Purified enzymes participating in C-terminal amidation

This application is a 371 of Application No. PCT/JP90/01036, filed Aug. 14, 1990.
TECHNICAL FIELD
This invention relates to a novel enzyme participating in a C-terminal amidation of a peptide C-terminal glycine adduct, a method of preparing same, and the use thereof. The term "participating in a C-terminal amidation" as used herein means possessing an action promoting any step for converting a peptide C-terminal glycine adduct into its peptide C-terminal amidated compound.
BACKGROUND ART
In the past, the enzyme participating in the enzymatic reaction in vivo, i.e., a C-terminal amidation of a C-terminal glycine adduct of peptides (compound in which glycine is peptide-bonded to C-terminal residue) is called peptidylglycine-.alpha.-amidating monooxygenase (C-terminal amidating enzyme) (EC.1.14.17.3) (Bradbury et. al., Nature, 298, 686, 1982: Glembotski et. al., J. Biol. Chem., 259. 6385, 1984), and is considered to catalyze the following reaction: ##STR1##
To clarify the amidation mechanism in vivo and utilize the enzyme for the method of converting the peptides which exhibit a physilogical activity for the first time by an amidation of the C-terminal with the peptide produced by the recombinant DNA technique, for example, calcitonin and gastrin, in vitro, attempts have been made to purify this enzyme. For example, there have been reported those derived from bovine pituitary gland middle lobe (Murthy et. al., J. Biol. Chem., 261, 1815, 1986), porcine pituitary gland (Kizer et. al., Endocrinology, 118, 2262, 1986; Bradbury et. al., Eur. J. Biochem., 169, 579, 1987), porcine heart atrium (Kojima et. al., J. Biochem., 105, 440, 1989), Xenopus body skin (Mizuno et. al., Biochem., Biophys. Res. Commun., 137, 984, 1986), rat thyroid gland tumor (Mehta et. al., Arch. Biochem., Biophys., 261, 44, 1988).
On the other hand, since it is difficult to procure a large amount of these purified enzymes, attempts have been made to isolate the cDNA's necessary for expression of these enzymes by use of the recombinant DNA technique generally practiced in recent years, and the production of the enzymes by utilizing same. For example, Eipper B. A, et. al. in Mol. Endocrinol. 1, 777-790, 1987, Ohsuye K. et. al. in Biochem. Biophys. Res. Commun., 150, 1275-1281, 1988, Stoffers, D. A. et. al. in Proc. Natl. Acad. Sci., USA, 86, 735-739, 1989, and Glauder, J. et. al. in Biochem. Biophys. Res. Commun., 169, 551-558, 1990, have reported peptide C-terminal amidating enzyme cDNA's derived from bovine pituitary gland, frog skin, rat atrium and human thyroid gland cell, respectively. Further, although not necessarily having a satisfactory productivity, there are also known examples of peptide C-terminal amidating enzymes produced by using of the recombinant DNA technique utilizing the cDNA derived from frog and bovine (e.g., see Japanese Unexamined Patent Publication (Kokai) No. 1-104168, Published International Application: WO89/02460, and Perkins et. al., Mol. Endocrinol., 4, 132-139, 1990).
On the other hand, these proteins have been reported to have molecular weights of 38, 42 or 54 kDa in bovine, 39 kDa in frog, and 41, 50, or 75 kDa in rat, which are very different from each other, depending on the collecting methods, etc. For example, the literature of Bradbury et. al., described above, Ramer et. al., 110, 8526-8532 (1988) and Young et. al., J. Am. Chem. Soc. 111, 1933-1934 (1989) suggest the existence of reaction intermediatesm, but there are no current examples which clarify the isolation of an intermediate, and the relationship between the intermediate and the amidating enzyme.
As described above, the peptide C-terminal amidating enzyme exhibits a very interesting action in vivo, and a composition having a constant purity derived from a specific living body organ is known. Nevertheless, these compositions cannot be used for the production of a peptide C-terminal amidated compound in vivo, as the purity and stability as well as to production costs thereof are not satisfactory. To solve these problems, on the premise that it is necessary to collect basic knowledge concerning the enzyme, i.e., clarify the reaction mechanism when carrying out the C-terminal amidation reaction, the present inventors attempted to isolate the intermediate product, and consequently successfully isolated the intermediate and determined the structure thereof. From this result it was found that the enzymatic active substance called the C-terminal amidating enzyme of the prior art is not a one-step reaction as considered in the prior art, but is a two-step reaction through the intermediate (corresponding to C-terminal .alpha.-hydroxylglycine adduct).
Since it is predicted that an efficient conversion of a peptide C-terminal glycine adduct into the corresponding amidated compound can be carried out by the single or combined use of enzymes catalyzing the respective reaction under adequate conditions, it will become necessary to provide these enzymes. Further, where the existence of these enzymes can be confirmed, it will become necessary to provide an efficient method of preparing same.
DISCLOSURE OF THE INVENTION
According to the present invention, there are provided an enzyme participating in a C-terminal amidation which acts on a C-terminal glycine adduct represented by the following formula (I): ##STR2## (wherein A represents a residue other than .alpha.-amino group or imino group and .alpha.-carboxylic group derived from naturally occurring .alpha.-amino acid, X represents a hydrogen atom or a residue of an amino acid derivative which is bonded to an N atom through a carbonyl group) to form a C-terminal .alpha.-hydroxylglycine adduct represented by the following formula (II): ##STR3## (wherein A and X have the same meanings as above, hereinafter sometimes called "Enzyme-I"), and an enzyme participating in a C-terminal amidation of a C-terminal glycine adduct which acts on a C-terminal .alpha.-hydroxylglycine adduct represented by the above formula (II) to form a C-terminal amidated compound represented by the following formula (III): ##STR4## (wherein A and X have the same meanings as above) (hereinafter sometimes called "Enzyme-II").
In the formulae (I), (II), and the formula (III), the hydrogen atom in the bracket (H) means no hydrogen atom exists when A is derived from an .alpha.-amino acid having an .alpha.-imino group.
By using each of these enzymes or a combination thereof, the peptide C-terminal glycine adduct represented by the formula (I) can be efficiently converted into the corresponding peptide C-terminal amidated compound represented by the formula (III).
According to the present invention, there are also provided a method of producing these enzymes from the above-mentioned enzyme activity-containing compound, by the use of a specific ligand, and a method of efficiently producing these enzymes by the use of a cDNA coding these enzyme activity-containing peptides.
Further, according to present invention, there are provided a method of assaying the activity of the above-mentioned enzyme and a method of screening said enzyme-containing compounds.
Furthermore, according to the present invention, a cDNA encoding said enzyme activity derived from horse.

BRIEF DESCRIPTION OF THE DRAWINGS
In the description and drawings, letters which are used in an amino acid sequence by one letter mean those which are usually used in the art, and "hyG" means .alpha.-hydroxyglycine.
FIG. 1 is an HPLC pattern when preparing FGFhyG by using the enzyme-I of the present invention, with FGFG as the substrate;
FIG. 2 shows the results of an FAB-MS spectrum analysis conducted for confirmation of the molecular structure of FGFhyG prepared;
FIG. 3 is a chromatogram pattern showing a separation of the enzyme-I and the enzyme-II of the present invention according to chromatography by a Mono Q column, wherein the open square plots indicate the activity of the enzyme-II, the filled circle plots show the activity of the enzyme-I, and the broken line shows the linear concentration gradient of sodium chloride;
FIG. 4 shows an HPLC pattern over a lapse of time when preparing FGF-NH.sub.2 by using the enzyme-II of the present invention with FGFhyG as the substrate;
FIGS. 5(A)-5(F) show the amino acid sequences estimated from the peptide C-terminal amidating enzyme cDNA's cloned from human, horse, bovine, rat, frog, as a one letter representation;
FIGS. 6(A)-6(H) show the nucleotide sequence of the C-terminal amidating enzyme cDNA cloned from the rat pituitary mRNA and the amino acid sequence estimated therefrom;
FIG. 7 schematically shows the five C-terminal amidating enzymes cloned from the rat pituitary mRNA, wherein the region coding for the enzyme estimated is shown by boxes. The numerals indicate the base numbers (bp) with the translation initiation point being made 1, TM represents the portion corresponding to the membrane-transport region, KK represents the lysine--lysine sequence, and the restriction endonucleases are shown by the following abbreviations, respectively:
B (Bam HI), N (Nsi I), RI (EcoRI), RV (EcoRV), S (SPhI), X (XmaI).
FIG. 8, FIG. 9, and FIG. 10 show the Sephacryl S-200 column chromatography patterns of the enzymes expressed by the plasmids SV-a, SV-b, SV-203, respectively;
FIG. 11 and FIG. 12 show the changes in production of the .alpha.-hydroxylglycine adduct, and the C-terminal amidated compound over a lapse of time when using PheGlyPheGly as the substrate;
FIGS. 13(A)-13(P) show the nucleotide sequence of the longest cDNA fragment among the cDNA's coding for the polypeptide having a peptide C-terminal amidating enzyme activity derived from isolated horse and the amino acid sequence coded for thereby as a one letter representation; and
FIGS. 14(A)-FIGS. 14(C) and FIGS. 15(A)-15(F) respectively show a part of the base sequence of cDNA's coding for the peptide C-terminal amidating enzymes derived from rat used as the probe, which were digested with different restriction endonucleases, respectively.

BEST MODE OF CARRYING OUT THE INVENTION
The C-terminal glycine adduct represented by the formula (I) of the present invention, i.e., the substrate of the enzyme composition of the present invention, may generally include compounds derived from amino acid derivatives wherein the ##STR5## moiety in the above formula is natural or synthetic, particularly the compounds derived from peptides or proteins, with glycine being bonded to the C-terminal acid residue thereof (represented by --N(H)--A--CO--). As the C-terminal amino acid residue, a residue derived from naturally occurring .alpha.-amino acid, particularly an amino acid constituting proteins, for example, an aliphatic amino acid such as glycine or alanine; branched amino acid such as valine, leucine or isoleucine; hydroxylated amino acid such as serine or threonine; acidic amino acid such as aspartic acid or glutamic acid; amide such as asparagine or glutamine; basic amino acid such as lysine, hydroxylysine, arginine; sulfur containing amino acid such as cysteine, cystine or methionine; aromatic amino acid such as phenylalanine or tyrosine; heterocyclic amino acid such as tryptophan or histidine; and imino acid such as proline or 4-hydroxyproline may be included. The hydrogen atom or the residue of the amino acid derivative bonded to the .alpha.-amino group or imino group of the amino acid residue (represented by X--) is not particularly limited with respect to the kind and chain length of the peptide of the constituent amino acid residue, provided that it is a peptide bonded through a single amino acid or .alpha.-amino group, and further, phosphoric acid, sugar or other substituent may be covalently bonded to the constituent amino acid residue and it may form a conjugate with a lipid. Specific examples of the above-mentioned substituents include, corresponding to the respective amino acid residues, the substituents on the guanidino group of arginine residue, for example, alkyl groups such as methyl, ethyl, etc., the residues derived from adenosine diphosphate ribose, citrulline or ornithine; substituents derived from .epsilon.-amino group of lysine residue, for example, the substituents derived from compounds having glycosyl group, pyridoxyl group, biotinyl group, lipoyl group, acetyl group, phosphoric acid or .delta.-hydroxyl group, compounds having .delta.-glycosyl group, residue derived from glutaraldehyde or citraconic anhydride, etc.; substituents on the imidazole group of hystidine residue, for example, methyl group, the substituents derived from phosphoric acid, iodine atom or flavin; substituents on proline residue, for example, hydroxyl group, dihydroxyl group, glycosyloxy group; substituents on the benzene ring of phenylalanine residue, for example, hydroxyl group or glycosyloxy group; substituents on the hydroxyl group of tyrosine residue, for example, glycosyloxy group, sulfonic acid group, iodine atom, bromine atom or chlorine atom, or a compound having hydroxyl group, bisether, adenine, residue derived from uridine or RNA (ribonucleic acid), etc.; substituents on the hydroxyl group of serine residue, for example, methyl group, glycosyl group, phosphopanteteic acid, adenosine diphosphoric acid ribosyl or phosphoric acid; substituents on the hydroxyl group of threonine residue, for example, glycosyl group, methyl group or phosphoric acid group; substituents on the SH group of cysteine residue, for example, glycosyl group, the substituents derived from cystinyl, dehydroalanyl group, selenium atom, or residue derived from heme or flavin; substituents on the carboxyl group of aspartic acid or glutamic acid residue, for example, methyl group, phosphoric acid group or .gamma.-carboxyl group; substituents on asparagine or glutamine residue, for example, glycosyl group, pyrrolidonyl group or imino group, etc.
The peptide having glycine peptide bonded to the C-terminal residue as in the above substrate, or its derivative may be either naturally extracted or produced by chemical synthesis, or produced by a recombinant DNA technique. Therefore, as the substrate of the present invention, the compound represented by the formula (I) may include C-terminal glycine adducts (i.e., amide bonded compounds of C-terminal carboxyl group and glycine), for example, peptides with amino acid residues of about 2 to 100, phosphate peptides as represented by casein, protein kinase, adenovirus EIA protein, RAS 1 protein, etc. and hydrolyzates thereof, lipoproteins such as thromboplastin, .alpha..sub.1 -lipoprotein, lipovitellin, etc. and hydrolyzates thereof, metal proteins as represented by hemoglobin, myoglobin, hemocyanin, chlorophyil, phycocyanin, flavin, rhodopsin, etc., and hydrolyzates thereof, glycoproteins as represented by collagen, laminin, interferon .alpha., seroglycoide, avidin, etc., and hydrolyzates thereof, as well as other physiologically active peptides of the maturation type with amidated C-terminal carboxyl group, for example, calcitonin, secretin, gastrin, vasoactive intestinal peptide (VIP), cholecystokinin, caerulein, pancreatic polypeptide, growth hormone-releasing factor, corticotropin-releasing factor, calcitonin gene related peptide, etc. Of these, a preferable substrate for identifying the enzyme activity of the enzyme composition of the present invention includs D-tyrosyl-valyl-glycine, D-tyrosyl-tryptophanyl-glycine, glycyl-phenylalanyl-glycine, phenylalanyl-glycyl-phenylalanyl-glycine, D-tyrosyl-leucyl-asparaginyl-glycine, arginyl-phenylalanyl-arginyl-alanyl-arginyl-leusyl-glycine, leucyl-methionyl-glycine, glycyl-leucyl-methionyl-glycine, phenylalanyl-glycyl-leucyl-methionyl-glycine, asparaginyl-arginyl-phenylalanyl-glycine, tryptophanyl-asparaginyl-arginyl-phenylalanyl-glycine, alanyl-phenylalanyl-glycine, lysyl-alanyl-phenylalanyl-glycine, seryl-lysyl-alanyl-phenylalanyl-glycine, arginyl-tyrosyl-glycine, glycyl-methionyl-glycine, glycyl-tyrosyl-glycine, glycyl-histidyl-glycine, histidyl-glycyl-glycine, tryptophanyl-glycyl-glycine and glycyl-cysteinyl-glycine and the like (except for glycine, L-form is shown unless otherwise particularly noted as D-). On the other hand, a preferable substrate for effectively utilizing the present enzyme composition includs the peptides with glycine peptide bonded to the C-terminal carboxyl group thereof, which form a physiologically active peptide of the maturation type by amidation of the above-mentioned C-terminal carboxyl group.
Acting on the substrate as mentioned above, the enzyme-I of the present invention can form a C-terminal .alpha.-hydroxylglycine adduct represented by the following ormula (II): ##STR6## (wherein specific examples of the ##STR7## moiety have the meanings as defined for the above formula (I)).
The compound represented by the formula (II) can be converted by hydrolyzing under conditions whereby no deleterious influence is exerted on the moiety ##STR8## or by treating with the second enzyme of the present invention, as described below, to be converted to the corresponding C-terminal amidated compound.
The above-mentioned enzyme-I has a molecular weight of about 25 kilo-dalton (kDa) in horse and of about 36 kDa in rat according to the molecular weight determination method by use of gel filtration. More specifically, the molecular weight can be measured according to the gel filtration method known per se (e.g., "Seikagaku Jikken Kouza 5, Enzyme Study Method, Former vol., p. 283-298", Tokyo Kogaku Dojin (1975)). Specifically by use of a 50 mM Tris-HCl (pH 7.4) containing 100 mM potassium chloride as the equilibration and eluting solution, gel filtration was effected on Toyopearl HW-55S (produced by Toso), and the molecular weight was determined with .beta.-amylase (M.W. 200,000), alcohol dehydrogenase (M.W. 150,000), BSA (M.W. 66,000), carbonic anhydrolase (M.W. 29,000) and cytochrome C (M.W. 15,400) as the indices.
The enzyme-I of the present invention is further specified by the following physicochemical properties, namely:
(a) the optimum pH is about 5 to 7 and the stable pH is 4 to 9;
(b) the acting optimum temperature is from about 25.degree. to 40.degree. C.;
(c) metal ions and ascorbic acid act as the cofactor.
The above properties (a) and (b) are measured by the use of conventional buffers, specifically, Tris-HCl, Mes-potassium hydroxide, Tes-sodium hydroxide, Hepes-potassium hydroxide buffers. The enzyme composition of the present invention can catalyze the above reaction within the temperature range of 1.degree. C. to 55.degree. C., but will be inactivated at 56.degree. C. within about 10 minutes; a slight inactivation is also seen at around 40.degree. C.
As the metal ion, Cu.sup.2+, Zn.sup.2+, Ni.sup.2+, Co.sup.2+, Fe.sup.3+, etc. are suitable, but particularly preferably Cu.sup.2+ and Zn.sup.2+ are used.
The present invention further provides another kind of enzyme, as follows. More specifically, there is provided an enzyme participating in a C-terminal amidation of a C-terminal glycine adduct which acts on a C-terminal .alpha.-hydroxylglycine adduct represented by the above formula (II) to form a C-terminal amidated compound represented by the following formula (III): ##STR9## (wherein A and X have the same meanings as defined above) and glyoxylic acid.
The molecular weight of this enzyme also depends on the origin thereof. When separated from the enzyme activity-containing compound described below, followed by purification, the enzyme-II is an enzyme participating in a C-terminal amidation of glycine adduct, which has a molecular weight of about 40 kDa when derived from horse, or about 43 kDa when derived from rat according to the molecular weight determination method by gel filtration. The molecular weight of the enzyme-II produced by utilizing cDNA is sometimes large and similar to the case of the enzyme-I. The significance and molecular weight determination of the moiety ##STR10## used for specifying this enzyme are the same as used for specifying the enzyme-I. As preferable substrates for identification of the enzyme activity of the enzyme-II, .alpha.-hydroxyglycine compounds corresponding to the substrates specifically enumerated above for the enzyme-I may be included.
Specific examples include D-tyrosyl-valyl-.alpha.-hydroxyglycine, D-tyrosyl-tryptophanyl-.alpha.-hydroxyglycine, glycyl-phenylalanyl-.alpha.-hydroxyglycine, phenylalanyl-glycyl-phenylalanyl-.alpha.-hydroxyglycine, D-tyrosyl-leucyl-asparaginyl-.alpha.-hydroxyglycine, arginyl-phenylalanyl-.alpha.-hydroxyglycine, arginyl-alanyl-arginyl-leusyl-.alpha.-hydroxyglycine, leucyl-methionyl-.alpha.-hydroxyglycine, glycyl-leucyl-methionyl-.alpha.-hydroxyglycine, phenylalanyl-glycyl-leucyl-methionyl-.alpha.-hydroxylglycine, asparaginyl-arginyl-phenylalanyl-.alpha.-hydroxyglycine, triptophanyl-asparaginyl-arginyl-phenylalanyl-.alpha.-hydroxyglycine, alanyl-phenylalanyl-.alpha.-hydroxyglycine, lysyl-alanyl-phenylalanyl-.alpha.-hydroxyglycine, seryl-lysyl-alanyl-phenylalanyl-.alpha.-hydroxyglycine, arginyl-tyrosyl-.alpha.-hydroxyglycine, glycyl-methionyl-.alpha.-hydroxyglycine, glycyl-tyrosyl-.alpha.-hydroxyglycine, glycyl-histidyl-.alpha.-hydroxyglycine, histidyl-glycyl-.alpha.-hydroxyglycine, triptophanyl-glycyl-.alpha.-hydroxyglycine, and glycyl-cysteinyl-.alpha.-hydroxyglycine and the like.
