The present invention relates to the detection of three different bacterial species which are responsible for sexually-transmitted diseases, i.e., Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and Mycoplasma genitalium (MG).
The present invention more particularly relates to the detection of these three species in real-time PCR, in multiplex PCR or in real-time multiplex PCR.
Chlamydia trachomatis (CT) is a species of the chlanydiae, a group of obligately intracellular bacteria. It causes sexually transmitted diseases, such as chlamydia and lymphogranuloma venereum, as well as trachoma, an eye infection that is a frequent cause of blindness.
Neisseria gonorrhoeae (NG) is a species of Gram-negative bacteria responsible for the disease gonorrhoea.
CT and NG co-infections are frequent.
Mycoplasma genitalium (MG) is a parasitic bacterium which lives in the primate genital and respiratory tracts. MG is thought to be involved in urethritis.
Traditional diagnosis of the presence of CT and/or MG and/or NG involves the culture of samples collected from patients, such as urethral specimen, on species-specific culture media. Such cultures are time-consuming and fastidious. They are all the most time-consuming and fastidious in the case of CT, MG and NG, because the culture of CT and MG requires a high level of technicality, and because NG is very sensitive to temperature and humidity variations.
Diagnosis methods based on nucleic acid amplification have therefore been developed. For example, the FDA-approved Amplicor™ kit available from Roche Diagnostic enables the detection of CT or NG. However, it does not enable to detect MG.
WO 98/11259 in the name of Visible Genetics Inc. discloses a method for co-amplification and detection of CT, MG and NG. This method involves the amplification of CT, MG and NG targets by amplification primers. The detection of the amplicons produced by said primers is carried out either by direct labelling of the primers, or by agarose gel techniques. The method of WO 98/11259 does however not involve the use of amplicon-annealing probes (cf. pages 9-10 of WO 98/11259). Hence, the method of WO 98/11259 is not a real-time technique.
The present invention enables the detection of CT, MG and NG in real-time amplification, and provides primers as well as probes, preferably beacon probes, which can be used together in multiplex in the same tube to detect the three bacterial species in real-time amplification.
As an advantageous feature, the invention may thus be implemented in real-time PCR, in multiplex PCR, or in multiplex real-time PCR.
The invention relates to the detection of three different bacterial species which are responsible for sexually-transmitted diseases, i.e., Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and Mycoplasma genitalium (MG).
The invention more particularly relates to the detection of these three species in real-time PCR, in multiplex PCR and in real-time multiplex PCR.
The invention provides reference templates sequences, which are especially adapted to the design of primers and probes, which can be used together in the same tube to detect CT and/or MG and/or NG, advantageously CT and MG and NG, by real-time multiplex amplification.
The invention also relates to these primers and probes, as well as to pharmaceutical compositions, to biological compositions, to detection kits and to diagnostic kits, which comprise at least one of primers and/or probes of the invention.
Table 1, which is at the end of Example 1 below, lists SEQ ID sequences, which are representative of reference template polynucleotides, primers and probes of the invention.
The invention further relates to a process for the detection of CT, MG and NG, which involves the use of at least one primer pair and/or at least one probe of the invention, as well as to the amplicons, which are obtainable with the primers of the invention.
To the best of the inventors' knowledge, the invention provides the first description of a detection of CT and MG and NG in real-time multiplex amplification.
The present invention relates to the detection of three sexually-transmittable bacterial species, namely: Chlamydia trachomatis (CT), Mycoplasma genitalium (MG) and Neisseria gonorrhoeae (NG).
The present invention provides nucleic acid reference template sequences, which allow for the construction and production of primers and probes, which are suitable for the detection of CT and/or MG and/or NG in real-time multiplex amplification.
The present invention thus provides CT primers, CT primer pairs, CT probes, MG primers, MG primer pairs, MG probes, NG primers, NG primer pairs and NG probes, which are suitable for the detection of CT and/or MG and/or NG in real-time multiplex amplification.
The primers of the invention can be mixed together in multiplex in the same tube to amplify CT and MG and NG in said same tube.
Advantageously, the present invention provides probes, which are suitable for real-time detection in such multiplex operative conditions.
Hence, the primers and probes of the invention can be mixed together in multiplex in the same tube to amplify and detect CT and MG and NG in real-time in said same tube.
Hence, the present invention enables the detection of CT and MG and NG in one single (amplification+detection) operative step.
To the best of the inventors' knowledge, the present invention is the first description of a real-time multiplex detection of the three bacterial species (CT, MG, NG).
In addition to detecting the three bacterial species within the same sample, the invention has the advantage of allowing checking for the absence of Taq polymerase inhibitors, by the use of an Internal Control (IC). IC, as well as IC primers and probes, are described in more details below.
The invention therefore allows for a quadruplex amplification (CT, MG, NG and IC).
The invention provides for a detection of said three bacterial species, which is much faster than any prior art technique, as well as much reliable as it heavily reduces the risk of having contaminated samples or cultures for analysis.
The means of the invention further are very sensitive and reproducible (see example 4 below).
At present time, there is no systemic detection of MG, whereas it is now acknowledged that MG is responsible for non-gonococcal urethritis, and is often associated to cervicitis and endometritis.
The present invention provides the first means that allow for a systemic detection of MG in a routine test allowing the simultaneous detection of CT and NG.
The invention thereby allows the physician to avoid the prescription of inappropriate antibiotics.
More particularly, the present invention provides:
Still more particularly, the present invention provides CT real-time amplification systems, MG real-time amplification systems, and NG real-time amplification systems, which allow for a detection of CT, MG and NG, respectively, which is specific of the bacterial species to which the real-time amplification system is intended.
Advantageously, the present invention provides CT real-time amplification systems, MG real-time amplification systems, and NG real-time amplification systems, which can be used together in multiplex in the same tube, without any significant loss in specificity: even when used together in multiplex in the same tube,
To the best of the inventors' knowledge, none of the real-time amplification systems of the invention detects human DNA (no cross-hybridization).
The application also relates to pharmaceutical compositions, to biological compositions, to detection kits and to diagnostic kits, which comprise at least one of the primers and/or probes of the invention, preferably at least two primers and at least one probe of the invention, more preferably at least one real-time amplification system of the invention, most preferably at least one CT and at least one MG and at least one NG real-time amplification systems of the invention.
The present application also relates to a process for the detection of at least one Chlamydia trachomatis (CT) and/or at least one Mycoplasma genitalium (MG) and/or at least one Neisseria gonorrhoeae (NG).
Said detection is usually performed in a sample.
By “sample containing nucleic acid material”, it is meant any sample, which contains at least one nucleic acid, e.g., a biological sample, such as a sample which has been collected from a cell culture, or from an animal or a human being, preferably a sample which has been collected from a tissue or fluid that is suspected of containing CT and/or MG and/or NG, such as e.g., a sample of uterine cervix, most preferably a urine sample (such as a first void urine sample).
Advantageously, the invention enables a reliable detection of CT and/or MG and/or NG is a urine sample.
Said sample may optionally have been further treated and/or purified according to any technique known by the skilled person, to improve the amplification efficiency and/or qualitative accuracy and/or quantitative accuracy. The sample may thus exclusively, or essentially, consist of nucleic acid(s), whether obtained by purification, isolation, or by chemical synthesis. Means are available to the skilled person, who would like to isolate or purify nucleic acids, such as DNA, from a biological sample, for example to isolate or purify DNA from cervical scrapes (e.g., QIAamp-DNA Mini-Kit; Qiagen, Hilden, Germany).
Said detection comprises the determination of whether at least one amplicon has been, or is, produced from said sample, or from nucleic acid material thereof, by amplification by means of amplification primers,
whereby a positive determination indicates that at least one CT and/or at least one MG and/or at least one NG is(are) present in said sample.
Said determination can be carried out by means of at least one probe, which is intended to anneal to said at least one amplicon.
The detection process of the invention may thus comprise:
In the process of the invention, said amplification primers comprise:
In the process of the present invention, said at least one probe preferably comprise:
Whereas the reference template sequences, the primers and the probes of the invention have been optimized so as to allow for the detection of CT, MG and NG in real-time multiplex amplification, the simplex embodiments thereof are of course also encompassed by the application (e.g., real-time, or non real-time simplex embodiments, involving one primer pair of the invention).
Quite similarly, whereas the present invention provides the special feature of allowing a multiplex detection of CT, MG and NG in real-time, the implementations of the primers of the invention without a probe of the invention, or with at least one probe of the invention but not in real-time, are of course also encompassed by the present application.
Also, whereas the primers of the invention have been designed as primer pairs, each primer is individually encompassed as such by the present application.
Table 1, which is at the end of Example 1 below, lists SEQ ID sequences, which are representative of reference template polynucleotides, primers and probes of the invention. Table 1 thereby shows two CT real-time amplification systems, five MG real-time amplification systems, and one real-time amplification system of the invention. These systems can be used together in the same tube to detect CT and MG and NG in real-time multiplex amplification.
