The regulation and maintenance of energy is an important topic of investigation in the biomedical sciences. One area of particular interest is the mechanism associated with energy regulation and maintenance at synaptic terminals.
Synaptic terminals are the key portals of information flow between brain cells, and they are subcellular regions with high energy demands. They are the sites of transduction of electrical information into chemical information (on the presynaptic side) followed by a reconversion of chemical information into electrical information (on the postsynaptic side). Both of these processes require the use of adenosine-tri-phosphate (ATP). ATP is also needed to support membrane trafficking events in the form of synaptic vesicle fusion, endocytosis and filling with neurotransmitters. As a consequence of these high metabolic needs, most synapses in the brain have one or two mitochondria anchored within the presynaptic terminals.
The precise regulation of ATP levels at synapses, and the general field of synaptic metabolism are poorly understood. This low level of understanding is unfortunate, because dysfunction of synaptic metabolism, which includes potential mitochondrial dysfunction may be linked to a number of neurological or neurodegenerative diseases such as Parkinson's and Alzheimer's disease. Thus, understanding and identifying the molecular mechanisms responsible for the fidelity of synaptic transmission in the central nervous system is a subject of intense interest.
One area that has remained very poorly explored is how local synaptic adenosine-tri-phosphate concentrations ([ATP]) are controlled. This area is particularly interesting because although in response to intense energy demands, many tissues in the body rely on local glycogen stores as a source of energy, neurons lack the capacity to store glycogen.
Synapses in particular have intense energy needs that vary enormously over time. During periods of intense activity such as with sustained action potential firing, the energy requirements at synapses increase significantly, because in addition to regulating ion homeostasis, the many membrane trafficking steps associated with both pre- and postsynaptic biology all have significant ATP requirements.
Moreover, because synapses are typically located at significant distances from neuronal cell bodies, they must rely on local energy resources to function. The presence of local mitochondria at many synapses suggests that there must be a local response to energy demands mediated through oxidative phosphorylation. However, it is important to note that, in hippocampal CA1 axons for example, only approximately 50% of synapses appear to have local mitochondria [1]. Thus, a number of important questions remain open regarding the nature of the relationship between activity and local [ATP]: is local depletion of [ATP] responsible for certain forms of activity-dependent synaptic depression?; how does the absence or presence of local mitochondria impact activity-dependent changes in [ATP]?; and do certain diseased states of the nervous system function manifest as a deregulation of local ATP supplies?
Upon review of these open questions, regulation of local [ATP] becomes a clear area of significant importance and interest. Furthermore, the need to understand this important biological variable is underscored by the large coterie of neurological disorders (e.g., peripheral neuropathies and ataxias) [2] that result from mutations in mitochondrial genes. Unfortunately, although measurements of ATP in living tissue are routinely made, in general these are made for large volumes. This is problematic because synaptic terminals are relatively small, having volumes of only about 10−15 [1], and current technologies have not been amenable to measurements in these subcellular specializations.
A direct measure of the molecular currency of energy supply in cells, the concentration of ATP, would provide the most useful diagnostic for examining energy homeostasis in living tissues. If one could provide a quantitative analytical tool to begin to directly monitor intracellular synaptic [ATP] levels, new avenues of research in synaptic energetics, a poorly explored but critically important problem in understanding brain function would be opened. The present invention is directed to providing new and non-obvious compositions and methods to probe the dynamics of ATP levels at synapses.
The present invention provides compositions and methods for measuring the local concentration of ATP in e.g., cells. Through the novel and non-obvious compositions and methods, one can better study ATP use and regulation at different locales, including but not limited to at or near synapses.
In one embodiment, the present invention provides an isolated polynucleotide comprising a sequence that encodes a hybrid protein, wherein the sequence comprises a first region that encodes a reporter enzyme, a second region that encodes a reporter fluorescent protein and third region that encodes a targeting protein, wherein these genes are linked together in a single reading frame. The targeting protein is capable of causing the protein that contains regions that correspond to each of the regions of the construct to be in a desired locale of e.g., a cell. The isolated polynucleotide may be single stranded or double stranded and DNA, RNA or a DNA/RNA hybrid. Furthermore, the polynucleotide may be isolated (and purified), which unless otherwise specified includes but is not limited to as part of a vector such as a plasmid or bacteriophage.
In another embodiment, the present invention is directed to a hybrid protein that is encoded by a polynucleotide. The hybrid protein may be encoded by the polynucleotide of the present invention or otherwise created (e.g., through chemical synthesis) to have the same sequence as a protein created through enzymatic synthesis that relies on one of the polynucleotides of the present invention. The protein may have each of a first region, second region and third region that corresponds to the three aforementioned regions of the polynucleotide construct.
In another embodiment, the present invention provides an isolated polynucleotide comprising a sequence that encodes a hybrid protein, wherein the sequence comprises a first region that encodes a reporter enzyme that is capable of reporter activity such as in a cell or within a locale of a cell by for example, chemoluminescence, and a second region that encodes a reporter fluorescent protein. These two regions may be linked in a single reading frame. In some embodiments, the present invention is directed to proteins with amino acid sequences that are the same as this hybrid protein. By way of example, there may be a hybrid protein that comprises, consists essentially of or consists of the amino acid sequence of a reporter enzyme and the amino acid sequence of a fluorescent reporter protein. In some embodiments, the construct also contains a nucleotide sequence of a targeting protein; however, in other embodiments it does not. These hybrid proteins may provide a direct measure of enzyme activity to enzyme concentration. These proteins may be particularly advantageous for an enzyme whose activity can be related to luminescence, e.g., in ATP assays.
