Recombinant Alpha-Fetoprotein, Method and Means for Preparation Thereof, Compositions on the Base Thereof and Use Thereof

Abstract
The invention relates to the microbiological and medical industry, genetic engineering, biotechnology. A Saccharomyces cerevisiae yeast strain was obtained on the basis of constructing a recombinant plasmid DNA comprising a structural gene of a human alpha-fetoprotein (AFP) under the control of a regulatory promoter, providing the synthesis and production of AFP in a secreted soluble form, this AFP having activity identical or similar to the activity of a human AFP. The obtained recombinant AFP may be used as an active substance for the preparation of therapeutic agents for use in oncology, immunotherapy, cosmetology and also for the diagnosis of cancer and embryonic pathologies.
Description
FIELD OF THE INVENTION

The invention relates to the microbiological and medical industry, genetic engineering, biotechnology. A recombinant alpha-fetoprotein (AFP) according to the instant invention, retaining the activity of a human AFP, obtained from serum, is intended for use in oncology, immunotherapy, cosmetology.


BACKGROUND OF THE INVENTION

Alpha-fetoprotein (AFP) is the main component of embryonic blood serum of mammals, which is synthesized by embryonal liver and yolk sac during perinatal development. Immediately after birth, the level of AFP in the serum sharply decreases and its expression became undetectable in healthy adult individuals (Deutsch H. F., 1991, Adv. Canc. Res. 56, 253-312). The synthesis of AFP is renewed upon malignant development of liver tumors and germinogenic teratoblastomas and could be detectable to a lesser degree in the case of chemical and mechanical damage to the liver, accompanied by regeneration, for example, during acute viral hepatitis or cirrhosis (Mizejewsly G. J., 2002, Expert Rev. Anticancer. Ther. 2: 89-115).


Human AFP is a glycoprotein consisting of 590 amino acids and comprising about 4% of a carbohydrate component (Morinaga T., et al., 1983, Proc. Natl. Acad. Sci., U.S.A., 80, 4604-4608; Pucci P. et al., 1991, Biochemistry 30, 5061-5066). One of the main properties of AFP is the noncovalent sorption of different low-molecular chemical substances, such as polyunsaturated fatty acids, steroidal hormones, metals, retinoids, hydrophobic antibiotics and others (Aussel S. & Masseyeff R., 1994, Biochem. Biophys. Res. Commun. 119: 1122-1127; Deutsch H. F., 1994, J. Tumor Marker Oncol., 9: 11-14). In early stages of embryonic development, AFP replaces albumin as a transport vehicle for fatty acids and other low-molecular substances (Deutsch H. F., 1991, Adv. Canc. Res. 56, 253-312).


AFP molecule consists of three globular structural domains bounded by 15 interchain disulfide bonds, which significantly increases the complexity of the process of assembly of a tertiary structure of a protein (Morinaga T., et al., 1983, Proc. Natl. Acad. Sci. U.S.A., 80, 4604-4608; Pucci P., et al., 1991, Biochemistry 30, 5061-5066). Furthermore, all important structural element of an AFP molecule is the carbohydrate component, which provides correct reception and functioning of the molecule (Deutsch H. F., 1991, Adv. Canc. Res. 56, 253-312).


In addition to a polypeptide chain consisting of 590 amino acid residues, the structure of the molecule of a serum embryonic AFP or that one secreted by hepatocarcinoma cells includes one oligosaccharide group linked to asparagin according to the N-type glycosylation (Yamashita K. et al., 1993, Cancer Res. 53:2970-2975). The structure of an oligosaccharide AFP chain is heterogeneous and depends on different factors: the stage of development of hepatocarcinoma or the stage of development of the embryo. Oligosaccharides affect structural properties of an AFP molecule, could be included in the content of antigenic determinants and receptor-binding centers (Deutsch H. F., 1991, Adv. Canc. Res. 56, 253-312). As distinctive from serum AFP, recombinant AFP expressed in bacterial cells is not glycosylated, which is a characteristic distinction of the product characterized in the works of Murgita (U.S. Pat. Nos. 6,331,611; 6,627,440; 6,416,734) and, consequently, has structural and functional properties distinguishing it from a serum analog and also from the recombinant AFP expressed in yeast systems. It is known that during expression of heterologic proteins in yeasts, their glycosylation is carried out in respect to the same amino acid residues as in the serum analog, but the structure of the oligosaccharides themselves significantly differ in respect to makeup, length and branching of the chain, which also predetermines certain distinctions in the structural and functional properties of corresponding proteins (Hard K. et al., 1998, FEBS Lett. 248:111).


AFP may be selectively absorbed by cells expressing specific AFP receptors (AFPR), such as embryonic cells, stem cells, activated immune cells, cancer cells or cells transformed by certain types of retroviruses (Uriel J. et al., 1989, in Jizejewsky G. I., Jakobson H. I. (eds): Biological Properties of Alpha-Fetoprotein. Boca Raton, CRC Press, vol. 2:103-117). Normal mature cells lose the ability to absorb AFP and do not express specific AFPR. In view of this property of AFP, methods have been proposed for the therapeutic use of AFP for the purpose of targeting delivering of cytostatics and other substances, suppressing the growth of cancer cells, to a tumor (Deutsch H. F., 1994, J. Tumor Marker Oncol. 9: 11-14; Tsukada Y. et al., 1994, J. Tumor Marker Oncol. 9: 99-103).


AFP has a number of functional properties, which at present are being intensively studied. The classical concept of AFP as an analog of embryonic serum albumin, is at present supplemented by data concerning the capability of AFP to carry out the regulation of the growth, development and programmed death of cells (Mizejewslcy G. J., 2002, Expert Rev. Anticancer. Ther. 2: 89-115). In particular, it was shown that a recombinant AFP, similarly to a serum and cultural analog, is capable of suppressing the growth of estrogen-dependent tumoral and normal tissues (Bennett J. A. et al., 1997, Breast Cancer Res. Treat. 45, 169-179; Bennet J. A. et al., 1998, Clinical Cancer Research, 4, 2877-2884). Recently, it was established that the oncosuppressive activity of AFP is carried out in accordance with the mechanism of triggering apoptosis, which is characterized by typical morphological changes, the arrest of growth, by cytotoxicity and DNA fragmentation (Semenkova L. N., 1997, Tumor Biol. 18, 261-274; Dudich E. I., et al., 1998, Tumor Biol. 19, 30-40; Dudich E. I.; et al., 1999, Eur. J. Biochem. 266: 1-13; Semenkova L., et al., 2003, Eur.; J. Biochem. 70: 4388-4399).


Earlier studies showed the capability of AFP to regulate differentiation and activation of immune cells. In particular, AFP is capable to suppress immune cells activated with allo- or autoantigens and to inhibit various cytokine gene expression (Yamashita K., et al., 1993, Cancer Res. 53, 2970-2975; U.S. Pat. No. 5,965,528). On the other hand, AFP induces pronounced stimulation of the growth of immature bone marrow cells, stem cells and embryonic cells (Dudich E. I., et al., 1998, Tumor Biol. 19, 30-40; U.S. Pat. No. 6,627,440).


These properties of AFP, and also increased selectivity of absorption of AFP by cancer cells in vivo (Uriel J., et al., 1989, in Mizejewslcy G. I., Jakobson H. I., eds: Biological Properties of Alpha-Fetoprotein. Boca Raton, CRC Press. vol. 2:103-117), revealed the base for its use in medicine as a therapeutic preparation in the treatment of autoimmune (U.S. Pat. No. 5,965,528) and oncological diseases (U.S. Pat. No. 6,416,734; Mizejewslcy G. J., 2002, Expert Rev. Anticancer. Ther. 2: 89-115). Furthermore, traditionally AFP is used as an oncoembryonic marker for early diagnosis of oncological diseases and pathologies of embryonical development (Deutsch H. F., 1991, Adv. Canc. Res. 56, 253-312). However, the use of natural AFP as a drug is technologically impossible because of raw material deficiency.


