PRRSV vaccines

[0001] The invention relates to the field of PRRS viruses and infectious clones obtained from PRRS viruses. Furthermore, the invention relates to vaccines and diagnostic assays obtainable by using and modifying such infectious clones of PRRS viruses.

[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) is a positive-strand RNA virus that belongs to the family of arteriviruses together with equine arteritis virus (EAV), lactate dehydrogenase-elevating virus (LDV) and simian hemorrhagic fever virus (Meulenberg et al., 1993). Recently, the International Committee on the Taxonomy of Viruses has decided to incorporate this family in a new order of viruses, the Nidovirales, together with the Coronaviridae (genomic length 28 to 30 kb), and Toroviridae (genomic length 26 to 28 kb). The order Nidovirales represents enveloped RNA viruses that contain a positive-stranded RNA genome and synthesize a 3′ nested set of subgenomic RNAs during replication. The subgenomic RNAs of coronaviruses and arteriviruses contain a leader sequence which is derived from the 5′ end of the viral genome. The subgenomic RNAs of toroviruses lack a leader sequence. Whereas the ORFs 1a and 1b, encoding the RNA dependent RNA polymerase, are expressed from the genomic RNA, the smaller ORFs at the 3′ end of the genomes of Nidovirales, encoding structural proteins, are expressed from the subgenomic mRNAs.

[0003] A replicon herein is defined as derived from a recombinant nucleic acid. Although genomic information regarding PRRSV is now emerging, it is for example not known where deletions or modifications in the PRRSV genome can be located so that the resulting recombinant nucleic acid can be used as a functional replicon allowing in vivo RNA replication, be it in (complementary) cells expressing essential (PRRS) viral proteins (such as polymerase or structural (envelope) proteins or not, or allowing independent in vivo RNA replication in animals, such as pigs, after vaccination with a vaccine comprising a nucleic acid encoding such a PRRS replicon.

[0004] PRRSV (Lelystad virus) was first isolated in 1991 by Wensvoort et al. (1991) and was shown to be the causative agent of a new disease now known as porcine reproductive respiratory syndrome (PRRS). The main symptoms of the disease are respiratory problems in pigs and abortions in sows, sometimes complicated by sow-mortality. Although the major outbreaks, such as observed at first in the US in 1987 and in Europe in 1991, have diminished, this virus, in its various virulent or less-virulent forms, still causes major economic losses in herds in the US, Europe, and Asia.

[0005] PRRSV preferentially grows in alveolar lung macrophages (Wensvoort et al., 1991). A few cell lines, such as CL2621 and other cell lines cloned from the monkey kidney cell line MA-104 are also susceptible to the virus. Some well known PRRSV strains are known under accession numbers CNCM I-1102, I-1140, I-1387, I-1388, ECACC V93070108, or ATCC VR 2332, VR 2385, VR 2386, VR 2429, VR 2474, and VR 2402. The genome of PRRSV is 15 kb in length and contains genes encoding the RNA dependent RNA polymerase (ORF1a and ORF1b) and genes encoding structural proteins (ORFs 2 to 7; Meulenberg et al., 1993 and Meulenberg et al., 1996). ORF5 encodes the major envelope glycoprotein, designated GP5. The ORFs 2, 3, and 4 encode glycoproteins designated GP2, GP3, and GP4, respectively. These glycoproteins are less abundantly present in purified virions of the Lelystad virus isolate of PRRSV. The GP5 protein forms a di-sulfide-linked heterodimer with the membrane protein M encoded by ORF6. The nucleocapsid protein N is encoded by ORF7. The analysis of the genome sequence of PRRSV isolates from Europe and North America, and their reactivity with monoclonal antibodies has proven that they represent two different antigenic types. The isolates from these continents are genetically distinct and must have diverged from a common ancestor relatively long ago (Murtaugh et al., 1995).

[0006] Pigs can be infected by PRRSV via the oronasal route. Virus in the lungs is taken up by lung alveolar macrophages and in these cells replication of PRRSV is completed within 9 hours. PRRSV travels from the lungs to the lung lymphnodes within 12 hours and to peripheral lymphnodes, bone marrow and spleen within 3 days. At these sites, only a few cells stain positive for viral antigen. The virus is present in the blood during at least 21 days and often much longer. After 7 days antibodies to PRRSV are found in the blood. The combined presence of virus and antibody in PRRS infected pigs shows that the virus infection can persist for a long time, albeit at a low level, despite the presence of antibody. During at least 7 weeks the population of alveolar cells in the lungs is different from normal SPF lungs.

[0007] PRRSV needs its envelope to infect pigs via the oronasal route and the normal immune response of the pig thus entails among others the production of neutralising antibodies directed against one or more of the envelope proteins; such antibodies can render the virus non-infective. However, once in the alveolar macrophage, the virus also produces naked capsids, constructed of RNA encapsidated by the M and/or N protein, sometimes partly containing any one of the glycoproteins. The intra- and extracellular presence of these incomplete viral particles or (partly) naked capsids can be demonstrated by electron microscopy. Sometimes, naked capsids without a nucleic acid content can be found. The naked capsids are distributed through the body by the bloodstream and are taken up from the blood by macrophages in spleen, lymphnodes and bonemarrow. These naked but infectious viral capsids can not be neutralised by the antibodies generated by the pig and thus explain the persistence of the viral infection in the presence of antibody. In this way, the macrophage progeny from infected bonemarrow cells is spreading the virus infection to new sites of the body. Because not all bonemarrow macrophage-lineage cells are infected, only a small number of macrophages at peripheral sites are infected and produce virus. PRRSV capsids, consisting of ORF7 proteins only, can be formed in the absence of other viral proteins, by for instance infection of macrophages with a recombinant pseudorabies-ORF7 vector virus. The PRV virus was manipulated to contain ORF7 genetic information of PRRSV. After 18 hours post infection, the cytoplasm of infected cells contains large numbers of small, empty spherical structures with the size of PRRS virus nucleocapsids.

[0008] Although live-attenuated and killed PRRSV vaccines are now available, it has been shown that in general these are not immunogenic enough or are too virulent for specific groups of pigs, i.e. for young piglets or sows in the third trimester of pregnancy. It is clear that a PRRSV vaccine that is not sufficiently immunogenic will not stand up in the market. However, several of the existing immunogenic vaccines are not safe illustrating the need for attenuated PRRSV vaccines with reduced virulence.

[0009] Furthermore, again under specific circumstances, several of the existing vaccines spread within a population, and may inadvertently infect other pigs that need not or should not be vaccinated, illustrating the need for non-spreading PRRSV vaccines.

[0010] Furthermore, the existing vaccines can in general not be distinguished from wild type field virus, illustrating the need for a so-called marker vaccine, obtained for example by mutagenesis of the genome, so that vaccinated pigs can be distinghuished from field virus-infected pigs on the basis of differences in serum antibodies.

[0011] In addition, PRRS vaccines, being so widely used throughout the world, and being in general not infectious to other animals but pigs, would be attractive candidate vaccines to carry foreign antigens derived from other (porcine) pathogens to provide for protection against those other pathogens, illustrating the need for PRRSV carrier or vector vaccines allowing vaccination against those other pathogens or allowing positive marker identification.

[0012] It goes without saying, that PRRSV vaccines combining one or more of these features would be preferred. It is an object of the present invention to provide solutions to these needs.

[0013] The invention provides a porcine reproductive and respiratory syndrome virus (PRRSV) replicon having at least some of its original PRRSV nucleic acid deletions, herein also comprising substitutions, said replicon capable of in vivo RNA replication, said replicon further having been deprived of at least some of its original PRRSV nucleic acid and/or having been supplemented with nucleic acid derived from a heterologous micro-organism.

