PYRIMIDINE DERIVATIVES AS PROTEIN KINASE INHIBITORS

Abstract
The present invention relates to a compound of formula (VII)I, or a pharmaceutically acceptable salt or ester thereof, wherein: X is NR7; Y is O or N—(CH2)nR19; n is 1, 2 or 3; m is 1 or 2; R1 and R2 are each independently H, alkyl or cycloalkyl; R4 and R4′ each independently H alkyl; or R4 and R4′ together form a spiro cycloalkyl group; R19 is H, alkyl, aryl or a cycloalkyl group; R6 is OR8 or halogen; and R7 and R8 are each independently H or alkyl. Further aspects relate to pharmaceutical compositions comprising said compounds and use therefore in the treatment of proliferative disorders and the like.
Description

The present invention relates to substituted pyrimidine derivatives and their use in therapy. More specifically, but not exclusively, the invention relates to compounds that are capable of inhibiting one or more protein kinases, particularly polo-like kinases.


BACKGROUND TO THE INVENTION

The Polo-like kinase family consists of key cell cycle regulatory enzymes with integral roles in controlling entry into and progression through mitosis. Many tumour cells express high levels of PLK1 and are responsive to antisense oligonucleotides targeting this protein.


Initiation of mitosis requires activation of M-phase promoting factor (MPF), i.e. the complex between CDK1 and B-type cyclins [Nurse, P. (1990) Nature, 344, 503-508]. The latter accumulate during the S and G2 phases of the cell cycle and promote the inhibitory phosphorylation of the MPF complex by WEE1, MIK1, and MYT1 kinases. At the end of the G2 phase, corresponding dephosphorylation by the dual-specificity phosphatase CDC25C triggers the activation of MPF [Nigg, E. A. (2001) Nat. Rev. Mol. Cell Biol., 2, 21-32]. In interphase, cyclin B localizes to the cytoplasm and becomes phosphorylated during prophase, followed by nuclear translocation. The nuclear accumulation of active MPF during prophase is thought to be important for initiating M-phase events [Takizawa, C. G. and Morgan, D. O. (2000) Curr. Opin. Cell Biol., 12, 658-665]. However, nuclear MPF is kept inactive by WEE1 unless counteracted by CDC25C. The phosphatase CDC25C itself, localized to the cytoplasm during interphase, accumulates in the nucleus in prophase. The nuclear entry of both cyclin B and CDC25C are promoted through phosphorylation by PLK1 [Roshak, A. K., Capper, E. A., Imburgia, C., Fornwald, J., Scott, G. and Marshall, L. A. (2000) Cell. Signalling, 12, 405-411]. This kinase is thus an important regulator of M-phase initiation.


In humans, there exist three closely related polo-like kinases (PLKs) [Glover, D. M., Hagan, I. M. and Tavares, A. A. (1998) Genes Dev., 12, 3777-3787]. They contain a highly homologous N-terminal catalytic kinase domain and their C-termini contain two or three conserved regions, the polo boxes. The function of the polo boxes remains incompletely understood but polo box-dependent PLK1 activity is required for proper metaphase/anaphase transition and cytokinesis [Seong, Y.-S., Kamijo, K., Lee, J.-S., Fernandez, E., Kuriyama, R., Mild, T. and Lee, K. S. (2002) J Biol. Chem., 277, 32282-32293]. Of the three PLKs, PLK1 is the best characterized; it regulates a number of cell division cycle effects, including the onset of mitosis, DNA-damage checkpoint activation, regulation of the anaphase promoting complex, phosphorylation of the proteasome, and centrosome duplication and maturation. Mammalian PLK2 (also known as SNK) and PLK3 (also known as PRK and FNK) were originally shown to be immediate early gene products. PLK3 kinase activity appears to peak during late S and G2 phase. It is also activated during DNA damage checkpoint activation and severe oxidative stress. PLK3 also plays an important role in the regulation of microtubule dynamics and centrosome function in the cell and deregulated PLK3 expression results in cell cycle arrest and apoptosis [Wang, Q., Xie, S., Chen, J., Fukusawa, K., Naik, U., Traganos, F., Darzynkiewicz, Z., Jhanwar-Uniyal, M. and Dai, W. (2002) Mol. Cell. Biol., 22, 3450-3459]. PLK2 is the least-well understood homologue of the three PLKs. Both PLK2 and PLK3 may have additional important post-mitotic functions [Kauselmann, G., Weiler, M., Wulff, P., Jessberger, S., Konietzko, U., Scafidi, J., Staubli, U., Bereiter-Hahn, J., Strebhardt, K. and Kuhl, D. (1999) EMBO J., 18, 5528-5539].


The fact that human PLKs regulate some fundamental aspects of mitosis was shown by anti-PLK1 antibody microinjection of human tumour cells [Lane, H. A. and Nigg, E. A. (1996) J. Cell. Biol., 135, 1701-1713]. This treatment had no effect on DNA replication but impaired cell division. Cells were arrested in mitosis and showed abnormal distribution of condensed chromatin and monoastral microtubules nucleated from duplicated but unseparated centrosomes. By contrast, non-immortalized human cells arrested as single, mononucleated cells in G2. Moreover, when PLK1 function was blocked through adenovirus-mediated delivery of a dominant-negative gene, tumour-selective apoptosis in many tumour cell lines was observed, whereas again normal epithelial cells, although arrested in mitosis, escaped the mitotic catastrophe seen in tumour cells [Cogswell, J. P., Brown, C. E., Bisi, J. E. and Neill, S. D. (2000) Cell Growth Differ., 11, 615-623]. PLK1 activity is thus necessary for the functional maturation of centrosomes in late G2/early prophase and subsequent establishment of a bipolar spindle. Furthermore, these results suggest the presence in normal cells of a centrosome-maturation checkpoint that is sensitive to PLK1 impairment. Depletion of cellular PLK1 through the small interfering RNA (siRNA) technique also confirmed that this protein is required for multiple mitotic processes and completion of cytokinesis [Liu, X. and Erikson, R. L. (2003) Proc. Natl. Acad. Sci. USA, 100, 5789-5794]. A potential therapeutic rationale for PLK inhibition is also suggested by work with PLK1-specific antisense oligonucleotides, which were shown to induce growth inhibition in cancer cells both in vitro and in vivo [Spankuch-Schmitt, B., Wolf, G., Solbach, C., Loibl, S., Knecht, R., Stegmuller, M., von Minckwitz, G., Kaufmann, M. and Strebhardt, K. (2002) Oncogene, 21, 3162-3171]. Constitutive expression of PLK1 in mammalian cells was shown to lead to malignant transformation [Smith, M. R., Wilson, M. L., Hamanaka, R., Chase, D., Kung, H., Longo, D. L. and Ferris, D. K. (1997) Biochem. Biophys. Res. Commun., 234, 397-405]. Furthermore, overexpression of PLK1 is frequently observed in human tumours and PLK1 expression is of prognostic value for patients suffering from various types of tumours [Takahashi, T., Sano, B., Nagata, T., Kato, H., Sugiyama, Y., Kunieda, K., Kimura, M., Okano, Y. and Saji, S. (2003) Cancer Science, 94, 148-152; Tokumitsu, Y., Mori, M., Tanaka, S., Akazawa, K., Nakano, S. and Niho, Y. (1999) Int. J. Oncol., 15, 687-692; Wolf, G., Elez, R., Doermer, A., Holtrich, U., Ackermann, H., Stutte, H. J., Altmannsberger, H.-M., Rübsamen-Waigmann, H. and Strebhardt, K. (1997) Oncogene, 14, 543-549].


Although the therapeutic potential of pharmacological PLK inhibition has been appreciated [Kraker, A. J. and Booher, R. N. (1999) In Annual Reports in Medicinal Chemistry (Vol. 34) (Doherty, A. M., ed.), pp. 247-256, Academic Press], very little has been reported to date concerning small molecule PLK inhibitors that may be useful as drugs. One of the few biochemical PLK1 inhibitors characterized to date is scytonemin, a symmetric indolic marine natural product [Stevenson, C. S., Capper, E. A., Roshak, A. K., Marquez, B., Eichman, C., Jackson, J. R., Mattern, M., Gerwick, W. H., Jacobs, R. S. and Marshall, L. A. (2002) J. Pharmacol. Exp. Ther., 303, 858-866; Stevenson, C. S., Capper, E. A., Roshak, A. K., Marquez, B., Grace, K., Gerwick, W. H., Jacobs, R. S. and Marshall, L. A. (2002) Inflammation Research, 51, 112-114]. Scytonemin inhibits phosphorylation of CDC25C by recombinant PLK1 with an IC50 value of about 2 μM (at an ATP concentration of 10 μM). Inhibition is apparently reversible and the mechanism with respect to ATP of mixed-competitive mode. Similar potency against other protein serine/threonine- and dual specificity cell-cycle kinases, including MYT1, CHK1, CDK1/cyclin B, and PKC, was observed. Scytonemin showed pronounced anti-proliferative effects on various human cell lines in vitro. Further small molecule PLK inhibitors and their use in the treatment of proliferative disorders are described in International patent application WO2004/067000 in the name of Cyclacel Limited.


The present invention seeks to elucidate new small molecule PLK inhibitors. More specifically, the invention seeks to provide small molecule PLK inhibitors that have therapeutic applications in the treatment of a range of proliferative disorders.


STATEMENT OF INVENTION

A first aspect of the invention relates to a compound of formula VIII, or a pharmaceutically acceptable salt or ester thereof,




embedded image


wherein:


X is NR7;


Y is O or N—(CH2)nR19;


n is 1, 2 or 3;


m is 1 or 2;


R1 and R2 are each independently H, alkyl or cycloalkyl;


R4 and R4′ are each independently H or alkyl; or


R4 and R4′ together form a Spiro cycloalkyl group;


R19 is H, alkyl, aryl or a cycloalkyl group;


R6 is OR8 or halogen; and


R7 and R8 are each independently H or alkyl.


A second aspect of the invention relates to a compound of formula VI, or a pharmaceutically acceptable salt or ester thereof,




embedded image


wherein:


X is NR7;


R1 and R2 are each independently H, alkyl or cycloalkyl;


R4 and R4′ are each independently H or alkyl; or


R4 and R4′ together form a Spiro cycloalkyl group;


R18 is H or alkyl, wherein said alkyl group is optionally substituted by R6;


each R6 is independently OR8 or halogen; and


R7 and R8 are each independently H or alkyl.


A third aspect of the invention relates to a compound of formula VII, or a pharmaceutically acceptable salt or ester thereof,




embedded image


wherein:


X is NR7;


R1 and R2 are each independently H, alkyl or cycloalkyl;


R4 and R4′ are each independently H or alkyl; or


R4 and R4′ together form a spiro cycloalkyl group;


R6 is OR8 or halogen; and


R7 and R8 are each independently H or alkyl.


A fourth aspect of the invention relates to a compound selected from the following:













Compound



No.
Name







254
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide


218
(±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-



3-methoxy-N-(quinuclidin-3-yl)benzamide


195
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(4-methyl-



piperazin-1-yl)-benzamide


221
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide


371
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-



yl)cyclohexyl)-3-methoxybenzamide


372
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide


345
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-



b][1,4]diazepin-2-ylamino)-3-methoxy-N-[1-(tetrahydro-pyran-4-yl)-



piperidin-4-yl]-benzamide


373
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide


374
4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide


194
(±)-4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(quinuclidin-3-



yl)benzamide


186
(±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


375
4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-(4-(2-hydroxyethyl)piperazin-1-yl)-3-methoxybenzamide


376
4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-morpholinobenzamide


347
(R)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


348
(S)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


377
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-



yl)cyclohexyl)-3-methoxybenzamide


378
4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-



b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide


379
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


380
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((cis)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


381
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-(4-(4-(cyclopropylmethyl)-1,4-diazepan-1-yl)cyclohexyl)-



3-methoxybenzamide


382
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-(4-(4-ethyl-1,4-diazepan-1-yl)cyclohexyl)-3-



methoxybenzamide


383
N-(4-(4-benzyl-1,4-diazepan-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


384
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


385
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((cis)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


386
N-((trans)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


387
N-((cis)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


388
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((trans)-4-



morpholinocyclohexyl)benzamide


389
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((cis)-4-



morpholinocyclohexyl)benzamide


390
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-((trans)-4-morpholinocyclohexyl)benzamide


391
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-((cis)-4-morpholinocyclohexyl)benzamide









A fifth aspect of the invention relates to a pharmaceutical composition comprising a compound as described above admixed with a pharmaceutically acceptable diluent, excipient or carrier.


A sixth aspect of the invention relates to the use of a compound as described above in the preparation of a medicament for treating a proliferative disorder.


A seventh aspect of the invention relates to a method of treating a proliferative disorder, said method comprising administering to a subject a therapeutically effective amount of a compound as described above.


An eighth aspect of the invention relates to a method of treating a PLK-dependent disorder, said method comprising administering to a subject a therapeutically effective amount of a compound as described above.


A ninth aspect of the invention relates to a process for preparing compounds as defined above.


DETAILED DESCRIPTION

As used herein, the term “alkyl” includes both saturated straight chain and branched alkyl groups which may be substituted (mono- or poly-) or unsubstituted. Preferably, the alkyl group is a C1-20 alkyl group, more preferably a C1-15, more preferably still a C1-12 alkyl group, more preferably still, a C1-6 alkyl group, more preferably a C1-3 alkyl group. Particularly preferred alkyl groups include, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl and hexyl. Suitable substituents include, for example, one or more R6 groups. Preferably, the alkyl group is unsubstituted.


As used herein, the term “cycloalkyl” refers to a cyclic alkyl group which may be substituted (mono- or poly-) or unsubstituted. Preferably, the cycloalkyl group is a C3-12 cycloalkyl group, more preferably a C3-6 cycloalkyl group. Suitable substituents include, for example, one or more R6 groups.


As used herein, the term “aryl” refers to a C6-12 aromatic group which may be substituted (mono- or poly-) or unsubstituted. Typical examples include phenyl and naphthyl etc. Suitable substituents include, for example, one or more R6 groups.


Compounds of Formula VIII


As mentioned above, one aspect of the invention relates to a compound of formula VIII, or a pharmaceutically acceptable salt or ester thereof.


In one particularly preferred embodiment, the invention relates to a compound of formula VIIIa, or a pharmaceutically acceptable salt or ester thereof,




embedded image


wherein:


X is NR7;


R1 and R2 are each independently H, alkyl or cycloalkyl;


R4 and R4′ are each independently H or alkyl; or


R4 and R4′ together form a Spiro cycloalkyl group;


R19 is H, alkyl, aryl or a cycloalkyl group;


R6 is OR8 or halogen; and


R7 and R8 are each independently H or alkyl.


In one preferred embodiment, R19 is H, alkyl, or a cycloalkyl group.


Preferably, R1 is H or alkyl, more preferably, alkyl. Even more preferably, R1 is methyl or ethyl, more preferably still, Me.


Preferably, R2 is a cycloalkyl group, more preferably a C3-6 cycloalkyl group. Even more preferably, R2 is a cyclopentyl or cyclohexyl group, more preferably still, cyclopentyl.


Preferably, R7 is H or alkyl, more preferably, H or methyl, even more preferably, H.


In one preferred embodiment, one of R4 and R4′ is alkyl, and the other is H or alkyl.


In another preferred embodiment, R4 and R4′ are each independently alkyl. More preferably, R4 and R4′ are both methyl.


In another preferred embodiment, R4 and R4′ are both H.


In another preferred embodiment, R4 and R4′ together form a spiro cycloalkyl group, more preferably, a spiro C3-6 cycloalkyl group. Even more preferably, R4 and R4′ together form a Spiro C3 or C4 cycloalkyl group, more preferably still, a C3 cycloalkyl group.


In one preferred embodiment, R6 is OR8, even more preferably, OMe.


Preferably, R19 is cyclopropyl.


In another particularly preferred embodiment, the invention relates to a compound of formula VIIIb, or a pharmaceutically acceptable salt or ester thereof,




embedded image


wherein R1, R2, R6, R4, R4′ and X are as defined above.


In another particularly preferred embodiment, the invention relates to a compound of formula VIIIc, or a pharmaceutically acceptable salt or ester thereof,




embedded image


wherein X, R1, R2, R6, R4, R4′ and R19 are as defined above.


In one particularly preferred embodiment, said compound of formula VIII is selected from the following:













Compound No.
Name







371
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-



N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-



yl)cyclohexyl)-3-methoxybenzamide


372
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide


377
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-



yl)cyclohexyl)-3-methoxybenzamide


378
4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-



b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide


379
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


380
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((cis)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


381
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-(4-(4-(cyclopropylmethyl)-1,4-diazepan-1-yl)cyclohexyl)-



3-methoxybenzamide


382
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-(4-(4-ethyl-1,4-diazepan-1-yl)cyclohexyl)-3-



methoxybenzamide


383
N-(4-(4-benzyl-1,4-diazepan-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


384
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


385
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((cis)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


386
N-((trans)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


387
N-((cis)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


388
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((trans)-4-



morpholinocyclohexyl)benzamide


389
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((cis)-4-



morpholinocyclohexyl)benzamide


390
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-((trans)-4-morpholinocyclohexyl)benzamide


391
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-((cis)-4-morpholinocyclohexyl)benzamide









and pharmaceutically acceptable salts and esters thereof.


More preferably, the compound of formula VIII is selected from the following:













Com-



pound


No.
Name







371
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]-



diazepine]-2′-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-



yl)cyclohexyl)-3-methoxybenzamide


372
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


377
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-



2′-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-



yl)cyclohexyl)-3-methoxybenzamide


378
4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-



methoxybenzamide









or a pharmaceutically acceptable salt or ester thereof.


Even more preferably, the compound of the invention is compound [371].


Compounds of Formula VII


One aspect of the invention relates to a compound of formula VII, or a pharmaceutically acceptable salt or ester thereof,




embedded image


wherein:


X is NR7;


R1 and R2 are each independently H, alkyl or cycloalkyl;


R4 and R4′ are each independently H or alkyl; or


R4 and R4′ together form a Spiro cycloalkyl group; and


R6 is OR8 or halogen; and


R7 and R8 are each independently H or alkyl.


Preferably, R1 is alkyl, more preferably, methyl.


Preferably, R2 is a cycloalkyl group, more preferably a C3-6 cycloalkyl group. Even more preferably, R2 is a cyclopentyl or cyclohexyl group, more preferably still, cyclopentyl.


Preferably, R7 is H or alkyl, more preferably, H or methyl, even more preferably, H.


In one preferred embodiment, one of R4 and R4′ is alkyl, and the other is H or alkyl.


In another preferred embodiment, R4 and R4′ are each independently alkyl. More preferably, R4 and R4′ are both methyl.


In another preferred embodiment, R4 and are both H.


In another preferred embodiment, R4 and R4′ together form a Spiro cycloalkyl group, more preferably, a Spiro C3-6 cycloalkyl group. More preferably, R4 and R4′ together form a spiro C3 or C4 cycloalkyl group, even more preferably, a C3 cycloalkyl group.


Preferably, R6 is OR8, even more preferably, OMe.


In one preferred embodiment, the compound of formula VII is selected from the following:













Compound No.
Name







218
(±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


194
(±)-4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(quinuclidin-3-



yl)benzamide


186
(±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


347
(R)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


348
(S)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide









and pharmaceutically acceptable salts and esters thereof.


Compounds of Formula VI


One aspect of the invention relates to a compound of formula VI, or a pharmaceutically acceptable salt or ester thereof,




embedded image


wherein:


X is NR7;


R1 and R2 are each independently H, alkyl or cycloalkyl;


one of R4 and R4′ is alkyl, and the other is H or alkyl; or


R4 and R4′ together form a Spiro cycloalkyl group;


R18 is H or alkyl, wherein said alkyl group is optionally substituted by R6;


each R6 is independently OR8 or halogen; and


R7 and R8 are each independently H or alkyl.


Preferably, R1 is alkyl, more preferably methyl.


Preferably, R2 is a cycloalkyl group, more preferably, a C3-6 cycloalkyl group. Even more preferably, R2 is cyclopentyl or cyclohexyl, more preferably still, cyclopentyl.


Preferably, R7 is H or alkyl, more preferably, H or methyl, even more preferably, H.


In one preferred embodiment, one of R4 and R4′ is alkyl, and the other is H or alkyl.


In another preferred embodiment, R4 and R4′ are each independently alkyl. More preferably, R4 and R4′ are both methyl.


In another preferred embodiment, R4 and R4′ are both H.


In another preferred embodiment, R4 and R4′ together form a Spiro cycloalkyl group, more preferably, a Spiro C3-6 cycloalkyl group. Even more preferably, R4 and R4′ together form a Spiro C3 or C4 cycloalkyl group, even more preferably, a C3 cycloalkyl group.


Preferably, R6 is OMe or F.


Preferably, R18 is methyl or CH2CH2OH.


In one preferred embodiment, the compound of formula VI is selected from the following:















254
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-



2′-ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide


195
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(4-methyl-



piperazin-1-yl)-benzamide


221
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide


373
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide


374
4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-



2′-ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide


375
4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-



2′-ylamino)-N-(4-(2-hydroxyethyl)piperazin-1-yl)-3-



methoxybenzamide









and pharmaceutically acceptable salts and esters thereof.


In one especially preferred embodiment, the compound is [254], or a pharmaceutically acceptable salt or ester thereof.


In one highly preferred embodiment, the compound is the HCl salt of compound [254], i.e. 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide.HCl.


Another aspect of the invention relates to a compound which is selected from the following:













Compound No.
Name







254
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide


218
(±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


195
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(4-methyl-



piperazin-1-yl)-benzamide


221
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide


371
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-



yl)cyclohexyl)-3-methoxybenzamide


372
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide


345
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-



b][1,4]diazepin-2-ylamino)-3-methoxy-N-[1-(tetrahydro-pyran-4-yl)-



piperidin-4-yl]-benzamide


373
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide


374
4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide


194
(±)-4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(quinuclidin-3-



yl)benzamide


186
(±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


375
4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-(4-(2-hydroxyethyl)piperazin-1-yl)-3-methoxybenzamide


376
4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-morpholinobenzamide


347
(R)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


348
(S)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


377
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-



yl)cyclohexyl)-3-methoxybenzamide


378
4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-



b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-



(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide


379
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


380
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((cis)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


381
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-(4-(4-(cyclopropylmethyl)-1,4-diazepan-1-yl)cyclohexyl)-



3-methoxybenzamide


382
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-(4-(4-ethyl-1,4-diazepan-1-yl)cyclohexyl)-3-



methoxybenzamide


383
N-(4-(4-benzyl-1,4-diazepan-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


384
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((trans)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


385
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-N-((cis)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-



methoxybenzamide


386
N-((trans)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


387
N-((cis)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-



methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-



pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide


388
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((trans)-4-



morpholinocyclohexyl)benzamide


389
4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((cis)-4-



morpholinocyclohexyl)benzamide


390
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-((trans)-4-morpholinocyclohexyl)benzamide


391
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-((cis)-4-morpholinocyclohexyl)benzamide









and pharmaceutically acceptable salts and esters thereof.


Preferably, the compound is selected from the following:













Compound No.
Name







254
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide


218
(±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


195
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(4-methyl-



piperazin-1-yl)-benzamide


221
4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide


345
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-



b][1,4]diazepin-2-ylamino)-3-methoxy-N-[1-(tetrahydro-pyran-4-yl)-



piperidin-4-yl]-benzamide


194
(±)-4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-



pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(quinuclidin-3-



yl)benzamide


186
(±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


347
(R)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide


348
(S)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-



tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-



ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide









and pharmaceutically acceptable salts and esters thereof.


Advantageously, certain compounds of the invention exhibit improved selectivity for one or more kinases compared to structurally related compounds previously known in the art


In one preferred embodiment, the compound of the invention exhibits selectivity for one or more kinases over one or more other kinases.


For example, in one preferred embodiment, the compound of the invention is capable of preferentially inhibiting PLK family kinases over one or more other protein kinases; thus the compound is capable of “selectively” inhibiting PLK family kinases over one or more other protein kinases. As used herein, the term “selectively” refers to the compounds that are selective for PLK over one or more other protein kinases. Preferably, the selectivity ratio for PLK family kinases over one or more other protein kinases is greater than about 2 to 1, more preferably greater than about 5 to 1 or about 10 to 1, even more preferably greater than about 20 to 1, or 50 to 1 or 100 to 1. Selectivity ratios may be determined by the skilled person in the art.


In one particularly preferred embodiment, the compound of the invention displays selectivity for PLK1. Thus, in one preferred embodiment, the compound of the invention is capable of preferentially inhibiting PLK1 over one or more other protein kinases. Preferably, the selectivity ratio for PLK1 over one or more other protein kinases is greater than about 2 to 1, more preferably greater than about 5 to 1 or about 10 to 1, even more preferably greater than about 20 to 1, or 50 to 1 or 100 to 1.


In an even more preferred embodiment, the compound of the invention displays selectivity for PLK1 over PLK2 and/or PLK3. Thus, in one preferred embodiment, the compound of the invention is capable of preferentially inhibiting PLK1 over PLK2 and/or PLK3. Preferably, the selectivity ratio for PLK1 over PLK2 and/or PLK3 is greater than about 2 to 1, more preferably greater than about 5 to 1 or about 10 to 1, even more preferably greater than about 20 to 1, or 50 to 1 or 100 to 1.


By way of illustration, compound [218] displays selectivity for PLK1 over PLK2 and PLK3 compared with selected compounds of the prior art. For example, compound [218] of the invention is twice as selective for PLK1 versus PLK2 compared to compound [I-64] of WO 07/095188, ca 6-fold more selective than compound [I-76] and 7-fold more selective than compound [I-4] of WO 07/095188. Similarly, compound [218] is 5-fold more selective for PLK1 versus PLK3 compared to compound [I-64] of WO 07/095188, ca 12-fold more selective than compound [I-76] and 5-fold more selective than compound [I-4] of WO 07/095188. Further details may be found in the accompanying Examples.


In another preferred embodiment, the compounds of the invention exhibit superior solubility and/or pharmacokinetic properties when compared to structurally related compounds already known in the art.


For Example, compound [254] displays superior solubility and/or pharmacokinetic properties to Examples [I-76] and [I-253] of WO 07/095188, thereby rendering the compound more suitable for the treatment of diseases. Again, further details of these comparative studies may be found in the accompanying Examples.


Similarly, compound [371] displays advantageous pharmacokinetic properties in terms of its systemic exposure and oral bioavailability, compared to structurally related compounds known in the art.


One preferred embodiment of the invention relates to a subset of compounds that are characterised by low cellular efflux by the ATP-binding cassette (ABC) transporters such as the drug-efflux pump P-glycoprotein (P-gp). It is known that P-gp efflux substrates commonly show poor oral absorption due to the action of P-gp which can transport absorbed drug back into the gut [Ambudkar S. V., et al. (2003) Oncogene, 22, 7468-7485]. P-gp can also reduce the systemic exposure of substrates through promoting excretion into bile and urine. In addition to being drug efflux pumps, ABC transporters can confer drug resistance to tumour cells through elevated expression. Expression of P-gp is widely known to be a mechanism by which cancer cells can acquire multi-drug resistance (MDR) [Gottesman M. M., et al. (2002) Nat. Rev. Cancer, 2, 48-58]. Certain tumours derived from cells that normally express P-gp can exhibit intrinsic drug resistance [Ambudkar S. V., et al. (2005) Trends Pharmacol. Sci., 26, 385-387]. Drugs that are readily transported out of cells do not accumulate in high levels in transporter-expressing cells, limiting the success of the therapy due to reduced drug-target interaction.


Compounds exhibiting low cellular efflux therefore potentially have applications in the oral treatment of cancer, treatment of epithelial cell derived tumours and drug-resistant malignancies, as well has having a lower potential for inducing drug resistance through increased efflux pump expression. Particularly preferred compounds of the invention that exhibit low cellular efflux include compounds [371], [372] and [377]-[391]. Further details of cell viability assays and cellular efflux studies may be found in the Example 9 and FIG. 3.


In addition, compounds of the invention which exhibit low MDR/parental cell asymmetry in cell viability assays are also more effective at inhibiting PLK1 within MDR tumour cells than compounds of the prior art. Thus, these compounds have greater potential as therapeutic PLK inhibitors. Details of experiments measuring PLK1 inhibition in A2780-A2780/ADR cell line pairs are set forth in the accompanying examples.


Therapeutic Use


The compounds of the invention have been found to possess anti-proliferative activity and are therefore believed to be of use in the treatment of proliferative disorders such as cancers, leukaemias and other disorders associated with uncontrolled cellular proliferation such as psoriasis and restenosis.


Thus, one aspect of the invention relates to the use of a compound of the invention, or a pharmaceutically acceptable salt thereof, in the preparation of a medicament for treating a proliferative disorder.


As used herein the phrase “preparation of a medicament” includes the use of one or more of the above described compounds directly as the medicament in addition to its use in a screening programme for further antiproliferative agents or in any stage of the manufacture of such a medicament.


As defined herein, an anti-proliferative effect within the scope of the present invention may be demonstrated by the ability to inhibit cell proliferation in an in vitro whole cell assay, for example using any of the cell lines AGS, H1299 or SJSA-1. Using such assays it may be determined whether a compound is anti-proliferative in the context of the present invention.


One preferred embodiment relates to the use of one or more compounds of the invention in the treatment of proliferative disorders. Preferably, the proliferative disorder is a cancer or leukaemia. The term proliferative disorder is used herein in a broad sense to include any disorder that requires control of the cell cycle, for example cardiovascular disorders such as restenosis and cardiomyopathy, auto-immune disorders such as glomerulonephritis and rheumatoid arthritis, dermatological disorders such as psoriasis, anti-inflammatory, anti-fungal, antiparasitic disorders such as malaria, emphysema and alopecia. In these disorders, the compounds of the present invention may induce apoptosis or maintain stasis within the desired cells as required.


In one preferred embodiment of the invention, the proliferative disorder is cancer or leukaemia, more preferably cancer.


In one preferred embodiment, the proliferative disorder is a solid tumour.


In another preferred embodiment, the proliferative disorder is a hematological cancer.


Preferably, the haematological cancer is leukaemia, more preferably, advanced leukemias or myelodysplastic syndromes (MDS). Other examples include acute myelogenous leukemia (AML), acute lymphocytic leukemia (ALL) or chronic lymphocytic leukemia (CLL).


In another preferred embodiment, the proliferative disorder is glomerulonephritis.


In yet another preferred embodiment, the proliferative disorder is rheumatoid arthritis.


In another preferred embodiment, the proliferative disorder is psoriasis.


In another preferred embodiment, the proliferative disorder is a chronic obstructive pulmonary disorder.


The compounds of the invention may inhibit any of the steps or stages in the cell cycle, for example, formation of the nuclear envelope, exit from the quiescent phase of the cell cycle (G0), G1 progression, chromosome decondensation, nuclear envelope breakdown, START, initiation of DNA replication, progression of DNA replication, termination of DNA replication, centrosome duplication, G2 progression, activation of mitotic or meiotic functions, chromosome condensation, centrosome separation, microtubule nucleation, spindle formation and function, interactions with microtubule motor proteins, chromatid separation and segregation, inactivation of mitotic functions, formation of contractile ring, and cytokinesis functions. In particular, the compounds of the invention may influence certain gene functions such as chromatin binding, formation of replication complexes, replication licensing, phosphorylation or other secondary modification activity, proteolytic degradation, microtubule binding, actin binding, septin binding, microtubule organising centre nucleation activity and binding to components of cell cycle signalling pathways.


In one embodiment of the invention, the compound of the invention is administered in an amount sufficient to inhibit at least one PLK enzyme.


A further aspect of the invention relates to a method of treating a PLK-dependent disorder, said method comprising administering to a subject in need thereof, a compound of the invention or a pharmaceutically acceptable salt thereof, as defined above in an amount sufficient to inhibit PLK.


The polo-like kinases (PLKs) constitute a family of serine/threonine protein kinases. Mitotic Drosophila melanogaster mutants at the polo locus display spindle abnormalities [Sunkel et al., J. Cell Sci., 1988, 89, 25] and polo was found to encode a mitotic kinase [Llamazares et al., Genes Dev., 1991, 5, 2153]. In humans, there exist three closely related PLKs [Glover et al., Genes Dev., 1998, 12, 3777]. They contain a highly homologous amino-terminal catalytic kinase domain and their carboxyl termini contain two or three conserved regions, the polo boxes. The function of the polo boxes remains incompletely understood but they are implicated in the targeting of PLKs to subcellular compartments [Lee et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 9301; Leung et al., Nat. Struct. Biol., 2002, 9, 719], mediation of interactions with other proteins [Kauselmann et al., EMBO J., 1999, 18, 5528], or may constitute part of an autoregulatory domain [Nigg, Curr. Opin. Cell Biol., 1998, 10, 776]. Furthermore, the polo box-dependent PLK1 activity is required for proper metaphase/anaphase transition and cytokinesis [Yuan et al., Cancer Res., 2002, 62, 4186; Seong et al., J. Biol. Chem., 2002, 277, 32282].


Studies have shown that human PLKs regulate some fundamental aspects of mitosis [Lane et al., J Cell. Biol., 1996, 135, 1701; Cogswell et al., Cell Growth Differ., 2000, 11, 615]. In particular, PLK1 activity is believed to be necessary for the functional maturation of centrosomes in late G2/early prophase and subsequent establishment of a bipolar spindle. Depletion of cellular PLK1 through the small interfering RNA (siRNA) technique has also confirmed that this protein is required for multiple mitotic processes and completion of cytokinesis [Liu et al., Proc. Natl. Acad. Sci. USA, 2002, 99, 8672].


In a more preferred embodiment of the invention, the compound of the invention is administered in an amount sufficient to inhibit PLK1.


Of the three human PLKs, PLK1 is the best characterized; it regulates a number of cell division cycle effects, including the onset of mitosis [Toyoshima-Morimoto et al., Nature, 2001, 410, 215; Roshak et al., Cell. Signalling, 2000, 12, 405], DNA-damage checkpoint activation [Smits et al., Nat. Cell Biol., 2000, 2, 672; van Vugt et al., J. Biol. Chem., 2001, 276, 41656], regulation of the anaphase promoting complex [Sumara et al., Mol. Cell, 2002, 9, 515; Golan et al., J. Biol. Chem., 2002, 277, 15552; Kotani et al., Mol. Cell, 1998, 1, 371], phosphorylation of the proteasome [Feng et al., Cell Growth Differ., 2001, 12, 29], and centrosome duplication and maturation [Dai et al., Oncogene, 2002, 21, 6195].


In one particularly preferred embodiment, the compounds of the invention are ATP-antagonistic inhibitors of PLK1.


In the present context ATP antagonism refers to the ability of an inhibitor compound to diminish or prevent PLK catalytic activity, i.e. phosphotransfer from ATP to a macromolecular PLK substrate, by virtue of reversibly or irreversibly binding at the enzyme's active site in such a manner as to impair or abolish ATP binding.


In another preferred embodiment, the compound of the invention is administered in an amount sufficient to inhibit PLK2 and/or PLK3.


A further aspect of the invention relates to a method of inhibiting PLK in a cell comprising contacting said cell with an amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, such that PLK is inhibited in said cell.


Yet another aspect of the invention relates to a method of treating a proliferative disorder comprising inhibiting PLK by administering to a subject in need thereof, a therapeutically effective amount of a compound of formula I, or a pharmaceutically acceptable salt thereof, such that treatment of said proliferative disorder occurs.


In another preferred embodiment, the compound of the invention is administered in an amount sufficient to inhibit at least one aurora kinase. Preferably, the aurora kinase is aurora kinase A, aurora kinase B or aurora kinase C.


A further aspect of the invention relates to a method of treating an aurora kinase-dependent disorder, said method comprising administering to a subject in need thereof, a compound of the invention or a pharmaceutically acceptable salt thereof, as defined above in an amount sufficient to inhibit an aurora kinase.


Another aspect relates to the use of a compound of the invention for inhibiting a protein kinase.


A further aspect of the invention relates to a method of inhibiting a protein kinase, said method comprising contacting said protein kinase with a compound of the invention.


Preferably, the protein kinase is selected from an aurora kinase and a PLK. More preferably, the protein kinase is a PLK, more preferably PLK1.


Pharmaceutical Compositions


A further aspect of the invention relates to a pharmaceutical composition comprising a compound of the invention admixed with one or more pharmaceutically acceptable diluents, excipients or carriers. Even though the compounds of the present invention (including their pharmaceutically acceptable salts, esters and pharmaceutically acceptable solvates) can be administered alone, they will generally be administered in admixture with a pharmaceutical carrier, excipient or diluent, particularly for human therapy. The pharmaceutical compositions may be for human or animal usage in human and veterinary medicine.


Examples of such suitable excipients for the various different forms of pharmaceutical compositions described herein may be found in the “Handbook of Pharmaceutical Excipients, 2nd Edition, (1994), Edited by A Wade and P J Weller.


Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985).


Examples of suitable carriers include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol and the like. Examples of suitable diluents include ethanol, glycerol and water.


The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as, or in addition to, the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).


Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, corn sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose and polyethylene glycol.


Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like.


Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used.


Salts/Esters


The compounds of the invention can be present as salts or esters, in particular pharmaceutically acceptable salts or esters.


Pharmaceutically acceptable salts of the compounds of the invention include suitable acid addition or base salts thereof. A review of suitable pharmaceutical salts may be found in Berge et al, J Pharm Sci, 66, 1-19 (1977). Salts are formed, for example with strong inorganic acids such as mineral acids, e.g. sulphuric acid, phosphoric acid or hydrohalic acids; with strong organic carboxylic acids, such as alkanecarboxylic acids of 1 to 4 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acids, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with aminoacids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (C1-C4)-alkyl- or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane- or p-toluene sulfonic acid. Preferably, the salt is an HCl salt.


Esters are formed either using organic acids or alcohols/hydroxides, depending on the functional group being esterified. Organic acids include carboxylic acids, such as alkanecarboxylic acids of 1 to 12 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acid, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with aminoacids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (C1-C4)-alkyl- or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane- or p-toluene sulfonic acid. Suitable hydroxides include inorganic hydroxides, such as sodium hydroxide, potassium hydroxide, calcium hydroxide, aluminium hydroxide. Alcohols include alkanealcohols of 1-12 carbon atoms which may be unsubstituted or substituted, e.g. by a halogen).


Enantiomers/Tautomers


In all aspects of the present invention previously discussed, the invention includes, where appropriate all enantiomers and tautomers of the compounds of the invention. The person skilled in the art will recognise compounds that possess an optical properties (one or more chiral carbon atoms) or tautomeric characteristics. The corresponding enantiomers and/or tautomers may be isolated/prepared by methods known in the art.


Stereo and Geometric Isomers


Some of the compounds of the invention may exist as stereoisomers and/or geometric isomers—e.g. they may possess one or more asymmetric and/or geometric centres and so may exist in two or more stereoisomeric and/or geometric forms. The present invention contemplates the use of all the individual stereoisomers and geometric isomers of those inhibitor agents, and mixtures thereof. The terms used in the claims encompass these forms, provided said forms retain the appropriate functional activity (though not necessarily to the same degree).


The present invention also includes all suitable isotopic variations of the agent or a pharmaceutically acceptable salt thereof. An isotopic variation of an agent of the present invention or a pharmaceutically acceptable salt thereof is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature. Examples of isotopes that can be incorporated into the agent and pharmaceutically acceptable salts thereof include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine and chlorine such as 2H, 3H, 13C, 14C, 15N, 17O, 18O, 31P, 32P, 35S, 18F and 36Cl, respectively. Certain isotopic variations of the agent and pharmaceutically acceptable salts thereof, for example, those in which a radioactive isotope such as 3H or 14C is incorporated, are useful in drug and/or substrate tissue distribution studies. Tritiated, i.e., 3H, and carbon-14, i.e., 14C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium, i.e., 2H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances. Isotopic variations of the agent of the present invention and pharmaceutically acceptable salts thereof of this invention can generally be prepared by conventional procedures using appropriate isotopic variations of suitable reagents.


Solvates


The present invention also includes solvate forms of the compounds of the present invention. The terms used in the claims encompass these forms.


Polymorphs


The invention furthermore relates to the compounds of the present invention in their various crystalline forms, polymorphic forms and (an) hydrous forms. It is well established within the pharmaceutical industry that chemical compounds may be isolated in any of such forms by slightly varying the method of purification and or isolation form the solvents used in the synthetic preparation of such compounds.


Prodrugs


The invention further includes the compounds of the present invention in prodrug form. Such prodrugs are generally compounds of the invention wherein one or more appropriate groups have been modified such that the modification may be reversed upon administration to a human or mammalian subject. Such reversion is usually performed by an enzyme naturally present in such subject, though it is possible for a second agent to be administered together with such a prodrug in order to perform the reversion in vivo. Examples of such modifications include ester (for example, any of those described above), wherein the reversion may be carried out be an esterase etc. Other such systems will be well known to those skilled in the art.


Administration


The pharmaceutical compositions of the present invention may be adapted for oral, rectal, vaginal, parenteral, intramuscular, intraperitoneal, intraarterial, intrathecal, intrabronchial, subcutaneous, intradermal, intravenous, nasal, buccal or sublingual routes of administration.


For oral administration, particular use is made of compressed tablets, pills, tablets, gellules, drops, and capsules. Preferably, these compositions contain from 1 to 250 mg and more preferably from 10-100 mg, of active ingredient per dose.


Other forms of administration comprise solutions or emulsions which may be injected intravenously, intraarterially, intrathecally, subcutaneously, intradermally, intraperitoneally or intramuscularly, and which are prepared from sterile or sterilisable solutions. The pharmaceutical compositions of the present invention may also be in form of suppositories, pessaries, suspensions, emulsions, lotions, ointments, creams, gels, sprays, solutions or dusting powders.