Traditionally, a source for the obtainment of AFP is the blood serum of pregnant women, funic embryonal serum or ascitic fluid of cancer patients. Obviously, none of these sources are acceptable for the production of a protein substance for medical purpose because, in the first place, there is extremely limited access to the source of raw material and the content of AFP therein is low, and in the second place, there is the ever-growing risk of infection with viruses or prions.


Earlier data were published relating to the expression and purification of recombinant AFP (rAFP) in different microorganisms (Yamamoto R., et al., 1990, Life Sciences, 46:1679-1686; Nishi S., et al., 1988, J. Biochem. 104: 968-972; U.S. Pat. No. 5,206,153; U.S. Pat. No. 6,331,611). Thus, the intracellular production of human rAFP was carried out in Saccharomyces cerevisiae (Yamamoto R., et al., 1990, Life Sciences, 46:1679-1686; U.S. Pat. No. 5,206,153) and Escherichia coli (U.S. Pat. No. 6,331,611; Boismenu R., et al., 1997, Protein Expression and Purification. 10:10-26). It was shown that recombinant AFP, expressed in Escherichia coli, retains the immunoregulatory and oncosuppressive activity of the embryonic analog (Boismenu R., et al., 1997, Protein Expression and Purification. 10:10-26; Bennett J. A., et al., 1997, Breast Cancer Res. Treat. 45, 169-179). The main drawback of these expression systems is the incapability to secrete heterologic protein and the extremely low level of its production. Furthermore, the obtainment of the desired product from a biomass of recombinant strain-producers required that additional procedures of denaturation and renaturation be carried out, which resulted in a significant reduction of the yield of the product and, as a consequence, a substantial increase of its cost. Also, in the case of use of bacterial expression systems, the problem of contamination of the product with the lipopolysaccharides of the shell, which have known endotoxic activity, is also important.


The technical solution most similar to the instant invention is the strain-producer of human AFP that is described in the references (Yamamoto R., et al., 1990, Life Sciences, 46:1679-1686; U.S. Pat. No. 5,206,153). In these sources yeast strain-producer Saccharomyces cerevisiae with intracellular production of human AFP is disclosed, the amino acid sequence of which comprises an additional section corresponding to the signal peptide of rat AFP. This invention identifies the product of secretion of a yeast strain, which product has the properties of a mature human AFP and has the original sequence SEQ ID NO:2, which corresponds to the sequence of a mature human AFP. This specificity distinguishes the product described in the instant invention over the earlier disclosed (Yamamoto R., et al., 1990, Life Sciences, 46:1679-1686; U.S. Pat. No. 5,206,153). Furthermore, a drawback of this strain described in the cited references is the absence of mechanisms for intracellular assembly and secretion of AFP into a cultural liquid, which significantly raises the cost, makes the process of preparing a purified recombinant AFP in preparative amounts more complex and provides an extremely low level of production of AFP. Furthermore, the authors of the cited work (Yamamoto R., et al., 1990, Life Sciences, 46:1679-1686; U.S. Pat. No. 5,206,153) obtained a modified recombinant AFP, the sequence of which also comprises signal and linker peptide, which limits the possibility for its medical use because of modification of the structure of the protein, resulting in a change of the immunological specificity and, as a result thereof, in an increase of the risk of immunoreactive pathology with intravenous or subcutaneous administration.


In the case of heterological secretion production with yeast cells of proteins, for which the correct folding takes place with the formation of disulfide bonds (among them AFP), of importance is the level of production of yeast disulfidisomerase (Pdi) with cells of a producer (Shusta E. V., et al., 1998, Nat. Biotechnol. 16: 773-777). Furthermore, action synergic with this enzyme is provided by an increased amount of the shaperon-like yeast protein BiP (Robinson A. S., et al., 1996, J. Biol. Chem. 271: 10017-10022).


In spite of the fact that yeasts are traditionally considered to be organisms free of secreted proteinases (Chung B. H. & Park K. S., 1998, Biotechnol. Bioeng. 57:245-249), for a number of proteins, including—for HSA, their degradation in the course of culturing yeasts is shown, which is related to the presence of still unidentified proteinases associated with the cell (Chung B. H. & Park K. S., 1998, Biotechnol. Bioeng. 57:245-249; Kang H. A., et al., 2000, Appl. Microbiol. Biotechnol. 53: 575-582). All of the listed factors require that they be taken into account during the creation of a yeast producer of AFP, effectively secreted in a cultural liquid.


Taking the drawbacks of the methods existing at present for the preparation of a recombinant AFP into account, it becomes obvious that there is a need for further improvement of the technology of the systems for expression and secretion of recombinant AFP, in particular the development of new recombinant strains having the capability for higher expression of a heterological protein with the provision for intracellular assembly of a native tertiary structure and subsequent secretion of the desired product into a cultural liquid.


Thus, the requirement for the development of industrially applicable methods of preparing AFP, which in respect to its properties would be identical or similar to human serum AFP and thus would make it possible to use it in those fields where human serum AFP is traditionally used, objectively follows from the state of the art.


The achievement of the stated object is possible by the creation of a new strain of microorganisms, which could produce in a cultural medium a polypeptide identical or similar to human serum AFP in respect to its properties.


SUMMARY OF THE INVENTION

In order to prepare a recombinant AFP, the properties of which would be identical or similar to the properties of a human serum AFP, it was necessary to develop a strain-producer providing for synthesis and production of AFP in a secreted soluble form.


The strain-producer was obtained with the use of genetic engineering methods by transforming a parent strain with a plasmid, which comprised a DNA sequence encoding a protein having the activity of a mature human AFP.


A recombinant secreted AFP produced in a yeast system of expression has properties identical or similar to the properties of a mature human AFP, which are determined in an immunologic analysis and by its capability to suppress the growth of cells of B-cell lymphoma Raji and other human cellular lines sensitive to apoptogenic action in a culture in vitro. This provides for an identical mechanism of action of the obtained AFP and a mature human serum AFP, obtained by a traditional method and having an amino acid sequence presented as SEQ ID NO:2. The conditions for carrying out the method of preparing AFP according to the instant invention provides for the assembly of a polypeptide with minimum defects as compared with native human AFP.


The proximity of the properties of human recombinant AFP, produced in yeasts, and human serum AFP is provided by the inclusion of an expression cassette, comprising a DNA sequence encoding a mature human AFP, in the composition of the plasmid, in that the process of elation does not require the denaturation-renaturation step, and at the same time provides for glycosylation of the obtained polypeptide, and also folding of the molecule and formation of disulfide bonds. Recombinant human AFP produced in a secreted form in a yeast system of expression differs from the recombinant analog produced in a proeukaryotic system of expression in that it is glycosylated according to the N-type, while a recombinant bacterial AFP described in patents (Murgita R. A. U.S. Pat. Nos. 6,331,611; 6,627,440; 6,416,734) is not glycosylated. Human recombinant AFP produced in a secreted form in a yeast system of expression differs from the serum analog by the composition and structure of the oligosaccharide chain, which is determined by the yeast strain and composition of the sugars included in the nutrient medium.


In order to obtain a high yield of the secreted protein with the required activity from a host cell, several additional genes were added to the plasmid encoding the AFP gene, the additional genes providing a high level of gene transcription, folding of the proteins in the process of secretion and the correct formation of disulfide bonds.


As a result, a pKX plasmid was obtained having the capability of transforming cells for the expression and secretion of AFP.


A eukaryotic producer cell having the capability of secreting recombinant alpha-fetoprotein was obtained with the aid of the aforesaid plasmid.


In a preferable variant a recipient strain Saccharomyces cerevisiae YBS723 was used as the initial cell, this strain being transformed by pKX plasmid to obtain a strain-producer Saccharomyces cerevisiae YBS723/pKX, deposited in the Russian Collection of Industrial Microorganisms (VKPM) under No. Y-3115.


