementary to the other end of the linear DNA molecule. The splint oligonucleotide brings the two ends of the single-stranded linear DNA into proximity by hybridizing to the sequences at the two ends. A DNA ligase is then used to join the two ends of the DNA molecule to form a circular single-stranded DNA template. The splint oligonucleotide can then serve as the primer to initiate the rolling circle amplification to form a DNA concatemer, or to initiate the rolling circle transcription to form an RNA concatemer. One illustrative embodiment is shown in
The circular single-stranded DNA template comprises at least one promoter sequence that is operably linked to a spacer or a coding sequence of interest. In some embodiments, the splint oligonucleotide is complementary to the promoter sequence in the circular DNA template. In one embodiment, the split oligonucleotide has a sequence of SEQ ID NO: 12. The promoter sequence used herein can derive from a wide range of promoters. The promoter may be a mutant promoter, a truncated promoter, or a hybrid promoters. The promoter may be a constitutive or an inducible promoter. Nonlimiting examples of suitable promoters include a T7 promoter, a T3 promoter, a Lac promoter, an araBad promoter, a Trp promoter, a Tac promoter, or an SP6 promoter.
The circular single-stranded DNA template may further one or more other regulatory sequences, including without limitation, repressors, activators, transcription and translation enhancers, DNA-binding proteins, and the like
The circular DNA template such may also comprise one or more functional sequences for example, a coding sequence of a polypeptide of interest or a spacer sequence, as further described below.
A spacer is located between the promoter sequence and the G4 quadruplex motif in the circular DNA template. Typically the spacer is a non-coding sequence. The spacer may comprise multiple thymines. In some embodiments, the spacer comprises 15-220, e.g., 20-200, 25-150, or 30-120 nucleotides. In some embodiments, at least 50%, at least 60%, at least 90%, at least 95% of the nucleotides in the spacer are thymines (T). In some embodiments, the spacer comprises at least 10 (SEQ ID NO: 39), at least 12 (SEQ ID NO: 40), at least 13 (SEQ ID NO: 41), at least 14 (SEQ ID NO: 42), at least 15 (SEQ ID NO: 43), at least 16 (SEQ ID NO: 44), at least 20 consecutive thymines (SEQ ID NO: 45). In some embodiments all the nucleotides in the spacer are thymines. In some embodiments, the spacer comprises 3T, 10T (SEQ ID NO: 38), 30T (SEQ ID NO: 33), 60T (SEQ ID NO: 34), 90T (SEQ ID NO: 35), 120T (SEQ ID NO: 36), or 150T (SEQ ID NO: 37). In some embodiments, the spacer consists of 3T, 10T (SEQ ID NO: 38), 30T (SEQ ID NO: 33), 60T (SEQ ID NO: 34), 90T (SEQ ID NO: 35), 120T (SEQ ID NO: 36), or 150T (SEQ ID NO: 37). In some embodiments, the circular DNA template comprises a spacer, and said spacer comprises a sequence selected from the group consisting of SEQ ID NOs: 6-9, and 11.
The coding sequence encodes a polypeptide of interest. In some embodiments, the length of the coding sequence may be in a range from 20 to 300 nucleotides, e.g., from 25 to 200 nucleotides, or from 30 to 166 nucleotides. In terms of the lower limits, the coding sequence has a length of at least 20 nucleotides, at least 30 nucleotides, at least 50 nucleotides, or at least 100 nucleotides. In terms of the upper limits, the coding sequence has a length of no longer than 300, no longer than 200, or no longer than 166 nucleotides.
Nonlimiting examples of polypeptides of interest include an antibody, such as a single domain antibody, a single chain antibody, a fragment of an antibody (e.g., an scFv or a Fab fragment), a growth hormone (e.g., insulin), a receptor for hormones or growth factors; a CD protein such as CD-3, CD4, CD8, and CD-19; an interleukin; an interferon; a T-cell receptor; an enzyme; a viral antigen; a transport protein; a homing receptors; an addressin; a regulatory proteins (e.g., a TAT protein); and a fragment of any of the above-listed polypeptides. In some embodiments, the polypeptide of interest is a single-domain antibody, comprising a single monomeric variable antibody domain, e.g., a single VHH domain. In some embodiments, the single-domain antibody is anti CD40 ligand (“anti CD40L”) single-domain antibody. In some embodiments, the single-domain antibody is Letolizumab.
In some embodiments, the coding sequence encodes an amino acid sequence that is selected from the group consisting of SEQ ID NO: 23, 24, 25 and 27.
In some embodiments, the coding sequence is located between the promoter sequence and the G4 quadruplex motif in the circular DNA template. In some embodiments, the coding sequence is in an expression construct. In some embodiments, the coding sequence has a sequence that is selected from the group consisting of SEQ ID NO: 14, 16, 18, and 26,
A polypeptide of interest produced by the invention can be used for one or more of the following purposes or effects: inhibiting the growth, infection or function of, or killing, infectious agents, including, without limitation, bacteria, viruses, fungi and other parasites; effecting (suppressing or enhancing) bodily characteristics, including, without limitation, height, weight, hair color, eye color, skin, fat to lean ratio or other tissue pigmentation, or organ or body part size or shape (such as, for example, breast augmentation or diminution, change in bone form or shape); effecting biorhythms or circadian cycles or rhythms; effecting the fertility of male or female subjects; effecting the metabolism, catabolism, anabolism, processing, utilization, storage or elimination of dietary fat, lipid, protein, carbohydrate, vitamins, minerals, cofactors or other nutritional factors or component(s); effecting behavioral characteristics, including, without limitation, appetite, libido, stress, cognition (including cognitive disorders), depression (including depressive disorders) and violent behaviors; providing analgesic effects or other pain reducing effects; promoting differentiation and growth of embryonic stem cells in lineages other than hematopoietic lineages; hormonal or endocrine activity; in the case of enzymes, correcting deficiencies of the enzyme and treating deficiency-related diseases; treatment of hyperproliferative disorders (such as, for example, psoriasis); immunoglobulin-like activity (such as, the ability to bind antigens or complement); and the ability to act as an antigen in vaccine composition to raise an immune response against such protein or another material or entity which is cross-reactive with such protein.
The polypeptides produced by the invention can be used for any purpose known to one of skill in the art. Preferred uses include medical uses, including diagnostic uses, prophylactic and therapeutic uses. For example, the proteins can be prepared for topical or other type of administration. Another preferred medical use is for the preparation of vaccines. Accordingly, the proteins produced by the invention are solubilized or suspended in pharmacologically acceptable solutions to form pharmaceutical compositions for administration to a subject. Appropriate buffers for medical purposes and methods of administration of the pharmaceutical compositions are further set forth below. It will be understood by a person of skill in the art that medical compositions can also be administered to subjects other than humans, such as for veterinary purposes.
An RNA polymerase in this disclosure can be any RNA polymerase that can recognize the promoter in the DNA template as described above. Non-limiting examples of RNA polymerases include a T7 RNA polymerase, an SP6 RNA polymerase, or a T3 RNA RNA polymerase.