In another embodiment, the present invention provides a reporter construct and methods for its use for the in vivo or in vitro measurement of the concentration of a specific biologically important molecule in a subcellular compartment or locale. This reporter construct comprises three genes linked together in a single reading frame to produce a hybrid protein when expressed in a suitable biological system. The reporter construct is a genetically-encoded hybrid nucleic acid molecule comprising, consisting essentially of or consisting of three parts:
The gene that encodes an enzyme that senses the molecule to be measured will typically interact with the analyte of interest. Preferably, it will form an easily measurable result. The gene that encodes a fluorescent protein will provide a measure of the amount of the reporter enzyme at the site of interest. Thus the components (1) and (2) provide a way to calibrate the enzymatic measurements. The ratio of the enzyme activity to the fluorescence provides a measure of the specific activity of the enzyme. Component (3) enables the detection of such local concentrations by targeting these reporter molecules to the subcellular location of interest.
A particular embodiment of this invention is a construct that can be used to measure the ATP concentration ([ATP]) in living presynaptic nerve terminals. The components of this construct may comprise, consist essentially of or consist of: (1) a gene encoding the enzyme luciferase from the North American firefly Photonis pyralis (SEQ ID NO: 1); (2) a gene encoding any of a variety of fluorescent proteins, e.g., mCherry (SEQ ID NO: 2); and (3) a gene encoding the synaptic vesicle transmembrane protein synaptophysin (SEQ ID NO: 3) in a single reading frame. This construct is referred to as Syn-ATP for synaptically-targeted fluorescent-protein-tagged luciferase and in some embodiments, may contain linking nucleotides between three genes.
The protein that Syn-ATP expresses is depicted in use in
The selected genes also offer the following benefits. The luciferase enzyme has three substrates, ATP, Mg2+ and the membrane-permeant molecule luciferin, and the enzyme catalyzes the production of oxyluciferin, which emits a photon in the visible spectrum as shown in
The fluorescent protein provides a measure of the enzyme concentration. Preferably, this protein should have good optical properties, such as a low photobleaching rate constant and insensitivity to changes in pH and calcium ion concentration, which are two variables that are known to fluctuate during biological activity. mCherry is known to have these desirable properties. However, the aforementioned gene is merely an example and the gene for other fluorescent proteins can be used. Examples of other genes include, but are not limited to, Green Fluorescent Protein (GFP) from Aequorea victoria, GFP mutants, and various GFP-like green, yellow and red proteins.
Synaptophysin is one of approximately nine different types of transmembrane proteins that are highly enriched on synaptic vesicles. It is a tetra-spanning membrane protein whose N and C termini are both located on the cytoplasmic face of the protein.
The nucleic acid construct for this hybrid gene is then transfected into primary neurons. After a suitable time to allow for expression, the fluorescence (e.g., mCherry) can be visualized using fluorescence microscopy where the expression will follow that of native synaptophysin and become localized to nerve terminals. Upon addition of cell-permeant luciferin, the substrate for the luciferase enzyme, one can then image the chemoluminescence that arises from individual nerve terminals. The detected photon flux arising from each nerve terminal can be normalized with respect to the fluorescence obtained from the fluorescent protein. This effectively corrects for differences in the number of luciferase molecules at each location. Chemoluminescence is imaged using the same apparatus as the fluorescence, however no excitation source is used during the detection of light.
In other embodiments, the present invention provides constructs in which one or more nucleotides have been substituted in order to generate proteins that have one or more amino acids that are substituted as compared to amino acids in one or more of the first region, the second region or the third region of other embodiments of the present invention. In still other embodiments, the present invention provides mutant (also referred to as modified) hybrid proteins in which one or more of amino acids have been substituted as compared to one or more of the protein regions of the aforementioned hybrid protein. These modifications may for example, be incorporated into the first region and render the protein usable and suitable for both live cell measurements and in situ calibration at 37° C. These probes may for example, be used to monitor the dynamics of ATP concentration during neuronal action potential firing.
In some embodiments, the polynucleotide and resulting protein can be used in isolated neurons to measure the ATP concentration at synaptic vesicles under various conditions for research purposes. For example, they can help to determine if synaptic [ATP] under resting or active conditions is derived from glycolysis or oxidative phosphorylation or whether local mitochondria can account for synaptic activity. By observing [ATP] changes between two different experimental states, this method can also be employed to screen for molecules that perturb or enhance synaptic metabolism, as well as to investigate the synaptic metabolism in diseased and normal states of brain function.
In some embodiments the polynucleotide and resulting protein can be used to measure ATP concentrations in any type of cell either in a specific sub-cellular location or throughout the entire intracellular volume. Here, again, by observing [ATP] changes in such cells between two different experimental states, this method can also be employed to screen for molecules that perturb or enhance the [ATP]s being studied.
Additionally, the constructs and proteins of the present invention can be used in assays in which drugs that enhance ATP production, including but not limited to AICAR, AICA Riboside and GW 501516 or combinations thereof are administered prior to and/or during the time in which measurements are taken.
In another embodiment, the present invention is directed to a method for measuring ATP concentrations in general. The method comprises: (1) transfecting a cell with polynucleotides of the present invention or otherwise associating a hybrid protein of the present invention with a cell (e.g. a neuron) at a desired locale; (2) exposing the cell to luciferin; (3) measuring fluorescence; (4) measuring chemoluminescence; and (5) calculating [ATP]. The exposing may for example, be done under saturation conditions and the calculation of the concentration may for example, be done by determining the ratio of luminescence to fluorescence and comparing this ratio to a suitably constructed calibration curve.