The enzyme-II is also specified by having substantially the same properties as the enzyme-I, as other physicochemical properties, namely:
(a) the optimum pH is about 5 to 6 and the stable pH is 4 to 9; and
(b) the acting optimum temperature is from about 15.degree. to 35.degree. C.
The above properties (a) and (b) are measured by the use of conventional buffers, specifically, Tris-HCl, Mes-potassium hydroxide, Tes-sodium hydroxide, Hepes-potassium hydroxide buffers. The enzyme composition of the present invention can catalyze the above reaction within the temperature range of 1.degree. C. to 55.degree. C., but will be inactivated at 56.degree. C. within about 10 minutes, a slight inactivation is also seen at around 40.degree. C.
Preparation of Enzyme
The enzyme-I and the enzyme-II of the present invention as described above can be prepared according to the separation purification method of enzyme known per se, but preferably are obtained according to the preparation method of the present invention disclosed in the present specification. More specifically, it is possible to utilize the preparation method of the enzyme-I or the enzyme-II characterized by treating the enzyme activity containing compound of the enzyme-I or the enzyme-II with the substrate affinity chromatography by use of the C-terminal glycine adduct represented by the above formula (I) as the ligand and the anion exchange chromatography.
The enzyme activity-containing compound to be used in this method can include all of those containing the enzyme of the present invention, and may be either those derived from an organism or those provided artificially. Generally speaking, as the organism having these enzyme activities, there may be included preparations derived from mammals such as human, bovine, horse, porcine, sheep, rabbit, goat, rat, mouse, etc.; avian such as chicken, jungle fowl, rock-dove, etc.; reptiles such as stone-turtle, viper, rattling snake and cobra; tatrachian such as newt, xenopus, bullfrog, toad, etc.; fish such as lamprey, hagfish, oil shark, electric ray, sturgeon, herring, salmon, eel, Tetrodon rubripes, bream; insects such as coakroach, silkworm, drosophila and bee. As the suitable material to be extracted, there may be included homogenates derived from such organs as the brain, pituitary gland, stomach, heart and liver, as well as biological fluids containing body fluids such as blood and lymph.
More specifically, the enzyme of the present invention (enzyme-I or enzyme-II) can be obtained from the biological fluid having the present enzyme as mentioned above, by substrate affinity chromatography using the C-terminal glycine adduct represented by the following formula (I): ##STR11## (wherein A and X have the meanings as defined above) as the ligand, used optionally in combination with the conventional method, such as:
(1) fractionation by precipitation;
(2) heparin affinity chromatography;
(3) molecular weight fractionation method by dialysis, gel filtration, etc.; and/or
(4) ion-exchange chromatography.
As the above-mentioned ligand, all of the peptide C-terminal glycine adducts represented by the above formula (I) can be used, but preferably they include the peptides comprising 2 to 6 amino acid residues including glycine as specifically a preferable substrate for identification of the above-mentioned enzyme activity. Among them, D-Tyr-Trp-Gly, Phe-Gly-Phe-Gly and Gly-Phe-Gly are more preferable, but that using Phe-Gly-Phe-Gly as the ligand is particularly preferred as having a strong affinity for the enzyme composition of the present invention (also called the present enzyme).
These ligands are generally used as bound to a water-insoluble carrier, and it is important that the carboxyl group of the C-terminal glycine residue of the peptide to be used as the ligand should be in a free state or bondable to the carrier through the amino group of the amino acid residue at the N-terminal. In other words, the carrier may be any one which can be bound to the amino group of the peptide, and an active group reactive with the amino group may be chemically introduced into the carrier, or alternatively a commercially available carrier having the active group already introduced wherein may be used. The method of introducing chemically may be any method generally employed. For example, as described in "Seikagaku Jikkenhou, Vol. 5, Former vol., p. 257-281" written by Kasai, Tokyo Kagaku Dojin (1975), imidocarboxyl group is introduced into agarose by the use of cyanogen bromide. Commercially available activated carriers may include agarose type, cellulose type, hydrophilic polyvinyl type, etc. with the substrate as the index, but any of these may be employed. As the agarose type carrier, there may be included CNBr activated Sepharose 4B (produced by Pharmacia) in which the CNBr method is used for binding the ligand with the amino group, CH-Sepharose 4B, ECH-Sepharose 4B (all produced by Pharmacia) by the carbodiimide method, Affigel 10, Affigel 15 (all are produced by Biorad), the tresyl activated Sepharose 4B (produced by Pharmacia) by use of the tresyl chloride method, etc. As the cellulose type carrier, Formylcellulofine (produced by Chisso) by using the formyl method may be included. As the hydrophilic polyvinyl type carrier, there may be included AF-carboxyltoyopearl 650 by using the carbodiimide method, AF-formyltoyopearl 650 by use of the formyl method, AF-tresyltoyopearl 650 by use of the tresyl chloride method, AF-epoxytoyopearl 650 by use of the epoxy activation method (all are produced by Toso), etc. The binding reaction with the ligand may be carried out according to the instructions for each carrier.
Of these, the method of preparing Affigel 10 is described. The reaction between Affigel 10 and the peptide is carried out in a buffer such as Mopspotassium hydroxide, etc. of 0.001 to 1M, preferably 0.1M. The reaction conditions can be 0.degree. to 20.degree. C., 10 minutes to 24 hours and about pH 3 to 11, but preferably are 4.degree. C., 4 to 24 hours and pH 5 to 9. The mixing ratio of Affigel 10 to the peptide to be used for binding may be within the range of up to 25 .mu.mol per 1 ml of Affigel, because more will be bound as the peptide is added in a larger amount within this range, but conveniently about 1 to 20 .mu.mol may be used with respect to the binding efficiency. After the reaction, the mixture is thoroughly washed with the buffer used during the reaction, and then Tris-HCl (pH 8.0) is added to the final concentration of 50 mM, and the unreacted active groups are blocked according to the shaking method, at 4.degree. C. for one hour, etc., whereby the substrate affinity gel is prepared.
The substrate affinity chromatography may be carried out either batchwise or continuously with the gel packed in a column. The time for contacting the sample with the gel may be such that the present enzyme can be sufficiently adsorbed, but may be generally 20 minutes to 24 hours. Nonadsorbed components are washed away with a buffer having the same composition as that used for equilibration of the gel with a low ionic strength and pH of 6.0 to 11.0, preferably 7.0 to 9.0, for example, 10 mM Hepes-potassium hydroxide (pH 7.0). Among them, the fractions in which the present enzyme activity exists are eluted. The eluting solution may have any composition which can give the present enzyme with a good efficiency, but preferable examples include buffers with a pH of between 7.0 to 9.0 containing about 1 to 40% of acetonitrile together with 0.1 to 1M sodium chloride, such as 10 mM Hepes-sodium hydroxide (pH 7.0) containing 20% acetonitrile and 0.4M sodium chloride. Also, when filled in the column, elution may be carried out with application of the concentration gradient.
In some cases, before or after practicing the above substrate affinity chromatography (hereinafter represented by (5)), or both before and after, the fractionation by way of precipitation as mentioned above (hereinafter represented by (1)), heparin affinity chromatography (hereinafter represented by (2)) dialysis, molecular weight fractionation by gel filtration, etc. (hereinafter represented by (3)) and/or ion-exchange chromatography (hereinafter represented by (4)) may be also practiced. Thus, the present enzymes (enzyme-I and enzyme-II) can be separated form other intervening matters, and for separation of the enzyme-I and enzyme-II, it is effective to practice the steps of (3) and/or (4). Generally speaking, it is preferable to practice the total number of 1 to 6 steps, and further, the above step (5) or (3) as the final step. Specific examples of the combinations of the respective steps may include only (5), (1).fwdarw.(5), (5).fwdarw.(3), (2).fwdarw.(5), (1).fwdarw.(3).fwdarw.(5), (2).fwdarw.(3).fwdarw.(5), (1).fwdarw.(5).fwdarw.(3), (2).fwdarw.(5).fwdarw.(3), (2).fwdarw.(1).fwdarw.(5), (1).fwdarw.(2).fwdarw.(3).fwdarw.(5), (1).fwdarw.(2).fwdarw.(5).fwdarw.(3), (1).fwdarw.(3).fwdarw.(5).fwdarw.(3), (1).fwdarw.(2).fwdarw.(1).fwdarw.(5), (1).fwdarw.(2).fwdarw.(1).fwdarw.(3).fwdarw.(5), (2).fwdarw.(1).fwdarw.(5).fwdarw.(3), (2).fwdarw.(1).fwdarw.(3).fwdarw.(5), (2).fwdarw.(1).fwdarw.(3).fwdarw.(5).fwdarw.(3), (1).fwdarw.(2).fwdarw.(3).fwdarw.(5).fwdarw.(3), (1).fwdarw.(3).fwdarw.(2).fwdarw.(3).fwdarw.(5), (1).fwdarw.(3).fwdarw.(2).fwdarw.(3).fwdarw.(5).fwdarw.(3), (4).fwdarw.(3).fwdarw.(5), (5).fwdarw.(3).fwdarw.(5).fwdarw.(3), (1).fwdarw.(5).fwdarw.(3).fwdarw.(5).fwdarw.(3), (4).fwdarw.(5), (1).fwdarw.(3).fwdarw.(5).fwdarw.(4).fwdarw.(3), (1).fwdarw.(3).fwdarw.(4).fwdarw.(3).fwdarw.(5), (1).fwdarw.(2).fwdarw.(3).fwdarw.(5).fwdarw.(3).fwdarw.(4), (1).fwdarw.(2).fwdarw.(3).fwdarw.(5).fwdarw.(4).fwdarw.(3), or (4).fwdarw.(5).fwdarw.(3).
Among them, it is preferred that the steps should proceed in the order of (1).fwdarw.(2).fwdarw.(3).fwdarw.(5), (1).fwdarw.(2).fwdarw.(3).fwdarw.(5).fwdarw.(3), (1).fwdarw.(3).fwdarw.(2).fwdarw.(3).fwdarw.(5) or (1).fwdarw.(3).fwdarw.(2).fwdarw.(3).fwdarw.(5).fwdarw.(3), (1).fwdarw.(2).fwdarw.(3).fwdarw.(5).fwdarw.(4).fwdarw.(3).
In the following, the above steps (1) to (4) are described. These steps are all carried out at 0.degree. C. to 10.degree. C., preferably 4.degree. C.
As the substance to be used for fractionation according to precipitation of (1), there may be included salts such as ammonium sulfate, etc., organic solvents such as ethanol, acetone, etc., polymers such as polyethylene glycol, etc. The concentration added is not particularly limited, but it is preferable to use the conditions under which the present enzyme can be recovered with a good efficiency, and can be separated from other protein components. For example, when 30 to 50% of saturated ammonium sulfate, 10 to 15% (w/v) of polyethylene glycol 6000 are added, the present enzyme comes into the precipitated fraction, while many proteins exist in the supernatant portion, whereby purification can be effected with a good efficiency. Addition may be preferably done gradually while stirring with a stirrer. After the mixture is left to stand for at least one hour after completion of the addition, the fractions in which the present enzyme exists are recovered by centrifugation. When the precipitated fraction is recovered, this is dissolved in an appropriate buffer. The buffer, provided that it has pH 6.0 to 11.0, preferably 7.0 to 9.0, may have any composition, for example, Tris-HCl, Hepes-potassium hydroxide, Tes-sodium hydroxide, etc. The concentration is not particularly limited within the range which can maintain the buffering ability, but is preferably about 5 to 50 mM.
The active fraction obtained according to (1) may be subjected again to (1) or proceed to any step of (2) to (5), but when proceeding to (2), (4) or (5) by using a salt such as ammonium sulfate for fractionation of (1), it is necessary to lower the salt concentration to a level at which the present enzyme can be bound to the gel used in the step of (3) or in the subsequent step with addition of an appropriate buffer. On the other hand, when the precipitates are dissolved and left to stand for one hour or longer, or when dialysis is performed, insoluble substances may be formed, which are removed by centrifugation or filtration.
As for heparin affinity chromatography of (2), it may be carried out either batchwise or continuously by filling the gel in a column. Commercially available gels having heparin as the ligand may include heparin Sepharose CL-6B (produced by Pharmacia), Affigel heparin (produced by Biorad), heparin agarose (produced by Sigma), AF-heparintoyopearl 650 (produced by Toso).
The biological extract is contacted directly, or after the treatment of the fraction by precipitation as shown in (1), with the heparin affinity gel. The contact time may be such that the present enzyme can be sufficiently adsorbed, but generally 20 minutes to 12 hours. The components having no affinity for heparin are removed with a buffer having a low ionic strength to the extent that no present enzyme is eluted with pH of 6.0 to 11.0, preferably 7.0 to 9.0, for example, 10 mM Hepes-potassium hydroxide (pH 7.0). Thereafter, the fractions containing the present enzyme are eluted. As the eluting solution, one having a higher recovery of the present enzyme activity is preferred. For example, one having a pH of 6.0 to 11.0 containing a salt generally used for enzyme purification such as 0.5M-2M sodium chloride, potassium chloride, ammonium sulfate, etc. Elution may be performed according to the salt concentration gradient when packed in column, but one-step elution may be also practiced. For example, elution may be effected with 10 mM hepes-potassium hydroxide buffer (pH 7.0) containing 0.3 to 2.0M sodium chloride.
The active fraction obtained in the step (2) may be also provided for any of the steps (1) to (4), or when performing again the step (2), proceeding to the step (4) or (5), the step (3) may be previously conducted, or the ionic strength lowered to a level at which the present gel can be adsorbed to the gel used in (2), (4) or (5) by addition of a large amount of a buffer of 50 mM or lower having a low ionic strength and pH 6.0 to 11.0, preferably 7.0 to 9.0, for example 5 mM Hepes-potassium hydroxide (pH 7.0).
As for the step of removing low molecular weight substances by dialysis, gel filtration, etc. of (3), in the case of dialysis, the membrane to be used may have a cut-off molecular weight to the extent that the present enzyme cannot pass therethrough, but is preferably 1,000 to 10,000. The method of dialysis may be one generally employed as described in, for example, "Seikagaku Jikken Kouza, Vol. 5, Former Vol., p. 252-253" written by Soda, Tokyo Kagaku Dojin (1975), and may be carried out for several hours to several days, against a buffer with low ionic strength having pH 6.0 to 11.0, preferably pH 7.0 to 9.0, such as 10 mM Hepes-potassium hydroxide (pH 7.0), 10 mM Tris-HCel (pH 7.5), etc. Also, during dialysis, when insoluble substances are precipitated, they are removed by, for example, centrifugation, filtration, etc.
Concerning gel filtration, any carrier generally used for gel filtration may be employed. It is preferable that, for example, Sephadex G-10, G-15, G-25, G-50, G-75, G-100, Sephacryl S-200, S-300 (all produced by Pharmacia), Toyopearl HW-40, HW-55 (produced by Toso), Biogel P-2, P-4, P-6, P-10, P-30, P-60, P-100 (all produced by Biorad), etc. The buffer to be used may have the same composition as that used during dialysis. If the ionic strength is too low, however, it may be considered that adsorption of the present enzyme onto the gel well occur, and therefore, the concentration is made 5 to 200 mM, preferably 10 to 20 mM. The method of gel filtration may be practiced as described in, for example, "Seikagaku Jikken Kouza, Vol. 5, Former vol., p. 283-298", written by Soda, Tokyo Kagaku Dojin (1975). After a sample is added in an amount sufficient to obtain separation capacity relative to the bed volume of the gel filtration carrier, elution is effected and the fraction in which the present enzyme activity exists is recovered.
The active fraction obtained by the step of (3) can be permitted to proceed to the respective steps of (1) to (5) without any particular treatment.
For the ion-exchange chromatography, any carriers commercially available for ion-exchange chromatography in general may be used. For example, Aminex, Dowex, Amberlite, SP-Sephacryl M, Asahipak, DEAE-Toyopearl, DEAE-Sephadex, CM-Sepharose, DEAE Bio-Gel A, CM-Cellulose, DEAE-Cellulofine, Partisil SCY, Mono Q and Mono S, etc. are preferred. The buffer to be used and the use method may follow the method as described in the heparin affinity gel item. The basic operational methods may follow those described in general in "Shinkiso Seikagaku Jikkenho 2, Extraction-Purification-Analysis I" (Maruzen, 1988), etc.
The active fractions obtained in the step of (4) may be subjected to any of the steps (1) to (5), but when carrying out again (4) or proceeding to (2) to (5), it (3) must be previously conducted, or a large amount of a buffer of pH 5.0 to 11.0, preferably 6.0 to 8.0, with low ionic strength of 50 mM or lower, for example, Hepes-sodium hydroxide (pH 7.0), etc. must be added to lower the ionic strength to a level at which the present enzyme can be adsorbed onto the gel used in (2), (4) or (5). By passing through the purification steps as mentioned above, the crude product of the enzyme of the present invention can be obtained. Such a crude enzyme of product can be further isolated as fractions having peaks at a molecular weight of about 25,000 and at a molecular weight of 40,000, respectively, by protein separation means using the gel filtration step (3) to give a preparation of the present enzyme.
The respective steps as described above may be practiced by monitoring the activity of the enzyme-I and/or the enzyme-II by use of the compound of the formula (I) or the formula (II) as the substrate following the assaying method of the activity of enzyme which is another present invention as described below, respectively, to obtain the active fraction.
The enzyme-I and the enzyme-II of the present invention also can be prepared by culturing host cells transformed with a plasmid containing a cDNA coding for these enzyme, which can express the cDNA, and collecting either or both of the enzymes from the cultured product produced and accumulated thereby.
The cDNA coding for the enzyme of the present invention which can be used in this method may be any one regardless of its origin, provided that it is derived from a DNA coding for the amino acid sequence a peptide C-terminal amidating enzyme existing in mammals such as human, bovine, horse, porcine, sheep, rabbit, goat, rat, mouse, etc.; avian such as chicken, turkey, etc.; tatrachian such as frog, etc.; reptiles such as snake, etc.; fish such as sardine, mackerel, eel, salmon, etc., and the sequence of Lys-Lys exists at approximately the central portion of the cDNA, but may be preferably one derived from a mammal. More specifically, it is a DNA fragment coding for the amino acid sequence as shown in FIG. 5 obtained by inserting the amino acid sequence of a peptide C-terminal amidating enzyme presently known by one letter representation of the amino acid and yet the deficient portion (represented by -) as desired so as to enhance homology between the species, and the cDNA with the portion corresponding to the hydrophobic amino acid region in the vicinity of the C-terminal thereof being removed can be advantageously used. The respective cDNA's are described, for human, horse, bovine, rat, frog I and frog II, respectively in Biochem. Biophys. Res. Commun. 169, 551-558, 1990; Japanese Patent Application No. 2 (1990)-76331; Mol. Endocrinol, 1, p. 777-790, 1987; Proc. Natl. Acad. Sci. USA, 86, p. 735-739, 1989; Biochem. Biophys. Res. Commun., 148, p. 546-552, 1987; and Biochem. Biophys. Res. Commun., 150, 1275-1281, 1988. Of these, for example, according to the sequence of horse in FIG. 5, the 441st and the 442th K (lysine) and K (lysine) sequences are correspondent. The sequences are well stored in the cDNA's of human, horse, bovine, rat. The cDNA at the former half portion (5' side) than these sequences codes for the protein having the activity of acting on a peptide C-terminal glycine adduct represented by the formula (I) to produce a peptide C-terminal .alpha.-hydroxylglycine represented by the formula (II), while the cDNA at the latter half portion (3' side) than the KK sequences codes for the protein having the activity of acting on a C-terminal glycine adduct to form a C-terminal amidated compound represented by the formula (III) and glyoxylic acid. At the site in the vicinity of such KK sequences, the cDNA can be separated into the former half portion and the latter half portion by use of a restriction endonuclease known per se.