The rolling circle transcription can be performed in a reaction mixture comprising one or more of the following components: the circular DNA template as described above, an RNA polymerase that recognize the promoter to which gene of interest is operatively linked (e.g., T7 polymerase), and optionally one or more transcription factors directed to optional regulatory sequence to which the template is operatively linked, ribonucleotide triphosphates (rNTPs), a buffer, and optionally other transcription factors and cofactors.
The rolling circle transcription may be performed at a suitable temperature, for example, 25° C.-40° C., or about 37° C. The transcription reaction may last for a period of time that lasts from one hour to overnight.
Optionally, at the end of the rolling circle transcription, RNA transcripts are purified from the reaction mixture using methods well known in the art. In one embodiment, the RNAs may be purified from the transcription mixture using a tubular PAGE column, for example Prepcell 491, available from Bio-Rad (Hercules, Calif.).
Production of DNA Concatemers with G-Quadruplex Motifs
In some embodiments, DNA concatemers having G-quadruplex motifs can be produced by rolling circle amplification using a circular DNA template as disclosed above. These DNA concatemers can form DNA hydrogels.
A rolling circle amplification can be performed using a DNA polymerase that has strand displacement activity, i.e., being able to displace downstream DNA encountered during synthesis. A DNA polymerase having strand displacement activity is able to generate a DNA concatemer having multiple copies of a sequence that is complementary to the circular DNA template. Suitable DNA polymerases that can be used to perform rolling circle amplification include but are not limited to, a Phi29 polymerase, a Bst DNA Polymerase, Large Fragment, and a Deep-VentR DNA polymerase, all available from New England BioLabs (Ipswich, Mass.).
The nucleic acid concatemers produced as described above can form G-quadruplexes.
G quadruplexes can be detected by binding assays that are well known. In some embodiments, they can be detected by assays involving a fluorescent turn-on ligand, thioflavin T (ThT). Umar et al. (2019) and Mohanty et al., 2013. A binding of G quadruplex to ThT would significant enhance the fluorescence intensity, a detection of significant enhancement in fluorescence intensity would indicate the presence of G quadruplex. The RNA transcripts produced by the rolling circle transcription are able to produce G quadruplexes. One illustrative example is shown in
In some embodiments, a G quadruplex can also be visualized by detecting signal associated with self-biotinylation when it is complexed with hemin, as disclosed in Li et al. (2019). In one illustrative embodiment, G-quadruplexes is mixed with hemin in the presence of H2O2 and biotin tyramide. A proper formed G-quadruplexes would self-biotinylates and the biotin groups added to the G-quadruplexes will be able to bind the streptavidin and produce a bright signal. As shown in
In some embodiments, two nucleic acid concatemers are combined to form a single hydrogel, which is referred to as a wideband hydrogel. Each of the two nucleic acid concatemers can be produced by rolling circle transcription or rolling circle amplification from a circular DNA template, and each comprises a promoter and a G4 quadruplex motif One of the two circular DNA templates further comprises a spacer, and the other further comprises a coding sequence for a polypeptide of interest. Any of the spacer and coding sequences described above can be used in the circular DNA templates disclosed herein to produce a wideband hydrogel.
In some embodiments, both nucleic acid concatemers are DNA concatemers. In some embodiments, both nucleic acid concatemers are RNA concatemers. The wideband hydrogel formed by the two RNA concatemers are referred to as W-RG4.
The promoters used in the two circular DNA templates can be the same or be different. Similarly, the G quadruplex motifs in the two circular DNA templates may or may not be the same. Any of the promoters and G quadruple motifs disclosed in this application can be used to form a wideband hydrogel disclosed in this application.
The inventors have discovered surprisingly using the two DNA circular templates at appropriate proportions can improve translation efficiency. The first circular DNA comprises (i) a first promoter sequence, (ii) a sequence complementary to a first G-quadruplex motif, and (iii) a spacer comprising poly thymines. The second circular DNA template comprises (i) a second promoter sequence, (ii) a sequence complementary to a second G-quadruplex motif, and (iii) a coding sequence of the polypeptide of interest. The circle DNA template comprising the spacer is also referred to as “the spacer template,” and the circular DNA template comprising the coding sequence is also referred to as “the coding template.” In some embodiments, the molar fraction of the spacer template in the mixture of both the spacer and the coding templates ranges from 25% to 75%. As shown in
In some embodiments, the spacer template comprising a sequence selected from the group consisting of SEQ ID NO: 6-9, and the coding template comprise a sequence selected from the group consisting of SEQ ID NOs: 14, 16, and 18.
In some embodiments, the ratio of the length of the coding sequence to the length of the spacer sequence is in a range from 1:0.2 to 1:2, or about 1:1.
In some embodiments, the wideband hydrogel is formed by gelation of 1) an RNA concatemer produced from RCT of a circular template comprising a spacer (“a spacer template”) and a G quadruplex motif and 2) an mRNA transcribed from an expression construct comprising a coding sequence for a polypeptide of interest, as described above. In some embodiments, the peptide of interest encoded by the coding sequence in the expression construct consists of at least 20 amino acid residues, at least 30 amino acid residues, at least 40 amino acid residues, at least 60 amino acid residues. In one embodiment, the coding sequence encodes a single domain antibody. In one embodiment, the coding sequence encodes an anti CD40L single-domain antibody (SEQ ID NO: 26). In some embodiments, the expression construct comprises a sequence of SEQ ID NO: 27. In one embodiment, the W-RG4 hydrogel is formed by gelation of 1) a RNA concatemer produced from RCT of a circular DNA template comprising SEQ ID NO: 7 and 2) an mRNA transcribed from a plasmid comprising SEQ ID NO: 26.
In some embodiments, the molar ratio of the expression construct and the spacer template may be in a range from 1:2 to 1:400, e.g., from 1:5 to 1:200, from 1:10 to 1:120, or from 1:12 to 1:102.
Non-limiting examples of expression constructs (e.g., vectors) that can be used include pK7, pIVEX, pET, pTXB, pUC, and pF3K. In some embodiments, the molar ratio of the spacer template to the vector used in the transcription mixture is within a range from 1:1 to 1000:1, e.g., from 10:1 to 200:1.
The G-quadruplexes (e.g., RG4) formed by the nucleic acid concatemer (or the two nucleic acid concatemers as in the wideband system) can self-assemble into a hydrogel. The formation is facilitated by the non-covalent interactions between the guanines among the G-quadruplex motifs. The G-quadruplex hydrogels can be instantly prepared by the addition of various fluids, such as serum, artificial tear, or cell culture media, or phosphate buffered saline to the nucleic acid at ambient temperatures (e.g., 20° C.-40° C.). In some embodiments, gelation may takes 0-100 hours, e.g., from 3-60 hours, or from 3-48 hours. In some embodiments, the gelation may take, e.g., 3, 6, 9, 12, 24, or 48 hours.