In another embodiment, the present invention provides a method for determining the in vivo concentration of a molecule in a subcellular compartment or locale. The method comprises transfecting one or more cells with a subcellular locale of interest with a nucleic acid of the present invention; allowing time for the expression of a protein encoded by the construct in the one or more cells; measuring fluorescence of the fluorescent protein and measuring activity of a reporter enzyme in the one or more cells of interest; and determining a ratio of enzyme activity to fluorescence.
In some embodiments, the protein of the present invention can be used to monitor the dynamics of ATP concentration during neuronal action potential firing. Additionally or in alternative embodiments, the protein of the present invention (and the polynucleotide that encodes it) can be used to show that resting presynpatic ATP levels depend on continuous glycolysis but that during action potential firing, ATP generated by oxidative phosphorylation in mitochondria is important.
In the following description, reference is made to the accompanying drawings and figures that form a part hereof. The drawings and figures show by way of illustration, specific embodiments that may be practiced. These embodiments are described in detail in order to enable those skilled in the art to practice the invention, and it is to be understood that other embodiments may be utilized and that structural and logical changes may be made without departing from the scope of the present invention. The following description of example embodiments is, therefore, not to be taken in a limited sense, and the scope of the present invention is defined by the appended claims, which are intended to encompass the full scope of equivalents to which they may be entitled.
In some embodiments, the present invention is directed to reporter constructs that are useful for the in vivo or in vitro measurement of the concentration of specific biologically important molecules in a subcellular compartment or locale. These constructs may comprise, consist essentially of or consist of nucleotide sequences. In other embodiments, the present invention is directed to the protein that is encoded by these constructs or that has the same sequence as a protein encoded by these constructs. In still other embodiments, the present invention is directed to methods for use of these constructs and proteins.
The reporter construct may comprise three genes linked together in a single reading frame to produce a hybrid protein when expressed in a suitable biological system. Thus, the reporter construct may be a genetically-encoded hybrid nucleic acid molecule consisting of three regions. The first region may encode a gene for an enzyme that senses the molecule to be measured. This enzyme may interact with the analyte of interest and form an easily measurable result. The second region may encode a gene for a fluorescent protein. This protein may provide a measure of the amount of reporter enzyme at the site of interest. The third region may encode a gene for a targeting protein to enrich the concentration of the reporter in the desired subcellular location of interest.
The first two regions code for protein sequences that provide a way to calibrate the enzymatic measurements. The ratio of the enzyme activity to the fluorescence essentially provides the specific activity of the enzyme. The third region encodes a protein that enables the detection of local concentrations by targeting these reporter molecules to the subcellular location of interest.
A specific embodiment of this invention is a construct that can be used to measure the adenosine-tri-phosphate (ATP) concentration ([ATP]) in vivo in subcellular locations that offers significant improvements over current approaches for measuring [ATP].
Current Approaches for Measuring [ATP]
Traditional estimates of intracellular [ATP] concentration have generally been indirect, relying on either absorbance measurements of HPLC separated lysates of cellular material or bioluminescence of luciferase derived from large population of cells. It is from these measurements that other researches have indirectly accounted for the total content of luciferase (Gajewski, C. D., Yang, L., Schon, E. A., and Manfredi, G. (2003) Mol Biol Cell 14, 3628-3635).
More recently two different optical approaches have been introduced based on the use of fluorescent proteins. Unfortunately, both have serious drawbacks with respect to providing a quantitative readout of ATP levels. The first, pericam, takes advantage a circularly permuted GFP to splice in a bacterial ATP-binding protein (GlnK1) as the ATP sensor (Berg, J., Hung, Y. P., and Yellen, G. (2009) Nat Methods 6, 161-166). The proximity of the binding protein to the GFP chromophore rendered the optical properties of the GFP molecule sensitive to the ATP binding in the sensor. Although an elegant approach, it suffers primarily from the fact that GlnK1 binds ATP very tightly, with reported Kd for ATP binding <100 nM, far below the range of intracellular [ATP] typically reported (0.1-1 mM). Thus, this type of sensor would be expected to be saturated under most physiological conditions. The authors of that work, however, noted that in the presence of ADP there is a significant competitive inhibition for ATP binding, and the reporter can provide a reasonable measure of the ATP/ADP ratio. Although this might prove useful for some circumstances, it is generally thought that ADP is rapidly hydrolyzed to AMP in the cellular milieu, and thus the reporter will probably remain saturated with ATP.
The second approach (Imamura, H., Huynh Nhat, K. P., Togawa, H., Saito, K., Iino, R., Kato-Yamada, Y., Nagai, T., and Noji, H. (2009) Proc Natl Acad Sci USA) made use of a different ATP sensor, the ε□-subunit of the F0-F1 ATPase, and combined it with a FRET pair (CFP-YFP) to create a sensor termed ATeam. This sensor suffers from three difficulties that will hinder its use for quantitative applications. Although the authors were able to generate four different variants of the ε-subunit harboring different point mutations, none of the respective Km's were in the appropriate range for the expected approximately 0.1-1 mM range of intracellular ATP. This problem is compounded by the fact that the reporter shows a non-linear readout with respect to [ATP], with a hill coefficient of approximately 2. As a result, the dynamic range is quite limited because the system reaches saturation quickly in the vicinity of the Km.