An alternative means of transdermal administration is by use of a skin patch. For example, the active ingredient can be incorporated into a cream consisting of an aqueous emulsion of polyethylene glycols or liquid paraffin. The active ingredient can also be incorporated, at a concentration of between 1 and 10% by weight, into an ointment consisting of a white wax or white soft paraffin base together with such stabilisers and preservatives as may be required.


Injectable forms may contain between 10-1000 mg, preferably between 10-250 mg, of active ingredient per dose.


Compositions may be formulated in unit dosage form, i.e., in the form of discrete portions containing a unit dose, or a multiple or sub-unit of a unit dose.


Dosage


A person of ordinary skill in the art can easily determine an appropriate dose of one of the instant compositions to administer to a subject without undue experimentation. Typically, a physician will determine the actual dosage which will be most suitable for an individual patient and it will depend on a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy. The dosages disclosed herein are exemplary of the average case. There can of course be individual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention.


Depending upon the need, the agent may be administered at a dose of from 0.01 to 30 mg/kg body weight, such as from 0.1 to 10 mg/kg, more preferably from 0.1 to 1 mg/kg body weight.


In an exemplary embodiment, one or more doses of 10 to 150 mg/day will be administered to the patient for the treatment of malignancy.


Combinations


In a particularly preferred embodiment, the one or more compounds of the invention are administered in combination with one or more other active agents, for example, existing anticancer drugs available on the market. In such cases, the compounds of the invention may be administered consecutively, simultaneously or sequentially with the one or more other active agents.


Anticancer drugs in general are more effective when used in combination. In particular, combination therapy is desirable in order to avoid an overlap of major toxicities, mechanism of action and resistance mechanism(s). Furthermore, it is also desirable to administer most drugs at their maximum tolerated doses with minimum time intervals between such doses. The major advantages of combining chemotherapeutic drugs are that it may promote additive or possible synergistic effects through biochemical interactions and also may decrease the emergence of resistance in early tumor cells which would have been otherwise responsive to initial chemotherapy with a single agent. An example of the use of biochemical interactions in selecting drug combinations is demonstrated by the administration of leucovorin to increase the binding of an active intracellular metabolite of 5-fluorouracil to its target, thymidylate synthase, thus increasing its cytotoxic effects.


Numerous combinations are used in current treatments of cancer and leukemia. A more extensive review of medical practices may be found in “Oncologic Therapies” edited by E. E. Yokes and H. M. Golomb, published by Springer.


Beneficial combinations may be suggested by studying the growth inhibitory activity of the test compounds with agents known or suspected of being valuable in the treatment of a particular cancer initially or cell lines derived from that cancer. This procedure can also be used to determine the order of administration of the agents, i.e. before, simultaneously, or after delivery. Such scheduling may be a feature of all the cycle acting agents identified herein.


Process


Another aspect relates to a process for preparing a compound of the invention, said process comprising the steps of:

    • (i) converting a compound of formula (II) to a compound of formula (IV) either directly or via isolation of a compound of formula (III); and
    • (ii) converting said compound of formula (IV) to a compound of formula (I)




embedded image


Preferably, step (i) comprises heating said compound of formula (II) with NH4Cl and Fe in EtOH/H2O.





The present invention is further illustrated by way of the following non-limiting examples, and with reference to the following figures, wherein:



FIG. 1 shows the area under the curve (AUC) for the plasma concentration of compounds A-H versus time for each compound tested. The dosing vehicle across these experiments remained constant (intravenous=citrate buffer pH 3, 1 mL/kg; oral=DMA/PEG400/10 mM Tartrate buffer, pH 4 (1:3:6), 5 ml/kg);



FIG. 2 represents the same data as FIG. 1, but in the form of oral bioavailability (% F) for each compound.



FIG. 3 shows a comparison of selected compounds versus prior art compounds A′-J′ (defined in table 8) in parental and MDR tumor cells. Asymmetry ratios are presented relative to compound [378].





EXAMPLES

General Experimental


Chemicals and solvents were purchased from commercial sources and were used as received unless otherwise stated. Anhydrous MgSO4 was used as a standard drying agent for organic solutions unless otherwise stated. NMR spectra were recorded using a Varian ]NOVA-500 instrument. Chemical shifts are reported in parts per million relative to internal tetramethyl silane standard. Coupling constants (J) are quoted to the nearest 0.1 Hz. The following abbreviations are used: s, singlet; d, doublet; t, triplet; q, quartet; qu, quintuplet; m, multiplet and br, broad. Mass spectra were obtained using a Waters ZQ2000 single quadrupole mass spectrometer with electro spray ionisation (ESI). Analytical and preparative RP-HPLC was performed using either Vydac 218TP54 (250×4.6 mm) and Vydac 218TP1022 (250×22 mm) columns using a linear gradient elution of water/acetonitrile systems (containing 0.1% trifluoroacetic acid) at flow rates of 1 mL/min (analytical) and 9 mL/min (preparative). Analytical gradients used were as follows:



















% Acetonitrile
% Acetonitrile
% Acetonitrile



Method
Time = 0 min
Time = 20 min
Time = 25 min





















Vydac 1
0
60
100



Vydac 2
10
70
100



Vydac 3
20
80
100










Alternatively Xbridge (100×4.6 mm) and Xbridge (100×19 mm) columns using a linear gradient of water/acetonitrile systems (containing 0.1% ammonium hydroxide) at flow rates of 1 mL/min (analytical) and 20 mL/min (preparative).


Analytical gradients used were as follows:

















%
%





Acetonitrile
Acetonitrile



Time =
Time =
% Acetonitrile
% Acetonitrile


Method
0 min
5 min
Time = 10 min
Time = 12 min



















XBridge1
0

50
100


XBridge2
10


100


XBridge3
20
70

100









Silica gel (EM Kieselgel 60, 0.040-0.063 mm, Merck) or ISOLUTE pre-packed columns (Biotage) were used for flash chromatography.


Abbreviations:

    • DIPEA diisopropylethyl amine
    • DCM dichloromethane
    • DMF dimethylformamide
    • DMSO dimethyl sulfoxide
    • EtOAc ethyl acetate
    • EtOH ethanol
    • HCl hydrochloric acid
    • K2CO3 potassium carbonate
    • MeI methyl iodide
    • MeOH methanol
    • MgSO4 magnesium sulfate
    • NaH sodium hydride
    • NaCl sodium chloride
    • NH4Cl ammonium chloride
    • RM reaction mixture
    • rt room temperature
    • TBTU O-(Benzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium tetrafluoroborate
    • TFA trifluoroacetic acid
    • TFE 2,2,2-trifluoroethanol
    • THF tetrahydrofuran


Example 1
Compound [2]: 4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


1. Thionyl chloride (2.1 eq), MeOH, 0° C. for addition, reflux 2 h; 2. cyclopentanone (0.77 eq), sodium acetate (0.77 eq), sodium triacetoxyborohydride (1.11 eq), DCM, rt 16 h; 3. 2,4-dichloro-5-nitropyrimidine (1.1 eq), K2CO3 (1 eq), acetone, 0° C.—rt 16 h; 4. NH4Cl (8.5 eq), Fe (8 eq), EtOH/H2O (4:1), reflux 2.5 h;—not isolated 5. MeI (1.18 eq), NaH (1.07 eq), DMF, −10° C.—rt, 3 h; 6. 4-amino-3-methoxybenzoic acid (1.5 eq), conc. HCl, H2O/EtOH (4:1), reflux 48 h; 7. DIPEA (2 eq), TBTU (1.1 eq), 4-aminomethylpiperidine (1.2 eq), DCM, rt 16 h.


Step 1: Methyl 3-aminopropanoate

β-Alanine (9.37 g, 0.105 mol), was added to MeOH (50 ml) and the mixture cooled to 0° C. using an ice-bath before the dropwise addition of thionyl chloride [caution: exothermic addition]. Once the addition was complete the reaction was warmed to rt, then refluxed for 2 h. The solvent was next evaporated under reduced pressure and the resulting oil treated with t-butylmethyl ester and the resulting crystals filtered off and further dried in vacuo to give a white crystalline solid (11 g, quant.); 1H (DMSO-d6): δ 2.73 (dd, J=7 Hz, 2H, CH2), 2.98 (dd, J=7 Hz, 2H, CH2), 3.61 (s, 3H, CH3) 8.28 (bs, 2H, NH2); MS+ve: 104.1.


Step 2: Methyl 3-(cyclopentylamino)propanoate

Methyl 3-aminopropanoate (9.37 g, 0.09 mol) was solubilised in DCM (200 ml) and cyclopentanone (6.43 ml, 0.07 mol), sodium acetate (5.96 g, 0.07 mol) and sodium triacetoxyborohydride (22 g, 0.10 mol) were added. The reaction was stirred at rt for 16 h. 20% sodium bicarbonate (100 ml) and 2M sodium hydroxide (50 ml) were then added and the product extracted using DCM/H2O. The organic extracts were combined, washed with sat NaCl, dried using MgSO4, filtered and the filtrate evaporated under reduced pressure and further dried in vacuo to give the product as a pale yellow oil (8.90 g, 55%); MS+ve: 172.4.


Step 3: Methyl 3-[cyclopentyl(2-chloro-5-nitropyrimidin-4-yl)amino]propanoate

Methyl 3-(cyclopentylamino)propanoate (838 mg, 0.005 mol) and K2CO3 (676 mg, 0.005 mol) were added to acetone (5 ml) and the resulting mixture cooled to 0° C. using an ice-bath before the addition of 2,4-dichloro-5-nitropyrimidine (1.044 g, 1.1 eq). The reaction mixture (RM) was then warmed to rt and stirring continued for an additional 16 h before the addition of a further 0.12 eq of the pyrimidine. Stirring was then continued for a further 3 h. The RM was then evaporated under reduced pressure and the product extracted using EtOAc/H2O. The organic extracts were combined, washed with sat NaCl, dried using MgSO4, filtered and the filtrate evaporated under reduced pressure and further dried in vacuo to give the product as a brown oily residue (1.04 g, 65%); Rt=16 min (Vydac 1); ME+ve: 329.1.


Step 4: 2-Chloro-9-cyclopentyl-5,7,8,9-tetrahydro-6H-pyrimido[4,5-b][1,4]diazepin-6-one

Methyl 3-[cyclopentyl(2-chloro-5-nitropyrimidin-4-yl)amino]propanoate (1.00 g, 0.003 mol) and NH4Cl (1.38 g, 0.025 mol, 8.5 eq) were added to EtOH/H2O (4:1 ml, 10 ml) and the mixture heated to reflux before the portion-wise addition of iron powder (1.36 g, 0.024 mol, 8 eq). The RM was then refluxed for an additional 2 h. Progress of the reaction was monitored by HPLC and when no SM remained the RM was filtered hot through celite. The celite was washed with EtOAc (10 ml) and EtOH (10 ml) [both hot] and the filtrate evaporated under reduced pressure and further dried in vacuo to give the product as a brown solid (350 mg, 43%); Rt=12 min (Vydac 1); MS+ve: 267.2.


Step 5: 2-Chloro-9-cyclopentyl-5-methyl-5,7,8,9-tetrahydro-6H-pyrimido[4,5-b][1,4]diazepin-6-one

2-Chloro-9-cyclopentyl-5,7,8,9-tetrahydro-6H-pyrimido [4,5-b][1,4] diazepin-6-one (318 mg, 0.0012 mol) and MeI (88 μl, 0.0014 mol, 1.18 eq) were added to DMF (5 ml) and the solution cooled to −10° C. using acetone/dry ice before the addition of NaH (30 mg, 0.0013 mol, 1.07 eq). The RM was then stirred at 0° C. for 30 min and rt for 30 min. The RM was concentrated and the product extracted using EtOAc/H2O. The organic extracts were combined, washed with sat NaCl, dried using MgSO4, filtered and the filtrate evaporated under reduced pressure and further dried in vacuo to give the product as a purple oily residue (252 mg, 75%); Rt=13 min (Vydac 1); MS+ve: 281.2.


Step 6: (Compound [1]) 4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-benzoic acid

Coupling Method A


2-Chloro-9-cyclopentyl-5-methyl-5,7,8,9-tetrahydro-6H-pyrimido[4,5-b][1,4]diazepin-6-one (248 mg, 0.0009 moo and 4-amino-3-methoxybenzoic acid (221 mg, 0.0013 mol, 1.5 eq), conc. HCl (152 μl) and H2O/EtOH (8:2 ml) were added to a RBF and the resulting RM heated to reflux for 4 h. Progress of the reaction was monitored by HPLC and when no starting material remained (4 h reaction time), the RM was concentrated under reduced pressure and the product extracted using DCM/H2O. The organic extracts were combined, washed with sat NaCl, dried using MgSO4, filtered and the filtrate evaporated under reduced pressure and further dried in vacuo to give a brown oily residue. A few drops of MeOH were added to the residue and the solid ppt formed was collected by suction filtration, washed with MeOH and further dried in vacuo to give the product as a purple solid (51 mg, 14%); Rt=11.2 min (06020 min, purity 100%); 1H NMR (DMSO-d6): δ 1.61 (bs, 4H, cyclopent-H), 1.72 (bs, 2H, cyclopent-H), 1.94 (bs, 2H, cyclopent-H), 2.59 (dd, J=4.5 Hz, 2H, CH2), 3.18 (s, 3H, CH3), 3.63 (dd, J=4.5 Hz, 2H, CH2), 3.95 (s, 3H, CH3), 7.51 (s, 1H), 7.56 (d, J=8 Hz, 1H, phe-H), 7.82 (s, 1H, 8.10 (s, 1H, 8.47 (d, J=8.5 Hz, 1H, phe-H), 12.64 (bs, 1H, NH); MS+ve: 412.2.


Step 7: (Compound [2]): 4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide

4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-benzoic acid (35 mg, 0.085 mmol), DIPEA (28 μl, 0.17 mmol, 2 eq) and TBTU (30 mg, 0.093 mmol, 1.1 eq) were added to 3 ml DCM and the resulting solution stirred at rt for 30 min before the addition of 4-aminomethylpiperidine (13 μl, 0.10 mmol, 1.2 eq). The RM was then stirred at rt for 16 h. The RM was concentrated and the product extracted using DCM/H2O. The organic extracts were combined, washed with sat NaCl, dried using MgSO4, filtered and the filtrate evaporated under reduced pressure and further dried in vacuo to give a yellow oily residue (21 mg, 49%); Rt=9.86 min (06020 min, purity 100%); 1H NMR (CD3OD): δ 1.69-1.75 (m, 6H), 1.82 (bs, 2H), 1.96-1.99 (m, 2H), 2.03-2.05 (bs, 2H), 2.18-2.23 (m, 2H), 2.34 (s, 3H, CH3), 2.68 (dd, J=4.5 Hz, 2H, CH2), 2.95-2.97 (m, 2H), 3.28 (s, 3H, CH3), 3.73 (dd, J=4.5 Hz, 2H, CH2), 3.89-3.94 (m, 1H, CH), 4.01 (s, 3H, CH3), 4.91-4.96 (m, 1H, CH), 7.49-7.51 (m, 2H), 8.02 (bs, 1H), 8.50 (d, J=8.5 Hz, 1H, phe-H); MS+ve: 508.2.


Aminoester Intermediates


The following intermediates were prepared by the method described in Example 1, step 2:


3-Cyclopentylamino-butyric acid methyl ester



embedded image


MS+ve: 186.3


3-Cyclohexylamino-butyric acid methyl ester



embedded image


MS+ve: 200.3


3-Cyclopentylamino-2-methyl-propionic acid methyl ester



embedded image



1H NMR (CDCl3): 1.18 (3H, d, J 7 Hz, CH3), 1.33 (2H, m, CH2), 1.53 (2H, m, CH2), 1.67 (2H, m, CH2), 1.82 (2H, m, CH2), 2.63 (2H, m, CH2), 2.87 (1H, m, CH), 3.06 (1H, m, CH), 3.69 (3H, s, OCH3)


3-Cyclohexylamino-propionic acid methyl ester



embedded image


MS+ve: 186.4.


3-Cyclopentylamino-4-methyl-pentanoic acid methyl ester



embedded image



1H NMR (CDCl3): 1.18 (3H, d, J 7 Hz, CH3), 1.33 (2H, m, CH2), 1.53 (2H, m, CH2), 1.67 (2H, m, CH2), 1.82 (2H, m, CH2), 2.63 (2H, m, CH2), 2.87 (1H, m, CH), 3.06 (1H, m, CH), 3.69 (3H, s, OCH3)


3-(1-Ethyl-propylamino)-propionic acid methyl ester



embedded image



1H NMR (CDCl3): 0.89 (6H, t, J 8 Hz, CH3), 1.44 (4H, m, CH2CH3), 1.77 (1H, bs, NH), 2.39 (1H, m, CH), 2.53 (2H, m, CH2), 2.89 (2H, m, CH2), 3.69 (3H, s, OCH3)


3-(Tetrahydro-pyran-4-ylamino)-propionic acid methyl ester



embedded image



1H NMR (CDCl3): 1.41 (2H, m, CH2), 1.86 (2H, m, CH2), 2.54 (2H, m, CH2), 2.71 (1H, m, CH), 2.95 (2H, m, CH2), 3.44 (2H, t, J 11.5 Hz, CH2), 3.71 (3H, s, OCH3), 3.99 (2H, d, J 11 Hz, CH2)


1-Cyclopentylaminomethyl-cyclopropanecarboxylic acid methyl ester



embedded image



1H NMR (CDCl3): 0.84 (3H, t, J 7 Hz, CH3), 1.25 (4H, m, CH2), 1.37 (2H, m, CH), 1.54 (2H, m, CH), 1.70 (2H, m, CH), 1.83 (2H, m, CH), 2.71 (2H, s, CH2), 3.10 (1H, m, CH), 4.16 (2H, q, J 7 Hz, CH2CH3)


3-Cyclopentylamino-2,2-dimethyl-propionic acid ethyl ester



embedded image



1H NMR (CDCl3): 1.19 (6H, s, CH3), 1.25 (3H, t, J 7 Hz, CH3), 1.28 (2H, m, CH), 1.49 (2H, m, CH), 1.65 (2H, m, CH), 2.64 (1H, s, CH2), 3.01 (1H, m, CH), 4.10 (2H, q, J 7.5 Hz, CH2)


Alternative Method Step 2a: Methyl 3-aminopropanoate



embedded image


Methyl acrylate (4.50 ml, 4.302 g, 49.97 mmole, 0.99 eq) was added dropwise to a solution of cyclopentylamine (5.00 ml, 4.315 g, 50.68 mmole) in methanol (120 ml) at −60° C. (dry ice, acetone). The reaction mixture was allowed to warm to room temperature and stirred overnight. The solvent was removed (reduced pressure, vacuo) to afford the product as an oil (8.236 g, 96% crude yield). Proton NMR indicated that the product contained ˜25% of a dialkylated byproduct.


The following compounds were prepared by a similar method.


3-Phenylamino-propionic acid ethyl ester



embedded image



1H NMR (CDCl3): 1.29 (3H, t, J 7.5 Hz, CH3), 2.64 (2H, t, J 6.5 Hz, CH2), 3.48 (2H, t, J 6.5 Hz, CH2), 4.18 (2H, q, J 7 Hz, CH2), 6.65-6.74 (5H, m, Ar—H)


Nitropyrimidine Intermediates


The following intermediates were also prepared by the method described in Example 1 step 3:


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-butyric acid methyl ester



embedded image


Rt=18.0 min (06020 min); MS+ve: 343.20.


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclohexyl-amino]-butyric acid methyl ester



embedded image


MS+ve: 357.2.


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-2-methyl-propionic acid methyl ester



embedded image



1H NMR (CDCl3): 1.22 (3H, d, J 12 Hz, CH3), 1.57 (2H, m, CH2), 1.76 (2H, m, CH2), 1.93 (2H, m, CH2), 1.98 (2H, m, CH2), 3.18 (1H, s, CH), 3.61 (3H, m, CH+CH2), 3.68 (3H, s, OCH3), 8.74 (1H, s, Pyr-H)


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclohexyl-amino]propionic acid methyl ester



embedded image


Rt=17.6 min (Vydac 1); MS+ve: 343.1.


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-4-methyl-pentanoic acid methyl ester



embedded image



1H NMR (CDCl3): 0.94 (6H, t, J 7 Hz), 1.45-1.82 (7H, m, 3×CH2+CH), 2.17 (1H, m, CH), 2.69 (2H, m, 2×CH), 3.35 (2H, m, CH2), 2.58 (1H, m, CH), 3.73 (3H, s, OCH3), 8.64 (1H, s, Pyr-H)


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-(1-ethyl-propyl)-amino]-propionic acid methyl ester



embedded image


MS (+ve) 331.1, 333.1


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-(tetrahydro-pyran-4-yl)-amino]-propionic acid methyl ester



embedded image


MS (+ve) 345.1, 347.0; tR=12.62 min (Vydac 1).


3-[Benzyl-(2-chloro-5-nitro-pyrimidin-4-yl)-amino]-propionic acid ethyl ester



embedded image



1H NMR (CDCl3): 1.26 (3H, t, J 7 Hz, CH3), 2.73 (2H, t, J 7 Hz, CH2), 3.85 (2H, m, CH2), 4.16 (2H, q, J 7 Hz, CH2), 4.71 (2H, s, CH2), 7.20 (2H, m, Ar—H), 7.37 (3H, m, Ar—H), 8.69 (1H, s, Pyr-H).


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-phenyl-amino]-propionic acid ethyl ester



embedded image



1H NMR (CDCl3): 1.22 (3H, t, J 7.5 Hz, CH3), 2.73 (2H, t, J 7 Hz, CH2), 4.09 (2H, q, J 7 Hz, CH2), 4.43 (2H, t, J 7 Hz, CH2), 7.14-7.48 (5H, m, Ar—H), 8.57 (1H, s, Pyr-H).


1-{[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-methyl}cyclopropanecarboxylic acid ethyl ester



embedded image


MS (+ve) 381.1, 383.3; tR=4.80 min (XBridge 1).


3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-2,2-dimethyl-propionic acid ethyl ester



embedded image


MS (+ve) 371.1, 373.1; tR=4.67 min (XBridge 1).


Aminopyrimidine-Esters Leading to Chloropyrimidine-Diazepines


The following compounds were isolated from the reduction reaction as shown in Example 1, Step 4 as uncyclised intermediates.


3-[(5-Amino-2-chloro-pyrimidin-4-yl)-benzyl-amino]-propionic acid ethyl ester



embedded image



1H NMR (CDCl3): 1.26 (3H, t, J 7.5 Hz, CH3), 2.73 (2H, t, J 7 Hz, CH2), 3.86 (2H, t, J 7 Hz, CH2), 4.14 (2H, q, J 7 Hz, CH2), 4.86 (2H, s, CH2), 7.26-7.39 (5H, m, Ar—H), 7.94 (1H, s, Pyr-H)


3-[(5-Amino-2-chloro-pyrimidin-4-yl)-phenyl-amino]-propionic acid ethyl ester



embedded image


MS (+ve) 321.2, 323.2; tR=3.54 min (XBridge 1).


1-{[(5-Amino-2-chloro-pyrimidin-4-yl)-cyclopentyl-amino]-methyl}-cyclopropanecarboxylic acid ethyl ester



embedded image


MS (+ve) 339.2, 341.2; tR=4.15 min (XBridge 1).


3-[(5-Amino-2-chloro-pyrimidin-4-yl)-cyclopentyl-amino]-2,2-dimethyl-propionic acid ethyl ester



embedded image


MS (+ve) 341.2, 343.2; tR=4.25 min (XBridge 1).


The above compounds were then cyclised using the following method.


The relevant compound (5 mmol) in DMF (10 ml) was heated to 140° C. for 2 hours. Solvent was evaporated in vacuo, ethyl acetate (10 ml) added, and the resulting solid filtered and dried under vacuum to give the compounds listed below.


Note: This reaction may also be carried out with DMSO/NaH


9-Benzyl-2-chloro-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image



1H NMR (DMSO): 2.72 (2H, m, CH2), 3.67 (2H, m, CH2), 4.86 (2H, s, CH2), 7.26-7.37 (5H, m, Ar—H), 7.88 (1H, s, Pyr-H), 9.77 (1H, s, NH)


2-Chloro-9-phenyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 275.2, 277.2; tR=2.80 min (XBridge 1).


2-Chloro-9-cyclopentyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-7,1′-cyclopropan]-6-one



embedded image


MS (+ve) 293.2, 295.2; tR=3.48 min (XBridge 1).


2-Chloro-9-cyclopentyl-7,7-dimethyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 295.1, 297.2; tR=3.58 min (XBridge 1).


Alkylated Diazepinones


The following intermediates were also prepared by the method described in Example 1, step 5:


2-Chloro-9-cyclopentyl-5,8-dimethyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


Rt=14.6 min (Vydac 1); MS+ve: 295.2.


2-Chloro-9-cyclopentyl-5,7-dimethyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 295.1, 297.2; tR=9.11 min (XBridge 2).


2-Chloro-9-cyclopentyl-8-isopropyl-5-methyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 323.1, 325.1; tR=10.17 min (XBridge 2).


2-Chloro-9-cyclopentyl-5-ethyl-7-methyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image



1H NMR (CDCl3): 1.08 (6H, m, 2×CH3), 1.38 (1H, m, CH), 1.55-1.70 (5H, m, CH+CH2), 1.70 (1H, m, CH), 2.10 (1H, m, CH), 2.73 (1H, m, CH), 3.48 (2H, m, CH2), 4.03 (1H, m, CH), 4.72 (1H, m, CH), 7.98 (1H, s, Pyr-H)


2-Chloro-9-(1-ethyl-propyl)-5-methyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 283.2, 285.1; tR=8.44 min (XBridge 2).


2-Chloro-9-(1-ethyl-propyl)-5-ethyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 297.12, 299.14; tR=3.67 min (XBridge 2).


2-Chloro-5-methyl-9-(tetrahydro-pyran-4-yl)-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 297.1, 299.2; tR=5.74 min (XBridge 2).


9-Benzyl-2-chloro-5-methyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 303.1, 305.2; tR=13.57 min (Vydac 1).


2-Chloro-5-methyl-9-phenyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 289.1, 291.1; tR=2.93 min (XBridge 2).


2-Chloro-9-cyclopentyl-5-methyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-7,1′-cyclopropan]-6-one



embedded image


MS (+ve) 307.1, 309.2; tR=167 min (XBridge 2).


2-Chloro-9-cyclopentyl-5,7,7-trimethyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


MS (+ve) 309.1, 311.2; tR=3.90 min (XBridge 2).


Coupled Pyrimidinediazepinones


The following were also prepared by the method described in Example 1, step 6, Coupling Method A:


Compound [3]: 4-(9-Cyclopentyl-8-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-benzoic acid



embedded image


Purple solid (29%) 1H NMR (DMSO-d6): δ 1.33 (d, J=Hz, 3H, CH3), 1.52-1.58 (m, 3H, cyclopent-H), 1.70-1.78 (m, 3H, cyclopent-H), 1.87-1.93 (m, 2H, cyclopent-H), 2.97-3.00 (m, 2H, CH2), 3.94 (s, 3H, CH3), 4.15-4.17 (m, 1H, CH), 4.93-4.97 (m, 1H, CH), 7.59-7.60 (m, 2H), 7.82 (1, 1H), 8.01 (d, J=9 Hz, 1H, phe-H), 9.55 (bs, 1H, OH), 9.96 (s, 1H); MS+ve: 426.2. Rt=11.08 min (purity 100%, (Vydac 1))


Compound [4]: 4-(9-Cyclopentyl-5,8-dimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-benzoic acid



embedded image


Purple solid (67%). 1H NMR (DMSO-d6): δ 1.26 (d, J=Hz, 3H, CH3), 1.43-1.93 (m, 8H, cyclopent-H), 2.52 (s, 3H, CH3), 2.99-3.02 (m, 2H, CH2), 3.96 (s, 3H, CH3), 4.13-4.16 (m, 1H, CH), 4.65-4.69 (m, 1H, CH), 7.60-7.61 (m, 2H), 8.06 (d, J=9 Hz, 1H, phe-H), 8.17 (s, 1H), 9.35 (bs, 1H); MS+ve: 426.2. Rt=11.59 min (purity 96%, (Vydac 1))


Compound [5]: 4-(9-Cyclohexyl-8-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-benzoic acid



embedded image


Brown solid (12%); 1H NMR (DMSO-d6): δ 1.27(d, J=6.5 Hz, 3H, CH3), 1.58-1.87 (m, 10H, cyclohex-H), 2.85-2.88 (m, 2H, CH2), 3.94 (s, 3H, CH3), 4.21-4.23 (m, 1H, CH), 4.77 (bs, 1H, CH), 7.03 (s, 1H), 7.13 (s, 1H), 7.23 (s, 1H), 7.57-7.58 (m, 2H), 7.086 (s, 1H), 8.07-8.08 (m, 1H), 9.89 (bs, 1H, NH); ME+ve: 426.2. Rt=11.58 min (purity 90%, (Vydac 1))


Compound [6]: 4-(9-Cyclopentyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-benzoic acid



embedded image


Purple solid (13%); 1H NMR (DMSO-d6): δ 1.55-1.86 (m, 8H, cyclopent-H), 2.70-2.73 (m, 2H, CH2), 3.70-3.72 (m, 2H, CH2), 5.02-5.09 (m, 1H, CH), 7.57-7.59 (m, 2H), 7.77 (s, 1H, pyrimid-H), 8.06 (d, J=8.5 Hz, 1H, phe-H), 9.54 (bs, 1H, OH), 9.75 (s, 1H, NH); MS+ve: 398.2. Rt=10.55 min (purity 96%, (Vydac 1))


Compound [7]: 4-(9-Cyclopentyl-8-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-benzoic acid



embedded image


Off-white solid (10%); 1H NMR (DMSO-d6): δ 1.27 (d, J=6.5 Hz, 3H, CH3), 1.46-1.90 (m, 8H, cyclopent-H), 2.83-2.86 (m, 2H, CH2), 4.07-4.09 (m, 1H, CH), 5.04-5.09 (m, 1H, CH), 7.20 (dd, J=3.5 and 8.5 Hz, 2H, phe-H), 7.79 (d, J=2.0 Hz, 1H, pyrimid-H), 7.86 (d, J=8.5 Hz, 2H, phe-H), 9.78 (bs, 1H, NH); MS+ve: 382.2. Rt=10.46 min (purity 90%, (Vydac 1))


Compound [8]: 4-(9-Cyclopentyl-5,8-dimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-benzoic acid



embedded image


Off-white solid (25%); 1H NMR (DMSO-d6): δ 1.19 (d, J=6.0 Hz, 3H, CH3), 1.32-2.10 (m, 8H, cyclopent-H), 2.73-2.76 (m, 2H, CH2), 3.22 (s, 3H, CH3), 4.04 (m, 1H, CH, 4.70-4.75 (m, 1H, CH, 7.38-7.85 (m, 4H, phe-H), 8.12 (s, 1H, pyrimid-H), 9.68 (bs, 1H, NH); MS+ve: 394.0. Rt=11.05 min (purity 96%, (Vydac 1))


Compound [9]: 4-(9-Cyclohexyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-benzoic acid



embedded image


Brown solid (15%); 1H NMR (DMSO-d6): δ 1.15-1.86 (m, 10H, cyclohex-H), 2.72 (dd, J=4.5 Hz, 2H, CH2), 3.75 (dd, J=4.5 Hz, 2H, CH2), 3.96 (s, 3H, CH3), 4.58-4.63 (m, 1H, CH), 7.58-7.60 (m, 2H), 7.79 (s, 1H, pyrimid-H), 8.16 (d, J=8.5 Hz, 1H, phe-H), 9.74 (bs, 1H, NH); MS+ve: 412.2. Rt=11.19 min (purity 100%, (Vydac 1))


Compound [10]: 9-Cyclohexyl-2-(4-hydroxy-phenylamino)-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


Purple solid (7%); 1H NMR (DMSO-d6): δ 1.17-1.87 (m, 10H, cyclohex-H), 2.72 (bs, 2H, CH2), 3.72 (bs, 2H, CH2), 4.62-4.66 (m, 1H, CH), 6.82 (d, J=8.5 Hz, 2H, phe-H), 7.13 (s, 1H), 7.23 (s, 1H), 7.34-7.37 (m, 3H, 2×phe-H and NH); MS+ve: 354.2. Rt=10.63 min (purity 100%, (Vydac 1))


Compound [11]: 9-Cyclopentyl-2-(4-hydroxy-phenylamino)-7-methyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image



1H NMR (CD3OD): 1.18 (3H, d, J 7 Hz, CH3), 1.52 (1H, m, CH), 1.61-1.84 (6H, m, CH), 1.99 (1H, m, CH), 2.85 (1H, m, CH), 3.53 (2H, m, CH), 5.14 (1H, m, CH), 6.74 (2H, m, Ar—H), 7.34 (2H, m, Ar—H), 7.64 (1H, s, Pyr-H) ; MS(+ve): 354.2; tR=10.85 min (Vydac 1).


Compound [12]: 9-Cyclopentyl-2-(4-hydroxy-phenylamino)-8-isopropyl-5-methyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image



1H NMR (DMSO):0.72 (3H, d, J 7 Hz, CHCH3), 0.85 (2H, d, J 7 Hz, CHCH3), 1.29 (1H, m, CH), 1.51 (4H, m, CH), 1.60 (2H, m, CH), 1.93 (1H, m, CH), 2.08 (1H, m, CH), 2.29 (2H, m, 2×CH), 3.13 (3H, s, N—CH3), 3.82 (1H, m, CH), 4.15 (1H, m, CH), 6.65 (2H, d, J 6 Hz, Ar—H), 7.47 (2H, d, J 6 Hz, Ar—H), 8.14 (1H, s, Pyr-H), 8.99 (1H, s, NH); MS(+ve): 396.1; tR=12.54 min (Vydac 1).


Compound [13]: 9-Cyclopentyl-2-(4-hydroxy-phenylamino)-5,8-dimethyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one



embedded image


White solid (27%); 1H NMR (DMSO-d6): δ 1.22 (d, J=6.5 Hz, 3H, CH3), 1.38-1.85 (m, 8H, cyclopent-H), 2.49-2.53 (m, 2H, CH2), 3.18 (s, 3H, CH3), 4.05-4.10 (m, 1H, CH), 4.51-4.60 (m, 1H, CH), 6.80 (d, J=9.0 Hz, 2H, phe-H), 7.22 (d, J=9.0 Hz, 2H, phe-H), 7.98 (s, 1H, pyrimid-H), 9.53 (bs, 1H, OH), 10.05 (bs, 1H, NH); MS+ve: 368.3 Rt=10.81 min (purity 93%, (Vydac 1))


Compound [14]: 4-(9-Benzyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-benzoic acid



embedded image



1H NMR (DMSO): 2.72 (2H, m, CH2), 3.68 (2H, m, CH2), 3.90 (3H, s, OCH3), 4.88 (2H, s, CH2), 7.22-7.44 (6H, m, Ar—H), 7.44 (1H, s, Ar—H), 7.77 (1H, s, Pyr-H), 8.10 (1H, d, J 7 Hz), 8.18 (1H, s, NH); MS(+ve): 434.2; tR=10.97 min (Vydac 1).


Compound [15]: 4-(5-Methyl-6-oxo-9-phenyl-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-benzoic acid



embedded image



1H NMR (DMSO): 2.84 (2H, m, CH2), 3.28 (3H, s, CH3), 4.08 (2H, m, CH2), 7.24 (2H, d, J 8.5 Hz, Ar—H), 7.35-7.37 (3H, m, Ar—H), 7.47-7.52 (4H, m, Ar—H), 8.29 (1H, s, Pyr-H), 9.77 (1H, s, NH); MS(+ve): 390.2; tR=1.93 min (XBridge 2).


Compound [16]: 4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-benzoic acid



embedded image



1H NMR (DMSO): 1.09 6H, s, CH3), 1.60 (4H, m, CH), 1.74 (2H, m, CH), 1.88 (2H, m, CH), 3.19 (3H, s, N—CH3), 3.37 (2H, s, CH2), 5.23 (1H, s, CH), 7.82 (4H, m, Ar—H), 7.99 (1H, s, Pyr-H), 9.57 (1H, s, NH); MS(+ve): 410.25; tR=2.25 min (XBridge 2).


Preparation and Reaction of Amino-Benzamides


4-Amino-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


To 4-amino-3-methoxybenzoic acid (1.064 g mg, 6.37 mmol) in dichloromethane (50 ml) was added DIPEA (2.22 ul, 12.74 mmol) and TBTU (2.25 g, 7.0 mmol) and the mixture stirred for 10 minutes. 4-amino-1-methylpiperidine (0.872 g, 7.65 mmol) was added and stirring continued for 16 hours. The resulting solid was filtered and dried under vacuum (1.04 g, 3.95 mmol, 62%).



1H NMR (DMSO): 1.54 (2H, m, CH), 1.68 (2H, m, CH), 1.90 (2H, m, CH), 2.15 (3H, s, N—CH3), 2.76 (2H, d, J 11.5 Hz, CH), 3.66 (1H, m, CH), 3.77 (3H, s, OCH3), 6.56 (1H, m, Ar—H), 7.26 (1H, m, Ar—H), 7.75 (1H, d, J 7.5 Hz); MS (+ve) 264.4; tR=7.45 min (Vydac 2).


The following amino-benzamides were prepared by a similar method:


4-Amino-N-(1-methyl-piperidin-4-yl)-benzamide Via [4-(1-Methyl-piperidin-4-ylcarbamoyl)-phenyl]-carbamic acid tert-butyl ester



embedded image


[4-(1-Methyl-piperidin-4-ylcarbamoyl)-phenyl]-carbamic acid tert-butyl ester 1H NMR (DMSO): 1.44 (9H, s, C(CH3)3), 1.52 (2H, m, CH), 1.71 (2H, m, CH), 1.92 (2H, m,


CH), 1.92 (3H, s, N—CH3), 2.74 (2H, m, CH), 3.68 (1H, m, N—CH), 7.47 (2H, d, J 8.5 Hz, Ar—H), 7.72 (2H, d, J 8.5 Hz, Ar—H), 8.00 (1H, d, J 7.5 Hz, NH), 9.54 (1H, s, NH) This compound was used without prior deprotection when using Coupling Method B (below)


Coupling Method B


Compound [17]: 4-(9-Cyclopentyl-5,7-dimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


The aniline (149 mg, 0.57 mmol), pyrimidine (53 mg, 0.19 mmol) and TFA (109 □l, 0.95 mmol) in 2,2,2-trifluoroethanol (5 ml) were heated to reflux for 18 hours. Solvent was evaporated, Ethyl acetate (10 ml) added, washed with sat. NaHCO3, brine and the solvent evaporated. Ethyl acetate (10 ml) was added and the resulting solid filtered and dried under vacuum (30 mg, 0.06 mmol, 30%).



1H NMR (DMSO): 1.06 (3H, d, J 7 Hz, CHCH3), 1.52-1.78 (10H, m, alkyl CH+CH2), 2.01 (2H, m, CH), 2.36 (3H, s, N—CH3), 2.73 (1H, m, CH), 2.85 (2H, m, CH), 3.45 (1H, m, CH), 3.71 (1H, m, CH), 3.94 (3H, s, OCH3), 5.06 (1H, m, CH), 7.46 (2H, m, Ar_h), 7.61 (1H, s, Ar—H), 7.77 (1H, s, NH), 8.10 (1H, d, J 8 Hz, Ar—H), 8.36 (1H, d, J 8 Hz), Ar—H), 9.44 (1H, s, NH); MS(+ve): 508.2; tR=7.30 min (XBridge 2).


The following compounds were prepared in a similar manner to the above example:


Compound [18]: 4-(9-Cyclopentyl-7-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (DMSO):1.08 (3H, d, J 7 Hz, CHCH3), 1.53-1.80 (10H, m, alkyl CH+CH2), 2.01 (2H, m, CH), 2.12 (2H, m, CH), 2.29 (3H, s, N—CH3), 2.75 (1H, m, CH), 2.90 (2H, m, CH), 3.48 (1H, m, CH), 3.77 (1H, m, CH), 5.11 (1H, m, CH), 7.78 (4H, m, Ar—H), 8.04 (1H, d, J=7.5 Hz, NH), 9.35 (1H, s, CONH), 9.43 (1H, s, CONH); MS(+ve): 478.2; tR=6.74 min (XBridge 2).


Compound [19]: 4-(9-Cyclopentyl-8-isopropyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (CD3OD): 0.92 (3H, d, J=6.5 Hz, CHCH3), 1.04 (3H, d, J=6 Hz, CHCH3), 1.65-1.97 (14H, m, alkyl CH+CH2), 2.25 (2H, dd, J 11.5 Hz, 11.5 Hz, CH), 2.36 (3H, s, N—CH3), 2.67 (1H, m, CH), 3.03 (3H, m, CH+CH2), 3.51 (1H, m, CH), 3.95 (1H, m, CH), 4.02 (3H, s, OCH3), 5.09 (1H, m, CH), 7.59 (2H, m, Ar—H), 7.87 (1H, s, pyr-H—H), 8.46 (1H, d, J 7 Hz, Ar—H); MS(+ve): 536.3; tR=7.68 min (XBridge 2).


Compound [20]: 4-(9-Cyclopentyl-5,7-dimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (DMSO): 1.02 (3H, d, J 6.5 Hz, CHCH3), 1.54-1.80 (12H, m, alkyl CH+CH2), 2.10 (3H, m, (CH+CH2), 2.27 (3H, s, N—CH3), 2.84 (3H, m, CH3), 3.15 (3H, s, CH3), 3.46 (1H, m, CH), 3.80 (1H, m, N—CH), 3.95 (3H, s, OCH3), 4.76 (1H, m, CH), 7.50 (2H, m, Ar—H), 7.75 (1H, s, Ar—H), 8.10 (1H, s, NH), 8.14 (1H, d, J 7.5 Hz, Ar—H), 8.40 (1H, d, J 8 Hz, Ar—H); MS(+ve): 522.3; tR=7.76 min (XBridge 2).