[0014] Surprisingly, it has been found that the genome of PRRSV can be deprived of quite a large amount of its nucleic acid. An independent and functional PRRSV replicon capable of independent in vivo RNA replication can still exist if the stretch, or fragments thereof, of nucleic acid encoding the ORF2-ORF6, but not an essential element from the ORF7 protein, is deleted and/or modified. Having a replicon wherein such a large stretch of nucleic acid has been deleted or modified opens up a large capacity for the addition to said replicon of heterologous nucleic acid from any other organism than PRRSV, thereby providing a PRRSV vector replicon with large carrier capacities. Herewith, the inventor provides identification of specific nucleic acid regions in the genome of porcine reproductive and respiratory syndrome virus, that are important for attenuation of the virus, for making it non- or little spreading or for the introduction of a marker, without crippling the viral nucleic acid so much that it can no longer provide in vivo RNA replication. Furthermore, the inventor demonstrates that a PRRSV replicon can be used as vector for the expression of foreign antigens, preferably derived from other (porcine) pathogens, allowing vaccination against those other pathogens and allowing positive marker identification. The minimal sequence requirements for a PRRSV replicon or PRRSV vector replicon as provided by the invention are essential elements comprising the 5′ noncoding region-ORF1a-ORF1b-ORF7-3′ noncoding region, (e.g. from the PRRSV polymerase region) whereby the ORF7 coding region can be deleted further for example according to the data shown in FIG. 2. In a preferred embodiment, the invention provides a PRRSV replicon or vector at least comprising essential elements from the PRRSV polymerase region for example as described below and/or comprising at least nucleic acid derived from a essential region of 44 nucleotides between nucleotides 14642 to 14686 in the ORF7 gene (as identified in the nucleic acid sequence of the Lelystad virus isolate of PRRSV, however, the skilled person can easily determine by alignment wherein in any other PRRSV genome said essential element is located).

[0015] In another preferred embodiment, the invention provides a PRRSV replicon comprising at least nucleic acid derived from essential sequence elements from ORF1a and ORF1b, or from the PRRSV polymerase region and having nucleic acid from ORF2, ORF 3, ORF 4, ORF 5, ORF 6, or non-essential elements from ORF7 deleted, allowing insertion of foreign nucleic acid, thereby providing a PRRSV vector replicon having foreign antigen coding capacities. This in contrast to WO98/55626 where the homologous polymerase is replaced with a heterologous Arteriviral one to express ORF2-ORF7, essentially without disclosing expression of foreign antigens derived from other (porcine) pathogens to provide for protection against those other pathogens allowing vaccination against those other pathogens (let alone wherein the PRRSV genome nucleic acid encoding foreign antigens may be located for providing a PRRSV vector replicon or which essential sequence elements should remain).

[0016] The replicase polyprotein of PRRSV encoded by ORF1 is thought to be cleaved in 13 processing end-products (designated nonstructural proteins—nsps) and a large number of intermediates. The polyprotein is cleaved by protease domains located in nsp1α, nsp1β, nsp2 and nsp4. Essential PRRSV RNA-dependent RNA polymerase and nucleoside triphosphate-binding/RNA Helicase motifs were identified in nsp9 and nsp10, respectively. Another conserved (essential) domain was found in nsp11, a conserved Cys/His-rich domain was found in nsp10. It has for example been shown that the latter protein plays a role in subgenomic mRNA synthesis.

[0017] In a further embodiment, the invention provides a PRRSV replicon capable of independent in vivo RNA replication wherein said replicon is a RNA transcript of an infectious copy cDNA. It has been shown for many positive strand RNA viruses that their 5′ and/or 3′ noncoding regions contain essential signals that control the initiation of plus- and minus-strand RNA synthesis. It was not determined for PRRSV whether these sequences alone are sufficient for replication. As for most RNA viruses, PRRSV contains a concise genome and most of the genetic information is expected to be essential. Furthermore, the maximum capacity for the integration of foreign genes into the PRRSV genome is not yet known. An extra limitation is that the ORFs encoding the structural proteins of PRRSV are partially overlapping. The introduction of mutations in these overlapping regions often results in two mutant structural proteins and therefore is more often expected to produce a nonviable virus.

[0018] The production of an infectious clone allowed us to analyse replication signals in the genome of PRRSV. In this study we have mapped cis-acting sequence elements required for replication by introducing deletions in the infectious clone. Surprisingly, we have shown that also cis-acting sequence elements from the region of the genome encoding structural proteins are essential for proper replication. We have shown that transcripts derived from cDNA clones lacking the ORF7 gene are not replicated. A more systematic deletion analysis showed that a region of 44 nucleotides between nucleotides 14642 to 14686 in the ORF7 gene was essential for replication of RNA of PRRS. This was an interesting finding, since the sequences essential for replication of most positive strand RNA viruses are present in the 5′ and 3′ noncoding regions. It is an important finding for studies who's aim is to develop viral replicons which can only be rescued in complementing cell lines expressing the deleted ORFs. The minimal sequence requirements for these RNAs are located in the 5′ noncoding region-ORF1a-ORF1b-ORF7-3′ noncoding region. Viral RNA's or replicons containing these sequence elements supplemented with a selection of fragments from other PRRSV open reading frames or fragments of open reading frames expressing antigens of other (heterologous) pathogens can be packaged into virus particles when the proteins essential for virus assembly are supplied in trans. When these particles are given to pigs, for example as vaccine, they will enter specific host cells such as macrophages and virus- or heterologous antigens are expressed and induce immune responses because of the replicating RNA. However, since the RNA does not express (all) the proteins required for packaging and the production of new particles, the replicon can not spread further, creating an extremely efficient, but safe and not-spreading recombinant vaccine effective against PRRSV and/or heterologous pathogens.

[0019] In a preferred embodiment, the invention provides a replicon according to the invention incapable of N-protein capsid formation. For example, two Cys residues are present at positions 27 and 76 in the N protein sequence and mutating or deleting Cys-27 and Cys-76 from the N protein inhibits the production of infectious particles of PRRSV. The ORF7 gene encoding the N protein was mutated as such that the Cys residues were substituted for Asn and Leu residues, respectively, however, substitution with another amino acid, or deletion of the coding sequence, leads to the desired result as well, as for example can be seen below.

[0020] The Cys-27 and Cys-76 mutations were subsequently introduced in the infectious clone pABV437 of the Lelystad virus isolate of PRRSV, resulting in plasmids pABV534-536 (Cys-27→Asn) and pABV472-475 (Cys-76→Leu). RNA was transcribed from these mutated infectious clones and transfected to BHK-21 cells. The structural proteins were properly expressed, these mutant RNAs were replicated and subgenomic RNAs synthesized. However, infectious particles were not secreted, since the transfer of the supernatant of the transfected BHK-21 cells to macrophages did not result in the production of viral proteins in the macrophages nor in the induction of a cpe.

[0021] Thus, these residues are essential for a proper structure or function or both of the N protein in virus assembly of PRRSV. The N protein is involved in the first steps in virus assembly, the binding of the viral genomic RNA and formation of the capsid structure. Since transcripts of genomic length cDNA clones containing the Cys-27 and/or Cys-76 deletion replicated at the wild type level, the mutations in the Cys residues destroy the binding of the RNA by the N protein. Alternatively, they induce a different structure of the N protein that inhibits the formation of proper capsids. The defect in the encapsidation of the viral RNA genome can be complemented by wild type N protein transiently expressed or continuously expressed in a (BHK-21) cell line. In this way a virus is produced that is able to complete only one round of infection/replication. Therefore such a virus is considered to be a very safe vaccine for protection against PRRSV in pigs.

[0022] In another example, the invention provides a replicon incapable of N-protein capsid formation wherein substitutions in the genome encoding the N protein area containing two antigenic regions designated B and D inhibited the production of infectious virus particles. The B region comprises amino acids 25-30 (QLCQLL), D region; amino acids 51-67 (PEKPHFPLAAEDDIRHH) and amino acids 80-90 (ISTAFNQGAGT) of the N protein of PRRSV. The corresponding sites in VR2332 and other American strains are found when the N proteins of these strains are aligned. Since RNA replication and subgenomic mRNA synthesis appeared to be at the wild type level, these mutations most likely prevented the formation of proper capsids by the N protein.

[0023] The invention furthermore provides a replicon according to the invention wherein a marker allowing serological discrimination has been introduced. For example, mutagenesis of a single amino acid in the D region (Asp-62 or a.a. corresponding thereto) of protein N results in a replicon that has a different MAb binding profile from PRRSV and all other PRRSV viruses. Such a replicon induces a different spectrum of antibodies in pigs, compared to these other PRRSV isolates. Therefore it can be differentiated from field virus on the basis of serum antibodies and is an excellent mutant for further development of marker vaccines against PRRSV.

[0024] The above example involves a subtle modification resulting in a replicon useful for a marker vaccine. However, more extensive changes are now also possible, knowing that it is allowed to partly or fully delete the nucleic acid encoding the structural proteins 2, 3, 4, 5, and/or 6 without tampering with the replicative properties of the resulting replicon. A PRRSV replicon lacking one or more (antigenic) fragments of these structural proteins has the advantage that no immune respons, more specifically no antibodies, against these deleted fragments will be formed, for example after vaccination with a vaccine comprising such a replicon. Again, such a replicon induces a different spectrum of antibodies in pigs, compared to wild type PRRSV. Therefore it can be differentiated from field virus on the basis of serum antibodies and is an excellent mutant for further development of marker vaccines against PRRSV.