Thus, at present no suitable methods exist to probe the dynamics of [ATP] at subcellular resolution, and in particular at the level of single synapses. The need to understand this important biological variable is underscored by the large coterie of neurological disorders (e.g., peripheral neuropathies, ataxias and neurodegenerative diseases) (Chen, H., and Chan, D. C. (2006) Curr Opin Cell Biol 18, 453-459 and Petrozzi, L., Ricci, G., Giglioli, N. J., Siciliano, G., and Mancuso, M. (2007) Biosci Rep 27, 87-104) that result from mutations in mitochondrial genes. Providing a quantitative analytical tool to begin to directly monitor intracellular synaptic [ATP] levels should open up new avenues of research in synaptic energy metabolism, a poorly explored but critically important problem in understanding brain function.
Constructs, Proteins and Methods of Use
In some embodiments, the present invention provides a nucleic acid reporter construct that enables the measurement of [ATP] at presynaptic nerve terminals and methods of its use. This reporter construct has the following components linked together in a single reading frame: (1) a gene encoding the enzyme luciferase from the North American firefly Photonis pyralis; (2) a gene encoding any of the variety of fluorescent proteins; and (3) a gene encoding the synaptic vesicle transmembrane protein synaptophysin. As noted above, this construct and various modifications with a similar use are referred to as Syn-ATP. The protein that it expresses is depicted in use in
Various embodiments of the proteins of the present invention possess one or more if not all of the following properties: (1) a good signal to noise ratio when sampling local synaptic ATP levels (at the single synapse level) over a useful time scale; (2) sensitivity to [ATP] in a useful biological range; (3) relative insensitivity to other environmental variables such as calcium ions and pH or other nucleotides; (4) allowing for calibration to determine absolute ATP levels and provide meaningful comparisons of [ATP] from synapse to synapse and from cell to cell; (5) the ability to provide a report of ATP levels that does not significantly alter native physiological properties of the synapse; and (6) being genetically encoded.
The use of the Syn-ATP nucleic acid reporter construct takes advantage of recent significant technological improvements in optical detection, in particular at the level of image sensors, to be able to image chemiluminescence at the subcellular level. This approach utilizes the 62 kD enzyme luciferase from the firefly Photinus pyralis that converts luciferin, a cell permeant substrate, to oxyluciferin+light in the form of visible spectrum photon in an ATP-dependent fashion (
Luciferases have previously been shown to be very useful and robust ATP sensors in cells (Bell, C. J., Manfredi, G., Griffiths, E. J., and Rutter, G. A. (2007) Methods Cell Biol 80, 341-352) and faithfully follow Michaelis-Menten kinetics with respect to ATP concentration. However, their use for examining subcellular ATP levels, and in particular synaptic ATP concentrations, poses a technological challenge, given the typical very slow catalytic rate (only photon at a rate of approximately one per second) for most ATP-dependent luciferases. Although chemiluminescence has been mapped at the subcellular level in applications such as bioluminescence energy transfer (BRET) (Coulon, V., Audet, M., Homburger, V., Bockaert, J., Fagni, L., Bouvier, M., and Perroy, J. (2008) Biophys J 94, 1001-1009), the bioluminescent enzyme used in those cases is a luciferase from Renilla reniformis. This luciferase has a much higher turnover rate than that of Photinus pyralis, but sadly it does not use ATP or luciferin as a substrate, using coelenterazine and calcium ions instead.
Furthermore, as the local photon flux in a given subcellular area will be determined by the number of luciferase enzymes present, diffusion of the enzyme will begin to blur the spatial information on the microscopic scale even over timescales of approximately one second. The present invention overcomes these challenges by combining the molecular engineering of the Syn-ATP nucleic acid reporter construct with state-of-the-art optical detection.
In some embodiments, in order to overcome the difficulty of using a bioluminescence approach for sub-cellular quantitative imaging of ATP, the inventor has made two modifications to luciferase. The reporter construct was designed to express luciferase in neurons as a “double” chimeric protein, so that each luciferase was linked to a fluorescent protein and a protein that targets the luciferase to presynaptic terminals. The fluorescent protein component provides a ratiometric way to normalize luminescence signals with respect to fluorescent signals. The local ratio of luminescence to fluorescence thereby provides a means by which to correct the local photon flux in a given experiment and in a given part of the cell, thereby providing the local concentration of the enzyme.
The targeting component helps concentrate the enzyme in the region of interest. This improves the signals, because it increases the concentration of the reporter at the synapse. It also overcomes the problem of reporter diffusion, because by anchoring itself to synaptic vesicles it essentially immobilizes (or at least greatly slows diffusion) of the reporter. In some embodiments, mCherry is advantageous as the fluorescent tag, because it is conveniently spectrally well separated from the typical GFP channel such that a number of useful functional synaptic reporters (e.g., pHluorin or genetically encoded calcium indicators) can be used in tandem. Although in principle mCherry could serve as an energy acceptor for luciferase emission via BRET, this should not impose any problem, as all emitted photons will be detected in the chemiluminescence mode without spectral separation. The targeting protein selected is synaptophysin, a tetra-spanning synaptic vesicle membrane protein of poorly understood function. Because this component anchors the reporter protein to synaptic vesicles it also overcomes the problem of reporter diffusion, because it essentially immobilizes (or at least greatly slows diffusion) of the reporter protein.
Expression of Syn-ATP in neurons results in excellent synaptic localization, as synaptophysin is quite specifically located in presynaptic nerve terminals. Results of a typical experiment are illustrated in
The ratio of the luminescence intensities to the fluorescence intensities provides a “map” of the luciferase specific activity across different boutons. If luciferin itself is maintained at saturating levels, the specific activity is proportional to the concentration of ATP providing one is near or below the Km of luciferase for ATP.