Compound [21]: 4-[9-(1-Ethyl-propyl)-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (DMSO):0.85 (6H, d, J 7 Hz, CH2CH3), 1.59 (4H, m, CH2CH3), 1.66 (2H, m, CH), 1.83 (2H, m, CH), 2.37 (3H, s, N—CH3), 2.65 (2H, m, CH2), 2.98 (2H, m, CH), 3.50 (2H, m, CH2), 3.83 (1H, m, N—CH), 3.94 (3H, s, OCH3), 4.93 (1H, s, CH), 4.49(2H, m, Ar—H+NH), 7.57 (1H, s, NH), 7.79 (1H, s, Ar—H), 8.15 (1H, d, J 6.5 Hz, Ar—H), 8.37 (1H, d, J=8.5 Hz, Ar—H), 9.41 (1H, s, NH); MS(+ve): 496.2; tR=6.73 min (XBridge 2).


Compound [22]: 4-[9-(1-Ethyl-propyl)-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (DMSO): 0.86 (6H, d, J 7 Hz, CH2CH3), 1.56 (4H, m, CH2CH3), 1.62 (2H, m, CH), 1.76 (2H, m, CH), 2.52 (3H, s, N—CH3), 2.63 (2H, m, CH2), 3.22 (2H, m, CH), 3.49 (2H, m, CH2), 3.92 (1H, m, CH), 4.97 (1H, m, CH), 7.78 (4H, m, Ar—H), 8.15 (1H, s, Pyr-H), 9.31 (1H, s, NH), 9.39 (1H, s, NH); MS(+ve): 466.3; tR=6.26 min (XBridge 2).


Compound [23]: 4-(9-Cyclopentyl-8-isopropyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (CD3OD): 0.83 (3H, d, J 7 Hz, CHCH3), 0.93 (3H, d, J=7 Hz, CHCH3), 1.41 (2H, m, CH), 1.65 (4H, m, CH), 1.79 (2H, M, CH), 1.91 (2H, m, CH), 2.17 (2H, m, CH), 2.41 (2H, m, 2×CH), 2.71 (4H, m, CH3+CH), 2.91 (2H, m, CH), 3.35 (3H, s, CH3), 3.90 (1H, m, CH), 3.94 (3H, s, OCH3), 4.21 (1H, m, CH), 4.27 (1H, m, CH), 7.18 (2H, m, Ar—H), 8.23 (1H, s, Pyr-H), 8.56 (1H, d, J 8.5 Hz, Ar—H); MS(+ve): 550.3; tR=8.40 min (XBridge 2).


Compound [24]: 4-[9-(1-Ethyl-propyl)-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (DMSO): 0.85 (6H, t, J 7.5, CH2CH3), 1.62 (8H, m, CH+CH2), 1.76 (2H, d, J 7 Hz, CH), 1.94 (2H, dd, J 10 Hz, 10 Hz, CH), 2.17 (3H, s, N—CH3), 2.64 (2H, m, CH2), 2.80 (2H, d, J 11 Hz, CH), 3.18 (3H, s, N—CH3), 3.49 (2H, m, CH2), 3.75 (1H, m, CH), 3.95 (3H, s, OCH3), 4.65 (1H, m, CH), 7.49 (2H, m, Ar—H), 7.69 (1H, s, Pyr-H), 8.07 (1H, s, NH), 8.10 (1H, d, J 9 Hz, Ar—H), 8.37 (1H, d, J 9 Hz, Ar—H); MS(+ve): 510.3; tR=8.35 min (XBridge 2).


Compound [25]: 3-Methoxy-N-(1-methyl-piperidin-4-yl)-4-[6-oxo-9-(tetrahydro-pyran-4-yl)-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]-benzamide



embedded image



1H NMR (CD3OD): 1.60 (2H, m, CH), 1.69 (2H, d, J 11 Hz, CH), 1.93 (2H, d, J 12 Hz, CH), 1.97 (2H, dd, J 12 Hz, 12 Hz, CH), 2.18 (3H, s, N—CH3), 2.61 (2H, m, CH2), 2.80 (2H, d, J 10.5 Hz, CH), 3.48 (2H, dd, J 11 Hz, CH), 3.62 (2H, m, CH2), 3.75 (1H, m, CH), 3.95 (3H, s, OCH3), 4.04 (2H, d, J 8 Hz, CH), 4.85 (1H, s, CH), 7.49 (2H, m, Ar—H), 7.66 (1H, s, NH), 7.81 (1H, s, Pyr-H), 8.11 (1H, d, J=7.5 Hz, Ar—H), 8.33 (1H, d, J 8 Hz, Ar—H), 9.45 (1H, s, NH); MS(+ve): 510.1; tR=5.34 min (XBridge 2).


Compound [26]: 3-Methoxy-4-[5-methyl-6-oxo-9-(tetrahydro-pyran-4-yl)-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (CD3OD): 1.73 (2H, ddd, J 3 Hz, 12 Hz, 18 Hz, CH), 1.84 (2H, d, J 11 Hz, CH), 1.98 (4H, m, alkyl CH), 2.19 (2H, dd, J 10.5 Hz, 10.5 Hz, CH), 2.33 (3H, s, N—CH3), 2.71 (2H, m, CH2), 2.97 (2H, d, J 12 Hz, CH), 3.65 (2H, dd, J 11 Hz, CH), 3.75 (2H, m, CH2), 3.92 (1H, m, CH), 4.02 (3H, s, OCH3), 4.12 (1H, dd, J 4 Hz, 11 Hz, CH), 4.78 (1H, m, CH), 7.53 (2H, m, Ar—H), 8.04 (1H, s, Pyr-H), 8.45 (1H, d, J 9 Hz, Ar—H); MS(+ve): 524.3; tR=5.71 min (XBridge 2).


Compound [27]: 4-[5-Ethyl-9-(1-ethyl-propyl)-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (DMSO): 0.86 (6H, t, J 7.5 Hz, CH3), 0.94 (3H, d, J 7 Hz, CH3), 1.63 (6H, m, alkyl CH+CH2), 1.78 (2H, d, J 11 Hz, CH), 1.94 (2H, dd, J 11.5 Hz, CH), 2.18 (3H, s, N—CH3), 2.57 (2H, m, CH2), 2.80 (2H, m, CH2), 3.47 (2H, m, CH2), 3.77 (3H, m, CH+CH2), 3.96 (3H, s, OCH3), 4.59 (1H, m, CH), 7.50 (2H, m, Ar—H), 7.24 (1H, s, NH), 8.01 (2H, m, Ar—H+Pyr-H), 8.39 (1H, d, J 9 Hz, Ar—H); MS(+ve): 524.3; tR=7.56 min (XBridge 2).


Compound [29]: 4-(9-Benzyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H-NMR (DMSO): 1.58 (2H, ddd, J 4 Hz, 12.5 Hz, 24.5 Hz, CH), 1.73 (2H, d, J11.5 Hz, CH), 1.93 (2H, dd, J 15 Hz, CH), 2.17 (3H, s, N—CH3), 2.69 (2H, m, CH2), 2.78 (2H, d, J 11.5 Hz, CH), 3.22 (3H, s, N—CH3), 3.63 (2H, m, CH2), 3.72 (1H, m, CH), 3.91 (3H, s, OCH3), 4.87 (2H, s, CH2), 7.23-7.32 (4H, m, Ar—H), 7.35-7.43 (2H, m, Ar—H), 7.44 (1H, d, J 2 Hz, Ar—H), 7.72 (1H, s, Pyr-H), 8.04 (1H, d, J 7.5 Hz, Ar—H), 8.12 (1H, d, J 8.5 Hz), 8.16 (1H, s, NH); MS(+ve): 530.4; tR=4.55 min (XBridge 2).


Compound [30]: 3-Methoxy-4-(5-methyl-6-oxo-9-phenyl-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (DMSO): 1.56 (2H, dd, J 11.5 Hz, 20.5 Hz, CH), 1.75 (2H, d, J 10 Hz, CH), 1.95 (2H, m, CH), 2.18 (3H, s, N—CH3), 2.83 (3H, m, CH+CH2), 3.16 (1H, s, CH), 3.27 (3H, s, N—CH3), 3.71 (1H, m, N—CH), 3.88 (3H, s, OCH3), 4.06 (2H, m, CH2); MS(+ve): 516.3; tR=2.72 min (XBridge 2).


Compound [31]: 4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-spiro[pyrimido[4,5-b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)-N-(1-methyl-piperidin-4yl)-benzamide



embedded image



1H NMR (DMSO): 0.66 (2H, d, J 6 Hz, cyclopropyl-CH), 0.91 (2H, d, J 6 Hz, cyclopropyl-CH), 1.50 (2H, m, CH), 1.58 (4H, m, CH), 1.69 (2H, m, CH), 1.77 (2H, m, CH), 1.95 (4H, m, CH), 2.16 (3H, s, N—CH3), 2.73 (1H, s, CH), 2.79 (2H, d, J 11 Hz, CH), 2.89 (1H, s, CH), 3.16 (3H, s, N—CH3), 3.47 (2H, s, CH2), 3.72 (1H, m, CH), 3.94 (3H, s, OCH3), 4.86 (1H, m, CH), 7.46 (2H, m, Ar—H), 7.67 (1H, s, NH), 7.95 (1H, s, Pyr-H), 8.07 (1H, d, J 8 Hz, Ar—H), 8.38 (1H, d, J 8 Hz, Ar—H); MS(+ve): 534.3; tR=3.05 min (XBridge 2).


Compound [32]: 4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image



1H NMR (DMSO): 1.09 6H, s, CH3), 1.58 (6H, m, CH2), 1.74 (4H, m, CJ), 1.95 (4H, m, CH), 2.16 (3H, s, NCH3), 2.73 (2H, d, J 11.5 Hz, CH), 3.18 (3H, s, NCH3), 3.37 (2H, s, CH2), 3.74 (1H, m, CH), 3.94 (3H, s, OCH3), 5.19 (1H, m, CH), 7.46 (2H, m, Ar—H), 7.67 (1H, s, NH), 7.98 (1H, s, Pyr-H), 8.07 ˜(1H, d, J=8 Hz, Ar—H), 8.36 (1H, d, J 8 Hz); MS(+ve): 536.40; tR=3.32 min (XBridge 2).


Amide Couplings


The following were also prepared by the method described in Example 1, step 7:


Compound [33]: 4-(9-Cyclopentyl-5,8-dimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


Yellow solid (31%). 1H NMR (CD3OD): δ 1.24 (d, J=6.5 Hz, 3H, CH3), 1.36-2.17 (m, 16H, 8×cyclopent-H and 4×piperid-H), 2.51 (s, 3H, CH3), 3.14-3.16 (m, 2H, CH2), 3.28 (s, 3H, CH3), 4.00 (s, 3H, CH3), 4.04-4.06 (m, 1H, CH), 4.71-4.74 (m, 1H, CH), 7.49-7.52 (m, 2H), 7.99 (s, 1H), 8.41 (d, J=8.5 Hz, 1H, phe-H); MS+ve: 522.4. Rt=10.03 min (purity 97%, Vydac 1)


Compound [34]: 4-(9-Cyclopentyl-8-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


Yellow solid (38%); MS+ve: 508.3. Rt=9.53 min (purity 97%, Vydac 1)


Compound [35]: 4-(9-Cyclohexyl-8-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


Off-white solid (33%); 1H NMR (CD3OD): δ 1.34-1.41 (m, 2H), 1.44 (d, J=6.5 Hz, 3H, CH3), 1.60-1.99 (m, 8H), 2.22-2.26 (m, 2H), 2.73-2.77 (m, 1H), 2.91 (s, 3H, CH3), 2.96-3.25 (m, 5H), 3.61-3.63 (m, 2H, CH2), 4.01 (s, 3H, CH3), 4.17-4.21 (m, 1H, CH), 4.33-4.36 (m, 1H, CH), 7.59 (dd, J=2.0 and 8.5 Hz, 1H, phe-H), 7.63 (d, J=2.0 Hz, 1H, phe-H), 7.69 (s, 1H, pyrimid-H), 8.00 (d, J=8.5 Hz, 1H, phe-H); MS+ve: 522.2. Rt=10.17 min (purity 100%, Vydac 1)


Compound [36]: 4-(9-Cyclopentyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


Purple solid (40%); 1H NMR (CD3OD): δ 1.65-2.25 (m, 8H, cyclopent-H), 2.34 (s, 3H, CH3), 2.73-2.75 (m, 2H, CH2), 3.69-3.71 (m, 2H, CH2), 3.90-3.94 (m, 1H, CH), 4.01 (s, 3H, CH3), 5.22-5.25 (m, 1H, CH), 7.48-7.51 (m, 2H, 2×phe-H), 7.76 (s, 1H, pyrimid-H), 8.47 (s, 1H, NH); MS+ve: 493.4. Rt=9.21 min (purity 92%, Vydac 1)


Compound [37]: 4-(9-Cyclopentyl-5,8-dimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


Off-white solid (45%); 1H NMR (DMSO-d6): δ 1.17 (d, J=6.0 Hz, 3H, CH3), 1.29-2.10 (m, 16H, 8×cyclopent-H and 8×piperid-H), 2.21 (bs, 3H, CH3), 2.81-2.83 (m, 2H, CH2), 3.21 (s, 3H, CH3), 3.73-3.76 (m, 1H, CH), 4.03-4.05 (m, 1H, CH, 4.68-4.72 (m, 1H, CH), 7.74-7.79 (m, 4H, phe-H), 8.11 (s, 1H, pyrimid-H), 9.47 (bs, 1H, NH); MS+ve: 492.3. Rt=9.70 min (purity 92%, Vydac 1)


Compound [38]: 4-(9-Cyclopentyl-8-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


Off-white solid (15%); 1H NMR (DMSO-d6): δ 1.25 (d, J=7.0 Hz, 3H, CH3), 1.51-2.04 (m, 10H), 2.09 (s, 3H, CH3), 2.55-2.66 (m, 6H), 2.78-2.79 (m, 2H, CH2), 3.05-3.15 (m, 1H, CH), 3.95-4.04 (m, 1H, CH), 5.13-5.15 (m, 1H, CH), 7.75 (dd, J=8.5 Hz, 4H, phe-H), 7.81 (s, 1H, pyrimid-H), 8.24 (d, J=7 Hz, 1H, NH), 9.48 (s, 1H, NH), 9.66 (bs, 1H, NH); MS+ve: 478.3. Rt=9.28 min (purity 100%, Vydac 1)


Compound [39]: 4-(9-Cyclohexyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)-benzamide



embedded image


Off-white solid (19%); 1H NMR (DMSO-d6): δ 1.16-1.98 (m, 18H, 10×cyclohex-H) and 8×piperid-H), 2.18 (s, 3H, CH3), 2.60 (dd, J=5 Hz, 2H, CH2), 3.60 (dd, J=5 Hz, 2H, CH2), 3.73-3.76 (m, 1H, CH), 3.95 (s, 3H, CH3), 4.58-4.63 (m, 1H, CH), 7.46 (dd, J=2.0 and 8.0 Hz, 1H, phe-H), 7.49 (d, J=2 Hz, 1H, phe-H), 7.60 (s, 1H), 7.78 (s, 1H), 8.10 (d, J=8.0 Hz, 1H, NH), 8.37 (d, J=8.0 Hz, 1H, phe-H), 9.41 (bs, 1H, NH); MS+ve: 508.4. Rt=9.70 min (purity 95%, Vydac 1)


Example 2

General Experimental


Analytical and preparative RP-HPLC-MS was performed using Waters XBridge (50×4.6 mm C18 3.5 μm or 100×4.6 mm C18 3.5 μm) and XBridge (100×19 mm C18 5 μm) columns using a linear gradient of solvent A (water containing 0.1% ammonium hydroxide and 5% acetonitrile)/solvent B (acetonitrile) systems. Preparative RP-HPLC was performed using Apex Prepsil ODS 10μ column (22×250 mm) using a linear gradient of solvent A (water containing 0.1% TFA)/solvent B (acetonitrile). Mass spectra were obtained using a Waters ZQ2000 single quadrupole mass spectrometer with electro spray ionisation (ESI).


Gradients used were as follows:
















Flow rate
% solvent B


















Mode
Method
Column
mL/min
0 min
0.5 min
4 min
6 min
8.5 min
10 min
12 min
40 min





















Analytical
Analytical_1
4.6 × 50  
1.6
10

100
100






Analytical
Analytical_2
4.6 × 100 
1
10




50
100


Analytical
Analytical_3
4.6 × 100 
1


Preparative
Preparative_1
19 × 100
20
10
10


100

100


Preparative
Preparative_2
19 × 100
20
30
30


80

100


Preparative
Preparative_3
19 × 100
20
10
10


55

100


Preparative
Preparative_4
22 × 250
9
0






60


Preparative
Preparative_5
19 × 100
20
55
55


100

100









Intermediate 1: 2-chloro-9-cyclopentyl-5-methyl-8,9-dihydro-5H-pyrimido[4,5-b][1,4]diazepin-6(7H)-one



embedded image


1. Thionyl chloride (2.1 eq), MeOH, 0° C. for addition, reflux 2 h; 2. Cyclopentanone (0.77 eq), sodium acetate (0.77 eq), sodium triacetoxyborohydride (1.11 eq), DCM, rt 16 h; 3. 2,4-Dichloro-5-nitropyrimidine (1.1 eq), K2CO3 (1 eq), acetone, 0° C.-rt 16 h; 4. NH4Cl (8.5 eq), Fe (8 eq), EtOH/H2O (4:1), reflux 2.5 h; 5. MeI (1.18 eq), NaH (1.07 eq), DMF, −10° C.-rt, 3 h.


Step 1: Methyl 3-aminopropanoate

β-Alanine (9.37 g, 0.105 mol, 1.0 eq), was added to MeOH (50 mL) and the mixture cooled to 0° C. before the dropwise addition of thionyl chloride (16 mL, 0.221 mol, 2.1 eq) [caution: exothermic addition]. The reaction was allowed to warm to rt then heated at reflux for 2 h. The solution was concentrated in vacuo, treated with t-butylmethyl ester and the resulting crystals removed by filtration. The product was a white crystalline solid (11 g, 100%); 1H (DMSO-d6): δ 2.73 (2H, dd, J=7 Hz, CH2), 2.98 (2H, dd, J=7 Hz, CH2), 3.61 (3H, s, CH3), 8.28 (2H, bs, NH2); MS+ve: 104.1.


Step 2: Methyl 3-(cyclopentylamino)propanoate

Methyl 3-aminopropanoate (9.37 g, 0.09 mol) was dissolved in DCM (200 mL). Cyclopentanone (6.43 mL, 0.07 mol, 0.77 eq), sodium acetate (5.96 g, 0.07 mol, 0.77 eq) and sodium triacetoxyborohydride (22 g, 0.10 mol, 1.11 eq) were added then the reaction was stirred at rt for 16 h. 20% Sodium bicarbonate (100 mL) and 2 M sodium hydroxide (50 mL) were added and the product extracted using DCM/H2O. The organic extracts were combined, washed with sat. NaCl, dried (MgSO4) and evaporated under reduced pressure to give the product as a pale yellow oil (8.90 g, 55%); MS+ve: 172.4.


Step 3: Methyl 3-[cyclopentyl(2-chloro-5-nitropyrimidin-4-yl)amino]propanoate

Methyl 3-(cyclopentylamino)propanoate (0.838 g, 0.005 mol, 1 eq) and K2CO3 (0.676 g, 0.005 mol, 1 eq) were added to acetone (5 mL) and the resulting mixture cooled to 0° C. before the dropwise addition of 2,4-dichloro-5-nitropyrimidine (1.04 g, 0.0055 mol, 1.1 eq). The reaction mixture (RM) was warmed to rt and stirring continued for an additional 16 h before the addition of a further 0.12 eq of the pyrimidine. Stirring continued for a further 3 h. The RM was evaporated under reduced pressure and the product extracted using EtOAc/H2O. The organic extracts were washed with sat NaCl, dried (MgSO4) and evaporated under reduced pressure to give the product as a brown oily residue (1.04 g, 65%); MS+ve: 329.2; Rt=3.78 min (Analytical1).


Step 4: 2-Chloro-9-cyclopentyl-5,7,8,9-tetrahydro-6H-pyrimido[4,5-b][1,4]diazepin-6-one

Methyl 3-[cyclopentyl(2-chloro-5-nitropyrimidin-4-yl)amino]propanoate (1.0 g, 0.003 mol, 1 eq) and NH4Cl (1.38 g, 0.025 mol, 8.5 eq) were added to EtOH/H2O (4:1 , 10 mL) and the mixture heated to reflux. Iron powder (1.36 g, 0.024 mol, 8 eq) was added portionwise and after 2 h the RM was hot filtered through celite washing through with EtOAc (10 mL) and EtOH (10 mL) [both hot]. The solvent was evaporated under reduced pressure to give the product as a brown solid (0.35 g, 43%); 1H (DMSO-d6): δ 1.55 (4H, m, 2CH2), 1.7 (2H, m, CH2), 1.83 (2H, m, CH2), 2.66 (2H, t, J=5 Hz, CH2), 3.57 (2H, t, J=5 Hz, CH2), 5.01 (1H, m, CH), 7.83 (1H, s, CH), 9.71 (1H, s, NH); MS+ve: 267.2; Rt=2.87 min (Analytical1).


Step 5: 2-chloro-9-cyclopentyl-5-methyl-8,9-dihydro-5H-pyrimido[4,5-b][1,4]diazepin-6(7H)-one

2-Chloro-9-cyclopentyl-5,7,8,9-tetrahydro-6H-pyrimido[4,5-b][1,4]diazepin-6-one (0.318 g, 0.0012 mol) and MeI (0.088 mL, 0.0014 mol, 1.18 eq) were added to DMF (5 mL) and the solution cooled to −10° C. NaH (0.03 g, 0.0013 mol, 1.07 eq) was added and the RM was stirred at 0° C. for 30 min and rt for 30 min. The solvent was evaporated under reduced pressure and the product extracted using EtOAc/H2O. The organic extracts were combined, washed with sat NaCl, dried (MgSO4) and evaporated under reduced pressure to give the product as a purple oily residue (0.25 g, 75%); 1H (DMSO-d6): δ 1.55 (4H, m, 2CH2), 1.7 (2H, m, CH2), 1.9 (2H, m, CH2), 2.63 (2H, t, J=5 Hz, CH2), 3.17 (3H, s, CH3), 3.65 (2H, t, J=5 Hz, CH2), 4.74 (1H, m, CH), 8.14 (1H, s, CH); MS+ve: 281.2; Rt=3.11 min (Analytical1).


Using similar methods to those described above for Intermediate 1, the following intermediates 2-4 were prepared:


Intermediate 2: 2′-Chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one

Reaction of 1-aminomethyl-cyclopropanecarboxylic acid ethyl ester with cyclopentanone, sodium acetate and sodium triacetoxyborohydride in DCM gave 1-cyclopentylaminomethyl-cyclopropanecarboxylic acid ethyl ester




embedded image



1H NMR (CDCl3): 0.84 (3H, t, J 7 Hz, CH3), 1.25 (4H, m, CH2), 1.37 (2H, m, CH), 1.54 (2H, m, CH), 1.70 (2H, m, CH), 1.83 (2H, m, CH), 2.71 (2H, s, CH2), 3.10 (1H, m, CH), 4.16 (2H, q, J 7 Hz, CH2CH3)


Reaction of 1-cyclopentylaminomethyl-cyclopropanecarboxylic acid methyl ester with 2,4-dichloro-5-nitropyrimidine and K2CO3 in acetone gave 1-{[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-methyl}cyclopropanecarboxylic acid ethyl ester. Treatment with NH4Cl and iron powder in ethanol gave 1-{[(5-Amino-2-chloro-pyrimidin-4-yl)-cyclopentyl-amino]-methyl}-cyclopropanecarboxylic acid ethyl ester




embedded image


MS (+ve): 339.2, 341.2; Rt=4.15 min (Analytical2).


The above compound in DMF was heated to 140° C. for 2 hours. Solvent was evaporated in vacuo, ethyl acetate added, and the resulting solid filtered and dried under vacuum to give 2′-chloro-9′-cyclopentyl-8′,9′-dihydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one




embedded image


MS (+ve): 293.2, 295.2; Rt=3.48 min (Analytical2).


Reaction of 2-chloro-9-cyclopentyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-7,1′-cyclopropan]-6-one with MeI and NaH in DMF gave 2′-chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one




embedded image


MS (+ve): 307.1, 309.2; Rt=3.67 min (Analytical3).


Intermediate 3: 2-chloro-9-cyclopentyl-5,7,7-trimethyl-8,9-dihydro-5H-pyrimido[4,5-b][1,4]diazepin-6(7H)-one

Reaction of 3-amino-2,2-dimethyl-propionic acid ethyl ester with cyclopentanone, sodium acetate and sodium triacetoxyborohydride in DCM gave 3-Cyclopentylamino-2,2-dimethyl-propionic acid ethyl ester




embedded image



1H NMR (CDCl3): 1.19 (6H, s, CH3), 1.25 (3H, t, J 7 Hz, CH3), 1.28 (2H, m, CH), 1.49 (2H, m, CH), 1.65 (2H, m, CH), 2.64 (1H, s, CH2), 3.01 (1H, m, CH), 4.10 (2H, q, J 7.5 Hz, CH2)


Reaction of 3-cyclopentylamino-2,2-dimethyl-propionic acid ethyl ester with 2,4-dichloro-5-nitropyrimidine and K2CO3 in acetone gave 3-[(2-Chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-2,2-dimethyl-propionic acid ethyl ester




embedded image


MS (+ve): 371.1, 373.1; Rt=4.67 min (Analytical2).


Reaction of 3-[(2-chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-2,2-dimethyl-propionic acid ethyl ester with NH4Cl and iron powder in ethanol gave 3-[(5-Amino-2-chloro-pyrimidin-4-yl)-cyclopentyl-amino]-2,2-dimethyl-propionic acid ethyl ester




embedded image


MS (+ve): 341.2, 343.2; Rt=4.25 min (Analytical2).


3-[(5-Amino-2-chloro-pyrimidin-4-yl)-cyclopentyl-amino]-2,2-dimethyl-propionic acid ethyl ester in DMF was heated to 140° C. for 2 hours. Solvent was evaporated in vacuo, ethyl acetate added, and the resulting solid filtered and dried under vacuum to give 2-Chloro-9-cyclopentyl-7,7-dimethyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one




embedded image


MS (+ve): 295.1, 297.2; Rt=3.58 min (Analytical2).


Reaction of 2-chloro-9-cyclopentyl-7,7-dimethyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one with MeI and NaH in DMF gave 2-chloro-9-cyclopentyl-5,7,7-trimethyl-8,9-dihydro-5H-pyrimido[4,5-b][1,4]diazepin-6(7H)-one




embedded image


MS (+ve): 309.1, 311.2; Rt=3.90 min (Analytical3).


Intermediate 4: 2′-chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one

Reaction of 1-aminomethyl-cyclobutanecarboxylic acid methyl ester with cyclopentanone, sodium acetate and sodium triacetoxyborohydride in DCM gave 1-cyclopentylaminomethyl-cyclobutanecarboxylic acid methyl ester




embedded image



1H NMR (CDCl3): 1.36 (2H, m, CH2), 1.51 (2H, m, CH2), 1.66 (2H, m, CH2), 1.95 (4H, m, 2×CH2), 2.15 (2H, m, CH2), 2.43 (4H, m, 2×CH2), 2.93 (2H, s, CH2), 3.21 (1H, m, CH), 3.76 (3H, s, CH3)


Reaction of 1-cyclopentylaminomethyl-cyclobutanecarboxylic acid methyl ester with 2,4-dichloro-5-nitropyrimidine and K2CO3 in acetone gave 1-{[(2-chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-methyl}-cyclobutanecarboxylic acid methyl ester




embedded image


MS(+ve):369.2, 371.2; Rt=3.48 min (Analytical1).


Reaction of 1-{[(2-chloro-5-nitro-pyrimidin-4-yl)-cyclopentyl-amino]-methyl}-cyclobutanecarboxylic acid methyl ester with NH4Cl and iron powder in ethanol gave 2′-chloro-9′-cyclopentyl-8′,9′-dihydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one, isolated directly.




embedded image


MS(+ve): 307.2, 309.2; Rt=3.48 min (Analytical1).


Reaction of 2-chloro-9-cyclopentyl-5,7,8,9-tetrahydro-pyrimido[4,5-b][1,4]diazepin-7,1′-cyclobutan]-6-one with MeI and NaH in DMF gave 2′-chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one




embedded image


MS(+ve): 321.2, 323.3; Rt=3.77 min (Analytical1).


Intermediate 5: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid

2′-Chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one (Intermediate 2) (0.70 g, 2.5 mmol, 1 eq), 4-amino-3-methoxybenzoic acid (1.25 g, 7.5 mmol, 3 eq) and TFA (1.43 g, 12.5 mmol, 5 eq) were heated to reflux in TFE (25 mL) for 18 hours. Solvent was evaporated in vacuo and the resulting residue was triturated with MeOH to give 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (0.81 g, 74%).




embedded image


Rt=1.88 min (Analytical1) MS(+ve): 438.4, MS (−ve): 436.5.


Intermediate 6: 4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxybenzoic acid

2-Chloro-9-cyclopentyl-5,7,7-trimethyl-8,9-dihydro-5H-pyrimido[4,5-b][1,4]diazepin-6(7H)-one (Intermediate 3) (0.35 g, 1.14 mmol, 1 eq), 4-amino-3-methoxybenzoic acid (0.57 g, 3.42 mmol, 3 eq) and TFA (0.42 mL, 5.7 mmol, 5 eq) were heated to reflux in TFE (10 mL) for 36 hours. Solvent was evaporated in vacuo and the resulting residue was triturated with EtOAc to give 4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxybenzoic acid (0.38 g, 76%).




embedded image


MS(+ve): 440.3, MS(−ve): 438.5.


Intermediate 7: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4diazepine]-2′-ylamino)-3-methoxybenzoic acid

2′-Chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one (Intermediate 4) (1.02 g, 3.18 mmol, 1 eq), 4-amino-3-methoxybenzoic acid (1.6 g, 9.5 mmol, 3 eq) and TFA (1.2 mL, 15.9 mmol, 5 eq) were heated to reflux in TFE (40 mL) for 24 hours. Solvent was evaporated in vacuo and the resulting residue was triturated with EtOAc to give 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (1.08 g, 75%).




embedded image


Rt=2.10 min (Analytical1); MS(+ve): 452.3, MS (−ve): 450.4.


Intermediate 8: 4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxybenzoic acid

2-Chloro-9-cyclopentyl-5-methyl-8,9-dihydro-5H-pyrimido[4,5-b][1,4]diazepin-6(7H)-one (Intermediate 1) (0.70 g, 2.5 mmol, 1 eq), 4-amino-3-methoxybenzoic acid (1.25 g, 7.5 mmol, 3 eq) and TFA (0.93 mL, 12.5 mmol, 5 eq) were heated to reflux in TFE (25 mL) for 20 hours. Solvent was evaporated in vacuo and the resulting residue was triturated with MeOH to give 4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxybenzoic acid (0.66 g, 64%).




embedded image


Rt=1.88 min (Analytical1); MS(+ve): 412.4, MS (−ve): 410.5.


Intermediate 9: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluorobenzoic acid

2′-Chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one (Intermediate 2) (0.42 g, 1.36 mmol, 1 eq), 4-amino-3-fluorobenzoic acid (0.63 g, 4.1 mmol, 3 eq) and TFA (0.51 mL, 6.8 mmol, 5 eq) were heated to reflux in TFE (10 mL) for 36 hours. Further 4-amino-3-fluorobenzoic acid (0.63 g, 4.1 mmol, 3 eq) and TFA (0.51 mL, 6.8 mmol, 5 eq) were added and the reaction was heated to reflux again for 4 days. Solvent was evaporated in vacuo and the resulting residue was triturated with EtOAc to give 4-(9-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluorobenzoic acid (0.41 g, 71%).




embedded image


Rt=1.93 min (Analytical1); MS(+ve): 426.3


Intermediate 10: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluorobenzoic acid

2′-Chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one (Intermediate 4) (0.20 g, 0.63 mmol, 1 eq), 4-amino-3-fluorobenzoic acid (0.30 g, 1.9 mmol, 3 eq) and TFA (0.24 mL, 3.2 mmol, 5 eq) were heated to reflux in TFE for 18 hours. Further 4-amino-3-fluorobenzoic acid (0.20 g) and TFA (0.1 mL) were added and the reaction was heated to reflux again for 2 days. Further TFA (0.24 mL) was added and the reaction was heated to reflux again for 3 days. Solvent was evaporated in vacuo and the resulting residue was triturated with EtOAc to give 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluorobenzoic acid (0.15 g, 55%).




embedded image


Rt=2.02 min (Analytical1); MS(+ve): 440.3; MS(−ve): 438.4


Intermediate 11: 4-Amino-(trans-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide



embedded image


4-Amino-N-(trans-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide is a compound known in the art and was prepared by the methods described in WO 2007/090844 A1.


Intermediate 12: 4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(piperidin-4-yl)benzamide

4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxybenzoic acid (Intermediate 8) (0.49 g, 1.2 mmol, 1 eq), TBTU (0.42 g, 1.3 mmol, 1.1 eq) and DIPEA (0.40 mL, 2.4 mmol, 2 eq) were stirred together in DCM (25 mL) for 30 min before addition of 4-amino-1-BOC-piperidine (0.29 g, 1.4 mmol, 1.2 eq). The RM was stirred at rt for 20 hours before diluting with DCM (30 mL) and washing sequentially with water (2×15 mL), 50% saturated aqueous sodium hydrogen carbonate (1×20 mL), saturated aqueous potassium carbonate (1×20 mL) and saturated brine (1×20 mL). Concentrated in vacuo to isolate 4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1-BOC-piperidin-4-yl)benzamide that was used without further purification (0.71 g). Rt=3.58 min (Analytical1).


Methanolic hydrochloric acid was added and the solution was stirred for 4 hours at rt. Concentration in vacuo provided the hydrochloride salt of 4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(piperidin-4-yl)benzamide. This salt was partitioned between DCM and aqueous potassium carbonate solution at pH 8. The DCM layer was separated and the aqueous layer extracted with DCM and EtOAc. The combined organic layers were dried (MgSO4) and concentrated in vacuo to provide 4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(piperidin-4-yl)benzamide as free base (0.51 g).




embedded image


Rt=2.78 min (Analytical1); MS(+ve): 494; MS(−ve): 492.


Compound [254]: 4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (22 mg, 0.05 mmol, 1 eq), DIPEA (17 μl, 0.10 mmol, 2 eq) and TBTU (18 mg, 0.055 mmol, 1.1 eq) were added to 0.5 mL DMF and the resulting solution stirred at rt for 30 min before the addition of 1-amino-4-methylpiperazine (12 μl, 0.1 mmol, 2 eq). The RM was then stirred at rt for 4 hours before purifying by preparative RP-HPLC-MS (Preparative1) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide (white solid, 8 mg, 30%).




embedded image


Rt=2.63 min (Analytical1) MS(+ve): 535.5; MS(−ve): 533.6; 1H NMR (DMSO-d6) δ ppm: 0.63-0.70 (2H, m), 0.87-0.94 (2H, m), 1.43-1.54 (2H, m), 1.55-1.63 (2H, m), 1.64-1.73 (2H, m), 1.83-1.94 (2H, m), 2.18 (3H, s), 2.31-2.48 (4H, m), 2.92 (4H, m), 3.16 (3H, s), 3.47 (2H, s), 3.94 (3H, s), 4.78-4.91 (1H, m), 7.35-7.48 (2H, m), 7.68 (1H, s), 7.98 (1H, s), 8.39 (1H, d, J=8.3 Hz), 9.31 (1H, s).


Compound [218]: (±)-4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 7) (15 mg, 0.033 mmol), DIPEA (12 μl, 0.066 mmol, 2 eq) and TBTU (12 mg, 0.036 mmol, 1.1 eq) were added to 0.5 mL DMF and the resulting solution stirred at rt for 5 min before the addition of 3-aminoquinuclidine dihydrochloride (8 mg, 0.04 mmol, 1.2 eq) and DIPEA (13 μL). The RM was then stirred at rt for 3 hours before purifying by preparative RP-HPLC-MS (Preparative2) to provide (±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide.




embedded image


Rt=3.26 min (Analytical1); MS(+ve): 560.4; 1H NMR (DMSO-d6) δ ppm: 8.37 (d, J=8.3 Hz, 1H), 8.08 (d, J=6.8 Hz, 1H), 8.05 (s, 1H), 7.73 (s, 1H), 7.45-7.53 (m, 2H), 4.82 (quin, J=8.3 Hz, 1H), 3.84-4.01 (m, 4H), 3.64 (s, 2H), 3.18 (s, 3H), 3.04-3.14 (m, 1H), 2.88 (t, J=9.8 Hz, 1H), 2.58-2.75 (m, 4H), 2.21-2.33 (m, 2H), 2.07 (s, 2H), 1.97 (br. s., 2H), 1.87 (br. s., 2H), 1.76 (d, J=4.9 Hz, 2H), 1.56-1.70 (m, 8H), 1.30 (br. s., 1H)


Compound [195]: 4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(4-methyl-piperazin-1-yl)-benzamide

4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxybenzoic acid (Intermediate 6) (20 mg, 0.046 mmol, 1 eq), DIPEA (16 μl, 0.091 mmol, 2 eq) and TBTU (16 mg, 0.05 mmol, 1.1 eq) were added to 0.5 mL DMF and the resulting solution stirred at rt for 5 min before the addition of 1-amino-4-methylpiperazine (7 mg). The RM was then stirred at rt for 16 hours before purifying by preparative RP-HPLC-MS (Preparative1) to provide 4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(4-methyl-piperazin-1-yl)-benzamide.




embedded image


Rt=2.81 min (Analytical1); MS(+ve): 537.5; 1H NMR (DMSO-d6) δ ppm: 1.09 (6H, s), 1.61 (4H, m), 1.73 (2H, m), 1.87 (2H, m), 2.19 (3H, s), 2.42 (2H, m), 2.92 (4H, m), 3.29 (3H, s), 3.37 (3H, m), 3.93 (3H, s), 3.17 (1H, m), 7.40 (2H, m), 7.68 (1H, s), 7.98 (1H, s), 8.37 (1H, d, 7 Hz), 9.30 (1H, s).


Compound [221]: 4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 7) (15 mg, 0.033 mmol, 1 eq), DIPEA (12 μl, 0.066 mmol, 2 eq) and TBTU (12 mg, 0.036 mmol, 1.1 eq) were added to 0.5 mL DMF and the resulting solution stirred at rt for 5 min before the addition of 1-amino-4-methylpiperazine (5 mg) and DIPEA (13 μL). The RM was then stirred at rt for 3 hours before purifying by preparative RP-HPLC-MS (Preparative2) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(4-methylpiperazin-1-yl)benzamide.




embedded image


Rt=2.79 min (Analytical1); MS(+ve): 549.5; 1H NMR (DMSO-d6) δ ppm: 9.31 (s, 1H), 8.37 (d, J=8.3 Hz, 1H), 8.05 (s, 1H), 7.72 (s, 1H), 7.37-7.47 (m, 2H), 4.73-4.86 (m, 1H), 3.93 (s, 3H), 3.64 (s, 2H), 3.18 (s, 3H), 2.92 (br. s., 4H), 2.36 (br. s., 4H), 2.27 (d, J=9.3 Hz, 2H), 2.18 (s, 3H), 1.97 (br. s., 2H), 1.79-1.91 (m, 1H), 1.76 (br. s., 2H), 1.54-1.72 (m, 7H).


Compound [371]: -(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide

2′-Chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one (Intermediate 2) (0.14 g, 0.45 mmol, 1 eq), 4-amino-N-(trans-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide (Intermediate 11) (0.26 g, 0.67 mmol, 1.5 eq) and TFA (0.17 mL, 2.2 mmol, 5 eq) in TFE (3 mL) were heated together at 80° C. for 18 hours. Further quantity of Intermediate 2 (0.14 g) was added and the reaction further heated for 48 hours. RM was concentrated in vacuo and the residue was purified by flash column chromatography on silica eluting with 0→20% ammonia/MeOH in DCM gradient followed by preparative HPLC (Preparative4) then finally preparative RP-HPLC-MS (Preparative1) to give 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide (0.11 g, 25%).




embedded image


Rt=3.18 min (Analytical1); ES(+ve): 657.6; ES(-ve): 655.7; 1H NMR (DMSO-d6) δ ppm: 0.05 (d, J=4.20 Hz, 3H), 0.44 (d, J=7.74 Hz, 2H), 0.67 (d, J=1.61 Hz, 2H), 0.74-0.85 (m, 1H), 0.90 (s, 2H), 1.23-1.44 (m, 3H), 1.44-1.55 (m, 2H), 1.54-1.64 (m, 2H), 1.64-1.74 (m, 2H), 1.88 (br. s., 5H), 2.08 (s, 3H), 2.13 (d, J=6.45 Hz, 2H), 2.17-2.28 (m, 1H), 2.29-2.47 (m, 3H), 2.60-2.67 (m, 1H), 3.06-3.23 (m, 5H), 3.47 (s, 2H), 3.65-3.79 (m, 1H), 3.94 (s, 2H), 4.05-4.13 (m, 1H), 4.78-4.91 (m, 1H), 7.48 (s, 2H), 7.67 (s, 1H), 7.98 (s, 1H), 8.00-8.07 (m, 1H), 8.31-8.45 (m, 1H).