Said at least two primers, which are intended for targeting CT, and which are suitable for the detection of CT in real-time multiplex amplification, are oligonucleotides, the sequences of which are suitable for use as forward and reverse primers, respectively, in the amplification of at least one CT reference template sequence, wherein said at least one CT reference template sequence is a fragment consisting of positions 5571-5760 (SEQ ID NO: 5) of the CT sequence of SEQ ID NO: 1 (CT pCHL1 plasmid; J03321), or of a conservative sub-fragment thereof, which has retained the property of being a suitable reference template sequence, to construct and produce CT-targeted primers, which allow for a real-time multiplex detection of CT. Said at least two primers, which are intended for targeting CT, preferably consist of 14-30 nucleotides (each independently from each other).
Said at least one CT reference template sequence advantageously is the fragment consisting of positions 5580-5754 (SEQ ID NO: 6) of the CT sequence of SEQ ID NO: 1, or the sequence that is fully complementary to said fragment over the entire length of said fragment.
Said at least two primers, which are intended for targeting MG, and which are suitable for the detection of MG in real-time multiplex amplification, are oligonucleotides, the sequences of which are suitable for use as forward and reverse primers, respectively, in the amplification of at least one MG reference template sequence, wherein said at least one MG reference template sequence is a fragment consisting of:
Said at least two primers, which are intended for targeting MG, preferably consist of 14-30 nucleotides (each independently from each other).
Said at least one MG reference template sequence advantageously is:
Said MG reference template sequences share the specific technical feature of being suitable references to construct and produce MG-targeted primers, as well as MG-specific probes, which can be used together in multiplex in the same tube to specifically detect CT and/or MG and/or NG, advantageously CT and MG and NG, in real-time time in said same tube.
Said at least two primers, which are intended for targeting NG, and which are suitable for the detection of NG in real-time multiplex amplification, are oligonucleotides, the sequences of which are suitable for use as forward and reverse primers, respectively, in the amplification of at least one NG reference template sequence, wherein said at least one NG reference template sequence is a fragment consisting of positions 101-380 (SEQ ID NO: 42) of the NG sequence of SEQ ID NO: 4 (NG pilE gene; AF042097), or of a conservative sub-fragment thereof, which has retained the property of being a suitable reference template sequence, to construct and produce NG-targeted primers, which allow for a real-time multiplex detection of NG.
Said at least two primers, which are intended for targeting NG, preferably consist of 14-30 nucleotides (each independently from each other).
Said at least one NG reference template sequence advantageously is the fragment consisting of positions 114-365 (SEQ ID NO: 43) of the NG sequence of SEQ ID NO: 4, or the sequence that is fully complementary to said fragment over the entire length of said fragment.
By “consisting of 14-30 nucleotides”, it is meant “consisting of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides”.
The same applies mutatis mutandis to any range, which is recited in the present application.
The nucleotide lengths of the primers can be chosen independently from each other.
By “suitable for use as forward and reverse primers, respectively, in the amplification of” a reference template sequence “consisting of” an indicated sequence or SEQ ID, it is herein meant that these forward and reverse primers do not flank the reference template sequence, but that they anneal in the exact terminal positions that allow for the sequence that would be amplified to consist of the indicated reference template sequence.
More preferably, a primer of the invention consists of 14-30 nucleotides, the sequence of which has an identity of at least 80%, preferably of at least 85%, more preferably of at least 90%, even more preferably of at least 92%, still even more preferably of at least 95%, most preferably of at least 97%, with a sequence of the same length contained at the very 3′ end or at the very 5′ end of its reference template sequence or conservative sub-fragment thereof, or of the sequence that is fully complementary to said reference template sequence or conservative sub-fragment thereof over the entire length of this reference template sequence or complementary sequence thereof.
For example, a primer pair of the invention may consist of a forward primer and a reverse primer, which each independently consists of 14-30 nucleotides,
wherein the sequence of the forward primer has an identity of at least 80%, preferably of at least 85%, more preferably of at least 90%, even more preferably of at least 92%, still even more preferably of at least 95%, most preferably of at least 97%, with a sequence of the same length contained at the very 5′ end of its reference template sequence or conservative sub-fragment thereof, and
wherein the sequence of the reverse primer has an identity of at least 80%, preferably of at least 85%, more preferably of at least 90%, even more preferably of at least 92%, still even more preferably of at least 95%, most preferably of at least 97%, with a sequence of the same length contained at the very 5′ end of the sequence that is fully complementary to said reference template sequence or conservative sub-fragment thereof, over the entire length of said reference template sequence or complementary sequence thereof.
A primer of the invention preferably consists of 14-28, more preferably of 15-28, even more preferably of 16-27, still even more preferably of 16-26, most preferably of 17-25 nucleotides, e.g., of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.
Said at least two CT-targeted primers preferably are one oligonucleotide of SEQ ID NO: 7 (forward primer), or a conservative variant thereof, and one oligonucleotide of SEQ ID NO: 12 (reverse primer), or a conservative variant thereof.
Said at least two MG-targeted primers preferably are:
Said at least two MG-targeted primers can for example be at least one oligonucleotide selected from the group consisting of SEQ ID NO: 21; 27, or a conservative variant thereof, and at least one oligonucleotide selected from the group consisting of SEQ ID NO: 24; 30; 36, or a conservative variant thereof.
Said at least two MG-targeted primers preferably are one oligonucleotide of SEQ ID NO: 21, or a conservative variant thereof, and at least one oligonucleotide selected from the group consisting of SEQ ID NO: 24; 36, or a conservative variant thereof.
More preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 21, or a conservative variant thereof and one oligonucleotide of SEQ ID NO: 24, or a conservative variant thereof.
More preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 27, or a conservative variant thereof, and at least one oligonucleotide selected from the group consisting of SEQ ID NO: 24; 30; 36, or a conservative variant thereof. Most preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 27, or a conservative variant thereof, and one oligonucleotide of SEQ ID NO: 30, or a conservative variant thereof.
Said at least two MG-targeted primers preferably are one oligonucleotide of SEQ ID NO: 36, or a conservative variant thereof, and at least one oligonucleotide selected from the group consisting of SEQ ID NO: 21; 27; 33 and 39, or a conservative variant thereof.
Most preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 33 and one oligonucleotide of SEQ ID NO: 36; or are one of SEQ ID NO: 39 and one oligonucleotide of SEQ ID NO: 36.
Said at least two NG-targeted primers preferably are one oligonucleotide of SEQ ID NO: 44, or a conservative variant thereof, and one oligonucleotide of SEQ ID NO: 47, or a conservative variant thereof.
Conservative variants of such primers more particularly comprise those variant primers, the sequence of which has an identity of at least 80%, preferably of at least 85%, more preferably of at least 90%, even more preferably of at least 92%, still even more preferably of at least 95%, most preferably of at least 97%, with at least one of the above-mentioned SEQ ID primer sequences.
Said at least one CT- or MG- or NG-targeted probe, which is suitable for the detection of CT or MG or NG, respectively, in real-time multiplex amplification is an oligonucleotide, the sequence of which is suitable for use as a probe for the detection of at least one amplicon produced from CT or MG or NG, respectively, by said at least two CT- or MG- or NG-targeted primers.
The sequence of such a CT- or MG- or NG-targeted probe hence necessarily differs from the sequence of the CT-, MG-, NG-targeted primers.
Advantageously, said at least one CT-targeted probe is a CT-specific probe that anneals to CT amplicons, without annealing to NG or MG amplicons under conditions of at least moderate stringency.
Advantageously, said at least one MG-targeted probe is a MG-specific probe that anneals to MG amplicons, without annealing to CT or NG amplicons under conditions of at least moderate stringency.
Advantageously, said at least one NG-targeted probe is a NG-specific probe that anneals to NG amplicons, without annealing to CT or MG amplicons under conditions of at least moderate stringency.
Said at least one CT-specific probe preferably is an oligonucleotide of 15-60 nucleotides, which is sufficiently complementary to a fragment of the same size of said CT reference template sequence, or to a fragment of the same size of the sequence that is fully complementary to said CT reference template sequence over the entire length of said reference template sequence, to anneal to said CT reference template sequence or complementary sequence thereof, under conditions of at least moderate stringency,
but which is not sufficiently complementary to any fragment of the same size of said MG or NG reference template sequence, or of the sequence that is fully complementary to said MG or NG reference template sequence over the entire length of said MG or NG reference template sequence, to anneal to said MG or NG reference template sequence or complementary sequence thereof, under the same stringency conditions.
Said at least one MG-specific probe preferably is an oligonucleotide of 15-60 nucleotides, which is sufficiently complementary to a fragment of the same size of said MG reference template sequence, or to a fragment of the same size of the sequence that is fully complementary to said MG reference template sequence over the entire length of said reference template sequence, to anneal to said MG reference template sequence or complementary sequence thereof, under conditions of at least moderate stringency,
but which is not sufficiently complementary to any fragment of the same size of said CT or NG reference template sequence, or of the sequence that is fully complementary to said CT or NG reference template sequence over the entire length of said CT or NG reference template sequence, to anneal to said CT or NG reference template sequence or complementary sequence thereof, under the same stringency conditions.