Gelation can be detected by various methods. One of the common diagnostic tests of gelation is the vial inversion test. The vial inversion test is performed by placing a vial containing a sample upside down and observing whether the sample flows under its own weight. If a sample does not flow under its own weight, it is a gel.
As shown in
The hydrogels (RG4 or W-RG hydrogels) formed as disclosed above can be molded into different shapes when placed in various polygonal molds. For example, the hydrogels disclosed herein may be molded into circular, triangular, rectangular, and star shapes (
The RG4 gels disclosed herein have excellent viscoelastic and mechanical properties, rendering them ideal platforms for a variety of biological applications. Various methods can be used to assess these properties. In some embodiments, the hydrogel's viscoelastic properties of can be tested using methods well known in the art, for example, rotational assays, oscillational assays, and vertical assays, as described in www.rheologytestingservices.com/, the entire content of which is herein incorporated by reference. In some embodiments, a temperature sweep rheology test is used to measure the viscosity change over increasing and decreasing temperature ramps. In some embodiments, the hydrogel's viscoelastic properties can be examined by using a rotational rheometer, e.g., ARES-G2 (TA Instruments, New Castle, Del.).
In some embodiments, the hydrogel's the stiffness can be evaluated using a Young's modulus test. Young's modulus test defines the relationship between stress (force per unit area) and strain (proportional deformation) in a material in the linear elasticity regime of uniaxial deformation. In one embodiment, the Young's modulus was determined through a compression test on the centimeter scale obtained from the slope of the curve, as described in Hermann et al. (2001). The Young's modulus determined through a compression test on the centimeter scale of the RG4 gel disclosed herein is typically in the range of 12 kPa-100 kPa, e.g., 20 kPa-58 kPa, or about 38.4 kPa. As shown
In one embodiment, an Atomic Force Microscopy (AFM)-based indentation test method on the nanometer scale is used. The AFM-based test is typically used to analyze the elastic modulus of soft and hydrated samples using force curves. Methods for using AFM-based indentation test is well known and as described in (26, 27). The RG4 gel disclosed herein exhibits an excellent time-dependent increase in modulus, and the time-dependent increase in modulus is surprisingly significantly higher than that is reported for DNA-based gels. In one embodiment, the time-dependent increase in modulua in the range of 5 to 20 kPa (e.g., about 10.93 kPa) at 48 hours. One illustrative example is shown in
In some embodiments, storage modulus of the hydrogel can be determined using dynamic mechanical analysis methods. See, Encyclopedia of Polymer Science and Technology, DOI: 10.1002/0471440264.pst102.pub2. In general, these approaches analyze viscoelastic properties of polymeric materials by taking forced oscillatory measurements. In one embodiment, storage modulus of the hydrogels can be measured using a Dynamic Frequency Scan. The RG4 gel disclosed herein has a dominant solid-like structure as indicated by a storage modulus that is higher than the loss modulus at 24 h (
Water retention and absorption capacity of the hydrogels can be analyzed using methods generally described in (31). In one embodiment, the water retention and absorption capacity is determined by measuring the volumetric dehydration and rehydration ratio of the gel, Specifically, the mass of the freshly prepared hydrogel required for the initial mass and the mass of dried hydrogel required for the rehydrated mass were measured to assess the water-retaining and absorbing nature of the RG4 hydrogel. Water retention and absorption capacity can be calculated using Equation 1 below.
Q: swelling degree, the volume ratio of swollen hydrogel with respect to the volume of dried gel (pure gel material without the media) expressing the volumetric increase of the hydrogel when swollen
ρ_1: density of swelling medium (DI water)
ρ_2: density of polymer (gel components excluding the swelling medium)
m_sw: mass of swollen gel
m_d: mass of dried gel
The RG4 gel disclosed in this application has excellent water retention and absorption capacity. The RG4 hydrogel as disclosed herein typically has a swelling degree of 500% to 5000%. One illustrative example is shown in
Additionally, the RG4 hydrogel is capable of undergoing swelling-rehydration cycles, exhibiting a re-swelling degree of at least 400%, at least 500%. In one illustrative embodiment, the RG4 hydrogel showed a re-swelling degree (or a rehydration degree) of 734.2% (
A RG4 gel disclosed herein has high diffusivity. It allows reaction components and products (e.g., ribosomes) to diffuse freely and also permits their ingress and egress through the pores of the hydrogel. These features allows the further enhancement in translation efficiency. The diffusivity of the hydrogel can be assessed by measuring the diffusion velocity of an agent (for example, ThT or a ribosome) across the hydrogel. The diffusion velocity can be determined by the distance traveled by the agent captured on confocal microscope and the time required for the diffusion. In one illustrative embodiment, a theoretical calculation of diffusion velocity of into G4-RNA hydrogel can be calculated using the Equations below (32).
rs: Radius of the solute, 0.7 nm for Thioflavin T (47), 5 nm for a large subunit of the prokaryotic ribosome (48). k: Hydraulic permeability of the medium.
Diffusivity at infinite dilution (D0), porosity of the hydrogel not considered, is given as below by the Stokes-Einstein Law for diffusion in solution (49):
Kb: Boltzmann coefficient, 1.38065×10−23JK−1
η: Dynamic viscosity of the media solvent, 1.0016 mPa·s at 20° C., 0.696 mPa·s at 37° C. (50)
Hydraulic permeability of the medium is given as below (51):
k=0.31rf2φ−1.17 Equation (4)
rf: Radius of the pore of the hydrogel, 5.65 nm estimated by AFM image (
φ: Volume fraction of polymer in the gel, estimated by the mass of dried hydrogel, 0.0852
Molar diffusion flux of the diffusing solute (J) given as below by the Fick's first law (52):
C: Molar concentration of the solute, 10 μM for ThT, 2.4 μM for ribosome
x: Travel distance of the diffusing solute, 573.4 μm for ThT, 10 μm for hydrogel pad
Diffusion velocity of the solute transported into the porous hydrogel (v) is given as below (53):
In one example the time required for a ribosome to completely diffuse into a 20-μm deep hydrogel (33) were in the range from 4.5 to 5.5 m/s. In some cases, the ribosome diffuse 10 μm on one side of the hydrogel in about 1.8 seconds and 2.2 seconds. See
Various ways can be used to measure the pore size of a hydrogel. In one embodiment, the pore size is estimated to be the average distance calculated between the G4 structures in the RG4 hydrogel and/or based on the pore size estimation from the AFM image (
An RG4 hydrogel disclosed herein can not only serve as a scaffold for various applications but also enhance the activities of a bioactive agent (e.g., an enzyme) with which it forms a complex. In some embodiments, the RG4 can boost the activity of a peroxidase (e.g., a hemin) when it forms a complex with the enzyme. The enhancement can be detected using a colormetric reaction involving the substrate of the enzyme, e.g., a colorimetric change of 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS). See
Thus in some embodiments, this disclosure provides an RG4 hydrogel disclosed above that is complexed with a bioactive agent, and optionally the RG4 enhances the activity of the bioactive agent. The enhancement may be at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% relative to the activity of the bioactive agent that is not complexed with the RG4 hydrogel.