[0025] Furthermore, the invention provides a replicon comprising a nucleic acid modification in a virulence marker of PRRSV. Virulence markers of PRRSV have not been elucidated, despite the fact that various differences in virulence have been observed. However, for successfully attenuating a PRRSV or replicon thereof, such knowledge helps in selecting the least virulent, but most immunogenic replicon or virus possible. Now that it is known that deleting or modifying the ORF2 to ORF 6 region is possible without effecting the in vivo RNA replicative properties, such virulence markers can easily be detected. For example, the invention provides replicon comprising a nucleic acid modification in ORF 6 encoding the membrane spanning M-protein. It has been found that the membrane protein is influencing the virus assembly, the stability of the virus, or the virus entry in macrophages, all factors contributing to the virulence of PRRSV. The M protein is the most conserved structural protein among arteriviruses and coronaviruses. The protein is an integral membrane protein containing three N-terminal hydrophobic membrane spanning domains (Rottier, 1995). The protein spans the membrane three times leaving a short N-terminal domain outside the virion and a short C-terminal domain inside the virion. The M protein of coronaviruses was shown to play an important role in virus assembly (Vennema et al., 1996), but was then not determined to be a virulence factor. In particular, the invention provides a replicon wherein said modification modifies protein M in between its second and third membrane spanning fragment, essential in determining virulence of a specific PRRSV isolate. For example, the invention provides a replicon comprising vABV575. A Thr-59→Asn mutation is located between the second and third membrane spanning fragment of M in vABV575. This mutation influences virus assembly, the stability of the virus, or virus entry in the PAMs.

[0026] The invention furthermore provides a replicon according to the invention wherein said heterologous micro-organism comprises a pathogen. Since PRRSV specifically infects macrophages, it can be used as a vector for the delivery of important antigens of other (respiratory) agents to this specific cell of the immune system. The infectious cDNA clone enables us to introduce site specific mutations, deletions and insertions into the viral genome.

[0027] In a preferred embodiment, the invention provides a replicon wherein said pathogen is a virus. We have successfully used PRRSV as a vector for the expression of a foreign protein anigen, an HA epitope of the haemagglutinin of influenza A virus. Recombinant PRRSV vector replicons were engineered that produced the HA tag fused to the N- or C-terminus of the N protein. In addition, an PRRSV mutant was created that contained the HA-tag as well as the protease 2A of foot-and-mouth-disease virus (FMDV) fused to the N terminus of the N protein.

[0028] Furthermore, the invention provides a vaccine comprising a replicon or vector replicon according to the invention. PRRSV vaccines are now provided with specified antigenicity or immunogenicity that are in for example in addition safe enough for specific groups of pigs, i.e. for young piglets or sows in the third trimester of pregnancy.

[0029] Furthermore, the invention provides non-spreading PRRSV vaccines, comprising a replicon or vector replicon for example incapable of N-protein capsid formation, or incapable of further infection due to the absence of (fragments of) structural proteins encoded by ORF 2 to 6, without hampering its in vivo RNA replication properties, thereby allowing the production of proteins against which an immune response is desired.

[0030] Furthermore, the invention provides a vaccine that can be distinguished from wild type field virus, a so-called marker vaccine, obtained for example by mutagenesis of the genome, so that vaccinated pigs can be distinguished from field virus-infected pigs on the basis of differences in serum antibodies.

[0031] In addition, PRRS vaccines, being so widely used throughout the world, and being in general not infectious to other animals but pigs, are now provided as vector vaccines to carry foreign antigens derived from other (porcine) pathogens, allowing vaccination against those other pathogens and allowing positive marker identification.

[0032] Use of a vaccine according to the invention is especially useful for vaccinating pigs, sine the PRRSV is in general very host specific and replicates in macrophages of pigs, thereby targeting an important antigen presenting cell of the immune system.

[0033] The invention is further explained in the detailed description, without limiting the invention.

DETAILED DESCRIPTION

[0034] 1. Mutation of Cys-27 and Cys-76 in the N Protein Inhibits the Production of Infectious Particles of PRRSV

[0035] The nucleocapsid protein N (expressed by ORF7) is present as a monomer in purified virions of PRRSV. However, in some experiments we also detected a homodimer of N. For instance when the N protein was immunoprecipitated from purified virions with N-specific MAbs and electrophorezed on a sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE), a protein of 15 kDa was predominantly observed under reduced conditions, whereas a homodimer of 30 kDa was predominantly observed under nonreduced conditions (Meulenberg et al., 1996). However, when compounds such as N-methyl maleimide or iodoacetamide were used to prevent the formation of nonspecific disulfide bonds, these dimers of N were not detected. This indicated that dimers of N are formed due to the formation of nonspecific disulfide bonds during the processing of cell lysates for analysis. Two cystein residues are present in the N protein sequence. The question raised which of the cysteine residues was responsible for the formation of nonspecific disulfide bonds and whether the cysteine residues are important for the structure and function of the N protein. To answer this question we mutated the two cystein residues individually in the infectious cDNA clone of PRRSV and studied the infectivity of the resulting mutant viral genomic RNAs.

[0036] 2. Introduction of a Marker in the N Protein

[0037] The N protein of PRRSV contains 4 antigenic sites, designated A-D (Meulenberg et al., 1998). Two sites, B and D, contain epitopes that are conserved in European and North American isolates of PRRSV. To produce viruses that can be serologically distinguished from wild type viruses, mutations in the B and D domain that disrupt the binding of N-specific MAbs were introduced in the infectious cDNA clone of PRRSV. Transcripts of the resulting mutant full length cDNA clones were analyzed for RNA replication by detecting the expression of structural proteins and production of infectious virus.

[0038] 3. Elucidation of Replication Signals Present in the Region Encoding Structural Proteins of Lelystad Virus

[0039] Positive strand RNA viruses contain 5′ and 3′ noncoding regions which are essential for replication. The RNA sequences at the 5′ and 3′ end usually have a specific secondary structure which is recognized by the viral RNA dependent RNA polymerase to initiate positive and negative strand synthesis and in the case of arteriviruses subgenomic RNA synthesis. We deleted the ORF7 gene from the infectious clone of PRRSV (Meulenberg et al., 1998) in a first attempt to generate a defective RNA replicon that could be complemented for production of infectious particles, when transfected to a cell expressing the N protein. The ORF7 gene was precisely deleted, without affecting the 3′ noncoding region of the virus. Surprisingly, the RNA of this deletion mutant did not replicate in BHK-21 cells. This suggested that RNA replication signals are present in the coding region of ORF7. The purpose of this study was to further localize these replication signals. By expensive deletion analysis of the coding region and upstream sequences of ORF7 we were able to identify a region of 44 nucleotides in the ORF7 gene that is important for replication of RNA of PRRSV.

[0040] 4. Production of an Attenuated PRRSV Virus by Deletion of the NdeI Site in ORF6.

[0041] Recently, we have established an infectious clone cDNA clone of PRRSV (Meulenberg et al., 1998). The full length cDNA clone contains two NdeI sites, the first at nucleotide 12559 (ORF3) and the second at nucleotide 14265 (in ORF6) in the genome sequence. To facilitate mutagenesis and exchange of fragments in the region encoding the structural proteins (ORFs 2 to 7) of the virus, we destroyed the second NdeI site by PCR-directed mutagenesis. This resulted in an amino acid substitution at position 59 in the M protein (Thr→Asn). The growth properties of the virus produced from the mutated full length cDNA clone containing a unique NdeI site was analysed.

[0042] 5. Lelystad Virus as a Vector for the Expression of Foreign Antigens or Proteins.

[0043] The generation of an infectious cDNA clone of PRRSV (Meulenberg et al., 1998) is a major breakthrough in PRRSV research and opens up new possibilities for the development of new viral vectors. Since PRRSV specifically infects macrophages, it can be used as a vector for the delivery of important antigens of other (respiratory) agents to this specific cell of the immune system. The infectious cDNA clone enables us to introduce site specific mutations, deletions and insertions into the viral genome. However, it is still not known which regions of the PRRSV genome are essential or allow mutagenesis. As for most RNA viruses, PRRSV contains a concise genome and most of the genetic information is expected to be essential. Furthermore, the maximum capacity for the integration of foreign genes into the PRRSV genome is not yet known. An extra limitation is that the ORFs encoding the structural proteins of PRRSV are partially overlapping. The introduction of mutations in these overlapping regions results in two mutant structural proteins and therefore is more often expected to produce a nonviable virus.