Said at least one NG-specific probe preferably is an oligonucleotide of 15-60 nucleotides, which is sufficiently complementary to a fragment of the same size of said NG reference template sequence, or to a fragment of the same size of the sequence that is fully complementary to said NG reference template sequence over the entire length of said reference template sequence, to anneal to said NG reference template sequence or complementary sequence thereof, under conditions of at least moderate stringency,
but which is not sufficiently complementary to any fragment of the same size of said CT or MG reference template sequence, or of the sequence that is fully complementary to said MG or NG reference template sequence over the entire length of said CT or MG reference template sequence, to anneal to said CT or MG reference template sequence or complementary sequence thereof, under the same stringency conditions.
More preferably, said at least one CT-specific probe is a fragment of at least 15 nucleotides of said CT reference template sequence, or of the sequence that is fully complementary to said CT reference template sequence over the entire length of said reference template sequence,
wherein said fragment does not anneal to said MG or NG reference template sequences under conditions of at least moderate stringency.
More preferably, said at least one MG-specific probe is a fragment of at least 15 nucleotides of said MG reference template sequence, or of the sequence that is fully complementary to said MG reference template sequence over the entire length of said reference template sequence,
wherein said fragment does not anneal to said CT or NG reference template sequences under conditions of at least moderate stringency.
More preferably, said at least one NG-specific probe is a fragment of at least 15 nucleotides of said NG reference template sequence, or of the sequence that is fully complementary to said NG reference template sequence over the entire length of said reference template sequence,
wherein said fragment does not anneal to said CT or MG reference template sequences under conditions of at least moderate stringency.
The expression “conditions of at least moderate stringency” is intended to mean conditions of moderate, high or very high stringency.
The expressions “moderate stringency”, “high stringency” and “very high stringency” are given their ordinary meaning in the field.
Stringency refers to hybridization conditions chosen to optimize binding of polynucleotide sequences with different degrees of complementarity. Stringency is affected by factors such as temperature, salt conditions, the presence of organic solvents in the hybridization mixtures, and the lengths and base compositions of the sequences to be hybridized and the extent of base mismatching, and the combination of parameters is more important than the absolute measure of any one factor.
Illustrative conditions of moderate stringency comprise:
Illustrative conditions of high stringency comprise:
Illustrative conditions of very high stringency comprise:
Most preferably, said at least one CT-specific probe, which is suitable for the detection of CT in real-time multiplex amplification, preferably is:
Most preferably, said at least one MG-specific probe, which is suitable for the detection of MG in real-time multiplex amplification, preferably is:
Most preferably, said at least one NG-specific probe, which is suitable for the detection of NG in real-time multiplex amplification, preferably is:
Said percentage of identity preferably is of at least 91%, more preferably of at least 92%, even more preferably of at least 93%, still more preferably of at least 94%, most preferably of at least 95%, e.g., 95%, at least 96%, at least 97%, at least 98%, or at least 99%.
A probe of the invention comprises at least 15 nucleotides. For example, it consists of 15-60 nucleotides. A probe of the invention preferably consists of 15-50, more preferably of 1540, even more preferably of 15-30, still more preferably of 16-30, even still more preferably of 18-30, most preferably of 19-30, still most preferably of 21-29, even still most preferably of 22-27 nucleotides, e.g., 22, 23, 24, 25, 26 or 27 nucleotides.
Said at least one CT-specific probe preferably is of SEQ ID NO: 8 or 10 (CT probes SCT 175b and 175c), or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Said at least one MG-specific probe preferably is selected from the group consisting of SEQ ID NO: 16; 22; 28; 34 and 40 (MG probes SF-MG 258c, MGBR 140c, MGBR 186j, MGBR 178q, MGBR 204u), or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Said at least one NG-specific probe is of SEQ ID NO: 45 (NG probe pilEc), or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
A probe of the invention can be linked to at least one detection label, and/or at least one nucleotide arm that is unrelated to CT, MG and NG and that is intended to carry a quencher or a reporter (e.g., a fluorophore).
Various formats (types) of probes, including Taqman™ probes (hydrolysis probes), molecular Beacons™ (beacon probes or molecular beacon probes), and Scorpion™ probes are known in the art.
It may e.g., be linked to at least one beacon arm, or to at least one Scorpion™ arm, preferably at least one of such arms in 5′ and/or 3′, most preferably two of such arms, in 5′ and in 3′, respectively.
One of preferred formats is the beacon format.
The structure of molecular beacons is as follows. A short nucleotide sequence (so-called beacon arm) which is unrelated to the target sequence is thus covalently linked to both ends of the probe. A short unrelated arm is thus linked in 5′ of the probe, and is labelled with a fluorescent moiety (i.e. fluorescent dye or fluorescent marker). Another but still unrelated arm is linked to the 3′ end of probe and is labelled with a fluorescence quenching moiety. Thus, molecular beacons have a fluorophore and a quencher at opposite ends. The 5′ short arm is totally complementary to the one in 3′ so that they can anneal together, and thus can assume a hairpin structure when unhybridized to the target in solution. In this hairpin conformation, the quencher and the fluorescent dye are close enough to each other to allow efficient quenching of the fluorophore. However, when the probe encounters a target molecule, annealing is favoured with respect to the hairpin conformation when values of beacon arm Tm and probe Tm are suitably chosen (theoretically: probe Tm>beacon arm Tm>primer Tm, wherein Tm is the melting temperature of interest). The fluorophore and quencher move away from each other and the fluorophore can then fluoresce when illuminated by suitable light excitation. As PCR proceeds, amplification product accumulates, and the amount of fluorescence at any given cycle depends on the amount of amplification product present at that time. (See e.g., Sanjay Tyagi and Fred Russell Kramer, Nature Biotechnology 1996, volume 14, pages 303-308; Nature Biotechnology 1998, volume 16, pages 49-53).
(Remark: It is also possible to link the fluorophore at the 3′ end, while attaching the quencher at the 5′ end.)
Schematically, said probe can have the following formulae (molecular beacon format):
5′Fluorophore-(arm1)-probe-(arm2)-Quencher 3′
5′ Quencher-(arm1)-probe-(arm2)-Fluorophore 3′
wherein arm1 and arm2 can be any short nucleotide sequences, e.g. in the range of 3-10 nucleotides, preferably 5, 6, 7 nucleotides, allowing for the hair pin structure formation under suitable stringency conditions, i.e. arm1 and arm2 are totally complementary to anneal under the desired stringency conditions (standard PCR stringency conditions include, for example, an annealing temperature of 55 to 65° C. and an Mg concentration of 4 to 8 mM). However, arm1 and arm2 are unrelated to the target sequence of the probe, i.e. the hairpin conformation resulting from the annealing between arm1 and arm2 is essentially the only possible secondary structure for the probe when unhybridized. The skilled person would know how to choose such arms for a given probe.
Illustrative beacon arms are given in example 1 below.
By fluorophore, it is herein understood any fluorescent marker/dye known in the art.
Examples of such suitable fluorescent markers include Fam, Hex, Tet, Joe, Rox, Tamra, Max, Edans, Cy dyes such as Cys, Fluorescein, Coumarin, Eosine, Rhodamine, Bodipy, Alexa, Cascade Blue, Yakima Yellow, Lucifer Yellow and Texas Red (all of them are Trade-Marks), the family of ATTO dyes.
By quencher, we herein understand any quencher known in the art. Examples of such quenchers include Dabcyl, Dark Quencher, Eclipse Dark Quencher, ElleQuencher, Tamra, BHQ and QSY (all of them are Trade-Marks).
The skilled person would know which combinations of dye/quencher are suitable when designing a probe.
In a preferred embodiment according to the invention, spectral properties of said probes can be chosen as to not interfere with each other. In particular, when probes are used in multiplex, each single probe can have its own fluorophore being spectrally significantly different from each other, i.e., the absorption/emission spectra are essentially non-overlapping. This advantageously allows for low-noise multiplex detection for all single probes, making sure that individual signals do not interfere with each other in detection.
Examples of dyes which can be used together in multiplex include Fam with Tamra, Fam with Tamra with Texas Red.
The choice of appropriate dyes to be used together may also be dependent of the filter contained in the amplification apparatus.
Said at least one CT-specific probe most preferably is of SEQ ID NO: 9 or 11 (CT probes SCT 175b and 175c with beacon arms), or the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Said at least one MG-specific probe most preferably is selected from the group consisting of SEQ ID NO: 17; 23; 29; 35 and 41 (MG probes SF-MG 258c, MGBR 140c, MGBR 186j, MGBR 178q, MGBR 204u with beacon arms), or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence. Said at least one NG-specific probe most preferably is of SEQ ID NO: 46 (NG probe pilEc with beacon arms), or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Said at least one CT- or MG- or NG-specific probe may also be an oligonucleotide, which is a conservative variant of said probe SEQ ID, as above-described, i.e., which derives from said SEQ ID sequence by deletion and/or substitution and/or addition of at least one nucleotide, but which has retained the capacity of being a CT- or MG- or NG-specific probe, e.g., a conservative variant of said SEQ ID sequence, the sequence of which has at least 90% identity with said SEQ ID sequence, over the entire length of said SEQ ID sequence (global alignment, also referred to as “needle” alignment).
One of the special technical features shared by said CT, MG and NG reference template sequences is that they are reference template sequences, which are suitable for construct and produce CT-, MG- and NG-targeted primers, as well as CT-, MG- and NG-specific probes, which can be used together in multiplex in the same tube to specifically detect at least one CT and/or at least one MG and/or at least one NG, advantageously at least one CT and at least one MG and at least one NG, in real-time time in said same tube.