Suitable bioactive agents include but are not limited to a biological or chemical compound, such as a polypeptide, an enzyme (e.g., a peroxidase), an antibody, a growth factor, an antigen, liposome, small interfering RNA, or a polynucleotide, therapeutic agent (e.g., drugs, toxins, immune modulators, chelators, antibodies, antibody-drug conjugates, photoactive agents or dyes, and radioisotopes), or a chemoattractant. The bioactive agent may be naturally-occurring or artificially synthesized.
The RG4 hydrogels disclosed herein are stable, with a half-life of at least 30 hours, at least 35 hours, or at least 40 hours. The term “half-life,” when used in connection with a nucleic acid hydrogel, refers to the time required for the nucleic acid content in the gel to reduce to 50% of its initial amount. The half-life of the RG4 hydrogel is significantly longer than the RGx solution (
Not only the RNA in the RG4 degrades slower, but the formation of G quadruplex in RG4 prolongs RNA synthesis time during the transcription stage. As shown in
A RG4 hydrogel produced as described herein can be used for cell-free protein synthesis. In some embodiments, the translation is uncoupled with the transcription so that the RG4 hydrogel forms before the initiation of translation. A cell-free protein synthesis translation mixture may include, but are not limited to, one or more cell extracts/lysates, ATP or energy source (e.g., pyruvate, glucose, and glutamate), co-factors, enzymes and other reagents that are necessary for polypeptide services, e.g., ribosomes, tRNA, polyamines polymerase transcriptional factors, aminoacyl synthetases, chaperones, elongation factors, initiation factors, and the like. Other components that may be useful in a cell-free protein synthesis system are described in methods for cell-free synthesis are described in Spirin & Swartz (2008) Cell-free Protein Synthesis, Wiley-VCH, Weinheim, Germany.
In some embodiments, cell lysates (also referred to as lysates) used in the translation reaction may be prepared by lysing cells under conditions to preserve the transcription and/or the translationary machinery. Nonlimiting examples of the cell types that can be used to prepare cell lysates from include, E. coli cells, insect cells, yeast cells, Chinese hamster ovary cells, rabbit reticulocytes, wheat germ cells, and Hela cells. In some embodiments, cell lysates include components that are required for translation. Such components include a ribosome, amino acids, tRNA, tRNA synthetase, energy sources (Creatine phosphate), Creatine kinases, and/or any combinations thereof. Cell lysates and methods for their production are also disclosed in, Kuruma and Ueda Nature Protocols 10, 1328-1344 (2015) and Gregorio et al., Methods. Protoc. 2019 March; 2 (1): 24, the entire disclosures of which are herein incorporated by reference. Cell-free protein synthesis reagents are commercially available, for example, from New England Biolabs (Ipswich, Mass.).
If the hydrogel is a DNA hydrogel, it can be first transcribed into RNA using reagents and conditions suitable for an in vitro transcription, as discussed above, and then subject to the cell-free protein system disclosed herein.
A nucleic acid hydrogel disclosed herein, e.g., a W-RG4 gel, can produce proteins in high quantities. In one illustrative example, the protein expression yield of W-RG4 showed a 117-fold enhancement of expressing HiBiT, an 11 amino-acid peptide tag, over the free DNA template (fDNA) and an 8-fold enhancement over the free RNA (fRNA) template. Free DNA/RNA template refers to DNA/RNA that is in solution. See
Optionally, parameters such as chaotropic treatment, reaction time, temperature, volume can be modified to maximize the protein yield of the nucleic acid hydrogel protein production system. In one approach, the translation reaction is controlled so that it lasts no more than 12 hours, no more than 10 hours, no more than 6 hours, no more than 5 hours, no more than 4 hours, no more than 3 hours, or no more than 2 hours. In one exemplary assay, the protein production is shown to peak around 2 hours from the translation initiation. See
In one approach, the reaction temperature is controlled at a temperature that is in a range from 16° C. to 37° C., e.g., 25° C. See
Proteins can be harvested and purified at the conclusion of the translation process. Methods for protein purification, chromatography, electrophoresis, centrifugation, and crystallization are described in Coligan et al. (2000) Current Protocols in Protein Science, Vol. 1, John Wiley and Sons, Inc., New York.
In some embodiments, cell lysates as described above are added to the transcription reactions that generate RG4 concatemers. The hydrogels formed by these RG4 concatemers contain cell lysates and thus they are referred to herein as lysate-embedded hydrogels (e.g., lysate-embedded W-RG4 hydrogels). In contrast, hydrogels formed by transcripts in the absence of any cell lysates are referred to as lysate-free hydrogels. Unless specifically noted otherwise, a W-RG4 hydrogel disclosed in this disclosure is a lystate-free W-RG4 hydrogel.
The volume ratio of cell lysates to the transcription mixture (excluding the cell lysate) may vary. In some cases the volume ratio is in a range from 1:1 to 1:3, e.g., about 1:2, or about 1:2.5.
Surprisingly, these lysate-embedded hydrogels are able to produce proteins at a much higher yield than the corresponding lysate-free hydrogels under the same translation conditions, and the protein yield reached the peak level within a shorter time than the corresponding lysate-free hydrogels. A lysate-embedded W-RG4 and its corresponding lysate-free W-RG4 share the same nucleic acid components. One illustrative example is shown in
It has also been found that it is desirable to control the duration of the transcription reaction that is used to produce lysate-embedded hydrogels. Production efficiency of the W-RG4 hydrogels may decrease if transcription proceeds for relatively a long time (e.g., 48 hours). See
In some embodiments, the lysate-embedded hydrogel is combined with a translation mixture that does not contain any cell lysates. As shown in
As disclosed above, the W-RG4 hydrogel can produce proteins in high-efficiency and high-yield. In some embodiments, the hydrogel is cut to improve the translation components' approachability, thus further improving translation efficiency. Cuts can be introduced by various means, for example, by piercing the hydrogel using pipette tips. The number of cuts made to the hydrogel is referred to as the cut-out number. In some embodiments, the W-RG4 has a cut-out number in the range of 250 to 400, e.g., about 300. One illustrative example is shown in
This application also provides kits for expressing a polypeptide of interest. In some embodiments, the kit comprises a single-stranded DNA molecule capable of forming a circular DNA template by hybridizing to a splint oligonucleotide. The circular DNA comprises (i) a promoter sequence, (ii) a sequence complementary to a G-quadruplex motif, and (iii) a coding sequence for a polypeptide of interest or a spacer. The splint oligonucleotide is complementary to the promoter sequence.