For example, according to the sequence of horse in FIG. 5, the region from V (valine) of the 880th to I (isoleucine) of the 901th corresponds to the above-mentioned hydrophobic amino acid region. Therefore, the membrane transport region as mentioned in the present invention refers to the above-mentioned hydrophobic amino acid region of the desired cDNA. Surprisingly, since the cDNA from which the region mentioned above is removed will not only secrete the enzyme produced out of the host all, but also markedly increase the whole amount produced; such a cDNA is particularly preferred for use in the present invention. Since the enzyme-I and the enzyme-II are coded on cDNA mutually adjacent to each other as described above, but these enzymes are released separately by processing in the secretion process in the cells, it is preferable to use the cDNA from which the above-mentioned membrane-transport region is removed. Such a cDNA may be prepared by cutting the portion by using a known restriction endonuclease known Per se from the known cDNA, or also can be chosen from various cDNA's formed by difference in splicing of mRNA at the stage of cloning of said cDNA. A cDNA coding for the enzyme-I and the enzyme-II independently which is separated as described above also may be used.
Cloning of the cDNA utilized in the present invention can be practiced according to the method known per se by the use of a diversity of tissues of various animals as mentioned above. Specifically, it is practiced according to the method generally employed, such as the +, - method, hybridization method, PCR method, etc. (see, for example, Methods in Enzymology, Vol. 152; Guide to Molecular Cloning Techniques, S. L. Berger and A. R. Kimmel, editors, 1987, Acadamic Press, INC.; Methods in Molecular Biology, vol. 4; New Nucleic Acid Techniques, J. M. Walker, editor, 1988, The Humana Press Inc.; Molecular Cloning A Laboratory Manual 2nd Ed., J. Sambrook, E. F. Fritsch, T. Maniatis, editors, 1989, Cold Spring Harbor Laboratory Press), the cDNA region coding for the protein is determined by determining the base sequence of the cDNA clone obtained, and the desired cDNA can be obtained by dividing the cDNA at around the KK sequence portion at the central portion as described above.
Referring to an example of rat, a tissue which forms abundantly a peptide C-terminal amidating enzyme, for example, a pituitary of rat is homogenized together with guanidyl thiocyanate to crush the cells, and RNA fraction is obtained by cecium chloride equilibration density gradient ultra-centrifugation. Subsequently, by affinity chromatography having an oligo-dT-cellulose carried thereon, an RNA having a poly-A (poly-A.sup.+ RNA) is isolated from the above-mentioned RNA fraction.
By use of the poly-A.sup.+ RNA as the template, a cDNA library is obtained according to the method known in the art, preferably the method of Okayama-Berg (Mol. Cell. Biol. 2, 161, 1982). From these cDNA libraries, an appropriate probe can be used to screen a positive clone, a positive cDNA clone obtained by rescreening by use of an appropriate probe from the amplified cDNA libraries isolated, and the structure of the desired cDNA can be determined by mapping and sequencing these restriction endonuclease. Also, by incorporating the above-mentioned cDNA into an expression vector, and evaluating the productivity of the peptide C-terminal amidating enzyme of the host transformed therewith, a plasmid containing the desired cDNA can be selected.
The host for expressing the cDNA may be cells of microorganisms such as E. coli., Bacillus subtilis, yeast, etc., cultured cells derived from insects, animals, etc., conventionally used. The expression plasmid may be any plasmid which can express efficiently the cDNA in these cells. For example, it can be appropriately chosen from those described in the textbooks as shown below.
Zoku Seikagaku Jikken Koza I, Idenshi Kenkyuho II-Recombinant DNA technique--Chapter 7 Expression of Recombinant (1986), edited by Society of Biochemical Society of Japan, Tokyo Kagaku Dojin; Recombinant DNA, Part D, Section II, Vectors for Expression of Cloned Genes, (1987) edited by RayWu and Lawrence Grossman, Academic Press, INC.; Molecular Cloning, A Laboratory Manual 2nd Ed. Book 3, (1989) edited by J. Sambrook, E. F. Fritsch and T. Maniatis, Cold Spring Harbor Laboratory Press; etc.
For example, when CV-1 conventionally used as the animal culturing cells is used as the host, a promotor of the type pSV, pL2n, pCol and having optionally formulated a selection marker therewith can be used. As for E. coli, a vector of the type pGH, pKYP, PHUB, while for yeast, a type of YRp, YEp can be used. Recombination with these cDNA's of these vectors, and transformations, transfections of the host cells with the recombinant plasmids can be practiced according to the procedures of the methods known per se described in the literatures as mentioned above. The transformed cells thus obtained can be cultured in a medium and under cultural conditions conventionally used for proliferation of the cells derived.
The peptide C-terminal amidating enzyme produced and accumulated from such cultured product can be collected easily from the culture broth after removal of the cells in the case of, for example, using animal cultured cells, because the produced enzyme is excreted out of the cells, but may be also collected from the cell lyzate, if necessary. Such collection and purification can be practiced by conventional enzyme purification methods, such as combination of fractionation by precipitation, heparin affinity chromatography and dialysis, etc., but further preferably by joint use of the substrate affinity chromatography with the use of the peptide C-terminal glycine adduct as the ligand.
According to FIGS. 5(A)-5(B), the enzyme-I of the present invention corresponds to the amino acid sequence from the 42th residue P or S to the 442th residue K in the case of human, horse, bovine and rat, and corresponds to the amino acid sequence from the 42th residue P or S to the 231th residue K in the case of horse and bovine. On the other hand, the enzyme-II obtained corresponds to the amino acid sequence from the 443th residue D to the 830th residue K in the case of human, horse, bovine and rat respectively. The term "corresponding" as used herein includes those to which a saccharide is bonded through N-acetylglucosamine.
Use of Enzyme
The present invention provides the use of the enzyme of the present invention as described below, i.e., a method of producing a peptide C-terminal .alpha.-hydroxylglycine adduct represented by the above formula (II), which comprises treating a peptide C-terminal glycine adduct represented by the above formula (I) with the above enzyme-I, and a method of producing a peptide C-terminal amidated compound represented by the above formula (III) which comprises treating the above adduct represented by the formula (II) with the enzyme-II. Also, by use of these enzyme-I and enzyme-II in combination, the compound of the formula (I) can be converted to the compound of the formula (III) in a single reaction composition. The use of the enzyme-II in the step of converting the compound from the formula (I) to the formula (III) would be clearly understood to be significant, because the above-mentioned conversion can be accomplished under milder enzyme reaction conditions compared with the case under the presence only of the enzyme of the enzyme-I type where it must be subjected to chemical hydrolysis conditions in converting the compound from the formula (II) to the formula (III). Particularly, these methods are suitable for a treatment of unstable substrates under alkaline conditions.
The preparation methods can be used, provided they contain the enzyme of the present invention, regardless of the concentration, purity, but it is advantageous to use the enzyme containing product from which the intervening proteins are removed to great extent, in view of isolation purification the product from the reaction mixture of the compound of the formula (II).
As the compounds of the formula (I) and (II), all of those described above are included, the corresponding compounds represented by the formula (I) or the formula (II) which can be converted according to the present preparation method to the compound of the formula (III), for example, arginine vasotocin (AVT), lutenizing hormone-release hormone (LH-RH), oxytocin, gastrin, gastrin secretion promoting peptide (GGRP), calcitonin (CT), vasoactive intestinal polypeptide (VIP), throtropin-releasing hormone (TRH), melanophore stimulating hormone (MSH), MSH release inhibiting hormone (MIH), cholecystokinin-octapeptide (CCK-8), substance P (SP), adipokinin, pancreatic polypeptide (PP) growth hormone releasing factor, secretin, caerulein, mollusk cardiostimulant neuropeptide, vasopressin, adrenocoricotropic hormone (ACTH), allochroic hormone, bombesin, light adaptation hormone, motilin, apamin, allitecine, eredoicin, catcinin, granulibelline R, scotophobin, hyranbatecaerulein, obesity cell degranulation peptide, physaremin, phyllocaerulein, phyllomezcin, promellitin, bombinin, mastoballan, manitoballan-X, mellitin-1, lanatensin, lanatensin-R.
The above-mentioned treatment can be practiced in a common buffer, particularly with addition of ascorbic acid and catalase in the reaction mixture in the reaction by use of the enzyme-I, but it is preferable to practice the reaction in view of the conditions of the assaying method of enzyme activity as shown below.
Assaying Method of Enzyme Activity and Screening Method of Novel Enzyme by Use Thereof
The enzyme-I and the enzyme-II of the present invention as described above can be monitored according to the assaying method of activity as described below, and the assaying method is useful for practicing the preparation method of the present enzymes as described above.
These assaying methods are based on the finding that the peptide C-terminal amidating reaction is not a one-step reaction as considered in the prior art, but a two-step reaction through an intermediate (peptide C-terminal .alpha.-hydroxylglycine adduct).
Initially, the activity of the enzyme-I is assayed according to the method comprising step (a) of buffering a sample to be tested expected to have its activity to pH 5 to 8, and step (b) of adding a peptide C-terminal glycine adduct represented by the above formula (I), L-ascorbic acid and catalase to the buffer followed by incubation, and then measuring the product represented by the formula (II), which has been isolated by chromatography described later, or measuring the product, which has been converted from the compound (II) into the compound (III) under alkaline conditions and then isolated. As a preferable isolation measurement, there may be used the step of detecting the reaction product by HPLC with the use of an acetonitrile-containing buffer (pH 6-10).
The activity of the enzyme-II is assayed according to the method comprising the step (a) of buffering a sample to be tested expected to have its activity to pH 4 to 8, the step (b) of adding a C-terminal .alpha.-hydroxylglycine adduct represented by the formula (II) to the buffer followed by incubation, and then detecting the reaction product of the formula (III) or glyoxylic acid by the method known per se. The activity of the enzyme-II is also preferably detected by the above HPLC.
As the sample to be tested as mentioned in the present invention, there may be included any fluid having those activities, particularly biological fluids having those activities, namely homogenates of biological organs, as well as body fluids, such as blood and lymph, and further treated solutions of these obtained by purification treatment, etc. Also, treated solutions derived from microorganism cells are included in the biological fluid.
The buffering agent to be used for the buffering these samples to be tested is not particularly limited, but those conventionally used may be employed. For example, tris-hydrochloric acid and hepes-potassium hydroxide may be included. The concentration of the buffering agent in the buffer may be any concentration, provided that the buffering action can be accomplished, with a concentration of 20 to 200 mM being suitable in general.
The respective buffers may be controlled to pH 6 to 8, preferably pH 6.5, for the former method, while pH 4 to 8, preferably around pH 6 for the latter method. As the peptide C-terminal glycine adduct to be added to the buffer thus prepared in the former, it is preferable to use one which is a substrate for said enzyme, and represented by the formula (I) enumerated as preferable substrate for identifying the activity of the enzyme-I as described above. The concentration of the compound should be suitably about 0.1 .mu.M to 2 mM. Further, it is required to add L-ascorbic acid which is considered to function as the cofactor, and catalase as the activating agent. Generally speaking, the concentration of L-ascorbic acid may be preferably 0.5 to 2 mM, and the concentration of catalase suitably 40 to 100 .mu.g/ml. A metal ion may be also added in the buffer, but this addition is not particularly required for the present activity assay, which addition however is preferable because higher activity may be sometimes obtained as compared in the case of no addition. As the metal ion to be employed, Zn.sup.2+, Cu.sup.2+, Ni.sup.2+, Ni.sup.2+, Co.sup.2+, Fe.sup.3+, etc. is appropriate, particularly preferably Cu.sup.2+ and Zn.sup.2+. The concentration of the metal ion in the buffer may be suitably 0 to 1000 .mu.M, preferably 0 to 10 .mu.M. The compounds for providing such metal ions are not particularly limited, but may include CuSO.sub.4, CuCl.sub.2, ZnCl.sub.2, NiCl.sub.2, CoCl.sub.2, FeCl.sub.3, etc.
For a specific example of such reaction composition, reference may be made to the reaction composition A of Example 7 as described below. On the other hand, the reaction composition in the latter is prepared by use of the corresponding compound of the formula (II) in place of the above formula (I). In this case, no cofactor such as ascorbic acid, catalase, etc. is required.
In these both assaying methods, the amount of the test sample employed is not particularly limited and can be varied, but preferably is suitably adjusted to contain a pmol/hr or more, more preferably 10.times.a pmol/hr or more, most preferably 10.times.a pmol/hr to a mol/hr, based on the amount of the substrate existing in the reaction system (defined as a nanomol (nmol)) (unit indicates enzyme activity, represented in the substrate amount which can be reacted at 37.degree. C. for one hour (e.g., picomol (pmol)).
Incubation may be carried out at 1.degree. to 55.degree. C., particularly in the former preferably 25.degree. to 40.degree. C., particularly preferably around 30.degree. C. with stirring for 2 to 24 hours, while in the latter preferably at 15.degree. to 35.degree. C., most preferably around 25.degree. C. stationarily for one minute to 48 hours.
For detection of the compound of the formula (II) and the compound of the formula (III) formed respectively in the steps as described above, there can be employed and method which can measure by separation those substrate and the product, for example, the compound of the formula (I) and the compound of the formula (II) in the former, while the compound of the formula (II) and the compound of the formula (III) in the latter. Generally speaking, separation measurement can be conducted by separation, purification by chromatography as mentioned below. As the chromatography which can be used for the above treatment, there may be included ion-exchange chromatography, reverse phase chromatography, gel filtration, affinity chromatography, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), etc. The substrate represented by the formula (II) and the amidated product represented by the formula (III) in the reaction system of the latter have peptide C-terminals of carboxyl group and amide group, respectively, with the charges being different. Ion-exchange chromatography, reverse phase chromatography, etc. using this property are preferred. Affinity chromatography by use of the antibody of the product may be also effectively used. However, although separation of the substrate represented by the formula (I) and the product represented by the formula (II) in the reaction system of the former, according to the high performance liquid chromatography (HPLC) with the use of an acetonitrile containing buffer (pH 6 to 10, preferably pH 9) as the eluate attempted for the first time by the present inventors, separation measurement can be done advantageously. The eluate should be particularly preferably applied with a straight line concentration gradient of acetonitrile concentration. As the column for HPLC, any kind of commercially available columns suited for the present object can be used, but it is particularly advantageous to use Capcell Pak C18SG, 300 .ANG. (produced by Shiseido).
The substrate and the product thus separated may be assayed for either the chemical or physical labels (optionally bound) of them. For such measurement, known labels, known assaying methods can be used, and it would be generally convenient to utilize the UV-absorption derived from the amino acid constituting the substrate peptide.
Since the assaying methods as described are correct and simple, by applying these to the biological fluids as mentioned above, the enzymes having the respective activities of the enzyme-I and the enzyme-II, can be searched. Such searching methods are provided as the eighth and the ninth inventions of the present application, respectively.
The biological fluid to be searched is inclusive of those of which enzymatic activity can be expected as described above, as a matter of course, and also all of living body cells, tissues, extracts of other animals and vegetables. For example, extracts may be prepared according to the extraction methods in general, as described in "Jikken Seibutsugaku Koza 6, Saibo Bunkakuho" (Maruzen, 1984), "Seikagaku Jikken Koza 5, Kosokenkyuho (Former)" (Tokyo Kagaku Dojin, 1975), "Kiso Seikagaku Jikkenho 1, Seibutsu Zairyo no Toriatsukaikata" (Maruzen, 1974).
DNA Sequences for Enzyme-I and Enzyme-II Derived from Horse
According to the present invention, there is provided a cDNA sequence coding for a polypeptide having a peptide C-terminal activities of enzyme-I and the enzyme-II. Since these enzymes provide the possibility of an excellent activity and stability in comparison with those of peptide C-terminal amidating enzymes known in the art (see Published International Application: WO89/1209), the reasons for providing the above DNA sequences will be clear. For the source of the enzyme, any kind may be available, provided that it is an organ or a tissue where the such enzyme exists, but primarily those derived from atrium, pituitary gland, brain or stomach are to be used.
The cDNA coding for the peptide having the C-terminal amidating enzyme activity according to the present invention is specifically shown in FIG. 13. In this Figure, the base sequence of the longest cDNA fragment and the amino acid sequence coded for thereby is shown by one letter representation. The content within the � ! in FIG. 13 (No. 4) is a cDNA deleted portion which appears to be formed through the difference in mRNA splicing found as the result of analysis of some cDNA's. Therefore, several kinds of the cDNA according to the present invention exist also for the amino acid sequences of the polypeptide to be coded for thereby. For example, as for the amino acid sequence of the polypeptide having the peptide C-terminal amidating enzyme activity derived from horse as described in the present invention, there exist 4 kinds having at least the common sequence up to a certain chain lenth and the 4 kinds of sequences, respectivly, upstream thereof. ##STR12##
The polypeptides having these amino acid sequences can be translated not merely by the 4 kinds of cDNA sequences, but also by use of a DNA comprising a combination of different codons coding for the same amino acid, and the DNA sequences of the present invention are inclusive of all of those. Further, it may be interpreted that, even if a part of the amino acid sequence may be modified by replacement, addition or removal to the extent that the C-terminal admidating enzyme activity is not lost, such a modified sequence can be suitable for the purpose of the present invention. Specific examples of these may include those having the common base sequence shown below and the respective different base sequence portions downstream thereof. ##STR13##
The cloning of the cDNA of the present invention can be practiced according to the method known per se by the use of various tissues of horse as in the description concerning rat.
In the following, the cDNA preparation method of the present invention is described in more detail.
A tissue which forms abundantly a peptide C-terminal amidating enzyme in horse (hereinafter called "plus tissue"), for example, an atrium of horse is homogenized together with guanidyl thiocyanate to crush the cells, and RNA fraction is obtained by cecium chloride equilibration density gradient ultracentrifugation. Subsequently, by affinity chromatography having an oligo-dT-cellulose carried thereon, an RNA having a poly-A (poly-A.sup.+ RNA) is isolated from the above-mentioned RNA fraction.
By use of the poly-A.sup.+ RNA as the template, a cDNA library is obtained according to the method known in the art, preferably the method of Okayama-Berg (Mol. Cell. Biol. 2, 161, 1982). The method of Okayama-Berg is practiced as described below. That is, the poly-A portion of poly-A.sup.+ RNA is adsorbed onto the poly-T portion of the Okayama-Berg vector, whereby the reaction of the reverse transcriptase is carried out to synthesize a cDNA. After addition of an oligodC to the 3'-end of the cDNA with a terminal deoxynucleotidyl transferase, the vector DNA is cleaved with a restriction endonuclease HindIII. After ligation of an oligodG linker, the vector is cyclized and then the RNA portion is replaced with DNA with a DNA polymerase to obtain a cDNA containing plasmid. By the use of these plasmids, E. coli is transformed according to such method as the calcium chloride method (Strik, P. et. al., J. Bacteriol. 138, 1033, 1979). By selecting an ampicillin-resistant strain with an ampicillin-added flat plate medium, a plasmid-accepting microorganism is procured.
On the other hand, the above-mentioned plus tissue, namely a tissue of producing abundantly a C-terminal amidating enzyme, and a tissue of producing not so much a C-terminal amidating enzyme (hereinafter called "minus tissue"), for example, liver of horse, are prepared, and poly-A.sup.+ RNA is isolated according to the methods as described above from the respective cells. The 5'-OH of RNA is labelled with .sup.32 P by use of polynucleotide kinase and �.gamma.-.sup.32 !PATP, and this is used as the probe.
Next, according to the colony hybridization method (Hanahan, D. et. al., Gene, 10, 63, 1980), a colony complimentary to the probe derived from the plus tissue but not complimentary to the minus tissue is selected from among the cDNA library as described above. Thus, a plasmid DNA is procured from the colony thus selected, and the base sequence determined according to the dideoxynucleotide method (Messing, J. Methods in Enzymology 101, 20, 1983), etc.