[0044] The aim of this study was to identify regions in the PRRSV genome that allow the introduction of foreign antigens that will be exposed to the immune system of the pig after infection with the mutant virus. In a first approach we have selected a small epitope of 9 amino acids of human haemagglutinin of influenza A for expression in PRRSV.

[0045] METHODS

[0046] Cells and Viruses

[0047] BHK-21 cells were grown in BHK-21 medium (Gibco BRL), completed with 5% FBS, 10% tryptose phosphate broth (Gibco BRL), 20 mM Hepes pH 7.4 (Gibco BRL) and 200 mM glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin. Porcine alveolar lung macrophages (PAMs) were maintained in MCA-RPMI-1640 medium, containing 10% FBS, 100 μg/ml kanamycin, 200 U/ml penicillin and 200 μg/ml streptomycin. Virus stocks were produced by serial passage of recombinant PRRSV viruses secreted in the culture supernatant of tranfected BHK-21 cells on PAMs. Virus was harvested when PAMs displayed cytopathic effect (cpe) usually 48 hours after infection. Virus titers (expressed as 50% tissue culture infective doses [TCID50] per ml) were determined on PAMs using end point dilution (Wensvoort et al., 1986).

[0048] Mutagenesis

[0049] 1. Mutagenesis of Cys-27 and Cys-76.

[0050] The Cys-27 was mutated to Asn by PCR-directed mutagenesis with primers LV108 and LV97. The sequences of primers used in this study are listed in Table 1 . The generated PCR fragment was digested with HpaI and PflmI and inserted in the ORF7 gene in pABV431 digested with the same enzymes. This resulted in plasmid pABV451 The Cys-76 was mutated to Leu by PCR-directed mutagenesis with primers LV108 and LV100. The generated fragment was digested with HpaI and ClaI and inserted in the ORF7 gene in pABV431 digested with the same enzymes. This resulted in pABV452. The mutated ORF7 genes were subsequently transferred to the genomic-length cDNA clone pABV437(Meulenberg et al., 1998) with the unique HpaI (nt 14581) and PacI (nt 14981) site, to create plasmids pABV534-536 (Cys-27→Asn) and plasmids pABV472-475 (Cys-76→Leu; FIG. 1).

[0051] 2. Mutagenesis of Antigenic Site B and D in the N Protein

[0052] Antigenic sites B (amino acids 25-30) and D (amino acids 51-67 and 80-90) of the N protein of PRRSV were mutated by substitution of the amino acids in this region for the corresponding amino acids of respectively EAV and LDV. Plasmids pABV455, pABV463, and pABV453 containing these respective mutation were described previously in Meulenberg et al. (1998). In addition, the Asp at position 62 in the D region of the N protein was mutated to a Tyr in a PCR with primers LV108 and LV188. The sequences of these primers are shown in Table 1. The PCR fragment was digested with HpaI and ClaI and inserted in the ORF7 gene in pABV431 digested with the same enzymes. This resulted in pABV582. The ORF7 genes containing the mutations were inserted in pABV437 using the unique HpaI (nt 14581) and PacI (nt 14981) (FIG. 1).

[0053] 3: Creation of Deletion Mutants in the Full-Length cDNA Clone of PRRSV

[0054] Several deletions were made in the full-length cDNA clone of pABV437 of PRRSV (FIG. 2). First, ORF2, ORF3, ORF4, ORF5 and the 5′ half of ORF6 were deleted. pABV437 was digested with EcoRI and NheI and the sites were made blunt with Klenow fragment (Pharmacia Biotech). The fragment was purified and ligated. This resulted in clone plasmid pABV594. Second, ORF7 was deleted from the infectious copy of PRRSV. For this purpose, the infectious full-length cDNA clone pABV442 that contains a SwaI restriction site directly downstream of the stopcodon of ORF7, was digested with HpaI and SwaI and ligated. This resulted in clone plasmid pABV521. Third, to delete the 3′ end of ORF6, PCR-mutagenesis was performed with primers LV198 and LV199. The primers used in PCR-mutagenesis are listed and described in Table 1. The generated product was digested with HpaI and NheI and ligated in the corresponding sites of pABV437. This resulted in plasmid pABV627. Fourth, several deletions in and upstream of the coding region of ORF7 were made. PCR-mutagenesis was performed with forward primers LV188-191 or LV195-197 and reversed primer LV112. The generated products were digested with HpaI and PacI and ligated in the same restriction sites of pABV437, resulting in plasmids pABV602-605 and pABV625-627. Plasmids were transformed to Escherichia coli DH5α and grown at 32° C. and 20 μg kanamycin per ml. For each construct two clones containing fragments of two independent PCRs were sequenced to confirm the correct sequence of the clones. The resultant mutants are shown in FIG. 2.

[0055] 4. Mutagenesis of the NdeI Site at Position 14265 in the Infectious cDNA Clone pABV437 of PRRSV

[0056] To mutate the NdeI site at position 14265 a fragment of 1.7 kb was amplified by PCR using primers LV27 (nt 12526) and LV182 (nt 14257; Table 1) Primer LV182 contains an AseI site. AseI and NdeI have compatible ends, but ligation of their ends to each other destroys both restriction sites. The PCR fragment was digested with NdeI and AseI and ligated in pABV437 digested with NdeI. The full length clone pABV575 (FIG. 3) that contained the PCR fragment in the proper orientation, lacked the NdeI site at position 14265 and had no other mutations between 12559 and 14265 due to PCR errors was selected for further analysis.

[0057] 5: Construction of Full-Length Genomic cDNA Mutants of PRRSV Encoding an Antigenic HA tag

[0058] PCR-mutagenesis was used to create mutants in the infectious clone of PRRSV. First, a sequence of 27 nucleotides encoding an epitope of the human haemagglutinin of influenza A (HA-tag; Kolodziej et al., 1991) was introduced directly downstream of the start codon of ORF7 in the PacI mutant of the genome-length cDNA clone of Lelystad Virus (pABV437; Meulenberg et al., 1998). Two sequential PCRs were performed with primers LV192 and LV112 and with primers LV193 and LV112. Primers used to create the PCR-fragments are listed and described in Table 1. Second, both this HA-tag and a sequence of 51 nucleotides encoding the protease 2A of FMDV (Percy et al., 1994) were introduced directly downstream of the startcodon of ORF7. Two sequential PCR-reactions were performed with primers LV139 and LV112 and with LV140 and LV112. Third, the HA-tag was introduced at the 31 end of the ORF7 gene in a PCR with primers LV108 and LV194. The three PCR fragments obtained were digested with HpaI and PacI and ligated into pABV437 digested with the same enzymes. Standard cloning procedures were performed essentially as described in Sambrook et al., (1989). Plasmids were transformed into Escherichia coli DH5α and grown at 32° C. and 20 μg kanamycin per ml. For each construct two clones containing fragments of two independent PCRs were sequenced to confirm the correct sequence of the clones. Introduction of the HA epitope at the 5′ end of ORF7 resulted in the generation of clone pABV525, introduction of both the HA-tag and the protease 2A at the 5′ end of ORF7 resulted in clone pABV523, and the introduction of the HA-epitope at the 3′ end of ORF7 resulted in clone pABV526 (FIG. 4).

[0059] Sequence Analysis

[0060] The generated cDNA clones were analyzed by oligonucleotide sequencing. Oligonucleotide sequences were determined with the PRISM Ready Dye Deoxy Terminator cycle sequencing kit and the automatic sequencer (Applied Biosystems).

[0061] In Vitro Transcription and Transfection of RNA

[0062] Full-length genomic cDNA clones and derivatives thereof were linearized with PvuI, which is located directly downstream of the poly(A) stretch. The linearized plasmids were precipitated with ethanol and 1.5 μg of these plasmids was used for in vitro transcription with T7 RNA polymerase by the methods described for SFV by Liljeström and Garoff (1991). The in vitro transcribed RNA was precipitated with isopropanol, washed with 70% ethanol and stored at −20° C. until use.