Compound [372]: 4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b ][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide

2-Chloro-9-cyclopentyl-5,7,7-trimethyl-8,9-dihydro-5H-pyrimido[4,5-b][1,4]diazepin-6(7H)-one (Intermediate 3) (0.13 g, 0.43 mmol, 1 eq), 4-amino-N-(trans-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide (Intermediate 11) (0.26 g, 0.67 mmol, 1.5 eq) and TFA (0.17 mL, 2.2 mmol, 5 eq) in TFE (3 mL) were heated together at 80° C. for 18 hours. Further quantity of Intermediate 6 (0.13 g) was added and the reaction further heated for 48 hours. RM was concentrated in vacuo and the residue was purified by flash column chromatography on silica eluting with 0→20% ammonia/MeOH in DCM gradient followed by preparative HPLC (Preparative4) then finally preparative RP-HPLC-MS (Preparative1) to give 4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide (0.03 g, 7%).




embedded image


Rt=3.38 min (Analytical1); ES(+ve): 659.6; ES(−ve): 657.7; 1H NMR (DMSO-d6) δ ppm: 0.05 (d, J=3.86 Hz, 3H), 0.40-0.48 (m, 3H), 0.73-0.84 (m, 2H), 1.03-1.13 (m, 10H), 1.18 (s, 1H), 1.24-1.43 (m, 6H), 1.61 (br. s., 3H), 1.74 (d, J=9.65 Hz, 2H), 1.88 (br. s., 5H), 2.08 (s, 5H), 2.13 (d, J=6.75 Hz, 2H), 2.17-2.25 (m, 1H), 2.36 (br. s., 3H), 2.60-2.67 (m, 1H), 3.14-3.22 (m, 2H), 3.37 (s, 1H), 3.51 (s, 1H), 3.94 (s, 2H), 5.18 (t, J=8.52 Hz, 1H), 7.43-7.50 (m, 1H), 7.67 (s, 1H), 7.98 (s, 1H), 8.03 (d, J=7.72 Hz, 1H), 8.35 (d, J=8.36 Hz, 1H).


Alternatively, the skilled person would appreciate that Examples 5, 6 could be synthesised by reaction of Intermediates 5 or 6 with the known compound trans-4-(4-cyclopropylmethyl-piperazin-1-yl)-cyclohexylamine (described in U.S. Pat. No. 6,861,422 B2) using standard amide bond formation conditions such as those described in Example 1.


Compound [345]: 4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-[1-(tetrahydro-pyran-4-yl)-piperidin-4-yl]-benzamide

4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(piperidin-4-yl)benzamide (Intermediate 12) (35 mg, 0.07 mmol, 1 eq) and sodium triacetoxyborohydride (18 mg, 0.084 mmol, 1.2 eq) in DCM (0.5 mL) were reacted with tetrahydropyran-4-one (6.5 μL, 0.07 mmol, 1 eq) at rt for 2 days. Further and sodium triacetoxyborohydride (18 mg, 1.2 eq), tetrahydropyran-4-one (6.5 μL, 1 eq) were added and acetic acid (4 μL, 1 eq). After two days the RM was diluted with DCM, washed with water and the organic layer concentrated in vacuo. The resulting residue was purified by preparative RP-HPLC-MS (Preparative1) to provide 4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-[1-(tetrahydro-pyran-4-yl)-piperidin-4-yl]-benzamide (10 mg, 25%).




embedded image


Rt=2.74 min (Analytical1); ES(+ve): 578.5; ES(−ve): 576.7.


Compound [373]: 4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide


4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluorobenzoic acid (Intermediate 10) (100 mg, 0.23 mmol, 1 eq), DIPEA (80 μl, 0.46 mmol, 2 eq) and TBTU (80 mg, 0.25 mmol, 1.1 eq) were added to 1 mL DMF and the resulting solution stirred at rt for 10 min before the addition of 1-amino-4-methylpiperazine (33 μL, 0.27 mmol, 1.2 eq). The RM was then stirred at rt for 1 hour before splitting into two equal batches and purifying by preparative RP-HPLC-MS (Preparative3) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide (0.05 g, 41%).




embedded image


Rt=2.74 min (Analytical1); MS(+ve): 537.5; 1H NMR (DMSO-d6) δ ppm: 1.55-1.65 (8H, m), 1.71 (2H, m), 1.88 (2H, m), 2.18 (3H, s), 2.28 (2H, q, J 10.5 Hz), 2.41-2.52 (4H, m), 2.89 (4H, m), 3.18 (3H, s), 3.61 (2H, s), 4.76 (1H, quintet, 8.5 Hz), 7.61 (2H, m), 8.03 (1H, s), 8.12 (1H, dd, J 8 Hz, 8.5 Hz), 8.76 (1H, s), 9.36 (1H, s).


Compound [374]: 4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluorobenzoic acid (Intermediate 9) (0.27 g, 0.63 mmol, 1 eq), DIPEA (0.21 mL, 1.26 mmol, 2 eq) and TBTU (0.22 g, 0.69 mmol, 1.1 eq) were added to 5 mL DCM and the resulting solution stirred at rt for 30 min before the addition of 1-amino-4-methylpiperazine (91 μl, 0.75 mmol, 1.2 eq). The RM was then stirred at rt for 4 hours before washing with water, concentrating in vacuo and purifying the residue by preparative RP-HPLC-MS (Preparative1) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-fluoro-N-(4-methylpiperazin-1-yl)benzamide (0.14 g, 44%).




embedded image


Rt=2.58 min (Analytical1); MS(+ve): 523.4; 1H NMR (DMSO-d6) δ ppm: 0.65-0.67 (2H, s, CH2), 0.85-0.95 (2H, m, CH2), 1.23-1.82 (8H, m, alkyl-H), 2.18 (3H, s, CH3), 2.36-2.41 (4H, m, alkyl-H), 2.88 (4H, s, alkyl-H), 3.16 (3H, s, CH3), 3.44 (2H, s, alkyl-H), 4.77-4.80 (1H, m, CH), 7.6 (2H, m, aryl-H), 7.96 (1H, s, aryl-H), 8.16 (1H, t, J=8 Hz, aryl-H), 8.70 (1H, s, NH), 9.35(1H, s, NH).


Compound [194]: (±)-4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide 4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxybenzoic acid (Intermediate 6) (20 mg, 0.046 mmol, 1 eq), DIPEA (16 μl, 0.091 mmol, 2 eq) and TBTU (16 mg, 0.05 mmol, 1.1 eq) were added to 0.5 mL DMF and the resulting solution stirred at rt for 5 min before the addition of 3-aminoquinuclidine dihydrochloride (11 mg, 0.055 mmol, 1.1 eq). The RM was then stirred at rt for 16 hours before purifying by preparative RP-HPLC-MS (Preparative1) to provide (±)-4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide (8 mg, 32%).



embedded image


Rt=3.28 min (Analytical1); MS(+ve): 548.5; 1H NMR (DMSO-d6) δ ppm: 8.37 (1H, d, J 8 Hz), 8.07 (1H, d, J 6.5 Hz), 7.98 (1H, s), 7.69 (1H, s), 7.47-7.50 (2H, m), 5.19 (1H, quint, J 8 Hz), 3.95 (4H, m), 3.37 (2H, s), 3.18 (3H, s), 3.11 (1H, m), 2.89 (1H, m), 2.65-2.72 (4H, m), 1.88 (2H, m), 1.73-1.87 (4H, m), 1.57-1.61 (6H, m), 1.31 (1H, m), 1.09 (6H, s).


Compound [186]: (±)-4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (25 mg, 0.057 mmol, 1 eq), DIPEA (20 μL, 0.11 mmol, 2 eq) and TBTU (20 mg, 0.063 mmol, 1.1 eq) were added to 0.5 mL DMF and the resulting solution stirred at rt for 15 min before the addition of 3-aminoquinuclidine dihydrochloride (11 mg, 0.055 mmol, 1.1 eq) and DIPEA (40 μL). The RM was then stirred at rt for 16 hours before purifying by preparative RP-HPLC-MS (Preparative1) to provide (±)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide.




embedded image


Rt=3.02 min (Analytical1); MS(+ve): 546.4; 1H NMR (DMSO-d6) δ ppm: 8.40 (1H, d, J 8 Hz), 8.08 (1H, d, J 7 Hz), 7.98 (1H, s), 7.69 (1H, s), 7.47-7.50 (2H, m), 4.87 (1H, quint, J 9 Hz), 4.10 (1H, q, J 5.5 Hz), 3.95 (4H, m), 3.47 (2H, s), 3.27 (3H, s), 3.07 (1H, m), 2.08 (1H, m), 2.63-2.86 (4H, m), 1.88 (3H, m), 1.78 (1H, m), 1.68 (2H, m), 1.50-1.62 (5H, m), 1.32 (1H, m), 0.90 (2H, m), 0.66 (2H, m).


Compound [375]: 4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-(4-(2-hydroxyethyl)piperazin-1-yl)-3-methoxybenzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (48 mg, 0.11 mmol, 1 eq), DIPEA (36 μL, 0.22 mmol, 2 eq) and TBTU (39 mg, 0.12 mmol, 1.1 eq) were added to 5 mL DCM and the resulting solution stirred at rt for 15 min before the addition of 2-(4-aminopiperazin-1-yl)ethanol (19 mg, 0.13 mmol, 1.2 eq). The RM was then stirred at rt for 16 hours before concentrating in vacuo and purifying by preparative RP-HPLC-MS (Preparative1) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine -2′-ylamino)-N-(4-(2-hydroxyethyl)piperazin-1-yl)-3-methoxybenzamide (24 mg, 39%).




embedded image


Rt=2.48 min (Analytical1); MS(+ve): 565.4; 1H NMR (DMSO) δ ppm: 0.66-0.67 (2H, m, CH2), 0.88-0.90 (2H, m, CH2), 1.23-1.90 (8H, m, alkyl-H), 2.34-2.41 (4H, m, alkyl-H), 2.91 (4H, t, J=4 Hz, alkyl-H), 3.16 (3H, s, CH3), 3.46-3.51 (4H, m,), 3.93 (3H, s, CH3), 4.38-4.45 (1H, m,) 4.81-4.87 (1H, m, CH), 7.40 (2H, d, J=10.5 Hz, aryl-H), 7.67 (1H, s), 7.98 (1H, s), 8.39 (1H, d, J=8 Hz, aryl-H), 9.30 (1H, s, NH).


Compound [376]: 4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-morpholinobenzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (50 mg, 0.11 mmol, 1 eq), DIPEA (38 μL, 0.23 mmol, 2 eq) and TBTU (40 mg, 0.12 mmol, 1.1 eq) were added to 5 mL DCM and the resulting solution stirred at rt for 15 min before the addition of 4-aminomorpholine (12 mg, 0.14 mmol, 1.2 eq). The RM was then stirred at rt for 16 hours before concentrating in vacuo and purifying by preparative RP-HPLC-MS (Preparative1) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-morpholinobenzamide (26 mg, 44%).




embedded image


Rt=2.72 min (Analytical1); MS(+ve): 522.4; 1H NMR (DMSO) δ ppm: 0.65-0.71 (2H, m, CH2), 0.85-0.91 (2H, m, CH2), 1.23-1.88 (8H, m, alkyl-H), 2.92 (4H, t, J=4 Hz, alkyl-H), 3.16 (3H, s, CH3), 3.47 (2H, s, alkyl-H), 3.66 (4H, t, J=4.5 Hz), 3.94 (3H, s, CH3), 4.81-4.87 (1H, m, CH), 7.41 (2H, d, J=9.5 Hz), 7.69 (1H, s), 7.98 (1H, s), 8.40 (1H, d, J=8 Hz), 9.41 (1H, s, NH).


Compound [347]: (R)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (0.11 g, 0.25 mmol, 1 eq), DIPEA (0.17 mL) and TBTU (88 mg, 0.28 mmol, 1.1 eq) were added to 5 mL DCM and the resulting solution stirred at rt for 30 min before the addition of (R)-(+)-3-aminoquinuclidine dihydrochloride (60 mg, 0.30 mmol, 1.2 eq). The RM was then stirred at rt for 16 hours before diluting with DCM and washing sequentially with water (×2), 50% saturated aqueous sodium hydrogen carbonate, saturated aqueous sodium hydrogen carbonate and saturated brine. The organic layer was dried (MgSO4) and concentrated in vacuo. The residue was dissolved in the minimum quantity of EtOAc before addition of n-heptane to precipitate (R)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide (white solid, 0.13 g, 96%).




embedded image


Rt=3.07 min (Analytical1); MS(+ve): 546.5; MS(−ve): 544.6; 1H NMR (DMSO-d6) δ ppm 0.62-0.72 (2H, m), 0.87-0.94 (2H, m), 1.20-1.38 (1H, m), 1.44-1.54 (2H, m), 1.54-1.64 (4H, m), 1.64-1.74 (2H, m), 1.75-1.85 (1H, m), 1.85-1.95 (3H, m), 2.65-2.79 (4H, m), 2.83-3.01 (1H, m), 3.11-3.21 (4H, m), 3.47(2H, s), 3.95 (4H, s), 4.77-4.93 (1H, m), 7.42-7.54 (2H, m), 7.69 (1H, s), 7.98 (1H, s), 8.10 (1H, d, J=6.3 Hz), 8.39 (1H, d, J=8.3 Hz).


Compound [348]: (S)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (0.11 g, 0.25 mmol, 1 eq), DIPEA (0.17 mL) and TBTU (88 mg, 0.28 mmol, 1.1 eq) were added to 5 mL DCM and the resulting solution stirred at rt for 30 min before the addition of (S)-(−)-3-aminoquinuclidine dihydrochloride (60 mg, 0.30 mmol, 1.2 eq). The RM was then stirred at rt for 16 hours before diluting with DCM and washing sequentially with water (×2), 50% saturated aqueous sodium hydrogen carbonate, saturated aqueous sodium hydrogen carbonate and saturated brine. The organic layer was dried (MgSO4) and concentrated in vacuo. The residue was dissolved in the minimum quantity of EtOAc before addition of n-heptane to precipitate (S)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-(quinuclidin-3-yl)benzamide (white solid, 0.075 g, 55%).




embedded image


Rt=3.04 min (Analytical1); MS(+ve): 546.5; MS(−ve): 544.6; 1H NMR (DMSO-d6) δ ppm: 0.59-0.74 (2H, m), 0.86-0.97 (2H, m), 1.20-1.43 (1H, m), 1.45-1.75 (7H, m), 1.76-1.98 (4H, m), 2.66-2.86 (3H, m), 2.89-3.07 (1H, m), 3.17 (3H, s), 3.47 (3H, s), 3.89-4.02 (4H, m), 4.76-4.96 (1H, m), 7.42-7.59 (2H, m), 7.70 (1H, s), 7.98 (1H, s), 8.14 (1H, d, J=6.3 Hz), 8.40 (1H, d, J=7.8 Hz).


Compound [377]: 4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide

2′-Chloro-9′-cyclopentyl-5′-methyl-8′,9′-dihydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepin]-6′(5′H)-one (Intermediate 4) (0.065 g, 0.2 mmol, 1 eq), 4-amino-N-(trans-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide (Intermediate 11) (0.24 g, 0.6 mmol, 3 eq) and TFA (75 μL, 1 mmol, 5 eq) in TFE (6 mL) were heated to reflux together 40 hours. RM was concentrated in vacuo and the residue was partitioned between EtOAc and saturated sodium hydrogen carbonate. The organic layer was separated, washed with saturated brine and concentrated in vacuo to a residue that was purified by preparative RP-HPLC-MS (Preparative1) to give 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclobutane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide.




embedded image


Rt=3.41 min (Analytical1); ES(+ve): 671.6; ES(−ve): 669.7; 1H NMR (DMSO-d6) δ ppm: 0.03 (2H, dd, J 9.5 Hz, 5 Hz), 0.41 (2H, dd, J 10 Hz, 5 Hz), 0.79 (1H, m), 1.20-1.37 (4H, m), 1.55-1.94 (18H, m), 2.04 (2H, d, J 6.5 Hz), 2.16-2.46 (8H, m), 3.15 (3H, s), 3.32 (2H, s), 3.69 (1H, m), 3.90 (3H, s), 4.79 (1H, m), 7.44 (2H, m), 7.68 (1H, s), 8.01 (2H, m), 8.34 (1H, d, J 8.5 Hz).


Compound [378]: 4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide

2-Chloro-9-cyclopentyl-5-methyl-8,9-dihydro-5H-pyrimido[4,5-b][1,4]diazepin-6(7H)-one (Intermediate 1) (0.13 g, 0.43 mmol, 1 eq), 4-amino-N-(trans-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide (Intermediate 11) (0.26 g, 0.67 mmol, 1.5 eq) and TFA (0.17 mL, 2.2 mmol, 5 eq) in TFE (3 mL) were heated together at 80° C. for 18 hours. Further quantity of Intermediate 1 (0.10 g) was added and the reaction further heated for 48 hours. RM was concentrated in vacuo and the residue was purified by flash column chromatography on silica eluting with 0→420% ammonia/MeOH in DCM gradient followed by preparative HPLC (Preparative4) then finally preparative RP-HPLC-MS (Preparative1) to give 4-(9-cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-N-((trans)-4-(4-(cyclopropylmethyl)piperazin-1-yl)cyclohexyl)-3-methoxybenzamide (0.11 g, 26%).




embedded image


Rt=2.88 min (Analytical1); ES(+ve): 631.5; ES(−ve): 629.6; 1H NMR (DMSO-d6) δ ppm: −0.15-0.11 (m, 2H), 0.40 (d, J=8.06 Hz, 2H), 0.63-0.85 (m, 1H), 1.11-1.41 (m, 3H), 1.57 (br. s., 2H), 1.69 (d, J=17.73 Hz, 2H), 1.74-1.95 (m, 6H), 2.04 (s, 2H), 2.09 (d, J=6.45 Hz, 2H), 2.16 (d, J=9.67 Hz, 1H), 2.32 (br. s., 2H), 2.49 (br. s., 1H), 2.51-2.59 (m, 2H), 2.59 (br. s., 1H), 3.07-3.17 (m, 3H), 3.27 (s, 5H), 3.53-3.62 (m, 2H), 3.67 (dd, J=7.41, 3.55 Hz, 1H), 3.89 (s, 2H), 4.04 (q, J=5.37 Hz, 1H), 4.76 (quin, J=8.22 Hz, 1H), 7.38-7.48 (m, 2H), 7.68 (s, 1H), 7.99 (d, J=7.74 Hz, 1H), 8.03 (s, 1H), 8.33 (d, J=8.06 Hz, 1H).


Intermediates 13-19: 4-(amine-substituted)cyclohexanamines



embedded image


1. [Analogous to Method III in Abdel-Magid A. F. et al. (1996) J. Org. Chem., 61, 3849-3862] sodium triacetoxyborohydride (1.5 eq), acetic acid (1 eq), amine (1.1 eq), THF, rt 20 h; 2. H2, 10% Pd/C, 60° C., methanol, flow hydrogenation; 3. sodium iodide (4 eq), chlorotrimethylsilane (4 eq), acetonitrile, 0° C.-rt, 18 h.


Step 1:


N-benzyloxycarbonyl-4-aminocyclohexanone, a compound known in the art [WO2007/002181 A2] (typically 1 mmol scale), was added to a reaction tube containing THF (5 mL), the appropriate substituted-piperazine, -homopiperazine, or morpholine, along with acetic acid and sodium triacetoxyborohydride. The reaction was stirred at ambient temperature for 20 hours. The reaction was quenched with NaHCO3 solution (2 mL) before acidifying to pH2 with 1N HCl solution. The mixture was washed with EtOAc before separating the aqueous layer and basifying to pH10 with 2N NaOH solution. The product was extracted into EtOAc, which was washed with sat. NaCl, dried (MgSO4) and evaporated under reduced pressure to provide the required benzyl 4-(amine-substituted)cyclohexylcarbamate.


Step 2:


Each benzyl 4-(amine-substituted)cyclohexylcarbamate were dissolved in methanol to a concentration of 0.05 M. Hydrogenation was conducted using an H-Cube™ (ThalesNano Inc.) flow reactor at 1 mL/mim flow rate over 10% Pd/C catalyst heated to 60° C. under full hydrogen mode. Concentration under reduced pressure provided the desired 4-(amine-substituted)cyclohexanamine product as oils. Solid hydrochloride salts could be obtained by stirring with ethereal HCl.


Where it was required to selectively deprotect the benzylcarbamates in the presence of an N-benzyl group (intermediates 16 & 18), step 3 was employed instead of step 2.


Step 3:


Sodium iodide (1.5 mmol, 4eq) was dissolved in anhydrous acetonitrile (5 mL) and was stirred whilst chlorotrimethylsilane (1.5 mmol, 4 eq) was added. After 5 minutes this mixture was added slowly to a solution of the 4-(amine-substituted)cyclohexanamine dissolved in anhydrous acetonitrile (2 mL) cooled in an ice-water bath. After 1 hour the cooling bath was removed and the RM was stirred at ambient temperature for 18 hours. RM was concentrated under reduced pressure and redissolved in 1% water in methanol solution. The mixture was absorbed onto an SCX II column, washed with methanol and eluted with ammonia in methanol. Concentrated in vacuo to provide the desired 4-(amine-substituted)cyclohexanamine.

















ES(+ve)
Analytical_1


Intermediate
Structure
[M + H]+
Rt (min)







13


embedded image


212.3
2.05





14


embedded image


252.3
2.42





15


embedded image


nd






16


embedded image


nd






17


embedded image


nd






18


embedded image


274.3
3.27





19


embedded image


185.2
1.47





nd = no data (ionization not detected under standard conditions)






Compound [379]: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((trans)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-methoxybenzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (66 mg, 0.15 mmol, 1 eq), DIPEA (52 μl, 0.3 mmol, 2 eq) and TBTU (54 mg, 0.17 mmol, 1.1 eq) were added to 1.5 mL DMF and the resulting solution was stirred at rt for 20 min before the addition of 4-(4-ethylpiperazin-1-yl)cyclohexanamine (Intermediate 13) as the trihydrochloride salt (58 mg, 0.18 mmol, 1.2 eq) and DIPEA (78 μL, 0.45 mmol, 3 eq). The RM was then stirred at rt for 2 hours before purifying by preparative RP-HPLC-MS (Preparative2) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((trans)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-methoxybenzamide (colourless glass, 26 mg, 28%).




embedded image


Rt=3.00 min (Analytical1) MS(+ve) 631.6; MS(−ve) 629.7; Rt=3.00 min (Analytical1) MS(+ve) 631.6; MS(−ve) 629.7; 1H NMR (DMSO-d6) δ ppm: 0.59-0.72 (2H, m), 0.81-0.92 (2H, m), 0.97 (3H, t, J=7.1 Hz), 1.20-1.42 (4H, m), 1.42-1.55 (2H, m), 1.54-1.64 (2H, m), 1.64-1.73 (2H, m), 1.83 (2H, d, J=11.7 Hz), 1.89 (4H, d, J=7.8 Hz), 2.14-2.42 (7H, m), 3.16 (3H, s), 3.47 (2H, s), 3.64-3.79 (1H, m), 3.94 (3H, s), 4.84 (1H, quin, J=8.7 Hz), 7.40-7.54 (2H, m), 7.67 (1H, s), 7.98 (1H, s), 8.03 (1H, d, J=7.8 Hz), 8.38 (1H, d, J=8.3 Hz).


Compound [380]: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((cis)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-methoxybenzamide

From the synthesis and purification of Compound [379] was isolated as a separate compound 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2-ylamino)-N-((cis)-4-(4-ethylpiperazin-1-yl)cyclohexyl)-3-methoxybenzamide (colourless glass, 27 mg, 29%).




embedded image


Rt=3.13 min (Analytical1) MS(+ve) 631.6; MS(−ve) 629.7; 1H NMR (DMSO-d6) δ ppm: 0.60-0.72 (2H, m), 0.83-0.93 (2H, m), 0.98 (3H, t, J=7.1 Hz), 1.38-1.55 (6H, m), 1.55-1.63 (2H, m), 1.63-1.80 (4H, m), 1.80-1.96 (4H, m), 2.02-2.17 (1H, m), 2.16-2.44 (7H, m), 3.16 (3H, s), 3.47 (2H, s), 3.79-3.92 (1H, m), 3.94 (3H, s), 4.84 (1H, quin, J=8.5 Hz), 7.44-7.58 (2H, m), 7.67 (1H, s), 7.98 (1H, s), 8.03 (1H, d, J=7.3 Hz), 8.37 (2H, d, J=8.8 Hz).


Compound [381]: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-(4-(4-(cyclopropylmethyl)-1,4-diazepan-1-yl)cyclohexyl)-3-methoxybenzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (88 mg, 0.2 mmol, 1 eq), DIPEA (70 μl, 0.4 mmol, 2 eq) and TBTU (72 mg, 0.24 mmol, 1.2 eq) were added to 2 mL DMF and the resulting solution was stirred at rt for min before the addition of 4-(4-(cyclopropylmethyl)-1,4-diazepan-1-yl)cyclohexanamine (Intermediate 14) (60 mg, 0.24 mmol, 1.2 eq). The RM was then stirred at rt for 2 hours before purifying by preparative RP-HPLC-MS (Preparative2) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-(4-(4-(cyclopropylmethyl)-1,4-diazepan-1-yl)cyclohexyl)-3-methoxybenzamide as a mixture cis and trans isomers (off-white solid, 67 mg, 50%).




embedded image


Rt=4.12 min (broad peak) (Analytical1) MS(+ve) 671.6; MS(−ve) 669.7; 1H NMR (DMSO-d6) δ ppm: 0.01 (2H, d, J=4.4 Hz), 0.40 (2H, d, J=7.3 Hz), 0.63 (2H, br. s.), 0.71-0.83 (1H, m), 0.87 (2H, br. s.), 1.02 (1H, t, J=7.1 Hz), 1.25-1.38 (2.5H, m), 1.39-1.52 (3.5H, m), 1.52-1.61 (2H, m), 1.65 (4H, d, J=5.9 Hz), 1.70-1.80 (3H, m), 1.85 (3H, d, J=4.4 Hz), 2.21-2.31 (1H, m), 2.55-2.83 (8H, m), 3.13 (3.5H, s), 3.35-3.55 (3H, m), 3.69 (0.5H, br. s.), 3.91 (3.5H, s), 4.31 (0.5H, t, J=5.1 Hz), 4.81 (1H, t, J=8.5 Hz), 7.25-7.54 (2H, m), 7.64 (1H, s), 7.84-8.16 (2H, m), 8.35 (1H, d, J=8.3 Hz).


Compound [382]: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-(4-(4-ethyl-1,4-diazepan-1-yl)cyclohexyl)-3-methoxybenzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (44 mg, 0.1 mmol, 1 eq), DIPEA (35 μl, 0.2 mmol, 2 eq) and TBTU (36 mg, 0.12 mmol, 1.2 eq) were added to 1 mL DMF and the resulting solution was stirred at rt for 20 min before the addition of 4-(4-ethyl-1,4-diazepan-1-yl)cyclohexanamine (Intermediate 15) as the trihydrochloride salt (32 mg, 0.1 mmol, 1 eq) and DIPEA (53 μL, 0.3 mmol, 3 eq). The RM was then stirred at rt for 2 hours before purifying by preparative RP-HPLC-MS (Preparative2) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-(4-(4-ethyl-1,4-diazepan-1-yl)cyclohexyl)-3-methoxybenzamide as a mixture cis and trans isomers (white solid, 10 mg, 16%).




embedded image


Rt=3.98 min, 4.18 min (broad peaks) (Analytical1) MS(+ve) 645.6; MS(−ve) 643.7; 1H NMR (DMSO-d6) δ ppm: 0.57-0.74 (2H, m), 0.82-0.93 (2H, m), 0.95-1.09 (3H, m), 1.30-1.42 (2H, m), 1.42-1.54 (3.5H, m), 1.58 (2H, d, J=4.4 Hz), 1.63-1.75 (3.5H, m), 1.75-1.83 (1.5H, m), 1.88 (3.5H, br. s.), 1.98-2.16 (1.5H, m), 2.59-2.86 (4H, m), 3.17 (4H, s), 3.41-3.53 (3.5H, m), 3.78 (2.5H, m), 3.88-4.02 (3.5H, m), 4.06-4.38 (1H, m), 4.76-4.91 (1H, m), 7.39-7.57 (2H, m), 7.59-7.78 (1H, m), 7.98 (2H, s), 8.31-8.45 (1H, m)


Compound [383]: N-(4-(4-benzyl-1,4-diazepan-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (66 mg, 0.15 mmol, 1 eq), DIPEA (52 μl, 0.3 mmol, 2 eq) and TBTU (54 mg, 0.17 mmol, 1.1 eq) were added to 1 mL DMF and the resulting solution was stirred at rt for 20 min before the addition of 4-(4-benzyl-1,4-diazepan-1-yl)cyclohexanamine (Intermediate 16) (54 mg, 0.19 mmol, 1.27 eq) dissolved in DMF (0.5 mL). The RM was then stirred at rt for 2 hours before purifying by preparative RP-HPLC-MS (Preparative5) to provide N-(4-(4-benzyl-1,4-diazepan-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide as a mixture cis and trans isomers (off-white solid, 33 mg, 31%).




embedded image


Rt=4.40 min (Analytical1) MS(+ve) 707.6; MS(−ve) 705.7; 1H NMR (DMSO-d6) δ ppm: 0.73 (2H, br. s.), 0.96 (2H, br. s.), 1.22-2.22 (19H, m), 2.64-2.91 (4H, m), 3.23 (5H, s), 3.53 (8H, s), 3.89-4.24 (4H, m), 4.91 (1H, t, J=8.5 Hz), 5.82 (0H, s), 7.23-8.54 (10H, m).


Compound [384]: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((trans)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-methoxybenzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (66 mg, 0.15 mmol, 1 eq), DIPEA (52 μl, 0.3 mmol, 2 eq) and TBTU (54 mg, 0.17 mmol, 1.1 eq) were added to 1 mL DMF and the resulting solution was stirred at rt for min before the addition of 4-(4-methylpiperazin-1-yl)cyclohexanamine (Intermediate 17) (35 mg, 0.18 mmol, 1.2 eq) dissolved in DMF (0.5 mL). The RM was then stirred at rt for 2 hours before purifying by preparative RP-HPLC-MS (Preparative2 and Preparative3) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((trans)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-methoxybenzamide (white solid, 17 mg, 18%).




embedded image


Rt=2.85 min (Analytical1) MS(+ve) 617.5; MS(−ve) 615.6; 1H NMR (DMSO-d6) δ ppm: 0.61-0.76 (2H, m), 0.89 (1H, t, J=6.8 Hz), 0.92-0.98 (2H, m), 1.22-1.47 (5H, m), 1.47-1.79 (6H, m), 1.81-2.02 (5H, m), 2.07-2.20 (3H, m), 2.20-2.42 (4H, m), 3.20 (4H, s), 3.34 (3H, s), 3.51 (2H, s), 3.67-3.82 (1H, m), 3.98 (3H, s), 4.88 (1H, quin, J=8.5 Hz), 7.42-7.59 (2H, m), 7.71 (1H, s), 8.02 (1H, s), 8.08 (1H, d, J=7.8 Hz), 8.42 (1H, d, J=8.3 Hz).


Compound [385]: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepin]-2′-ylamino)-N-((cis)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-methoxybenzamide

From the synthesis and purification of Compound [384] was isolated as a separate compound 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-N-((cis)-4-(4-methylpiperazin-1-yl)cyclohexyl)-3-methoxybenzamide (white solid, 34 mg, 37%).




embedded image


Rt=2.93 min (Analytical1) MS(+ve) 617.5; MS(−ve) 615.6; 1H NMR (DMSO-d6) δ ppm: 0.62-0.80 (2H, m), 0.84-1.02 (4H, m), 1.18-1.36 (4H, m), 1.43-1.84 (12H, m), 1.84-2.03 (4H, m), 2.09-2.22 (4H, m), 2.41 (4H, br. s.), 3.21 (3H, s), 3.52 (2H, s), 3.89-3.97 (1H, m), 3.99 (3H, s), 4.89 (1H, quin, J=8.5 Hz), 7.47-7.61 (2H, m), 7.72 (1H, s), 8.03 (1H, s), 8.08 (1H, d, J=7.3 Hz), 8.43 (1H, d, J=9.3 Hz)


Compound [386]: N-((trans)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (66 mg, 0.15 mmol, 1 eq), DIPEA (52 μl, 0.3 mmol, 2 eq) and TBTU (54 mg, 0.17 mmol, 1.1 eq) were added to 1 mL DMF and the resulting solution was stirred at rt for min before the addition of 4-(4-benzylpiperazin-1-yl)cyclohexanamine (Intermediate 18) (35 mg, 0.18 mmol, 1.2 eq) dissolved in DMF (0.5 mL). The RM was then stirred at rt for 2 hours before purifying by preparative RP-HPLC-MS (Preparative2) to provide N-((trans)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide (white solid, 13 mg, 13%).




embedded image


Rt=3.64 min (Analytical1) MS(+ve) 693.6; MS(−ve) 691.7; 1H NMR (DMSO-d6) δ ppm: 0.62-0.79 (2H, m), 0.85-1.02 (2H, m), 1.20-1.46 (4H, m), 1.46-1.58 (2H, m), 1.59-1.67 (2H, m), 1.67-1.78 (2H, m), 1.80-2.02 (6H, m), 2.12 (1H, s), 2.18-2.46 (6H, m), 3.20 (3H, s), 3.43-3.56 (5H, m), 3.67-3.84 (1H, m), 3.97 (3H, s), 4.88 (1H, quin, J=8.4 Hz), 7.22-7.42 (6H, m), 7.44-7.59 (2H, m), 7.71 (1H, s), 8.02 (1H, s), 8.08 (1H, d, J=7.8 Hz), 8.42 (1H, d, J=7.8 Hz)


Compound [387]: N-((cis)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b]1,4]diazepine]-2′-ylamino)-3-methoxybenzamide

From the synthesis and purification of Compound [386] was isolated as a separate compound N-((cis)-4-(4-benzylpiperazin-1-yl)cyclohexyl)-4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzamide (white solid, 20 mg, 19%).




embedded image


Rt=3.85 min (Analytical1) MS(+ve) 693.6; MS(−ve) 691.7; 1H NMR (DMSO-d6) δ ppm: 0.62-0.79 (2H, m), 0.87-1.01 (2H, m), 1.43-1.59 (5H, m), 1.59-1.67 (2H, m), 1.66-1.74 (2H, m), 1.75-1.84 (2H, m), 1.92 (4H, br. s.), 2.07-2.29 (2H, m), 2.41 (4H, br. s.), 3.20 (3H, s), 3.51 (4H, s), 3.87-4.05 (4H, m), 4.74-4.99 (1H, m), 7.24-7.39 (5H, m), 7.50-7.56 (2H, m), 7.71 (1H, s), 8.02 (1H, s), 8.07 (1H, d, J=6.8 Hz), 8.42 (1H, d, J=8.8 Hz)


Compound [388]: 4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((trans)-4-morpholinocyclohexyl)benzamide

4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxybenzoic acid (Intermediate 6) (66 mg, 0.15 mmol, 1 eq), DIPEA (52 μl, 0.3 mmol, 2 eq) and TBTU (54 mg, 0.17 mmol, 1.1 eq) were added to 1.5 mL DMF and the resulting solution was stirred at rt for 20 min before the addition of 4-morpholinocyclohexanamine (Intermediate 16) (33 mg, 0.18 mmol, 1.2 eq). The RM was then stirred at rt for 2 hours before purifying by preparative RP-HPLC-MS (Preparative2) to provide 4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((trans)-4-morpholinocyclohexyl)benzamide (off-white solid, 10 mg, 11%).




embedded image


Rt=3.16 min (Analytical1) MS(+ve) 606.4; MS(−ve) 604.5; 1H NMR (DMSO-d6) δ ppm: 1.07-1.18 (7H, m), 1.24-1.49 (4H, m), 1.58-1.71 (4H, m), 1.71-1.84 (2H, m), 1.83-2.03 (6H, m), 2.23 (1H, t, J=10.5 Hz), 2.43-2.51 (3H, m), 3.17-3.28 (4H, m), 3.42 (3H, br. s.), 3.60 (4H, br. s.), 3.64 (1H, br. s.), 3.71-3.83 (1H, m), 3.98 (3H, s), 5.23 (1H, t, J=8.3 Hz), 7.44-7.60 (2H, m), 7.72 (1H, s), 8.02 (1H, s), 8.09 (1H, d, J=7.8 Hz), 8.40 (1H, d, J=8.3 Hz)


Compound [389]: 4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((cis)-4-morpholinocyclohexyl)benzamide

From the synthesis and purification of Compound [388] was isolated as a separate compound 4-(9-cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3-methoxy-N-((cis)-4-morpholinocyclohexyl)benzamide (white solid, 22 mg, 24%).




embedded image


Rt=3.31 min (Analytical1) MS(+ve) 606.4; MS(−ve) 604.5; 1H NMR (DMSO-d6) δ ppm: 1.13 (6H, s), 1.39-1.60 (4H, m), 1.60-1.71 (4H, m), 1.71-1.85 (4H, m), 1.85-2.01 (4H, m), 2.07-2.22 (2H, m), 2.42-2.48 (4H, m), 3.22 (4H, s), 3.64 (4H, br. s.), 3.87-4.05 (4H, m), 5.14-5.31 (1H, m), 7.45-7.62 (2H, m), 7.71 (1H, s), 8.02 (1H, s), 8.09 (1H, d, J=7.3 Hz), 8.39 (1H, d, J=8.3 Hz)


Compound [390]: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-((trans)-4-morpholinocyclohexyl)benzamide

4-(9′-Cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxybenzoic acid (Intermediate 5) (66 mg, 0.15 mmol, 1 eq), DIPEA (52 μl, 0.3 mmol, 2 eq) and TBTU (54 mg, 0.17 mmol, 1.1 eq) were added to 1.5 mL DMF and the resulting solution was stirred at rt for 20 min before the addition of 4-morpholinocyclohexanamine (Intermediate 16) (33 mg, 0.18 mmol, 1.2 eq). The RM was then stirred at rt for 2 hours before purifying by preparative RP-HPLC-MS (Preparative2) to provide 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-((trans)-4-morpholinocyclohexyl)benzamide (off-white solid, 13 mg, 14%).




embedded image


Rt=2.96 min (Analytical1) MS(+ve) 604.4; MS(−ve) 602.5; 1H NMR (DMSO-d6) δ ppm: 0.72 (2H, s), 0.95 (2H, s), 1.24-1.49 (4H, m), 1.49-1.60 (2H, m), 1.60-1.69 (2H, m), 1.69-1.82 (2H, m), 1.82-2.03 (6H, m), 2.14 (1H, s), 2.17-2.32 (1H, m), 3.22 (4H, s), 3.53 (2H, s), 3.61 (4H, br. s.), 3.71-3.84 (1H, m), 4.00 (3H, s), 4.90 (1H, quin, J=8.5 Hz), 7.43-7.61 (2H, m), 7.73 (1H, s), 8.04 (1H, s), 8.10 (1H, d, J=7.8 Hz), 8.44 (1H, d, J=8.3 Hz)


Compound [391]: 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-b][1,4]diazepine]-2′-ylamino)-3-methoxy-N-((cis)-4-morpholinocyclohexyl)benzamide

From the synthesis and purification of Compound [390] was isolated as a separate compound 4-(9′-cyclopentyl-5′-methyl-6′-oxo-5′,6′,8′,9′-tetrahydrospiro[cyclopropane-1,7′-pyrimido[4,5-][1,4]diazepine]-2′-ylamino)-3-methoxy-N-((cis)-4-morpholinocyclohexyl)benzamide (white solid, 27 mg, 30%).




embedded image


Rt=3.10 min (Analytical1) MS(+ve) 604.4; MS(−ve) 602.5; 1H NMR (DMSO-d6) δ ppm: 0.66-0.81 (2H, m), 0.88-1.03 (2H, m), 1.45-1.86 (12H, m), 1.87-2.02 (4H, m), 2.10-2.21 (1H, m), 2.47 (4H, br. s.), 3.22 (3H, s), 3.52 (2H, s), 3.65 (4H, br. s.), 3.89-4.05 (4H, m), 4.90 (1H, quin, J=8.5 Hz), 7.50-7.63 (2H, m), 7.73 (1H, s), 8.03 (1H, s), 8.10 (1H, d, J=7.3 Hz), 8.43 (1H,


Example 3

A full-length human CDC25C clone was isolated by PCR from HeLa mRNA and was inserted on a BamHI-HindIII fragment into pRsetA. The amino terminal fragment of CDC25C (encoding residues 1-300) was excised from this vector and inserted into pET28a (between the NcoI and BamHI sites). Expression was under the control of the T7 promoter, and the encoded protein contained a His6 tag at the carboxyl terminus. The vector was transformed into E. coli strain BRL(DE3) pLysS for expression experiments. CDC25C was expressed in BL21(DE3) RIL bacteria cells, grown in LB media at 37° C. until OD600 nm of 0.6 was reached. The expression was induced with 1 mM IPTG and the bacterial culture was grown further for 3 h. The bacteria were harvested by centrifugation and the cell pellet was re-suspended in 50 mM Tris pH 7.5 and 10% sucrose, flash frozen, and stored at −70° C. until used. CDC25C protein was purified from E. coli inclusion bodies. The inclusion bodies were isolated in a buffer (50 mM Tris pH 8.0, 2 mM EDTA, 100 mM NaCl, 0.5% triton X-100). After denaturation in the presence of 6 M urea, the protein was refolded via slow dialysis of the urea. The protein was stored in 25 mM Tris pH 8.0, 100 mM NaCl, 1 mM DTT, 1 mM EDTA and 10% glycerol at −70° C. until used.