In some embodiments, the kit comprises a first single-stranded DNA molecule capable of forming a first circular DNA template by hybridizing to a first splint oligonucleotide, a second single-stranded DNA molecule capable of forming a second circular DNA template by hybridizing to a second splint oligonucleotide. The first circular DNA comprises (i) a first promoter sequence, (ii) a sequence complementary to a first G-quadruplex motif, and (iii) or a spacer. The second circular DNA comprises (i) a second promoter sequence, (ii) a sequence complementary to a second G-quadruplex motif, and (iii) or a spacer. The kit may further comprise the first splint oligonucleotide having a sequence that is complementary to the first promoter sequence and/or the second splint oligonucleotide having a sequence that is complementary to the second promoter sequence. In one embodiment, the first and/or the second split oligonucleotide has a sequence of SEQ ID NO: 12.
A kit disclosed herein may further comprise one or more reagents useful for performing the circularization of the DNA template and/or rolling circle transcription. These reagents include, but are not limited to, a ligase, an RNA polymerase, one or more ribonucleotide triphosphates (rNTPs), and a buffer suitable for transcription.
In some embodiments, the kit may further comprise one or more reagents suitable for the in vitro translation, such as, a ribosome, and a mixture of amino acids.
The following examples are offered for illustrative purposes, and are not intended to limit the invention. Those of skill in the art will readily recognize a variety of non-critical parameters that can be changed or modified to yield essentially the same results.
A first circular DNA template comprising (i) a first promoter sequence and (ii) a sequence complementary to a first G-quadruplex motif.
The first circular DNA template of embodiment 1, wherein the first promoter sequence is hybridized to a complementary nucleic acid sequence to form a first partially double-stranded DNA molecule, wherein the first partially double-stranded DNA molecule comprises a double-stranded region and a single-stranded region, wherein the double-stranded region comprises the first promoter sequence hybridized to the complementary nucleic acid sequence, and wherein the single-stranded region comprises the sequence complementary to the first G-quadruplex motif.
The first circular DNA template of any of the previous embodiments, further comprising a spacer, wherein the spacer comprises poly thymines.
The first circular DNA template of any of the previous embodiments, further comprising a coding sequence of a polypeptide of interest.
The first circular DNA template of any of the previous embodiments, wherein the sequence complementary to the first G-quadruplex motif comprises a sequence of ACCCTAACCCTA (SEQ ID NO: 1).
The first circular DNA template of any of the previous embodiments, wherein the first promoter sequence is selected from the group consisting of a T7 promoter, a T3 promoter, a Lac promoter, an araBad promoter, a Trp promoter, a Tac promoter, and an SP6 promoter.
A first nucleic acid concatemer comprising a plurality of monomers, wherein each monomer comprises (i) a first G-quadruplex motif, and (ii) a spacer comprising poly thymines or a coding sequence for a polypeptide of interest.
The first nucleic acid concatemer of embodiment 7, wherein the first nucleic acid concatemer is an RNA concatemer, wherein the first G-quadruplex motif comprises UAGGGUUAGGGU (SEQ ID NO: 2).
The first nucleic acid concatemer of any of embodiment 7-8, wherein the first nucleic acid concatemer is a DNA concatemer, wherein the first G-quadruplex motif comprises TAGGGTTAGGGT (SEQ ID NO: 20).
A nucleic acid hydrogel comprising the first nucleic acid concatemer of any of the embodiments 7-9.
A protein expression system comprising the nucleic acid hydrogel of embodiment 10, a ribosome, and/or a mixture of amino acids.
A composition comprising a first circular DNA template and a second circular DNA template, wherein the first circular DNA template comprises (i) a first promoter sequence, (ii) a sequence complementary to a first G-quadruplex motif, and (iii) a spacer comprising poly thymines, wherein the second circular DNA template comprises (i) a second promoter sequence, (ii) a sequence complementary to a second G-quadruplex motif, and (iii) a coding sequence of a polypeptide of interest; and wherein the molar fraction of the first circular DNA template relative to the total amount of first and second circular DNA templates ranges from 25% to 75%.
The composition of embodiment 12, (1) wherein the first promoter sequence is hybridized to a complementary nucleic acid sequence to form a first partially double-stranded DNA molecule, wherein the first partially double-stranded DNA molecule comprises a double-stranded region and a single-stranded region, wherein the double-stranded region of the first partially double-stranded DNA molecule comprises the first promoter sequence hybridized to the complementary nucleic acid sequence, and wherein the single-stranded region of the first partially double-stranded DNA molecule comprises the sequence complementary to the first G-quadruplex motif, and
(2) wherein the second promoter sequence is hybridized to a complementary nucleic acid sequence to form a second partially double-stranded DNA molecule, wherein the second partially double-stranded DNA molecule comprises a double-stranded region and a single-stranded region, wherein the double-stranded region of the second partially double-stranded DNA molecule comprises the second promoter sequence hybridized to the complementary nucleic acid sequence, and wherein the single-stranded region of the second partially double-stranded DNA molecule comprises the sequence complementary to the second G-quadruplex motif
The composition of embodiment 12 or 13, wherein the first G-quadruplex motif and the second G-quadruplex motif comprise the same nucleotide sequence.
The composition of any of embodiments 12-14, wherein the first promoter sequence and the second promoter sequence comprise the same nucleotide sequence.
The composition of any of the embodiments 12-15, wherein the first promoter sequence and the second promoter sequence comprise different nucleotide sequence.
The composition of any of the embodiments 12-16, wherein spacer comprises 30-120 thymines (SEQ ID NO: 32).
The composition of any of the embodiments 12-17, wherein the coding sequence has a length that is within a range from 20 to 300 nucleotides.
The composition of any of the embodiments 12-18, wherein the length ratio of the coding sequence to the spacer is within a ranges from 1:0.2 to 1:2.
The composition of any of the embodiments 12-19, wherein the polypeptide of interest is selected from the group consisting of insulin, Trans-activating transcriptional activator (TAT), HiBiT, and a single domain antibody.
The composition of any of the embodiments 12-20, further comprising one or more RNA polymerases, a mixture of ribonucleotides, and/or a buffer.
The composition of any of embodiments 12-20, further comprising a DNA polymerase having a strand replacement activity and thus is capable of performing a rolling circle amplification.
A composition comprising a circular DNA template and a double-stranded DNA construct, wherein the circular DNA template comprises (i) a first promoter sequence, (ii) a sequence complementary to a first G-quadruplex motif, and (iii) a spacer comprising poly thymines, wherein the double-stranded DNA construct comprises (i) a second promoter sequence, (ii) a sequence complementary to a second G-quadruplex motif, and (iii) a coding sequence of a polypeptide of interest.
A nucleic acid hydrogel comprising a first nucleic acid concatemer and a second nucleic acid concatemer, wherein the first nucleic acid concatemer is produced by rolling circle transcription or amplification of the first circular DNA template of the composition of any one of embodiments 12-20, and wherein the second nucleic acid concatemer is produced by rolling circle transcription or amplification of the second circular DNA template of the composition of any one of embodiments 12-20.