During the cultivation of a transformed strain, AFP is secreted into a medium from which it may be isolated in a pure form with the use of traditional biochemical methods.


An isolated AFP obtained from transformed cells is used in the content of a pharmaceutical composition inhibiting the growth of tumor cells, which comprises the obtained AFP and pharmaceutically acceptable carriers and excipients.


An isolated AFP is used in the makeup of a synergic composition, inhibiting the growth of tumor cells, which comprises the obtained AFP and chemotherapeutic preparations and pharmaceutically acceptable carriers and excipients.


With use of the isolated AFP, a pharmaceutical composition on the base thereof or comprising its synergic composition, a method for treating cancer or preventing its development has been developed, which presumes the administration to a patient of an effective amount of AFP, pharmaceutical composition or synergic composition.


Since the obtained AFP is similar in respect to properties to human serum AFP, the obtained AFP is used in the makeup of a synergic composition having an immunosuppressive and immunoregulating action, wherein the composition comprises AFP and cyclosporin C and pharmaceutically acceptable carriers and excipients.


A method for treating autoimmune diseases and correcting the immune status has been developed with use of the isolated AFP or aforesaid synergic composition, the method comprising administering to a patient an effective amount of an AFP or a synergic composition with cyclosporin C.


In view of the capability of AFP to stimulate growth of stem cells, the inventors have proposed a pharmaceutical composition stimulating the growth of stein cells, the composition comprising the obtained AFP and pharmaceutically acceptable carriers and excipients, and a synergic composition stimulating the growth of stem cells is also proposed, this composition comprising the obtained AFP and derivatives of vitamins A, E, D, antioxidants, steroid hormones, isoflavones of vegetative origin with pharmaceutically acceptable carriers and excipients.


A method for stimulating the growth of stem cells in vitro is proposed with use of the isolated AFP, the aforesaid pharmaceutical or synergistic composition, the method comprising acting on cells with an effective amount of AFP or corresponding compositions.


Furthermore, a method for stimulating the growth of stem cells in vivo is proposed, the method comprising administering to a patient an effective amount of AFP or the aforesaid pharmaceutical or synergistic composition.


A cosmetic composition for rejuvenating skin and preventing aging of the skin is proposed on the basis of functional activity of isolated AFP, the composition comprising the obtained AFP with carriers and excipients acceptable in cosmetology and, optionally, derivatives of vitamins A, E, D, antioxidants, steroid hormones, isoflavones of vegetative origin.


A method of using the obtained cosmetic composition for rejuvenating the skin and preventing aging of the skin is proposed within the frame of the instant invention, the method comprising applying the composition onto the skin of an individual.





BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings illustrate the presented subject matters of the invention.



FIG. 1 shows the structure of a pKX plasmid encoding the sequence of a mature human alpha-fetoprotein, comprising an expression cassette with a human alpha-protein gene; a fragment of a bacterial plasmid pUC18; a region of initiation of replication of a 2-μm yeast plasmid; a selective PGK1 yeast marker, a PD11 gene encoding an disulfidisomerase enzyme and a KAR2 gene providing correct assembly of the protein and secretion of the desired product into a culture medium.



FIG. 2 shows the structure of an expression cassette comprising a sequence encoding a human alpha-fetoprotein within the composition of a pKX plasmid. The promoter region of the GAL1 yeast gene is shown by italics. The pre-pro region of secretion of the MFα1 yeast gene is shown by dark print. The amino acid sequence of the human alpha-fetoprotein molecule is shown by capital letters.



FIG. 3 demonstrates the structure of a synthetic gene encoding AFP and consisting of the most often used yeast codones. The AFP amino acid sequence, which is identical to the amino acid sequence of serum human AFP, is singled out with dark print.



FIG. 4 shows the results of SDS-PAGE electroforesis (A) and immunoblotting-analysis (B) of different amounts, applied onto a line, of a purified recombinant alpha-fetoprotein obtained from a yeast culture Saccharomyces cerevisiae YBS723/pKX cultural liquid.


1. Marker proteins (94, 67, 43, 30, 20 kD).


2. rAFP after affinity chromatography on a column with anti-AFP-sepharose (0.3 μg).


3. rAFP after gel-chromatography on a column with Sephacryl S-200 (0.4 μg).


4. rAFP (0.1 μg).


5. rAFP after Sephacryl S-200 (0.6 μg).


6. rAFP after Sephacryl S-200 (0.5 μg).


7. Embryonic eAFP (0.4 μg).



FIG. 5 shows a dose dependence of the proliferation of B-cellular Raji lymphoma cells on the AFP concentration for two different samples of purified AFP, which are obtained from embryonic serum eAFP and recombinant rAFP, that is expressed by yeast strain producer Saccharomyces cerevisiae YBS723/pKX. Proliferation of the cells was measured by [H3]-thymidine incorporation and expressed in percentage of inhibition of growth in experimental cultures after 12-hour incubation with AFP in respect to a control without additives.



FIG. 6 demonstrates: (A) synergistic enhancement of oncosuppressive action of doxorubicine in respect to myeloblastoma U937 cells with the combined use with rAFP according to the instant invention;


(B) synergistic enhancement of the general oncosuppressive effect with combined use of rAFP according to the instant invention and retinoic acid (pro-vitamin A, acid). Proliferation of the cells was measured by [H3]-thymidine incorporation and expressed in percentage of inhibition of growth in experimental cultures after 12-hour incubation with AFP in respect to a control without additives.



FIG. 7 shows the stimulating effect of rAFP according to the instant invention on the growth of stem embryonic cells obtained from a primary culture of cells of embryonic lung and retina. Proliferation of the cells was measured by a standard method of [3]-thymidine incorporation during the last four hours of culture and expressed in percent of the stimulation of growth in test cultures in respect to a control without AFP.


The list of sequences comprises sequences SEQ ID NO:1 and SEQ ID NO:2, which are respectively the nucleotide sequence of an expression cassette comprising the encoding sequence of a human alpha-fetoprotein in the composition of a pKX plasmid and the amino acid sequence of a mature human AFP.


The nucleotide sequence of an expression cassette comprises a promoter region of GAL1 yeast gene, a pre-pro region of secretion of MFα1 yeast gene, the encoding sequence of a human alpha-fetoprotein gene and a field of termination of transcription of a CYC1 yeast gene. This expression cassette is included in the composition of the pKX plasmid encoding the sequence of a mature human alpha-fetoprotein in a yeast strain-producer of a Saccharomyces cerevisiae YBS723/pKX system.





DETAILED DESCRIPTION OF THE INVENTION

In order to realize the instant invention, the main technical object was the creation of a strain of yeast-producer of AFP, capable of effectively secreting the desired protein into a cultural liquid. This object is solved by constructing a recombinant DNA pKX plasmid encoding the regulated synthesis of human AFP and the strain Saccharomyces cerevisiae YBS723/pKX providing the synthesis and production of AFP in a secreted dissolved form with a level of expression not less than 10 mg/l. The high level of synthesis of the desired protein in secreted dissolved form is provided in that the pKX plasmid comprises a promoter of the GAL1 gene with simultaneous amplification of the KAR2 gene (Robinson A. S., et al., 1996, J. Biol. Chem. 271:10017-10022), encoding a chaperon heavy chain binding protein BiP. In the genome of the strain of the recipient, there is amplification of the PD11 gene (Robinson A. S., et al., 1996, J. Biol. Chem. 271:10017-10022), encoding a disulfidisomerase enzyme, which participates in the formation of disulfide bonds during the secretory process of the proteins.


The recombinant plasmid DNA comprises a human AFP gene under the control of a GAL1 promoter gene, providing a high level of transcription of the gene, and a KAR2 gene, encoding a chaperon heavy chain binding protein BiP, participating in folding proteins during the secretory process for the proteins, and providing a high level of production of the desired protein into the cultural liquid. Furthermore, in order to provide the correct formation of disulfide bonds and the formation of a native tertiary structure of the protein, a PS11 gene encoding disulfideisomerase is used.