A full-length human PLK1 (XM047240) (amino acids 1-603) clone was amplified from a foetal lung cDNA library using primers incorporating restriction enzyme sites. The 5′ primer (gccgctagcgacgatgacgataagatgagtgctgcagtgactgcagggaagc) had an Nhe1 site prior to the ATG start codon. The 3′ primer (ggaattcttaggaggccttgagacgg) incorporated a stop codon prior to the EcoR1 site. The PCR product was cloned into the Nhe1/EcoR1 sites of a baculovirus expression vector, pSSP1. Cloning into this vector resulted in a His6 tag fusion at the amino terminus of the PLK1 construct. Sf9 cells of a passage number less than 20 were split back to give a 300 mL culture volume, at a cell density of 1.5×106 cells/mL. Cells were only used for expression in logarithmic growth phase. PLK1 baculovirus (from P2 amplification) was added to give a multiplicity of infection of 3, this is equivalent to 3 virus particles for each insect cell. The flasks were incubated at 27° C., with shaking at 100 r.p.m. for 48 h. On harvest, cell density and viability was determined, the cultures spun down at 2500 r.p.m. for 5 min and washed with ice-cold phosphate-buffered saline. The wash was re-spun at the same speed and the pellet was snap frozen. PLK1 protein was purified on a metal affinity column. The insect cell pellet was lysed in a buffer (10 mM Tris-HCl pH 8.0, 150 mM NaCl, 5 mM β-mercaptoethanol, 1 mM PMSF, 1 mM benzamidine, 20 mM imidazole and protease inhibitor cocktail (Sigma) and the pre-cleared supernatant was loaded onto NiNTA-agarose (Qiagen). The affinity column was washed with the lysis buffer and the bound protein was eluted with 250 mM imidazole in the same buffer. After overnight dialysis against 25 mM Tris HCl, pH 7.5, 100 mM NaCl, 1 mM DTT, 1 mM PMSF, 1 mM benzamidine, protease inhibitors cocktail (Sigma) and 10% glycerol, the purified protein was stored at −70° C. until used.


Example 4

PLK1 protein kinase assays were carried out using a 96-well plate format by incubating CDC25C (2 μg/well) with PLK1 (1 μg/well) in 20 mM Tris/HCl buffer pH 7.5, supplemented with 25 mM β-glycerophosphate, 5 mM EGTA, 1 mM DTT and 1 mM NaVO3. Serial dilutions of test compound in assay buffer were added. Reaction was initiated by the addition of 100 μM ATP and 0.5 μCi of [γ-32P]-ATP. The reaction mixture was incubated at 30° C. for 1 h, then stopped with 75 mM aq orthophosphoric acid, transferred onto a 96-well P81 filter plate (Whatman), dried, and the extent of CDC25C phosphorylation was assessed by scintillation counting using a Packard TopCount plate reader. The raw assay data was analysed by non-linear regression analysis parameters and IC50 values were determined using the equation: y=A+((B−A)/(1+((C/x)̂D))), where y is % inhibition, A is minimum inhibition, B is maximum inhibition, C is EC50, and D is the slope factor.


Cellular proliferation assays using human tumour cell lines (obtained from the American Type Culture Collection, 10801 University Boulevard, Manessas, Va. 20110-2209, USA) were carried out. Standard 72-h MTT (thiazolyl blue; 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assays were performed (Loveland et al, Biochem. Int., 1992, 27, 501;Haselsberger et al, Anti Cancer Drugs, 1996, 7, 331). In short: cells were seeded into 96-well plates according to doubling time and incubated overnight at 37° C. Test compounds were made up in DMSO and a 1/3 dilution series prepared in 100 μL cell media, added to cells (in triplicates) and incubated for 72 h at 37° C. MTT was made up as a stock of 5 mg/mL in cell media and filter-sterilised. Media was removed from cells followed by a wash with 200 μL PBS. MTT solution was then added at 20 μL per well and incubated in the dark at 37° C. for 4 h. MTT solution was removed and cells again washed with 200 μL PBS. MTT dye was solubilised with 200 μL per well of DMSO with agitation. Absorbance was read at 540 nm and data analysed using curve-fitting software (GraphPad Prism version 3.00 for Windows, GraphPad Software, San Diego Calif. USA) to determine IC50 values (concentration of test compound which inhibits cell growth by 50%).


Example 5

PLK Selectivity


Table 4 shows the selectivity of compound [218] for PLK1 over PLK2 and PLK3 compared with selected compounds of the prior art. By way of illustration, compound [218] of the invention is twice as selective for PLK1 versus PLK 2 compared to compound [I-64] of WO 07/095188, ca 6-fold more selective than compound [I-76] and 7-fold more selective than compound [I-4] of WO 07/095188. Similarly, compound [218] is 5-fold more selective for PLK1 versus PLK3 compared to compound [I-64] of WO 07/095188, ca 12-fold more selective than compound [I-76] and 5-fold more selective than compound [I-4] of WO 07/095188.


Example 6

Solubility Studies


Table 5 shows that compound [254] (boxed structure below) has superior solubility and/or pharmacokinetic properties when compared to structurally related compounds already known in the art.




embedded image


Nephelometry Studies


If a DMSO solution of a water soluble compound is introduced into aqueous buffer, the mixture remains clear unless the aqueous solubility limit is reached. Above the solubility limit, precipitation occurs and light travelling through the turbid suspension is scattered. The measurement of the intensity of the scattered light is the basis of nephelometric solubility determination.


Selected compounds were screened using a nephelometer to identify the concentration at which turbidity occurs, thereby giving an indication of kinetic solubility. By nephelometry (2% DMSO : 98% phosphate buffered saline pH 7.5) compound [254] was freely soluble at 200 μM (>0.11 mg/mL) which is the highest concentration tested in this assay. In contrast, in the same nephelometry assay, the maximum soluble concentration of prior art Example [I-253] of WO 07/095188 was determined to be 75 μM (Table 6). This shows that compound [254] is more soluble in aqueous buffer in the concentration range used to study compound activity in vitro.


Pharmacokinetic Studies


In order to study compounds in vivo, higher concentrations are often required. To achieve these higher concentrations, salt forms of compounds are normally utilised.


Compound [254] and Example [I-76] of WO 07/095188 were studied as the free base and hydrochloride salts in various pharmaceutically relevant solvent mixtures that can be used for administration of compounds to living organisms. Having solubilized the compound by heating in the solvent, the solutions were cooled to 25° C. and observed. Rather than forming a precipitate, supersaturated mixtures tend to form a gelatinous mesophase after cooling that is not suitable or convenient for dosing. It is clear from the data presented in Table 5 that compound [254] and its HCl salt have consistently better solution profiles than Example [I-76] and its corresponding HCl salt. The HCl salt of Example [I-76] was administered to mice as a solution in 3% DMA 97% water by intravenous injection. The maximum tolerated dose appears to be dictated by reaching the maximum concentration of compound in stable solution. At the maximum tolerated dose no xenograft antitumour efficacy was observed (qd×7 dosing) as insufficient compound concentration could be administered. In contrast, compound [254] and its salt, having significantly higher water solubility is able to be injected at concentrations more likely to produce efficacy in the treatment of diseases.


Example 8

Pharmacokinetic Properties of Compound [371]


(a) Methodology


Preliminary investigations of the pharmacokinetics of selected compounds were carried out in fasted conscious CD-1 mice (25-30 g). Compounds were dosed as 1 mg/kg by intravenous administration or 5-10 mg/kg by oral route. Twenty one male mice per administration route (n=3 mice per time point) received dose solution by single bolus injection in the tail vein or by oral gavage. Blood samples were collected by cardiac puncture at 5, 15, 30, 60, 120, 240 and 360 min following iv administration and at 30, 60, 120, 240, 360, 480 and 1440 min following oral administration. Blood samples were collected into tubes containing the anti-coagulant lithium heparin, mixed and placed promptly on crushed ice. Plasma was derived from whole blood by centrifugation, frozen and stored at −80° C. prior to analysis. Plasma concentrations were determined by liquid chromatography-tandem mass spectrometry in electrospray positive mode (ESI LC/MS/MS) using calibration curves prepared in the appropriate matrix. The lower level of quantification (LLOQ) in all cases was ca. 5 ng/mL. Plasma concentration-time data was processed using the computer program WinNonLin version 5.2 from which areas under the plasma concentration-time curve (AUCall) were calculated by non-compartmental analysis using Model 201 (IV-bolus Input) or Model 200 (Extravascular Input).


(b) Comparison of Compounds [371] and [378] with Selected Prior Art Compounds


Further pharmacokinetic studies were carried to compare compounds [371] and [378] with a series of related analogues (see Table 7; compound [371] corresponds to compound H; compound [378] corresponds to compound I).



FIG. 1 plots the area under the curve (AUC) for plasma concentration vs time for each compound tested. The dosing vehicle across these experiments remained constant (intravenous=citrate buffer pH 3, 1 mL/kg; oral=DMA/PEG400/10 nM Tartrate buffer, pH 4 (1:3:6), 5 ml/kg). FIG. 2 represents the same data in the form of oral bioavailability (% F) for each compound.


The results indicate that compounds H and I exhibit markedly superior systemic exposure and oral bioavailability compared to compounds A-G.


Example 9

(a) Cellular Efflux Data


In vitro cell viability assays have been used to measure the effect of drug accumulation in paired parental and drug resistant tumour cell lines. The pairs used are the human ovarian carcinoma A2780 line with its MDR counterpart A2780/ADR and the human uterine sarcoma MES-SA line with its MDR counterpart MES-SA/Dx5 [Wesolowska O., et al. (2005) Anticancer Res., 25, 383-389].


Method: Cultivated human tumour cells of the ovarian cell line A2780 and its doxorubicin-resistant pair, A2780/ADR and the uterine cell line MES-SA and its doxorubicin-resistant pair, MES-SA/DX5 were seeded at 3000 cells per well in Nunc 96-well tissue culture plates, 100 μl per well in DMEM media containing 10% foetal calf serum and penicillin/streptomycin. The wells of the first column in each plate were filled with 100 μl DMEM media instead of cells to provide a blank control for the Alamar Blue. The cells were incubated overnight at 37° C. and 5% CO2. The compounds of interest, dissolved in DMSO, were added on to the cells at various concentrations. Dilutions of the compounds were first prepared in DMEM at twice the final desired concentration and 100 μl of the dilutions added on to the cells. Each set of compounds were tested in triplicate in each cell line. After 72 hours incubation, 20 μl Alamar Blue reagent (AbD Serotec) were added to each well and incubated for 3 hours. The plates were then read at 544/595 nm.


The amount of Alamar Blue reagent reacted represents the metabolic activity of the cells. The relative cell activity was calculated as a percentage of the control (cells without compound) and the active compound concentration which inhibited the cell activity by 50% (IC50) was derived. The values were calculated from the average of three individual measurements with blank correction (medium-only control).


The assay was performed on the Biomek FxP, automation platform from Beckman Coulter. The plates were read on the Paradigm plate reader supplied by Beckman Coulter. Asymmetry ratios were calculated as the IC50 value of the compound in the drug resistant cells divided by the IC50 value in the parental cells. FIG. 3 shows a comparison of selected compounds versus prior art compounds A′-J′ (defined in Table 8) in parental and MDR tumor cells. Asymmetry ratios are presented relative to compound [378].


(b) Inhibition of PLK1


In addition, compounds of this invention which exhibit low MDR/parental cell asymmetry in cell viability assays are also more effective at inhibiting PLK1 within MDR tumour cells than compounds of the prior art. Thus, they have greater potential as therapeutic PLK inhibitors. The intermediate filament protein vimentin is a cellular target of PLK1 phosphorylation. Inhibition of PLK1 is associated with a decrease in phospho-vimentin. This has been measured in the A2780- A2780/ADR cell line pair.


Method: A2780 cells and A2780/ADR cells were plated in separate 96-well plates (Perkin Elmer) at a density of 20 000 cells/well and incubated overnight at 37° C. and 5% CO2. Test compounds were added to cells at a range of concentrations, with triplicate wells for each concentration (top concentration of DMSO on cells was 0.1%). After 7 hrs incubation, the cells were fixed in ice-cold 3.7% formaldehyde for 10mins. The cells were washed in PBS, then permeabilised in cold methanol for 10 mins. The cells were washed again in PBS then incubated with PBS containing 0.1% Triton X-100 for 5mins. Cells were washed once with PBS containing 1% bovine serum albumin (Sigma) then incubated for 3hrs with antibodies to phospho-histone H3-Ser10 (1:4000; Millipore) and phospho-vimentin-Ser82 (1:1000; MBL), in 1% bovine serum albumin. Antibodies were detected with goat anti-mouse IgG conjugated to Alexafluor 488 (Invitrogen) and goat anti-rabbit IgG conjugated to Alexafluor 546 (Invitrogen), in 1% bovine serum albumin with 300nM DAPI (Cambridge Biosciences). Plates were scanned on a Cellomics Arrayscan II HCS Reader (Cellomics) using a 10× objective. The Cell Health Profiling V2 Bioapplication (Cellomics) was used to acquire and analyse the images. Phospho-vimentin staining, at intensities above a user-defined threshold, was measured in mitotic cells only (defined by the presence of phospho-histone H3) and the average staining intensity per mitotic cell for each well was reported. IC50 values were derived using average values from three replicate wells. Asymmetry ratios were calculated as the IC50 value of the compound in the drug resistant A2780/ADR cells divided by the IC50 value in the parental A2780 cells. FIG. 3 shows a comparison of selected compounds versus prior art compounds A′-J′ (defined in Table 8) in parental and MDR tumor cells. As before, asymmetry ratios are presented relative to compound [378].


Various modifications and variations of the described aspects of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes of carrying out the invention which are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.









TABLE 1







PLK IC50 values (μM) for selected compounds of the invention;













AA
PLK1















1


embedded image


*
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzoic acid





2


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





3


embedded image



*
4-(9-Cyclopentyl-8-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzoic acid





4


embedded image



*
4-(9-Cyclopentyl-5,8-dimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzoic acid





5


embedded image



*
4-(9-Cyclohexyl-8-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzoic acid





6


embedded image




4-(9-Cyclopentyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzoic acid





7


embedded image


*
**
4-(9-Cyclohexyl-8-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzoic acid





8


embedded image


***
**
4-(9-Cyclopentyl-5,8-dimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzoic acid





9


embedded image


*

4-(9-Cyclohexyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzoic acid





10


embedded image



*
9-Cyclohexyl-2-(4-hydroxy-phenylamino)-5,7,8,9- tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one





11


embedded image



*
9-Cyclopentyl-2-(4-hydroxy-phenylamino)-7- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one





12


embedded image




9-Cyclopentyl-2-(4-hydroxy-phenylamino)-8- isopropyl-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one





13


embedded image



*
9-Cyclopentyl-2-(4-hydroxy-phenylamino)-5,8- dimethyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one





14


embedded image




4-(9-Benzyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzoic acid





15


embedded image


**
*
4-(5-Methyl-6-oxo-9-phenyl-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)- benzoic acid





16


embedded image




4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzoic acid





17


embedded image



*
4-(9-Cyclopentyl-7-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





18


embedded image


*
*
4-(9-Cyclopentyl-7-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide





19


embedded image



*
4-(9-Cyclopentyl-8-isopropyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





20


embedded image



***
4-(9-Cyclopentyl-5,7-dimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





21


embedded image




4-[9-(1-Ethyl-propyl)-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]-3- methoxy-N-(1-methyl-piperidin-4-yl)-benzamide





22


embedded image




4-[9-(1-Ethyl-propyl)-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]- N-(1-methyl-piperidin-4-yl)-benzamide





23


embedded image



*
4-(9-Cyclopentyl-8-isopropyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1- methyl-piperidin-4-yl)-benzamide





24


embedded image



*
4-[9-(1-Ethyl-propyl)-5-methyl-6-oxo-6,7, 8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





25


embedded image




3-Methoxy-N-(1-methyl-piperidin-4-yl)-4-[6- oxo-9-(tetrahydro-pyran-4-yl)-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino]- benzamide





26


embedded image



**
3-Methoxy-4-[5-methyl-6-oxo-9-(tetrahydro- pyran-4-yl)-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-N-(1-methyl-piperidin- 4-yl)-benzamide





27


embedded image




4-[5-Ethyl-9-(1-ethyl-propyl)-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





28


embedded image



**
4-(9-Cyclopentyl-5-ethyl-7-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





29


embedded image



*
4-(9-Benzyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-N-(1-methyl-piperidin-4-yl)-benzamide





30


embedded image



**
3-Methoxy-4-(5-methyl-6-oxo-9-phenyl-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide





31


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane]-2-ylamino)-N-(1-methyl- piperidin-4-yl)-benzamide





32


embedded image




4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





33


embedded image



**
4-(9-Cyclopentyl-5,8-dimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





34


embedded image



**
4-(9-Cyclopentyl-8-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





35


embedded image



**
4-(9-Cyclohexyl-8-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide





36


embedded image



*
4-(9-Cyclopentyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-N-(1-methyl-piperidin-4-yl)-benzamide





37


embedded image


**
**
4-(9-Cyclopentyl-5,8-dimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide





38


embedded image



**
4-(9-Cyclopentyl-8-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)-benzamide





39


embedded image



*
4-(9-Cyclohexyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-N-(1-methyl-piperidin-4-yl)-benzamide





***denotes <0.1 μM IC50;


**denotes <1.0 μM IC50;


*denotes <10.0 μM IC50


















TABLE 2







AurA
PLK1




Cpd

IC50
IC50
Name
Data




















40


embedded image



***
4-(9-Cyclopentyl-7-ethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1- methyl-piperidin-4-yl)-benzamide
MS(+ve) : 536.3; tR = 3.33 min (xbridge 4).





41


embedded image


***
**
4-(9-Cyclopentyl-7-ethyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzoic acid
MS(+ve): 410.2; tR = 2.28 min (xbridge 4).





42


embedded image


**
*
4-(9-tert-Butyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4- yl)-benzamide
MS(+ve): 496.3; tR = 2.88 min (xbridge 4).





43


embedded image


**

4-(9-tert-Butyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzoic acid
MS(+ve): 370.1; tR = 2.08 min (xbridge 4).





44


embedded image


*

4-[9-(3,4-Dimethoxy-benzyl)-5,7-dimethyl-6- oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-3-methoxy-N-(1- methyl-piperidin-4-yl)-benzamide
MS(+ve): 604.4; tR = 2.87 min (xbridge 4).





45


embedded image


*

4-[9-(3,4-Dimethoxy-benzyl)-5,7-dimethyl-6- oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-benzoic acid
MS(+ve): 478.2; tR = 2.12 min (xbridge 4).





46


embedded image


***
*
9-Cyclopentyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one

1H NMR (DMSO): 1.56 (4H, m, CH2), 1.70 (2H, m, CH2), 1.89 (2H, m, CH2), 2.65 (2H, m, CH2), 3.16 (3H, s, NCH3), 3.67 (2H, m, CH2), 4.45 (4H, d, J 10 Hz, CH2), 4.84 (1H, m, CH), 7.33 (1H, d, J 8 Hz, Ar—H), 7.57 (1H, d, J 8 Hz, Ar—H), 7.71 (1H, s, Ar—H), 8.05 (1H, s, Ar—H), 9.96 (1H, s, NH); MS (+ve): 428.3; tR = 6.54 min (XBridge 2).






47


embedded image


***
*
9-Cyclopentyl-5-methyl-2-[4-(morpholine-4- sulfonyl)-phenylamino]-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one

1H NMR (DMSO): 1.60-1.99 (8H, m, alkyl-H), 2.50 (4H, bs, morph-H), 2.58- 2.60 (2H, m, CH2), 2.83 (4H, bs, morph- H), 3.18 (3H, s, CH3), 3.31 (2H, J 4.5 Hz, CH2), 4.79-4.84 (1H, m, CH), 7.60 (2H, d, J 8 Hz, Ar—H), 7.98 (2H, d, J 8 Hz, Ar—H), 8.11(1H, s, Ar—H), 9.77 (1H, bs, NH); MS(+ve): 487.31; tR = 3.07 min (Xbridge 4).






48


embedded image



*
3-Methoxy-4-[9-(3-methoxy-phenyl)-5-methyl- 6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-N-(1-methyl- piperidin-4-yl)-benzamide

1H NMR (DMSO): 1.58 (2H, dd, J 12.5 Hz, 22 Hz, CH), 1.74 (211, d, J 12 Hz, CH), 1.90 (2H, dd, J 11.5, 11.5 Hz, CH), 2.16 (3H, s, N—CH3), 2.79 (4H, m, CH + CH2), 3.29 (3H, s, N—CH3), 3.69 (1H, m, CH), 3.70 (3H, s, OCH3), 3.88 (3H, s, OCH3), 4.04 (2H, m, CH2), 6.88 (2H, m, Ar—H), 6.99 (1H, d, J 8 Hz, Ar—H), 7.37 (2H, m, Ar—H), 7.54 (1H, d, J 8 Hz, Ar—H), 7.56 (1H, s, NH), 8.00 (1H, d, J 7.5 Hz, Ar—H), 8.29 (1H, s, Pyr-H): MS(+ve); 546.4; tR = 2.58 min (xbridge 4).






49


embedded image


*
*
4-[9-(3-Methoxy-phenyl)-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 2-ylamino]-benzoic acid
MS(+ve); 420.22; tR = 1.44 min (xbridge 4).





50


embedded image


***
*
4-[9-(2-Fluoro-phenyl)-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-benzoic acid
MS(+ve); 408.2; tR =2.59 min (xbridge 4).





51


embedded image


**
**
9-Cyclopentyl-5-methyl-2-(4-morpholin-4-yl- phenylamino)-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one

1H NMR (DMSO): 1.56 (4H, m, CH2), 1.68 (2H, m, CH2), 1.91 (2H, m, CH2), 2.55 (2H, m, CH2), 3.01 (4H, m, CH2), 3.14 (3H, s, NCH3), 3.57 (2H, m, CH2), 3.73 (4H, m, CH2), 4.77 (1H, m, CH), 6.85 (1H, d, J 9 Hz, Ar—H), 7.55 (1H, d, J 9 Hz, Ar—H), 7.99 (1H, s, Ar—H), 8.92 (1H, s, NH); MS (+ve): 423.3; tR = 7.09 min (XBridge 2); tR = 10.51 min (Vydac 1).






52


embedded image



**
4-[9-(2-Fluoro-phenyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-3-methoxy-N-(1-methyl-piperidin-4- yl)-benzamide

1H NMR (DMSO): 1.58 (2H, dd, J 9.5 Hz, 21 Hz, CH), 1.74 (2H, d, J 11.5 Hz, CH), 1.92 (2H, dd, J 11 Hz, 11 Hz, CH), 2.16 (3H, s, N—CH3), 2.76 (2H, d, J 11 Hz, CH), 2.86 (2H, m, CH2), 3.70 (1H, m, CH), 3.82 (3H, s, OCH3), 4.02 (2H, m, CH2), 6.92 (2H, d, J 8.5 Hz, Ar—H), 7.32 (1H, d, J 8.5 Hz, Ar—H), 7.37 (2H, m, Ar— H), 7.46 (1H, m, Ar—H), 7.56 (1H, m, Ar— H), 7.66 (1H, s, NH), 7.99 (1H, d, J 7.5 Hz, Ar—H), 8.28 (1H, s, Ar—H): MS(+ve); 534.3; tR = 2.59 min (xbridge 4).






53


embedded image


**
**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzenesulfonamide

1H NMR (DMSO): 1.41-1.75 (8H, alkyl- H), 2.45 (2H, bs, CH2), 2.99 (3H, s, CH3), 3.47 (2H, bs, CH2), 4.74-4.75 (1H, m, CH), 7.13 (2H, bs, NH2), 7.29 (2H, bs, Ar—H), 7.59 (1H, bs, Ar—H), 7.89 (1H, bs, Ar—H), 8.06 (1H, bs, Ar—H), 9.72 (1H, bs, NH); MS(+ve): 417.22; tR = 2.62 (Xbridge 4).






54


embedded image


***
***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzoic acid

1H NMR (DMSO): 1.58-1.72 (6H, m, alkyl-H), 193-1.95 (2H, m, alkyl-H), 2.64 (2H, dd, J 4.5 Hz, CH2), 3.17 (3H, s, CH3), 3.67 (2H, dd, J 4.5 Hz, CH2), 4.83-4.89 (1H, m, CH), 7.78 (2H, dd, J 1.5 and 8 Hz, Ar-H), 7.87 (2H, d, J 8.5 Hz, Ar—H), 8.09 (1H, d, J 1.5 Hz, Ar—H), 10.02 (1H, s, NH); MS(+ve): 382.22; tR = 1.60 (Xbridge 4).






55


embedded image


***
*
9-Cyclopentyl-2-(4-methanesulfonyl- phenylamino)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one

1H NMR (DMSO): 1.61-1.99 (8H, m, alkyl-H), 2.59 (2H, dd, J 5 Hz, CH2), 3.14 (3H, s, CH3), 3.17 (3H, s, CH3), 3.63 (2H, dd, J 5 Hz, CH2), 4.82- 4.86 (1H, m, CH), 7.76 (2H, d, J 9 Hz, Ar—H), 7.98 (2H, d, J 9 Hz, Ar—H), 8.11 (1H, s, Ar—H), 9.77 (1H, bs, NH); MS(+ve): 416.26; tR = 2.83 (Xbridge 4).






56


embedded image


**
**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzoic acid

1H NMR (DMSO): 1.39-1.73 (8H, m, alkyl-H), 2.48 (2H, bs, CH2), 2.99 (3H, s, CH3), 3.49 (2H, bs, CH2), 4.77 (1H, bs, CH), 7.26 (1H, bs, Ar—H), 7.44 (1H, bs, Ar—H), 7.52 (1H, bs, Ar—H), 7.89 (1H, bs, Ar—H), 8.23 (1H, bs, Ar—H), 9.83 (1H, bs, NH); MS(+ve): 382.28; tR = 1.93 (Xbridge 4).






57


embedded image


**
*
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)- benzamide

1H NMR (DMSO): 1.54-1.64(8H, m, alkyl-H), 1.74-1.76 (2H, m, alkyl-H), 1.90-2.01 (4H, m, alkyl-H), 2.18 (3H, s, CH3), 2.56 (2H, dd, J 5 Hz, CH2), 2.77- 2.80 (2H, m, alkyl-H), 3.16 (3H, s, CH3), 3.59 (2H, dd, J 5 Hz, CH2), 3.69-3.73 (1H, m, CH), 4.79-4.84 (1H, m, CH), 7.27-7.33 (2H, m, Ar—H), 7.74 (1H, d, J 8 Hz, Ar—H), 8.04 (1H, 1H, J 1 Hz, Ar—H), 8.11 (1H, d, J 8 Hz, Ar—H), 8.17 (1H, s, Ar—H), 9.28 (1H, s, NH); MS(+ve): 478.33; tR = 2.60 (Xbridge 4).






58


embedded image


***
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-2-methoxy-N-(1-methyl-piperidin-4- yl)-benzamide

1H NMR (DMSO): 1.50 (6H, m, CH), 1.70 (2H, m, CH), 1.81 (2H, m, CH), 1.98 (2H, m, CH), 2.07 (2H, m, CH), 2.16 (3H, s, NCH3), 2.57 (2H, m, CH2), 2.63 (2H, m, CH), 3.17 (3H, s, NCH3), 3.61 (2H, m, CH2), 3.75 (1H, m, CH), 3.89 (3H, s, OCH3), 4.86 (1H? CH), 7.48 (1H, s, ArH), 7.54 (1H, dd, J 2 Hz, 8.5 Hz, NH), 7.73 (1H, d, J 8.5 Hz, ArH), 7.83 (1H, d, J 7.5 Hz, ArH), 8.09 (1H, s, pyrH), 9.44 (1H, s, NH); MS(+ve); 508.4; tR = 2.68 min (xbridge 4).






59


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-ethoxy-N-(1-methyl-piperidin-4-yl)- benzamide

1H NMR (DMSO): 1.44 (3H, t, J 6.5Hz), 1.59 (4H, m, CH), 1.76 (2H, m, CH), 1.93 (2H, m, CH), 2.16 (3H, s, N[13 CH3), 2.59 (2H, m, CH2), 2.78 (2H, d, J 11.5 Hz, CH2), 3.17 (3H, s, CH3), 3.63 (2H, m, CH2), 3.73 (1H, m, CH), 4.20 (2H, q, J 7 Hz, CH2CH3), 4.79 (1H, m, CH), 7.48 (2H, m, Ar—H), 7.70 (1H, s, NH), 8.06 (2H, m, Ar—H), 8.38 (1H, d, J 8.5 Hz, NH); MS(+ve); 522.4; tR = 2.88 min (xbridge 4).






60


embedded image



**
9-Cyclopentyl-2-(2-methoxy-phenylamine)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one

1H NMR (DMSO): 1.57 (4H, m, CH), 1.68 (2H, m, CH), 1.90 (2H, m, CH), 2.57 (2H, m, CH2), 3.16 (3H, s, N—CH3), 3.62 (2H, m, CH2), 3.86 (3H, s, OCH3), 4.75 (1H, m, CH), 6.90 (1H, dd, J 8 Hz, 8 Hz, Ar—H), 6.95 (1H, dd, J 8 Hz, 8 Hz, Ar—H), 7.02 (1H, d, J 8 Hz, Ar—H), 7.60 (1H, s, NH), 8.03 (1H, s, pyr-H), 8.20 (1H, d, J 8 Hz, Ar—H): MS(+ve); 368.3; tR =3.74 min (xbridge 4).






61


embedded image


**
*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)- benzenesulfonamide

1H NMR (DMSO): 1.57 (4H, m, CH2), 1.71 (2H, m, CH2), 1.93 (2H, m, CH2), 2.55 (2H, m, CH2), 2.70 (4H, m, CH2), 2.91 (4H, m, CH2), 3.17 (3H, s, NCH3), 3.63 (2H, m, CH2), 4.81 (1H, m, CH), 7.50 (1H, d, J 7 Hz, NH), 7.66 (2H, d, J 9 Hz, Ar—H), 7.89 (2H, d, J 9 Hz, Ar—H), 8.09 (1H, s, Ar—H), 9.67 (1H, s, NH); MS (+ve) 514.4; tR = 6.29 min (XBridge 2).






62


embedded image



**
2-Benzylamino-9-cyclopentyl-5-methyl- 5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one






63


embedded image


***
*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzenesulfonamide






64


embedded image


***
***
4-(9-Cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-N-(1- methyl-piperidin-4-yl)-benzamide
1H NMR (DMSO): 1.61-2.20 (16H, alkyl-H), 2.58 (2H, dd, J 5 Hz, CH2), 2.69 (3H, s, CH3), 3.31 (3H, s, CH3), 3.62 (2H, dd, J 5 Hz, CH2), 4.81-4.84 (1H, m, CH), 7.74-7.80 (2H, m, Ar—H), 8.08 (1H, s, Ar—H), 9.46 (1H, s, NH); MS(+ve): 478.40; tR = 2.56 (Xbridge 4).





65


embedded image



***
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1- methyl-piperidin-4-yl)-benzamide
1H NMR (DMSO): 0.29 (2H, d, J 4 Hz, cyclopropyl CH), 0.52 (2H, d, J 4 Hz, cyclopropyl CH), 1.16 (1H, m, CH), 1.58 (2H, dd, J 11.5, 20.5, CH), 1.75 (2H, m, CH), 1.95 (2H, dd, J 10 Hz, 10 Hz, CH), 2.16 (3H, s, NCH3), 2.64 (2H, m, CH2), 2.79 (2H, d, J 11.5 Hz, CH), 3.18 (3H, s, NCH3), 3.50 (2H, d, J 6.5 Hz, CH2), 3.73 (1H, m, CH), 3.79 (2H, m, CH2), 3.94 (3H, s, OCH3), 7.48 (2H, m, ArH), 7.71 (1H, s, ArH), 8.07 (2H, m, ArH), 8.40 (1H, d, J 9 Hz, ArH) ;MS(+ve); 494.38; tR = 2.60 min (xbridge 4).





66


embedded image



**
4-(9-Butyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-N-(1-methyl-piperidin-4-yl)- benzamide
1H NMR (DMSO): 0.91 (3H, t, J 7 Hz, CH3), 1.34 (2H, m, CH2), 1.62 (4H, m, CH2), 1.75 (2H, m, CH2), 1.93 (2H, d, J 11 Hz, CH2), 2.16 (3H, s, NCH3), 2.61 (2H, m, CH2), 2.77 (2H, d, J 11.5 Hz, CH2), 3.16 (3H, s, NCH3), 3.56 (2H, m, CH2), 3.70 (3H, m, CH2 + CH), 3.94 (3H, s, OCH3), 7.48 (2H, m, ArH), 7.70 (1H, s, ArH), 8.06 (1H, s, ArH), 8.08 (1H, d, J 8 Hz, ArH), 8.34 (1H, d, J 8.5 Hz, ArH); MS(+ve); 496.4; tR = 2.69 min (xbridge 4).





67


embedded image



***
4-(9-Isopropyl-5-methyl-6-oxo-6,7,8,9 tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4- yl)-benzamide
1H NMR (DMSO): 1.24 (6H, d, J 7 Hz, CH3), 1.61 (2H, ddd, J 3.5 Hz, 12 Hz, 18 Hz, CH), 1.76 (2H, d, J 9.5 Hz, CH), 1.93 (dd, J 9.5 Hz, 12 Hz, CH), 2.16 (3H, s, CH2), 2.59 (2H, m, CH2), 2.78 (2H, d, J 12 Hz, CH), 3.16 (3H, s, NCH3), 3.60 (2H, m, CH2), 3.73 (1H, m, CH), 3.94 (3H, s, OCH3), 4.80 (1H, m, CH), 7.48 (1H, d, J 1.5 Hz, ArH), 7.51 (1H, d, J 8.5 Hz, ArH), 7.68 (1H, s, ArH), 8.06 (2H, m, ArH), 8.1 (1H, d, J 8.5 Hz, ArH); MS(+ve); 482.3; tR = 2.55 min (xbridge 4).





68


embedded image



**
3-Methoxy-4-[5-methyl-9-(3-methyl-butyl)-6- oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-N-(1-methyl- piperidin-4-yl)-benzamide
1H NMR (DMSO): 0.92 (6H, d, J 7 Hz, CH3), 1.54 (4H, m, CH2), 1.62 (2H, d, J 9.5 Hz, CH), 1.93 (2H, dd, J 9.5 Hz, 12 Hz, CH), 2.16 (3H, s, NCH3), 2.60 (2H, m, CH2), 2.78 (2H, d, J 11.5 Hz, CH), 3.16 (3H, s, NCH3), 3.67 (2H, m, CH2), 3.71 (2H, m, CH2), 3.73 (1H, m, CH), 3.94 (3H, s, OCH3); MS(+ve); 510.4; tR = 2.85 min (xbridge 4).





69


embedded image



**
4-(9-Cyclopentylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1- methyl-piperidin-4-yl)-benzamide
1H NMR (DMSO): 1.23 (2H, m ,CH2), 1.49 (2H, m, CH2), 1.59 (4H, m, 2 x CH2), 1.69 (2H, m, CH2), 1.75 (2H, m, CH2), 1.93 (2H, dd, J 10 Hz, 12 Hz, CH2), 2.16 (3H, s, NCH3), 2.36 (1H, m, CH), 2,62 (2H, m, CH2), 2.79 (2H, d, J 12 Hz, CH2), 3.29 (3H, s, NCH3), 3.60 (2H, d, J 7.5 Hz, CH2), 3.73 (2H, m, CH2), 3.94 (3H, s, OCH3), 7.49 (2h, M, ArH), 7.70 (1H, S, ArH), 8.08 (2H, M, ArH), 8.32 (1H, d, J 8.5 Hz, ArH); MS(+ve); 522.4; tR = 2.89 min (xbridge 4).


70


embedded image


**
*
9-Cyclopentyl-5-methyl-2-phenylamino- 5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.62-2.00 (8H, m, alkyl-H), 2.76 (2H, dd, J 5 Hz, CH2), 3.27 (3H, s, CH3), 3.76 (2H, dd, J 5 Hz, CH2), 4.96-4.99 (1H, m, CH), 7.01-7.04 (1H, m, Ar—H), 7.16 (1H, t, J 7.5 Hz, Ar— H), 7.29 (1H, t, J 7.5 H, Ar—H), 7.37 (1H, t, J 7.5 Hz, Ar—H), 7.54-7.55 (2H, m, Ar— H), 7.89 (1H, bs, NH); MS(+ve): 338.26; tR = 3.52 (Xbridge 4).





71


embedded image



***
9-Cyclopentyl-2-(2,4-dimethoxy- phenylamino)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.53 (4H, m, CH), 1.65 (2H, m, CH), 1.83 (2H, m, CH), 2.54 (2H, m, CH2), 3.14 (3H, s, NCH3), 3.55 (2H, m, CH2), 3.73 (3H, s, OCH3), 3.81 (3H, s, OCH3), 4.64 91H, m, CH), 6.47 (1H, dd, J 3 Hz, 9 Hz, ArH), 6.61 (1H, d, J 3 Hz, ArH), 7.51 (1H, s, NH), 7.86 (1H, d, J 9 Hz, ArH), 7.97 (1H, s, PyrH); MS(+ve); 398.3; tR =3.51 min (xbridge 4).





72


embedded image


**

2-(4-Chloro-3-methyl-phenylamino)-9- cyclopentyl-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (9 (3H,(3H, 30D): 1.62-1.99 (8H, m, alkyl-H), 2.39 (3H, s, CH3), 2.76 (2H, dd, J 5.5 Hz, CH2), 3.23 (3H, s, CH3), 3.77 (2H, dd, J 5.5 Hz, CH2), 4.96-5.00 (1H, m, CH), 7.33-7.34 (2H, m, Ar—H), 7.56 (1H, s, Ar—H), 7.90 (1H, s, Ar—H); MS(+ve): 386.23; tR = 4.13 (Xbridge 4).





73


embedded image


***

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-9-(2-fluoro- phenyl)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 2.82 (2H, m, CH2), 3.27 (3H, s, CH3), 4.0 (2H, m, CH2), 4.12 (2H, s, CH2), 4.30 (2H, s, CH2), 6.91 (1H, d, J 8.5 Hz, CH), 7.16 (2H, m, 2CH), 7.36 (2H, m, 2CH), 7.43 (1H, m, CH), 7.56 (1H, m, CH), 8.28 (1H, s, CH), 9.50 (1H, s, NH); MS(+ve): 454.3; tR = 2.67 min (XBridge 4).





74


embedded image


***
**
9-Cyclopentyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)-7- ethyl-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 0.87 (3H, t, J 7.5 Hz, CH2CH3), 1.29-1.79 (9H, m, 4CH2, CH), 2.08 (1H, m, CH), 2.59 (1H, m, CHEt), 3.18 (3H, s, CH3), 3.38 (2H, d, J 6.5 Hz, NCH2), 4.4 (4H, m, 2CH2), 4.77 (1H, m, CH), 7.24 (1H, d, J 8.5 Hz, CH), 7.63 (1H, d, J 8.5 Hz, CH), 7.83 (1H, s, CH), 8.08 (1H, s, CH), 9.38 (1H, s, NH); MS(+ve): 456.3; tR = 3.31 min (XBridge 4).





75


embedded image


***

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-methyl-9- phenyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 2.78 (2H, m, CH2), 3.27 (3H, s, CH3), 4.03 (2H, m, CH2), 4.09 (2H, s, CH2), 4.30 (2H, s, CH2), 6.93 (1H, d, J 8.5 Hz, CH), 7.19 (1H, d, J 8.5 Hz, CH), 7.29 (4H, m, 4CH), 7.46 (2H, m, 2CH), 8.3 (1H, s, CH), 9.49 (1H, s, NH); MS(+ve): 436.3; tR = 2.66 min (XBridge 4).





76


embedded image


***
**
9-Cyclopentyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)-5,7- dimethyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.01 (3H, d, J 6.5 Hz, CH3), 1.4-1.85 (6H, m, 3CH2), 2.07 (1H, m, CH), 2.83 (1H, m, CH), 3.18 (3H, s, CH3), 3.3 (2H, d, CH2), 3.4 (1H, t, J 11.5 Hz, CH), 4.3-4.5 (4H, m, 2CH2), 4.73 (1H, m, CH), 7.24 (1H, d, J 8.5 Hz, CH), 7.64 (1H, dd, J 9, 2 Hz, CH), 7.84 (1H, s, CH), 8.06 (1H, s, CH), 9.37 (1H, s, NH); MS(+ve): 442.3; tR = 3.06 min (XBridge 4).





77


embedded image


**
**
9-Cyclopentyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)- 5,7,7-trimethyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.09 (6H, s, 2CH3), 1.58 (4H, m, 2CH2), 1.72 (2H, m, CH2), 1.86 (2H, m, CH2), 3.18 (3H, s, CH3), 3.35 (2H, s, CH2), 4.39 (2H, s, CH2), 4.43 (2H, s, CH2), 5.21 (1H, m, CHN), 7.23 (1H, d, J 8.5 Hz, CH), 7.6 (1H, dd, J 8.5, 2 Hz, CH), 7.83 (1H, s, CH), 7.95 (1H, s, CH), 9.30 (1H, s, NH); MS(+ve): 456.3; tR = 3.25 min (XBridge 4).





78


embedded image


***
**
(9-Cyclopentyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- spiro[pyrimido[4,5-b][1,4]diazepin-3,1′- cyclopropane]
1H NMR (DMSO): 0.66 (2H, m, CH2), 0.89 (2H, m, CH2), 1.47 (2H, m, CH2), 1.56 (2H, m, CH2), 1.67 (2H, m, CH2), 1.88 (2H, m, CH2), 3.16 (3H, s, CH3), 3.45 (2H, s, CH2), 4.39 (2H, s, CH2), 4.42 (2H, s, CH2), 4.86 (1H, m, CHN), 7.23 (1H, d, J 8.5 Hz, CH), 7.63 (1H, dd, J 8.5, 2 Hz, CH), 7.84 (1H, s, CH), 7.95 (1H, s, CH), 9.31 (1H, s, NH); MS(+ve): 454.3; tR = 3.03 min (XBridge 4).