Preferably, said at least two CT-targeted primers are one oligonucleotide of SEQ ID NO: 7 and one oligonucleotide of SEQ ID NO: 12, and said at least one CT-specific probe is selected from the group consisting of SEQ ID NO: 8; 9; 10; 11.
Preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 15 and one oligonucleotide of SEQ ID NO: 18, and said at least one MG-specific probe is of SEQ ID NO: 16 or 17, or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 21 and one oligonucleotide of SEQ ID NO: 24, and said at least one MG-specific probe is of SEQ ID NO: 22 or 23, or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 27 and one oligonucleotide of SEQ ID NO: 30, and said at least one MG-specific probe is of SEQ ID NO: 28 or 29, or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 33 and one oligonucleotide of SEQ ID NO: 36, and said at least one MG-specific probe is of SEQ ID NO: 34 or 35, or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Preferably, said at least two MG-targeted primers are one oligonucleotide of SEQ ID NO: 39 and one oligonucleotide of SEQ ID NO: 36, and said at least one MG-specific probe is of SEQ ID NO: 40 or 41, or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Preferably, said at least two NG-targeted primers are one oligonucleotide of SEQ ID NO: 44 and one oligonucleotide of SEQ ID NO: 47, and said at least one NG-specific probe is of SEQ ID NO: 45 or 46, or is the sequence that is fully complementary to this SEQ ID sequence, over the entire length of this SEQ ID sequence.
Advantageously, in accordance with the invention, said amplification primers can comprise at least two CT-targeted primers, and at least two MG-targeted primers, and at least two NG-targeted primers.
Preferably:
Advantageously, in accordance with the invention, said at least one probe can comprise at least one CT-specific probe and at least one MG-specific probe and at least one NG-specific.
Preferably:
In accordance with an advantageous embodiment of the invention, the detection of CT and/or MG and/or NG can be made in real-time multiplex amplification.
Of course, the primers and probes of the invention are also suitable for other protocols, including simplex protocols, multiplex protocols, end-point protocols, qualitative protocols, quantitative protocols, combinations thereof, and the like.
Said amplification can be any nucleic acid amplification, which is found appropriate to the skilled person, for example a PCR (Polymerase Chain Reaction), or an isothermal amplification technique, e.g., TMA (transcription mediated amplification), NASBA (nucleic acid sequence based amplification), 3SR (self sustained sequence replication) or strand displacement amplification.
Said amplification preferably is PCR.
In a preferred embodiment, the primers according to the invention are used in a final concentration range 20-2000 nM. Typically, said primers can be used at a final concentration range of 20-1300 nM, preferably of 20-1250 nM, more preferably of 25-1250 nM, e.g., of about 25, 125, 250, 500, 850, 1250 nM.
Probe concentration in a PCR reaction can be optimized, typically by varying the final concentration from 50 nM to 1000 nM. In a preferred embodiment, each probe according to the invention is used at a final concentration range of 75-300 nM, preferably 75-250 nM, more preferably 100-250 nM, even more preferably 150-200 nM, e.g., of about 150 nM or about 200 nM.
Appropriate amplification conditions are known to those skilled in the art. They include temperature conditions, in particular thermal cycling conditions, e.g., temperature, duration, number, heating rate of the cycles. In a preferred embodiment, said temperature conditions include conditions suitable for a PCR. In another preferred embodiment, said conditions include conditions suitable for a Q-PCR.
In accordance with the invention, an internal control (IC), which is unrelated to CT and/or MG and/or NG can also be implemented, such as the IC of SEQ ID NO: 48.
An appropriate primer pair for amplification of said IC comprises the primer pair of SEQ ID NO: 49 and 52. An appropriate IC probe comprises the probe of SEQ ID NO: 50 (SEQ ID NO: 51 in beacon format).
These IC, IC primers and IC probes are also encompassed individually as such by the application.
A 16S rRNA primer pair may also be implemented, such as, e.g., the primer pair of SEQ ID NO: 53 and 54. This system is used in order to detect the presence of bacterial DNA in sample.
The present application also relates to any amplicon obtainable by implementation of the process of the invention on a CT- and/or MG- and/or NG-containing sample.
The present application also relates to the primers and probes of the present invention, as such, i.e., as individual oligonucleotide products.
According to the invention, all the provided oligonucleotides can be either kept separately, or partially mixed, or totally mixed.
Said oligonucleotides can be provided under dry form, or solubilized in a suitable solvent, as judged by the skilled person. Suitable solvents include TE, PCR-grade water, and the like.
The application further relates to every product that is herein described, and more particularly to every reference template polynucleotide, to every primer and to every probe, as an individual product.
The application also relates to every possible combination that can be made of at least two products of the invention, preferably of at least three products of the invention, such as, e.g., of at least two primers of the invention and at least one probe of the invention.
The invention thus relates to a polynucleotide suitable for use as a reference template sequence in the design of primers and probes that can be used in the same tube for the detection of CT and MG and NG in real-time multiplex amplification, wherein said polynucleotide is selected from:
Preferably, said reference template polynucleotide is:
The application also relates to a primer, which is especially adapted to the detection of CT and/or MG and/or NG in real-time multiplex amplification, which is:
The application also relates to a primer system, which is especially adapted to the detection of CT and/or MG and/or NG in real-time multiplex amplification, which comprises at least two CT-targeted primers and/or at least two MG-targeted primers and/or at least two NG-targeted primers, such as:
The application also relates to a probe, which is especially adapted to the detection of CT and/or MG and/or NG in real-time multiplex amplification, which is:
The application also relates to a beacon probe, which is especially adapted to the detection of CT and/or MG and/or NG in real-time multiplex amplification, which is:
The application also relates to a primer and probe system, which is especially adapted to the detection of CT and/or MG and/or NG in real-time multiplex amplification, which comprises at least one primer of the invention and at least one probe of the invention, preferably at least one primer system of the invention, and at least one probe system of the invention.
The application also relates to an amplicon, obtainable by amplification of at least one nucleic acid from CT and/or MG and/or NG, by means of at least one primer system of the invention.
The application also relates to an amplification composition, comprising at least one amplicon according to the invention.
The application also relates to a kit for the diagnosis of an infection by CT and/or MG and/or NG, which comprises:
In the kit according to the invention, the oligonucleotides (primers, probes) can be either kept separately, or partially mixed, or totally mixed.
Said oligonucleotides can be provided under dry form, or solubilized in a suitable solvent, as judged by the skilled person. Suitable solvents include TE, PCR-grade water, and the like.
In a preferred embodiment, the kit according to the invention can also contain further reagents suitable for a PCR step.
Such reagents are known to those skilled in the art, and include water, like nuclease-free water, RNase free water, DNAse-free water, PCR-grade water; salts, like magnesium, potassium; buffers such as Tris; enzymes, including polymerases, such as Taq, Vent, Pfu (all of them Trade-Marks), activable polymerase, and the like; nucleotides like deoxynucleotides, dideoxunucleotides, dNTPs, dATP, dTTP, dCTP, dGTP, dUTP; other reagents, like DTT and/or RNase inhibitors; and polynucleotides like polyT, polydT, and other oligonucleotides, e.g., primers.
In another preferred embodiment, the kit according to the invention comprises PCR controls. Such controls are known in the art, and include qualitative controls, positive controls, negative controls, internal controls, quantitative controls, internal quantitative controls, as well as calibration ranges. The internal control for said PCR step can be a template which is unrelated to the target template in the PCR step. Such controls also may comprise control primers and/or control probes. For example, in the case of HPV detection, it is possible to use as an internal control, a polynucleotide chosen within a gene whose presence is excluded in a sample originating from a human body (for example, from a plant gene), and whose size and GC content is equivalent to those from the target sequence.
Illustrative internal controls comprise the IC of SEQ ID NO: 48. Appropriate IC primers thus comprise the primer of SEQ ID NO: 49 and the primer of SEQ ID NO: 50, which together form a primer pair capable of amplifying said IC of SEQ ID NO: 48. Appropriate IC probes comprise the probe of SEQ ID NO: 50 (or of SEQ ID NO: 51, in beacon format).
In a preferred embodiment, the kit according to the invention contains means for extracting and/or purifying nucleic acid from a biological sample, e.g., from urine. Such means are well known to those skilled in the art.
In a preferred embodiment, the kit according to the invention contains instructions for the use thereof. Said instructions can advantageously be a leaflet, a card, or the like. Said instructions can also be present under two forms: a detailed one, gathering exhaustive information about the kit and the use thereof, possibly also including literature data; and a quick-guide form or a memo, e.g., in the shape of a card, gathering the essential information needed for the use thereof.
The present invention also relates to all the medical, biological, pharmaceutical applications of the detection process of the invention, and/or of the primers and/or probes of the invention.
The present invention thus relates to a process for the diagnosis or prognosis of a CT and/or MG and/or NG infection, which comprises detecting CT and/or MG and/or NG with at least one primer of the invention.