A nucleic acid hydrogel comprising a first RNA molecule and a second RNA molecule, wherein the first RNA molecule comprises (i) a first G-quadruplex motif, and (ii) a spacer comprising poly adenines, and wherein the second RNA molecule comprises (i) a second G-quadruplex motif, and (ii) a coding sequence for a polypeptide of interest.
The nucleic acid hydrogel of embodiment 25, wherein the first RNA molecule is a n RNA concatemer comprising a plurality of monomers and wherein each monomer comprising the first G-quadruplex motif, and the spacer comprising poly adenines or a coding sequence for a polypeptide of interest.
A protein expression system comprising the nucleic acid hydrogel of any one of embodiment 24-26s, a ribosome, and/or a mixture of amino acids.
A kit for expressing a polypeptide of interest, wherein the kit comprises (1) a first DNA molecule capable of forming a first circular DNA template by hybridizing to a first splint oligonucleotide, wherein the first circular DNA template comprises (i) a first promoter sequence, (ii) a sequence complementary to a first G-quadruplex motif, and (iii) a spacer comprising poly thymines,
(2) the first splint oligonucleotide that is complementary to the first promoter sequence, wherein the first DNA template can hybridize to first splint oligonucleotide and be circularized to form a first circular DNA template, and/or
(3) a second DNA molecule capable of forming a second circular DNA template by hybridizing to a second splint oligonucleotide, wherein the second circular DNA template comprises (i) a second promoter sequence, (ii) a sequence complementary to a second G-quadruplex motif, and (iii) a coding sequence of the polypeptide of interest,
(4) the second splint oligonucleotide that is complementary to the second promoter sequence, wherein the second DNA template can hybridize to the second splint oligonucleotide and be circularized to form a second circular DNA template.
A kit for expressing a polypeptide of interest, wherein the kit comprises the composition of any one of embodiments 12-23.
The kit of embodiment 28 or 29, wherein the first G-quadruplex motif and the second G-quadruplex motif have the same or different sequence.
The kit of embodiment 28 or 29, wherein the first promoter sequence and the second promoter sequence are the same or different.
The kit of any one of embodiments 28-31, wherein spacer comprises 30-120 thymines (SEQ ID NO: 32).
The kit of any one of embodiments 28-32, wherein the coding sequence has a length that ranges from 20 to 300 nucleotides.
The kit of any one of embodiments 28-33, wherein the length ratio of the coding sequence to the spacer is within a range from 1:0.2 to 1:2.
The kit of any one of embodiments 28-34, wherein the polypeptide of interest is selected from the group consisting of insulin, HiBiT, a Trans-activating transcriptional activator (TAT), and a single domain antibody.
The kit of any one of embodiments 28-35, further comprising one or more DNA ligases, RNA polymerases, a mixture of ribonucleotides, and/or one or more buffers.
The kit of any one of embodiments 28-36, further comprising a DNA polymerase having a strand replacement activity and thus is capable of performing a rolling circle amplification.
A method of preparing a nucleic acid hydrogel comprising: (1) providing a first circular DNA template comprising (i) a first promoter sequence, and (ii) a sequence complementary to a first G-quadruplex motif; and (2) performing a rolling circle transcription or amplification on the first circular template to produce a first nucleic acid concatemer, wherein the first nucleic acid concatemer forms a nucleic acid hydrogel.
The method of embodiment 38, wherein the first circular DNA template further comprises a spacer comprising poly thymines, wherein the step (1) further comprises providing a second circular DNA template comprising (i) a second promoter sequence, (ii) a second G-quadruplex motif, and (iii) a coding sequence of a polypeptide of interest, and wherein the step (2) further comprises performing a rolling circle transcription or amplification of the second circular DNA template to produce a second nucleic acid concatemer, wherein the first and second nucleic acid concatemers form the nucleic acid hydrogel.
A method for producing a protein in a cell-free synthesis system, wherein the method comprises: combining the nucleic acid hydrogel of claim 10 or 24-26 with a cell-free synthesis system under conditions permitting translation of the polypeptide of interest.
The method of embodiment 40, wherein the cell-free synthesis system comprises a ribosome and/or a mixture of amino acids.
Sodium chloride, potassium chloride, sodium phosphate monobasic, sodium phosphate dibasic, agarose, DMSO (dimethyl sulfoxide), hemin, ABTS, and H2O2 were purchased from Sigma Aldrich. UltraPure Dnase/Rnase-Free distilled water, SYBR green II, ThT, and FBS were purchased from Invitrogen. 30% acrylamide-bis-acrylamide solution (29:1), APS (ammonium persulfate), and 10×TBE (Tris/boric acid/EDTA) buffer were purchased from PanReac Applichem. Biotin tyramide was purchased from Iris Biotech, and streptavidin was purchased from Rockland Immunochemicals. Urea was purchased from Daejung.
UltraPure Dnase/Rnase-Free distilled water was used for all experiments unless otherwise specified. The annealing protocol in this disclosure was a gradual cooling from 95° C. to 4° C. at 0.5° C./30s unless otherwise specified.
The RG4 hydrogel was fabricated through self-assembly of RNA transcribed using rolling circle transcription (RCT). The circular template for the RCT was fabricated by ligating a linear template with the G-quadruplex moiety, a coding sequence for a protein of interest, and the T7 promoter. The linear template was annealed with a short strand containing a partial complementary sequence and a T7 promoter primer to form a circular template. The concentration of each strand was 45 μM in 100 mM NaCl. The annealed circular template was ligated with T4 DNA ligase (Promega). The concentration of the annealed template was 10 μM, and the volume of the buffer and T4 DNA ligase was provided by a T4 DNA ligase kit, in which 0.1× of the total ligation solution and the mixture were incubated at 16° C. for 16 hours. The RNA was transcribed using a Hiscribe T7 High Yield RNA Synthesis Kit (New England Biolabs) with 1 μM ligated circular template followed by incubation at 37° C. Although the maximum yield of RNA was expected to be reached after 2 hours of incubation, the process was continued for 48 hours after initiation of transcription. The same mole number of starting materials was used for all the templates.
Letolizumab-G4 in pIDTBlue plasmid (Integrated DNA technologies, Coralville, Iowa) was digested with NdeI and SalI and cloned into pK7 plasmid to generate the pK7-Letolizumab-G4 plasmid. 20 ng of plasmid was used as a positive control for cell-free expression, and 20 ng plasmid was transcribed together with 0.125 μM, 0.25 μM, 0.5 μM, 0.75 μM, or 1 μM spacer template for 60 T RG4 to induce gelation.
The rheological properties of the RCT products were characterized by an ARES-G2 (TA Instruments) with 200 μL of the RCT products prepared in cylindrical molds.
Confocal microscope analysis. Thinly prepared RG4 hydrogel fabricated between cover glasses was stained with SYBR green II and visualized through an LSM 710 confocal microscope (Zeiss).