79


embedded image


***

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-9-(1-ethyl- propyl)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 0.83 (6H, t, J 7.5 Hz, 2CH3), 1.58 (4H, m, 2CH2), 2.61 (2H, m, CH2), 3.17 (3H, s, CH3), 3.46 (2H, m, CH2), 4.39 (2H, s, CH2), 4.44 (2H, s, CH2), 4.66 (1H, m, CHN), 7.23 (1H, d, J 8.5 Hz, CH), 7.68 (1H, dd, J 8.5, 2 Hz, CH), 7.75 (1H, s, CH), 8.03 (1H, s, CH), 9.29 (1H, s, NH); MS(+ve): 430.3; tR = 2.88 min (XBridge 4).





80


embedded image


**

9-Cyclopentyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)-8- isopropyl-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 0.72 (3H, d, J 7 Hz, CH3), 0.84 (3H, d, J 7 Hz, CH3), 1.26-2.4 (10H, m, 5CH2), 2.54 (1H, m, CH), 3.14 (3H, s, CH3), 3.85 (1H, m, CH), 4.2 (1H, m, CH), 4.39-4.5 (4H, m, 2CH2), 7.25 (1H, d, J 8.5 Hz, CH), 7.68 (1H, dd, J 8.5, 2 Hz, CH), 7.84 (1H, s, CH), 8.24 (1H, s, CH), 9.49 (1H, s, NH); MS(+ve): 470.3; tR = 3.30 min (XBridge 4).





81


embedded image


**

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-methyl-9- (tetrahydro-pyran-4-yl)-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.7 (2H, m, CH2), 1.85 (2H, m, CH2), 2.57 (2H, m, CH2), 3.16 (3H, s, CH3), 3.43 (2H, t, J 11 Hz, CH2), 3.62 (2H, m, CH2), 3.97 (2H, m, CH2), 4.39 (2H, s, CH2), 4.46 (2H, s, CH2), 4.58 (1H, m, CHN), 7.26 (1H, d, J 8.5 Hz, CH), 7.63 (1H, s, CH), 7.73 (1H, dd, J 8.5, 2 Hz, CH), 8.06 (1H, s, CH), 9.36 (1H, s, NH); MS(+ve): 444.3; tR = 2.35 min (XBridge 4).





82


embedded image


**

9-Benzyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 2.69 (2H, m, CH2), 3.22 (3H, s, CH3), 3.62 (2H, m, CH2), 4.01 (2H, s, CH2), 4.31 (2H, s, CH2), 4.86 (2H, s, CH2Ph), 7.04 (1H, d, J 8.5 Hz, CH), 7.42-7.27 (6H, m, 6CH), 7.69 (1H, s, CH), 8.13 (1H, s, CH), 9.40 (1H, s, NH); MS(+ve): 450.3; tR =2.78 min (XBridge 4).





83


embedded image


***
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzamide
1H NMR (DMSO): 1.61 (4H, m, CH), 1.72 (2H, m, CH), 1.93 (2H, m, CH), 2.63 (2H, m, CH2), 3.17 (3H, s, N—CH3), 3.66 (2H, m, CH2), 4.85 (1H, m, CH), 7.18 (1H, bs, NH), 7.72 (2H, d, J 8.5 Hz, Ar—H), 7.83 (2H, d, J 8.5 Hz, Ar—H), 8.06 (1H, s, pyr-H), 9.77 (1H, bs, NH): MS(+ve); 381.3; tR = 2.45 min (xbridge 4).





84


embedded image


*
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- benzoic acid
1H NMR (DMSO): 0.66 (2H, m, cyclopropyl-CH), 0.90 (2H, m, cyclopropyl-CH), 1.50 (2H, m, CH), 1.58 (2H, m, CH), 1.69 (2H, m, CH), 1.91 (2H, m, CH), 3.17 (3H, s, N—CH3), 3.47 (2H, s, CH2), 4.88 (1H, m, CH), 7.81 (4H, m, Ar—H), 7.99 (1H, s, NH), 9.56 (1H, s, pyr- H): MS(+ve); 408.3; tR = 1.81 min (xbridge 4).





85


embedded image


***
*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N,N-dimethyl-benzamide
1H NMR (DMSO): 1.59 (4H, m, CH), 1.70 (2H, m, CH), 1.94 (2H, m, CH), 2.58 (2H, m, CH2), 2.96 (6H, s, CH3), 3.16 (3H, s, N—CH3), 3.62 (2H, m, CH2), 4.81 (1H, m, CH), 7.31 (2H, d, J 8.5 Hz, Ar—H), 7.78 (2H, d, J 8.5 Hz, Ar—H), 8.06 (1H, s, N—H), 9.41 (1H, s, pyr-H): MS(+ve); 409.3; tR = 2.71 min (xbridge 4).





86


embedded image


***
*
N-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzyl]-acetamide
1H NMR (CD3OD): 1.62-1.98 (8H, m, alkyl-H), 2.00 (3H, s, CH3), 2.80 (2H, dd, J 5 Hz, CH2), 3.27 (3H, s, CH3), 3.80 (2H, dd, J 5 Hz, CH2), 4.37-4.38 (2H, m, CH2), 4.98-5.02 (1H, m, CH), 7.36 (2H, d, J 8.5 Hz, Ar—H), 7.47 (2H, d, J 8.5 Hz, Ar—H), 7.83 (1H, s, Ar—H), 8.50 (1H, bs, NH); MS(+ve): 409.33; tR = 2.53 (Xbridge 4).





87


embedded image


*
***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-methyl-benzamide






88


embedded image


*
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N,N-dimethyl-benzamide






89


embedded image


*
***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzamide






90


embedded image


**
*
N-[3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzyl]-acetamide






91


embedded image


**
*
2-(3-Aminomethyl-phenylamino)-9- cyclopentyl-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one






92


embedded image



*
9-Cyclopentyl-2-(4-methoxy-benzylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one






93


embedded image


***
*
N-Benzyl-4-(9-cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)- benzenesulfonamide
1H NMR (CD3OD): 1.68-1.81 (8H, m, alkyl-H), 2.69-2.71 (2H, m, CH2), 3.29 (3H, s, CH3), 3.73-3.75 (2H, m, CH2), 4.06 (2H, s, CH2), 7.21-7.27 (5H, m, Ar—H), 7.73 (2H, d, J 9 Hz, Ar—H), 7.84 (2H, d, J 9 Hz, Ar—H), 8.04 (1H, bs, NH); MS(+ve): 507.28; tR = 3.39 (Xbridge 4).





94


embedded image



*
9-Cyclopentyl-5-methyl-2-[(thiophen-2- ylmethyl)-amino]-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (CD3OD): 1.61 (4H, m, CH), 1.73 (2H, m, CH), 1.92 (2H, m, CH), 2.63 (2H, m, CH2), 3.23 (3H, s, N—CH3), 3.66 (2H, m, CH2), 4.71 (2H, s, CH2), 6.93 (6.93 (1H, m, Ar—H), 6.97 (1H, m, Ar—H), 7.23 (1H, m, Ar—H), 7.84 (1H, s, pyr-H): MS(+ve); 358.3; tR = 3.32 min (xbridge 4).





95


embedded image



*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-phenyl-benzamide
1H NMR (CD3OD): 1.51-2.00 (8H, m, alkyl-H), 3.28 (3H, s, CH3), 2.69 (2H, dd, J 5.5 Hz, CH2), 3.72 (2H, dd, J 5.5 Hz, CH2), 4.03 (3H, s, CH3), 5.04-5.08 (1H, m, CH) 7.12-7.16 (2H, m, Ar—H), 7.34-7.37 (3H, m, Ar—H), 7.65 (1H, dd, J 2 and 8.5 Hz, Ar—H), 7.70-7.72 (2H, m, Ar—H), 7.80 (1H, s, Ar—H), 8.82 (1H, d, J 2 Hz, Ar—H); MS(+ve): 487.35; tR = 3.46 (Xbridge 4).





96


embedded image


***
*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-methyl-benzenesulfonamide
1H NMR (CD3OD): 1.67-2.01 (8H, m, alkyl-H), 2.55 (3H, s, CH3), 2.80 (2H, dd, J 4.5 Hz, CH2), 3.29 (3H, s, CH3), 5.01- 5.04 (1H, m, CH), 7.78-7.81 (2H, m, Ar—H), 7.84-7.86 (2H, m, Ar—H), 7.96- 8.00 (2H, m, Ar—H and NH); MS(+ve): 431.32; tR = 2.81 (Xbridge 4)





97


embedded image


***
*
N-Acetyl-4-(9-cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-N-methyl- benzenesulfonamide
1H NMR (CD3OD): 1.68-2.04 (8H, m, alkyl-H), 2.34 (3H, s, CH3), 2.76 (2H, dd, J 5 Hz, CH2), 3.29 (3H, s, CH3), 3.31 (3H, s, CH3), 3.79 (2H, dd, J 5 Hz, CH2), 4.94-5.00 (1H, m, CH), 7.86 (2H, d, J 9 Hz, Ar—H), 7.91 (2H, d, J 9 Hz, Ar—H), 8.01 (1H, s, Ar—H); MS(+ve): 473.35; tR = 3.15 (Xbridge 4).





98


embedded image



**
9-Cyclopentyl-2-(1H-indol-7-ylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.50-1.86 (8H, m, alkyl-H), 2.77 (2H, dd, J 4.5 Hz, CH2), 3.23 (3H, s, CH3), 3.74 (2H, dd, J 4.5 Hz, CH2), 4.87-4.91 (1H, m, CH), 6.63 (1H, s, Ar—H), 7.16 (1H, t, J 8 Hz, Ar—H), 7.33 (1H, d, J 8 Hz, Ar—H), 7.42-7.47 (3H, m, Ar—H), 8.03-8.04 (1H, m, Ar—H), 9.94 (1H, bs, NH), 11.31 (1H, bs, NH); MS(+ve): 377.28; tR =3.13 (Xbridge 4).





99


embedded image



***
4-(9-Isopropyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide
1H NMR (DMSO): 0.68 (2H, m, cyclopropyl CH), 0.92 (2H, m, cyclopropyl CH), 1.17 (6H, d, J 6.5 Hz, CH3), 1.57 (2H, ddd, J 3.5 Hz, 12 Hz, 15 Hz, CH), 1.77 (2H, d, J 10 Hz, CH), 1.95 (2H, dd, J 10 Hz, 10 Hz, CH), 2.16 (3H, s, NCH3), 2.79 (2H, d, J 11.5 Hz, CH), 3.18 (3H, s, NCH3), 3.46 (2H, s, CH2), 3.77 (1H, m, CH), 3.46 (3H, s, OCH3), 4.84 (1H, m, CH), 7.48 (1H, s, Ar—H), 7.51 (1H, d, J 8.5 Hz, Ar—H), 7.97 (1H, s, Pyr-H), 8.08 (1H, d, J 8 Hz, Ar—H), 8.41 (1H, d, J 8.5 Hz, Ar—H); MS(+ve); 508.4; tR = 2.74 min (xbridge 4).





100


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclobutane]-2-ylamino)- 3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide
1H NMR (DMSO): 1.60 (8H, m, CH + CH2), 1.75 (4H, m, CH), 1.87-1.99 (6H, m, CH + CH2), 2.16 (3H, s, NCH3), 2.29 (2H, m, CH), 2.79 (2H, d, J 11 Hz, CH), 3.18 (3H, s, NCH3), 3.64 (2H, s, CH2), 3.73 (1H, m, CH), 3.94 (3H, s, OCH3), 4.82 (1H, m, CH), 7.48 (2H, m, Ar—H), 7.71 (1H, s, NH), 8.05 (1H, s, pyrH), 8.09 (1H, d, J 8 Hz, Ar—H), 8.36 (1H, d, J 8 Hz, Ar—H); MS(+ve); 548.4; tR = 3.20 min (xbridge 4).





101


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7.8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopentane]-2-ylamino)- 3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide
1H NMR (DMSO): 1.30 (2H, m, CH2), 1.51-1.63 (10H, m,4 x CH2), 1.88 (4H, m, 2xCH2), 1.91-2.17 (6H, m, 3 x Ch2), 2.17 (3H, s, NCH3), 2.89 (2H, d, J 8.5 Hz, CH), 3.19 (3H, s, NCH3), 3.41 (2H, s, CH2), 3.71 (1H, m, CH), 3.94 (3H, s, OCH3), 5.02 (1H, m, CH), 7.48 (2H, m, Ar—H), 7.69 (1H, s, Ar—H), 8.01 (1H, s, Ar—H), 8.09 (1H, d, J 7.5 Hz, Ar— H), 8.38 (1H, d, J 8.5 Hz, Ar—H); MS(+ve); 562.5; tR = 3.45 min (xbridge 4).





102


embedded image



**
4-(9-Allyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin- 2-ylamino)-3-methoxy-N-(1-methyl- piperidin-4-yl)-benzamide
1H NMR (CD3OD): 1.72 (2H, m, CH2), 1.96 (2H, m, CH2), 2.23 (2H, dd, J 10.5 Hz, 10.5 Hz, CH), 2.33 (3H, s, NCH3), 2.73 (2H, m, CH2), 2.94 (2H, d, J 12 Hz, CH2), 3.76 (2H, m, CH2), 3.91 (1H, m, CH), 4.01 (3H, s, OCH3), 4.30 (2H, d, J 5.5 Hz, CH2), 5.30 (2H, m, ═CH2), 6.06 (1H, m, ═CH), 7.46 (1H, dd, J 8.5 Hz, 2 Hz, ArH), 7.50 (1H, d, J 2 Hz, ArH), 8.06 (1H, s, pyrH), 8.49 (1H, d, J 8.5 Hz, ArH); MS(+ve); 480.3; tR = 2.49 min (xbridge 4).





103


embedded image


**
*
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)- benzenesulfonamide






104


embedded image


***
*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-methoxy-ethyl)- benzenesulfonamide
1H NMR (CD3OD): 1.67-1.99 (8H, m, alkyl-H), 2.80 (2H, dd, J 7.5 Hz, CH2), 3.04-3.06 (2H, m, CH2), 3.26 (3H, s, CH3), 3.38-3.41 (2H, m, CH2), 3.82 (2H, dd, J 4.5 Hz, CH2), 5.01-5.04 (1H, m, CH), 7.76-7.79 (2H, m, Ar—H), 7.85- 7.87 (2H, m, Ar—H), 7.96 (1H, s, Ar—H); MS(+ve): 475.33; tR = 2.87 (Xbridge 4).





105


embedded image


**

9-Cyclopentyl-5-methyl-2-[4-(4-methyl- piperazine-1-sulfonyl)-phenylamino]-5,7,8,9- tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one
MS(+ve): 500.33; tR = 2.97 (Xbridge 4).





106


embedded image



*
9-Cyclopentyl-5-methyl-2-[(thiophen-3- ylmethyl)-amino]-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one






107


embedded image



*
9-Cyclopentyl-2-[(furan-3-ylmethyl)-amino]-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one






108


embedded image


**
*
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-methoxy-ethyl)- benzenesulfonamide






109


embedded image


**
**
9-Cyclopentyl-5-methyl-2-[3-(pyrrolidine-1- sulfonyl)-phenylamino]-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one






110


embedded image


**
*
N-Benzyl-3-(9-cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)- benzenesulfonamide






111


embedded image



**
4-(5,9-Dimethyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-N-(1-methyl-piperidin-4-yl)- benzamide
1H NMR (DMSO): 1.63 (2H, m, CH), 1.79 (2H, m, CH), 2.26 (2H, m, CH), 2.60 (2H, m, CH2), 2.89 (2H,m , CH), 3.06 (3H, s, NCH3), 3.17 (3H, s, NCH3), 3.29 (3H, s, NCH3), 3.68 (2H, m, CH2), 3.78 (1H, m, CH), 3.94 (3H, s, OCH3), 7.47 (1H, s, ArH), 7.53 (1H, d, J 9 Hz, ArH), 8.10 (2H, m, ArH), 8.46 (1H, d, J 8.5 Hz, ArH); MS(+ve); 454.4; tR = 2.33 min (xbridge 4).





112


embedded image



*
4-(5,9-Dimethyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-N-methyl-benzamide
1H NMR (DMSO): 2.60 2H, m, CH2), 2.78 (3H, m, NCH3), 3.06 (3H, s, NCH3), 3.17 (3H, s, NCH3), 3.68 (2H, m, CH2), 3.93 (3H, s, OCH3), 7.49 (2H, m, ArH), 7.73 (1H, m, ArH), 8.10 (1H, d, J 2.5 Hz, ArH), 8.29 (1H, bs, NH), 8.45 (1H, dd, J 9 Hz, 2.5 Hz, ArH); MS(+ve); 371.3; tR = 2.29 min (xbridge 4).





113


embedded image



**
4-(9-Isopropyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-methoxy-N-methyl-benzamide
1H NMR (DMSO): 0.67 (2H, m, cyclopropyl H), 0.92 (2H, m, cyclopropyl H), 1.17 (6H, d, J 6.5Hz), 2.78 (3H, d, J 5 Hz, NCH3), 3.16 (3H, s, NCH3), 3.46 (2H, s, CH2), 3.93 (3H, s, OCH3), 4.83 (1H, m, CH), 7.47 (2H, m, ArH), 7.63 (1H, s, NH), 7.97 (1H, s, pyrH), 8.29 (1H, d, J4.5 Hz, NH), 8.42 (1H, d, J 8.5 Hz, ArH); MS(+ve); 425.3; tR = 2.70 min (xbridge 4)





114


embedded image


***

9-Cyclopropylmethyl-2-(2,2-dioxo-2,3-dihydro- 1H-2lambda*6*-benzo[c]thiophen-5-ylamino)- 5-methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
MS(+ve): 414.2; tR =2.64 min (XBridge 4).





115


embedded image


***
*
2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-9-isopropyl-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.21 (6H, d, J 7 Hz, 2CH3), 2.58 (2H, t, J 5 Hz, CH2), 3.16 (3H, s, CH3), 3.59 (2H, t, J 5 Hz, CH2), 4.39 (2H, s, CH2), 4.46 (2H, s, CH2), 4.8 (1H, m, CH(CH3)2), 7.24 (1H, d, J 8,5 Hz, CH), 7.59 (1H, dd, J 8.5, 2 Hz, CH), 7.87 (1H, s, CH), 8.03 (1H, s, CH), 9.39 (1H, s, NH); MS(+ve): 402.3; tR = 2.58 min (XBridge 4).





116


embedded image


**

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-methyl-9-(3- methyl-butyl)-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 0.90 (3H, s, CH3), 0.91 (3H, s, CH3), 1.51 (2H, m, CH2), 1.60 (1H, m, CH(CH3)2), 2.60 (2H, t, J 5.0 Hz, C(O)CH2), 3.15 (3H, s, CH3N), 3.59 (2H, t, J 7.5 Hz, CH2N), 3.67 (2H, t, J 5.0H, CH2N), 4.39 (2H, s, CH2), 4.43 (2H, s, CH2), 7.22 (111, d, J 8 Hz, CH), 7.69 (1H, s, CH), 7.74 (1H, d, J 8 Hz, CH), 8.04 (1H, s, CH), 9.37 (1H, s, NH); MS(+ve): 430.3; tR = 3.01 min (XBridge 4).





117


embedded image


**
**
(9-Cyclopentyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- spiro[pyrimido[4,5-b][1,4]diazepin-3,1′- cyclobutane+
1H NMR (DMSO): 1.5-2.0 (12H, m, 6CH2), 2.27 (2H, m, CH2), 3.18 (3H, s, CH3), 3.62 (2H, s, CH2N), 4.40 (2H, s, CH2), 4.43 (2H, s, CH2), 4.82 (1H, m, CHN), 7.24 (1H, d, J 8 Hz, CH), 7.62 (1H, d, J 8 Hz, CH), 7.83 (1H, s, CH), 8.04 (1H, s, CH), 9.35 (1H, s, NH); MS(+ve): 468.3; tR = 3.32 min (XBridge 4).





118


embedded image


**

(9-Cyclopentyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- spiro[pyrimido[4,5-b][1,4]diazepin-3,1′- cyclopentane]
1H NMR (DMSO): 1.33 (2H, m, CH2), 1.45-1.65 (8H, m, 4CH2), 1.71 (2H, m, CH2), 1.89 (2H, m, CH2), 2.01 (2H, m, CH2), 4.39 (2H, s, CH2), 4.43 (2H, s, CH2), 5.02 (1H, m, CHN), 7.24 (1H, d, J 8.5 Hz, CH), 7.61 (1H, d, J 8.5 Hz, CH), 7.82 (1H, s, CH), 7.98 (1H, s, CH), 9.37 (1H, s, NH); MS(+ve): 482.3; tR = 3.57 min (XBridge 2).





119


embedded image


***
*
9-Allyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 2.64 (2H, m, CH2), 3.18 (3H, s, CH3), 3.63 (2H, m, CH2), 4.17 (2H, m, CH2), 4.39 (2H, s, CH2), 4.42 (2H, s, CH2), 5.22 (2H, m, CH═CH2), 5.97 (1H, m, CH═CH2), 7.22 (1H, d, J 8.5 Hz, CH), 7.59 (1H, dd, J 8.5, 2 Hz, CH), 7.85 (1H, s, CH), 8.08 (1H, s, CH), 9.43 (1H, s, NH); MS(+ve): 400.3; tR = 2.60 min (XBridge 4).





120


embedded image


***

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-ethyl-9-(1- ethyl-propyl)-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 0.83 (6H, t, J 7.5 Hz, 2CH3), 0.93 (3H, t, J 7 Hz, CH2CH3), 1.59 (4H, m, 2CH2), 2.57 (2H, m, CH2), 3.45 (2H, m, CH2), 3.74 (2H, q, J 7.0 Hz, CH2CH3), 4.4 (2H, m, CH2), 4.45 (2H, s, CH2), 4.58 (1H, m, CHN), 7.25 (1H, d, J 8 Hz, CH), 7.69 (1H, d, J 8 Hz, CH), 7.73 (1H, s, CH), 8.08 (1H, s, CH), 9.38 (1H, s, NH); MS(+ve): 442.3; tR = 3.08 min (XBridge 4).





121


embedded image


**

9-tert-Butyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 2.60 (2H, m, CH2), 3.19 (3H, s, CH3), 3.54 (2H, m, CH2), 4.38 (2H, s, CH2), 4.43 (2H, s, CH2), 7.21 (1H, d, J 8.5 Hz, CH), 7.45 (1H, s, NH), 7.68 (1H, dd, J 8.5, 2 Hz, CH), 7.89 (1H, s, CH), 8.06 (1H, s, CH), 9.3 (1H, s, NH); MS(+ve): 360.2; tR = 2.18 min (XBridge 4).





122


embedded image


**

9-tert-Butyl-2-(2,2-dioxo-2,3-dihydro-1H- 2lambda*6*-benzo[c]thiophen-5-ylamino)-5- ethyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 0.91 (3H, t, J 7.0 Hz, CH2CH3), 1.41 (9H, s, C(CH3)3), 2.39 (2H, t, J 6 Hz, CH2), 3.60 (2H, t, J 6 Hz, CH2), 3.67 (2H, q, J 7.0 Hz, CH2), 4.4 (2H, s, CH2), 4.45 (2H, s, CH2), 7.26 (1H, d, J 8 Hz, CH), 7.62 (1H, d, J 8 Hz, CH), 7.83 (1H, s, CH), 8.22 (1H, s, CH), 9.41 (1H, s, NH); MS(+ve): 430.3; tR = 2.94 min (XBridge 4).





123


embedded image


**
**
2-(4-Chloro-phenylamino)-9-cyclopentyl-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.61 (4H, m, 2CH2), 1.68 (2H, m, CH2), 1.92 (2H, m, CH2), 2.57 (2H, t, J 5 Hz, CH2), 3.16 (3H, s, CH3), 3.60 (2H, t, J 5 Hz, CH2), 4.78 (1H, m, CHN), 7.28 (2H, d, J 9 Hz, 2CH), 7.74 (2H, d, J 9 Hz, 2CH), 8.04 (1H, s, CH), 9.35 (1H, s, NH); MS(+ve): 372.3; tR = 3.93 min (XBridge 4).





124


embedded image


*
*
9-Cyclopentyl-2-[(furan-2-ylmethyl)-amino]-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one






125


embedded image


***
**
9-Cyclopentyl-5-methyl-2-(2-methyl-1H-indol- 5-ylamino)-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (CD3OD): 2.38-2.80 (8H, m, alkyl-H), 3.15 (3H, s, CH3), 3.36 (2H, dd, J 5 Hz, CH2), 3.96 (3H, s, CH3), 4.39 (2H, dd, J 5 Hz, CH2), 5.60-5.64 (1H, m, CH), 6.78 (1H, s, Ar—H), 7.91-7.98 (2H, m, Ar—H), 8.68 (1H, s, Ar—H), 8.80 (1H, s, Ar—H), 9.65 (1H, s, Ar—H), 11.47 (1H, bs, NH); 391.35; tR = 3.21 (Xbridge 4).





126


embedded image


*

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-ethyl-5,7,8,9- tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.02 (3H, t, J 7 Hz, CH2CH3), 2.55 (2H, m, CH2), 3.53 (2H, m, CH2), 3.74 (2H, q, J 7 Hz, CH2CH3), 4.4 (2H, s, CH2), 4.43 (2H, s, CH2), 7.22 (1H, d, J 8.5 Hz, CH), 7.42 (1H, s, NH), 7.68 (1H, dd, J 8.5, 1.5 Hz, CH), 7.89 (1H, s, CH), 8.10 (1H, s, CH), 9.35 (1H, s, NH); MS(+ve): 374.2; tR = 2.2 min (XBridge 4).





127


embedded image



*
9-Cyclopentyl-2-[(2,3-dihydro- benzo[1,4]dioxin-6-ylmethyl)-amino]-5-methyl- 5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.50-1.78 (8H, m, alkyl-H), 2.48 (2H, dd, J 5.5 Hz, CH2), 3.09 (3H, s, CH3), 3.50 (2H, dd, J 5.5 Hz, CH2), 4.17-4.19 (4H, m, 2 × CH2), 4.27 (2H, d, J 6 Hz, CH2NH), 4.57 (1H, bs, CH), 6.75-6.78 (3H, m, Ar—H), 7.22 (1H, bs, NH), 7.89 (1H, s, Ar—H); MS(+ve): 410.35; tR = 3.22 (Xbridge 4).





128


embedded image


*
**
9-Cyclopentyl-2-[(2,3-dihydro- benzo[1,4]dioxin-5-ylmethyl)-amino]-5-methyl- 5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.46-1.99 (8H, m, alkyl-H), 2.61 (2H, dd, J 5.5 Hz, CH2), 3.23 (3H, s, CH3), 3.63 (2H, dd, J 5.5 Hz, CH2),(2H, m, CH2), 4.29-4.32 (2H, m, CH2), 4.50 (2H, s, CH2), 4.66-4.69 (1H, m, CH), 6.71- 6.72 (m, 2H, Ar—H), 6.77-6.79 (1H, m, Ar—H), 7.83 (1H, s, AR-H); MS(+ve): 410.35; tR = 3.34 (Xbridge 4).





129


embedded image



*
2-[(Benzo[b]thiophen-2-ylmethyl)-amino]-9- cyclopentyl-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.17-1.60 (8H, m, alkyl-H), 2.48 (2H, dd, J 4.5 Hz, 2H, CH2), 3.10 (3H, s, CH3), 3.49 (2H, dd, J 4.5 Hz, CH2), 4.65 (2H, d, J 6 Hz, CH2NH), 7.35-7.42 (4H, m, Ar—H), 7.89 (1H, s, Ar—H), 7.95-7.97 (1H, m, Ar—H); MS(+ve): 408.30; tR = 3.78 (Xbridge 4).





130


embedded image


**
*
9-Cyclopentyl-2-(1H-indo1-6-ylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (CD3OD): 1.60-1.80 (8H, m, alkyl-H), 2.02 (3H, s, CH3), 2.65 (2H, dd, J 5.5 Hz, CH2), 3.68 (2H, dd, J 5.5 Hz, CH2), 6.37 (1H, d, J 2.5 Hz, Ar—H), 6.88 (1H, s, Ar—H), 7.12-7.18 (1H, m, Ar—H), 7.21 (1H, d, J 3 Hz, Ar—H), 7.84 (1H, d, J 1.5 Hz, Ar—H), 7.90 (1H, s, Ar—H); MS(+ve): 377.32; tR = 3.02 (Xbridge 4).





131


embedded image



*
9-Cyclopentyl-5-methyl-2-(3-methyl- benzylamino)-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.48-1.77 (8H, m, alkyl-H), 2.27 (3H, s, CH3), 2.47 (2H, dd, J 4.5 Hz, CH2), 3.09 (3H, s, CH3), 3.50 (2H, dd, J 4.5 Hz, CH2), 4.36 (2H, d, J 6 Hz, CH2), 4.56 (1H, bs, CH), 7.00 (1H, d, J 7.5 Hz, Ar—H), 7.08-7.11 (2H, m, Ar— H), 7.16 (1H, t, J 7.5 Hz, Ar—H), 7.27 (1H, bs, NH), 7.86 (1H, s, Ar—H); MS(+ve): 366.29; tR = 3.65 (Xbridge 4).





132


embedded image


*
*
9-Cyclopentyl-5-methyl-2-(4-[1,2,3]thiadiazol- 4-yl-benzylamino)-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (CD3OD): 1.59-1.79 (8H, m, alkyl-H), 2.75 (2H, dd, J 5 Hz, CH2), 3.24 (3H, s, CH3), 3.73 (2H, dd, J 5 Hz, CH2), 4.71 (2H, s, CH2), 7.53 (2H, d, J 8 Hz, Ar—H), 7.83 (1H, s, Ar—H), 8.12 (2H, d, J 8 Hz, Ar—H), 9.26 (1H, s, Ar—H); MS(+ve): 436.29; tR = 3.28 (Xbridge 4).





133


embedded image


**

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-9-(2-methoxy- phenyl)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 2.80 (2H, m, CH2), 3.26 (3H, s, CH3), 3.69 (3H, s, CH3), 3.87 (2H, m, CH2), 4.13 (2H, s, CH2), 4.29 (2H, s, CH2), 6.88 (1H, d, J 8 Hz, CH), 7.08 (1H, m, CH), 7.12 (2H, m, 2CH), 7.22 (1H, d, J 8 Hz, CH), 7.31 (1H, m, CH), 7.41 (1H, m, CH), 8.17 (1H, s, CH), 9.36 (1H, s, NH); MS(+ve): 466.3; tR = 2.68 min (XBridge 4).





134


embedded image


**

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-methyl-9-o- tolyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 2.06 (3H, s, CH3), 2.8 (1H, s, CH), 2.93 (1H, s, CH), 3.28 (3H, s, CH3), 3.82 (1H, s, CH), 4.03 (1H, s, CH), 4.09 (2H, d, J 8.5 Hz, CH2), 4.28 (2H, s, CH2), 6.85 (1H, d, J 9 Hz, CH), 7.09 (2H, m, 2CH), 7.35 (4H, m, 4CH), 8.19 (1H, s, CH), 9.38 (1H, s, NH); MS(+ve): 450.25; tR = 2.76 min (XBridge 4).





135


embedded image


**

9-(2-Chloro-phenyl)-2-(2,2-dioxo-2,3-dihydro- 1H-2lambda*6*-benzo[c]thiophen-5-ylamino)- 5-methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
MS(+ve): 470.21; tR = 2.76 min (XBridge 4).





136


embedded image


**

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-9-(3-methoxy- phenyl)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 2.77 (2H, m, CH2), 3.27 (3H, s, CH3), 3.74 (3H, s, CH3), 4.02 (2H, m, CH2), 4.10 (2H, s, CH2), 4.32 (2H, s, CH2), 6.89 (3H, m, 3CH), 6.95 (1H, d, J 8.5 Hz, CH), 7.25 (1H, d, J 9 Hz, CH), 7.36 (2H, m, 2CH), 8.3 (1H, s, CH), 9.51 (1H, s, NH); MS(+ve): 466.3; tR = 2.68 min (XBridge 4).





137


embedded image


***
*
9-Cyclopentyl-5-methyl-2-m-tolylamino- 5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.58 (4H, m, 2CH2), 1.7 (2H, m, CH2), 1.95 (2H, m, CH2), 2.26 (3H, s, CH3), 2.56 (2H, m, CH2), 3.16 (3H, s, CH3), 3.60 (2H, m, CH2), 4.84 (1H, m, CHN), 6.71 (1H, d, J 7.5 Hz, CH), 7.10 (1H, m, CH), 7.40 (1H, d, J 8 Hz, CH), 7.67 (1H, s, CH), 8.03 (1H, s, CH), 9.11 (1H, s, NH); MS(+ve): 352.3; tR = 3.72 min (XBridge 4).





138


embedded image


**
*
9-Cyclopentyl-2-(3-methoxy-phenylamino)-5- methyl-5,7.8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.57 (4H, m, 2CH2), 1.69 (2H, m, CH2), 1.95 (2H, m, CH2), 2.56 (2H, m, CH2), 3.16 (3H, s, CH3), 3.60 (2H, m, CH2), 3.72 (3H, s, CH3), 4.82 (1H, m, CHN), 6.48 (1H, dd, J 8, 2 Hz, CH), 7.12 (1H, t, J 8 Hz, CH), 7.25 (1H, dd, J 8, 1 Hz, CH), 7.45 (1H, s, CH), 8.04 (1H, s, CH), 9.15 (1H, s, NH); MS(+ve): 368.3; tR = 3.47 min (XBridge 4).





139


embedded image


***
**
9-Cyclopentyl-2-(1H-indazol-5-ylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.58-1.95 (8H, m, alkyl-H), 2.54 (2H, dd, J 5 Hz, CH2), 3.16 (3H, s, CH3), 3.60 (2H, dd, J 5 Hz, CH2), 4.80-4.84 (1H, m, CH), 7.41 (1H, d, J 9 Hz, Ar—H), 7.52 (1H, d, J 9 Hz, Ar—H), 7.89 (1H, s, Ar—H), 8.04 (1H, s, Ar—H), 8.21 (1H, s, Ar—H), 9.14 (1H, bs, NH), 12.86 (1H, bs, NH); MS(+ve): 376.30; tR = 2.59 (Xbridge 4).





140


embedded image


*
*
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-2-methyl-N-(1-methyl-piperidin-4-yl)- benzamide
1H NMR (DMSO): 1.47 (6H, m, CH), 1.62 (2H, m, CH), 1.81 (4H, m, CH), 1.93 (2H, dd, J 10 Hz, 10 Hz, CH), 2.14 (3H, s, CH3), 2.19 (3H, s, CH3), 2.54 (2H, m, CH2), 2.74 (2H, m, CH2), 3.14 (3H, s, CH3), 3.54 (2H, m, CH2), 3.69 (1H, m, CH), 4.65 (1H, m, CH), 6.96 (1H, d, J7 Hz, Ar—H), 7.15 (1H, dd, J 7.5 Hz, 7.5 Hz, Ar—H), 7.63 (1H, d, J 7 Hz, Ar—H), 7.96 (1H, s, NH), 8.15 (1H, d, J 8 Hz, Ar— H), 8.35 (1H, s, Pyr-H): MS(+ve); 492.4; tR = 2.57 min (xbridge 4).





141


embedded image



*
3-(9-Cyctopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-2,N-dimethyl-benzamide
1H NMR (DMSO): 1.45 (4H, m, CH), 1.62 (2H, m, CH), 1.80 (2H, m, CH), 2.19 (3H, s, N—CH3), 2.55 (2H, m, CH2), 2.74 (3H, d, J 5 Hz, N—CH3), 3.29 (3H, s, CH3), 3.56 (2H, m, CH2), 4.61 (1H, s, CH), 6.99 (1H, d, J 8 Hz, Ar—H), 7.16 (1H, dd, J 7.5 Hz, 8 Hz, Ar—H), 7.61 (1H, d, J 8 Hz, Ar—H), 7.96 (1H, s, NH), 8.13 (1H, m, Ar—H), 8.35 (1H, s, Pyr-H): MS(+ve); 409.3; tR = 2.58 min (xbridge 4).





142


embedded image



*
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-hydroxy-ethyl)-2-methyl- benzamide
1H NMR (DMSO): 1.47 (4H, m, CH), 1.62 (2H, m, CH), 1.79 (2H, m, CH), 2.14 (3H, s, CH3), 2.20 (3H, s, CH3), 2.55 (2H, m, CH2), 3.14 (3H, s, CH3), 3.27 (2H, m, CH2), 3.49 (2H, m, CH2), 3.56 (2H, m, CH2), 4.63 (1H, m, CH), 4.67 (1H, bs, OH), 7.01 (1H, d, J7 Hz, Ar—H), 7.16 (1H, dd, J 7.5 Hz, 7.5 Hz, Ar—H), 7.63 (1H, d, J 7 Hz, Ar—H), 7.96 (1H, s, NH), 8.13 (1H, m, Ar—H), 8.35 (1H, s, Pyr-H): MS(+ve); 439.3; tR = 2.39 min (xbridge 4).





143


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-4-methoxy-N-(1-methyl-piperidin-4- yl)-benzamide
1H NMR (DMSO): 1.49-1.57 (8H, m, CH), 1.74 (2H, m, CH), 1.84 (2H, m, CH), 1.94 (2H, dd, J 10.5 Hz, 10.5 Hz, CH), 2.15 (3H, s, CH3), 2.53 (2H, m, CH2), 2.76 (2H, d, J 11.5 Hz, CH), 3.16 (3H, s, NCH3), 3.58 (2H, m, CH2), 3.68 (1H, m, CH), 3.89 (3H, s, OCH3), 4.81 (1H, m, CH), 7.04 (1H, d, J 8.5 Hz, Ar—H), 7.50 (1H, d, J 8.5 Hz, Ar—H), 7.70 (1H, s, NH), 8.00 (1H, d, J 7 Hz, Ar—H), 8.03 (1H, s, NH), 8.56 (1H, s, pyr-H): MS(+ve); 508.4; tR = 2.64 min (xbridge 4).





144


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-4-methoxy-N-methyl-benzamide
1H NMR (DMSO): 1.60 (6H, m, CH), 1.86 (2H, m, CH), 2.56 (2H, m, CH2), 2.74 (3H, d, J 4.5 Hz, NCH3), 3.16 (3H, s, NCH3), 3.58 (2H, m, CH2), 3.90 (3H, s, CH3), 4.42 (1H, m, CH), 7.04 (1H, d, J 8.5 Hz, Ar—H), 7.43 (1H, d, J 8.5 Hz, Ar—H), 7.68 (1H, s, NH), 8.04 (1H, s, N-H), 8.20 (1H, m, Ar—H), 8.60 (1H, s, pyr-H): MS(+ve); 425.3; tR = 2.64 min (xbridge 4).





145


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-hydroxy-ethyl)-4-methoxy- benzamide
1H NMR (DMSO): 1.55 (6H, m, CH), 1.86 (2H, m, CH), 2.56 (2H, m, CH2), 3.16 (3H, s, CH3), 3.30 (2H, m, CH2), 3.49 (2H, m, CH2), 3.59 (2H, m, CH2), 3.90 (3H, s, OCH3), 4.69 (1H, m, CH), 4.84 (1H, bs, OH), 7.04 (1H d, J8.5Hz, Ar—H), 7.48 (1H, d, J 8 Hz, Ar—H), 7.61 (1H, s, NH), 8.03 (1H, s, NH), 8.21 (1H, d, J5.5 Hz, Ar—H), 8.61 (1H, s, pyr-H): MS(+ve); 455.3; tR = 2.46 min (xbridge 4).





146


embedded image


*
*
9-Cyclopentyl-5-methyl-243-(piperazine-1- sulfonyl)-phenylamino]-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one






147


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(3-dimethylamino-propyl)-3- methoxy-N-methyl-benzamide






148


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-diethylamino-ethyl)-3-methoxy- benzamide






149


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(3-dimethylamino-propyl)-3- methoxy-benzamide






150


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-((1S,2R)-2-hydroxy-indan-1-yl)-3- methoxy-benzamide






151


embedded image


*
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(4-hydroxy-butyl)-3-methoxy- benzamide






152


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-((R)-1-hydroxymethyl-2-methyl- propyl)-3-methoxy-benzamide






153


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-hydroxymethyl-propyl)-3- methoxy-benzamide






154


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-hydroxy-propyl)-3-methoxy- benzamide






155


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1,1-dimethyl-2-pyrrolidin-1-yl- ethyl)-3-methoxy-benzamide






156


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1,1-dimethyl-2-piperidin-1-yl- ethyl)-3-methoxy-benzamide






157


embedded image



***
N-(1-Benzyl-piperidin-4-yl)-4-(9-cyclopentyl-5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






158


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4- ylmethyl)-benzamide






159


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(3-hydroxy-propyl)-3-methoxy- benzamide






160


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(4-methyl-piperazin-1- yl)-benzamide






161


embedded image



***
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-4-(9- cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






162


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1,2,2,6,6-pentamethyl- piperidin-4-yl)-benzamide






163


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-3- yl)-benzamide






164


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-hydroxy-butyl)-3-methoxy- benzamide






165


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(3-dimethylamino-2,2-dimethyl- propyl)-3-methoxy-benzamide






166


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-hydroxy-ethyl)-3-methoxy- benzamide






167


embedded image



*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N,N-bis-(2-hydroxy-ethyl)-3- methoxy-benzamide






168


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-[2-(2-hydroxy-ethoxy)-ethyl]-3- methoxy-benzamide






169


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3,N-dimethoxy-benzamide






170


embedded image


***
*
3-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-phenyl]-propionic acid






171


embedded image


***
*
N-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-phenyl]-acetamide






172


embedded image


***
*
[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-phenyl]-acetic acid






173


embedded image


***
*
9-Cyclopentyl-5-methyl-2-(2-oxo-2,3-dihydro- 1H-indo1-5-ylamino)-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.51-1.69 (8H, m, alkyl-H), 1.85 (2H, bs, CH2), 2.66 (2H, dd, J 4.5 Hz, CH2), 3.15 (3H, s, CH3), 3.66 (2H, dd, J 4.5 Hz, Ch2), 4.78-4.83 (1H, m, CH), 6.79 (1H, d, J 8 Hz, Ar—H), 7.30 (1H, d, J 8 Hz, Ar—H), 7.47 (1H, s, Ar—H), 7.96 (1H, s, Ar—H), 9.86 (1H, bs, NH), 10.35 (1H, bs, NH); MS(+ve): 393.32; tR = 2.46 (Xbridge 4).





