Recombinant DNA coding for a novel protein having .beta.-1,3-glucanase activity, bacteria containing this DNA, transformed plant cells and plants

Abstract

The invention provides a protein, isolated from soybean, having .beta.-1,3-glucanase activity and comprising the amino acid sequence of SEQ ID No: 1. DNA constructs encoding said protein, and transformed plants expressing the protein, are also provided.

Description

BACKGROUND OF THE INVENTION

The invention relates to a recombinant DNA coding for a novel protein having .beta.-1,3-glucanase activity, or for a precursor of this protein, to a bacterium containing this recombinant DNA, to a plant cell, plant or plant part, especially a plant seed, transformed by this recombinant DNA, as well as to this novel protein and to a method for preparing it.

Crop plants are known to be subjected to attack by-parasites such as phytopathogenic fungi, which are responsible for substantial harvest losses. The .main means at present for controlling these fungi lies in the use of chemical substances having fungicidal activity. It is now known that plants react naturally to such attack by various defence mechanisms, which are unfortunately, in general, triggered too late and at too low an intensity to be sufficiently effective.

One of these mechanisms comprises the induction of an enzyme known as .beta.-1,3-glucanase E.C.3.2.1.39 (Kombrink et al., 1988, Pr. Ntl. Acad. Sci. USA, 85,982-986 and Pegg et al., 1981, Physiol. Plant. Pathol. 19,371-382). This induction can be triggered artificially through the effect of elicitors, that is to say compounds of biological origin capable of inducing in a healthy plant the defence reactions which it deploys naturally during an infection by pathogenic agents, or during a hormonal imbalance caused by auxin, cytokinins or ethylene (Abeles et al., 1971, Plant Physiol. 47,129-134 and de Loose et al., 1988, Gene, 70,13-23).

.beta.-1,3-glucans are linear polysaccharide polymers consisting of glucose units linked via .beta.-(1.fwdarw.3) linkages, sometimes possessing .beta.-(1.fwdarw.4) or .beta.-(1.fwdarw.6) type branching (Farka 1982, in "Fungal protoplasts", Peberdy and Ferencry, published by Dekker Inc.). These polysaccharides constitute a typical component of the skeleton of the wall of most fungi, and in particular phytopathogenic fungi. .beta.-1,3-glucanases are capable of degrading them by fragmentation of the .beta.-1,3-glucan chains. Most known plant .beta.-1,3-glucanases are of the endo type.

It is known, moreover, that recent progress in so-called recombinant DNA technology and in the transformation of plant cells, as well as in the regeneration of whole plants from the latter, enable a gene of interest to be introduced into plant cells, a plant or a plant part so as to obtain an advantageous phenotype.

SUMMARY OF THE INVENTION

DNA sequences coding for several plant .beta.-1,3-glucanases, in particular a Nicotiana plumbaginifolia .beta.-1,3-glucanase (De Loose et al., 1988, Gene, 70,13-23) and a soybean .beta.-1,3-glucanase (Takeuchi et al., 1990, Plant Physiol., 93,673-682), have been isolated, cloned and determined. Patent Application EP-A-0,353,191 describes the isolation and cloning of different fragments of complementary DNA, the assembling of which enables the complementary DNA sequence coding for a tobacco .beta.-1,3-glucanase to be deduced, as well as of the genomic DNA sequence coding for this enzyme. The document EP-0,392,225 discloses, in particular, the construction of a chimeric gene coding for this tobacco .beta.-1,3-glucanase, the transformation of tobacco with the latter and the verification, by Western blot and visualisation using polyclonal antibodies, of the over-expression of this endogenous protein in the transformed plants. This patent application does not show that the recombinant tobacco .beta.-1,3-glucanase is biologically active, nor a fortiori that it confers a resistance of the said transformed plants to pathogenic agents.

It is known, moreover, that .beta.-1,3-glucanases such as, for example, Bacillus subtilis .beta.-1,3-glucanase are useful enzymes in the conversion of biomass, in particular in some sectors of the papermaking industry and in the agri-foodstuffs industry, especially brewing (Meaden, 1986, Brewers Guardian, 115, 7 and MacQueen, October 1987, New Scientist, 66).

It is known, lastly, that many recombinant proteins can be produced by eukaryotic cells and bacteria, following introduction into these of genes coding for the said proteins using conventional genetic engineering techniques.