Whether or not these are cDNA's of the peptide C-terminal amidating enzyme can be identified by incorporating the region coding or its amino acid sequence into an expression vector system of E. coli., Bacillul substilis, yeast, animal culture cells, etc., producing the protein coded for by the cDNA, and then assaying the amidating enzyme activity (see e.g., PCT/JP89/00521). The cDNA obtained may be also chosen by comparison of the homology with a known C-terminal amidating enzyme cDNA. Further, a partial amino acid sequence of the enzyme purified by use of the purification method of horse C-terminal amidating enzyme described in International Published Application WO89/12096 may be also determined by a peptide sequencer, etc. and identified to be the same amino acid sequence estimated from the cDNA. Still further, antibodies with the purified enzyme as the antigen may be prepared with rabbit, rat, etc., and then identification may be made by carrying out the antigen-antibody reaction with the protein expressed in E. coli, etc. with the cDNA as described above.
These identification means can be also used as the cDNA cloning method utilizing those characteristics. More specifically, there may be included the method in which among the known different kinds of C-terminal amidating enzyme cDNA's, the region with high homology between those kinds is considered to be also high in the cDNA derived from horse, and the cDNA library DNA is screened as the DNA in such region as the probe; the screening method with the use of an antibody by a cDNA cloning system by use of .lambda.gtll phage as the probe; the screening method of cDNA library of preparing from a part of amino acid sequences of the purified enzyme a synthetic DNA (several kinds) having the codons corresponding thereto by a DNA synthesizer, etc., and preparing this as the probe by use of a plasmid, phage, etc.
The DNA sequence coding for the protein having the peptide C-terminal amidating enzyme activity of the present invention thus prepared can produce the peptide C-terminal amidating enzyme in a large amount by linking its DNA to an appropriate expression vector, thereby expressing the enzyme with E. coli, Bacillus subtilis, yeast, animal cells, etc. as the host.
EXAMPLES
The present invention is described in detail with reference to Examples, which is no way limit, the present invention.
Example 1
Preparation of Gel for Substrate Affinity Chromatography
An amount of 5 ml of Affigel 10 was measured into a 10 ml volume Econocolumn (produced by Biorad) filled with isopropanol. After isopropanol was washed out, the gel was washed with 50 ml of 10 mM sodium acetate buffer (pH 4.5) and then with 10 ml of 0.1M Mops-sodium hydroxide buffer (containing 80 mM calcium chloride, pH 7.5). After the gel was transferred into a bottle of 20 ml volume, it was mixed with 10 ml of the above Mops-sodium hydroxide buffer containing 40 mg (about 100 .mu.mol) of phenylalanyl-glycyl-phenylalanyl-glycine (Phe-Gly-Phe-Gly, produced by Sigma) dissolved therein and a shaking reaction was carried out at 4.degree. C. for 18 hours. Then, 0.5 ml of 1M Tris-HCl buffer (pH 8.0) was added and a shaking reaction was carried out at 4.degree. C. for one hour to deactivate the unreacted active groups. After the gel was washed with the above Mops-sodium hydroxide buffer, then, with deionized water, it was suspended in 0.02% NaN.sub.3 filled in a column and stored at 4.degree. C. From the amount of the peptide (Phe-Gly-Phe-Gly) provided for the reaction and the peptide amount in the solution, about 10 .mu.mol per 1 ml of gel was calculated to be bound.
Example 2
Preparation of phenylalanyl-qlycyl-phenylalanyl-hydroxylglycine as Substrate
An amount of 3 mg of phenylalanyl-glycyl-penyl-alanylglycine (FGFG) (produced by Sigma) was weighed, and 50 mM Hepes-KOH buffer (pH 5.5), 3 mM ascorbic acid, 10 mM potassium iodide, 0.25 mg/ml catalase, 0.25 mM cupric sulfate, 7.5% acetonitrile and 200 .mu.l of an amidated enzyme composition derived from horse serum as described in Example 2 in International Patent Application JP89-00521 to make up the total amount to 10 ml, followed by aerobic amidation reaction at 30.degree. C. for 20 hours. The reaction was stopped by addition of 10% formic acid, and phenylalanyl-glycyl-phenylalanyl-hydroxylglycine (FGFhyG) was separated by high performance liquid chromatography (HPLC). The column of HPLC used was Capscell Pack C18SG, 300 .ANG. (manufactured by Shiseido). The eluting solvent used was 1 mM ammonium dicarbonate (pH 9.0) and acetonitrile, and a linear gradient of increasing acetonitrile from 0% to 40% for 30 minutes applied. The peptide was detected by the absorption at 214 nm. The results are shown in FIG. 1. The peak of phenylalanyl-glycyl-phenylalanyl-glycine at 10.7 minute was substantially extinguished after the C-terminal amidating reaction. As accompanied therewith, the peaks of the .alpha.-hydroxyglycine derivative at 9.9 minute and the amidated compound at 14.5 minute were observed. The structures of these substances were identified by FAB-MS spectrum analysis and NMR analysis. FIG. 2 shows the results of the FAB-MS spectrum in glycerine solution. The parent peak represents the molecular weight of 442, and as the result of its fragmentation, fragments of 425 and 408 m/z with one or two --OH groups existing at C-terminal being cleaved off were identified, thus indicating that it is .alpha.-hydroxylglycine adduct. The peak at 9.9 min. was separated, formed swiftly into a 10% formic acid solution, which was then lyophilized to prepare the substrate for the enzyme II of the present invention. The substrate could be similarly prepared even when the enzyme-I containing product of the present invention was used in place of the above amidating enzyme composition. As described above, the .alpha.-hydroxylglycine derivative is stable under acidic conditions, but unstable under alkaline conditions and will be decomposed into the amidated compound and glyoxylic acid irrespectively of the enzyme reaction. Therefore, the C-terminal amidation reaction initially conducted in this Example was practiced under acidic conditions. At this time, if the reaction is carried out at pH 7.5 or higher, it becomes impossible to identify the .alpha.-hydroxylglycine derivative. The known C-terminal amidating enzyme has been considered to be converted from the C-terminal glycine adduct represented by the formula (I) as described above to the C-terminal amidated compound represented by the formula (III) and glyoxylic acid, because non-enzymatic conversion under the alkaline conditions was included, and the catalytic reaction of the enzyme itself is the conversion reaction from the C-terminal glycine adduct represented by the formula (I) to the C-terminal .alpha.-hydroxylglycine adduct represented by the formula (II). Therefore, conversion of the amidating reaction under acidic conditions by the C-terminal amidating enzyme in the prior art has been generally low.
Example 3
Preparation of Enzyme-I from Horse Serum
(1) To 100 ml of a commercially available horse serum (produced by Gibco) was gradually added under stirring 100 ml of a 25% aqueous polyethylene glycol 6000 (w/v) (produced by Wako Junyaku), namely to a final concentration of 12.5%. The following operations were all conducted at 4.degree. C. After standing for 12 hours, the mixture was centrifuged (10,000.times.g, 10 min.) and the resultant precipitates were dissolved in 120 ml of Hepes-potassium hydroxide buffer (pH 7.0). Further after standing for 2 hours, the insoluble substance formed was again removed by centrifugation (10,000.times.g, 10 min.) to obtain a supernatant containing the C-terminal amidating enzyme activity (127 ml).
(2) The active fraction obtained in the above (1) was applied to a column (1.6.times.15 cm) filled with heparin Sepharose CL-6B (produced by Pharmacia) equilibrated with 10 mM Hepes-potassium hydroxide buffer (pH 7.0). After the nonadsorbed substances were washed out with 96 ml of the same buffer, elution was effected with 10 mM Hepes-potassium hydroxide buffer (pH 7.0) containing 0.5M sodium chloride (flow rate 30 ml/hr). FIG. 3 shows the elution pattern. The present enzyme-I was eluted with 0.5M sodium chloride containing buffer �fractions Nos. 14-16 were collected (100 ml)!.
(3) The above fractions were subjected to gel filtration by use of Sephadex G-25 Fine (produced by Pharmacia) column chromatography (5 cm.phi..times.23 cm). By use of 10 mM Hepes-KOH (pH 7.0) as the solvent, elution was effected at a flow rate of 2 ml/min. The proteins were detected by absorbance at 280 nm, and 100 ml of fractions containing the proteins was collected.
(4) Affigel 10-Phe-Gly-Phe-Gly gel prepared according to Example 1 in an amount of 5 ml of filled in a column (1.0.times.6.3 cm), and the column was equilibrated with 10 mM Hepes-potassium hydroxide buffer (pH 7.0) containing 0.1M sodium chloride. To the column was applied the sample (18.1 ml) obtained in the above (3). To ensure that the enzyme-I was adsorbed onto the gel, the liquid passed through the column was circulated many times through the column (flow rate 20 ml/hr). After 12 hours, the circulation was stopped, and the nonadsorbed substances were washed out with 35 ml of the buffer used for equilibration, followed by elution with 8 mM Hepes-potassium hydroxide buffer (pH 7.0) containing 0.4M sodium chloride and 20% acetonitrile (flow rate 20 ml/hr). The enzyme-I activity was recognized only in the eluted fraction (10 ml).
(5) The purified product obtained in the above (4) was subjected against to the treatment (3) as described above, then carried on Mono column (produced by Pharmacia, 0.5.times.5 cm) equilibrated with 10 mM hepes-potassium hydroxide buffer (pH 7.0), and an NaCl linear concentration gradient was applied in the same buffer as shown in FIG. 3, to elute the proteins. The flow rate at this time was made 0.5 ml/min.
Table 1 shows the total protein amounts, the total enzyme activities, specific activities, yields and purification folds in the respective steps of purification conducted in the above (1) to (5).
TABLE 1__________________________________________________________________________Preparation of enzyme-I from horse serum Total Total Specific protein activity activity Yield PurificationStep (mg) (U) (U/mg) (%) fold__________________________________________________________________________ Serum 7,500 10,500* 1.4 100(1) Polyethylene glycol 4,100 9,020 2.2 86 1.6 6000 Precipitation(2) Heparin Sepharose CL-6B 1,400 5,740 4.1 55 2.9(3) Sephadex G-25 1,100 3,960 3.6 38 2.6(4) Affigel 10-Phe--Gly--Phe--Gly 2.0 800 400 8 290(5) Mono Q column 0.5 350 700 3 500__________________________________________________________________________ *Probably because of the influence of the protease existing in the serum, the substrate and product were partially decomposed to give a relatively lower activity.
The activity assay was conducted by practicing the reaction according to the preparation method from FGFG to FGFhyG as described in Example 2 and quantitating FGFhyG by HPLC as described there. The enzyme activity 1 U was defined as the enzyme amount forming 1 nmole of FGFhyG at 37.degree. C. for one hour.
A measurement of the protein amount was conducted by using the improved method of Lowry (Bensadoun et al. Anal. Biochem., 70 265, 1976), and the standard curve was prepared with bovine serum albumin (fraction V, produced by Sigma).
As shown in Table 1, the present enzyme could be purified to about 500-fold with a yield of 2%. When further purification is required, the above-described steps (3) to (5) may be repeated, or either one of those steps may be repeated.
Example 4
Preparation of Enzyme-II from Horse Serum
Horse serum was treated in the same manner as in Example 3 except for performing the respective purification steps while monitoring the activity of the enzyme-II.
Table 2 shows the total proteins, the total enzyme activities, specific activities, yields and purification folds in the respective purification steps (1) to (5).
TABLE 2__________________________________________________________________________Preparation of enzyme-II from horse serum Total Total Specific protein activity activity Yield PurificationStep (mg) (U) (U/mg) (%) fold__________________________________________________________________________ Serum 7,500 2,100* 0.28(1) Polyethylene glycol 4,000 5,300 1.3 250 4.6 6000 Precipitation(2) Heparin Sepharose CL-6B 1,500 3,800 2.5 180 9.0(3) Sephadex G-25 1,200 3,000 2.5 140 9.0(4) Affigel 10-Phe--Gly--Phe--Gly 1.2 360 300 17 1070(5) Mono Q column 0.1 50 500 2 1790__________________________________________________________________________ *Probably because of the influence of the protease existing in the serum, the substrate and product were partially decomposed to give a relatively lower activity.
Activity assay was carried out at 30.degree. C. by dissolving the phenylalanyl-glycyl-phenylalanyl-hydroxylglycine (FGFhyG) obtained in Example 1 in 10 mM hepes-potassium hydroxide (pH 6.5) to 5 mM concentration, adding the samples at the respective steps, and making up the total amount to 100 ml. After the reaction for one hour, the reaction was stopped by addition of 10% formic acid, and the reaction product was quantitated by HPLC using the conditions of Example 2. At this time, the reaction of Control with no addition of the sample was also conducted to confirm that substantially no non-enzymatic conversion proceeded. The HPLC pattern of the reaction mixture is shown in FIG. 4 (the reaction conditions in the Figure are 37.degree. C., pH 6.9, with the reaction time being indicated in the Figure), and the activity represented in unit (U). 1 U is defined as the enzyme amount which forms 1 nmole of FGF-NH.sub.2 at 30.degree. C. for one hour.
Measurement of the protein mass was carried out in the same manner as in Example 3.
As shown in Table 2, the present enzyme could be purified to about 1800-fold with a yield of 2%.
In the following Examples, production of said enzyme utilizing a peptide C-terminal amidating enzyme cDNA derived from rat pituitary is described, but the present invention is not limited thereby.
Example 5
Construction of Expression Plasmid
By use of the poly-A.sup.+ RNA derived from rat pituitary, 5 cDNA clones were obtained (see FIG. 6, FIG. 7, Seikagaku, 61, 842 (1989)).
The DNA fragment of 2.58 kbp (kilobase pairs) of the cDNA clone 205 cleaved by EcoRI-XmaI was inserted into an expression vector of an animal culture cell system, pSV2 vector �S. Subramani, R. Mulligan, P. Berg, Mol. Cell. Biol. 1, 854 (1981)! via a synthetic linker at the HindIII-BglII, and the plasmid was designated as SV-205. Next, the NsiI(700)--XmaI fragment of SV-205 was replaced with the respective NsiI(700)--XmaI fragments of cDNA clones 201, 202, 203, 204. These expression plasmids were called SV-201, SV-202, SV-203, SV-204. The SV-203 DNA was deleted the DNA region coding trans membrane domain. From the SV-203 plasmid DNA this obtained, an expression plasmid SV-A which expresses an enzyme by acting on a C-terminal glycine adduct according to the present invention to convert it to a C-terminal .alpha.-hydroxylglycine adduct was constructed. The DNA portion of the BamHI site �FIG. 7 B (1386)! existing in the vicinity of the cDNA region coding for the KK sequence portion around the center was deleted by digestion with BamHI, XmaI �FIG. 7 X (1948)!, and a synthetic linker: ##STR14## was inserted into the cleaved site, ligation was effected, followed by completion of the SV-A plasmid. The synthetic DNA was synthesized in conventional manner by use of a DNA synthesizer produced by ABI and purified. The synthetic DNA is constituted of the BamHI cleaved site-stop codon-XmaI cleaved site.
Next, an expression plasmid SV-B according to the present invention which expresses an enzyme for converting a C-terminal .alpha.-hydroxylglycine adduct to a C-terminal amidated compound and glyoxylic acid was constructed. The SV-203 DNA was cleaved at the KpnI site �FIG. 7, N (175)! existing immediately downstream of the region coding for the signal peptide and the BamHi site existing at the position corresponding to the vicinity of the KK site at the center, and linked in between thereof with a synthetic DNA: ##STR15## to form an expression plasmid SV-B. As the result, the signal peptide region were combined with the cDNA latter part site in reading frame.
Example 6
Expression in Animal Culture Cells
The cultured cell COS-7 was grown in a synthetic medium (DMEM) containing a 10% fetal bovine serum and transformed by use of the expression plasmid of Example 5 according to the known method (see C. Chen and H. Okayama, Mol. Cell. Biol. 7, 2745 (1987)). In the transformation, 20 .mu.g of the expression plasmid was employed per 5.times.10.sup.5 cells. After cultivation under the conditions of 3% carbon dioxide, 35.degree. C. for 24 hours, the cells were washed twice with 10 ml of a DMEM medium containing 0.2% bovine serum albumin (BSA), and then further cultured in 10 ml of the DMEM medium containing 0.2% BSA under the conditions of 5% carbon dioxide and 37.degree. C. for 48 hours.
Example 7
C-terminal Amidating Enzyme Activity Produced by the Recombinant Cells
The cell culture broth expressed in Example 6 was separated by centrifugation into cells and supernatant (medium).
For the supernatant, enzyme activity was assayed. Assay of the activity was carried out following basically the method by use of HPLC shown in a literature (J. Biol. Chem. 265, 9602-9605). Shortly speaking, the conversion activity of the C-terminal glycine adduct to the .alpha.-hydroxylglycine adduct was determined by permitting the reaction to proceed with the reaction composition (A) as shown below and quantitating the substrate (PheGlyPheGly) and the product (PheGlyPhehydroxyGly) after a certain time of the reaction.
Reaction composition (A):
15 .mu.M PheGlyPheGly
5 mM CuSO.sub.4
5 .mu.l/reaction mixture 1 ml Catalase (Sigma)
100 mM MES buffer (pH 5.6)
1 mM Ascorbic acid
+ Culture supernatant (medium)
The converting activity of the .alpha.-hydroxylglycine adduct to the amidated compound and glyoxylic acid was assayed similarly by use of the following reaction composition (B).
Reaction composition (B):
15 .mu.M PheGlyPhehydroxyGly*
100 mM MES buffer (pH 5.6)
+ Culture supernatant (medium)
* The reaction was permitted to proceed in the reaction composition (A), and prepared from the .alpha.-hydroxylglycine adduct separated by HPLC.
The assay results are shown in Table 3.
TABLE 3______________________________________Enzyme activity n mole/h/ml medium Substrate PheGlyPheGly PheGlyPhehydroxyGly Product PheGlyPhe- PheGlyPhe--NH.sub.2 +Plasmid hydroxyGly Glyoxylic acid______________________________________SV-203 (Signal sequence + 2.5 4.2 N-terminal domain + C-terminal domain; present invention)SVa (Signal sequence + 2.8 <2 N-terminal domain; present invention)SVb (Signal sequence + 0.4 10.8 C-terminal domain; present invention)PSV2 (Control) 0.3 <2NO (Control) 0.5 <2Plasmid______________________________________
In medium of the transformant with the SV-a plasmid, a markedly improved .alpha.-hydroxylglycine adduct producing activity was recognized, and it did not participate in the reaction with the .alpha.-hydroxylglycine adduct as the substrate. In contrast, in the strain transformed with the SV-b plasmid, no reaction occurred at all on the C-terminal glycine adduct, but only an activity of converting the .alpha.-hydroxylglycine adduct to the amidated compound was recognized. In the strain transformed with the plasmid SV-203 having substantially the whole region of the cDNA, both enzyme activities were recognized, but the respective enzyme activities were lower as compared with SV-a, SV-b.
Next, whether or not the enzyme expressed in these transformed strains is single was confirmed by gel filtration chromatography. By the use of a Sephacryl S-200 (produced by Pharmacia) column (1.times.95 cm), the column was equilibrated with an elution buffer 10 mM HEPES-KOH (pH 7.0), 50 mM NaCl. The elution rate was 6 ml/hour, and 1 ml fractions were collected. The results of the both enzyme activities and the protein masses assayed are shown in FIG. 8 to FIG. 10. The enzyme activities derived from SV-a (FIG. 8) and from SV-b (FIG. 9) became respectively the single peaks, and also the molecular weights assayed were found to be 36 kDa, and 54 kDA, corresponding to the molecular weights of the proteins coded for by the cDNA's possessed by the respective plasmids. However, the protein derived from SV-203 plasmid, as shown in FIG. 10, was separated into the two peaks of the activity for producing the .alpha.-hydroxylglycine adduct (.quadrature.--.quadrature.) by acting on the C-terminal glycine and the activity for producing the amidated compound and glyoxylic acid (.largecircle.--.largecircle.) by acting on the .alpha.-hydroxylglycine adduct. Besides, these molecular weights were found to be the same as those of the respective enzymes shown in FIG. 8, FIG. 9 expressed solely. This result showed that the KK sequence positioned at the central portion of the protein coding for the cDNA was cleaved by processing the culture cells. Therefore, it was shown that the two kinds of enzymes according to the present invention can be also produced by expression of the cDNA having such whole cDNA region.