As persons of ordinary skill in the art will recognize, luciferases are slow enzymes, and therefore photon fluxes obtained will be far lower than with conventional fluorescence approaches. However as the inventor appreciated, sufficient photon fluxes can be generated with Syn-ATP to provide the desired subcellular [ATP] measurements.
The nucleic acid construct for this hybrid gene is then transfected into primary neurons. After a suitable time to allow for expression, the mCherry fluorescence can be visualized using fluorescence microscopy where the expression will follow that of native synaptophysin and become localized to nerve terminals. Upon addition of cell-permeant luciferin, the substrate for the luciferase enzyme, one can then image the chemoluminescence arising from individual nerve terminals. The detected photon flux arising from each nerve terminal can be normalized with respect to the fluorescence obtained from the fluorescent protein. This effectively corrects for differences in the number of luciferase molecules at each location. Chemiluminescence is imaged using the same apparatus as the fluorescence, however no excitation source is used during the detection of light.
This construct can be used in isolated neurons to measure the ATP concentration at synaptic vesicles under various conditions for research purposes. This method can also be employed to screen for compounds that perturb or enhance synaptic metabolism by performing the [ATP] measurements both in the presence and absence of test compounds to determine whether the [ATP] differs when the compound is present. This method can also be used to investigate the synaptic metabolism in diseased and normal states of brain function.
It will be appreciated by those skilled in the art that the components of Syn-ATP can be modified in various ways, and the Syn-ATP construct will have the same utility. For example, the gene for the luciferase enzyme can be altered to make it more thermo-stable, including but not limited to, by containing any or all of the mutations shown to improve the thermostability including Thr214Ala, Ala215Leu, Ile232Ala, Phe295Leu, and Glu354Lys (Branchini B R et al. Anal. Biochem. 361, 253 (2007)). As persons of ordinary skill in the art are aware, by introducing specific mutations to a polynucleotide sequence, a desired mutation can be introduced to the protein that is produced from that mutation. Polynucleotide constructs or proteins that differ from Syn-ATP by one or more of these mutations may be referred to as “mutant Syn-ATP,” and unless otherwise specified or apparent from context, the ability to use Syn-ATP in an application implies the ability to use mutant Syn-ATP as well.
Similarly the gene (and protein) can be modified in ways to enhance luciferase's enzymatic activity. One such example of this would be to encode the luciferase with the Ile423Leu mutation that has been shown to increase the turnover rate of this enzyme (Fuji H. et al. Anal. Biochem. 366, 131 (2007). Similarly any mutant identified in a mutagenesis screen on bacterially-expressed “optimized” Photinus pyrallis luciferase with increases in the enzymes kcat and/or Km could be employed for the luciferase component of the Syn-ATP construct.
In other embodiments of the Syn-ATP construct, any gene encoding any fluorescent protein that has spectral properties compatible with the fluorescence and luminescence measurements can be used in this Syn-ATP construct. Other fluorescent proteins include but are not limited to Green Fluorescent protein, GFP, mPlum, mCherry, tdTomato, mStrawberry, J-Red, DsRed-monomer, mOrange, mKO, mCitrine, Venus, YPet, EYFP, Emerald, EGFP, CyPet, mCFPm, Cerulean, and T-Sapphire and combinations thereof.
Other embodiments of the Syn-ATP construct could contain the gene for any protein that is expressed specifically in the synaptic vesicles instead of synaptophysin. Other possible proteins that could be encoded in the Syn-ATP construct to target this reporter construct to the synaptic vesicles include but are not limited to: SV2, synapsin I, synapsin II, synaptotagmin (p65), vesicle associated membrane protein (synaptobrevin, VAMP), rab3A, VAT-1, vacuolar protein pump, and high MW proteoglycan.
Another modification would be to increase the number of genes included in the construct for each different component. For example, a way to increase the concentration of expressed luciferase by the Syn-ATP reporter would be to include several genes for luciferase in tandem, i.e., concatemers (e.g., exactly or at least two, three, four, five or six) of luciferases in the construct. This would increase the total photon flux per expressed protein complex. Hence, another embodiment of the Syn-ATP construct of this invention includes a nucleic acid linking a gene encoding synaptophysin, a gene encoding a fluorescent protein such as mCherry to a string of more than one luciferase genes. A similar approach has been used successfully with fluorescent proteins, encoding a concatamer of up to 4 GFPs spliced into a protein (Zhu, Y., Xu, J., and Heinemann, S. F. (2009) Neuron 61, 397-411). The time resolution of the ATP mapping a Syn-ATP construct with three concatamers of luciferase will increase 3-fold (while maintaining the same signal to noise ratio).
Another embodiment of this invention is directed to the targeting of the luciferase-fluorescent protein construct so that one can measure the [ATP] at any other intracellular locale. Other intracellular locales of interest include postsynaptic spines that could be targeted by fusing the gene for the post synaptic density protein 95 (PSD-95) to the genes for the fluorescent protein and luciferase. PSD-95 is a scaffolding protein of the post synaptic density. Other non-neuronal intracellular locales where the study of local [ATP] would have physiological relevance include: the mitochondrial matrix, the cytoplasmic surface of mitochondria, the inner leaflet of the plasma membrane, the surface of the endoplasmic reticulum or the Golgi apparatus.