[0063] BHK-21 cells were seeded in 35-mm wells (approximately 106 cells/well) and were transfected with 2.5 μg in vitro transcribed RNA mixed with 10 ml lipofectin in optimem as described earlier (Meulenberg et al., 1998). Alternatively, RNA was introduced in BHK-21 cells in 20-mm wells with 0.5 μg in vitro transcribed RNA mixed with 2 ml lipofectin in optimem. The medium was harvested 24 h after transfection, and transferred to CL2621 cells or PAMs to rescue infectious virus. Transfected and infected cells were tested for expression of PRRSV proteins by an immunoperoxidase monolayer assay (IPMA), essentially as described by Wensvoort et al. (1986). Monoclonal antibodies (MAbs) 122.14, 122.1, and 126.3 directed against respectively the GP3, GP4, M protein (van Nieuwstadt et al., 1996) were used for staining in this assay. A panel of MAbs (122.17, 125.1, 126.9, 126.15, 130.2, 130.4, 131.7, 131.9, 138.22, WBE1, WBE4, WBE5, WBE6, SDOW17, NS95, and NS99) directed to four different antigenic sites A-D were used to study the expression of the N protein (Meulenberg et al., 1998). MAb 12CAS was used to detect the expression of the HA-epitope and was purchased from Boehringer Mannheim. In addition, we analyzed the expression of PRRSV proteins by metabolic labeling of transfected or infected cells, followed by immunoprecipitation using specific monoclonal antibodies or peptide sera directed to the structural proteins of PRRSV, as described by Meulenberg et al (1996).

[0064] Sequence Analysis of Genomic RNA of Recombinant Viruses

[0065] The culture supernatant of the PAMs infected with passage 3 of the HA-expressing viruses was used to analyze viral RNA by RT-PCR. A volume of 500 μl proteinase K buffer (100 mM Tris-HCl [pH 7.2], 25 mM EDTA, 300 mM NaCl, 2% [wt/vol] sodium dodecyl sulfate) and 0.2 mg Proteinase K was added to 500 μl supernatant. After incubation for 30 minutes at 37° C., the RNA was extracted with phenol-chloroform and precipitated with ethanol. The RNA was reverse transcibed with primer LV76. Then, PCR was performed with primers LV37 and LV112 to amplify fragments of vABV523 and vABV525 and with primers LV37 and LV75 to amplify fragments of vABV526 (Table 1). Sequence analysis was performed to determine whether the mutant viruses at passage 4 still contained the inserted foreign sequences.

[0066] Results

[0067] 1. Mutation of Cys-27 and Cys-76 in full length cDNA clone pABV437 Two Cys residues are present at positions 27 and 76 in the N protein sequence. The ORF7 gene encoding the N protein was mutated as such that the Cys residues were substituted for Asn and Leu residues, respectively. The Cys-27 and Cys-76 mutations were subsequently introduced in the infectious clone pABV437 of the Lelystad virus isolate of PRRSV, resulting in plasmids pABV534-536 (Cys-27→Asn) and pABV472-475 (Cys-76→Leu; FIG. 1). RNA was transcribed from these mutated infectious clones and transfected to BHK-21 cells. These cells stained positive with N-specific MAbs in IPMA. Analysis of the N protein synthesized by pABV534-536 and pABV472-475 in immuno precipitation and SDS-PAGE indicated that its apparent molecular weight was similar to the wild type N protein and migrated at 15 kDa under reducing conditions. Next we analyzed the N protein under nonreducing conditions in the absence of N-methyl maleimide or iodoacetamide. Under these conditions, the N protein expressed by pABV472-475 (Cys-76→Leu) resembled the wild type N protein and was mainly detected as a dimer, whereas the N protein expressed by pABV534-536 (Cys-27→Asn) was detected as a monomer. This indicated that the Cys residue at position 27 was responsible for the formation of nonspecific disulfide bonds. The production of other structural proteins such as GP3, GP4, and M was also detected in IPMA and immuno precipitation after transfection of full length RNA from plasmids pABV534-536 (Cys-27→Asn) and pABV472-475 (Cys-76→Leu: FIG. 1). Since the structural proteins were properly expressed, these mutant RNAs were replicated and subgenomic RNAs synthesized. However, infectious particles were not secreted, since the transfer of the supernatant of the transfected BHK-21 cells to PAMs did not result in the production of viral proteins in the PAMs nor in the induction of a cpe. Therefore both Cys residues are essential for a proper structure or function or both of the N protein in virus assembly.

[0068] 2. Characterization of Full Length cDNA Clones containing Mutations in Antigenic Sites of the N Protein of PRRSV

[0069] Site B (amino acids 25-30) and D (amino acids 51-67 and 80-90) are two antigenic regions that are conserved in European and North American PRRSV isolates. When we mutated site B and D by substituting their amino acid sequence for the corresponding amino acids of the LDV or EAV N protein, the binding of the N protein by respectively B-specific and D-specfic MAbs was disrupted (Meulenberg et al., 1998). To produce a PRRSV virus that is antigenically different from PRRSV field viruses, we introduced the ORF7 genes containing a mutated B or D region in our infectious clone pABV437. This resulted in pABVS27-533, containing a mutated B site (amino acids 25-30), pABV537-539 containing a mutated D domain (amino acids 51-67), and pABV512-515 containing a mutated D domain (amino acids 80-90) (FIG. 1). When RNA of these full length clones was transfected to BHK-21 cells, these cells stained positive with N-specific MAbs at 24 h after transfection. As expected, the N protein expressed by pABV527-533 was recognized by A-, C-, and D-specific MAbs, but not by B-specific MAbs. On the other hand the N protein expressed by pABV537-539 and pABV512-515 was recognized by A-, B-, and C-specific MAbs but not by D-specific MAbs. The staining of cells transfected with the RNA derived from pABVS27-533 , pABV537-539 and pABV512-515 with MAbs directed against GP3, GP4, and M, was similar to that observed in transfections with RNA derived from wild type pABV437. This suggested that RNA replication and subgenomic mRNA synthesis were not affected by the mutations. When the supernatant of the cells transfected with RNA derived from pABV527-533, pABV537-539 and pABV512-515 was transferred to PAMs, cpe was not produced. Most likely, the mutations in the B and D region destroyed the function of the N protein in the formation of a proper capsid structure.

[0070] Since the mutation of 4 amino acids in domain B and 5 or 9 amino acids in domain D did not allow the generation of infectious particles we then created a more subtle mutation of 1 amino acid in the D region. We introduced an Asp-62 to Tyr mutation in the N-protein in the infectious clone of PRRSV. The amino acid Asp-62 in the PRRSV N protein was mutated to Tyr by PCR directed mutagenesis and transferred to pABV437, resulting in pABV600. RNA transcribed from pABV600 was tranfected to BHK-21 cells. These cells stained positive with MAbs directed against GP3, GP4, M and N. At 24 h after transfection, suggesting that the RNA was replicated and subgenomic mRNAs were synthesized. When the supernatant of the BHK-21 cells transfected with transcripts from pABV600 was transferred to PAMs, cpe was detected at 2-3 days after inoculation. The infected cells stained positive with PRRSV specific MAbs, which further confirmed that infectious virus was produced. Therefore, the mutation of Asp-62 to Tyr in the N protein is tolerated in the virus and does not destroy the function of the N protein. The mutant virus VABV600 was further typed with a panel of N-specific MAbs (Table 2). Not only the binding of D-specific MAb SDOW17, but also the binding of D-specific MAbs 130.2, 130.4, 131.7, and 131.9 and WBE1 to vABV600 was greatly reduced. If hybridoma culture supernatant of these MAbs was diluted to 0.3-0.5 μg IgG/ml bright staining was observed for wild type PRRSV, but no staining could be observed for vABV600. However, when the IgG of MAbs 130.2, 130.4, 131.7, and 131.9 was purified and used more concentrated (10 μg IgG/ml) faint staining was observed. Staining of vABV600 with A- and B-specific MAbs was comparable to PRRSV. These data indicated that we have created a virus that is antigenically different from wild type PRRSV or North American PRRS viruses.

[0071] 3: Identification of Replication Signals at the 3′ End of the PRRSV Genome

[0072] In order to determine cis-acting sequences that are essential signals for RNA replication (plus and/or minus strand synthesis and/or subgenomic mRNA synthesis), several deletions were made in the infectious cDNA clone and transcripts derived from these deletion mutants were analysed for replication in BHK-21 cells. When transcripts from pABVS21, lacking the entire ORF7 gene were transfected to BHK-21 cells, the expression of the N-protein could not be detected in IPMA (FIG. 2). Interestingly, these transcripts were also defective in the expression of other structural proteins, such as GP3, GP4 and M. This indicated that these RNAs were not replicated and did not produce subgenomic RNAs. On the other hand, the deletion of ORF2, ORF3, ORF4, ORF5 and the 5′ end ORF6 from the infectious copy (pABV594) resulted in viral RNA that was still capable of replication. Therefore, replication signals are present in the coding region of ORF7 and not in the coding region of ORF's 2-6. To test this and further locate the regions involved in replication, mutants containing smaller deletions in ORF7 were constructed. The transcripts of these constructs were tested for their ability to replicate by detecting the expression of PRRSV proteins in IPMA of transfected BHK-cells (FIG. 2). From these results, it could be concluded that essential signals for replication of the PRRSV genome are present between nucleotides 14643 to 14687. Viral RNAs lacking this region were defective in replication.