The present invention also relates to a process for monitoring the efficiency of an anti-CT and/or anti-MG and/or anti-NG treatment or drug, or an anti-CT and/or anti-MG and/or anti-NG candidate treatment or drug, which comprises determining by the detection method of the invention whether said treatment, drug, candidate treatment or candidate drug induces the non-reoccurrence, non-persistence, disappearance, or a decrease in the presence of at least one CT and/or MG and/or NG, whereby a positive determination indicates that said treatment, drug, candidate treatment or candidate drug is efficient.
The present invention also relates to a method to produce an anti-CT and/or anti-MG and/or anti-NG drug, which comprises:
providing at least one anti-CT and/or anti-MG and/or anti-NG candidate drug, administering said at least one candidate anti-CT and/or anti-MG and/or anti-NG drug to a cell culture or to a non-human animal, wherein said cell culture or animal is or comprises at least one CT and/or MG and/or NG, and
determining by the detection method of the invention whether said candidate anti-CT and/or anti-MG and/or anti-NG drug induces the regression or disappearance of said at least one CT and/or MG and/or NG,
whereby a positive determination indicates that said candidate drug is an efficient CT and/or MG and/or NG drug.
In the present application, start and end values of any described range are to be understood as comprised within said range, e.g., an expression such as “position X to Y of a sequence” describes a sequence extending from nucleotide in position X to nucleotide in position Y, wherein both nucleotide in position X and nucleotide in position Y are part of said sequence.
The term “comprising”, which is synonymous with “including” or “containing”, is open-ended, and does not exclude additional, unrecited element(s), ingredient(s) or method step(s), whereas the term “consisting of” is a closed term, which excludes any additional element, step, or ingredient which is not explicitly recited.
The term “essentially consisting of” is a partially open term, which does not exclude additional, unrecited element(s), step(s), or ingredient(s), as long as these additional element(s), step(s) or ingredient(s) do not materially affect the basic and novel properties of the invention.
The term “comprising” (or “comprise(s)”) hence includes the term “consisting of” (“consist(s) of”), as well as the term “essentially consisting of” (“essentially consist(s) of”). Accordingly, the term “comprising” (or “comprise(s)”) is, in the present application, meant as more particularly encompassing the term “consisting of” (“consist(s) of”), and the term “essentially consisting of” (“essentially consist(s) of”).
In the present application, the term “at least x” relating to a set or group of n elements (wherein x is different from zero, and n is a number that is higher than x), explicitly encompasses each value, which is comprises between x and n. For example, the term “at least one” relating to a group or set of six elements explicitly encompasses one, two, three, four, five and six of said elements, as well as at least two, at least three, at least four, at least five of said elements.
Each of the relevant disclosures of all references cited herein is specifically incorporated by reference. The following examples are offered by way of illustration, and not by way of limitation.
1.1. Selection of Primers and Probe for C. trachomatis (CT)
As a source of appropriate CT targets, the inventors selected the cryptic plasmid, which is present in all C. trachomatis serovars. This plasmid is contained at 7-10 copies per genome.
Four different sequences of this plasmid are available from Genbank:
There is less than 1% variation between these four sequences (Comanducci, et al., 1990, Plasmid, 23: 149-154).
The sequence of plasmid pCHL1, which is available under accession number J03321, is shown on the enclosed
A selected CT target sequence is located in ORF5 of pCHL1. A sub-sequence of SEQ ID NO: 5 has been selected by the inventors within the sequence of pCHL1 ORF5.
Within this CT sub-sequence of SEQ ID NO: 5, a CT target sequence has been selected by the inventors (SEQ ID NO: 6). The forward and reverse primers are referred to as U-PC 5580 and L-PC 5754, respectively. Two FAM-labelled fluorescent probes (SCT175b, SCT175c) proved to be successful in detecting the amplicon. The sequences of these CT primers and probes are shown in the above CT sub-sequence of SEQ ID NO: 5 (from 5′ to 3′):
The selected CT target sequence therefore is:
1.2. Selection of Primers and Probe for Mycoplasma genitalium (MG)
The MG target sequence is selected within the gene coding for MgPa adhesin protein (major surface protein). This gene is referred to as adhesin gene, or Pa gene, or MgPa gene.
It is present at one copy per bacterium genome, and has been completely sequenced for reference strain G-37 (accession M31431).
A 5′ region of this gene has also been sequenced for four other MG strains; these sequences are available from GenBank:
The sequence of the 5′ region of the adhesin gene of strain M2341, which is available under accession number X91074, is shown on the enclosed
The sequence of the adhesin gene of strain G-37, which is available under accession M31431, is shown on the enclosed
A selected MG target sequence is located within the following Pa gene sub-sequence:
A MG target sequence (SEQ ID NO: 14) has been selected within this MG sub-sequence of SEQ ID NO: 13. The sequence of a MG forward primer (U-MG 1320), the sequence of a MG probe (SF-MG 258c), and the target sequence of a MG reverse primer (L-MG 1578) are shown in underlined and bold characters within the above MG sub-sequence of SEQ ID NO: 13 (from 5′ to 3′, respectively).
The selected MG target sequence therefore is:
ggatcattt ggattagtaa gaagc
caaaa tgacaactta
gc
tttatatg atattaactt agcaaaaatg gaaaacccct
tccttttaaa ggctttggt
Four other MG targets have been selected by the inventors. These four other MG targets are also located within the MG adhesin gene, more particularly within the 5′ region of this gene. They are defined with respect to the adhesin gene sequence, which is available under accession number M31431 (SEQ ID NO: 3, shown in
These four other MG target sequences are located within the following MG sub-sequences:
ggtgtag gtggttattt
tctctttaac caaaataagc aacgtagtag cgtgagcaac
In bold and underlined characters, are shown (from 5′ to 3′) the sequences of the MG forward primer (U-MG1144), of the target for the MG probe (MGBR 140c), and of the target for the MG reverse primer (L-MG1283).
CGCGTT AC CAA CCC AAG CAG TTA AGT GTT AA A ACG CG
gt atgca ccaaccaaag
aaaagac
tgg ctaagaagtc ttgagccttt ctaaccgctg cacttaccct tggggttata
In bold and underlined characters, are shown (from 5′ to 3′) the sequences of the MG forward primer (U-MG1087), of the target for the MG probe (MGBR 186j Tamra/Dabcyl), and of the target for the MG reverse primer (L-MG1249).
aaagttccag
tagaagtagt tcaatccccc cattccccca acctctattt tgtgttacta
gtgcctaagg
tggcattaga gtat
In bold and underlined characters, are shown (from 5′ to 3′) the sequences of the MG forward primer (U-MG 1527), of the target for the MG probe (MGBR 178q Tamra/Dabcyl), and of the target for the MG reverse primer (L-MG1704).
gcaaaaatgg
aaaacccctc aacggtgcaa aggggtttaa atggcgagcc tatctttgat
aaagtt
ccag tagaagtagt tcaatccccc cattccccca acctctattt tgtgttacta
gtgcctaagg
tggcattaga gtat
In bold and underlined characters, are shown (from 5′ to 3′) the sequences of the MG forward primer (U-MG 1501), of the target for the MG probe (MGBR 178q Tamra/Dabcyl), and of the target for the MG reverse primer (L-MG 1704).
1.3. Selection of Primers and Probe for Neisseria gonorrhoeae (NG)
The selection of an appropriate nucleotide target is difficult to achieve for NG. The genome of NG is indeed highly homologous to the one of M. meningitidis (at about 98%), and is homologous to the genome of commensal species such as N. cinerea, N. lactamica, N. sicca, N. subflava, N. mucosa.
We selected the pilE gene to detect NG. The pilE gene codes for type IV pili. It is present within every pathogenic NG, and is absent from non-pathogenic NG (NG strains often loose this gene when they are grown in vitro).
The pilE gene is present at a variable copy number, and is often subject to nucleotide variations. The pilE gene is also present in N. lactamica and N. cinerea, and may also be present in some other bacterial geni, such as some Pseudomonas, Bacteroides, and Bacillus.
A primer pair (U-pilE 159/L-pilE 406) has been selected. The obtained amplicon is of 252 bp. A fluorescent (ATTO 647N/Dabcyl) probe has been selected to hybridize to the amplicon.
The sequence of the pilE gene, which is accessible under accession number AF042097, is shown on the enclosed
gagtattacc tg
aatcacgg caaatggccg gaaaacaaca cttctgccgg cgtggcatcc
tgggcc
aggc gtgaaaacgg ttcggtaaaa tggttctgcg gacagccggt tacgcgcacc
gacga
cgaca ccgttgccga
Underlined are shown (from 5′ to 3′) the sequences of the NG forward primer (U-pilE 159), of the target for the NG probe (pilEc), and of the target for the NG reverse primer (L-pilE 406).
gagtattacc tg
aatcacgg caaatggccg gaaaacaaca cttctgccgg cgtggcatcc
tgggcc
aggc gtgaaaacgg ttcggtaaaa tggttctgcg gacagccggt tacgcgcacc
gacga
The Internal Control (IC) consists in a single-stranded random sequence.