Field-Emission scanning electron microscope (FE-SEM) analysis. The RG4 hydrogel and RGx were frozen at −80° C. and lyophilized for 24 hours. The lyophilized samples were coated with iridium and characterized using SEM (JEM ARM200F, Jeol) at a voltage of 15.0 kV.
AFM analysis. Force-indentation curves for the RCT products were obtained using the ScanAsyst mode with commercially available DNP-S probe cantilevers (nominal spring constant of 0.12 N/m, tip radius of 10 nm, drive frequency of 16-28 kHz) with an aluminum reflux coating. The approach curve was used to measure the Young's modulus of the hydrogel by fitting a Hertzian contact mechanics model. The surface topography of the RCT products was analyzed using a multimode scanning probe microscope with a Nanoscope V controller (Bruker Inc.) in air using peak force tapping mode. The obtained topographical images were flattened to remove the background slope and contrast. We dispensed 30 μL of transcription mix onto the mica substrate to ensure flat fabrication of the RG4 hydrogel.
Streptavidin labeling. RCT products were prepared on mica and incubated with 200 μL of 100 μM hemin solution (20 mM phosphate buffer at pH 7.9, 1% DMSO, 0.1% Triton-X, 100 mM NaCl, 100 mM KCl) for 3 hours. Then 50 μL of 6 mM biotin tyramide (20 mM phosphate buffer at pH 7.9, 1% DMSO, 0.1% Triton-X, 100 mM NaCl, 100 mM KCl) and 50 μL of 4.5 mM H2O2 (20 mM phosphate buffer at pH 7.9, 1% DMSO, 0.1% Triton-X, 100 mM NaCl, 100 mM KCl) were added consecutively at 5 min intervals. We added 10 μL of 10 μM streptavidin solution after removing the reaction solution. Topographic analysis was conducted after thorough washing of unbound streptavidin using 100 mM KCl.
Quantification of RNA. The quantity of transcribed RCT products was measured with a Qubit Flex Fluorometer (Invitrogen) using an RNA BR Assay Kit (Invitrogen) after annealing to ensure the required 50× dilution.
CD spectroscopy. CD spectra were recorded to identify the conformational states responsible for the quadruplex and non-quadruplex RNA-developing analogs, sG4 and sGx, respectively, with a J-815 CD spectrometer (JASCO) in the wavelength range of 220 nm to 300 nm.
Characterization of the fluorescence signal from RG4-bound ThT. We mixed 10 d of 1 μM sG4 and sGx with 40 μL of 10 μM ThT solution in 100 mM NaCl and 100 mM KCl and measured the fluorescence spectra (λex=440 nm, λem=460-510 nm) through a fluorometer (SpectraMax M5, Molecular Devices) after 15 min.
Enzymatic activity of RG4-bound hemin. We incubated 10 μL of transcribed RCT products with 40 μL of 100 μM hemin solution (20 mM phosphate buffer at pH 7.9, 1% DMSO, 0.1% Triton-X, 100 mM NaCl, 100 mM KCl) for 16 hours. Then 25 μL of 3.2 mM ABTS2−(20 mM phosphate buffer, varying pH from 4.4 to 7.9, 1% DMSO, 0.1% Triton-X, 100 mM NaCl, 100 mM KCl) and 25 μL of 0.3 mM H2O2 (20 mM phosphate buffer, varying pH from 4.4 to 7.9, 1% DMSO, 0.1% Triton-X, 100 mM NaCl, 100 mM KCl) were added consecutively to the solution with thorough mixing. The colorimetric change of the solution at =390 nm, caused by oxidation of ABTS2− into ABTS•−, was characterized continuously with a spectrophotometer (SpectraMax M5, Molecular Devices) for 4 hours.
Diffusion of ThT into the RG4 hydrogel. ThT solution at a concentration of 10 μM was added to RG4 hydrogel fabricated on a cover glass ensuring that no ThT was absorbed onto the top or bottom of the hydrogel.
Polyacrylamide gel (PAGE) electrophoresis (12%) was used to characterize the annealed and ligated circular templates, and 2% agarose gel was used to characterize the transcribed RNA after annealing. Pre-cast Mini-PROTEAN® Tris-tricine SDS-PAGE gel (16.5%) was performed for the separation of Letoluzimab protein from the total cell-free expression.
Characterization of degradation. We mixed 10 μL of the RCT products with 40 μL of 100% FBS (fetal bovine serum) to provide an Rnase-rich environment. To characterize the total amount of RNA, samples were stored at −20° C. after each time interval to minimize the further effects of serum, followed by annealing for gel electrophoresis analysis using Weibull fit model.
We used 11 μL of RCT products as templates for a 50 μL batch of uncoupled translations with a NEBExpress® Cell-free E. coli Protein Synthesis system (New England Biolabs). T7 polymerase, which was provided separately in the kit, was deliberately excluded. Translation was carried out at 25° C. for 2 hours, unless otherwise specified. We pierced the protein-encoded RG4 hydrogels with pipette tips to enhance the protein expression yield, and the gel cut 300 times showed the best yield. The ligated DNA templates (1 μM), fDNA and fRNA templates, and an equalized number of starting materials were used as control templates for coupled translation. For uncoupled translation, 11 μL of the 75% W-RG4 was mixed with wheat germ extract in a total volume of 50 μL at 25° C. for 2 hours, following the manual provided by the manufacturer except for fRNA where 10 g was used. Varying volumes of template solutions were used to estimate protein efficiency.
For uncoupled translation of Letoluzimab, 12 μL of RCT products as templates for a 50 μL batch of uncoupled translations with a NEBExpression® Cell-free E. coli Protein Synthesis system (New England Biolabs). Translation kit components were used in which T7 polymerase was deliberately excluded. It was found that optimal protein expression were reached when the translation last for 8 hours at 30° C.
Characterization of Luminescence from Expressed HiBiT-Tagged Protein
We mixed 2 μL of post-treatment translation product with 8 μL of HiBiT detection reagent in a Nano-Glo® HiBiT Extracellular Detection System (Promega). The resulting luminescent signal was characterized by a luminometer (SpectraMax M5, Molecular Devices) after 4 min of orbital shaking. Then, heat-inhibition at 95° C. for 10 mins was conducted. The mixture was incubated with an equal volume of 8 μM urea for 2 hours to solubilize the aggregated protein. The relative luminescence units (RLUs) were normalized with respect to the luminescence of a blank cell.