[0073] 4. Analysis of Full Length cDNA Clone pABV575 Lacking the NdeI Site in ORF6

[0074] A full length cDNA clone, pABV575, was created that had a unique NdeI site at position 12559 due to mutation of the second NdeI site at position 14265 by PCR. RNA was produced from pABV575 and transfected to BHK-21 cells together with RNA from its parent clone pABV437. At 24 h after transfection with pABV575 RNA and pABV437 RNA an equal number of cells stained positive in IPMA with M-specific and N-specific MAbs (FIG. 3). Furthermore, the intensity of the staining was similar. However, when the supernatant of the transfected BHK-21 cells was transferred to PAMs and incubated for 24 h, the number of cells infected by vABV575 was much lower than that observed for vABV437. Furthermore, the cpe developed much slower in the PAMs inoculated with vABV575 than with vABV437. Although the replication of the RNA and synthesis of the subgenomic RNAs of vABV575 in BHK-21 appeared to be at the wild type level, the virus that is produced was less infectious for macrophages. This was most likely due to the amino acid mutation in the M protein (Thr→Asn) that resulted from the destruction of the NdeI site at position 14265.

[0075] 5: Introduction of an HA-Tag in the Infectious Clone of PRRSV

[0076] An epitope of the haemagglutinin of influenza A (HA-tag; Kolodziej et al., 1991) was expressed by different recombinant PRRSV viruses. The HA epitope was chosen as foreign antigen for expression in PRRSV mainly for two reasons; First, the tag has a limited size (27 nucleotides), which reduces the chance to disturb the replication of the virus or the expression or function of the protein to which it is fused. Second, antibodies to detect the expression of this epitope are available. The HA-tag was introduced at the 5′ end of ORF7 (pABV525), and at the 3′ end of ORF7 (pABV526; FIG. 4) as such that it did not induce mutations in other ORFs. We expected to get high expression of the foreign antigen by inserting it in the ORF7 gene, because subgenomic messenger RNA7(encoding ORF7) is most abundantly produced in infected cells. Since we could not predict the influence of the HA-epitope on the function and the structure of the N protein, we created an additional in frame insertion of the 16-amino acid self-cleaving 2A protease of foot-and-mouth disease virus (FMDV; Percy et al., 1994). This protease was introduced downstream of the HA-tag at the 5′ end of ORF7, which resulted in clone pABV523 (FIG. 4). We expected that this would result in the expression of a polyprotein, which could be proteolytically cleaved to release both the HA-tag and the N-protein.

[0077] 5. Analysis of Recombinants of PRRSV Expressing the HA Epitope

[0078] First, the expression of the structural proteins by the various transcripts from the recombinant full-length cDNA clones was tested in IPMA. BHK-21 cells, transfected with transcripts of pABV523, 525, and 526 stained positive with MAbs directed against GP3, GP4, the M protein, and the N protein, which indicated that these PRRSV proteins were properly expressed (FIG. 4). The cells also stained positive with a MAb directed against HA, indicating that the HA epitope was expressed by all three RNAs. Therefore, the HA-expressing transcripts replicated in BHK-21 cells. In addition, the N-protein to which the HA-tag was fused was still expressed by the mutant RNAs.

[0079] To examine whether the transcripts of pABV523, 525 and 526 were able to produce infectious virus, the culture supernatant of transfected BHK-21 cells was used to infect PAMs.

[0080] PAMs not only stained positive with MAbs directed against the PRRSV proteins GP3, GP4, M protein and N protein in IPMA, but also with MAb 12CA5 directed against the HA epitope. However, when PAMs were double stained, both with MAbs against the HA-tag and the N protein, we also detected PAMs which could only be stained with the MAb against the N protein but not with that against the HA-tag. For viruses derived from pABV525 and pABV526 the percentage of cells that stained only with N-specific Mabs was higher than for the viruses derived form pABV523, which contained the additional protease 2A. This indicated that the HA-tag directly attached to the N- or C-terminus of the N protein disturbed to some extent either the packaging of the viral RNA or the infectivity of the virus. However, when the protease 2A was introduced to cleave the HA-tag from the N protein by the protease 2A, the fitness of the resulting virus (vABV523) was not or hardly reduced (FIG. 4). The recombinant viruses were designated vABV523, vABV525 and vABV526.

[0081] Analysis of protease 2A activity in vABV523 The activity of the protease 2A was further analyzed by radioimmunoprecipitation. Besides a 15 kDa protein, an additional protein of approximately 18 kDa was immunoprecipitated with N-specific MAb 122.17 from cells transfected with transcripts of pABV523. The 15 kDa protein was similar in size to the wild type N protein; the 18 kDa protein resembled the expected size of the polyprotein of HA-protease 2A-N. These data indicated that protease 2A of FMDV is able to cleave the HA-protease 2A-N polyprotein in the cell, which results in the release of the HA-tag from the N protein.

[0082] 5.Growth Characteristics of HA-Expressing Viruses

[0083] The amount of virus produced by BKH-21 cells transfected with transcripts from pABV437 and pABV523 was generally higher than that produced by BHK-21 cells transfected with transcripts from pABV525 and pABV526.

[0084] Serial passage of HA-expressing viruses on PAMs resulted in stocks of vABV523, vABV525, and vABV526 with titers of approximately 107 TCID50/ml. It needs to be resolved whether the HA-expressing viruses have the same growth properties as the wild type virus of the infectious copy of PRRSV (vABV437). This will be studied in growth curves.

[0085] 5. Analysis of the Stability of HA-Expressing Viruses.

[0086] To determine the stability of HA-expressing viruses, viral RNA was examined at passage 4. For this purpose, RT-PCR was performed on isolated viral RNA. Part of the ORF7 gene, the site at which the HA-tag was inserted, was amplified by PCR and the obtained fragments were analyzed on agarose gel. We obtained two fragments for vABV523 and vABV525 and one fragment for vABV526. Sequence analysis of the most abundantly amplified fragment showed that vABV523 at passage 4 still contained the properly inserted nucleotide sequence encoding the HA-tag and the protease 2A gene. In contrast, both vABV525 and vABV526 had lost the inserted nucleotide sequence encoding the HA-tag.

[0087] 1. Mutation of Cys-27 and Cys-76 in the N Protein Inhibits the Production of Infectious Particles of PRRSV

[0088] In this study we have found that mutation of Cys-27→Asn and Cys-76→Leu in the N protein of PRRSV interferes with the production of infectious particles in BHK-21 cells. We conclude that these residues are essential for a proper structure or function or both of the N protein in virus assembly of PRRSV. The N protein is involved in the first steps in virus assembly, the binding of the viral genomic RNA and formation of the capsid structure. Since transcripts of genomic length cDNA clones containing the Cys-27→Asn and Cys-76→Leu replicated at the wild type level, the mutations in the Cys residues destroy the binding of the RNA by the N protein. Alternatively, they induce a different structure of the N protein that inhibits the formation of proper capsids. The defect in the encapsidation of the viral RNA genome can be complemented by wild type N protein transiently expressed or continuously expressed in a (BHK-21) cell line. In this way a virus is produced that is able to complete only one round of infection/replication. Therefore such a virus is considered to be a very safe vaccine for protection against PRRSV in pigs.

[0089] 2. Introduction of a Marker in the N Protein of PRRSV.

[0090] The aim of this study was to create mutant PRRS viruses that can be serologically differentiated from field virus and therefore may be promising mutants for marker vaccine development against PRRSV. The N protein was chosen as a first candidate for mutagenesis to create a virus with a serologic marker since many studies have shown that the N protein is the most antigenic protein of PRRSV. For example, pigs infected with PRRSV develop strong antibody responses against the N protein of PRRSV (Meulenberg et al., 1995). In addition, the N protein contains two antigenic regions designated B and D that are conserved in European and US PRRSV isolates and MAbs directed to these regions are available (Meulenberg. et al., 1998). Here, we have demonstrated that mutation of 4 amino acids in site B to corresponding amino acids of the EAV N protein and mutation of 5 or 9 amino acids in domain D to corresponding amino acids of the LDV N protein inhibited the production of infectious virus particles. Since RNA replication and subgenomic mRNA synthesis appeared to be at the wild type level, these mutations most likely prevented the formation of proper capsids by the N protein. However, mutagenesis of a single amino acid in the D region (Asp-62→Tyr) resulted in virus vABV600 that had a different MAb binding profile from PRRSV and all other PRRSV Viruses. vABV600 induces a different spectrum of antibodies in pigs, compared to these other PRRSV isolates. Therefore vABV600 can be differentiated from field virus on the basis of serum antibodies and is an excellent mutant for further development of marker vaccines against PRRSV.