Next, the synergetic effect by using the two kinds of enzymes in the present invention in the C-terminal amidating reaction was shown by use of FIG. 11 and FIG. 12. FIG. 11 and FIG. 12 show the change in conversion of amidated compound with a lapse of time when PheGlyPheGly was employed as the substrate. The enzyme samples were prepared by purifying the medium supernatants obtained by expression of SV-a, SV-b plasmids by the gel filtration as described above, and concentrating the respective active fractions. FIG. 11 shows one derived from SV-a, which shows that only the .alpha.-hydroxyl adduct is produced with no amidated compound being produced. FIG. 12 shows the case when using only the enzyme derived from SV-b (.star.), and the case when using those derived from SV-a and SV-b in combination. It was shown that none of the .alpha.-hydroxyl adduct and the amidated compound were produced at all with only the enzyme derived from SV-b, while both the .alpha.-hydroxyl adduct and the amidated compound could be produced well by using the both enzymes in combination (the amounts of the enzymes added were the same). Note, the reaction efficiency is increased when they were used after 4 hours or later, and after the reaction for 9 hours, a conversion as high as 1.5-fold is obtained compared with the case of use of only the enzyme derived from SV-a shown in FIG. 11. Thus, the use of both enzymes proved to be a very effective means for carrying out the C-terminal amidating reaction.
Example 8
Preparation of poly-A.sup.+ RNA from Horse Heart Atrium
(1) Preparation of whole RNA
Horse heart atrium after enucleation was minced swiftly, and about 2 g thereof was placed in a 50 ml plastic tube (No. 2070, produced by Falcon) and freezed in liquid nitrogen. An amount 20 ml of guanidine thiocyanate solution (4M guanidine thiocyanate, 25 mM sodium citrate (pH 7.0), 0.5% laurylsarcosine sodium, 0.1% Antifoam A, 0.1M 2-mercaptoethanol) were added, and the cells were crushed by means of Polytron (Central Kagaku Boeki), followed by take-out and introduction of the crushed liquor by a 10 ml syringe (produced by Terumo Co., Ltd.) equipped with an 18 G injection needle. The sedimentation was removed by a low speed centrifugation (300.times.g, 5 minutes), and 7.3 ml of the supernatant was overlaid in a 3.7 ml CsTFA vessel (produced by Pharmacia, aqueous cesium trifluoroacetic acid containing 0.5M EDTA, adjusted to a density of 1.64 g/ml) and treated by a ultra-centrifugation machine by use of a swing rotor RPS-40T (produced by Hitachi Seisakusho, SCP85H) at 33,000 rpm for 16 hours. The precipitates were washed with 3 ml of 4M guanidine solution, then with 3 ml of 95% ethanol and thereafter dissolved in 1.5 ml CsTFA solution. To the solution were added 60 .mu.l of 5M NaCl Solution, 3.9 ml of ethanol, and ethanol precipitation was effected at -80.degree. C. for 30 minutes, followed by centrifugation at 16,000.times.g for 15 minutes to obtain precipitates. The precipitates were washed with 70% ethanol, and then dried by a concentrator (produced by Sakuma Seisakusho, EC-57C). After dissolved in sterilized distilled solution, absorbance at 260 nm was measured to quantitate the RNA amount. According to this method, 350 .mu.g of RNA could be obtained from about 2 g of a horse heart atrium tissue.
(2) Preparation of poly-A.sup.+ RNA
Preparation of a poly-A.sup.+ RNA from the whole RNA was carried out by use of "mRNA Purification Kit" (produced by Pharmacia) according to the accompanying protocol. Affinity chromatography was carried out twice by an oligo(dT) column to obtain 13 .mu.g of a poly-A.sup.+ RNA from 350 .mu.g of a horse heart atrium whole RNA.
Example 9
Preparation of cDNA Library
(1) Preparation of cDNA
By the use of "cDNA Synthesis System Plus" (RPN1256Y, produced by Amersham), cDNA synthesis was carried out by the use of 5 .mu.g of a horse heart atrium poly-A.sup.+ RNA. The synthesis procedure followed faithfully the accompanying protocol. As the primer, an oligo-dT nucleotide was employed, and the cDNA synthesis efficiency was calculated from the radio-activity according to a synthetic system containing �.alpha.-.sup.32 P!-dCTP. As the result, the reverse transcription efficiency was found to be about 20%, and the second strand synthesis efficiency 90% or higher.
(2) Preparation of cDNA library
By use of "cDNA Cloning System .lambda.gt10, version 2.0" (RPN 1257, produced by Amersham) for linking to the phage DNA, and "Gigapack;Gold" (produced by Stratagene) for packaging into the phage, a cDNA library was prepared from the synthetic cDNA according to the accompanying protocols of these.
(3) Infection of E. coli
As the host microorganism, E. coli Y1089 (ATCC37196) was employed, and the competent cells were prepared as described below. Single colony cells were inoculated into 5 ml of an NZY medium (0.5% NaCl, 1% NZ amine, type A (Wako Junyaku), 0.5% yeast extract (DIFCO), 0.2% magnesium sulfate, pH 7.5) added with 0.2% maltose, and shaking cultivation was carried out at 37.degree. C. overnight. An amount of 100 .mu.l of the culture broth was transplated into 5 ml of the same fresh medium, and after culturing at 37.degree. C. to OD.sub.660 =0.5, the microorganisms were collected by centrifugation. The competent cells were prepared by suspending the cells in 1 ml of a 10 mM magnesium sulfate solution.
To 0.2 ml of the competent cell suspension was added 0.1 ml of the phage solution prepared in (2), and the mixture was mixed with 3 ml of top agarose (NZY medium containing 0.7% type I-LowEEO-agarose (produced by Sigma)) maintained at a temperature of 56.degree. C., followed by casting into the upper part of an NZY agar plate (30 ml of NZY medium containing 1.5% Bactoagar (produced by DIFCO) added to the 1005 Plate produced by Falcon). After solidifcation of top agarose, stationary cultivation was carried out at 37.degree. C. overnight. By identifying the plaques, the phage-infected cells were identified.
According to the method as described above, a horse heart atrium cDNA library containing 2.0.times.10.sup.7 independent phage.
Example 10
Isolation of C-terminal Amidating Enzyme cDNA
(1) Preparation of DNA probe
A peptide C-terminal amidating enzyme cDNA derived from rat has been already isolated, and its sequence reported (D. A. Soffer et. al., Proc. Natl. Acad. Sci. USA, 86, 735-739 (1989), Kato et. al., Seikagaku, 61, 842 (1989)). The present inventors considered that there is homology to some extent between the rat cDNA and the C-terminal amidating enzyme cDNA derived from horse, procured a part of the rat cDNA and progressed isolation of the horse cDNA with the use of this as the probe. The rat cDNA was gifted from Tohoku University, School of Medicine (Kato et. al., Seikagaku, 61, 842 (1989)), which was digested with restriction endonucleases EcoRI and HincII as well as Nsi I and Sph I, whereby the DNA fragments shown in FIG. 14 and FIG. 15 were respectively isolated, followed by .sup.32 P labelling by Multiprime DNA Labelling Kit (produced by Amersham) to provide a probe.
(2) Plaque hybridization
According to the method shown in the infection of E. coli in Example 9 (3) about 500,000 plaques were formed per one sheet of a plate of 15 cm in diameter (No. 1058, produced by FALCON). The cultivation for plaque formation was carried out at 37.degree. C. for 4 hours. After the plate was left to stand at 4.degree. C. for 2 hours, a nitrocellulose filter (BA85, produced by Schleicher & Schuell) was adhered to have the phage DNA migrated to the filter, and then the DNA was denatured in an alkaline solution (0.5M caustic soda, 1.5M sodium chloride). After neutralization with a neutralizing solution (1.5M sodium chloride, 0.5M Tris-HCl buffer, pH 7.0), the mixture was rinsed with a 2.times.SSC solution (0.3M sodium chloride, 30 mM sodium citrate buffer pH 7.0), and after air drying heated at 80.degree. C. for 2 hours under a reduced pressure, followed by fixing of the DNA onto the filter.
For the nitrocellulose filter having the phage DNA fixed thereon, plaque hybridization was effected by use of the probe prepared in (1). The filter was placed in Lappybag (produced by Iwatani), and 30 ml of a prehybridization liquor (0.75M sodium chloride, 50 mM sodium phosphate buffer, pH 7.4, 5 mM EDTA, 0.05% Ficoll, 0.05% polyvinyl pyrrolidone, 0.05% bovine serum albumin (fraction V, produced by Sigma), 0.1% SDS, 0.2 mg/ml salmon sperm DNA) was added, followed by sealing of the bag by a sealer and heating at 65.degree. C. for 4 hours. The prehybridization liquor was discarded, and 30 ml of a hybridization solution (0.75M sodium chloride, 50 mM sodium phosphate buffer, pH 7.4, 5 mM EDTA, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% bovine serum albumin, 0.1% SDS, 0.1 mg/ml salmon sperm DNA having about 1.0.times.10.sup.7 cpm of the radioactivities was added, and after sealing, hybridization was effected at 65.degree. C. for 15 hours. The filter was washed twice with 250 ml of a washing solution (0.3 mM sodium chloride, 20 mM sodium phosphate buffer, pH 7.4, 2 mM EDTA, 0.1% SDS) and further twice with 250 ml of a washing solution (30 mM sodium chloride, 2 mM sodium phosphate buffer pH 7.4, 0.2 mM EDTA, 0.1% SDS) and dried on air. The positive clone was detected by autoradiography by an X-ray film (Fuji, HR-H) under the exposure conditions at -80.degree. C. overnight.
For the two probes employed, 2,000,000 plaques were respectively screened, and about 1000 positive clones were obtained. The phage DNA was recovered from the positive plaques, and again E. coli was effected therewith according to the method as described above, and plaque hybridization practiced again, which operations were repeated until the plaque became single. Ordinarily, single plaques can be obtained by repeating the operations twice.
Example 11
Determination of cDNA Base Sequence
According to the method described on pages 371-372 in Molecular Cloning A Laboratory Manual (T. Maniatis, E. F. Fritsch, J. Sambrook, editors, Cold Spring Harbor Laboratory, 1982), DNA was separated and purified from the phage cloned. The DNA was digested with a restriction enconuclease EcoRI (produced by Takara Shuzo), and the cDNA insertion DNA fragment was separated from the phage DNA according to 1.5% Agarose gel electrophoresis. The cDNA fragment was extracted from the gel, and incorporated at the EcoRI site of the E. coli plasmid pUC 119 (produced by Takara Shuzo) by the ligation reaction. When the EcoRI site exists in the cDNA fragment, the cDNA fragment was obtained by partial digestion of the phage DNA with EcoRI. After the plasmid was amplified, the cDNA fragment was subcloned with M13 phages mp 18, mp 19 (produced by Takara Shuzo), to obtain a single-stranded DNA following conventional procedures. By the use of Sequenase (trade name, produced by Toyo Boseki K. K.) following the instructions thereof, the DNA base sequence was determined. The base sequence of single-stranded DNA was determined for about 400 bases, and for the DNA fragment with a length exceeding that length, the sequence was determined by subcloning by the use of an appropriate restriction endonuclease. For the cDNA fragment, the base sequences of both chains of the double-strand were determined.
FIGS. 13(A)-13(F) show the horse C-terminal amidating enzyme cDNA base sequence determined (this base sequence shows the longest cDNA as the result of many analyses of cDNA) and the amino acid sequence (one letter representation) expected from the base sequence. Also, cDNA's in which one or both of the portions shown by � ! in the Figure were deficient could be confirmed. These cDNA's are considered to be derived from mRNA's by different mRNA splicing methods.
INDUSTRIAL APPLICABILITY