A recombinant pKX plasmid DNA (FIG. 1), encoding a human AFP gene, is characterized by the following features:

    • it is an expression plasmid for the effective secretion of human AFP;
    • it has a size of 13301 bp;
    • it comprises a fragment encoding the amino acid sequence of a mature human alpha-fetoprotein SEQ ID NO:2;
    • it comprises a fragment of the bacterial plasmid pUC18; a region of initiation of a 2-μm yeast plasmid; a selective yeast marker PGK1; a KAR2 yeast gene encoding a chaperon heavy chain binding protein BiP; a PD11 gene encoding a disulfidisomerase enzime; anr expression cassette with an AFP genome;
    • in the structure of the expression cassette presented by the nucleotide sequence SEQ ID NO:1 is included: a promoter region of GAL1 yeast gene; a pre-pro region of secretion of MFα1 yeast gene; a region encoding a mature human AFP; a field of termination of transcription of a CYC1 yeast gene. When this plasmid is introduced into a cell, a high level of transcription of the AFP gene is achieved due to the use of a highly effective GAL1 promoter. The introduction of a pre-pro region of secretion of MFccl provides for the correct secretory processing of AFP accompanied by the effective secretion of the protein with the expected amino acid sequence SEQ ID NO:2, if the encoding region will correspond to the DNA sequence encoding a mature human AFP in a cultural liquid;
    • a significant distinction of the proposed plasmid construction is that an afp gene is under the control of a highly effective GAL1 promoter, and in order to provide the correct formation of disulfide bonds and the formation of a native tertiary structure of the protein, PD11 and KAR2 genes are used.


Any eukaryotic cell susceptible to such a transformation with the indicated plasmid may be transformed with the aid of the created plasmid. The selection of the cell is not critical since the methods and steps of transformation are well-known to those skilled in the art. However, depending on the type of cell and the conditions for culturing the obtained transformant, the level of expression of AFP may vary, but the fact of expression of the required peptide will take place under condition of successful transformation of the parent cell.


A recipient strain YBS723 of the genotype pgk1/pgk1 is used to obtain the strain Saccharomyces cerevisiae YBS723/pKX. The homozygosis of pgk1/pglc1 makes this strain incapable of growth in all mediums containing any single source of carbon within the norm digestible by yeasts S. cerevisiae. The homozygosis of ga180::PD11/ga180: PD11 results in a change of regulation of the promoter of the GAL1 gene with simultaneous amplification in the genome of the PD11 gene encoding the disulfidisomerase enzyme and participating in the formation of disulfide bonds during the secretory process of the proteins.


The YBS723 strain is transformed by the pKX plasmid according to the method (Ito H., et al., 1983, J. Bacteriol. 153:163-168). Transformants were selected according to the capability to grow on a full-value yeast medium (bactopeptone—20 g/l, yeast extract—10 g/l, bactoagar—20 g/l) comprising 2% glucose as a source of carbon. One of such clones is designated as YBS723/pKX.


The obtained diploid yeast strain Saccharomyces cerevisiae YBS723/pKX is characterized by the following features:


Genetic features: Genotype pgk1/pgk1 ga180::PD11/ga180::PD11;


Morphological features: Vegetative cells of a 48-hour culture grown on a solid nutrient medium with 2% glucose as the only source of carbon have an oval form, cell size of 3.6×7.1 μm, the protoplasma is homogenous, reproduction is by gemmation. When growing on a solid medium comprising a yeast extract and peptone (YEP) at 30° C. after 72 hours of growth, the columns have the following appearance:


1) on a YEP medium with glucose—a white color column with a smooth edge, shining surface, cone-shaped profile, cream-like consistency;


2) on a YEP medium with starch—a white color column with a patterned edge, dull surface, lens-like profile and grain consistency;


3) on a YEP medium with molasses—a white color column with a dull wrinkled surface, patterned edge, convex profile and cream-like consistency.


Growth in a liquid medium—on a YEP medium with starch at 32° C. during the first 24 hours of culturing—a cloudy liquid, white residue, does not cake, does not form parietal films.


Physicochemical features: Facultative anaerobe. Temperature of growth—23-33° C. (optimum—31° C.). pH of culturing—3.8-6.7 (optimum—5.0). Highest level of secretion of AFP is observed at pH 6.8-7.0.


Assimilation of carbon sources: ferments glucose, galactose, fructose, maltose, saccharose, dextrine, starch.


Assimilation of nitrogen sources: assimilates amino acids, urea, ammonium sulphate, ammonium nitrate.


Distinctive specificities: in the case of culturing on a rich medium with starch (2%), zones of fading starch surrounded by a dark rim after incubation of dish at +4° C. for 24 h.


Pathogenicity: the strain Saccharomyces cerevisiae YBS723/pKX is not pathogenic.


Method of storage: The strain is stored on an agarized rich medium with glucose for 3 months at +4° C.


The obtained strain Saccharomyces cerevisiae YBS723/pKX—producer of AFP in a secreted form is deposited in the Russian Collection of Industrial Microorganisms (VKPM) under No. Y-3115.


The cell strain producer of recombinant AFP proposed by the Applicants has a number of advantages over already existing prototypes:

    • production of the desired product is carried out in a secreted form into a cultural liquid;
    • the amino acid sequence of the final product corresponds to the sequence of a mature human AFP—SEQ ID NO:2;
    • similar to the serum embryonal analog, rAFP, produced by the strain producer Saccharomyces cerevisiae YBS723/pKX, is glycosylated;
    • the yield of the desired product is significantly increased due to an increase of expression of the gene encoding the disulfidisomerase enzyme PD11 providing for the formation of disulfide bonds and the KAR2 gene encoding shaperon heavy chain binding protein BiP providing for correct assembly of the protein and secretion of the desired product into the cultural medium.


It is completely obvious that the sequence encoding the DNA may comprise replacements related to degeneration of the genetic code, and also some replacements, insertions, deletions, which as a whole do not result in the obtainment of inactive forms of the fetoprotein. Possible variations are known to those skilled in the art. The obtained polypeptide may also include within the frame of the amino acid sequence conservative amino acid replacements presuming the replacement of one amino acid with another having similar properties. However, within the limits of the claimed features of the instant invention there are only those polypeptides which have primary, secondary and tertiary structure, that does not disturb the required activity of the obtained polypeptide, in particular—to have properties identical or similar to the properties of a mature human AFP, determined in an immunological analysis and in accordance with its capability to suppress the growth of cells of a B-cellular lymphoma Raji in a culture in vitro.


The indexes of functional activity, at which it is regarded that the obtained polypeptide will have the properties of a mature human serum AFP are determined according to the immunological reaction and according to its capability of inhibiting in vit7-o the growth of cells of the B-cellular lymphoma Raji at a level not less than 10% of the activity of a mature human serumal AFP cells of the B-cellular lymphoma Raji at a level not less than 10% of the activity of a mature human serum AFP.


In the case of practical use of the obtained polypeptide within the makeup of a composition, traditional additional components are used, such as excipients, diluents, preservatives, buffer solutions, physiological solution, a 0.9% solution of sodium chloride, technological additives used during the production of drug forms, etc. Compositions may be fluid (solutions, suspensions, creams, emulsions, etc.), solid (lyophilizated powder, reconstituted prior to use, an adsorbed preparation on a carrier, etc.), serving for parenteral, oral, intravenous, intramuscular, etc. administration or for external use. Wherein, the compositions for external use may comprise additives promoting the absorption and diffusion of the active substance in tissue.


The synergic compositions of the instant invention provide for the presence in the composition of another active substance, wherein in the case where two active substances are present at the same time, one of which is the AFP according to the instant invention, the effect of their action is reliably higher than in the case where each substance is used separately.