[0091] 3: Elucidation of Replication Signals in ORF7 of Lelystad Virus

[0092] It has been shown for many positive strand RNA viruses that their 5′ and/or 3′ noncoding regions contain essential signals that control the initiation of plus- and minus-strand RNA synthesis. It was not yet determined for PRRSV whether these sequences alone are sufficient for replication. The production of an infectious clone allowed us to analyse replication signals in the genome of PRRSV. In this study we have mapped cis-acting sequence elements required for replication by introducing deletions in the infectious clone. We have shown that transcripts derived from cDNA clones lacking the ORF7 gene are not replicated. A more systematic deletion analysis showed that a region of 44 nucleotides between nucleotides 14644 to 14687 in the ORF7 gene was important for replication of RNA of PRRSV. This was an essential interesting finding, since the sequences essential for replication of most positive strand RNA viruses are present in the 5′ and 3′ noncoding regions. It is also an important finding for studies who's aim is to develop viral replicons which can only be rescued in complementing cell lines expressing the deleted ORFs. The minimal sequence requirements for these RNAs are 5′ noncoding region-ORF1a-ORF1b-ORF7-3′ noncoding region. Viral RNA s or replicons containing these sequence elements supplemented with a selection of fragments from other PRRSV open reading frames or fragments of open reading frames expressing antigens of other (heterologous) pathogens can be packaged into virus particles when the proteins essential for virus assembly are supplied in trans. When these particles are given to pigs, for example as vaccine, they will enter specific host cells such as macrophages and virus- or heterologous antigens are expressed and induce immune responses because of the replicating RNA. However, since the RNA does not express (all) the proteins required for packaging and the production of new particles, the replicon can not spread further, creating an extremely efficient, but safe and not-spreading recombinant vaccine effective against PRRSV and/or heterologous pathogens.

[0093] 4. Production of an Attenuated PRRSV Virus by Deletion of the NdeI Site in ORF6.

[0094] In this study we have produced a mutant PRRS virus vABV575 that had different growth characteristics in PAMs compared to the parent strain vABV437. Whereas no difference in the expression of structural proteins in BHK-21 cells by RNAs of vABV575 or vABV437 was observed, the vABV575 virus produced in BHK-21 cells infected PAMs slower than vABV437. The growth kinetics of vABV575 need to be analyzed further by performing growth curves in PAMs. In the cDNA clone pABV575, that was used to produce vABV575, the NdeI site at position 14265 in ORF6 was mutated. This resulted in an amino acid change of Thr-59->Asn in the M protein. The mutated M protein was still bound by M-specific MAb 126.3. The M protein is the most conserved structural protein among arteriviruses and coronaviruses. The protein is an integral membrane protein containing three N-terminal hydrophobic membrane spanning domains (Rottier, 1995). The protein spans the membrane three times leaving a short N-terminal domain outside the virion and a short C-terminal domain inside the virion. The M protein of coronaviruses was shown to play an important role in virus assembly (Vennema et al., 1996). The Thr-59→Asn mutation is located between the second and third membrane spanning fragment of M in AB575. This mutation influences virus assembly, the stability of the virus, or virus entry in the PAMs.

[0095] 5. Expression of the HA Epitope in Recombinant PRRSV viruses

[0096] In this study we have successfully used PRRSV as a vector for the expression of a foreign antigen, an HA epitope of the haemagglutinin of influenza A virus. Recombinant PRRSV viruses were engineered that produced the HA tag fused to the N- or C- terminus of the N protein. In addition, a PRRSV mutant was created that contained the HA-tag as well as the protease 2A of FMDV fused to the N terminus of the N protein. The protease 2A was functionally active in the context of the PRRSV virus, and cleaved the HA-tag from the N protein. This resulted in an N protein that is identical to the wild type N protein, except for the first and second amino acids (Met and Ala) that are lacking in the mutant. Genetic analysis of passage 4 of the recombinant viruses indicated that the mutant virus containing both the HA-tag and the protease 2A was more stable than the mutant viruses expressing the HA-N-fusion proteins. Apparently, the lack of the first methionine? and mutation of the second amino acid at the N-terminus of N is better tolerated by the virus than the addition of the HA-tag of 9 amino acids to the N- or C-terminus of N. Further genetic and functional analysis needs to be done to explain the differences in stability observed for these viruses. In addition, pigs need to be infected with these HA-expressing mutants to determine whether antibody responses are induced against the HA epitope.

[0097] The ORF7 gene was selected for insertion of the HA-tag mainly for two reasons; (I) The subgenomic RNA7 expressing this gene is the most abundant subgenomic RNA produced in infected cells and (II) the HA-tag could be inserted without mutating other ORFs since ORF7 has very little overlap with ORF6 at the 5′ end and no overlap with other ORFs at the 3′ end. However, similar constructs can be made by introducing the HA-tag and protease 2A at the 5′ end of ORP2 and at the 5′ end of ORF5 without affecting other ORFs.

[0098] The successful expression of the HA-tag in combination with the protease 2A at the 5′ end of ORF7 creates new opportunities to express other foreign antigens such as the E2 protein of hog cholera virus, or B cell epitopes of parvo virus by PRRSV. Since PRRSV specifically infects macrophages, cells of the immune system that have antigen presentation and processing capacities, PRRSV might be an excellent vector for the expression of antigens and induction of immunity to these antigens in the pig.

LEGENDS TO THE FIGURES

[0099]
FIG. 1. Properties of full length cDNA clones of PRRSV containing mutations in the ORF7 gene. The mutated ORF7 genes were inserted in infectious cDNA clone pABV437 with the unique HpaI and PacI site that are indicated. The plasmid (pABV) numbers of the resulting constructs are shown. RNA replication was determined by detecting the expression of structural proteins in IPMA after transfection of the transcripts of the full length cDNA clones in BHK-21 cells. N protein production was determined in IPMA or immunoprecipitation. Production of infectious virus was established by transfer of the supernatant of transfected BHK-21 cells to PAMs and detection of cpe.

[0100]
FIG. 2. Properties of full length cDNA clones of PRRSV containing deletions in the region encoding the structural proteins of LV in order to elucidate the presence of replication signals in this region. The deleted regions (dotted bars), the regions of ORF7 still present (dark bars) and the plasmid (pABV) numbers of the resulting clones are shown. RNA replication was determined by detecting the expression of structural proteins, and the expression of the N-protein in particular, both in IPMA. Production of infectious virus was established by infecting PAMs with the supernatant of transfected BHK-21 cells. IPMA was performed to detect the expression of LV-proteins.

[0101]
FIG. 3. Properties of infectious cDNA clone pABV575. This clone was constructed by mutation of the NdeI site at position 14265 in ORF6. RNA replication was determined by detecting the expression of structural proteins in IPMA after transfection of the transcripts of the full length cDNA clones in BHK-21 cells. Production of infectious virus was established by transfer of the supernatant of transfected BHK-21 cells to PAMs and detection of cpe.

[0102]
FIG. 4. Introduction of an antigenic marker in the infectious clone of PRRSV. The insertion of the HA tag and protease 2A sequence in plasmids pABV 525, 523 and 526 is indicated. RNA replication was determined by detecting the expression of structural proteins in IPMA after transfection of the transcripts of the full length cDNA clones. The expression of N and HA was also determined in IPMA. Production of infectious virus was established by transfer of the supernatant of transfected BHK-21 cells to PAMS and detection of cpe.

References

[0103] 1. Liljeström, P. and Garoff, H. (1991). A new generation of animal cell expression vectors based on the Semliki Forest virus replicon. Biotechnol. 9, 1356-1361.

[0104] 2. Kolodziej, P. A. and Young, R. A. Epitope tagging and protein surveillance. 1991. Methods Enzymol. 194, 508-519

[0105] 3. Meulenberg, J. J. M., Bende, R. J., Pol, J. M., Wensvoort, G., and Moormann, R. J. M. (1995). Nucleocapsid protein N of Lelystad virus: expression by recombinant baculovirus, immunological properties, and suitability for detection of serum antibodies. Clin. Diagn. Laboratory Immunol. 2, 652-656.

[0106] 4. Meulenberg, J. J. M., Hulst, M. M., de Meijer, E. J., Moonen, P. L. J. M., den Besten, A., de Kluyver, E. P., Wensvoort, G., and Moormann, R. J. M. (1993). Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS) is related to LDV and EAV. Virology 192, 62-74.