Employing the reporter construct of this invention helps to overcome the main barrier to using an enzyme as an optical reporter. In most optical readouts using fluorescence, the number of photons emitted per unit time sets the signal to noise ratio. Fluorescent reporters, such as small organic molecules or fluorescent proteins have a maximal light flux that is limited by the excited state lifetime of the molecule after it absorbs excitation light. For most fluorescent probes this is on the order of ten nsec. Thus, the maximal photon flux for typical probes, under maximal illumination intensity, is on the order of 108 photons per sec. Enzymes work on much slower time scales and for a bioluminescent enzyme such as luciferase the maximal number of photons emitted is determined by the kcat, that for Photonus pyralis luciferase is approximately 1.6 per sec. As a result in practice it is very difficult to use luciferase for subcellular imaging, because the maximal light output is 108-fold lower than typical fluorescent probes.
Technological advances in recent years in imaging detectors have made the possibility of imaging extremely low photon fluxes a reality. However, given the very low turnover rate for luciferase, it was not clear whether sufficient photons could be gathered in a useful time frame, and whether they would be greater in number than stray photons impinging on the detector over these time periods. In anticipation of this difficulty the data described here were all acquired using a state-of-the-art cooled electron multiplying charge coupled device camera (EMCCDs) with very high quantum efficiency and extremely low readout out noise, coupled to a high numerical aperture objective (40× fluar 1.3 NA) to maximize the total photon collection efficiency. Luminescence images were acquired in the absence of any dichroic or emission filters, and fluorescence images were obtained using a filter set optimized for mCherry detection that was alternately swung into the collection path.
Using Syn-ATP, however, a much different picture emerges.
These images demonstrate that targeting of luciferase to nerve terminals makes imaging of subcellular bioluminescence possible. The signal to noise ratio of the luminescence picture for the three minute integration time is approximately 40:1, which is calculated by comparing the mean value of the synaptic luminescence intensity compared to the standard deviation of the background noise in the absence of luciferin.
Analysis of the intensity of the luminescence signal as a function of the fluorescence signal across different boutons shows that the two signals are tightly correlated (
Methods for synthesizing the polynucleotides and proteins referred to herein include but are not limited to enzymatic synthesis and chemical synthesis.
The present description is further illustrated by the following examples, which should not be construed as limiting in any way. The contents of all cited references (including literature references, issued patents, and published patent applications as cited throughout this application) are hereby expressly incorporated by reference.
The Syn-ATP shown in SEQ ID NO:4 was constructed using standard molecular biological tools and polymerase chain reaction (PCR) approaches to synthesize cDNA of the three fused genes that were then cloned into an expression vector. (See Sambrook J, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, 2001). It will be recognized by someone skilled in the art that various other sequences will have similar properties, and mutations in the sequences such as those already described are possible as long as the basic functions of each component remain. Similarly, different linking sequences between the component genes are possible, provided that the reading frames of the three component genes are maintained.
All experiments were performed using dissociated primary hippocampal neurons according to procedures that have been previously described in Ryan T A. J. Neurosci 19:1317-1323 (1999). Briefly, hippocampi from newborn rats (P2-P4) were removed and dissected. Prior to cell dissociation, the dendate gyrus was removed leaving a relatively pure population of CA3 & CA1 excitatory neurons and interneurons. These cells were dissociated and plated onto poly-L-ornithine-coated glass cover slips and maintained in a CO2/air incubator in growth media. cDNAs were transfected into the neurons using calcium-phosphate-mediated transfection as previously described (Sankaranarayanan S & Ryan T. A. Nature Cell Biol. 2, 197-204 (2000)) that has been optimized for simultaneously expressing multiple constructs in the same neuron. Transfection was carried out at day 7-10 in vitro (7-10 DIV), and experiments were performed between day 14 and 25 in vitro. For fluorescence and luminescence experiments cover slips were mounted in a rapid switching low volume perfusion chamber equipped with stimulus electrodes and mounted on the stage of an inverted microscope equipped with EMCCD detection and laser-based wide-field illumination. Chemiluminescence was imaged using the same apparatus as the fluorescence, however no excitation source was used during the detection of light.
On DIV 14-25, neurons were mounted in a custom-built physiological perfusion chamber with temperature control that allows direct control of field stimulation to drive action potential firing. The perfusion chamber was mounted on a custom-built inverted microscope coupled to an EM-CCD camera with acousto-optically-gated wide-field laser illumination. Luminescence and fluorescence imaging were performed using an EM-CCD Andor Ixon, thinned back-illuminated sensor through a 1.3 NA 40× fluar objective. Neurons expressing Syn-ATP were perfused with 20 mM luciferin, one minute prior to and throughout the period during which the luminescence images was obtained. Luciferin is under saturating conditions for luciferase at this concentration. For optimal photon detection no optical elements other than a mirror and a tube lens (1.6×) are present in the light path during luminescence imaging. To minimize stray light contributions, the entire microscope is enclosed in a custom-built light-tight, shielded environment. Fluorescence images were obtained using acousto-optically-gated wide-field laser illumination, before and after the luminescence acquisition.
As mentioned earlier the sensitivity of luminescence imaging differs from conventional fluorescence imaging. In conventional imaging one is often limited in collecting sufficient photons from a sub-cellular region that are greater in number than those arising from auto-fluorescence in the tissue. In luminescence no excitation light is used. Consequently, the only photons originating from the tissue can be those associated with the bioluminescent reaction. However, given the low turnover rates of these enzymes, one will likely have to integrate over much longer times than for a typical fluorescence image. Here the biggest sources of noise will be stray light entering the microscope, dark noise associated with the detector and read-out noise associated with conversion of the charge into a voltage. Thus, a critical aspect in considering ultra-low photon flux imaging is to ensure that: (1) no stray-light enters the microscope; and (2) that the sensitivity of the camera is maximal (and therefore that instrumentation noise is kept to a minimum).