It is quite obvious that synergic compositions are one of the preferable variants of embodiment of the invention, since to one skilled in the art the variant of administering each active component separately is obvious. For example, in the case of anticancer therapy, each preparation of an active component may be administered separately and together simultaneously, with separation by time or by different manners of administration. The concrete selection depends on the state of the patient, the seriousness of the illness, prior treatment, etc.


The selection of the therapeutic dosages for treatment may be any dose in a wide range from 0.001-10 mg/kg of a patient's weight, with the proviso that the required therapeutic effect is obtained. It corresponds to the traditional dosages of human AFP, since the obtained AFP will have properties that are similar or close in respect to activity. The limiting dosages of AFP according to the invention correspond to the dosages of human AFP, since they have a similar amino acid sequence, which is not recognized by a normal immune system of a human as “foreign.”


The instant invention is illustrated by the following examples, which are not of a restrictive character, but are intended to demonstrate embodiment of the invention and realization of the best variant of the embodiment.


Example 1
Isolation of Sum RNA and Construction of Intermediate Recombinant Plasmid DNA pTrcafp

The total mRNA was isolated from the cellular line of human hepatoma HepG2 with the aid of Trizol Reagent (Gibco BRL, USA) in accordance with a method of the producer. The cDNA was obtained using First Strand cDNA Synthesis Kit (MBI Fermentas) in the presence of primers oligo (dT)18 or GAAGTAATTTAAACTCCCAAAGC (3R), complementary to the 3′-end of the gene afp. Amplification of the obtained matrix for subsequent cloning was caried out in the presence of primers:












CTTCAATCGATATGACACTGCATAGAAATG (Cla)








CTTCCAAGCTTAAACTCCCAAAGCAG (Hind),






the first of which corresponds to the 5′-sequence of mature protein gene (singled out by dark print) and comprises the recognition site for restrictase Cla I, while the second is complementary to the 3′-end section of the gene (singled out by dark print) and comprises a recognition site for Hind III. Amplification of the gene was carried out in a volume of 100 μl. The reaction mixture comprised 10 ng of cDNA, 30 μM of each of primers (1) and (2), a mixture of dNTP (0.2 mM of each), 10 mM of Tris-HCl, pH 8.8, 10 mM of KCl, 2.5 mM of MgSO4, 2.5 unit Pfu DNA-polymerases (Stratagene firm) and 1 unit Taq DNA-polymerase (Fernentas firm). There were 25 cycles carried out according to the scheme: 95° C./40 sec, 39° C./40 sec, 72° C./1 min. The products of the reaction were analyzed by electroforesis in a 1% agarous gel; strips of a length of about 1790 bp were cut, DNA was extracted from the gel, treated with restrictases ClaI and HindIII and cloned into the plasmid pTrcTEGF, earlier obtained on the base of the vector pTrc99A (Amnann E., et al., 1988, Gene, 69, 301-315), and treated with those same restrictases. As a result the plasmid pTrcafp was obtained; its structure was confirmed by restrictase analysis, using restrictases Cla I and Hind III, in respect to which cloning was carried out, and also Spe I, Mun I, Sec I and Sty I, the recognition sites of which iixe inside the AFP gene, and by determination of the nucleotide sequence of the DNA section cloned with the aid of PCR. Sequencing was carried out according to the method and with use of the Cycle Reader™ DNA Sequencing Kit (Fermentas, Lithuania).


Example 2
Preparation of Synthetic cDNA, Encoding a Human AFP Gene

In order to obtain a synthesized AFP gene, 36 oligonucleotides having a length of 62-68 b were chemically synthesized. On the basis of these oligonucleotides six double-chain fragments were obtained by the method of polymerase chain reaction, each of which was cloned to a vector pUC18. The primary structure of all the cloned fragments was confirmed by sequencing. Fragments with the correct nucleotide structure were then sequentially collected into a desired gene by the method of restriction/ligation in the form of a fragment of the plasmid pUC18. In a similar manner a cDNA was obtained for expression of modified forms of AFP, comprising deletion, mutation or added amino acid residues.


Example 3
Construction of a Recombinant Plasmid DNA pKX

The plasmid pTrcafp was used as a matrix for PCR in the presence of primers:












CAACCCTCGAGTTAAACTCCCAAAGC








CCAACCCATGGCTAAGAGAACACTGCATAGAAA-TG.






Restriction sites NcoI and XhoI (underlined) are set in the sequence of primers. The DNA fragment obtained as a result of amplification after treatment with endonucleases of restriction NcoI/XhoI were cloned onto vector pUC18/GAL1-pp, comprising a promoter GAL1 and pre-pro region of secretion MFal. As a result the plasmid pUC18/GAL1-pp/afp was obtained. In order exclude possible errors of PCR the NcoI/XhoI fragment of the plasimd was sequenced. The HindIII/XhoI fragment of the plasmid pUC18/GAL1-pp/afp, comprising the promoter GAL1, pre-pro region of secretion of MFα1 and encoding part of the human AFP gene (FIG. 2) were transferred to the HindIIdIXhoI bireplicori (yeast—E. coli) vector pPDX. As a result the plasmid pPDX/GAL1-pp/afp was obtained. The ClaI/XhoI fragment of the plasmid pPDX/GAL1-pp/afp was transferred to ClaI/XhoI vector of pPK, differing from pPDX by the presence of the KAR2 gene. The plasmid obtained as a result is named pKX (FIG. 1). In a similar manner the plasmid pKX-1 was obtained, comprising the synthetic human AFP gene consisting of the most widely used yeast codons (FIG. 3). The plasmid pKX-1 differs from pKX in that it comprises the synthetic gene of a mature human AFP.


Example 4
Obtainment of a Strain-Producer of Human AFP

In order to obtain the strain Saccharomyces cerevisiae YBS723/pKX, the recipient strain YBS723 was transformed by the plasmid pKX in accordance with the method (Ito H., et al., 1983; J. Bacteriol. 153: 163-168). The transformants were selected by the capability to grow on a full-value yeast medium (bactopepton—20 g/l, yeast extract—10 g/l, bactoagar—20 g/l), comprising 2% glucose as the source of carbon. One of such clones is designated YBS723/pKX.


Example 5
Determination of Productivity of Strain-Producer of Human AFP Saccharomyces cerevisiae YBS723/pKX

Cells of the strain-producer YBS723/pKX were grown in vials at 26° C. on a rocker (250 rpm) on a medium of the following composition: glucose -2%, glycerine -1.5%, yeast extract—1%, peptone—2%, distilled water. The pH of the medium was maintained at 7.0 by the addition of 0.1 M of a phosphate buffer. The initial titer of the cells was 5×106. Samples were taken after 72 hours of growth of the culture after transition to the stationary phase of growth at a titer of 7-8×108. A sample of the cultural liquid was obtained after centrifugation of the culture at 10 000 rpm for 1 min and was used in the following analyses. Samples of the CL were analyzed by electrophoresis in a 12.5% polyacrylamide gel with sodium dodecyl sulphate. The gels were colored Coomassie R-250 (FIG. 4) and scanned to determine the total protein and relative content of the AFP specific protein. According to the data of electrophoresis and scanning, the total content of AFP in the CL is about 10-25% of the total protein, but there is partial intracellular degradation of the protein. The relative content of AFP in the CL was determined by the method of immunoblotting in the presence of polyclonal antibodies to AFP (FIG. 4). Also, the quantitative content of AFP in the cultural liquid was determined by the method of immunoenzymatic analysis (IEA), with use of a set of monoclonal and polyclonal antibodies to human AFP. According to the IEA data, the average content of AFP in the CL in liquid mediums reached 5 mg/l.


Example 6
Determination of Productivity of Strain-Producer of Human AFP Saccharomyces cerevisiae YBS723/pIX in High-Density Mediums

Feed-batch culturing of the strain YBS723/pKX was carried out in a fermenter at 26° C. and pH 7.0 (automatic maintenance). The content of dissolved oxygen dO was maintained, >20%. During fermentation, replenishment with a medium of the following composition was carried out: yeast extract—30 g/l, peptone—60 g/l, glucose—100 g/l.