The present invention can be utilized for producing a peptide C-terminal amidation compound from the corresponding peptide C-terminal glycine adduct. Such a peptide C-terminal amidation compound includes valuable physiologically active substances.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 21(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 631 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: rat(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:ATGGCCGGACGCGCCCGCAGCGGTCTGCTACTGCTGCTGCTCGCCCTGCATCGCCCTGCA60GACCAGCTGCCTGGCCTTCAGAAGCCCACTTTCTGTCTTTAAGAGGTTTAAAGAAACTAC120CCAGATCATTTTCCAATGAATGCCTTGGTACCATTGGACCAGTCACCCCTCTTGATGCAT180CAGATTTTGCGCTGGATATTCGCATGCCTGGGGTTACACCTAAAGAGTCTGACACATACT240TCTGCATGTCCATGCGTCTGCCTGTGGATGAGGAAGCTTCGTGATTGACTTCAAGCCTCG300TGCCAGCATGGATACTGTCCACCATATGCTGCTGTTTGGATGCAATATGCCCTCGTCCAC360TGGAAGTTACTGGTTTTGTGATGAAGGAACCTGTAAACAGATAAAGCCAATATTCTATAT420GCCTGGGCAAGGAATGCTCCCCCACCCGGCTCCCGAAAGGTGTTGGATTCAGATTGGAGG480AGAAACTGGAAGCAAATACTTCGTCCTTCAAGTTCACTATGGCGATATCAGTGCTTTTCG540AGATAATCACAAAGACTGCTCTGGCGTGTCCGTACATCTCACACGTGTGCCCCAGCCTTT600AATTGCGGGCATGTACCTTATGATGTCTGTT631(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 6638 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(vi) ORIGINAL SOURCE:(A) ORGANISM: Horse(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 11..3070(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:CGGCGTGGACATGGCTGGCCTTCGTAGCCTGCTAGTTCTCCTCCTTGTT49MetAlaGlyLeuArgSerLeuLeuValLeuLeuLeuVal1510TTTCAGAGCAGCTGTTTGGGTTTCAGAAGCCCACTTTCTGTCTTTAAG97PheGlnSerSerCysLeuGlyPheArgSerProLeuSerValPheLys152025AGGTTTAAAGAAACTACCAGACCATTTTCCAATGAATGTCTTGGTACC145ArgPheLysGluThrThrArgProPheSerAsnGluCysLeuGlyThr30354045ACCAGACCAGTCATTCCTATTGATTCATCAGATTTTGCATTGGATATT193ThrArgProValIleProIleAspSerSerAspPheAlaLeuAspIle505560CGCATGCCTGGAGTCACACCTAAACAGTCTGATACATACTTCTGCATG241ArgMetProGlyValThrProLysGlnSerAspThrTyrPheCysMet657075TCGATGCGTTTGCCAATGGATGAGGAAACCTTCGTGATTGACTTCAAA289SerMetArgLeuProMetAspGluGluThrPheValIleAspPheLys808590CCTCGTGCCAGCATGGATACTGTCCATCATATGTTACTTTTTGGTTGC337ProArgAlaSerMetAspThrValHisHisMetLeuLeuPheGlyCys95100105AATATGCCCTCATCCACTGGAAGTTACTGGTTTTGTGATGAAGGCGTC385AsnMetProSerSerThrGlySerTyrTrpPheCysAspGluGlyVal110115120125TGTACAGACAAAGCCAATATTCTCTATGCCTGGGCAAGAAATGCTCCC433CysThrAspLysAlaAsnIleLeuTyrAlaTrpAlaArgAsnAlaPro130135140CCCACCAGACTCCCCAAAGGTGTTGGATTCAGAGTTGGAGGAGAGACT481ProThrArgLeuProLysGlyValGlyPheArgValGlyGlyGluThr145150155GGAAGTAAATACTTCGTACTACAAGTACACTATGGGGATATTAGTGCT529GlySerLysTyrPheValLeuGlnValHisTyrGlyAspIleSerAla160165170TTTAGAGATAATCACAAGGACTGTTCTGGTGTGTCCTTACACCTCACA577PheArgAspAsnHisLysAspCysSerGlyValSerLeuHisLeuThr175180185CGCCTGCCACAGCCTTTAATTGCTGGCATGTACCTTATGATGGCTCTT625ArgLeuProGlnProLeuIleAlaGlyMetTyrLeuMetMetAlaLeu190195200205GACACTGTTATACCAGCAGGAGAGAAAGTGGTGAATTCTGACCTTTCA673AspThrValIleProAlaGlyGluLysValValAsnSerAspLeuSer210215220TGCCATTATAAAAAGTACCCAATGCATGTCTTTGCCTATAGAGTTCAC721CysHisTyrLysLysTyrProMetHisValPheAlaTyrArgValHis225230235ACTCACCATTTAGGTAAGGTAGTAAGTGGCTACAGAGTAAGAAATGGA769ThrHisHisLeuGlyLysValValSerGlyTyrArgValArgAsnGly240245250CAGTGGACACTGATTGGACGTCAGAGCCCCCAGCTGCCACAGGCTTTC817GlnTrpThrLeuIleGlyArgGlnSerProGlnLeuProGlnAlaPhe255260265TACCCTGTGGAACACCCAGTAGATGTCAGTTTTGGTGACATACTGGCA865TyrProValGluHisProValAspValSerPheGlyAspIleLeuAla270275280285GCAAGATGTGTGTTCACTGGTGAAGGAAGGACAGAAGCCACGCACATT913AlaArgCysValPheThrGlyGluGlyArgThrGluAlaThrHisIle290295300GGTGGCACATCTAGTGATGAAATGTGCAACTTATACATTATGTATTAC961GlyGlyThrSerSerAspGluMetCysAsnLeuTyrIleMetTyrTyr305310315ATGGAAGCCAAGCACGCAGTTTCTTTCATGACCTGTACCCAGAATGTA1009MetGluAlaLysHisAlaValSerPheMetThrCysThrGlnAsnVal320325330GCTCCAGAAATGTTCAGAACCATCCCCCCAGAGGCCAATATTCCAATT1057AlaProGluMetPheArgThrIleProProGluAlaAsnIleProIle335340345CCTGTGAAGTCCGACATGGTTATGATGCATGGACATCACAAAGAAACA1105ProValLysSerAspMetValMetMetHisGlyHisHisLysGluThr350355360365GAGAACAAAGATAAGACTTCACTACAACAGCCAAAACAAGAAGAAGAA1153GluAsnLysAspLysThrSerLeuGlnGlnProLysGlnGluGluGlu370375380GTGTTAGAACAGGGTGATTTCTATTCACTGCTTTCCAAGCTGCTAGGA1201ValLeuGluGlnGlyAspPheTyrSerLeuLeuSerLysLeuLeuGly385390395GAAAGGGAAGATGTTGTTCATGTGCATAAATATAACCCTACAGAAAAG1249GluArgGluAspValValHisValHisLysTyrAsnProThrGluLys400405410GCAGAATCAGAGTCAGACCTGGTAGCTGAGATTGCAAATGTAGTCCAA1297AlaGluSerGluSerAspLeuValAlaGluIleAlaAsnValValGln415420425AAGAAGGATCTCGGTCGATCTGATGCCAGAGAGAGTGCAGAGCATGAG1345LysLysAspLeuGlyArgSerAspAlaArgGluSerAlaGluHisGlu430435440445GACAGGGGCAATGCTATTCTTGTCAGAGACAGAATTCACAAATTCCAC1393AspArgGlyAsnAlaIleLeuValArgAspArgIleHisLysPheHis450455460AGACTAGAATCTACTTTGAGGCCAACAGAGAGCAGAGTTATCTCAGTA1441ArgLeuGluSerThrLeuArgProThrGluSerArgValIleSerVal465470475CCGCAGCCCCTACCTGGTGAAGGCACCTGGGAACCAGAACACACAGGA1489ProGlnProLeuProGlyGluGlyThrTrpGluProGluHisThrGly480485490GATTTCCATGTAGAAGAGGCACTGGATTGGCCTGGAGTATACTTGTTA1537AspPheHisValGluGluAlaLeuAspTrpProGlyValTyrLeuLeu495500505CCAGGCCAGGTTTCTGGGGTAGCTCTGGACCTTCAGAATAACCTGGTG1585ProGlyGlnValSerGlyValAlaLeuAspLeuGlnAsnAsnLeuVal510515520525ATTTTCCACAGAGGTGACCATGTCTGGGATGGAAACTCTTTTGACAGC1633IlePheHisArgGlyAspHisValTrpAspGlyAsnSerPheAspSer530535540AAGTTTGTGTACCAGCAAAGAGGACTCGGGCCAATTGAAGAAGATACT1681LysPheValTyrGlnGlnArgGlyLeuGlyProIleGluGluAspThr545550555ATTCTTGTCATAGATCCAAATAATGCTGCAGTCCTCCAGTCCAGTGGA1729IleLeuValIleAspProAsnAsnAlaAlaValLeuGlnSerSerGly560565570AAAAATCTGTTTTACTTGCCACATGGCTTGAGCATAGACAAAGATGGA1777LysAsnLeuPheTyrLeuProHisGlyLeuSerIleAspLysAspGly575580585AATTATTGGGTCACAGACGTGGCTCTCCATCAGGTGTTCAAACTGGAT1825AsnTyrTrpValThrAspValAlaLeuHisGlnValPheLysLeuAsp590595600605CCAAACAGTAAAGAAGGCCCTCTGTTGATCCTGGGAAGAAGCATGCAA1873ProAsnSerLysGluGlyProLeuLeuIleLeuGlyArgSerMetGln610615620CCAGGCAGTGACCAGAATCACTTCTGTCAACCCACCGATGTGGCTGTA1921ProGlySerAspGlnAsnHisPheCysGlnProThrAspValAlaVal625630635GATCCAAACACTGGGACCATCTTTGTATCAGATGGTTACTGCAACAGT1969AspProAsnThrGlyThrIlePheValSerAspGlyTyrCysAsnSer640645650CGGATCGTGCAGTTTTCACCAACTGGAAGGTTCATCACACAGTGGGGA2017ArgIleValGlnPheSerProThrGlyArgPheIleThrGlnTrpGly655660665GAAGAGTCTTCTGAGAGCAATCCTAAACCAGGCCAGTTCAGGGTTCCT2065GluGluSerSerGluSerAsnProLysProGlyGlnPheArgValPro670675680685CACAGCTTGGCCCTTGTGCCTCATTTGGGCCAATTATGTGTGGCCGAC2113HisSerLeuAlaLeuValProHisLeuGlyGlnLeuCysValAlaAsp690695700CGGGAAAATGGTCGGATCCAGTGTTTTAAAACTGACACCAAAGAATTT2161ArgGluAsnGlyArgIleGlnCysPheLysThrAspThrLysGluPhe705710715GTGCGAGAGATTAAGCATGCATCATTTGGAAGAAATGTATTTGCAATT2209ValArgGluIleLysHisAlaSerPheGlyArgAsnValPheAlaIle720725730TCGTATATACCAGGTTTGCTCTTTGCCGTAAATGGGAAGCCTTACTTT2257SerTyrIleProGlyLeuLeuPheAlaValAsnGlyLysProTyrPhe735740745GGGGACCAAAAACCAGTACAAGGATTTGTGATGAACTTTTCCAGTGGG2305GlyAspGlnLysProValGlnGlyPheValMetAsnPheSerSerGly750755760765GAAATTATAGATGTCTTCAAGCCAGTGCGCAAGCACTTTGACATGCCT2353GluIleIleAspValPheLysProValArgLysHisPheAspMetPro770775780CATGACATTACTGCATCTGAAGACGGGACTGTGTATGTTGGAGATGCT2401HisAspIleThrAlaSerGluAspGlyThrValTyrValGlyAspAla785790795CACACCAACACCGTGTGGAAGTTCACTTCGACTGAAACAGCCCAGGTC2449HisThrAsnThrValTrpLysPheThrSerThrGluThrAlaGlnVal800805810TGGTTCCCGGGTGTGGACCTACATCACTCGTCAGTGGCCATGCTGTGG2497TrpPheProGlyValAspLeuHisHisSerSerValAlaMetLeuTrp815820825TGGCAGCTCACATACAAAAAGAGGAAGATTGACAACAGATGTTATCTC2545TrpGlnLeuThrTyrLysLysArgLysIleAspAsnArgCysTyrLeu830835840845AGGGCCAATCTTCCTCAGCAAATGAAAAAAAAAAGAGTGGAGCATCGA2593ArgAlaAsnLeuProGlnGlnMetLysLysLysArgValGluHisArg850855860TCAGTTAAAAAGGCTGGCATTGAGGTCCAGGAAATCAAAGAATCCGAG2641SerValLysLysAlaGlyIleGluValGlnGluIleLysGluSerGlu865870875GCAGTTGTTGAAACCAAAATGGAGAACAAACCCGCCTCCTCAGAATTG2689AlaValValGluThrLysMetGluAsnLysProAlaSerSerGluLeu880885890CAGAAGATGCAAGAGAAACAGAAACTGATCAAAGAGCCAGGCTCGGGA2737GlnLysMetGlnGluLysGlnLysLeuIleLysGluProGlySerGly895900905GTGCCCGTTGTTCTCATTACAACCCTTCTGGTTATTCCGGTGGTTGTC2785ValProValValLeuIleThrThrLeuLeuValIleProValValVal910915920925CTGCTGGCCATTGCCATATTTATTCGGTGGAAAAAATCAAGGGCCTTT2833LeuLeuAlaIleAlaIlePheIleArgTrpLysLysSerArgAlaPhe930935940GGAGAGTCTGAACACAAAGTCGAGGCAAGTTCAGGAAGAGTACTGGGA2881GlyGluSerGluHisLysValGluAlaSerSerGlyArgValLeuGly945950955AGACTTAGAGGAAAAGGAAGTGGAGGCTTAAACCTCGGAAATTTCTTT2929ArgLeuArgGlyLysGlySerGlyGlyLeuAsnLeuGlyAsnPhePhe960965970GCGAGCCGTAAAGGCTACAGTCGGAAAGGGTTTGACCGGCTCAGCACC2977AlaSerArgLysGlyTyrSerArgLysGlyPheAspArgLeuSerThr975980985GAGGGGAGTGACCAGGAGAAAGATGAGGATGACGGAAGTGAATCAGAA3025GluGlySerAspGlnGluLysAspGluAspAspGlySerGluSerGlu99099510001005GAAGAATATTCAGCACCTCTGCCCGCACCTGTACCTTCCTCCTCC3070GluGluTyrSerAlaProLeuProAlaProValProSerSerSer101010151020TGAAAACTGGGCTTTGATTTAGTTGATGAGATTTACCAAGAATGCCAGGTTCCTTTCCCT3130TTAGCACGATTAGAGTTTTGTGTATTTAATTGTAAACTGTACTAGTCTGTGTGGGACTGT3190ACACATTTTATTTACTTCGTTTTGGTTTAGTTGGCTTCTGTTTCTGGTTGAGGAGTTTCC3250TAAAAGTTCATAACAGTGCCATTGTCTTTATCTGAACATAGAATAGAGAAACAGTCCTCT3310TCTTCCATCACGTTACTAATTTAATGATGGAAGCTTTGCTCATTTACATTTTGAGACTTT3370TCTGTAGGTGTAAATAGCCCCATTCTCTGCTTGGACACAGTCTTTTCCCAATAGCACTTC3430CATTGCCAGTGTCTTTCTTTGGTGCCTTTCCTGTTCAGCATTCTCAGCCTGTGGCAGTAA3490AGAGAAACTTTGTGCTACACGACGACGAAGCTGCTAAATCTTCTTCTATTTTTTTAAAAT3550CACTAACATTATATTGCAACAAGGGAAAGAAAAAAGTCTCTATTTAAATTCTTTTTTTTA3610AATTTTCTTCTTTAGTTGGTGTGTTTTTGGGATGTCTTATTTTTAGATGGTTACACTGTT3670AGAACACTATTTTCAGAATCTGAATGTAATTTGTGTAATAAAGTGTTTTCAGAGCATTAG3730CTGTCAGAGTGTATTTTGCCAATTTTTGCATATGTCCAGGGTTTTGTATACTTTTGTAAT3790AATTACATAAACCACAGATTGAGTGAAACCTACTCAATGTCTTCAACCAAAAGAAATGTG3850TTGTATTGTATTAAAATCAAGAAGATATTTTGTTATGTAGCTGATACAAATTAAAAACCA3910GCCTAAGAGCTTACATACATGTGTAAAATCAGGCTCTCTGATGATTCAACGAGAGTGTTT3970GCCTGTATATCAATCAGAAGGTAAATATCTGAATAAAAGGTGATCATAGCTGAGAGGAAA4030AAAAAAAAAAGAGTGGAGCATCGATCAGTTAAAAAGGCTGGCATTGAGGTCCAGGAAATC4090AAAGAATCCGAGGCAGTTGTTGAAACCAAAATGGAGAACAAACCCGCCTCCTCAGAATTG4150CAGAAGATGCAAGAGAAACAGAAACTGATCAAAGAGCCAGGCTCGGGAGTGCCCGTTGTT4210CTCATTACAACCCTTCTGGTTATTCCGGTGGTTGTCCTGCTGGCCATTGCCATATTTATT4270CGGTGGAAAAAATCAAGGGCCTTTGGAGAGTCTGAACACAAAGTCGAGGCAAGTTCAGGA4330AGAGTACTGGGAAGACTTAGAGGAAAAGGAAGTGGAGGCTTAAACCTCGGAAATTTCTTT4390GCGAGCCGTAAAGGCTACAGTCGGAAAGGGTTTGACCGGCTCAGCACCGAGGGGAGTGAC4450CAGGAGAAAGATGAGGATGACGGAAGTGAATCAGAAGAAGAATATTCAGCACCTCTGCCC4510GCACCTGTACCTTCCTCCTCCTGAAAACTGGGCTTTGATTTAGTTGATGAGATTTACCAA4570GAATGCCAGGTTCCTTTCCCTTTAGCACGATTAGAGTTTTGTGTATTTAATTGTAAACTG4630TACTAGTCTGTGTGGGACTGTACACATTTTATTTACTTCGTTTTGGTTTAGTTGGCTTCT4690GTTTCTGGTTGAGGAGTTTCCTAAAAGTTCATAACAGTGCCATTGTCTTTATCTGAACAT4750AGAATAGAGAAACAGTCCTCTTCTTCCATCACGTTACTAATTTAATGATGGAAGCTTTGC4810TCATTTACATTTTGAGACTTTTCTGTAGGTGTAAATAGCCCCATTCTCTGCTTGGACACA4870GTCTTTTCCCAATAGCACTTCCATTGCCAGTGTCTTTCTTTGGTGCCTTTCCTGTTCAGC4930ATTCTCAGCCTGTGGCAGTAAAGAGAAACTTTGTGCTACACGACGACGAAGCTGCTAAAT4990CTTCTTCTATTTTTTTAAAATCACTAACATTATATTGCAACAAGGGAAAGAAAAAAGTCT5050CTATTTAAATTCTTTTTTTTAAATTTTCTTCTTTAGTTGGTGTGTTTTTGGGATGTCTTA5110TTTTTAGATGGTTACACTGTTAGAACACTATTTTCAGAATCTGAATGTAATTTGTGTAAT5170AAAGTGTTTTCAGAGCATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA5230AAACAGCCCAGGTCTGGTTCCCGGGTGTGGACCTACATCACTCGTCAGTGGCCATGCTGT5290GGTGGCAGCTCACATACAAAAAGAGGAAGATTGACAACAGATGTTATCTCAGGGCCAATC5350TTCCTCAGCAAATGAAAAAAAAAAGAGTGGAGCATCGATCAGTTAAAAAGGCTGGCATTG5410AGGTCCAGGAAATCAAAGCAGAGTCTGAACACAAAGTCGAGGCAAGTTCAGGAAGAGTAC5470TGGGAAGACTTAGAGGAAAAGGAAGTGGAGGCTTAAACCTCGGAAATTTCTTTGCGAGCC5530GTAAAGGCTACAGTCGGAAAGGGTTTGACCGGCTCAGCACCGAGGGGAGTGACCAGGAGA5590AAGATGAGGATGACGGAAGTGAATCAGAAGAACAATATTCAGCACCTCTGCCCGCACCTG5650TACCTTCCTCCTCCTGAAAACTGGGCTTTGATTTAGTTGATGAGATTTACCAAGAATGCC5710AGGTTCCTTTCCCTTTAGCACGATTAGAGTTTTGTGTATTTAATTGTAAACTGTACTAGT5770CTGTGTGGGACTGTACACATTTTATTTACTTCGTTTTGGTTTAGTTGGCTTCTGTTTCTG5830GTTGAGGAGTTTCCTAAAAGTTCATAACAGTGCCATTGTCTTTATCTGAACATAGAATAG5890AGAAACAGTCCTCTTCTTCCATCACGTTACTAATTTAATGATGGAAGCTTTGCTCATTTA5950CATTTTGAGACTTTTCTGTAGGTGTAAATAGCCCCATTCTCTGCTTGGACACAGTCTTTT6010CCCAATAGCACTTCCATTGCCAGTGTCTTTCTTTGGTGCCTTTCCTGTTCAGCATTCTCA6070GCCTGTGGCAGTAAAGAGAAACTTTGTGCTACACGACGACGAAGCTGCTAAATCTTCTTC6130TATTTTTTTAAAATCACTAACATTATATTGCAACAAGGGAAAGAAAAAAGTCTCTATTTA6190AATTCTTTTTTTTAAATTTTCTTCTTTAGTTGGTGTGTTTTTGGGATGTCTTATTTTTAG6250ATGGTTACACTGTTAGAACACTATTTTCAGAATCTGAATGTAATTTGTGTAATAAAGTGT6310TTTCAGAGCATTAGCTGTCAGAGTGTATTTTGCCAATTTTTGCATATGTCCAGGGTTTTG6370TATACTTTTGTAATAATTACATAAACCACAGATTGAGTGAAACCTACTCAATGTCTTCAA6430CCAAAAGAAATGTGTTGTATTGTATTAAAATCAAGAAGATATTTTGTTATGTAGCTGATA6490CAAATTAAAAACCAGCCTAAGAGCTTACATACATGTGTAAAATCAGGCTCTCTGATGATT6550CAACGAGAGTGTTTGCCTGTATATCAATCAGAAGGTAAATACTTGAATAAAAGGTGATCA6610TAGCTGAGAGGAAAAAAAAAAAAAAAAA6638(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1020 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:MetAlaGlyLeuArgSerLeuLeuValLeuLeuLeuValPheGlnSer151015SerCysLeuGlyPheArgSerProLeuSerValPheLysArgPheLys202530GluThrThrArgProPheSerAsnGluCysLeuGlyThrThrArgPro354045ValIleProIleAspSerSerAspPheAlaLeuAspIleArgMetPro505560GlyValThrProLysGlnSerAspThrTyrPheCysMetSerMetArg65707580LeuProMetAspGluGluThrPheValIleAspPheLysProArgAla859095SerMetAspThrValHisHisMetLeuLeuPheGlyCysAsnMetPro100105110SerSerThrGlySerTyrTrpPheCysAspGluGlyValCysThrAsp115120125LysAlaAsnIleLeuTyrAlaTrpAlaArgAsnAlaProProThrArg130135140LeuProLysGlyValGlyPheArgValGlyGlyGluThrGlySerLys145150155160TyrPheValLeuGlnValHisTyrGlyAspIleSerAlaPheArgAsp165170175AsnHisLysAspCysSerGlyValSerLeuHisLeuThrArgLeuPro180185190GlnProLeuIleAlaGlyMetTyrLeuMetMetAlaLeuAspThrVal195200205IleProAlaGlyGluLysValValAsnSerAspLeuSerCysHisTyr210215220LysLysTyrProMetHisValPheAlaTyrArgValHisThrHisHis225230235240LeuGlyLysValValSerGlyTyrArgValArgAsnGlyGlnTrpThr245250255LeuIleGlyArgGlnSerProGlnLeuProGlnAlaPheTyrProVal260265270GluHisProValAspValSerPheGlyAspIleLeuAlaAlaArgCys275280285ValPheThrGlyGluGlyArgThrGluAlaThrHisIleGlyGlyThr290295300SerSerAspGluMetCysAsnLeuTyrIleMetTyrTyrMetGluAla305310315320LysHisAlaValSerPheMetThrCysThrGlnAsnValAlaProGlu325330335MetPheArgThrIleProProGluAlaAsnIleProIleProValLys340345350SerAspMetValMetMetHisGlyHisHisLysGluThrGluAsnLys355360365AspLysThrSerLeuGlnGlnProLysGlnGluGluGluValLeuGlu370375380GlnGlyAspPheTyrSerLeuLeuSerLysLeuLeuGlyGluArgGlu385390395400AspValValHisValHisLysTyrAsnProThrGluLysAlaGluSer405410415GluSerAspLeuValAlaGluIleAlaAsnValValGlnLysLysAsp420425430LeuGlyArgSerAspAlaArgGluSerAlaGluHisGluAspArgGly435440445AsnAlaIleLeuValArgAspArgIleHisLysPheHisArgLeuGlu450455460SerThrLeuArgProThrGluSerArgValIleSerValProGlnPro465470475480LeuProGlyGluGlyThrTrpGluProGluHisThrGlyAspPheHis485490495ValGluGluAlaLeuAspTrpProGlyValTyrLeuLeuProGlyGln500505510ValSerGlyValAlaLeuAspLeuGlnAsnAsnLeuValIlePheHis515520525ArgGlyAspHisValTrpAspGlyAsnSerPheAspSerLysPheVal530535540TyrGlnGlnArgGlyLeuGlyProIleGluGluAspThrIleLeuVal545550555560IleAspProAsnAsnAlaAlaValLeuGlnSerSerGlyLysAsnLeu565570575PheTyrLeuProHisGlyLeuSerIleAspLysAspGlyAsnTyrTrp580585590ValThrAspValAlaLeuHisGlnValPheLysLeuAspProAsnSer595600605LysGluGlyProLeuLeuIleLeuGlyArgSerMetGlnProGlySer610615620AspGlnAsnHisPheCysGlnProThrAspValAlaValAspProAsn625630635640ThrGlyThrIlePheValSerAspGlyTyrCysAsnSerArgIleVal645650655GlnPheSerProThrGlyArgPheIleThrGlnTrpGlyGluGluSer660665670SerGluSerAsnProLysProGlyGlnPheArgValProHisSerLeu675680685AlaLeuValProHisLeuGlyGlnLeuCysValAlaAspArgGluAsn690695700GlyArgIleGlnCysPheLysThrAspThrLysGluPheValArgGlu705710715720IleLysHisAlaSerPheGlyArgAsnValPheAlaIleSerTyrIle725730735ProGlyLeuLeuPheAlaValAsnGlyLysProTyrPheGlyAspGln740745750LysProValGlnGlyPheValMetAsnPheSerSerGlyGluIleIle755760765AspValPheLysProValArgLysHisPheAspMetProHisAspIle770775780ThrAlaSerGluAspGlyThrValTyrValGlyAspAlaHisThrAsn785790795800ThrValTrpLysPheThrSerThrGluThrAlaGlnValTrpPhePro805810815GlyValAspLeuHisHisSerSerValAlaMetLeuTrpTrpGlnLeu820825830ThrTyrLysLysArgLysIleAspAsnArgCysTyrLeuArgAlaAsn835840845LeuProGlnGlnMetLysLysLysArgValGluHisArgSerValLys850855860LysAlaGlyIleGluValGlnGluIleLysGluSerGluAlaValVal865870875880GluThrLysMetGluAsnLysProAlaSerSerGluLeuGlnLysMet885890895GlnGluLysGlnLysLeuIleLysGluProGlySerGlyValProVal900905910ValLeuIleThrThrLeuLeuValIleProValValValLeuLeuAla915920925IleAlaIlePheIleArgTrpLysLysSerArgAlaPheGlyGluSer930935940GluHisLysValGluAlaSerSerGlyArgValLeuGlyArgLeuArg945950955960GlyLysGlySerGlyGlyLeuAsnLeuGlyAsnPhePheAlaSerArg965970975LysGlyTyrSerArgLysGlyPheAspArgLeuSerThrGluGlySer980985990AspGlnGluLysAspGluAspAspGlySerGluSerGluGluGluTyr99510001005SerAlaProLeuProAlaProValProSerSerSer101010151020(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:PheGlyPheGly(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 