174


embedded image


*
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methyl-benzoic acid
1H NMR (DMSO): 1.49-1.83 (8H, m, alkyl-H), 2.31 (3H, s, CH3), 2.57 (2H, dd, J 4.5 Hz, CH2), 3.14 (3H, s, CH3), 3.58 (2H, dd, J 4.5 Hz, CH2), 4.68-4.71 (1H, m, CH), 7.70 (1H, d, J 8.5 Hz, Ar—H), 7.75 (1H, s, Ar—H), 7.98 (1H, d, J 8.5 Hz, Ar—H), 9.04 (1H, s, Ar—H), 8.35 (s, 1H, Ar— H), 12.55 (1H, bs, NH); MS(+ve): 396.32; tR = 1.78 (Xbridge 4).





175


embedded image


*

9-Cyclopentyl-2-[2-(1H-indo1-3-yl)-1-methyl- ethylamino]-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (CD3OD): 1.22 (3H, d, J 5.5 Hz, CH3), 1.52-1.97 (8H, m, alkyl-H), 2.57 (2H, dd, J 6 Hz, CH2), 2.90- 3.04 (2H, m, CH2), 3.19 (3H, s, CH3), 3.58 (2H, dd, J 6 Hz, CH2), 4.35- 4.39 (1H, m, CH), 4.68-4.74 (1H, m, CH), 6.97 (1H, t, J 8 Hz, Ar—H), 7.04-7.08 (2H, m, Ar— H), 7.31 (1H, d, J 8 Hz, Ar—H), 7.54 (1H, d, J 8 Hz, Ar—H), 7.75 (1H, s, Ar—H); MS(+ve): 419.36; tR = 3.60 (Xbridge 4).





176


embedded image


***
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-cyclopropyl-benzamide
1H NMR (DMSO): 0.55 (2H, m, CH2), 0.66 (2H, m, CH2), 1.61 (4H, m, 2CH2), 1.72 (2H, m, CH2), 1.95 (2H, m, CH2), 2.58 (2H, m, CH2), 2.81 (1H, m, CH), 3.17 (3H, s, CH3), 3.62 (2H, m, CH2), 4.82 (1H, m, CHN), 7.72 (2H, d, J 9 Hz, 2CH), 7.78 (2H, d, J 9 Hz, 2CH), 8.08 (1H, s, CH), 8.21 (1H, d, J 4 Hz, NH) 9.47 (1H, s, NH); MS(+ve): 421.4; tR = 2.75 min (XBridge 4).





177


embedded image


***
**
9-Cyclopentyl-2-[3-(1,1-dioxo-thiomorpholin-4- ylmethyl)-phenylamino]-5-methyl-5,7,8,9- tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.6 (4H, m, 2CH2), 1.71 (2H, m, CH2), 1.97 (2H, m, CH2), 2.56 (2H, m, CH2), 2.86 (4H, m, 2CH2), 3.11 (4H, m, 2CH2), 3.16 (3H, s, CH3), 3.61 (4H, m, 2CH2), 4.84 (1H, m, CHN), 6.88 (1H, d, J 7.5 Hz, CH), 7.2 (1H, t, J 8 Hz, CH), 7.61 (1H, d, J 8.5 Hz, CH), 7.71 (1H, s, CH), 8.04 (1H, s, CH), 9.17 (1H, s, NH); MS(+ve): 485.4; tR = 3.0 min (XBridge 4).





178


embedded image


***
**
Cyclopropanecarboxylic acid [4-(9- cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)- phenyl]-amide
1H NMR (DMSO): 0.76 (4H, m, 2CH2), 1.57 (5H, m, 2CH2 + CH), 1.72 (2H, m, CH2), 1.91 (2H, m, CH2), 2.56 (2H, m, CH2), 3.15 (3H, s, CH3), 3.59 (2H, m, CH2), 4.77 (1H, m, CHN), 7.44 (2H, d, J 9 Hz, 2CH), 7.61 (2H, d, J 9 Hz, 2CH), 8.01 (1H, s, CH), 9.09 (1H, s, NH) 10.0 (1H, s, NH); MS(+ve): 421.4; tR = 2.9 min (XBridge 4).





179


embedded image


***
*
Cyclopropanecarboxylic acid [4-(9- cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)-2- methyl-phenyl]-amide
1H NMR (DMSO): 0.75 (4H, m, 2CH2), 1.57 (4H, m, 2CH2), 1.7 (2H, m, CH2), 1.8 (1H, m, CH), 1.96 (2H, m, CH2), 2.51 (3H, s, CH3), 2.56 (2H, m, CH2), 3.15 (3H, s, CH3N), 3.60 (2H, m, CH2), 4.83 (1H, m, CHN), 7.17 (1H, d, J 8.5 Hz, CH), 7.38 (1H, d, J 8.5 Hz, CH), 7.64 (1H, s, CH), 8.03 (1H, s, CH), 9.01 (1H, s, NH) 9.38 (1H, s, NH); MS(+ve): 435.4; tR = 2.89 min (XBridge 4).





180


embedded image


***
*
3-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-phenyl]-N-(1-methyl-piperidin-4-yl)- propionamide






181


embedded image


***
*
2-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-phenyl]-N-(1-methyl-piperidin-4-yl)- acetamide






182


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- N-(2-diethylamino-ethyl)-3-methoxy- benzamide
MS(+ve); 536.5; tR = 3.42 min (xbridge 4).





183


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- N-(3-methylamino-propyl)-3-methoxy- benzamide
MS(+ve); 522.5; tR = 3.12 min (xbridge 4).





184


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- N-((1S,2R)-2-hydroxy-indan-1-yl)-3-methoxy- benzamide
MS(+ve); 569.5; tR = 3.50 min (xbridge 4).





185


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- -N-(4-hydroxy-butyl)-3-methoxy-benzamide
MS(+ve); 509.3; tR = 2.77 min (xbridge 4).





186


embedded image



***
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-4-(9- cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-spiro[pyrimido[4,5-b][1,4]diazepin-3,1′- cyclopropane]-2-ylamino)-3-methoxy- benzamide
MS(+ve); 546.4; tR = 3.02 min (xbridge 4).





187


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1-cyclopropane]-2-ylamino)- 3-methoxy-N-(1-methyl-piperidin-3-yl)- benzamide
MS(+ve); 534.4; tR = 3.12 min (xbridge 4).





188


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- N-(2-hydroxy-ethyl)-3-methoxy-benzamide
MS(+ve); 481.3; tR = 2.67 min (xbridge 4).





189


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- N-[2-(2-hydroxy-ethoxy)-ethyl]-3-methoxy- benzamide
MS(+ve); 525.4; tR = 2.68 min (xbridge 4).





190


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3,N-dimethoxy-benzamide
MS(+ve); 467.4; tR = 2.51 min (xbridge 4).





191


embedded image




N-Acetyl-4-(9-cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido [4,5-b][1,4]diazepin-2-ylamino)- benzenesulfonamide
1H NMR (DMSO): 1.6 (4H, m, 2CH2), 1.72 (2H, m, CH2), 1.9 (3H, s, CH3), 1.95 (2H, m, CH2), 2.59 (2H, m, CH2), 3.17 (3H, s, CH3), 3.62 (2H, m, CH2), 4.83 (1H, m, CHN), 7.45 (2H, d, J 8.5 Hz, 2CH), 7.92 (2H, d, J 8.5 Hz, 2CH), 8.10 (1H, s, CH), 9.76 (1H, s, NH), 11.86 (1H, s, NH); MS(+ve): 459.3; tR = 1.63 min (XBridge 4).





192


embedded image


*
*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-ethyl benzoic acid
1H NMR (CD3OD): 1.28 (3H, t, J 7.5 Hz, CH2CH3), 1.51-1.54 (2H, m, alkyl-H), 1.63-1.65 (m, 2H, alkyl-H), 1.71-1.75 (2H, m, alkyl-H), 1.83 (2H, bs, alkyl-H), 2.76 (2H, q, J 7.5 Hz, CH2CH3), 2.79 (2H, dd, J 5 Hz, CH2), 3.27 (3H, s, CH3), 3.78 (2H, dd, J 5 Hz, CH2), 7.63 (1H, d, J 8 Hz, Ar—H), 7.84 (1H, s, Ar—H), 7.95 (1H, dd, J 1.5 and 8 Hz, Ar—H), 8.05 (1H, d, J 1.5 Hz, Ar—H); MS(+ve): 410.36; tR = 1.89 (Xbridge 4).





193


embedded image



*
N-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- yl)-benzamide






194


embedded image



***
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-4-(9- cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzamide






195


embedded image



***
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(4-methyl-piperazin-1- yl)-benzamide






196


embedded image



***
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4- ylmethyl)-benzamide






197


embedded image



***
N-(1-Benzyl-piperidin-4-yl)-4-(9-cyclopentyl- 5,7,7-trimethyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






198


embedded image



**
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(2-methoxy-ethyl)- benzamide






199


embedded image



***
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-pyridin-4-yl-ylmethyl- benzamide






200


embedded image



***
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-[2-(1H-imidazol-4-yl)-ethyl]-3- methoxy-benzamide






201


embedded image



***
4-(9-Cyclopentyl-5,7,7-trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-furan-2-ylmethyl-3-methoxy- benzamide






202


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-2- ylmethyl)-benzamide






203


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(2-morpholin-4-yl- ethyl)-benzamide






204


embedded image



***
N-Cyclopentyl-4-(9-cyclopentyl-5-methyl-6- oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy- benzamide






205


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-1H-pyrrol-2- ylmethyl)-benzamide






206


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-piperidin-4-yl- benzamide






207


embedded image



*
4-(9-Cyclopropyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4- yl)-benzamide






208


embedded image



**
4-[9-(2-Hydroxy-ethyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-3-methoxy-N-(1-methyl-piperidin-4- yl)-benzamide






209


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methanesulfonyl-piperidin-4-yl)- 3-methoxy-benzamide






210


embedded image



**
N-(1-Acetyl-piperidin-4-yl)-4-(9-cyclopentyl-5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






211


embedded image



**
{4-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzoylamino]-piperidin- 1-yl}-acetic acid ethyl ester






212


embedded image



**
N-(1-Benzoyl-piperidin-4-yl)-4-(9-cyclopentyl- 5-methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






213


embedded image


*

9-Cyclopentyl-2-[4-(4-methoxy-phenyl)- piperazin-1-yl]-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one






214


embedded image



***
3-Chloro-4-(9-cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-N-(1-methyl- piperidin-4-yl)-benzamide






215


embedded image


*
***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-fluoro-N-(1-methyl-piperidin-4-yl)- benzamide






216


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tefrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)-3- trifluoromethoxy-benzamide






217


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclobutane]-2-ylamino)- 3-methoxy-N-(1-benzylpiperidin-4-yl)- benzamide






218


embedded image



***
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-4-(9- Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclobutane]-2-ylamino)- 3-methoxy-benzamide






219


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclobutane]-2-ylamino)- N-(2-diethylamino-ethyl)-3-methoxy- benzamide






220


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclobutane]-2-ylamino)- N-(2-dimethylamino-propyl)-3-methoxy- benzamide






221


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclobutane]-2-ylamino)- N-(4-methyl-piperazin-1-yl)-3-methoxy- benzamide






222


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclobutane]-2-ylamino)- N-furan-2-ylmethyl-3-methoxy-benzamide






223


embedded image



*
4-{9-[2-(2-Hydroxy-ethylcarbamoyl)-ethyl]-5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino}-3- methoxy-N-(1-methyl-piperidin-4-yl)- benzamide






224


embedded image



**
3-Methoxy-4-[5-methyl-9-(2-methylcarbamoyl- ethyl)-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino]-N-(1- methyl-piperidin-4-yl)-benzamide






225


embedded image



**
4-[9-(2-Dimethylcarbamoyl-ethyl)-5-methyl-6- oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-3-methoxy-N-(1- methyl-piperidin-4-yl)-benzamide






226


embedded image



**
4-{9-[2-(3-Dimethylamino-propylcarbamoyl)- ethyl]-5-methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino}-3- methoxy-N-(1-methyl-piperidin-4-yl)- benzamide






227


embedded image


**
***
9-Cyclopentyl-2-(1H-indazol-5-ylamino)-5- methyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane-6-one






228


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-hydroxy-N-(1-methyl-piperidin-4- yl)-benzamide






229


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)- acid






230


embedded image



**
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane-2-ylamino)- 3-methoxy-benzoic acid






231


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(2-diethylamino-ethyl)-4-methoxy- benzamide






232


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(3-dimethylamino-propyl)-4- methoxy-benzamide






233


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(3-hydroxy-propyl)-4-methoxy- benzamide






234


embedded image



*
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1,1-dimethyl-2-piperidin-1-yl- ethyl)-4-methoxy-benzamide






235


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-4-methoxy-N-(1-methyl-piperidin-4- ylmethyl)-benzamide






236


embedded image




3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(3-dimethylamino-2,2-dimethyl- propyl)-4-methoxy-benzamide






237


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-ethyl-piperidin-4-yl)-3-methoxy- benzamide






238


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-cyclopropylmethyl-piperidin-4- yl)-3-methoxy-benzamide






239


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-3-methoxy- benzoic acid






240


embedded image



***
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-N-(2-diethylamino- ethyl)-3-methoxy-benzamide






241


embedded image



**
N-(1-Benzyl-piperidin-4-yl)-4-(9- cyclopropylmethyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzamide






242


embedded image



**
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1- methyl-piperidin-4-ylmethyl)-benzamide






243


embedded image



**
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-4-(9- cyclopropylmethyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzamide






244


embedded image



**
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N- (1,2,2,6,6-pentamethyl-piperidin-4-yl)- benzamide






245


embedded image



**
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1- methyl-piperidin-3-yl)-benzamide






246


embedded image



**
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-N-(3- dimethylamino-2,2-dimethyl-propyl)-3- methoxy-benzamide






247


embedded image



**
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-N-(3- dimethylamino-propyl)-3-methoxy-benzamide






248


embedded image



**
N-Cyclopentyl-4-(9-cyclopropylmethyl-5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






249


embedded image



**
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1- methyl-1H-pyrrol-2-ylmethyl)-benzamide






250


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7, 8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-N-(1,1-dimethyl- 2-pyrrolidin-1-yl-ethyl)-3-methoxy-benzamide






251


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6, 7, 8, 9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-N-(1,1-dimethyl- 2-piperidin-1-yl-ethyl)-3-methoxy-benzamide






252


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-methoxy-N-(1-benzylpiperidin-4-yl)- benzamide






253


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-3-methoxy-N-(1- methyl-piperidin-4-ylmethyl)-benzamide






254


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-3-methoxy-N-(4- methyl-piperazin-1-yl)-benzamide






255


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-methoxy-N-(1,2,2,6,6-pentamethyl-piperidin- 4-yl)-benzamide






256


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-N-(3- dimethylamino-2,2-dimethyl-propyl)-3- methoxy-benzamide






257


embedded image




4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1 ′-cyclopropane]-2-ylamino)- 3-methoxy-N-pyridin-4-yl-benzamide






258


embedded image



***
4(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-3-methoxy-N- pyridin-4-ylmethyl-benzamide






259


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-3-methoxy-N-(1- methyl-1 H-pyrrol-2-ylmethyl)-benzamide






260


embedded image



***
N-Cyclopentyl-4-(9-Cyclopentyl-5-methyl-6- oxo-6,7,8,9-tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-methoxy-benzamide






261


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro(pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-ethyl-N-(1-methyl-piperidin-4-yl)-benzamide






262


embedded image



***
4-(9-Cyclopropylmethyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane-2-ylamino)- 3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide






263


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-[2-(2-hydroxy-ethoxy)-ethyl]-4- methoxy-benzamide






264


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-4,N-dimethoxy-benzamide






265


embedded image



**
N-(1-Benzyl-pyrrolidin-3-yl)-3-(9-cyclopentyl- 5-methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-4- methoxy-benzamide






266


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-4-methoxy-N-(2-morpholin-4-yl- ethyl)-benzamide






267


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-[2-(1H-imidazol-4-yl)-ethyl]-4- methoxy-benzamide






268


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-4-methoxy-N-(1-methyl-1H-pyrrol-2- ylmethyl)-benzamide






269


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-4-methoxy-N-(1-methyl-piperidin-2- ylmethyl)-benzamide






270


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-4-methoxy-N-(2-methoxy-ethyl)- benzamide






271


embedded image



**
N-(1-Benzyl-piperidin-4-yl)-3-(9-cyclopentyl-5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-4- methoxy-benzamide






272


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(4-hydroxy-butyl)-4-methoxy- benzamide






273


embedded image



**
3-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-furan-2-ylmethyl-4-methoxy- benzamide






274


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-hydroxy-N-(1-methyl-piperidin-4-yl)- benzamide






275


embedded image



**
4-(9-Cyclopropylmethyl-5,7,7-trimethyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-benzoic acid






276


embedded image



**
4-(9-Cyclopropylmethyl-5,7,7-trimethyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3-methoxy-N-(1- methyl-piperidin-4-yl)-benzamide






277


embedded image



*
3-Methoxy-4-[9-(2-methoxy-phenyl)-5-methyl- 6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-N-(1-methyl- piperidin-4-yl)-benzamide






278


embedded image



*
3-Methoxy-4-[9-(2-methoxy-phenyl)-5-methyl- 6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-N-(1,2,2,6,6- pentamethyl-piperidin-4-yl)-benzamide






279


embedded image



*
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-3-methoxy-4- [9-(2-methoxy-phenyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-benzamide






280


embedded image



*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-3-methyl- benzoic acid






281


embedded image




4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin- 3,1′-cyclopropane-2-ylamino)-3- trifluoromethoxy-benzoic acid






282


embedded image











283


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-fluorobenzoic acid






284


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-trifluoromethoxy-N-(1-methyl-piperidin-4-yl)- benzamide






285


embedded image


***
*
N-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-2-methyl-phenyl]-acetamide
1H NMR (DMSO): 1.57 (4H, m, 2CH2), 1.7 (2H, m, CH2), 1.93 (2H, m, CH2), 2.01 (3H, s, CH3), 2.14 (3H, s, CH3), 2.56 (2H, m, CH2), 3.16 (3H, s, CH3), 3.6 (2H, m, CH2), 4.83 (1H, m, CHN), 7.15 (1H, d, J 8.5 Hz, CH), 7.39 (1H, d, J 8.5 Hz, CH), 7.64 (1H, s, CH), 8.02 (1H, s, CH), 9.10 (1H, s, NH), 9.16 (1H, s, NH); MS(+ve): 409.4; tR = 2.58 min (XBridge 4).





286


embedded image


**

N-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-2-trifluoromethyl-phenyl]-acetamide
1H NMR (DMSO): 1.56 (4H, m, 2CH2), 1.69 (2H, m, CH2), 1.92 (2H, m, CH2), 2.01 (3H, s, CH3), 2.58 (2H, m, CH2), 3.16 (3H, s, CH3), 3.61 (2H, m, CH2), 4.84 (1H, m, CHN), 7.27 (1H, d, J 8.5 Hz, CH), 7.8 (1H, d, J 8.5 Hz, CH), 8.08 (1H, CH), 8.24 (1H, s, CH), 9.39 (1H, s, NH), 9.54 (1H, s, NH); MS(+ve): 463.34; tR = 2.85 min (XBridge 4).





287


embedded image


***
*
N-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-2-methyl-phenyl]-2,2-dimethyl- propionamide
1H NMR (DMSO): 1.22 (9H, s, C(CH3)3), 1.58 (4H, m, 2CH2), 1.70 (2H, m, CH2), 1.94 (2H, m, CH2), 2.10 (3H, s, CH3), 2.57 (2H, m, CH2), 3.16 (3H, s, CH3), 3.60 (2H, m, CH2), 4.84 (1H, m, CHN), 6.98 (1H, d, J 8.5 Hz, CH), 7.41 (1H, d, J 8.5 Hz, CH), 7.67 (1H, s, CH), 8.03 (1H, s, CH), 8.76 (1H, s, NH), 9.14 (1H, s, NH); MS(+ve): 451.42; tR = 3.29 min (XBridge 4).





288


embedded image


***

N-[4-(9-(9-5-methyl-6-oxo-6,7,8,9-6,7,8,9 tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-2-methyl-phenyl]- methanesulfonimide
1H NMR (DMSO): 1.6 (4H, m, 2CH2), 1.71 (2H, m, CH2), 1.95 (2H, m, CH2), 2.3 (3H, s, CH3), 2.58 (2H, m, CH2), 3.17 (3H, s, CH3), 3.5 (6H, s, 2CH3), 3.62 (2H, m, CH2), 4.86 (1H, m, CHN), 7.27 (1H, d, J 8.5 Hz, CH), 7.51 (1H, d, J 8.5 Hz, CH), 7.86 (1H, s, CH), 8.07 (1H, s, CH), 9.42 (1H, s, NH); MS(+ve): 523.28; tR = 3.12 min (XBridge 4).





289


embedded image


***
**
9-Cyclopentyl-2-(1,1-dioxo-1H-1lambda*6*- benzo[b]thiophen-5-ylamino)-5-methyl- 5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.59 (4H, m, 2CH2), 1.7 (2H, m, CH2), 1.94 (2H, m, CH2), 2.59 (2H, m, CH2), 3.18 (3H, s, CH3), 3.62 (2H, m, CH2), 4.83 (1H, m, CHN), 7.3 (1H, d, J 6.5 Hz, CH), 7.49 (1H, d, J 6.5 Hz, CH), 7.69 (1H, d, J 8.5 Hz, CH), 7.84 (1H, d, J 8.5 Hz, CH), 7.98 (1H, s, CH), 8.11 (1H, s, CH), 9.82 (1H, s, NH); MS(+ve): 426.31; tR = 2.95 min (XBridge 4).





290


embedded image


***
*
2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-methyl-9-p- tolyl-5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 2.38 (3H, s, CH3), 2.78 (2H, m, CH2), 3.26 (3H, s, CH3), 4.0 (211, m, CH2), 4.03 (2H, s, CH2), 4.31(2H, s, CH2), 6.93 (1H, d, J 8.0 Hz, CH), 7.16 (1H, d, J 8.0 Hz, CH), 7.2 (2H, d, J 8.0 Hz, 2CH), 7.27 (2H, d, J 8.0 Hz, 2CH), 7.32 (1H, s, CH), 8.25 (1H, s, CH), 9.45 (1H, s, NH); MS(+ve): 450.33; tR = 2.82 min (XBridge 4).





291


embedded image


***
*
Cyclopropanecarboxylic acid [2-methyl-4-(5- methyl-6-oxo-9-p-tolyl-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)- phenyl]-amide
1H NMR (DMSO): 0.72 (4H, m, 2CH2), 1.78 (1H, m, CH), 1.87 (3H, s, CH3), 2.33 (3H, s, CH3), 2.78 (2H, m, CH2), 3.25 (3H, s, CH3), 3.99 (2H, m, CH2), 6.87 (1H, m, CH), 6.96 (1H, m, CH), 7.16 (3H, m, 3CH), 7.21 (2H, d, J 8.0 Hz, 2CH), 8.25 (1H, s, CH), 9.17 (1H, s, NH), 9.24 (1H, s, NH); MS(+ve): 457.41; tR = 2.89 min (XBridge 4).





292


embedded image


***
**
5-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-benzo[b]thiophene-2-carboxylic acid
1H NMR (DMSO): 1.60 (4H, m, 2CH2), 1.72 (2H, m, CH2), 1.97 (2H, m, CH2), 2.58 (2H, m, CH2), 3.17 (3H, s, CH3), 3.61 (2H, m, CH2), 4.87 (1H, m, CHN), 7.53 (1H, s, CH), 7.55 (1H, d, J 8.5 Hz, CH), 7.73 (1H, d, J 8.5 Hz, CH), 8.06 (1H, s, CH), 8.40 (1H, s, CH), 9.29 (1H, s, NH); MS(+ve): 438.28; tR = 1.90 min (XBridge 4).





293


embedded image


***
*
9-Cyclopentyl-5-methyl-2-[4-(morpholine-4- carbonyl)-phenylamino]-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.59 (4H, m, 2CH2), 1.70 (2H, m, CH2), 1.94 (2H, m, CH2), 2.57 (2H, m, CH2), 3.17 (3H, s, CH3), 3.5 (4H, m, 2CH2), 3.60 (6H, m, 3CH2), 4.81 (1H, m, CHN), 7.32 (2H, d, J 8.5 Hz, 2CH), 7.79 (2H, d, J 8.5 Hz, 2CH), 8.06 (1H, s, CH), 9.43 (1H, s, NH); MS(+ve): 451.40; tR = 2.63 min (XBridge 4).





294


embedded image


**
**
9-Cyclopentyl-5-methyl-2-(3-oxo-3,4-dihydro- 2H-benzo[1,4]oxazin-7-ylamino)-5,7,8,9- tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.58 (4H, m, 2CH2), 1.69 (2H, m, CH2), 1.93 (2H, m, CH2), 2.54 (2H, m, CH2), 3.15 (3H, s, CH3), 3.58 (2H, m, CH2), 4.51 (2H, s, CH2), 4.77 (1H, m, CHN), 6.75 (1H, d, J 8.5 Hz, CH), 7.2 (H, d, J 8.5 Hz, CH), 7.50 (1H, s, CH), 8.02 (1H, s, CH), 9.13 (1H, s, NH), 10.5 (1H, s, NH); MS(+ve): 409.33; tR = 2.60 min (XBridge 4).





295


embedded image


***
*
9-Cyclopentyl-5-methyl-2-(3-oxo-3,4-dihydro- 2H-benzo[1,4]oxazin-6-ylamino)-5,7,8,9- tetrahydro-pyrimido[4,5-13][1,4]diazepin-6-one
1H NMR (DMSO): 1.54 (4H, m, 2CH2), 1.66 (2H, m, CH2), 1.91 (2H, m, CH2), 2.55 (2H, m, CH2), 3.15 (3H, s, CH3), 3.58 (2H, m, CH2), 4.48 (2H, s, CH2), 4.74 (1H, m, CHN), 6.82 (1H, d, J 8.5 Hz, CH), 7.22 (2H, m, 2CH), 7.99 (1H, s, CH), 9.05 (1H, s, NH), 10.65 (1H, s, NH); MS(+ve): 409.33; tR = 2.75 min (XBridge 4).





296


embedded image


***
**
5-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylaminoybenzo[b]thiophene-2-carboxylic acid






297


embedded image


***
*
9-Cyclopentyl-5-methyl-2-[4-(morpholine-4- carbonyl)-phenylamino]-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one






298


embedded image


**
**
9-Cyclopentyl-5-methyl-2-(3-oxo-3,4-dihydro- 2H-benzo[1,4]oxazin-7-ylamino)-5,7,8,9- tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one






299


embedded image


***
*
9-Cyclopentyl-5-methyl-2-(3-oxo-3,4-dihydro- 2H-benzo[1,4]oxazin-6-ylarnino)-5,7,8,9- tetrahydro-pyrimido[4,5-b][1,4]diazepin-6-one






300


embedded image


***
*
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N,N-dimethyl-benzenesulfonamide
1H NMR (DMSO): 1.59 (4H, m, 2CH2), 1.70 (2H, m, CH2), 1.95 (2H, m, CH2), 2.57 (8H, m, 2CH3, CH2), 3.17 (3H, s, CH3), 3.62 (2H, m, CH2), 4.82 (1H, m, CHN), 7.6 (2H, d, J 8 Hz, 2CH), 7.96 (2H, d, J 8 Hz, 2CH), 8.10 (1H, s, CH), 9.73 (1H, s, NH); MS(+ve): 445.36; tR = 3.16 min (XBridge 4).





301


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-methyl-N-(1-methyl-piperidin-4-yl)- benzamide






302


embedded image



**
4-(9-Isobutyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-4- yl)-benzamide






303


embedded image



**
4-(9-Isobutyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1-methyl-piperidin-3- yl)-benzamide






304


embedded image



**
N-(1-Benzyl-piperidin-4-yl)-4-(9-isobutyl-5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






305


embedded image



**
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-4-(9-isobutyl- 5-methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






306


embedded image



**
4-(9-Isobutyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(1,2,2,6,6-pentamethyl- piperidin-4-yl)-benzamide






307


embedded image



**
N-(2-Diethylamino-ethyl)-4-(9-isobutyl-5- methyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-3- methoxy-benzamide






308


embedded image



*
3-Methoxy-4-(5-methyl-6-oxo-9-o-tolyl-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-4-yl)- benzamide






309


embedded image



*
3-Methoxy-4-(5-methyl-6-oxo-9-o-tolyl-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-methyl-piperidin-3-yl)- benzamide






310


embedded image



*
N-(1-Benzyl-piperidin-4-yl)-3-methoxy-4-(5- methyl-6-oxo-9-o-tolyl-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)- benzamide






311


embedded image



**
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-3-methoxy-4- (5-methyl-6-oxo-9-o-tolyl-6,7,8,9-tetrahydro- 5H-pyrimido[4,5-b][1,4]diazepin-2-ylamino)- benzamide






312


embedded image



*
3-Methoxy-4-(5-methyl-6-oxo-9-o-tolyl-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1,2,2,6,6-pentamethyl-piperidin-4- yl)-benzamide






313


embedded image



*
N-(2-Diethylamino-ethyl)-3-methoxy-4-(5- methyl-6-oxo-9-o-tolyl-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)- benzamide






314


embedded image



**
3-Methoxy-4-[9-(4-methoxy-phenyl)-5-methyl- 6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylaminol-N-(1-methyl- piperidin-4-yl)-benzamide






315


embedded image



**
3-Methoxy-4-[9-(4-methoxy-phenyl)-5-methyl- 6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino1-N-(1-methyl- piperidin-3-yl)-benzamide






316


embedded image



**
N-(1-Benzyl-piperidin-4-yl)-3-methoxy-4-[9-(4- methoxy-phenyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-benzamide






317


embedded image



**
N-(1-Aza-bicyclo[2.2.2]oct-3-yl)-3-methoxy-4- [9-(4-methoxy-phenyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-benzamide






318


embedded image



**
3-Methoxy-449-(4-methoxy-phenyl)-5-methyl- 6-oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]-N-(1,2,2,6,6- pentamethyl-piperidin-4-yl)-benzamide






319


embedded image



*
N-(2-Diethylamino-ethyl)-3-methoxy-4-[9-(4- methoxy-phenyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-benzamide






320


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- N-(1-ethyl-pyrrolidin-3-yl)-3-methoxy-N- benzamide






321


embedded image



**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- N-[2-(4-iso






322


embedded image



***
N-(Benzyl-pyrrolidin-3-yl)-4-(9-cyclopentyl- 5-methyl-6-oxo-6,7,8,9-tetrahydro-5H- spiro[pyrimido[4,5-b][1,4]diazepin-3,1′- cyclopropane]-2-ylamino)-3-methoxy-N- benzamide






323


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-fluoro-N-(1-methyl-piperidin-4-yl)- benzamide






324


embedded image


**
*
N-[2-Chloro-4-(9-cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-phenyl]-acetamide
1H NMR (DMSO): 1.60 (4H, m, 2CH2), 1.70 (2H, m, CH2), 1.96 (2H, m, CH2), 2.04 (3H, s, CH3), 2.58 (2H, m, CH2), 3.16 (3H s CH3), 3.61 (2H m, CH2), 4.83 (1H, m, CHN), 7.42 (2H, s, 2CH), 8.06 (1H, s, CH), 8.15 (1H, s, CH), 9.38 (1H, s, NH), 9.40 (1H, s, NH); MS(+ve): 429.28; tR = 2.76 min (XBridge 4).





325


embedded image


**

4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1,1-dioxo-tetrahydro-1lambda*6*- thiophen-3-yl)-benzenesulfonamide
MS(+ve): 535.27; tR = 2.54 min (XBridge 4).





326


embedded image


***
*

MS(+ve): 431.25; tR =2.80 min (XBridge 4).





327


embedded image


***

Cyclopropanecarboxylic acid {4-[9-(4- methoxy-phenyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-2-methyl-phenyl}-amide
1H NMR (DMSO): 0.73 (4H, m, 2CH2), 1.78 (1H, m, CH), 1.89 (3H, s, CH3), 2.77 (2H, m, CH2), 3.25 (3H, s, CH3), 3.79 (3H, s, CH3), 3.98 (2H, m, CH2), 6.85 (1H, d, J 8.5 Hz, CH), 6.96 (1H, m, CH), 6.98 (2H, d, J 8.5 Hz, 2CH), 7.11(1H, s, CH), 7.23 (2H, d, J 8.5 Hz, 2CH), 8.19 (1H, s, CH), 9.11 (1H, s, NH), 9.25 (1H, s, NH); MS(+ve): 473.35; tR = 2.73 min (XBridge 4).





328


embedded image


*

Cyclopropanecarboxylic acid [4-(5-ethyl-6- oxo-9-p-tolyl-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino)-2- methyl-phenyl]-amide
1H NMR (DMSO): 0.73 (4H, m, 2CH2), 1.05 (3H, t, J 7 Hz, CH3), 1.78 (1H, m, CH), 1.87 (3H, s, CH3), 2.32 (3H, s, CH3), 2.68 (2H, m, CH2), 3.78 (2H, q, J 7 Hz, CH2), 3.98 (2H, m, CH2), 6.93 (1H, m, CH), 7.0 (1H, m, CH), 7.09 (2H, d, J 8 Hz, 2CH), 7.19 (2H, d, J 8.0 Hz, 2CH), 7.23 (1H, s, CH), 8.32 (1H, s, CH), 9.28 (2H, m, 2NH); MS(+ve): 471.34; tR = 3.05 min (XBridge 4).





329


embedded image


**

Cyclopropanecarboxylic acid {4-[9-(2,6- difluoro-phenyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-2-methyl-phenyl}amide
1H NMR (DMSO): 0.73 (4H, m, 2CH2), 1.77 (1H, m, CH), 1.96 (3H, s, CH3), 2.86 (2H, m, CH2), 3.27 (3H, s, CH3), 3.89 (2H, m, CH2), 6.77 (1H, d, J 9 Hz, CH), 6.90 (1H, d, J 9 Hz, CH), 6.99 (1H, s, CH), 7.29 (2H, m, 2CH), 7.52 (1H, m, CH), 8.24 (1H, s, CH), 9.22 (1H, s, NH), 9.3 (1H, s, NH); MS(+ve): 479.27; tR = 2.78 min (XBridge 4).





330


embedded image


*

Cyclopropanecarboxylic acid {4-[5-ethyl-9-(4- methoxy-phenyl)-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino]-2- methyl-phenyl}-amide
1H NMR (DMSO): 0.73 (4H, m, 2CH2), 1.06 (3H, t, J 7 Hz, CH3), 1.78 (1H, m, H), 1.89 (3H, s, CH3), 2.70 (2H, m, CH2), 3.78 (5H, m, CH2, CH3), 3.98 (2H, m, CH2), 6.90 (1H, d, J 8.5 Hz, CH), 6.97 (3H, m, 3CH), 7.17 (3H, m, 3CH), 8.25 (1H, s, CH), 9.20 (1H, s, NH), 9.26 (1H, s, NH); MS(+ve): 487.31; tR = 2.86 min (XBridge 4).





331


embedded image


***

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-ethyl-9-p-tolyl- 5,7,8,9-tetrahydro-pyrimido[4,5- b][1,4]diazepin-6-one
1H NMR (DMSO): 1.06 (3H, t, J 7 Hz, CH3), 2.36 (3H, s, CH3), 2.70 (2H, m, CH2), 3.78 (2H, q, J 7 Hz, CH2), 3.99 (2H, m, CH2), 4.04 (2H, s, CH2), 4.32 (2H, s, CH2), 6.97 (1H, d, J 8.0 Hz, CH), 7.13 (2H, d, J 8.0 Hz, 2CH), 7.2 (1H, d, J 8.0 Hz, CH), 7.25 (2H, d, J 8.0 Hz, 2CH), 7.38 (1H, s, CH), 8.33 (1H, s, CH), 9.53 (1H, s, NH); MS(+ve): 464.29; tR = 2.96 min (XBridge 4).





332


embedded image


***

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-9-(4-methoxy- phenyl)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 2.8 (2H, m, CH2), 3.26 (3H, s, CH3), 3.82 (3H, s, CH3), 3.99 (2H, m, CH2), 4.02 (2H, s, CH2), 4.31 (2H, s, CH2), 6.94 (1H, d, J 8.5 Hz, CH), 7.05 (2H, d, J 8 Hz, 2CH), 7.15 (1H, d, J 8.5 Hz, CH), 7.27 (3H, m, 3CH), 8.20 (1H, s, CH),9.41 (1H, s, NH); MS(+ve): 466.23; tR = 2.67 min (XBridge 4).





333


embedded image


***

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-ethyl-9-(4- methoxy-phenyl)-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.07 (3H, t, J 7 Hz, CH3), 2.72 (2H, m, CH2), 3.78 (2H, q, J 7 Hz, CH2), 3.81 (3H, s, CH3), 3.99 (2H, m, CH2), 4.03 (2H, s, CH2), 4.32 (2H, s, CH2), 6.97 (1H, d, J 8.5 Hz, CH), 7.04 (2H, d, J 8.5 Hz, 2CH), 7.18 (1H, m, CH), 7.21 (2H, d, J 8.5 Hz, 2CH), 7.32 (1H, s, CH), 8.26 (1H, s, CH), 9.48 (1H, s, NH); MS(+ve): 480.22; tR = 2.82 min (XBridge 4).





334


embedded image


*

9-(4-tert-Butyl-phenyl)-2-(2,2-dioxo-2,3- dihydro-1H-2lambda*6*-benzo[c]thiophen-5- ylamino)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.33 (9H, s, C(CH3)3), 2.76 (2H, m, CH2), 3.26 (3H, s, CH3), 3.99 (2H, m, CH2), 4.12 (2H, s, CH2), 4.29(2H, s, CH2), 6.92 (1H, d, J 8 Hz, CH), 7.20 (2H, d, J 8.5 Hz, 2CH), 7.28 (1H, d, J 8 Hz, CH), 7.44 (3H, m, 3CH), 8.31 (1H, s, CH), 9.5 (1H, s, NH); MS(+ve): 492.36; tR = 3.32 min (XBridge 4).





335


embedded image


*

9-(4-tert-Butyl-phenyl)-2-(2,2-dioxo-2,3- dihydro-1H-2lambda*6*-benzo[c]thiophen-5- ylamino)-5-ethyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.04 (3H, t, J 7 Hz, CH3), 1.32 (9H, s, C(CH3)3), 2.68 (2H, m, CH2), 3.78 (2H, q, J 7 Hz, CH2), 3.98 (2H, m, CH2), 4.12 (2H, s, CH2), 4.31 (2H, s, CH2), 6.98 (1H, d, J 8.5 Hz, CH), 7.12 (2H, d, J 8.5 Hz, 2CH), 7.31 (1H, d, J 8.5 Hz, CH), 7.41 (2H, d, J 8.5 Hz, 2CH), 7.52 (1H, s, CH), 8.4 (1H, s, CH), 9.6 (1H, s, NH); MS(+ve): 506.32; tR = 3.45 min (XBridge 4).





336


embedded image


***

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-methyl-9-(4- morpholin-4-yl-phenyl)-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 2.79 (2H, m, CH2), 3.19 (4H, m, 2CH2), 3.26 (3H, s, CH3), 3.79 (4H, m, 2CH2), 3.98 (2H, m, CH2), 4.04 (2H, s, CH2), 4.30 (2H, s, CH2), 7.01 (1H, d, J 8.5 Hz, CH), 7.05 (2H, d, J 8.5 Hz, 2CH), 7.10 (1H, d, J 8.5 Hz, CH), 7.20 (211, d, J 8.5 Hz, 2CH), 7.31 (1H, s, CH), 8.18 (1H, s, CH), 9.39 (1H, s, NH); MS(+ve): 521.30; tR = 2.60 min (XBridge 4).


337


embedded image


***

Cyclopropanecarboxylic acid {2-methyl-4-[5- methyl-9-(4-morpholin-4-yl-phenyl)-6-oxo- 6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylaminol-phenyl}amide
1H NMR (DMSO): 0.73 (4H, m, 2CH2), 1.79 (1H, m, CH), 1.92 (3H, s, CH3), 2.77 (2H, m, CH2), 3.13 (4H, m, 2CH2), 3.25 (3H, s, CH3), 3.75 (4H, m, 2CH2), 3.97 (2H, m, CH2), 6.89 (1H, d, J 8 Hz, CH), 6.98 (3H, m, 3CH), 7.10 (1H, s, CH), 7.16 (2H, d, J 8.5 Hz, 2CH), 8.17 (1H, s, CH), 9.09 (1H, s, NH), 9.21 (1H, s, NH); MS(+ve): 528.33; tR = 2.60 min (XBridge 4).