The IC comprises a sequence which is unrelated to CT, MG and NG, and which preferably is also unrelated to human nucleic acids. The IC further comprises a sequence located in 5′ of this unrelated sequence and a sequence located 3′ of this unrelated sequence, wherein one of said 5′- and 3′-located sequences has the sequence of a primer of a primer pair, and the other of said 5′- and 3′-located sequences is the complementary sequence of the other primer of the same primer pair, such that said primer pair can hybridize to said IC in such locations and following such an orientation that this primer pair can function as an amplification forward and reverse primer pair on said IC. For example, said 5′-located sequence is identical to the forward primer of a primer pair, and said 3′-located sequence is complementary to the reverse primer of said primer pair.
This primer pair may be a primer pair which is used for the detection of CT, MG, or NG, or it can be a different primer pair, which has then to be specifically added in the PCR mix when implementing a multiplex PCR.
In the present example, the IC is of 92 bases, and comprises 5′- and 3′-located sequences which hybridize to a primer pair (primer pair IS 368 and IS 569), which is different from the CT, MG and NG primer pairs.
GAGAGTGGG
ACAGTCGTCCTTCAAGGAGCACATCAGCGGATC
Underlined are shown (from 5′ to 3′) the sequences of the IC forward primer (IS 368), of the target of the IC probe, and of the target of the reverse primer (IS 569).
1.5. 16S rRNA
A fragment of the 16S rRNA which is present in all micro-organisms is also amplified.
The following 16S rRNA primers have been used:
Lysis is performed in the presence of detergents and of Chelex™ X-100 beads (i.e., a resin which binds divalent ions, and which also is a chaotropic agent).
8% of Chelex™ X-100 resin (Bio-Rad, ref.: 142-1253); 0.5% NP-40 (Sigma, ref.: Igepal 1-3021); 0.5% Tween 20 (VWR, ref.: 28829296) in Tris 10 mM buffer (Sigma, ref.: T-6791); EDTA 1 mM (Sigma, ref.: E-1644) pH 8.3.
The internal control (IC) is added at the extraction step.
The IC solution is of 9.6 104 copies of IC per 10 μL, to obtain 2.4 103 copies per PCR test PCR after extraction.
The negative control is achieved by collecting 400 μL of lysis buffer into which the IC is added.
The products amplified by the 16S rRNA primers (S1-F, and S1-R) are visualised by a Bet staining after electrophoretic migration on a 7.5% acrylamide gel.
2.1.4. Real-Time Simplex PCR for Chlamydia trachomatis
In a 1×PCR mix, add: 0.2 μM of the SCT 175b probe (SEQ ID NO: 9), 0.5 μM of each CT primers (U-PC 5580-SEQ ID NO: 7-, et L-PC 5754-SEQ ID NO: 12-), 5% Glycerol, 0.3% PVP 10, 2U of Taq Polymerase, 1 mM dNTP and 6 mM final of MgCl2.
μL of DNA are added to this mix.
In a 1×PCR mix, add: 0.2 μM of the MG probe (SF-MG 258c —SEQ ID NO: 17-), 0.5 μM of each MG primers (U-MG 1320-SEQ ID NO: 15-, and L-MG 1578-SEQ ID NO: 18-), 5% Glycerol, 0.3% PVP 10, 2U of Taq Polymerase, 1 mM dNTP and 6 mM final of MgCl2.
10 μL of DNA are added to this mix.
In a 1×PCR mix, add: 0.2 μM of the NG probe (pilEc —SEQ ID NO: 46-), 0.5 μM of each NG primers (U pilE 159-SEQ ID NO: 44-, et L-pilE 406-SEQ ID NO: 47-), 5% Glycerol, 0.3% PVP 10, 2U of Taq Polymerase, 1 mM dNTP and 4 mM final of MgCl2.
10 μL of DNA are added to this mix.
In a 1×PCR mix, add the following primers:
CT forward primer U-PC 5580 (SEQ ID NO: 7) at 0.125 μM,
CT reverse primer L-PC 5754 (SEQ ID NO: 12) at 0.5 μM,
MG forward primer U-MG 1320 (SEQ ID NO: 15) at 0.025 μM,
MG reverse primer L-MG 1578 (SEQ ID NO: 18) at 1.25 μM,
NG forward primer U-pilE 159 (SEQ ID NO: 44) at 0.85 μM,
NG reverse primer L-pilE 406 (SEQ ID NO: 47) at 0.25 μM,
IC forward primer IS 368 (SEQ ID NO: 49) at 0.5 μM, and
IC reverse primer IS 569 (SEQ ID NO: 52) at 0.5 μM.
The probes are used at the following concentrations:
CT probe SCT 175b (SEQ ID NO: 9) at 0.15 μM (fluorophore FAM),
MG probe SF-MG 258c (SEQ ID NO: 17) at 0.2 μM (fluorophore TAMRA), and
NG probe pilEc (SEQ ID NO: 46) at 0.2 μM (fluorophore ATTO 647N).
IC probe SIMB (SEQ ID NO: 51) at 0.15 μM (fluorophore ATTO-590),
The following reactants are further added:
5% Glycerol, 0.3% PVP 10, 2U of Taq Polymerase, 1 mM dNTP and 5 mM final of MgCl2.
μL of DNA are added to this mix.
CT DNA: Chlamydia trachomatis LGV II strain 434, available from ABi, lot 141-115, 1.63 1010 elementary body/ml, 100 μL at 50 ng/μL.
ABi is Advanced Biotechnologies Inc., RiversPark II, 9108 Guilford Road, Columbia, Md. 21046-2701, U.S.A.
MG DNA: strain G-37 available from ATCC, deposit number 33530 (source culture ATCC 33530D), lot 2305272, concentration 200 ng/μL.
ATCC is: American Type Culture Collection, 10801 University Boulevard Manassas, Va. 20110-2209, U.S.A.
NG DNA: strain 107031 from the CNCM (Collection de 1'Institut Pasteur, BP 52, 25 rue du Docteur Roux, 75724 Paris cedex 15, France), reference strain for antimicrobial disk susceptibility test (count has been made on Petri dish).
Quantity of IC: 1,000 copies per PCR
The CT and MG primers and probes have a perfect specificity: they do not cross-react with any nucleic acid other than CT or MG nucleic acids (respectively); they notably do not cross-react with other bacterial or with human nucleic acids.
The NG primers and probes are specific for NG, except that they cross-react with N. meningitidis.
The amplicon is of 175 bp.
The CT primers and probes of the invention detect all CT serovars. They notably detect the following serovars: A, B, Ba, C, D, E, F, H, I, J, K, L1, L2a and L3.
The CT primers and probes of the invention have also been tested on 24 different bacterial strains which may be found in the urogenital sphere, and were shown to be non cross-reactive. For these 24 other strains, presence of DNA was confirmed by end-point PCR using the 16S rRNA primers (S1R and S1F primers), followed by deposition on gel. Specificity results are shown in table 1 below (column “simplex CT”).
The amplicon is of 258 bp.
The MG primers and probes of the invention detect the nine MG strains that have been tested (strains G-37, 2282, 2288, 2300, 2321, 2341, M30, UTMB1 and TW-10-51).
The MG primers and probes of the invention did not cross-react with any of the 29 non-MG bacterial DNA tested.
Results are reported in the above table 2, column “simplex MG”.
Chlamydia trachomatis, serovar A, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar B, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar Ba, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar C, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar D, strain UW-3/Cx, ATCC VR 885
Chlamydia trachomatis, serovar F, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar H, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar I, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar J, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar K, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar L1, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar L2a, clinical strain, CHU Bordeaux
Chlamydia trachomatis, serovar L3, clinical strain, CHU Bordeaux
Escherichia coli ATCC 25922
Enterobacter cloacae ATCC 13047
Staphylococcus saprophyticus, clinical strain
Enterococcus faecium, clinical strain
Enterococcus faecalis, clinical strain
Proteus mirabilis ATCC 29906
Lactobacillus acidophilus, clinical strain
Bacillus subtilis, clinical strain
Gardnerella vaginalis, clinical strain
Neisseria gonorrhoeae, 5 clinical strains
Neisseria cinerea DSMZ 4630
Neisseria lactamica DSMZ 4691
Neisseria sicca, clinical strain
Neisseria meningitidi, clinical strain
Staphylococcus aureus ATCC 25923
Staphylococcus simulans strain Institut Pasteur
Pseudomonas aeruginosa, ATCC 27853
Klebsiella pneumoniae, CIP 104298
Strepcococcus agalactiae, ATCC 12403
Streptococcus bovis CIP 105065
Acinetobacter baumanii, ATCC 49139
Staphylococcus epidermidis ATCC 49139
Candida albicans clinical strain
Mycoplasma pneumoniae clinical strain
Neisseria mucosa clinical strain
Rhodococcus equi clinical strain
Moraxella catarrhalis, clinical strain
Mycoplasma genitalium, strain G-37, ATCC 33530
Mycoplasma genitalium, strain 2282, clinical strain, Statens Serum
Mycoplasma genitalium, strain 2288, clinical strain, Statens Serum
Mycoplasma genitalium, strain 2300, clinical strain, Statens Serum
Mycoplasma genitalium, strain 2321, clinical strain, Statens Serum
Mycoplasma genitalium, strain 2341, clinical strain, Statens Serum
Mycoplasma genitalium, strain M30, clinical strain, CHU Bordeaux
Mycoplasma genitalium, strain UTMB1, clinical strain, CHU
Mycoplasma genitalium, strain TW-10-51, clinical strain, CHU
Mycoptasma orale ATCC 23714
Mycoplasma fermentans strain PG18, clinical strain, CHU Bordeaux
Mycoplasma penetrans strain GTU64, clinical strain, CHU Bordeaux
The amplicon is of 252 bp.