The present invention relates to a novel recombinant DNA, characterised in that it codes for a protein having .beta.-1,3-glucanase activity or for a precursor thereof, this protein having .beta.-1,3-glucanase activity comprising the following amino acid sequence (a.sub.1) (SEQ ID NO:1):

______________________________________Ile Gly Val Cys Tyr Gly Met Leu Gly Asn Asn Leu Pro SerAla Asn Asp Val Ile Gly Leu Tyr Arg Ser Asn Asn Ile LysArg Met Arg Leu Tyr Asp Pro Asn Gln Ala Ala Leu Glu AlaLeu Arg Asn Ser Gly Ile Glu Leu Ile Leu Gly Val Pro AsnSer Asp Leu Gln Gly Leu Ala Thr Asn Pro Asp Thr Ser ArgGln Trp Val Gln Lys Asn Val Leu Asn Phe Trp Pro Ser ValLys Ile Lys Tyr Val Ala Val Gly Asn Glu Val Ser Pro ValGly Gly Ser Ser Ser Val Ala Gln Tyr Val Leu Pro Ala IleGln Asn Val Tyr Gln Ala Ile Arg Ala Gln Gly Leu His AspGln Ile Lys Val Ser Thr Ser Ile Asp Met Thr Leu Ile GlyAsn Ser Phe Pro Pro Ser Gln Gly Ser Phe Arg Gly Asp ValArg Ser Tyr Leu Asp Pro Ile Ile Gly Tyr Leu Val Tyr AlaAsn Ala Pro Leu Leu Val Asn Val Tyr Pro Tyr Phe Ser TyrThr Gly Asn Pro Arg Asp Ile Ser Leu Pro Tyr Ala Leu PheThr Ala Pro Asn Val Val Val Trp Asp Gly Gln Tyr Gly TyrGln Asn Leu Phe Asp Ala Met Leu Asp Ser Val His Ala AlaIle Asp Asn Thr Lys Ile Gly Tyr Val Glu Val Val Val SerGlu Ser Gly Trp Pro Ser Asp Gly Gly Phe Ala Ala Thr TyrAsp Asn Ala Arg Val Tyr Leu Asp Asn Leu Val Arg Arg AlaAsn Arg Gly Ser Pro Arg Arg Pro Ser Lys Pro Thr Glu ThrTyr Ile Phe Ala Met Phe Asp Glu Asn Gln Lys Asn Pro GluIle Glu Lys His Phe Gly Leu Phe Asn Pro Asn Lys Gln LysLys______________________________________ or a sequence possessing a high degree of homology with the sequence (a.sub.1), (SEQ ID NO:1).

A high degree of homology means here a homology (ratio of identical amino acids to the total number of amino acids) of at least 80%, and preferably at least 90%, of the amino acid sequences when they are aligned on the basis of maximal homology according to the optimal sequence alignment method of Needleman and Wunsch, 1970, J. Mol. Biol., 48, 443-453. This method is used, in particular, in the University of Wisconsin's UWGCG software : Devereux et al., 1984, Nucl. Ac. Res., 12, 8711-8721--GAP option.

The already known peptide sequence closest to that of the sequence (a.sub.1) (SEQ ID NO.1): of 307 amino acids is that of the protein of 369 amino acids deduced from the complementary DNA of a Nicotiana plumbaginifolia .beta.-1,3-glucanase SEQ ID NO.12) (see Swissprot data bank ref. Gus$ Nipl. and De Loose et al., 1988, Gene, 70, 13-23). A comparison of these two sequences using the method of Needleman and Wunsch, 1970, J. Mol. Biol., 48,443-453, shows that 213 amino acids out of 307 are identical, equivalent to an approximately 69% homology. This algorithmic method, which considers all possible alignments and creates an alignment, shown in FIGS. 7A and 7B in which the largest possible number of identical amino acids are paired and the number of holes in the aligned sequences is minimal, is used, in particular, in the University of Wisconsin's UWGCG software: Devereux et al., 1984, Nucl. Ac. Res., 12, 8711-8721--GAP option.

This novel recombinant DNA may be used for the expression of this protein having .beta.-1,3-glucanase activity, either to confer an enhanced resistance to pathogenic agents on a plant or plant part expressing the protein, or to produce this protein using eukaryotic cells, in particular ascomycetes such as yeast or filamentous fungi, for example Cryphonectria parasitica, or plant cells, or prokaryotic microorganisms such as, for example, Escherichia coli.

This recombinant DNA can contain, immediately downstream of the nucleotide sequence coding for the amino acid sequence (a.sub.1) (SEQ ID NO1), the nucleotide sequence coding for the following amino acid sequence (a.sub.4) (SEQ ID NO:4):

______________________________________Tyr Pro Phe Gly Phe Gly Gly Lys Arg Leu Gly Lys Val ValIle Asp Asp Phe Asn Ala Thr Thr Ser Ile Lys Ser Asp Val______________________________________ truncated in its carboxy-terminal portion by 0 to 27 amino acids.

Advantageously, this recombinant DNA comprises immediately upstream of the nucleotide sequence coding for the amino acid sequence (a.sub.1) (SEQ ID NO:1), a codon for Gln.