The rate of feeding the replenishment was such as to provide a rate of growth of the culture μ=0.03. After achievement of OD50, equal to 280 optical units, the content of AFP in the CL was analyzed. The relative and total content of AFP in the CL of high density cultures of YBS723/pKX was determined as described above in example 4. In the case of culturing in high density mediums, the content of rAFP in the CL according to IFA data reached 70 mg/l.


Example 7
Isolation and Characterization of Recombinant Human AF from CL of a Strain-Producer YBS723/pKX

Isolation of rAFP from the CL of the strain-producer YBS723/pKX was carried out as described earlier (Dudich et al., 1999, Biochemistry, 38:10406-10414) with slight changes. The cultural liquid was concentrated from 3 l to 200 ml by ultrafiltration on a concentrating cell “Millipore” and dialyzed against 0.005M Tris-HCl, a pH 7.5, 0.1M NaCl buffer, 4° C., then centrifuged for 0.5 hours at 10 000 rpm.


Ion exchange chromatography. The supernatant obtained after centrifugation was applied onto an ion exchange column DEAE-Sepharose Fast Flow (Pharmacia, 27×4 cm), balanced with 0.01M Tris-HCl, pH 7.5, 0.1M NaCl. The components not bond to sorbent were washed from the column with a starting buffer, while the elution of the desired product was carried out by 0.2 M of NaCl in a Tris-HCl buffer, pH 7.5 at a rate of 1 mL/min.


Affinity chromatography. The fractions comprising rAFP were combined, the concentration of NaCl was brought to 0.5M and applied to an affinity column with Sepharose CL-4B conjugated with polyclonal anti-AFP rabbit antibodies, which was balanced with 0.05M Tris-HCl, pH 7.5 and 0.5M NaCl. After the output of the proteins not bonded to the antibodies of the proteins, the adsorbed rAFP was eluted with 0.005M HCl. The peak of the output of the material upon achievement of pH from 5.0 to 3.5 was determined by absorption at 280 nm. The solution of rAFP was neutralized to pH 7.5 by the addition of a 2M solution of Tris-HCl, pH 7.5.


Gel chromatography. Further purification of rAFP was carried out by gel chromatography on a column with Sephacryl S-200 (1.8×70 cm) in a 0.1 M phosphate buffer, pH 7.0; 0.15M NaCl, at a rate of 0.5 ml/min. The solution of purified rAFP was concentrated in a cell “Amicon” (membrane YM-30) under the pressure of nitrogen.


Analysis of samples. The identification and purity of the obtained rAFP preparation were controlled by methods of gel electrophoresis according to Lammly in 12.5% SDS-PAGE with β-mercaptoethanol with subsequent coloring by Coomassie (FIG. 4A), Western-blot-analysis on a PVDF-membrane with a titer of primary antibodies 1:500 and secondary 1:5000, dot-blot on a Hybond ECL-nitrocellulose membrane (FIG. 4B), IFA.


Determination of the concentration of the protein in the solutions was canied out in accordance with the Bredford method, using a standard solution of embryonal AFP as the control, and also spectrophotometrically at 278 nm, talting the coefficient of extinction E1%,278 nm=0.53 into account.


Example 8
Determination of Biological Activity of Recombinant Human AFP In Vitro

The functional activity of rAFP and the modified forms thereof were determined according to its capability of suppressing the growth of cells of B-cellular lymphoma Raji in the culture in vitro, as earlier described (Semenkova L. N., 1997, Tumor Biol. 18, 261-274; Dudich E. I., et al., 1998, Tumor Biol. 19, 30-40). Preliminarily washed by a fresh medium, Raji cells were placed into each cell of a 96-alveolar plate according to 5×103 in 0.1 ml of a medium RPMI-1640 in the presence of a 10% fetal calf serum, then different doses of AFP were added for 12 hours. Proliferation of the cells was measured by a standard method by the introduction of [H3]-thymidine during the last 4 hours of culturing. For comparison, the dose-dependent reactivity was studied for two samples of AFP of embryonal origin embrAFP and yeast rAFP (FIG. 5). It is evident that both preparations manifest an expressed cytostatic activity in respect to these cells. Similarly, in order to determine the activity of preparations on the base of AFP in vitro, any other lines of cancer cells may be used that are sensitive to the suppressive action of AFP, such as human hepatocarcinoma HepG2, breast cancer MCF-7, prostate cancer LnCap, myeloblastoma U-937 and others (Semenkova L. N., 1997, Tumor Biol. 18, 261-274; Dudich E. I., et al., 1998, Tumor Biol. 19, 30-40).


Example 9
Use of Recombinant AFP as Anticancer Preparation

Anticancer preparations on the base of rAFP and of modified forms thereof may be used for inhibition of the growth of malignant neoplasms, such as primary or metastatic cancer of the liver, blood cancer (leucosis, myeloblastoma, lymphoma), breast cancer, prostate cancer. In order to determine the sensitivity of this type of tumor cells to AFP, it is possible to use different methods both in vitro and also in vivo. The method of determining activity in vitro is described in the preceding example 8. In order to determine the oncosuppressive action of preparations on the base of AFP in vivo, models on animals may be used, for example with use of Nude mice with subcutaneously or intraperitoneally implanted human lines of cancer cells, such as Raji, HepG2, LnCap, MCF-7 and others. For example, cells of B-cellular lymphoma Raji were administered subcutaneously in an amount of 1-5×106 per mouse. Administration of the AFP and derivatives thereof was begun 7 days prior to implantation of tumor cells intraperitoneally or intravenously in an amount of 1-10 mg/kg. The physiological buffered solution (PBS) was used as a control. The size of the tumor was evaluated by daily measurements with the aid of a micrometer.









TABLE 1







Results of tests of rAFP on models of Nude line mice


implanted with cells of B-cellular lymphoma Raji










Number of
Dose of AFP
Method of



animals
per injection
administration
Result













10
1 mg
Intraperitoneally,
2 - stabilization




daily for 20 days
5 - 50% inhibition





3 - tumor did not develop


5
PBS
Intraperitoneally,
10 - 100% development




daily for 20 days
of tumor


10
0.5 mg  
Intraperitoneally,
2 - stabilization




daily for 20 days
5 - 50% inhibition





3 - tumor did not develop


10
2 mg
Intraperitoneally,
2 - stabilization




daily for 20 days
5 - 50% inhibition





3 - tumor did not develop









The method of administering preparations on the base of yeast rAFP or derivatives thereof may also comprise therein the administration of chemotherapeutic preparations simultaneously or sequentially. The following may be presented as examples of such chemotherapeutic preparations: doxorubicin, vincristine, fluorourascil, metatrexate, actinomycin D, mitomycin C, tamoxifen, flutamid, vincristine, vinblastine, cyclosporin, retinoids, carotenoids, and others. Usually, a chemotherapeutic preparation may be administered in standard doses or in suboptimum doses, below the usual therapeutic. The effect of the combined action of rAFP and doxorubicin (A) and rAFP and all-trans-Retinoic acid (tRA) is presented as an example in FIG. 6. In the case of simultaneous administration of the preparations, synergic oncosuppressive action in the case of use of suboptimum doses is observed.


Example 9
Use of Recombinant AFP for Stimulation of the Growth of Stem Cells

The primary culture of embryonal fibroblasts of the lung and human retina was obtained by treating with a 0.2% trypsin solution corresponding tissues of 5-10 week embryos obtained after legal abortions. The cells were cultured in an RPMI-1640 medium in the presence of a 10% calf fetal serum (CFS). The cytostatic activity of AFP was measured as earlier described (Semenkova L. N., 1997, Tumor Biol. 18, 261-274; Dudich E. I., et al., 1998, Tumor Biol. 19, 30-40). Cells in an amount of 4×104 in a 0.15 ml medium were intensively washed with a fresh medium and placed in each cell of a 96-lune plate, then different doses of AFP were added and cultured 24 hours. Proliferation of the cells was measured by a standard method by the inclusion of [H3]-thymidine during the last four hours of culturing.