The NG primers and probes of the invention have been assayed in real-time PCR on 55 different NG strains. All results were positive.
The NG primers and probes of the invention have also been tested on several Neisseria species other than NG. Results are shown in table 3 below. No amplification was obtained with the following species: N. sicca (3 strains), N. polysaccharia (1 strain), N. subflava (4 strains), N. mucosa (3 strains), N. cinerea (1 strain), and N. lactamica (2 strains).
Among the 16 N. meningitidis strains that have been tested, 10 gave a positive response (NM cross-reaction).
N. cinerea (1850) DSMZ 4630
N. lactamica (1851) DSMZ 4691
N. lactamica (1874)
10 clinical strains
N. meningitidis 6 clinical strains
N. mucosa (1853, 1870, 1871)
N. polysaccharia (1852) CIP 100113T
N. sicca (1854, 1872, 1873)
N. subflava (1855, 1876, 1877)
N. subflava (1875) CIP 73.13
, 55 clinical strains
The specificity of the NG primers of the invention has been assayed in end-point PCR, followed by deposition on gel, with 13 bacterial strains that do not belong to the Neisseria genus. No amplification has been detected. Results are reported in table 4 below.
Escherichia coli ATCC 25922
Enterobacter cloacae ATCC 13047
Staphylococcus saprophyticus, clinical strain
Enterococcus faecium, clinical strain
Enterococcus faecalis, clinical strain
Proteus mirabilis ATCC 29906
Bacillus subtilis, clinical strain
Garnerella vaginalis, clinical strain
Pseudomonas aeruginosa, ATCC 27853
Strepcococcus agalactiae, ATCC 12403
Acinetobacter baumanii, ATCC 49139
Staphylococcus epidermidis ATCC 49139
Moraxella catarrhalis, clinical strain
PCR Sensitivity
The CT, MG, NG and IC primers and probes of the invention have been assayed in quadruplex on a mix of a pre-determined quantity of CT, MG and NG DNA (the experiment was made in duplicate).
Results are as follows:
sensitivity is of 10 copy per PCR
sensitivity is of 100 copies per PCR.
Sensitivity is of 1 copy per PCR
There is no Ct variation for the IC, whatever quantity of DNA is being used.
In a 1×PCR mix, add the following primers:
CT forward primer U-PC 5580 (SEQ ID NO: 7) at 0.125 μM,
CT reverse primer L-PC 5754 (SEQ ID NO: 12) at 0.5 μM,
MG forward primer U-MG 1144 (SEQ ID NO: 21) at 0.5 μM,
MG reverse primer L-MG 1283 (SEQ ID NO: 24) at 0.5 μM,
NG forward primer U-pilE 159 (SEQ ID NO: 44) at 0.85 μM,
NG reverse primer L-pilE 406 (SEQ ID NO: 47) at 0.25 μM,
IC forward primer IS 368 (SEQ ID NO: 49) at 0.5 μM, and
IC reverse primer IS 569 (SEQ ID NO: 52) at 0.5 μM.
The probes are used at the following concentrations:
CT probe SCT 175b (SEQ ID NO: 9) at 0.15 μM (fluorophore FAM),
MG probe MGBR 140c (SEQ ID NO: 23) at 0.2 μM (fluorophore TAMRA
NG probe pilEc (SEQ ID NO: 46) at 0.2 μM (fluorophore ATTO 647N) and
IC probe SIMB (SEQ ID NO: 51) at 0.15 μM (fluorophore ATTO-590),
In a 1×PCR mix, add the following primers:
CT forward primer U-PC 5580 (SEQ ID NO: 7) at 0.125 μM,
CT reverse primer L-PC 5754 (SEQ ID NO: 12) at 0.5 μM,
MG forward primer U-MG 1087 (SEQ ID NO: 27) at 0.5 μM,
MG reverse primer L-MG 1249 (SEQ ID NO: 30) at 0.5 μM,
NG forward primer U-pilE 159 (SEQ ID NO: 44) at 0.85 μM,
NG reverse primer L-pilE 406 (SEQ ID NO: 47) at 0.25 μM,
IC forward primer IS 368 (SEQ ID NO: 49) at 0.5 μM, and
IC reverse primer IS 569 (SEQ ID NO: 52) at 0.5 μM.
The probes are used at the following concentrations:
CT probe SCT 175b (SEQ ID NO: 9) at 0.15 μM (fluorophore FAM),
MG probe MGBR 186j (SEQ ID NO: 29) at 0.2 μM (fluorophore TAMRA)
NG probe pilEc (SEQ ID NO: 46) at 0.2 μM (fluorophore ATTO 647N) and
IC probe SIMB (SEQ ID NO: 51) at 0.15 μM (fluorophore ATTO-590),
In a 1×PCR mix, add the following primers:
CT forward primer U-PC 5580 (SEQ ID NO: 7) at 0.125 μM,
CT reverse primer L-PC 5754 (SEQ ID NO: 12) at 0.5 μM,
MG forward primer U-MG 1527 (SEQ ID NO: 33) at 0.5 μM,
MG reverse primer L-MG 1704 (SEQ ID NO: 36) at 0.5 μM,
NG forward primer U-pilE 159 (SEQ ID NO: 44) at 0.85 μM,
NG reverse primer L-pilE 406 (SEQ ID NO: 47) at 0.25 μM,
IC forward primer IS 368 (SEQ ID NO: 49) at 0.5 μM, and
IC reverse primer IS 569 (SEQ ID NO: 52) at 0.5 μM.
The probes are used at the following concentrations:
CT probe SCT 175b (SEQ ID NO: 9) at 0.15 μM (fluorophore FAM),
MG probe MGBR 178q (SEQ ID NO: 35) at 0.2 μM (fluorophore TAMRA
NG probe pilEc (SEQ ID NO: 46) at 0.2 μM (fluorophore ATTO 647N) and
IC probe SIMB (SEQ ID NO: 51) at 0.15 μM (fluorophore ATTO-590),
In a 1×PCR mix, add the following primers:
CT forward primer U-PC 5580 (SEQ ID NO: 7) at 0.125 μM,
CT reverse primer L-PC 5754 (SEQ ID NO: 12) at 0.5 μM,
MG forward primer U-MG 1501 (SEQ ID NO: 39) at 0.5 μM,
MG reverse primer L-MG 1704 (SEQ ID NO: 36) at 0.5 μM,
NG forward primer U-pilE 159 (SEQ ID NO: 44) at 0.85 μM,
NG reverse primer L-pilE 406 (SEQ ID NO: 47) at 0.25 μM,
IC forward primer IS 368 (SEQ ID NO: 49) at 0.5 μM, and
IC reverse primer IS 569 (SEQ ID NO: 52) at 0.5 μM.
The probes are used at the following concentrations:
CT probe SCT 175b (SEQ ID NO: 9) at 0.15 μM (fluorophore FAM),
MG probe MGBR 204u (SEQ ID NO: 41) at 0.2 μM (fluorophore TAMRA)
NG probe pilEc (SEQ ID NO: 46) at 0.2 μM (fluorophore ATTO 64TN) and
IC probe SIMB (SEQ ID NO: 51) at 0.15 μM (fluorophore ATTO-590),
The following reactants are further added:
5% Glycerol, 0.3% PVP 10, 2U of Taq Polymerase, 1 mM dNTP and 5 mM final of MgCl2.
μL of DNA are added to this mix.
16S rRNA PCR
cf. chapter 1.6.1
The MG primers and probes of the invention detect the nine MG strains that have been tested (strains G-37, 2282, 2288, 2300, 2321, 2341, M30, UTMB1 and TW-10-51).
The MG primers and probes of the invention have also been tested on 27 different bacterial strains which may be found in the urogenital sphere, and were shown to be non cross-reactive. For these 27 different bacterial strains, presence of DNA was confirmed by end-point PCR using the 16S rRNA primers (SIR and SIF primers), followed by deposition on gel.
Results are reported in the above tables.