338


embedded image


**

2-(2,2-Dioxo-2,3-dihydro-1H-2lambda*6*- benzo[c]thiophen-5-ylamino)-5-ethyl-9-(4- morpholin-4-yl-phenyl)-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.07 (3H, t, J 7 Hz, CH3), 2.71 (2H, m, CH2), 3.18 (4H, m, 2CH2), 3.79 (6H, m, 3CH2), 3.97 (2H, m, CH2), 4.05 (2H, s, CH2), 4.30 (2H, s, CH2), 7.03 (3H, m, 3CH), 7.14 (3H, m, 3CH), 7.35 (1H, s, CH), 8.24 (1H, s, CH), 9.46 (1H, s, NH); MS(+ve): 535.27; tR = 2.72 min (XBridge 4).





339


embedded image


***

9-(2,6-Difluoro-phenyl)-2-(2,2-dioxo-2,3- dihydro-1H-2lambda*6*-benzo[c]thiophen-5- ylamino)-5-methyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 2.87 (2H, m, CH2), 3.28 (3H, s, CH3), 3.91 (2H, m, CH2), 4.18 (2H, s, CH2), 4.30 (2H, s, CH2), 6.91 (1H, d, J 8 Hz, CH), 7.13 (2H, m, 2CH), 7.35 (2H, m, 2CH), 7.57 (1H, m, CH), 8.27 (1H, s, CH), 9.53 (1H, s, NH); MS(+ve): 472.18; tR = 2.72 min (XBridge 4).





340


embedded image


**

9-(2,6-Difluoro-phenyl)-2-(2,2-dioxo-2,3- dihydro-1H-2lambda*6*-benzo[c]thiophen-5- ylamino)-5-ethyl-5,7,8,9-tetrahydro- pyrimido[4,5-b][1,4]diazepin-6-one
1H NMR (DMSO): 1.03 (3H, t, J 7 Hz, CH3), 2.80 (2H, m, CH2), 3.83 (2H, q, J 7 Hz, CH2), 3.9 (2H, m, CH2), 4.18 (2H, s, CH2), 4.31 (2H, s, CH2), 6.93 (1H, d, J 9 Hz, CH), 7.16 (2H, m, 2CH), 7.34 (2H, m, 2CH), 7.57 (1H, m, CH), 8.32 (1H, s, CH), 9.57 (1H, s, NH); MS(+ve): 486.22; tR = 2.87 min (XBridge 4).





341


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-methoxy-N-(1-methyl-piperidin-4-yl)- benzamide mesylate






342


embedded image


*

Cyclopropanecarboxylic acid {4-[(9-(4-tert- butyl-phenyl)-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino]-2-methyl-phenyl}-amide
1H NMR (DMSO): 0.71 (4H, m, 2CH2), 1.30 (9H, s, C(CH3)3), 1.77 (1H, m, CH), 1.91 (3H, s, CH3), 2.75 (2H, m, CH2), 3.25 (3H, s, CH3), 3.99 (2H, m, CH2), 6.88 (1H, d, J 8.5 Hz, CH), 7.05 (1H, d, J 8.5 Hz, CH), 7.17 (2H, d, J 8.5 Hz, 2CH), 7.19 (1H, s, CH), 7.41 (2H, d, J 8.5 Hz, 2CH), 8.28 (1H, s, CH), 9.22 (2H, s, 2NH); MS(+ve): 499.45; tR = 3.37 min (XBridge 4).





343


embedded image



**
{4-[4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-benzoylaminol-piperidin- 1-yl}-acetic acid






344


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-(1-isopropyl-piperidin-4-yl)-3- methoxy-benzamide






345


embedded image



***
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-[1-(tetrahydro-pyran-4- yl)piperidin-4-yl]-benzamide






346


embedded image




4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1′-cyclopropane]-2-ylamino)- 3-methoxy-benzoylamino}-piperidine-1- carboxylic acid tert-butyl ester






347


embedded image



***
N-(R)-(1-Aza-bicyclo[2.2.2]oct-3-yl)-4-(9- cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-spiro[pyrimido[415-b][1,4]diazepin-3,1′- cyclopropane]-2-ylamino)-3-methoxy- benzamide






348


embedded image



***
N-(S)-(1-Aza-bicyclo[2.2.2]oct-3-yl)-4-(9- cyclopentyl-5-methyl-6-oxo-6,7,8,9-tetrahydro- 5H-spiro[pyrimido[4,5-b][1,4]diazepin-3,1'- cyclopropane]-2-ylamino)-3-methoxy- benzamide






349


embedded image


*
**
4-(9-Cyclopentyl-5-methyl-6-oxo-6,7,8,9- tetrahydro-5H-spiro[pyrimido[4,5- b][1,4]diazepin-3,1'-cyclopropane]-2-ylamino)- N-(1-methyl-piperidin-4-yl)-benzamide






350


embedded image


**

N-Acetyl-4-[9-(4-methoxy-phenyl)-5-methyl-6- oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]- benzenesulfonamide






351


embedded image


***

N-Acetyl-4-[9-(2,6-difluoro-phenyl)-5-methyl-6- oxo-6,7,8,9-tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino]- benzenesulfonamide






352


embedded image


**

N-Acetyl-4-[5-methyl-9-(4-morpholin-4-yl- phenyl-6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2-ylamino]- benzenesulfonamide
















TABLE 3







PLK IC50 values and characterization data for selected compounds of the invention; ***denotes <0.1 μM IC50;


**denotes between 1 μM and 0.1 μM IC50; * denotes between 10 μM and 1 μM IC50











No.
Structure
PLK1
Name
Data





254


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxy-N-(4-methylpiperazin-1- yl)benzamide
Rt = 2.63 min (Analytical_1); MS(+ve): 535.5; MS(−ve): 533.6; 1H NMR (DMS0-d6) δ ppm: 0.63-0.70 (2 H, m), 0.87-0.94 (2 H, m), 1.43-1.54 (2 H, m), 1.55-1.63 (2 H, m), 1.64-1.73 (2 H, m), 1.83-1.94 (2 H, m), 2.18 (3 H, s), 2.31-2.48 (4 H, m), 2.92 (4 H, m), 3.16 (3 H, s), 3.47 (2 H, s), 3.94 (3 H, s), 4.78-4.91 (1 H, m), 7.35-7.48 (2 H, m), 7.68 (1 H, s), 7.98 (1 H, s), 8.39 (1 H, d, J = 8.3 Hz), 9.31 (1 H, s).





218


embedded image


***
(±)-4-(9′-cyclopentyl-5′-methyl-6′- oxo-5′,6′,8′,9′- tetrahydrospiro[cyclobutane-1,7′- pyrimido[4,5-b][1,4]diazepine]-2′- ylamino)-3-methoxy-N- (quinuclidin-3-yl)benzamide
Rt = 3.26 min (Analytical_1); MS(+ve): 560.4; 1H NMR (DMSO-d6) δ ppm: 8.37 (d, J = 8.3 Hz, 1 H), 8.08 (d, J = 6.8 Hz, 1 H), 8.05 (s, 1 H), 7.73 (s, 1 H), 7.45-7.53 (m, 2 H), 4.82 (quin, J = 8.3 Hz, 1 H), 3.84-4.01 (m, 4 H), 3.64 (s, 2 H), 3.18 (s, 3 H), 3.04-3.14 (m, 1 H), 2.88 (t, J = 9.8 Hz, 1 H), 2.58-2.75 (m, 4 H), 2.21-2.33 (m, 2 H), 2.07 (s, 2 H), 1.97 (br. s., 2 H), 1.87 (br. s., 2 H), 1.76 (d, J =4.9 Hz, 2 H), 1.56-1.70 (m, 8 H), 1.30 (br. s., 1 H)





195


embedded image


***
4-(9-Cyclopentyl-5,7,7-trimethyl- 6-oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-(4-methyl- piperazin-1-yl)-benzamide
Rt = 2.81 min (Analytical_1); MS(+ve): 537.5; 1H NMR (DMS0-d6) δ ppm: 1.09 (6 H, s), 1.61 (4 H, m), 1.73 (2 H, m), 1.87 (2 H, m), 2.19 (3 H, s), 2.42 (2 H, m), 2.92 (4 H, m), 3.29 (3 H, s), 3.37 (3 H, m), 3.93 (3 H, s), 3.17 (1 H, m), 7.40 (2 H, m), 7.68 (1 H, s), 7.98 (1 H, s), 8.37 (1 H, d, J 7 Hz), 9.30 (1 H, s).





221


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclobutane-1,7′- pyrimido[4,5-b][1,4]diazepine]-2′- ylamino)-3-methoxy-N-(4- methylpiperazin-1-yl)benzamide
Rt = 2.79 min (Analytical_1); MS(+ve): 549.5; 1H NMR (DMS0-d6) δ ppm: 9.31 (s, 1 H), 8.37 (d, J = 8.3 Hz, 1 H), 8.05 (s, 1 H), 7.72 (s, 1 H), 7.37-7.47 (m, 2 H), 4.73-4.86 (m, 1 H), 3.93 (s, 3 H), 3.64 (s, 2 H), 3.18 (s, 3 H), 2.92 (br. s., 4 H), 2.36 (br. s., 4 H), 2.27 (d, J = 9.3 Hz, 2 H), 2.18 (s, 3 H), 1.97 (br. s., 2 H), 1.79-1.91 (m, 1 H), 1.76 (br. s., 2 H), 1.54- 1.72 (m, 7 H).





371


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-N- ((trans)-4-(4- (cyclopropylmethyl)piperazin-l- yl)cyclohexyl)-3- methoxybenzamide
Rt = 3.18 min (Analytical_1); ES(+ve): 657.6; ES(−ve): 655.7; 1H NMR (DMS0-d6) δ ppm: 0.05 (d, J = 4.20 Hz, 3 H), 0.44 (d, J = 7.74 Hz, 2 H), 0.67 (d, J = 1.61 Hz, 2 H), 0.74-0.85 (m, 1 H), 0.90 (s, 2 H), 1.23-1.44 (m, 3 H), 1.44- 1.55 (m, 2 H), 1.54-1.64 (m, 2 H), 1.64-1.74 (m, 2 H), 1.88 (br. s., 5 H), 2.08 (s, 3 H), 2.13 (d, J = 6.45 Hz, 2 H), 2.17- 2.28 (m, 1 H), 2.29-2.47 (m, 3 H), 2.60-2.67 (m, 1 H), 3.06- 3.23 (m, 5 H), 3.47 (s, 2 H), 3.65-3.79 (m, 1 H), 3.94 (s, 2 H), 4.05-4.13 (m, 1 H), 4.78-4.91 (m, 1 H), 7.48 (s, 2 H), 7.67 (s, 1 H), 7.98 (s, 1 H), 8.00-8.07 (m, 1 H), 8.31-8.45 (m, 1 H).





372


embedded image


***
4-(9-cyclopentyl-5,7,7-trimethyl-6- oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-((trans)-4-(4- (cyclopropylmethyl)piperazin-l- yl)cyclohexyl)-3- methoxybenzamide
Rt = 3.38 min (Analytical_1); ES(+ve): 659.6; ES(−ve): 657.7; 1H NMR (DMS0-d6) δ ppm: 0.05 (d, J = 3.86 Hz, 3 H), 0.40-0.48 (m, 3 H), 0.73-0.84 (m, 2 H), 1.03-1.13, (m, 10 H), 1.18 (s, 1 H), 1.24-1.43 (m, 6 H), 1.61 (br. s., 3 H), 1.74 (d, J = 9.65 Hz, 2 H), 1.88 (br. s., 5 H), 2.08 (s, 5 H), 2.13 (d, J = 6.75 Hz, 2 H), 2.17-2.25 (m, 1 H), 2.36 (br. s., 3 H), 2.60-2.67 (m, 1 H), 3.14-3.22 (m, 2 H), 3.37 (s, 1 H), 3.51 (s, 1 H), 3.94 (s, 2 H), 5.18 (t, J = 8.52 Hz, 1 H), 7.43-7.50 (m, 1 H), 7.67 (s, 1 H), 7.98 (s, 1 H), 8.03 (d, J = 7.72 Hz, 1 H), 8.35 (d, J = 8.36 Hz, 1 H).





345


embedded image


***
4-(9-Cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-[1 - (tetrahydro-pyran-4-yl)-piperidin- 4-yl]-benzamide
Rt = 2.74 min (Analytical_1); ES(+ve): 578.5; ES(−ve): 576.7.





373


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclobutane-1,7′- pyrimido[4,5-b][1,4]diazepine]-2′- ylamino)-3-fluoro-N-(4- methylpiperazin-1-yl)benzamide
Rt = 2.74 min (Analytical_1); MS(+ve): 537.5; 1H NMR (DMS0-d6) δ ppm: 1.55-1.65 (8 H, m), 1.71 (2 H, m), 1.88 (2 H, m), 2.18 (3 H, s), 2.28 (2 H, q, J 10.5 Hz), 2.41-2.52 (4 H, m), 2.89 (4 H, m), 3.18 (3 H, s), 3.61 (2 H, s), 4.76 (1 H, quintet, 8.5 Hz), 7.61 (2 H, m), 8.03 (1 H, s), 8.12 (1 H, dd, J 8 Hz, 8.5 Hz), 8.76 (1 H, s), 9.36 (1 H, s).





374


embedded image


***
4-(9′-Cyclopentyl-5′-methyl-6′- oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- fluoro-N-(4-methylpiperazin-1- yl)benzamide
Rt = 2.58 min (Analytical_1); MS(+ve): 523.4; 1H NMR (DMS0-d6) δ ppm: 0.65-0.67 (2 H, s, CH2), 0.85-0.95 (2 H, m, CH2), 1.23-1.82 (8 H, m, alkyl-H), 2.18 (3 H, s, CH3), 2.36-2.41 (4 H, m, alkyl-H), 2.88 (4 H, s, alkyl-H), 3.16 (3 H, s, CH3), 3.44 (2 H, s, alkyl-H), 4.77- 4.80 (1 H, m, CH), 7.6 (2 H, m, aryl-H), 7.96 (1 H, s, aryl-H), 8.16 (1 H, t, J = 8 Hz, aryl-H), 8.70 (1 H, s, NH), 9.35 (1 H, s, NH).





194


embedded image


***
(±)-4-(9-cyclopentyl-5,7,7- trimethyl-6-oxo-6,7,8,9- tetrahydro-5H-pyrimido[4,5- b][1,4]diazepin-2-ylamino)-3- methoxy-N-(quinuclidin-3- yl)benzamide
Rt = 3.28 min (Analytical_1); MS(+ve): 548.5; 1H NMR (DMS0-d6) δ ppm: 8.37 (1 H, d, J 8 Hz), 8.07 (1 H, d, J 6.5 Hz), 7.98 (1 H, s), 7.69 (1 H, s), 7.47-7.50 (2 H, m), 5.19 (1 H, quint, J 8 Hz), 3.95 (4 H, m), 3.37 (2 H, s), 3.18 (3 H, s), 3.11 (1 H, m), 2.89 (1 H, m), 2.65-2.72 (4 H, m), 1.88 (2 H, m), 1.73-1.87 (4 H, m), 1.57-1.61 (6 H, m), 1.31 (1 H, m), 1.09 (6 H,s).





186


embedded image


***
(±)-4-(9′-cyclopentyl-5′-methyl-6′- oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxy-N-(quinuclidin-3- yl)benzamide
Rt = 3.02 min (Analytical_1); MS(+ve): 546.4; 1H NMR (DMSO-d6) δ ppm: 8.40 (1 H, d, J 8 Hz), 8.08 (1 H, d, J 7 Hz), 7.98 (1 H, s), 7.69 (1 H, s), 7.47-7.50 (2 H, m), 4.87 (1 H, quint, J 9 Hz), 4.10 (1 H, q, J 5.5 Hz), 3.95 (4 H, m), 3.47 (2 H, s), 3.27 (3 H, s), 3.07 (1 H, m), 2.08 (1 H, m), 2.63-2.86 (4 H, m), 1.88 (3 H, m), 1.78 (1 H, m), 1.68 (2 H, m), 1.50- 1.62 (5 H, m), 1.32 (1 H, m), 0.90 (2 H, m), 0.66 (2 H, m).





375


embedded image


***
4-(9′-Cyclopentyl-5′-methyl-6′- oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-N- (4-(2-hydroxyethyl)piperazin-1-yl)- 3-methoxybenzamide
Rt = 2.48 min (Analytical_1); MS(+ve): 565.4; 1H NMR (DMSO) δ ppm: 0.66-0.67 (2 H, m, CH2), 0.88-0.90 (2 H, m, CH2), 1.23-1.90 (8 H, m, alkyl-H), 2.34-2.41 (4 H, m, alkyl-H), 2.91 (4 H, t, J = 4 Hz, alkyl-H), 3.16 (3 H, s, CH3), 3.46-3.51 (4 H, m,), 3.93 (3 H, s, CH3), 4.38-4.45 (1 H, m,) 4.81-4.87 (1 H, m, CH), 7.40 (2 H, d, J = 10.5 Hz, aryl-H), 7.67 (1 H, s), 7.98 (1 H, s ), 8.39 (1 H, d, J = 8 Hz, aryl-H ), 9.30 (1 H, s, NH).





376


embedded image


***
4-(9′-Cyclopentyl-5′-methyl-6′- oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxy-N-morpholinobenzamide
Rt = 2.72 min (Analytical_1); MS(+ve): 522.4; 1H NMR (DMSO) δ ppm: 0.65-0.71 (2 H, m, CH2), 0.85-0.91 (2 H, m, CH2), 1.23-1.88 (8 H, m, alkyl-H), 2.92 (4 H, t, J = 4 Hz, alkyl-H), 3.16 (3 H, s, CH3), 3.47 (2 H, s, alkyl-H), 3.66 (4 H, t, J = 4.5Hz), 3.94 (3 H, s, CH3), 4.81-4.87 (1 H, m, CH), 7.41 (2 H, d, J = 9.5 Hz), 7.69 (1 H, s), 7.98 (1 H, s), 8.40 (1 H, d, J = 8 Hz), 9.41 (1 H, s, NH).





347


embedded image


***
(R)-4-(9′-cyclopentyl-5′-methyl-6′- oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxy-N-(quinuclidin-3- yl)benzamide
Rt= 3.07 min (Analyticall_1); MS(+ve): 546.5; MS(−ve): 544.6; 1H NMR (DMSO-d6) δ ppm: 0.62-0.72 (2 H, m), 0.87-0.94 (2 H, m), 1.20-1.38 (1 H, m), 1.44-1.54 (2 H, m), 1.54-1.64 (4 H, m), 1.64-1.74 (2 H, m), 1.75-1.85 (1 H, m), 1.85-1.95 (3 H, m), 2.65-2.79 (4 H, m), 2.83-3.01 (1 H, m), 3.11-3.21 (4 H, m), 3.47 (2 H, s), 3.95 (4 H, s), 4.77-4.93 (1 H, m), 7.42-7.54 (2 H, m), 7.69 (1 H, s), 7.98 (1 H, s), 8.10 (1 H, d, J = 6.3 Hz), 8.39 (1 H, d, J = 8.3 Hz).





348


embedded image


***
(S)-4-(9′-cyclopentyl-5′-methyl-6′- oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxy-N-(quinuclidin-3- yl)benzamide
Rt = 3.04 min (Analytical_1); MS(+ve): 546.5; MS(−ve): 544.6; 1H NMR (DMSO-d6) δ ppm: 0.59-0.74 (2 H, m), 0.86-0.97 (2 H, m), 1.20-1.43 (1 H, m), 1.45-1.75 (7 H, m), 1.76-1.98 (4 H, m), 2.66-2.86 (3 H, m), 2.89-3.07 (1 H, m), 3.17 (3 H, s), 3.47 (3 H, s), 3.89-4.02 (4 H, m), 4.76-4.96 (1 H, m), 7.42-7.59 (2 H, m), 7.70 (1 H, s), 7.98 (1 H, s), 8.14 (1 H, d, J = 6.3 Hz), 8.40 (1 H, d, J = 7.8 Hz).





377


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclobutane-1,7′- pyrimido[4,5-b][1,4]diazepine]-2′- ylamino)-N-((trans)-4-(4- (cyclopropylmethyl)piperazin-1- yl)cyclohexyl)-3- methoxybenzamide
Rt = 3.41 min (Analytical_1); ES(+ve): 671.6; ES(−ve): 669.7; 1H NMR (DMSO-d6) δ ppm: 0.03 (2 H, dd, J 9.5 Hz, 5 Hz), 0.41 (2 H, dd, J 10 Hz, 5 Hz), 0.79 (1 H, m), 1.20-1.37 (4 H, m), 1.55-1.94 (18 H, m), 2.04 (2 H, d, J 6.5 Hz), 2.16-2.46 (8 H, m), 3.15 (3 H, s), 3.32 (2 H, s), 3.69 (1 H, m), 3.90 (3 H, s), 4.79 (1 H, m), 7.44 (2 H, m), 7.68 (1 H, s), 8.01 (2 H, m), 8.34 (1 H, d, J 8.5 Hz)





378


embedded image


***
4-(9-cyclopentyl-5-methyl-6-oxo- 6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2- ylamino)-N-((trans)-4-(4- (cyclopropylmethyl)piperazin-l- yl)cyclohexyl)-3- methoxybenzamide
Rt = 2.88 min (Analytical_1); ES(+ve): 631.5; ES(−ve): 629.6; 1H NMR (DMS0-d6) δ ppm: −0.15-0.11 (m, 2 H), 0.40 (d, J = 8.06 Hz, 2 H), 0.63-0.85 (m, 1 H), 1.11-1.41 (m, 3 H), 1.57 (br. s., 2 H), 1.69 (d, J = 17.73 Hz, 2 H), 1.74- 1.95 (m, 6 H), 2.04 (s, 2 H), 2.09 (d, J = 6.45 Hz, 2 H), 2.16 (d, J = 9.67 Hz, 1 H), 2.32 (br. s., 2 H), 2.49 (br. s., 1 H), 2.51-2.59 (m, 2 H), 2.59 (br. s., 1 H), 3.07-3.17 (m, 3 H), 3.27 (s, 5 H), 3.53-3.62 (m, 2 H), 3.67 (dd, J = 7.41, 3.55 Hz, 1 H), 3.89 (s, 2 H), 4.04 (q, J = 5.37 Hz, 1 H), 4.76 (quin, J = 8.22 Hz, 1 H), 7.38-7.48 (m, 2 H), 7.68 (s, 1 H), 7.99 (d, J = 7.74 Hz, 1 H), 8.03 (s, 1 H), 8.33 (d, J = 8.06 Hz, 1 H)





379


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pynmido[4,5- b][1,4]diazepine]-2′-ylamino)-N- ((trans)-4-(4-ethylpiperazin-1 - yl)cyclohexyl)-3- methoxybenzamide
Rt = 3.00 min (Analytical_1) MS(+ve) 631.6; MS(−ve) 629.7; 1H NMR (DMSO-d6) δ ppm: 0.59-0.72 (2 H, m), 0.81-0.92 (2 H, m), 0.97 (3 H, t, J=7.1 Hz), 1.20-1.42 (4 H, m), 1.42- 1.55 (2 H, m), 1.54-1.64 (2 H, m), 1.64-1.73 (2 H, m), 1.83 (2 H, d, J = 11.7 Hz), 1.89 (4 H, d, J = 7.8 Hz), 2.14-2.42 (7 H, m), 3.16 (3 H, s), 3.47 (2 H, s), 3.64-3.79 (1 H, m), 3.94 (3 H, s), 4.84 (1 H, quin, J = 8.7 Hz), 7.40-7.54 (2 H, m), 7.67 (1 H, s), 7.98 (1 H, s), 8.03 (1 H, d, J = 7.8 Hz), 8.38 (1 H, d, J = 8.3 Hz)





380


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2'-ylamino)-N- ((cis)-4-(4-ethylpiperazin-1- yl)cyclohexyl)-3- methoxybenzamide
Rt = 3.13 min (Analytical_1) MS(+ve) 631.6; MS(−ve) 629.7; 1H NMR (DMS0-d6) δ ppm: 0.60-0.72 (2 H, m), 0.83- 0.93 (2 H, m), 0.98 (3 H, t, J = 7.1 Hz), 1.38-1.55 (6 H, m), 1.55-1.63 (2 H, m), 1.63-1.80 (4 H, m), 1.80-1.96 (4 H, m), 2.02-2.17 (1 H, m), 2.16-2.44 (7 H, m), 3.16 (3 H, s), 3.47 (2 H, s), 3.79-3.92 (1 H, m), 3.94 (3 H, s), 4.84 (1 H, quin, J = 8.5 Hz), 7.44-7.58 (2 H, m), 7.67 (1 H, s), 7.98 (1 H, s), 8.03 (1 H, d, J = 7.3 Hz), 8.37 (2 H, d, J = 8.8 Hz)





381


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-N- (4-(4-(cyclopropylmethyl)-1,4- diazepan-1-yl)cyclohexyl)-3- methoxybenzamide
Rt = 4.12 min (Analytical_1) MS(+ve) 671.6; MS(−ve) 669.7; 1H NMR (DMS0-d6) δ ppm: 0.01 (2 H, d, J = 4.4 Hz), 0.40 (2 H, d, J = 7.3 Hz), 0.63 (2 H, br. s.), 0.71-0.83 (1 H, m), 0.87 (2 H, br. s.), 1.02 (1 H, t, J = 7.1 Hz), 1.25-1.38 (2.5 H, m), 1.39-1.52 (3.5 H, m), 1.52-1.61 (2 H, m), 1.65 (4 H, d, J = 5.9 Hz), 1.70-1.80 (3 H, m), 1.85 (3 H, d, J = 4.4 Hz), 2.21- 2.31 (1 H, m), 2.55-2.83 (8 H, m), 3.13 (3.5 H, s), 3.35- 3.55 (3 H, m), 3.69 (0.5 H, br. s.), 3.91 (3.5 H, s), 4.31 (0.5 H, t, J = 5.1 Hz), 4.81 (1 H, t, J = 8.5 Hz), 7.25-7.54 (2 H, m), 7.64 (1 H, s), 7.84-8.16 (2 H, m), 8.35 (1 H, d, J = 8.3 Hz)





382


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-N- (4-(4-ethyl-1,4-diazepan-1- yl)cyclohexyl)-3- methoxybenzamide
Rt = 3.98 min, 4.18 min (Analytical_1) MS(+ve) 645.6; MS (−ve) 643.7; 1H NMR (DMS0-d6) δ ppm: 0.57-0.74 (2 H, m), 0.82-0.93 (2 H, m), 0.95-1.09 (3 H, m), 1.30-1.42 (2 H, m), 1.42-1.54 (3.5 H, m), 1.58 (2 H, d, J = 4.4 Hz), 1.63- 1.75 (3.5 H, m), 1.75-1.83 (1.5 H, m), 1.88 (3.5 H, br. s.), 1.98-2.16 (1.5 H, m), 2.59-2.86 (4 H, m), 3.17 (4 H, s), 3.41-3.53 (3.5 H, m), 3.78 (2.5 H, m), 3.88-4.02 (3.5 H, m), 4.06-4.38 (1 H, m), 4.76-4.91 (1 H, m), 7.39-7.57 (2 H, m), 7.59-7.78 (1 H, m), 7.98 (2 H, s), 8.31-8.45 (1 H, m)





383


embedded image


**
N-(4-(4-benzyl-1,4-diazepan-1- yl)cyclohexyl)-4-(9′-cyclopentyl-5′- methyl-6′-oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxybenzamide
Rt = 4.40 min (Analytical_1) MS(+ve) 707.6; MS(−ve) 705.7; 1H NMR (DMSO-d6) δ ppm: 0.73 (2 H, br. s.), 0.96 (2 H, br. s.), 1.22-2.22 (19 H, m), 2.64-2.91 (4 H, m), 3.23 (5 H, s), 3.53 (8 H, s), 3.89-4.24 (4 H, m), 4.91 (1 H, t, J = 8.5 Hz), 5.82 (0 H, s), 7.23-8.54 (10 H, m)





384


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-N- ((trans)-4-(4-methylpiperazin-1- yl)cyclohexyl)-3- methoxybenzamide
Rt = 2.85 min (Analytical_1) MS(+ve) 617.5; MS(−ve) 615.6; 1H NMR (DMS0-d6) δ ppm: 0.61-0.76 (2 H, m), 0.89 (1 H, t, J = 6.8 Hz), 0.92-0.98 (2 H, m), 1.22-1.47 (5 H, m), 1.47- 1.79 (6 H, m), 1.81-2.02 (5 H, m), 2.07-2.20 (3 H, m), 2.20- 2.42 (4 H, m), 3.20 (4 H, s), 3.34 (3 H, s), 3.51 (2 H, s), 3.67-3.82 (1 H, m), 3.98 (3 H, s), 4.88 (1 H, quin, J = 8.5 Hz), 7.42-7.59 (2 H, m), 7.71 (1 H, s), 8.02 (1 H, s), 8.08 (1 H, d, J = 7.8 Hz), 8.42 (1 H, d, J = 8.3 Hz)





385


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-N- ((cis)-4-(4-methylpiperazin-1- yl)cyclohexyl)-3- methoxybenzamide
Rt = 2.93 min (Analytical_1) MS(+ve) 617.5; MS(−ve) 615.6; 1H NMR (DMS0-d6) δ ppm: 0.62-0.80 (2 H, m), 0.84- 1.02 (4 H, m), 1.18-1.36 (4 H, m), 1.43-1.84 (12 H, m), 1.84-2.03 (4 H, m), 2.09-2.22 (4 H, m), 2.41 (4 H, br. s.), 3.21 (3 H, s), 3.52 (2 H, s), 3.89-3.97 (1 H, m), 3.99 (3 H, s), 4.89 (1 H, quin, J = 8.5 Hz), 7.47-7.61 (2 H, m), 7.72 (1 H, s), 8.03 (1 H, s), 8.08 (1 H, d, J = 7.3 Hz), 8.43 (1 H, d, J = 9.3Hz)





386


embedded image


***
N-((trans)-4-(4-benzylpiperazin-1- yl)cyclohexyl)-4-(9′-cyclopentyl-5′- methyl-6′-oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxybenzamide
Rt = 3.64 min (Analytical_1) MS(+ve) 693.6; MS(−ve) 691.7; 1H NMR (DMS0-d6) δ ppm: 0.62-0.79 (2 H, m), 0.85- 1.02 (2 H, m), 1.20-1.46 (4 H, m), 1.46-1.58 (2 H, m), 1.59- 1.67 (2 H, m), 1.67-1.78 (2 H, m), 1.80-2.02 (6 H, m), 2.12 (1 H, s), 2.18-2.46 (6 H, m), 3.20 (3 H, s), 3.43-3.56 (5 H, m), 3.67-3.84 (1 H, m), 3.97 (3 H, s), 4.88 (1 H, quin, J = 8.4 Hz), 7.22-7.42 (6 H, m), 7.44-7.59 (2 H, m), 7.71 (1 H, s), 8.02 (1 H, s), 8.08 (1 H, d, J = 7.8 Hz), 8.42 (1 H, d, J = 7.8 Hz)





387


embedded image


**
N-((cis)-4-(4-benzylpiperazin-1- yl)cyclohexyl)-4-(9′-cyclopentyl-5′- methyl-6′-oxo-5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxybenzamide
Rt = 3.85 min (Analytical_1) MS(+ve) 693.6; MS(−ve) 691.7; 1H NMR (DMS0-d6) δ ppm: 0.62-0.79 (2 H, m), 0.87- 1.01 (2 H, m), 1.43-1.59 (5 H, m), 1.59-1.67 (2 H, m), 1.66- 1.74 (2 H, m), 1.75-1.84 (2 H, m), 1.92 (4 H, br. s.), 2.07- 2.29 (2 H, m), 2.41 (4 H, br. s.), 3.20 (3 H, s), 3.51 (4 H, s), 3.87-4.05 (4 H, m), 4.74-4.99 (1 H, m), 7.24-7.39 (5 H, m), 7.50-7.56 (2 H, m), 7.71 (1 H, s), 8.02 (1 H, s), 8.07 (1 H, d, J = 6.8 Hz), 8.42 (1 H, d, J = 8.8 Hz)





388


embedded image


***
4-(9-cyclopentyl-5,7,7-trimethyl-6- oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-((trans)-4- morphoIinocyclohexyl)benzamide
Rt = 3.16 min (Analytical_1) MS(+ve) 606.4; MS(−ve) 604.5; 1H NMR (DMSO-d6) δ ppm: 1.07-1.18 (7 H, m), 1.24- 1.49 (4 H, m), 1.58-1.71 (4 H, m), 1.71-1.84 (2 H, m), 1.83- 2.03 (6 H, m), 2.23 (1 H, t, J = 10.5 Hz), 2.43-2.51 (3 H, m), 3.17-3.28 (4 H, m), 3.42 (3 H, br. s.), 3.60 (4 H, br. s.), 3.64 (1 H, br. s.), 3.71-3.83 (1 H, m), 3.98 (3 H, s), 5.23 (1 H, t, J = 8.3 Hz), 7.44-7.60 (2 H, m), 7.72 (1 H, s), 8.02 (1 H, s), 8.09 (1 H, d, J = 7.8 Hz), 8.40 (1 H, d, J = 8.3 Hz)





389


embedded image


**
4-(9-cyclopentyl-5,7,7-trimethyl-6- oxo-6,7,8,9-tetrahydro-5H- pyrimido[4,5-b][1,4]diazepin-2- ylamino)-3-methoxy-N-((cis)-4- morpholinocyclohexyl)benzamide
Rt = 3.31 min (Analytical_1) MS(+ve) 606.4; MS(−ve) 604.5; 1H NMR (DMSO-d6) δ ppm: 1.13 (6 H, s), 1.39-1.60 (4 H, m), 1.60-1.71 (4 H, m), 1.71-1.85 (4 H, m), 1.85-2.01 (4 H, m), 2.07-2.22 (2 H, m), 2.42-2.48 (4 H, m), 3.22 (4 H, s), 3.64 (4 H, br. s.), 3.87-4.05 (4 H, m), 5.14-5.31 (1 H, m), 7.45-7.62 (2 H, m), 7.71 (1 H, s), 8.02 (1 H, s), 8.09 (1 H, d, J = 7.3 Hz), 8.39 (1 H, d, J = 8.3 Hz)





390


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxy-N-((trans)-4- morpholinocyclohexyl)benzamide
Rt = 2.96 min (Analytical_1) MS(+ve) 604.4; MS(−ve) 602.5; 1H NMR (DMSO-d6) δ ppm: 0.72 (2 H, s), 0.95 (2 H, s), 1.24-1.49 (4 H, m), 1.49-1.60 (2 H, m), 1.60-1.69 (2 H, m), 1.69-1.82 (2 H, m), 1.82-2.03 (6 H, m), 2.14 (1 H, s), 2.17-2.32 (1 H, m), 3.22 (4 H, s), 3.53 (2 H, s), 3.61 (4 H, br. s.), 3.71-3.84 (1 H, m), 4.00 (3 H, s), 4.90 (1 H, quin, J = 8.5 Hz), 7.43-7.61 (2 H, m), 7.73 (1 H, s), 8.04 (1 H, s), 8.10 (1 H, d, J = 7.8 Hz), 8.44 (1 H, d, J = 8.3 Hz)





391


embedded image


***
4-(9′-cyclopentyl-5′-methyl-6′-oxo- 5′,6′,8′,9′- tetrahydrospiro[cyclopropane- 1,7′-pyrimido[4,5- b][1,4]diazepine]-2′-ylamino)-3- methoxy-N-((cis)-4- morpholinocyclohexyl)benzamide
Rt = 3.10 min (Analytical_1) MS(+ve) 604.4; MS(−ve) 602.5; 1H NMR (DMSO-d6) δ ppm: 0.66-0.81 (2 H, m), 0.88- 1.03 (2 H, m), 1.45-1.86 (12 H, m), 1.87-2.02 (4 H, m), 2.10-2.21 (1 H, m), 2.47 (4 H, br. s.), 3.22 (3 H, s), 3.52 (2 H, s), 3.65 (4 H, br. s.), 3.89-4.05 (4 H, m), 4.90 (1 H, quin, J = 8.5 Hz), 7.50-7.63 (2 H, m), 7.73 (1 H, s), 8.03 (1 H, s), 8.10 (1 H, d, J = 7.3 Hz), 8.43 (1 H, d, J = 8.3 Hz)
















TABLE 4







PLK activity data for compound [218] versus selected prior art compounds











Compound


PLK2 IC50/
PLK3 IC50/


64
Structure
PLK1
PLK1 IC50
PLK1 IC51














[218]


embedded image


***
35
330





WO 2007/095188 [I-64]


embedded image


***
17
67





WO 2007/095188 [I-76]


embedded image


***
6
26





WO 2007/095188 [I-4]


embedded image


***
5
64





*** denotes < 0.1 μM IC50













TABLE 5







Solubility data for compound [254] and its HCl salt versus


Example [I-76] of WO 07/095188 and its HCl salt















Concentration
Forms





Liquid
based on free
stable
Forms


Compound
Description
phase
base (mg/mL)
solution
gel?















[254]
free base
DMA/
8
y





PEG400/







10 mM







pH4







Tartrate







buffer







(1:3:6)





Example
free base
DMA/
8
n
y


[I-76] of

PEG400/





WO

10 mM





07/095188

pH4







Tartrate







buffer







(1:3:6)





[254]•HCl
HCl salt
40%
20
y




of [254]
Captisol/







water





[254]•HCl
HCl salt
30%
20
y




of [254]
Captisol/







water





[254]•HCl
HCl salt
20%
20
y




of [254]
HPβCD/







water





[I-76]•HCl
HCl salt
40%
20
n
y



of [I-76]
Captisol/







water





[I-76]•HCl
HCl salt
30%
15
n
y



of [I-76]
Captisol/







water





[I-76]•HCl
HCl salt
20%
10
n
y



of [I-76]
HPβCD/







water







embedded image


embedded image















TABLE 6







Nephelometry maximum soluble concentration for compound


[254] of the invention versus compound [I-253] of WO 07/095188













Nephelometry





maximum




PLK1
soluble




Ki
concentration



Compound
(nM)
(μM)







embedded image


Compound [254]
<10
>200







embedded image


Example [I-253] of WO 07/095188
<10
75





[254]•HCl

<10
>200
















TABLE 7







Compounds tested in pharmacokinetic studies; compound H = compound


[371]; compound I = compound [378]; compounds A-G are for comparative purposes








Structure
Compound







embedded image


A







embedded image


B







embedded image


C







embedded image


D







embedded image


E







embedded image


F







embedded image


G







embedded image


H







embedded image


I
















TABLE 8







Comparator compounds tested in cell assays; letters correspond to labels in Figure 3.









Figure


Structure
label







embedded image


A′







embedded image


B′







embedded image


C′







embedded image


D′







embedded image


E′







embedded image


F′







embedded image


G′







embedded image


H′







embedded image


I′







embedded image


J′








Claims
  • 1. A compound of formula VIII, or a pharmaceutically acceptable salt or ester thereof,
  • 2. A compound according to claim 1 which is of formula VIIIa, or a pharmaceutically acceptable salt or ester thereof,
  • 3. A compound according to claims 1, 2, 11 or 12 wherein R1 is H or alkyl.
  • 4. A compound according to claims 1, 2, 11 or 12 wherein R2 is cycloalkyl.
  • 5. A compound according to claims 1, 2, 11 or 12 wherein R7 is H or alkyl.
  • 6. A compound according to claims 1, 2, 11 or 12 wherein R4 and R4′ are each independently alkyl.
  • 7. A compound according to claims 1, 2, 11 or 12 wherein R4 and R4′ together form a spiro cycloalkyl group.
  • 8. A compound according to claims 1, 2, 11 or 12 wherein R6 is OR8.
  • 9. A compound according claims 1 or 2 wherein R19 is cyclopropyl.
  • 10. A compound according to claim 1 which is selected from the following:
  • 11. A compound of formula VI, or a pharmaceutically acceptable salt or ester thereof,
  • 12. A compound of formula VII, or a pharmaceutically acceptable salt or ester thereof,
  • 13. (canceled)
  • 14. A compound according to claim 11 which is selected from the following:
  • 15. A compound according to claim 12 which is selected from the following:
  • 16. A compound which is selected from the following:
  • 17. A pharmaceutical composition comprising a compound according to claim 1, 2, 11 or 12 admixed with a pharmaceutically acceptable diluent, excipient or carrier.
  • 18-20. (canceled)
  • 21. A method of treating a proliferative disorder, said method comprising administering to a subject a therapeutically effective amount of a compound as defined in claims 1, 2, 11 or 12.
  • 22. A method of treating a PLK-dependent disorder, said method comprising administering to a subject a therapeutically effective amount of a compound as defined claims 1, 2, 11 or 12.
  • 23. A process for preparing a compound as defined in claims 1, 2, 11 or 12, said process comprising the steps of: (i) converting a compound of formula (II) to a compound of formula (IV) either directly or via isolation of a compound of formula (III); and(ii) converting said compound of formula (IV) to a compound according to any one of claims 1 to 16
  • 24. A process according to claim 23 wherein step (i) comprises heating said compound of formula (II) with NH4Cl and Fe in EtOH/H2O.
  • 25-26. (canceled)
  • 27. A compound according to claim 3 wherein R1 is methyl.
  • 28. A compound according to claim 4 wherein R2 is cyclopentyl or cyclohexyl.
  • 29. A compound according to claim 6 wherein at least one of R4 and R4′ are methyl.
  • 30. A compound according to claim 6 wherein R4 and R4′ are methyl.
  • 31. A compound according to claim 7 wherein the spiro cycloalkyl group is a spiro C3 cycloalkyl group.
Priority Claims (2)
Number Date Country Kind
0719038.2 Sep 2007 GB national
0806844.7 Apr 2008 GB national
PCT Information
Filing Document Filing Date Country Kind 371c Date
PCT/GB08/03305 9/29/2008 WO 00 11/1/2010