The dosage dependence of the effect of AFP on cellular growth was also studied for the primary culture of human embryonal fibroblasts. AFP had a stimulating effect on these cells, reaching 50-90% in respect to the control (FIG. 7).


Example 10
Use of Recombinant AFP in Cosmetology

In view of the fact that AFP has the capability to stimulate the growth of stem cells and is a growth factor for embryonal cells, its possible use is proposed for the preparation of cosmetic masks, creams and lotions. rAFP may be used as an excipient for liposome, microsome and nanosome. In view of the fact that AFP is capable of binding hydrophobic ligands, in particular, fat-soluble vitamins, steroids, isoflavinoids, polyunsaturated fatty acids (Deutsch H. F., 1991, Adv. Canc. Res. 56, 253-312); Aussel C. & Masseyeff R., 1994, Biochem. Biophys. Res. Commun. 119: 1122-1127; Deutsch H. F., 1994, J. Tumor Marker Oncol. 9: 11-14), the combined use of rAFP with fat-soluble vitamins, such as derivatives of retinoids, carotenoids, tokoferol, vitamin D, with steroids such as derivatives of estrogens and androgens, is shown. Estradiol and others may be used as an example of such steroids.


REFERENCES



  • Amaim E., Ochs B., Abel K.-J. (1988) Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene. 69(2):301-15.

  • Aussel, C. & Masseyeff, R. (1994) Interaction of retinoids and bilirubin with the binding of arachidonic acid to human alpha-fetoprotein. Biochem. Biophys. Res. Commun. 119, 1122-1127.

  • Bennett, J. A., Semeniuk, D. J., Jacobson, H. I. & Murgita, R. A. (1997) Similarity between natural and recombinant human alpha-fetoprotein as inhibitors of estrogen-dependent breast cancer growth. Breast Cancer Res. Treat. 45, 169-179

  • Bennet, J. A., Zhu, S., Pagano-Mirarchi, A., Kellom, T. A. & Jacobson, H. I. (1998) α-Fetoprotein derived from a human hepatoma prevents growth of estrogen-dependent human breast cancer xenografts. Clinical Cancer Research, 4, 2877-2884.

  • Boismenu R., Semeniulc D., Murgita R. A. (1997) Purification and characterization of human and mouse recombinant alpha-fetoproteins expressed in Echerichia coli. Protein Expression and Purification. 10:10-26.

  • Chung B. H., Park K. S. (1998) A simple approach to reducing the proteolysis during the secretory production of human parathyroid hormone in Saccharomyces cerevisiae. Biotechnol. Bioeng. 57:245-249.

  • Deutsch, H. F. (1991) Chemistry and biology of x-fetoprotein. Adv. Canc. Res. 56, 253-312.

  • Deutsch H. F. (1994) The uptake of adriamycin-arachidonic acid complexes by human tumor cells in the presence of α-fetoprotein. J. Tumor Marker Oncol. 9: 11-14.

  • Dudich, E. I., Semenkova, L. N., Gorbatova, E. A., Dudich, I. V., Khromykh, L. M., Tatulov, E. B., Grechko, G. K. & Sukhikh, G. T. (1998) Growth-regulative activity of alpha-fetoprotein for different types of tumor and normnal cells. Tumor Biol. 19, 30-40.

  • Dudich E. I., Semenkova L. N., Dudich I. V., Gorbatova E. A., Tokhtamysheva, N., Tatulov E. B., Nikolaeva M. A. & Sukhikh G. T. (1999) α-Fetoprotein causes apoptosis in tumor cells via a pathway independent of CD95, TNFR1 and TNFR2 through activation of caspase-3-like proteases. Eur. J. Biochem., 266:1-13

  • Dudich, I. V., Tokhtamysheva, N., Semenkova, L., Dudich, E., Hellman, J. and Korpela, T. (1999) Isolation and structural and functional characterization of two stable peptic fragments of human alpha-fetoprotein. Biochemistry, 38: 10406-10414.

  • Ito H., Fukuda Y., Murata K., Kimura A. (1983) Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 1983, 153:163-168.

  • Hard K, Bitter W, Kamerling J P, Vliegenthart J F. (1989) O-mannosylation of recombinant human insulin-like growth factor I (IGF-I) produced in Saccharomyces cerevisiae. FEBS Lett. 248:111-4.

  • Quirk A. Y., Geisow M. J., Woodrow J. R., Burton S. J., Wood P. C., Sutton A. D., Lohnson R. A., Dodsworth N. (1989) Production of recombinant human serum albumin from Saccharomyces cerevisiae. Bitechnol. Appl. Biochem. 11: 273-287.

  • Kang H. A., Choi E. S., Hong W. K., Kim J. Y., Ko S. M., Sohn J. H., Rhee S. K. (2000) Proteolytic stability of recombinant human serum albumin secreted in the yeast Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 53: 575-582.

  • Mizejewsky G. J. (2002) Biological role of x-fetoprotein in cancer: prospects for anticancer therapy. Expert Rev. Anticancer. Ther. 2: 89-115.

  • Morinaga, T., Salcai, M., Wegmann, T. G., and Namaoki, T. (1983) Primary structures of human α-fetoprotein and its mRNA. Proc. Natl. Acad. Sci. U.S.A. 80, 4604-4608.

  • Murgita R., Recombinant human alpha-fetoprotein as an immunosuppressive agent. U.S. Pat. No. 5,965,528 C07K 14/47, 1999.

  • Murgita R., Recombinant human alpha-fetoprotein as a cell proliferative agent U.S. Pat. No. 6,627,440 C12N 005/00, 2003.

  • Murgita R., Recombinant alpha-fetoprotein for treating and diagnosing cancers U.S. Pat. No. 6,416,734, A61K 051/00, 2002.

  • Murgita R. A. Expression and purification of cloned human alpha-fetoprotein. U.S. Pat. No. 6,331,611 C07K 014/00, 2001.

  • Nishi S., Koyama Y., Sakamoto T., Soda M., Kairiyama C. B. (1988) Expression t of rat α-fetoprotein cDNA Esherichia coli and in yeast. J. Biochem. 104: 968-972.

  • Pucci, P., Siciliano, R., Maiorni, A., Marino, G., Tecce, M., F., Ceccarini, C., and Terrana, B. (1991) Biochemistry 30:5061-5066.

  • Uriel J., Laborda J., Naval J., Geuskens M (1989) Alpha-fetoprotein receptors in malignant cells. An overview; in Mizejewsky G. I., Jakobson H. I. (eds): Biological Properties of Alpha-Fetoprotein. Boca Raton, CRC Press, vol. 2:103-117.

  • Robinson A. S., Bockhaus J. A., Witthup K. D. (1996) Reduction of BiP level decreases heterologous protein secretion in Saccharomyces cerevisiae. J. Biol. Chem. 271:10017-10022.

  • Semenkova, L. N., Dudich, E. I. & Dudich, I. V. (1997) Induction of apoptosis in human hepatoma cells by alpha-fetoprotein. Tumor Biol. 18, 261-274.

  • Semenkova, L., Dudich, E., Dudich, I., Tokhtamisheva, N., Tatulov, E., Okruzhnov, Y., Garcia-Foncillas, J., Palop-Cubillo J.-A., Korpela T. (2003) Alpha-fetoprotein positively regulates cytochrome c-mediated caspase activation and apoptosome complex formation, Eur. J. Biochem. 70: 4388-4399.

  • Sleep D., Belfield G. P., Goodey A. R. (1990) The secretion of human serum albumin from the yeast Saccharomyces cerevisiae using five different leader sequences. Biotechnology 8: 42-46.