Chlamydia trachomatis, serovar D, strain
Chlamydia trachomatis, serovar L1, clinical
Escherichia coli ATCC 25922
Enterobacter cloacae ATCC 13047
Staphylococcus saprophyticus, clinical
Enterococcus faecium, clinical strain
Enterococcus faecalis, clinical strain
Proteus mirabilis ATCC 29906
Lactobacillus acidophilus, clinical strain
Bacillus subtilis, clinical strain
Gardnerella vaginalis, clinical strain
Neisseria gonorrhoeae, 1 clinical strain
Staphylococcus aureus ATCC 25923
Pseudomonas aeruginos, ATCC 27853
Klebsiella pneumonia, CIP 104298
Strepcococcus agalactiae, ATCC 12403
Streptococcus bovis CIP 105065
Acinetobacter baumanii, ATCC 49139
Staphylococcus epidermidis ATCC 49139
Candida albicans clinical strain
Mycoplasma pneumoniae clinical strain
Neisseria mucosa clinical strain
Rhodococcus equi clinical strain
Moraxella catarrhalis, clinical strain
Mycoplasma genitalium, strain G-37, ATCC
Mycoplasma genitalium, strain 2282,
Mycoplasma genitalium, strain 2288,
Mycoplasma genitalium, strain 2300,
Mycoplasma genitali, strain 2321,
Mycoplasma genitalium, strain 2341,
Mycoplasma genitalium, strain M30, clinical
Mycoplasma genitalium, strain UTMB1,
Mycoplasma genitalium, strain TW-10-51,
Mycoplasma orale ATCC 23714
Mycoplasma fermentans strain PG18,
Mycoplasma penetrans strain GTU64,
Chlamydia trachomatis, serovar D, strain
Chlamydia trachomatis, serovar L1, clinical
Escherichia coli ATCC 25922
Enterobacter cloacae ATCC 13047
Staphylococcus saprophyticus, clinical
Enterococcus faecium, clinical strain
Enterococcus faecalis, clinical strain
Proteus mirabilis ATCC 29906
Lactobacillus acidophilus, clinical strain
Bacillus subtilis, clinical strain
Gardnerella vaginalis, clinical strain
Neisseria gonorrhoeae, 1 clinical strain
Staphylococcus aureus ATCC 25923
Pseudomonas aeruginos, ATCC 27853
Klebsiella pneumoniae, CIP 104298
Strepcococcus agalactiae, ATCC 12403
Streptococcus bovis CIP 105065
Acinetobacter baumanii, ATCC 49139
Staphylococcus epidermidis ATCC 49139
Candida albicans clinical strain
Mycoplasma pneumoniae clinical strain
Neisseria mucosa clinical strain
Rhodococcus equi clinical strain
Moraxella catarrhalis, clinical strain
Mycoplasma genitalium, strain G-37, ATCC
Mycoplasma genitalium, strain 2282,
Mycoplasma genitalium, strain 2288,
Mycoplasma genitalium, strain 2300,
Mycoplasma genitalium, strain 2321,
Mycoplasma genitalium, strain 2341,
Mycoplasma genitalium, strain M30, clinical
Mycoplasma genitalium, strain UTMB1,
Mycoplasma genitalium, strain TW-10-51,
Mycoplasma orale ATCC 23714
Mycoplasma fermentans strain PG18,
Mycoplasma penetrans strain GTU64,
Chlamydia trachomatis, serovar D, strain
Chlamydia trachomatis, serovar L1, clinical
Escherichia coli ATCC 25922
Enterobacter cloacae ATCC 13047
Staphylococcus saprophyticu, clinical
Enterococcus faecium, clinical strain
Enterococcus faecalis, clinical strain
Proteus mirabilis ATCC 29906
Lactobacillus acidophilus, clinical strain
Bacillus subtilis, clinical strain
Gardnerella vaginalis, clinical strain
Neisseria gonorrhoea, 1 clinical strain
Staphylococcus aureus ATCC 25923
Pseudomonas aeruginosa, ATCC 27853
Klebsiella pneumoniae, CIP 104298
Strepcococcus agalactia, ATCC 12403
Streptococcus bovis CIP 105065
Acinetobacter baumanii, ATCC 49139
Staphylococcus epidermidis ATCC 49139
Candida albicans clinical strain
Mycoplasma pneumoniae clinical strain
Neisseria mucosa clinical strain
Rhodococcus equiclinical strain
Moraxella catarrhalis, clinical strain
Mycoplasma genitalium, strain G-37, ATCC
Mycoplasma genitalium, strain 2282,
Mycoplasma genitalium, strain 2288,
Mycoplasma genitalium, strain 2300,
Mycoplasma genitalium, strain 2321,
Mycoplasma genitalium, strain 2341,
Mycoplasma genitalium, strain M30, clinical
Mycoplasma genitalium, strain UTMB1,
Mycoplasma genitalium, strain TW-10-51,
Mycoplasma orale ATCC 23714
Mycoplasma fermentans strain PG18,
Mycoplasma penetrans strain GTU64,
The CT, MG, NG and IC primers and probes of the invention have been assayed in quadruplex on a mix of a pre-determined quantity of CT, MG and NG DNA (the experiment was made in quadricate). Four multiplex are tested, each multiplex containing one MG simplex described on top.
Results are as follows:
sensitivity is of 10 copies per PCR for the first quadruplex mix (Probe MGBR140c and 100 copies per PCR for other multiplex
sensitivity is of 10 copy per PCR for all multiplex tested
Sensitivity is of 1 copy per PCR for all multiplex tested
There is no Ct variation for the IC, whatever quantity of DNA is being used
CT+MG+NG+IC real-time amplification systems of the invention, together in multiplex in the same mix;
compared to Roche Amplicor CT test, to in house MG PCR test, and to NG culture test.
Samples are collected from human patients (Saint Louis Hospital, France). The first void urines are stored at −20° C. until use.
19 samples (1 to 19) are tested in multiplex. A negative control (sample without DNA), a positive C. trachomatis control (only C. trachomatis DNA), a positive M. genitalium control (only M. genitalium DNA) and a N. gonorrhoeae (only N. gonorrhoeae DNA) positive control are tested in the same run.
cf. Example 2
CT detection: COBAS Amplicor® CT test available from Roche Diagnostics (Amplicor CT/NG amplification kit ref: ART: 07 59 41 4, and Cobas Amplicor CT detection kit ref.: Art 07 5749 7.)
MG detection: in-house MG PCR test: A primer set, MgPa-1 (5′-AGT TGA TGA AAC CTT AAC CCC TTG G-3′; SEQ ID NO: 55) and MgPa-3 (5′-CCG TTG AGG GGT TTT CCA TTT TTG C-3′; SEQ ID NO: 56) was used to amplify the 281 base pair fragment of the major adhesion gene (Jensen J S, Uldum S A, J Søndergård-Andersen, J Vuust, and K Lind, “Polymerase chain reaction for detection of Mycoplasma genitalium in clinical samples” J. Clin. Microbiol., 1991; 29: 46-50). The specificity of the 281 base pair amplified fragment was verified by hybridization with the 25 mer MgPa 2 probe (5′-GAC CAT CAA GGT ATT TCT CAA CAG C 3′; SEQ ID NO: 57), labelled with fluorescein-11 dUTP with use of the ECL oligonucleotide 3-tail labelling system (Amersham International, Amersham UK). The specimens from which the 281 base pair DNA fragment, visible after Southern blot hybridization with the internal probe, was obtained were regarded as positive (Casin I, Vexiau-Robert D, De La Salmoniere P, Eche A, Grandry B, Janier M. “High prevalence of Mycoplasma genitalium in the lower genitourinary tract of women attending a sexually transmitted disease clinic in Paris, France”, Sex Transm Dis., June 2002; 29: 353-359).
NG detection: standard NG culture test, as described in “Performance Standards for Antimicrobial Susceptibility Testing; sixteenth Information Supplement”, January 2006, p 130 Table 2F, edited by Clinical and Laboratory Standards Institute (CLSI) antimicrobial susceptibility testing standards M2-A9 and M7-A7.
cf. Example 2.
In a 1×PCR mix, add the following primers:
CT forward primer U-PC 5580 (SEQ ID NO: 6) at 0.125 μM,
CT reverse primer L-PC 5754 (SEQ ID NO: 12) at 0.5 μM,
MG forward primer U-MG 1320 (SEQ ID NO: 15) at 0.025 μM,
MG reverse primer L-MG 1578 (SEQ ID NO: 18) at 1.25 μM,
NG forward primer U-pilE 1 59 (SEQ ID NO: 44) at 0.85 μM,
NG reverse primer L-pilE 406 (SEQ ID NO: 47) at 0.25 μM,
IC forward primer IS 368 (SEQ ID NO: 49) at 0.5 μM, and
IC reverse primer IS 569 (SEQ ID NO: 52) at 0.5 μM.
The probes are used at the following concentrations:
CT probe SCT 175b (SEQ ID NO: 9) at 0.15 μM (fluorophore FAM),
MG probe SFMG 258c (SEQ ID NO: 17) at 0.2 mM (fluorophore TAMRA), and
NG probe pilEc (SEQ ID NO: 46) at 0.2 μM (fluorophore ATTO 647N).
IC probe SIMB (SEQ ID NO: 51) at 0.15 μM (fluorophore ATTO-590),
The following reactants are further added:
5% Glycerol, 0.3% PVP 10, 2U of Taq Polymerase, 1 mM dNTP and 5 mM final of MgCl2.
10 μL of DNA are added to this mix.
C.
M.
N.
trachomatis
genitalium
gonorrhoeae
C. trachomatis
M. genitalium
N. gonorrhoeae
M. genitalium
N. gonorrhoeae
The IC is perfectly detected in the real-time multiplex system of the invention, which confirms that there is no Taq polymerase inhibitor.
The real-time multiplex amplification of the invention has a good reproducibility, the standard deviations being very low, except for two points on N. gonorrhoeae.
The detection results obtained with the real-time multiplex system of the invention are at least as accurate as the ones obtained with the prior art ones.
Number | Date | Country | Kind |
---|---|---|---|
06290862.9 | May 2006 | EP | regional |
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/EP2007/003170 | 4/10/2007 | WO | 00 | 11/13/2008 |