A G-quadruplex motif from the secondary structure of the telomeric RNA repeat in nature (12, 13) were selected to fabricate a programmed DNA-driven RNA gel in which RNA transcribed from a DNA template serves as building blocks, crosslinkers, and functional items. We also embedded spacer sequences as poly thymines (poly T) or functional motifs such as a protein-encoding moiety in the assemblage. A single-stranded DNA template (any one of SEQ ID NO: 4-10) and the T7 promoter primer (SEQ ID NO: 12) were annealed to form circular DNA, followed by T4 enzymatic ligation (
Gelation of RG4 with respect to synthesis time was evaluated using vial inversion tests. In this experiment, gelation times were 0, 48 hours for RGx and 0, 3, 6, 9, 12, 24, 48 hours for RG4 from left to right (
Spacer lengths with varied numbers of thymines (3T, 10T (SEQ ID NO: 38), 30T (SEQ ID NO: 33), 60T (SEQ ID NO: 34), 90T (SEQ ID NO: 35), and 120T (SEQ ID NO: 36)) were also tested to evaluate the versatile gelating behavior of RG4 (
We precisely patterned the RG4 gels into circular, triangular, rectangular, and star shapes (
The structural features of the engineered RG4 concatemer (comprising SEQ ID NO: 2) and their specific responses to the dose of salt solution were analyzed through the ellipticity changes in their circular dichroism (CD) spectra, which exhibited a parallel fold of the G-quadruplex (15-17) (
The ability of the RG4 gel to perform peroxidase activity when complexed with hemin was investigated to validate the existence and intrinsic function of the G4s in the RG4 gel in a pH range from 4.4 to 7.9 (
The Young's modulus of the RG4 gels was tested to assess the gels' mechanical properties. The Young's modulus determined through a compression test on the centimeter scale was 38.4 kPa, obtained from the slope of the curve (23) (
The water retention and absorption capacity of the RG4 gel were analyzed by measuring the volumetric dehydration and rehydration ratio of the gel (31) (
We analyzed the behavior of ThT and ribosome diffusion into the porous hydrogel both experimentally and theoretically. The distance traveled by the ThT was captured on confocal microscope which was 573.4 μm in 1550 s (
The diffusion velocities of the ligands indicate that they are not only able to move freely within the hydrogel network, but also permits ingress and egress of reagents through its controllable pore size. Pore size was estimated based on the average distance calculated between the G4 structures in the RG4 hydrogel and the pore size estimation from the AFM image (
Degradation study (
Influenced by those properties of the RG4 hydrogel, we evaluated its protein production ability as sketched (
With this confidence, we further explored the aspect of therapeutic protein production which is a pressing need in the health care system. Trans-activating transcriptional activator (TAT) and insulin proteins were chosen due to their significance in therapy where a rational formulation of protein therapeutics can be delivered with the use of RNA hydrogel. The TAT encoding sequence used in this study includes a partial 10-amino acid functional basic region of the HIV (human immunodeficiency virus) TAT protein SEQ ID NO:24 (35). The insulin encoding sequence used in this study includes a 30-amino acid B-chain of human insulin SEQ ID NO: 23 (36).
TAT and insulin templates (SEQ ID NOs: 16 and 18, respectively) embedded with a HiBiT tag possessed 10- and 18-fold increase in W-RG4 compared with the fDNA templates, respectively (
We also tested the protein production of 14 kDa single-domain antibody Letolizumab using the W-RG4 approach (
The RCT products from the 60T RG4 template and mRNA transcripts from the plasmid together form a W-RG4 hydrogel. Translation was performed at 30° C. for 8 hours.
Lystate embedding W-RG4 gel were produced by mixing the following ingredients, shown in Table 3, below.
1.1 μl of a template mixture containing 75% HiBiT-RG4 template (SEQ ID NO: 14) and 25% of the spacer template for 30T-RG4 (SEQ ID NO: 6), the spacer template for 90T-RG4 (SEQ ID NO: 8), or the spacer template for 150T-RG4 (SEQ ID NO: 11), were added to the transcription reaction mixture above. 75% and 25% refer to the respective molar fraction of the HiBiT-RG4 template and the spacer template in the total template mixture. The transcription reaction mixture was incubated at 37° C. for 3 hours or 48 hours, during which the RNA transcripts were produced from these templates and form a hydrogel.
Lysate-free W-RG4s expressing HiBiT were produced using the same protocol as above except no lysate/Rnase Inhibitor mixture was added. In addition, 3.3 μl Dnase-free, Rnase-free water was used in producing lysate-free W-RG4s as opposed to 0.3 μL for producing the lysate-embedded W-RG4.
After hydrogels were formed, translation reactions were carried out using the NEBExpress Cell-free E. coli Protein Synthesis System (NEB #E5360). 11 μl of lysate-free W-RG4 or lysate-embedded W-RG4 was incubated with 25 μL protein synthesis buffer, 10 μL lysate/Rnase inhibitor mixture (a volume ratio of the lysate to the Rnase inhibitor was 12 to 1), and 104 μL Dnase free Rnase free water to initiate protein translation. Translation reactions were kept at 25° C. and terminated after two hours.
As shown in
Effects of cell lysates in the translation reaction mixtures on protein production were tested, and the results are shown in
For all purposes in the United States of America, each and every publication and patent document referred to in this disclosure is incorporated herein by reference in its entirety for all purposes to the same extent as if each such publication or document was specifically and individually indicated to be incorporated herein by reference.
While the invention has been described with reference to the specific examples and illustrations, changes can be made and equivalents can be substituted to adapt to a particular context or intended use as a matter of routine development and optimization and within the purview of one of ordinary skill in the art, thereby achieving benefits of the invention without departing from the scope of what is claimed and their equivalents.
In this listing of illustrative sequences, the underlined represent the G-quadruplex motif The double underlined represent the scrambled G-quadruplex motifs. All sequences are listed in the direction of 5′→3′.
TCACCATATTTTTTCCTCCTTATACTTAATCCCT
ACAGTAACAGTA
TTAGCTAATCTTCTTGAACAGCCGCCAGCCGCTCACCATATTTTTTCC
TCCTTATACTTAATCCCTTATAGTGAGTCGTATTA
TC
ACTCTTCGTCGCTGTCTCCGCTTCTTCCTGCC
CATATTTTTTCCTCCTTATACTTAATCCCT
ACAGTAACAGTA
TTAGCTAATCTTCTTGAACAGCCGCCAGCCGCTC
ACTCTTCGTCGCTGT
CTCCGCTTCTTCCTGCC
CATATTTTTTCCTCCTTATACTTAATCCCTATAGTGAGTCGTATTA
TC
ACGGTGTTGGGTGTGTAGAAGAAGCCTCGTTCCCCGCACACTAGGTAGAGAGCTTCCACCAGG
TGTGAGCCGCACAGGTGTTGGTTCACAAA
CATATTTTTTCCTCCTTATACTTAATCCCT
ACAGTAACAGTA
TTAGCTAATCTTCTTGAACAGCCGCCAGCCGCTC
ACGGTGTTGGGTGTGTAGAAGAAGCCTCGTTCCCCGCACACTAGGTAGAGAGCTTCCACCAGGTG
TTAGCTAATCTTCTTGAACAGCCGCCAGCCGCTCAC
GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCTAA
| Number | Date | Country | Kind |
|---|---|---|---|
| 10-2019-0136416 | Oct 2019 | KR | national |
| 10-2020-0077146 | Jun 2020 | KR | national |