  • Shusta E. V., Raines R. T., Pluckthun A., Wittrup K. D. (1998) Increasing the secretory capacity of Saccharomyces cerevisiae for production of single-chain antibody fragment. Nature Biotechnol. 16: 773-777.

  • Tamaoki T., Morinaga T., Nishi S. (1993) Method of producing human .alpha.-fetoprotein and product produced thereby. U.S. Pat. No. 5,206,153, C07K 013/00; C12N 015/62.

  • Tsukada Y., Hibi N., Ohlcawa K., Deutsch H. F. (1994) Cytocidal effect of daunomycin unsaturated fatty acid complexes on rat tumor cell lines. J. Tumor Marker Oncol. 9: 99-103.

  • Yamashita, K., Taketa, K., Nishi, S., Fukushima K., and Ohkura T. (1993) Sugar chains of human cord serum α-fetoprotein. Cancer Res. 53, 2970-2975.

  • Yamamoto R., Sakamoto T., Nishi S., Sakai M., Morinaga T., Tamaoki T. (1990) Expression of human α-fetoprotein in yeast. Life Sciences, 46:1679-1686.


Claims
  • 1. An expression cassette of SEQ ID NO:1, comprising: a promoter region of GAL1 yeast gene; a pre-pro region of secretion of MFα1 yeast gene; a DNA sequence encoding a protein having the activity of a mature human alpha-fetoprotein, and a field of termination of transcription of a CYC1 yeast gene.
  • 2. The expression cassette according to claim 1, wherein the DNA sequence encoding a protein having the activity of a mature human alpha-fetoprotein is a synthetic gene encoding a mature human alpha-fetoprotein (SEQ ID NO: 4) or a modified form thereof having deletions, additions or replacement of one or more amino acid residues, which results in the formation of a modified human alpha-fetoprotein, the sequence of which at least 80% corresponds to the amino acid sequence of a mature human alpha-fetoprotein (SEQ ID NO: 4), with retention of the functional biological activity of a mature human alpha-protein in said product with a modified structure.
  • 3. (canceled)
  • 4. An eukaryotic producer cell, having the capability of secreting human recombinant alpha-fetoprotein by transforming it with the pKX plasmid according to claim 22.
  • 5. A producer cell strain Saccharomyces cerevisiae YBS723/pKX, having the capability of secreting human recombinant alpha-fetoprotein, deposited in the Russian Collection of Industrial Microorganisms (VKPM) under No. Y-3115.
  • 6. A method for preparing a recombinant alpha-fetoprotein having the biological activity of a mature human alpha-fetoprotein of serum origin, comprising: culturing an eukaryotic cell according to claim 4, the cell having the capability of secreting a recombinant alpha-fetoprotein into the cultural medium, and the step of isolating the recombinant alpha-fetoprotein from the cultural medium.
  • 7. The method according to claim 6, characterized in that a eukaryotic cell is a yeast cell.
  • 8. The method according to claim 7, characterized in that the yeast cell is a cell of strain Saccharomyces cerevisiae YBS723/pKX, deposited in the Russian Collection of Industrial Microorganisms (VKPM) under No. Y-3115 and having the capability of secreting recombinant alpha-fetoprotein.
  • 9. The method according to claim 8, characterized in that culturing is carried out at a temperature of 23-33° C. in a medium comprising: glucose—2%, glycerine—1.5%, yeast extract—1%, peptone—2%, distilled water; with retention of the pH of the medium at 4.5-7.0 by additional buffering and adding soluble oxygen to pO>20%.
  • 10. A recombinant alpha-fetoprotein, prepared by the method according to claim 6, having the properties of a mature human serum AFP, the properties determined according to an immunological reaction and to its capability of inhibiting the growth of B-cellular Raji lymphoma cells in vitro at a level not lower than 10% of the activity of a mature human serum AFP.
  • 11. A pharmaceutical composition inhibiting the growth of tumor cells, comprising a recombinant alpha-fetoprotein according to claim 10 and pharmaceutically acceptable carriers and excipients.
  • 12. A synergistic composition inhibiting growth of tumor cells, comprising a recombinant alpha-fetoprotein according to claim 10 and chemo-therapeutic preparations, such as: doxorubicin, vincristine, fluorouracil, metatrexate, actinomycin D, mitomycin C, tamoxifen, flutamid, vincristine, vinblastine, cyclosporin C, derivatives of retinoic acid, carotenoids, steroid hormones and pharmaceutically acceptable carriers and excipients.
  • 13. (canceled)
  • 14. A synergistic composition having immunosuppressive and immunomodulating action, comprising a recombinant alpha-fetoprotein according to claim 10 and cyclosporin C and pharmaceutically acceptable carriers and excipients.
  • 15. A method for treating autoimmune diseases and correcting the immune status, comprising administering to a patient in need thereof an effective amount of a recombinant alpha-fetoprotein according to claim 10 with pharmaceutically acceptable carriers and excipients or administering a composition according to claim 14.
  • 16. A pharmaceutical composition stimulating the growth of stem cells, the composition comprising a recombinant alpha-fetoprotein according to claim 10 and pharmaceutically acceptable carriers and excipients.
  • 17. A synergic composition stimulating growth of stem cells, the composition comprising a recombinant alpha-fetoprotein according to claim 10 and derivatives of vitamins A, E, D, antioxidants, steroid hormones, isoflavones of vegetative origin and pharmaceutically acceptable carriers and excipients.
  • 18-19. (canceled)
  • 20. A cosmetic composition for rejuvenating skin and preventing aging of the skin, comprising a recombinant alpha-fetoprotein according to claim 10, carriers and excipients acceptable in cosmetology and, optionally, derivatives of vitamins A, E, D, antioxidants, steroid hormones, isoflavones of vegetative origin.
  • 21. A method of using the cosmetic composition according to claim 20 for rejuvenating the skin and preventing aging of the skin, comprising applying said composition onto the skin of an individual.
  • 22. A recombinant pKX plasmid comprising: the expression cassette according to claim 1; a fragment of the bacterial plasmid pUC18; a region of initiation of replication of a 2-μm yeast plasmid; a KAR2 gene providing correct assembly of the protein and secretion of the desired product into a culture medium; a PD11 gene providing the correct formation of disulfyl bonds; a selective URA3 and a selective PGK1 yeast marker.
  • 23. A method for treating cancer or preventing the development of cancer, comprising administering to a patient in need thereof an effective amount of a recombinant alpha-fetoprotein according to claim 10.
  • 24. A method for treating cancer or preventing the development of cancer, comprising administering to a patient in need thereof an effective amount of a pharmaceutical composition according to claim 11.
  • 25. A method for treating cancer or preventing the development of cancer, comprising administering to a patient in need thereof an effective amount of a synergistic composition according to claim 12.
  • 26. A method for stimulating the growth of stem cells in vitro, comprising acting on cells with an effective amount of recombinant alpha-fetoprotein according to claim 10.
  • 27. A method for stimulating the growth of stem cells in vitro, comprising acting on cells with an effective amount of a pharmaceutical composition according to claim 16.
  • 28. A method for stimulating the growth of stem cells in vitro, comprising acting on cells with an effective amount to a synergic composition according to claim 12.
  • 29. A method for stimulating the growth of stem cells in vivo, comprising administering to a patient in need thereof an effective amount of a recombinant alpha-fetoprotein according to claim 10.
  • 30. A method for stimulating the growth of stem cells in vivo, comprising administering to a patient in need thereof an effective amount of a pharmaceutical composition according to claim 16.
  • 31. A method for stimulating the growth of stern cells in vivo, comprising administering to a patient in need thereof an effective amount of a synergic composition according to claim 17.
Priority Claims (1)
Number Date Country Kind
200400907 Jul 2004 EA regional
PCT Information
Filing Document Filing Date Country Kind 371c Date
PCT/RU2005/000369 7/7/2005 WO 00 1/12/2007