Although in general most fluorescence microscopes seek to eliminate possible stray light contamination, imaging of luminescence has far more stringent requirements as integration times will likely be over the tens or even hundreds of seconds time scale compared with approximately 100 msec or less with typical fluorescence measurements. Thus, photon contamination would need to be at least 2-3 orders of magnitude lower for luminescence measurements compared to fluorescence measurements. In order to maximize detection efficiency and minimize camera readout noise the inventor chose to use an electron-multiplying CCD as the imaging sensor. The high on-chip gain associated with the electron multiplication effectively lowers readout noise to negligible levels, and the current generation state-of-the-art EMCCDs have quantum efficiencies for photon detection in the visible spectrum of approximately 98%. Additionally, the dark noise is very low, allowing for use of long integration times.
Calibration for Estimates of [ATP]syn
In order to convert the ratio of luminescence per unit time to fluorescence (L/F) in Syn-ATP measurements into a value of [ATP] an in-situ calibration approach may be used. Application of mild cell permeabilization conditions allows the perfusion of extracellular ATP into the cytosol across the plasma membrane, thereby clamping the ATP-level to that of the bath (schematized in
One advantage of the dual fluorescence-luminescence approach is that by monitoring the fluorescence at each synapse, one can effectively control for any loss of enzyme (because it is fluorescently-tagged) that might result from the permeabilization procedure. The key step here is to find conditions that leave the synaptic distribution of the enzyme itself reasonably intact. A number of permeabilized cell protocols have been developed over the years to allow the introduction of extracellular agents across the plasma membrane. This experiment used streptolysin-O, that forms approximately 20-30 nm pores in the plasma membrane. This small size of this toxin was thought to be sufficient to allow exchange of small molecules such as ATP. The presence of the pores in the plasma membrane allows extracellular [ATP] and intracellular [ATP] to equilibrate and be clamped to the external value. Using these permeabilization pores a standard curve was created for the luminescence/fluorescence ratio as a function of external [ATP] at each nerve terminal.
Notably, the increased stability of Syn-ATP under permeabilized cell conditions permits an accurate specific activity curve to be measured. This curve then permits the conversion of data obtained in live cells into absolute, calibrated values of ATP concentration.
Mutations in luciferase were used to optimize the construct: TS—I432L_D436G. The following set of mutations were incorporated, (i) five point mutations to increase thermal stability based on ref (1,2); T214A, A215L, I232A, F295L, E354K (these are referred to as TS mutations); (ii) increase in the catalytic rate of the enzyme by mutation I423L; and (iii) increase in the catalytic rate of the enzyme by mutation D436G.
A comparison was made of the enzymatic activity reported at resting intracellular synaptic ATP concentrations in intact synapses using various mutants of Syn-ATP at 37° C. The introduction of the TS mutants alone significantly lower the activity. However, introduction of the mutants that impact the enzyme's kcat restore the activity to near that of the WT protein, while permitting in-situ calibration that the wild type protein does not. The new mutant has the sequence of SEQ ID NO: 7. This mutant may be referred to as TS I432L_D 436G or Syn-ATP*. Results are shown in
Experiments that were identical to those that were run to generate the data of
Syn-ATP* mutant activity (encoded by SEQ ID NO: 7, protein of SEQ ID NO: 6) in streptolycin-O permeabilized nerve terminals was examined for different calcium ion concentration and pH. These data show that calcium does not impact Syn-ATP signals but pH does. The calibration will allow appropriate corrections to be applied for intact cell experiments. For example, one may measure intracellular pH and determine possible changes in pH brought about by different physiological conditions, such as electrical stimulation, or the addition of pharmacological inhibitors. One can then correct any changes in the Syn-ATP* mutant readout for potential changes in pH according to the curve of
As
As
Live cell Syn-ATP measurements were taken. The measurements reveal that ATP concentrations depress during electrical activity. Primary hippocampal neurons were transfected with Syn-ATP* and mounted in custom-built a perfusion chamber (see previous examples). Syn-ATP measurements, luminescence and fluorescence images) were obtained at one minute intervals. After acquisition of the second time point, a sequence of action potentials were triggered by passing a brief electrical stimulus across a pair of field electrodes mounted on either side of the perfusion system for the time indicated in the figure (as described in reference [4]). Data from approximately 20 to approximately 30 synaptic terminals all originating from the same transfected neuron were obtained. For each synaptic terminal, the ratio of luminescence to fluorescence was calculated and the values for all terminals in the field of view were averaged together. All subsequent values obtained at different times were divided by the initial value at the first time point which was set to the value 1.
Nucleotide Sequences
GCGGCCGCTCTAGGCTACCGGACTCAGATCTCGAGCTCAATCCTGAATTC
ACTAGTAACGGCCGCCAGTGTGCTGGAATTCTGCA
G[ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAA
GCTAGCGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTGCCC
TT[ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCC
TCGAG . . .
For SEQ ID NO: 4, each gene is demarked by brackets [ ] and identified in parentheses following the gene sequence. The restriction sites are underlined and identified in boldface. The restriction enzyme that recognizes each site is identified in parentheses following the identified restriction site. Linking sequences are denoted in italics.