5 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(ix) FEATURE:(A) NAME/KEY: Modified-site(B) LOCATION: 1(D) OTHER INFORMATION: /note= ""D-tyr""(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:TyrLeuAsnGlyArg15(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 5 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:PheGlyLeuMetGly15(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:LysAlaPheGly1(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:GlyLeuMetGly1(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:AspArgPheGly1(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3226 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(vi) ORIGINAL SOURCE:(A) ORGANISM: Rat(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 2..831(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:CATGGCCGGACGCGCCCGCAGCGGTCTGCTACTGCTGCTGCTGGGG46MetAlaGlyArgAlaArgSerGlyLeuLeuLeuLeuLeuLeuGly151015CTGCTCGCCCTGCAGAGCAGCTGCCTGGCCTTCAGAAGCCCACTTTCT94LeuLeuAlaLeuGlnSerSerCysLeuAlaPheArgSerProLeuSer202530GTCTTTAAGAGGTTTAAAGAAACTACCAGATCATTTTCCAATGAATGC142ValPheLysArgPheLysGluThrThrArgSerPheSerAsnGluCys354045CTTGGTACCATTGGACCAGTCACCCCTCTTGATGCATCAGATTTTGCG190LeuGlyThrIleGlyProValThrProLeuAspAlaSerAspPheAla505560CTGGATATTCGCATGCCTGGGGTTACACCTAAAGAGTCTGACACATAC238LeuAspIleArgMetProGlyValThrProLysGluSerAspThrTyr657075TTCTGCATGTCCATGCGTCTGCCTGTGGATGAGGAAGCCTTCGTGATT286PheCysMetSerMetArgLeuProValAspGluGluAlaPheValIle80859095GACTTCAAGCCTCGTGCCAGCATGGATACTGTCCACCATATGCTGCTG334AspPheLysProArgAlaSerMetAspThrValHisHisMetLeuLeu100105110TTTGGATGCAATATGCCCTCGTCCACTGGAAGTTACTGGTTTTGTGAT382PheGlyCysAsnMetProSerSerThrGlySerTyrTrpPheCysAsp115120125GAAGGAACCTGTACAGATAAAGCCAATATTCTATATGCCTGGGCAAGG430GluGlyThrCysThrAspLysAlaAsnIleLeuTyrAlaTrpAlaArg130135140AATGCTCCCCCCACCCGGCTCCCGAAAGGTGTTGGATTCAGAGTTGGA478AsnAlaProProThrArgLeuProLysGlyValGlyPheArgValGly145150155GGAGAAACTGGAAGCAAATACTTCGTCCTTCAAGTTCACTATGGCGAT526GlyGluThrGlySerLysTyrPheValLeuGlnValHisTyrGlyAsp160165170175ATCAGTGCTTTTCGAGATAATCACAAAGACTGCTCTGGCGTGTCCGTA574IleSerAlaPheArgAspAsnHisLysAspCysSerGlyValSerVal180185190CATCTCACACGTGTGCCCCAGCCTTTAATTGCGGGCATGTACCTTATG622HisLeuThrArgValProGlnProLeuIleAlaGlyMetTyrLeuMet195200205ATGTCTGTTGACACTGTCATACCACCAGGAGAGAAAGTAGTGAATGCT670MetSerValAspThrValIleProProGlyGluLysValValAsnAla210215220GACATTTCGTGCCAATACAAAATGTATCCAATGCATGTGTTTGCCTAC718AspIleSerCysGlnTyrLysMetTyrProMetHisValPheAlaTyr225230235AGAGTCCACACTCACCATTTAGGTAAGGTGGTGAGCGGATACAGAGTA766ArgValHisThrHisHisLeuGlyLysValValSerGlyTyrArgVal240245250255AGAAACGGACAGTGGACACTGATTGGACGCCAGAACCCCCAGCTGCCA814ArgAsnGlyGlnTrpThrLeuIleGlyArgGlnAsnProGlnLeuPro260265270CAGGCTTTCTACCCTGTGGAACACCCCGTTGATGTTACTTTTGGTGA861GlnAlaPheTyrPro275TATACTGGCAGCCAGATGTGTGTTCACTGGTGAAGGGAGGACAGAGGCCACCCACATCGG921CGGCACTTCTAGTGACGAAATGTGTAACCTGTACATCATGTATTACATGGAAGCCAAATA981TGCACTTTCCTTCATGACCTGTACAAAGAACGTGGCTCCAGATATGTTCAGAACTATCCC1041AGCAGAGGCCAATATCCCAATTCCTGTCAAACCGGACATGGTTATGATGCACGGGCATCA1101CAAAGAAGCAGAAAACAAAGAAAAGAGTGCTTTAATGCAGCAGCCAAAACAGGGAGAGGA1161AGAAGTATTAGAGCAGGAATTTCCATGTGGAAGAAGAACTGGACTGGCCTGGAGTGTACT1221TGTTACCAGGCCAGGTTTCTGGGGTGGCCCTGGATTCTAAGAATAACCTGTGATTTTCCA1281CAGAGGTGACCATGTTTGGGATGGAAACTCTTTTGACAGCAAGTTTGTTTACCAGCAAAG1341AGGTCTTGGGCCAATTGAAGAAGACACCATCCTGGTCATTGACCCAAATAATGCTGAAAT1401CCTCCAGTCCAGTGGCAAGAACCTGTTTTATTTACCACACGGCTTGAGCATAGATACAGA1461TGGAAATTATTGGGTCACAGATGTGGCTCTCCACCAGGTGTTCAAATTGGACCCGCATAG1521CAAAGAAGGCCCTCTCTTAATTCTGGGAAGGAGCATGCAACCTGGGAGTGACCAAAATCA1581TTTCTGCCAGCCCACCGATGTGGCTGTGGAGCCCAGTACTGGAGCTGTCTTCGTGTCAGA1641CGGTTACTGTAACAGTCGGATTGTGCAGTTTTCACCAAGCGGAAAGTTCGTCACCCAGTG1701GGGAGAAGAGTCCTCTGGAAGCAGTCCTAGGCCAGGCCAGTTCAGTGTTCCTCAGAGTTT1761GGCCCTTGTGCCTCATTTGGACCAGTTGTGTGTGGCAGACAGGGAAAATGGCCGAATCCA1821ATGCTTCAAAACTGACACCAAAGAATTTGTGAGAGAGATTAAGCACGCATCATTTGGAAG1881GAATGTCTTTGCCATTTCATATATACCAGGTTTCCTCTTTGCCGTAAACGGGAAGCCTTA1941CTTTGGAGACCAAGAGCCCGTGCAAGGATTTGTGATGAACTTTTCCAGTGGGGAAATTAT2001AGACGTCTTCAAGCCAGTACGCAAGCACTTCGACATGCCTCATGATATTGTGGCTTCTGA2061AGATGGGACTGTGTACATTGGAGACGCACACACAAACACCGTGTGGAAGTTCACCCTGAC2121TGAAAAAATGGAGCATCGGTCAGTTAAAAAGGCTGGCATTGAAGTCCAGGAAATCAAAGA2181AGCCGAGGCAGTTGTTGAACCCAAAGTGGAGAACAAACCCACCTCCTCAGAATTGCAGAA2241GATGCAAGAGAAACAGAAACTGAGCACAGAGCCCGGCTCGGGAGTGTCCGTGGTTCTCAT2301TACAACCCTTCTGGTTATTCCTGTGCTGGTCCTGCTGGCCATTGTCATGTTTATTCGGTG2361GAAAAAATCAAGGGCCTTTGGAGGAAAGGGAAGCGGCGGCTTAAATCTGGGAAATTTCTT2421TGCAAGTCGAAAAGGCTACAGCAGAAAAGGGTTTGACCGAGTGAGCACAGAGGGGAGTGA2481CCAAGAGAAAGATGAGGACGACGGAAGTGAGTCTGAAGAGGAGTACTCGGCCCCGCTGCC2541CAAGCCTGCACCTTCCTCCTGAGCTCCAGCCTTCGCCCGGGTAGCTGGACTGAGGTTTAC2601CAGGATGCCCAGACTCCTTCCCCTTTAGCGCGTGTAAAGTTCTGTGCATTTGATTGTAAA2661CTGTACTCGTCAGTGTGGGACTGTACACACCTTATTTACTTCATTTGGCTCCGTTGGCTT2721CTGTTTTCTAGGTGAGGAGTTCCCCACCAGTTCACTCCAGTGCCATTGTCTTTATATGAA2781CTTAGCGTAGAGAAGCCGCCCTCCTCTTCCAAGGTAGCGCTCCAACCCCCGAGGGAAGTT2841TAGCTCATTCACATTTGGAGACGTTTTAGTTGGTGGATGTAAATAGCCCTATTCTCTGCT2901TGAACACAGTATTCTCCCAGTCCACACCCATCGCCAGTGTCTTTCTTTGGTGCCTTTCCT2961GTTCAGCATTCTCAGCCTGTGGCAGTGAAGAGAACCAACCTGCCACACGACGAAAAGCTG3021CTAAATCTCCTTCTATTTTTTTAAAATCACTAACATTATATTGCAATGAGAGAAATTTTA3081AAAAGTCTCTATTTAAATTCTTTTTTTAAATTTCTCCTCAGTTGGTGTGTTTCCGGGATG3141TCTTATTTTTAGATGGTTACACTGTTAGAACACTATTTTTCAGAATCTGAATGTAATTTG3201TGTAATAAAGTGTTTTCAGAGCATT3226(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 276 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:MetAlaGlyArgAlaArgSerGlyLeuLeuLeuLeuLeuLeuGlyLeu151015LeuAlaLeuGlnSerSerCysLeuAlaPheArgSerProLeuSerVal202530PheLysArgPheLysGluThrThrArgSerPheSerAsnGluCysLeu354045GlyThrIleGlyProValThrProLeuAspAlaSerAspPheAlaLeu505560AspIleArgMetProGlyValThrProLysGluSerAspThrTyrPhe65707580CysMetSerMetArgLeuProValAspGluGluAlaPheValIleAsp859095PheLysProArgAlaSerMetAspThrValHisHisMetLeuLeuPhe100105110GlyCysAsnMetProSerSerThrGlySerTyrTrpPheCysAspGlu115120125GlyThrCysThrAspLysAlaAsnIleLeuTyrAlaTrpAlaArgAsn130135140AlaProProThrArgLeuProLysGlyValGlyPheArgValGlyGly145150155160GluThrGlySerLysTyrPheValLeuGlnValHisTyrGlyAspIle165170175SerAlaPheArgAspAsnHisLysAspCysSerGlyValSerValHis180185190LeuThrArgValProGlnProLeuIleAlaGlyMetTyrLeuMetMet195200205SerValAspThrValIleProProGlyGluLysValValAsnAlaAsp210215220IleSerCysGlnTyrLysMetTyrProMetHisValPheAlaTyrArg225230235240ValHisThrHisHisLeuGlyLysValValSerGlyTyrArgValArg245250255AsnGlyGlnTrpThrLeuIleGlyArgGlnAsnProGlnLeuProGln260265270AlaPheTyrPro275(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 315 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(vi) ORIGINAL SOURCE:(A) ORGANISM: Rat(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:GTGATTTCTATTCACTGCTTTCCAAGCTGCTAGGAGAAAGGGAAGATGTTCATGTGCACA60AGTATAATCCTACAGAAAAGACAGAATCTGGGTCAGACCTGGTAGCTGAGATTGCAAACG120TGGTCCAGAAAAAGGACCTTGGTCGGTCTGACGCCAGAGAAGGTGCAGAGCATGAGGAAT180GGGGTAATGCTATCCTAGTCAGAGACAGGATCCACAGATTCCACCAGCTAGAGTCAACTC240TGAGGCCAGCTGAGAGCAGAGCTTTCTCGTTCCAGCAGCCTGGCGAAGGCCCTTGGGAAC300CAGAACCCTCAGGAG315(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 54 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(vi) ORIGINAL SOURCE:(A) ORGANISM: Rat(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:ATCATGACCGCAAGCTCGAGTCAAGTTCTGGAAGAGTCCTGGGAAGATTCCGAC54(2) INFORMATION FOR SEQ ID NO:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 989 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Bovine(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:MetAlaGlyXaaPheArgSerXaaXaaLeuLeuValLeuLeuXaaLeu151015ValXaaPheProSerGlyCysValGlyPheArgSerProLeuSerVal202530PheLysArgPheLysGluThrThrArgSerPheSerAsnGluCysLeu354045GlyThrThrArgProValIleProIleAspSerSerAspPheAlaLeu505560AspIleArgMetProGlyValThrProLysGlnSerAspThrTyrPhe65707580CysMetSerValArgLeuProMetAspGluGluAlaPheValIleAsp859095PheLysProArgAlaSerMetAspThrValHisHisMetLeuLeuPhe100105110GlyCysAsnMetProAlaSerThrGlyAsnTyrTrpPheCysAspGlu115120125GlyThrCysThrAspLysAlaAsnIleLeuTyrAlaTrpAlaArgAsn130135140AlaProProThrArgLeuProLysGlyValGlyPheArgValGlyGly145150155160GluThrGlySerLysTyrPheValLeuGlnValHisTyrGlyAspIle165170175SerAlaPheArgAspAsnHisLysAspCysSerGlyValSerLeuHis180185190LeuThrArgLeuProGlnProLeuIleAlaGlyMetTyrLeuMetMet195200205SerValAspThrValIleProProGlyGlyLysValValAsnSerAsp210215220IleSerCysHisTyrLysLysTyrProMetHisValPheAlaTyrArg225230235240ValHisThrHisHisLeuGlyLysValValSerGlyTyrArgValArg245250255AsnGlyGlnTrpThrLeuIleGlyArgGlnSerProGlnLeuProGln260265270AlaPheTyrProValGluHisProValAspValSerPheGlyAspIle275280285LeuAlaAlaArgCysValPheThrGlyGluGlyArgThrGluValThr290295300HisIleGlyGlyThrSerSerAspGluMetCysAsnLeuTyrIleMet305310315320TyrTyrMetGluAlaLysHisAlaValSerPheMetThrCysThrGln325330335AsnValAlaProAspIlePheArgThrIleProProGluAlaAsnIle340345350ProIleProValLysSerAspMetValMetMetXaaXaaXaaXaaHis355360365GlyHisHisLysGluThrGluAsnLysAspLysThrSerLeuLeuGln370375380GlnProLysArgGluGluGluGlyValLeuGluGlnGlyAspPheTyr385390395400SerLeuLeuSerLysLeuLeuGlyGluArgGluAspValValHisVal405410415HisLysTyrAsnProThrGluLysAlaGluSerGluSerAspLeuVal420425430AlaGluIleAlaAsnValValGlnLysLysAspLeuGlyArgSerAsp435440445ThrArgGluSerAlaGluXaaGlnGluXaaArgGlyAsnAlaIleLeu450455460ValArgAspArgIleHisLysPheHisArgLeuValSerThrLeuArg465470475480ProAlaGluSerArgValLeuSerLeuGlnGlnProLeuProGlyGlu485490495GlyThrTrpGluProGluHisThrGlyAspPheHisValGluGluAla500505510LeuAspTrpProGlyValTyrLeuLeuProGlyGlnValSerGlyVal515520525AlaLeuAspProGlnAsnAsnLeuValIlePheHisArgGlyAspHis530535540ValTrpAspGlyAsnSerPheAspSerLysPheValTyrGlnGlnArg545550555560GlyLeuGlyProIleGluGluAspThrIleLeuValIleAspProAsn565570575AsnAlaAlaValLeuGlnSerSerGlyLysAsnLeuPheTyrLeuPro580585590HisGlyLeuSerIleAspLysAspGlyAsnTyrTrpValThrAspVal595600605AlaLeuHisGlnValPheLysLeuAspProLysSerLysGluGlyPro610615620LeuLeuThrLeuGlyArgSerMetGlnProGlySerAspGlnAsnHis625630635640PheCysGlnProThrAspValAlaValAspProAspThrGlyThrIle645650655TyrValSerAspGlyTyrCysAsnSerArgLeuValGlnPheSerPro660665670SerGlyLysPheIleThrHisTrpGlyGluAlaSerLeuGluSerSer675680685ProLysProGlyGlnPheArgValProHisSerLeuAlaLeuValPro690695700ProLeuGlyGlnLeuCysValAlaAspArgGluAsnGlyArgIleGln705710715720CysPheLysThrAspThrLysGluPheValArgGluIleLysHisPro725730735SerPheGlyArgAsnValPheAlaIleSerTyrIleProXaaGlyLeu740745750LeuPheAlaValAsnGlyLysProTyrPheGluAspGlnGluProVal755760765GlnGlyPheValMetAsnPheSerSerGlyGluIleIleAspValPhe770775780LysProValArgLysHisPheAspMetProHisAspIleAlaAlaSer785790795800GluAspGlyThrValTyrValGlyAspAlaHisThrAsnThrValTrp805810815LysPheThrSerThrGluLysMetGluHisArgSerValLysLysAla820825830GlyIleGluValGlnGluIleLysGluSerGluAlaValValGluThr835840845LysMetXaaXaaGluAsnLysProAlaSerSerGluLeuGlnLysIle850855860GlnGluLysGlnLysLeuValLysGluProGlySerGlyValProAla865870875880ValLeuIleThrThrLeuLeuValIleProValValValLeuLeuAla885890895IleAlaLeuPheIleArgTrpLysLysSerArgXaaAlaPheGlyAsp900905910SerGluArgLysLeuGluAlaSerSerGlyArgValLeuGlyArgLeu915920925ArgGlyLysGlyGlyGlyGlyLeuAsnLeuGlyAsnPhePheAlaSer930935940ArgLysGlyTyrSerArgLysGlyPheAspArgLeuSerThrGluGly945950955960SerAspGlnGluLysXaaAspGluXaaAspAlaSerGluSerGluGlu965970975GluTyrSerAlaProProProAlaProAlaProSerSer980985(2) INFORMATION FOR SEQ ID NO:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 404 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Frog(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:MetAlaSerXaaLeuSerSerSerXaaPheLeuValLeuXaaXaaPhe151015LeuLeuPheGlnAsnSerCysTyrCysPheArgSerProLeuSerVal202530PheLysArgTyrGluGluSerThrArgSerLeuSerAsnAspCysLeu354045GlyThrThrArgProValMetSerProGlySerSerAspTyrThrLeu505560AspIleArgMetProGlyValThrProThrGluSerAspThrTyrLeu65707580CysLysSerTyrArgLeuProValAspAspGluAlaTyrValValAsp859095PheArgProHisAlaAsnMetAspThrAlaHisHisMetLeuLeuPhe100105110GlyCysAsnIleProSerSerThrGlyAspTyrTrpAspCysSerAla115120125GlyThrMetAspLysSerSerIleMetTyrAlaTrpAlaLysAsnAla130135140ProProThrLysLeuProGluGlyValGlyPheArgValGlyGlyLys145150155160SerGlySerArgTyrPheValLeuGlnValHisTyrGlyAsnValLys165170175AlaPheGlnAspLysHisLysAspThrGlyValThrValArgValThr180185190ProGluLysGlnProGlnIleAlaGlyIleTyrLeuSerMetSerVal195200205AspThrValIleProProGlyGluGluAlaValAsnSerAspIleAla210215220CysLeuTyrAsnArgProThrIleHisProPheAlaTyrArgValHis225230235240ThrHisGlnLeuGlyGlnValValSerGlyPheArgValArgHisGly245250255LysTrpSerLeuIleGlyArgGlnSerProGlnLeuProGlnAlaPhe260265270ValProValGluHisProValGluIleSerProGlyAspIleIleAla275280285ThrArgCysLeuPheThrGlyLysGlyArgThrSerAlaThrTyrIle290295300GlyGlyThrSerAsnAspGluMetCysAsnLeuTyrIleMetTyrTyr305310315320MetAspAlaAlaHisAlaThrSerTyrMetThrCysValGlnThrGly325330335GluProLysLeuPheGlnAsnIleProGluIleAlaAsnValProIle340345350ProValSerProAspMetMetMetMetXaaXaaMetGlyHisGlyHis355360365HisHisThrGluAlaGluProGluLysAsnThrGlyLeuGlnGlnPro370375380LysArgGluGluGluGluValLeuAspGlnGlyLeuIleThrLeuGly385390395400AspSerAlaVal(2) INFORMATION