[0107] 5. Meulenberg, J. J. M., and Petersen-den Besten, A. (1996). Identification and characterization of a sixth structural protein of Lelystad virus: The glycoprotein GP2 encoded by ORF2 is incorporated in virus particles. Virology 225, 44-51.

[0108] 6. Meulenberg, J. J. M., Bos-de Ruijter, J. N. A, van de Graaf, R., and Wensvoort, G., and R. J. M. Moormann. (1998) Infectious transcripts from cloned genome-length cDNA of porcine reproductive and respiratory syndrome virus. J. of Virology 72, 380-387.

[0109] 7. Meulenberg, J. J. M., van Nieuwstadt, A. P., van Essen-Zandbergen, A., Bos-de Ruijter, J. N. A., Langeveld, J. P. M., and Meloen, R. H. (1998) Localization and fine mapping of antigenic sites on the nucleocapsid protein N of porcine reproductive and respiratory syndrome virus with monoclonal antibodies. Virology, 252, 106-114.

[0110] 8. Murtaugh, M. P., Elam, M. R., and Kakach, L. T., (1995). Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus. Arch. Virol. 140, 1451-1460.

[0111] 9. Percy, N., Barclay, W. S., Garcia-Sastre, A. and Palese, P. Expression of a foreign protein by influenza A virus. 1994. J. Virol. 68: 4486-4492

[0112] 10. Rottier, P. J. M. (1995) The coronavirus membrane protein, p. 115-139. In: S. D. Siddell (ed.), The coronaviridae. Plenum Press, New York, N.Y.

[0113] 11. Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular cloning a laboratory manual. 1989. 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

[0114] 12. van Nieuwstadt, A. P., Meulenberg, J. J. M., van Essen-Zandbergen, A., Petersen-den Besten, A., Bende, R. J., Moormann, R. J. M., and Wensvoort, G. (1996). Proteins encoded by ORFs 3 and 4 of the genome of Lelystad virus (Arteriviridae) are structural proteins of the virion. J. Virol. 70, 4767-4772.

[0115] 13. Wensvoort, G., Terpstra, C., Pol, J. M. A., Ter Laak, E. A., Bloemraad, M., de Kluyver, E. P., Kragten, C., van Buiten, L., den Besten, A., Wagenaar, F., Broekhuijsen, J. M., Moonen, P. L. J. M., Zetstra, T., de Boer, E. A., Tibben, H. J., de Jong, M. F., van't Veld, P., Groenland, G. J. R., van Gennep, J. A., Voets, M. Th., Verheijden, J. H. M., and Braamskamp, J. (1991). Mystery swine disease in the Netherlands: the isolation of Lelystad virus. Vet. Quart. 13, 121-130.

[0116] 14. Vennema, H., Godeke, G. -J., Rossen, J. W. A., Voorhout, W. F., Horzinek, M. C., Opstelten, D. -J. E., and Rottier, P. J. M. (1996) Nucleocapsid-independent assembly of coronavirus-like patricales by viral envelope protein genes. EMBO J. 15, 2020-2028

[0117] Wensvoort, G., Terpstra, C., Boonstra, J., Bloemraad, M., and van Zaane, D. (1986). Production of monoclonal antibodies against swine fever virus and their use in laboratory diagnosis. Vet. Microbiol. 12, 101-108.

1TABLE 1Primers used in PCR-mutagenesis and sequencingSense (+)Primer (nt.)Sequence primeraantisense(-)PurposeLV975′CATTGCACCCAGCAACGGTTCAGTTGT 3′−Cys-27→AsnLV1005′CGTCTGGATCGATTGCAAGAGGAGGGA 3′−Cys-76→LeuLV1885′TCTGGATCGATTGCAAGCAGAGGGAGCGTTCAGTCTGGG−Asp-62→TyrTGAGGTGGTGCCGGATGTCATATTCAGCAG 3′LV275′GATTGGATCCAACACATCATTCGAGCTG 3′+Δ NdelLV1825′GGATTGAAAATGCAATTAATTCATGTAT 3′−Δ Ndel118U250 (14755)5′CAGCCAGGGGAAAATGTGGC 3′−SequencingLV37 (14340)5′GATTGGATCCACCATGGAGTCATGGAAGTTTATCACT 3′+SequencingLV75 (15088)5′TCTAGGAATTCTAGACGATCG 3′−SequencingLV76 (15088)5′TCTAGGAATTCTAGACGATCG(T)403′−RT-PCRLV82 (14703)5′AGCAACCTAGGGGAGGACAG 3′+SequencingLV108 (14566)5′GGAGTGGTTAACCTCGTCAAGTATGGCCGGTAAAAACCAGAGCC 3′+ORF7-HALV112 (14958)5′CCATTCACCTGACTGTTTAATTAACTTGCACCCTGA 3′−Pacl siteLV139 (14609)5′AACTTTGACCTTCTCAAGTTGGCCGGCGACGTCGAGTCCAA+1st HA-prot-ORF7CCCAGGGCCCGGTAAAAACCAGAGCCAGAA 3′LV140 (14609)5′GAGTGGTTAACCTCGTCAAGTATGGCCGGTAAATACCCATACGAT+2nd HA-prot-ORF7GTTCCAGATTACGCT0AACTTTGACCTTCT 3′LV188 (14687)5′ACGTGCGTTAACTAAGGTGCAATGATAAAGTCCCA 3′+Δ 99 nt. 5′ORF7LV189 (14796)5′ACGTGCGTTAACTAAATCCGGCACCACCTCACCCA 3′+Δ 198 nt. 5′ORF7LV190 (14885)5′ACGTGCGTTAACTAAGGGAAGGTCAGTTTTCAGGT 3′+Δ 297 nt. 5′ORF7LV191 (14936)5′ACGTGCGTTAACTAACGCCTGATTCGCGTGACTTC 3′+Δ 348 nt. 5′ORF7LV192 (14609)5′AAATACCCATACGATGTTCCAGATTACGCTAACCAGAGCCA 3′+1st HA-ORF7LV193 (14609)5′AGTGGTTAACCTCGTCAAGTATGGCCGGTAAA TACCCATACG 3′=2nd HA-ORF7LV194 (14971)5′ACTGTTTAATTAAGCGTAATCTGGAACATCGTA−ORF7-HATGGGTAACTTGCACCCTG 3′LV195 (14642)5′ACGTGCGTTAACTAACCGATGGGGAATGGCCAG 3′+Δ 55 nt 5′ORF7LV196 (14642)5′GGAGTGGTTAACCTCGTCAAGTAACCGATGGGGAATGGCCAG 3′+Δ 45 nt 5′ORF7LV197 (14597)5′ACGTGCGTTAACGGCCGGTAAAAACCAGAGC 3′+Δ 10 nt 3′ORF6LV198 (141333)5′GCTCGTGCTAGCCTTTAGCATCACATACAC 3′+Δ 54 nt 3′ORF6LV199 (14596)5′CTTGACGAGGTTAACTGGTACTAGAGTGCC 3′−Δ 54 nt 3′ORF6aRestriction sites are underlined, inserted foreign sequences are boxed (HA: line; protease: dotted line)

[0118]

2

TABLE 2

Staining of LV4.2.1, vABV600 (Asp-62→Tyr mutation),

ATCCVR2332-like PRRSV containing an Asp61→ Tyr

mutation in the N protein, and ATCC-VR2332 with

various N-specific MAbs in IPMA

vABV600
ATCCVR2332-

(Asp-62→
like (Asp61→

MAb
Site
LV4.2.1
Tyr)
Tyr)
ATCC-VR2332

138.22
A
+
+
−
−

NS99
B
+
+
+
+

122.17
D
++
++
++
++

130.2
D
++
−1)
−
+

130.4
D
++
−1)
−
+

131.7
D
++
−1)
−
+

131.9
D
++
−1)
−
+

SDOW17
D
++
−1)
−1)
++

WBE1
D
+
−
−
−

WBE4
D
++
++
−
−

WBE5
D
++
++
−
−

WBE6
D
++
++
−
−

VO17
?
−
−
+
+

1)
No staining in IPMA with hybridoma culture supernatant diluted to 0.3-0.5 μg/ml, but faint staining with IgG purified from the culture supernatant diluted to 10 μg/ml.

[0119]

	Number	Date	Country
Parent	PCT/NL00/00152	Mar 2000	US
Child	09948747	Sep 2001	US

PRRSV vaccines

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

Priority Claims (1)

Continuations (1)