M D V V N Q L V A G G Q F R V V K E P L G F V K V L Q W V F
M D F L A T A V F A F M W L V S S S A W A K G L S D V K M A T D P E N
M E G S V N G H E F E I E G E G E G R P Y E G T Q T A K L K V T K G G
M D V V N Q L V A G G Q F R V V K E P L G F V K V L Q W V F
M D F L A T A V F A F M W L V S S S A W A K G L S D V K M A T D P E N
M E G S V N G H E F E I E G E G E G R P Y E G T Q T A K L K V T K G G
ATGGACGTGGTGAATCAGCTGGTGGCTGGGGGTCAGTTCCG
GGTGGTCAAGGAGCCCCTTGGCTTCGTGAAGGTGCTGCAGTGGGTCTTTG
CCATCTTCGCCTTTGCTACGTGTGGCAGCTACACCGGGGAGCTTCGGCTGA
GCGTGGAGTGTGCCAACAAGACGGAGAGTGCCCTCAACATCGAAGTTGAA
TTCGAGTACCCCTTCAGGCTGCACCAAGTGTACTTTGATGCACCCTCCTGC
GTCAAAGGGGGCACTACCAAGATCTTCCTGGTTGGGGACTACTCCTCGTC
GGCTGAATTCTTTGTCACCGTGGCTGTGTTTGCCTTCCTCTACTCCATGGG
GGCCCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAACAACA
AAGGGCCTATGATGGACTTTCTGGCTACAGCCGTGTTCGCTTTCATGTGGC
TAGTTAGTTCATCAGCCTGGGCCAAAGGCCTGTCCGATGTGAAGATGGCC
ACGGACCCAGAGAACATTATCAAGGAGATGCCCATGTGCCGCCAGACAG
GGAACACATGCAAGGAACTGAGGGACCCTGTGACTTCAGGACTCAACACC
TCAGTGGTGTTTGGCTTCCTGAACCTGGTGCTCTGGGTTGGCAACTTATGG
TTCGTGTTCAAGGAGACAGGCTGGGCAGCCCCATTCATGCGCGCACCTCC
AGGCGCCCCGGAAAAGCAACCAGCACCTGGCGATGCCTACGGCGATGCG
GGCTACGGGCAGGGCCCCGGAGGCTATGGGCCCCAAGACTCCTACGGGCC
TCAGGGTGGTTATCAACCCGATTACGGGCAGCCAGCCAGCGGTGGCGGTG
GCTACGGGCCTCAGGGCGACTATGGGCAGCAAGGCTATGGCCAACAGGGT
GCGCCCACCTCCTTCTCCAATCAGATGGGATCCACTAGTAACGGCCGCCA
GAGGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCT
GGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGAACATCACGTA
CGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGG
GCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTT
ATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGA
CATTTATAATGAACGTGAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTA
GTGTTTGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAATTAC
CAATAATCCAGAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCA
GTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGAT
TTTGTACCAGAGTCCTTTGATCGTGACAAAACAATTGCACTGATAATGAATTCCT
CTGGATCTACTGGGTTACCTAAGGGTGTGGCCCTTCCGCATAGAgCTctCTGCG
TCAGATTCTCGCAcGCCAGAGATCCAATaTTTGGCAATCAAATCgcTCCGGATAC
TGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTC
GGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGC
TGTTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACCAAC
CCTATTTTCATTCTTgGCCAAAAGtACTCTGATTGACAAATACGATTTATCTAATTT
ACACGAAATTGCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGG
TTGCAAAACGCTTCCATCTTCCAGGGATACGACAAGGATATGGGCTCACTGAGA
CTACTAGTGCTATTCTGATTACACCCaAGGGGGATGATAAACCGGGCGCGGTC
GGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATCTGGATACCGGGAAA
ACGCTGGGCGTTAATCAGAGAGGCGAATTATGTGTCAGAGGACCTATGATTATG
TCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGA
TGGCTACATTCTGGAGACCTAGCTTACTGGGACGAAGACGAACACTTCTTCATA
GTTGGCCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGTGGCCCCCGCT
GAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGTGGCA
GGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGA
GCACGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAG
TAACAACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCG
AAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAG
GCCAAGAAGGGCGGAAAGATCGCCGTGTAA
This application is a continuation-in-part of International Application PCT/US10/52787, filed Oct. 15, 2012, which claims the benefit of U.S. Provisional Application Ser. No. 61/252,262, filed Oct. 16, 2009. This application claims the benefit of the filing dates of each of these applications and the entire disclosures of these applications are incorporated by reference as if set forth fully herein.
| Number | Name | Date | Kind |
|---|---|---|---|
| 7601517 | Gambhir et al. | Oct 2009 | B2 |
| 20090148449 | Deweers et al. | Jun 2009 | A1 |
| Number | Date | Country |
|---|---|---|
| WO2005123918 | Jun 2005 | WO |
| Entry |
|---|
| Accession DD332917. Oct. 23, 2006. |
| Accession AY678264. Dec. 17, 2004. |
| Accession X06177. Sep. 12, 1993. |
| Granseth et al. Neuron. Sep. 21, 2006;51(6):773-86. |
| Validation Report for Sequence Listing. Feb. 22, 2016. |
| PCT Search Report and Written Opinion. PCT/US2010/52787. Jan. 18, 2011. |
| Branchini et al.,Thermostable red and green light-producing firefly luciferase mutants for bioluminescent reporter applications, Analytical Biochemistry, vol. 361, pp. 253-262, 2007. |
| Fujii et al., Increase in bioluminescence intensity of firefly luciferase using genetic modification. Analytical Biochemistry, vol. 366, pp. 131-136, 2007. |
| Sasaki et al. Improvement or DNA vaccine immunogenicity by a dual antigen expression system. Biochem Biophys Res Commun. vol. 315, No. 1; pp. 38-43, 2004. abstract only. |
| Number | Date | Country | |
|---|---|---|---|
| 20140017696 A1 | Jan 2014 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61252262 | Oct 2009 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2010/052787 | Oct 2010 | US |
| Child | 13445534 | US |