FOR SEQ ID NO:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 989 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Frog(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:MetAspMetAlaSerXaaLeuIleSerSerXaaLeuLeuValLeuXaa151015XaaPheLeuIlePheGlnAsnSerCysTyrCysPheArgSerProLeu202530SerValPheLysArgTyrGluGluSerThrArgSerLeuSerAsnAsp354045CysLeuGlyThrThrArgProValMetSerProGlySerSerAspTyr505560ThrLeuAspIleArgMetProGlyValThrProThrGluSerAspThr65707580TyrLeuCysLysSerTyrArgLeuProValAspAspGluAlaTyrVal859095ValAspTyrArgProHisAlaAsnMetAspThrAlaHisHisMetLeu100105110LeuPheGlyCysAsnValProSerSerThrGlyAspTyrTrpAspCys115120125SerAlaGlyThrCysAsnAspLysSerSerIleMetTyrAlaTrpAla130135140LysAsnAlaProProThrLysLeuProGluGlyValGlyPheGlnVal145150155160GlyGlyLysSerGlySerArgTyrPheValLeuGlnValHisTyrGly165170175AspValLysAlaPheGlnAspLysHisLysAspThrGlyValThrVal180185190ArgIleThrProGluLysGlnProLeuIleAlaGlyIleTyrLeuSer195200205MetSerLeuAsnThrValValProProGlyGlnGluValValAsnSer210215220AspIleAlaCysLeuTyrAsnArgProThrIleHisProPheAlaTyr225230235240ArgValHisThrHisGlnLeuGlyGlnValValSerGlyPheArgVal245250255ArgHisGlyLysTrpThrLeuIleGlyArgGlnSerProGlnLeuPro260265270GlnAlaPheTyrProValGluHisProLeuGluIleSerProGlyAsp275280285IleIleAlaThrArgLeuPheThrGlyLysGlyArgMetSerAlaThr290295300TyrIleGlyGlyThrAlaLysAspGluMetCysAsnLeuTyrIleMet305310315320TyrTyrMetAspAlaAlaHisAlaThrSerTyrMetThrCysValGln325330335ThrGlyAsnProLysLeuPheGluAsnIleProGluIleAlaAsnVal340345350ProIleProValSerProAspMetMetMetMetMetMetMetGlyHis355360365GlyHisHisHisThrGluAlaGluAlaGluThrAsnThrAlaLeuGln370375380GlnProLysArgGluGluGluGluValLeuAsnGlnXaaXaaXaaXaa385390395400XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa405410415XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa420425430XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa435440445XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa450455460XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa465470475480XaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaaXaa485490495XaaXaaXaaXaaXaaXaaXaaXaaXaaAspValHisLeuGluGluAsp500505510ThrAspTrpProGlyValAsnLeuLysValGlyGlnValSerGlyLeu515520525AlaLeuAspProLysAsnAsnLeuValIlePheHisArgGlyAspHis530535540ValTrpAspGluAsnSerPheAspArgAsnPheValTyrGlnGlnArg545550555560GlyIleGlyProIleGlnGluSerThrIleLeuValValAspProAsn565570575ThrSerLysValLeuLysSerThrGlyGlnAsnLeuPhePheLeuPro580585590HisGlyLeuThrIleAspArgAspGlyAsnTyrTrpValThrAspVal595600605AlaLeuHisGlnValPheLysXaaValGlyAlaGluLysGluThrPro610615620LeuLeuValLeuGlyArgAlaPheGlnProGlySerAspArgLysHis625630635640PheCysGlnProThrAspValAlaValAspProIleThrGlyAsnPhe645650655PheValAlaAspGlyTyrCysAsnSerArgIleMetGlnPheSerPro660665670AsnGlyMetPheIleMetGlnTrpGlyGluGluThrSerSerAsnLeu675680685ProArgProGlyGlnPheArgIleProHisSerLeuThrMetIleSer690695700AspGlnGlyGlnLeuCysValAlaAspArgGluAsnGlyArgIleGln705710715720CysPheHisAlaLysThrGlyGluPheValLysGlnIleLysHisGln725730735GluPheGlyArgGluValPheAlaValSerTyrAlaProGlyGlyVal740745750LeuTyrAlaValAsnGlyLysProTyrTyrGlyAspSerThrProVal755760765GlnGlyPheMetIleAsnPheSerAsnGlyAspIleLeuAspThrPhe770775780IleProAlaArgLysAsnPheGluMetProHisAspIleAlaAlaGly785790795800AspAspGlyThrValTyrValGlyAspAlaHisAlaAsnAlaValTrp805810815LysPheXaaSerProSerLysAlaGluHisArgSerValLysLysAla820825830GlyIleGluValGluGluIleThrGluThrGluXaaIlePheGluThr835840845HisMetArgSerArgProLysThrAsnGluSerValGlyGlnGlnThr850855860GlnGluLysProSerValValGlnGluSerSerAlaGlyValSerPhe865870875880ValLeuIleIleThrLeuLeuIleIleProValValValLeuIleAla885890895IleAlaIlePheIleArgTrpArgLysValArgMetTyrGlyGlyAsp900905910IleGlyHisLysSerGluSerSerSerGlyGlyIleLeuGlyLysLeu915920925ArgGlyLysGlySerGlyGlyLeuAsnLeuGlyThrPhePheAlaThr930935940HisLysGlyTyrSerArgLysGlyPheAspArgLeuSerThrGluGly945950955960SerAspGlnGlnLysAspAspAspAspGlySerAspSerGluGluGlu965970975TyrSerAlaProProIleProProValXaaSerSerSer980985(2) INFORMATION FOR SEQ ID NO:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 989 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(vi) ORIGINAL SOURCE:(A) ORGANISM: Rat(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:MetAlaGlyArgAlaArgSerGlyLeuLeuLeuLeuLeuLeuGlyLeu151015LeuAlaLeuGlnSerSerCysLeuAlaPheArgSerProLeuSerVal202530PheLysArgPheLysGluThrThrArgSerPheSerAsnGluCysLeu354045GlyThrIleGlyProValThrProLeuAspAlaSerAspPheAlaLeu505560AspIleArgMetProGlyValThrProLysGluSerAspThrTyrPhe65707580CysMetSerMetArgLeuProValAspGluGluAlaPheValIleAsp859095PheLysProArgAlaSerMetAspThrValHisHisMetLeuLeuPhe100105110GlyCysAsnMetProSerSerThrGlySerTyrTrpPheCysAspGlu115120125GlyThrCysThrAspLysAlaAsnIleLeuTyrAlaTrpAlaArgAsn130135140AlaProProThrArgLeuProLysGlyValGlyPheArgValGlyGly145150155160GluThrGlySerLysTyrPheLeuValLeuGlnValHisTyrGlyAsp165170175IleSerAlaPheArgAspAsnHisLysAspCysSerGlyValSerVal180185190HisLeuThrArgValProGlnProLeuIleAlaGlyMetTyrLeuMet195200205MetSerValAspThrValIleProProGlyGluLysValValAsnAla210215220AspIleSerCysGlnTyrLysMetTyrProMetHisValPheAlaTyr225230235240ArgValHisThrHisHisLeuGlyLysValValSerGlyTyrArgVal245250255ArgAsnGlyGlnTrpThrLeuIleGlyArgGlnAsnProGlnLeuPro260265270GlnAlaPheTyrProValGluHisProValAspValThrPheGlyAsp275280285IleLeuAlaAlaArgCysValPheThrGlyGluGlyArgThrGluAla290295300ThrHisIleGlyGlyThrSerSerAspGluMetCysAsnLeuTyrIle305310315320MetTyrTyrMetGluAlaLysTyrAlaLeuSerPheMetThrCysThr325330335LysAsnValAlaProAspMetPheArgThrIleProAlaGluAlaAsn340345350IleProIleProValLysProAspMetValMetMetXaaXaaXaaXaa355360365HisGlyHisHisLysGluAlaGluAsnLysGluLysSerAlaLeuMet370375380GlnGlnProLysGlnGlyGluGluGluValLeuGluGlnGlyAspPhe385390395400TyrSerLeuLeuSerLysLeuLeuGlyGluArgGluAspXaaValHis405410415ValHisLysTyrAsnProThrGluLysThrGluSerGlySerAspLeu420425430ValAlaGluIleAlaAsnValValGlnLysLysAspLeuGlyArgSer435440445AspAlaArgGluGlyAlaGluHisGluGluXaaTrpGlyAsnAlaIle450455460LeuValArgAspArgIleHisArgPheHisGlnLeuGluSerThrLeu465470475480ArgProAlaGluSerArgAlaPheSerPheGlnGlnXaaXaaProGly485490495GluGlyProTrpGluProGluProSerGlyAspPheHisValGluGlu500505510GluLeuAspTrpProGlyValTyrLeuLeuProGlyGlnValSerGly515520525ValAlaLeuAspSerLysAsnAsnLeuValIlePheHisArgGlyAsp530535540HisValTrpAspGlyAsnSerPheAspSerLysPheValTyrGlnGln545550555560ArgGlyLeuGlyProIleGluGluAspThrIleLeuValIleAspPro565570575AsnAsnAlaGluIleLeuGlnSerSerGlyLysAsnLeuPheTyrLeu580585590ProHisGlyLeuSerIleAspThrAspGlyAsnTyrTrpValThrAsp595600605ValAlaLeuHisGlnValPheLysLeuAspProHisSerLysGluGly610615620ProLeuLeuIleLeuGlyArgSerMetGlnProGlySerAspGlnAsn625630635640HisPheCysGlnProThrAspValAlaValGluProSerThrGlyAla645650655ValPheValSerAspGlyTyrCysAsnSerArgIleValGlnPheSer660665670ProSerGlyLysPheValThrGlnTrpGlyGluGluSerSerGlySer675680685SerProArgProGlyGlnPheSerValProHisSerLeuAlaLeuVal690695700ProHisLeuAspGlnLeuCysValAlaAspArgGluAsnGlyArgIle705710715720GlnCysPheLysThrAspLysGluPheValArgGluIleLysHisAla725730735SerPheGlyArgAsnValPheAlaIleSerTyrIleProXaaGlyPhe740745750LeuPheAlaValAsnGlyLysProTyrPheGlyAspGlnGluProVal755760765GlnGlyPheValMetAsnPheSerSerGlyGluIleIleAspValPhe770775780LysProValArgLysHisPheAspMetProHisAspIleValAlaSer785790795800GluAspGlyThrValTyrIleGlyAspAlaHisThrAsnThrValTrp805810815LysPheThrLeuThrGluLysMetGluHisArgSerValLysLysAla820825830GlyIleGluValGlnGluIleLysGluAlaGluAlaValValGluPro835840845LysValXaaXaaGluAsnLysProThrSerSerGluLeuGlnLysMet850855860GlnGluLysGlnLysLeuSerThrGluProGlySerGlyValSerVal865870875880ValLeuIleThrThrLeuLeuValIleProValLeuValLeuLeuAla885890895IleValMetPheIleArgTrpLysLysSerArgXaaAlaPheGlyAsp900905910HisAspArgLysLeuGluSerSerSerGlyArgValLeuGlyArgPhe915920925ArgGlyLysGlySerGlyGlyLeuAsnLeuGlyAsnPhePheAlaSer930935940ArgLysGlyTyrSerArgLysGlyPheAspArgValSerThrGluGly945950955960SerAspGlnGluLysXaaAspGluAspAspGlyThrGluSerGluGlu965970975GluTyrSerAlaProLeuProLysProAlaProSerSer980985(2) INFORMATION FOR SEQ ID NO:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 5 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:SerLeuAlaPheGly15(2) INFORMATION FOR SEQ ID NO:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 10 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:CATCTGAAAC10(2) INFORMATION FOR SEQ ID NO:20:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 10 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:ACTTTGGGCC10(2) INFORMATION FOR SEQ ID NO:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1172 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(vi) ORIGINAL SOURCE:(A) ORGANISM: Rat(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:TGCATGTGTTTGCCTACAGAGTCCACACTCACCATTTAGGTAAGGTGGTGAGCGGATACA60GAGTAAGAAACGGACAGTGGACACTGATTGGACGCCAGAACCCCCAGCTGCCACAGGCTT120TCTACCCTGTGGAACACCCCGTTGATGTTACTTTTGGTGATATACTGGCAGCCAGATGTG180TGTTCACTGGTGAAGGGAGGACAGAGGCCACCCATATCGGCGGCACTTCTAGTGACGAAA240TGTGTAACCTGTACATCATTGTATTACATGGAAGCCAAATATGCACTTTCCTTCATGACC300TGTACAAAGAACGTGGCTCCAGATATGTTCAGAACTATCCCAGCAGAGGCCAATATCCCA360ATTCCTGTCAAACCGGACATGGTTATGATGCACGGGCATCACAAAGAAGCAGAAAACAAA420GAAAAGAGTGCTTTAATGCAGCAGCCAAAACAGGGAGAGGAAGAAGTATTAGAGCAGGGT480GATTTCTATTCACTGCTTTCCAAGCTGCTAGGAGAAAGGGAAGATGTTCATGTGCACAAG540TATAATCCTACAGAAAAGACAGAATCTGGGTCAGACCTGGTAGCTGAGATTGCAAACGTG600GTCCAGAAAAGGACCTTGGTCGGTCTGACGCCAGAGAAGGTGCAGAGCATGAGGAATGGG660GTAATGCTATCCTAGTCAGAGACAGGATCCACAGATTCCACCAGCTAGAGTCAACTCTGA720GGCCAGCTGAGAGCAGAGCTTTCTCGTTCCAGCAGCCTGGCGAAGGCCCTTGGGAACCAG780AACCCTCAGGAGATTTCCATGTGGAAGAAGAACTGGACTGGCCTGGAGTGTACTTGTTAC840CAGGCCAGGTTTCTGGGGTGGCCCTGGATTCTAAGAATAACCTAGTGATTTTCCACAGAG900GTGACCATGTTTGGGATGGAAACTCTTTTGACAGCAAGTTTGTTTACCAGCAAAGAGGTC960TTGGGCCAATTGAAGAAGACACCATCCTGGTCATTGACCCAAATAATGCTGAAATCCTCC1020AGTCCAGTGGCAAGAACCTGTTTTATTTACCACACGGCTTGAGCATAGATACAGATGGAA1080ATTATTGGGTCACAGATGTGGCTCTCCACCAGGTGTTCAAATTGGACCCGCATAGCAAAG1140AAGGCCCTCTCTTAATTCTGGGAAGGAGCATG1172__________________________________________________________________________

Number	Date	Country
1-209687	Aug 1989	JPX
1-281933	Oct 1989	JPX
2-76331	Mar 1990	JPX
2-106412	Apr 1990	JPX
2-205475	Aug 1990	JPX

Number	Name	Date	Kind
4693985	Degen et al.	Sep 1987
4708934	Gilligan et al.	Nov 1987

Number	Date	Country
0 308 067	Mar 1989	EPX
0 447 547	Sep 1991	EPX
0 465 404 B1	Jan 1992	EPX
3-262484	Nov 1991	JPX
PCTUS8803172	Mar 1989	WOX
WO 8902460	Mar 1989	WOX

Purified enzymes participating in C-terminal amidation

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (5)

PCT Information

US Referenced Citations (2)

Foreign Referenced Citations (6)

Non-Patent Literature Citations (15)

Entry
A. Bradbury et al., "Mechanism of C-terminal amide Formation By Pituitary Enzymes," Nature, vol. 298, Aug. 12, 1982, pp. 686-688.
K. Ohsuye et al., "Cloning of cDNA Encoding A New Peptide C-Terminal .alpha.-Amidating Enzyme . . . ," BBRC, vol. 150, Feb. 15, 1988, pp. 1275-1281.
K. Mizuno et al., "Peptide C-Terminal .alpha.-Amidating Enzyme Purified to Homogeneity . . . ," BBRC, vol. 137, Jun. 30, 1986, pp. 984-991.
A. Katopodis et al., "A Novel Enzyme from Bovine Neurointermediate Pituitary Catalyzes Dealkylation of .alpha.-Hydroxyglycine Derivatives, Thereby Functioning Sequentially with Peptidylglycine .alpha.-Amidating Monooxygenase in Peptide Amidation", Biochemistry, vol. 29, No. 26, Jul. 3, 1990, pp. 6115-6120.
K. Takahashi et al., "Peptidylglycine .alpha.-Amidating Reaction: Evidence for A Two-Step Mechanism Involving a Stable Intermediate at Neutral pH", Biochemical and Biophysical Research Communications, vol. 169, No. 2, Jun. 15, 1990, pp. 524-530.
J. Glauder et al., "Human Peptidylglycime .alpha.-Amidating Monooxygenase: cDNA, Cloning and Functional Expression of a Truncated Form in Cos Cells", Biochemical and Biophysical Research Communications, vol. 169, No. 2, Jun. 15, 1990, pp. 551-558.
A. Murthy et al., "Purification and Characterization of Peptidylglycine .alpha.-Amidating Monooxygenase from Bovine Neurointermediate Pituitary", The Journal of Biological Chemistry, vol. 261, No. 1., Feb. 5, 1986, pp. 1815-1822.
Stoffers et al., Proc. Natl. Acad. Sci., USA, Jan. 1989, vol. 86, pp. 735-739.
Betty A. Eipper et al., "Structure of the Precursor to an Enzyme Mediating COOH-Terminal Amidation in Peptide Biosynthesis", Molecular Endocrinology, vol. 1 No. 11, pp. 777-790 (1987).
Doris A. Stoffers et al., "Alternative mRNA splicing generates multiple forms of peptidyl-glycine .alpha.-amidating monooxygenase in rat atrium", Proc. Natl' Acad. Sci. USA, vol. 86, pp. 735-739 (Jan. 1989).
Masahiro Tajima et al., "The Reaction Product of Peptidylglycine .alpha.-Amidating Enzyme Is a Hydroxyl Derivative at .alpha.-Carbon of the Carboxyl-terminal Glycine", The Journal of Biological Chemistry, vol. 265, No. 17, pp. 9602-9605, Issue of Jun. 15, 1990.
D. Stoffers et al., "Alternative mRNA Splcing Generates Multiple Forms of Peptidyl-glycine .alpha.-amidating Monooxygenase in Rate Atrium", Proc. Natl. Acad. Sci. USA, vol. 86, Jan. 1989, pp. 735-739.
Young et al., "Enzymatic Peptidyl .alpha.-Amidation Proceeds through Formation of an .alpha.-Hydroxyglycine Intermediate", J. Am. Chem. Soc., vol. 111, No. 5, Mar. 1989, pp. 1933-1934.
Biochemical and Biophysical Research Communication, vol. 151, No. 1 (1988), A. G. Katopodis, et. al., pp. 499-505.
Biochemistry, vol. 29, No. 26, (1990), A. G. Katopodis, et al., pp. 6115-6120.