An especially high valued DNA such as defined above is that which codes for a protein having .beta.-1,3-glucanase activity or a precursor thereof, and which comprises the following sequence (a.sub.5) (SEQ ID NO:3):

______________________________________GlnIle Gly Val Cys Tyr Gly Met Leu Gly Asn Asn Leu Pro SerAla Asn Asp Val Ile Gly Leu Tyr Arg Ser Asn Asn Ile LysArg Met Arg Leu Tyr Asp Pro Asn Gln Ala Ala Leu Glu AlaLeu Arg Asn Ser Gly Ile Glu Leu Ile Leu Gly Val Pro AsnSer Asp Leu Gln Gly Leu Ala Thr Asn Pro Asp Thr Ser ArgGln Trp Val Gln Lys Asn Val Leu Asn Phe Trp Pro Ser ValLys Ile Lys Tyr Val Ala Val Gly Asn Glu Val Ser Pro ValGly Gly Ser Ser Ser Val Ala Gln Tyr Val Leu Pro Ala IleGln Asn Val Tyr Gln Ala Ile Arg Ala Gln Gly Leu His AspGln Ile Lys Val Ser Thr Ser Ile Asp Met Thr Leu Ile GlyAsn Ser Phe Pro Pro Ser Gln Gly Ser Phe Arg Gly Asp ValArg Ser Tyr Leu Asp Pro Ile Ile Gly Tyr Leu Val Tyr AlaAsn Ala Pro Leu Leu Val Asn Val Tyr Pro Tyr Phe Ser TyrThr Gly Asn Pro Arg Asp Ile Ser Leu Pro Tyr Ala Leu PheThr Ala Pro Asn Val Val Val Trp Asp Gly Gln Tyr Gly TyrGln Asn Leu Phe Asp Ala Met Leu Asp Ser Val His Ala AlaIle Asp Asn Thr Lys Ile Gly Tyr Val Glu Val Val Val SerGlu Ser Gly Trp Pro Ser Asp Gly Gly Phe Ala Ala Thr TyrAsp Asn Ala Arg Val Tyr Leu Asp Asn Leu Val Arg Arg AlaAsn Arg Gly Ser Pro Arg Arg Pro Ser Lys Pro Thr Glu ThrTyr Ile Phe Ala Met Phe Asp Glu Asn Gln Lys Asn Pro GluIle Glu Lys His Phe Gly Leu Phe Asn Pro Asn Lys Gln LysLys Tyr Pro Phe Gly Phe Gly Gly Lys Arg Leu Gly Lys ValVal Ile Asp Asp Phe Asn Ala Thr Thr Ser Ile Lys Ser AspVal______________________________________

This recombinant DNA preferably contains, upstream of the sequence coding for the sequence (a.sub.1) (SEQ ID NO:1) optionally preceded by a codon for Gln, a signal sequence, chosen in accordance with the host cell, which has the function of enabling the protein to be exported from the cytoplasm.

For an expression in prokaryotic microorganisms such as, for example, Escherichia coli, this signal sequence can be either a sequence derived from a sequence coding for a natural precursor of a protein exported by a prokaryotic microorganism, for example the OmpA signal peptide (Ghrayeb et al., 1984, EMBO Journal, 3, 2437-2442) or an alkaline phosphatase precursor (J. Bact. 1983, 154, 366-3747), or a non-endogenous sequence originating from a sequence coding for a eukaryotic precursor (for example the signal peptide of one of the natural precursors of human growth hormone), or a sequence coding for a synthetic signal peptide (for example that described in French Patent Application No. 2,636,643, of sequence (SEQ ID NO:4):

______________________________________Met Ala Pro Ser Gly Lys Ser Thr Leu Leu Leu Leu Phe LeuLeu Leu Cys Leu Pro Ser Trp Asn Ala Gly Ala.______________________________________

For an expression in eukaryotic cells such as ascomycetes, for example Saccharomyces cerevisiae yeast or the filamentous fungus Cryphonectria parasitica, this signal sequence is preferably a sequence derived from a sequence coding for a natural precursor of a protein secreted by these cells, for example, for yeast, the invertase precursor (Patent Application EP-0,123,298) or the precursor of the prepro sequence of the alpha pheromone (Patent Application DK 2484/84), or for Cryphonectria parasitica, the precursor of the prepro sequence of endothiapepsin (described in French patent application no. 2 666 590), of sequence (SEQ ID NO: 5):

______________________________________Met Ser Ser Pro Leu Lys Asn Ala Leu Val Thr Ala Met LeuAla Gly Gly Ala Leu Ser Ser Pro Thr Lys Gln His Val GlyIle Pro Val Asn Ala Ser Pro Glu Val Gly Pro Gly Lys TyrSer Phe Lys Gln Val Arg Asn Pro Asn Tyr Lys Phe Asn GlyPro Leu Ser Val Lys Lys Thr Tyr Leu Lys Tyr Gly Val ProIle Pro Ala Trp Leu Glu Asp Ala Val Gln Asn Ser Thr SerGly Leu Ala Glu Arg______________________________________

For an expression in plant cells, either a sequence coding for the signal peptide of a plant cell protein known to be exported, for example the following sequence described in French patent application no. 2 665 177 (SEQ ID NO:6):

______________________________________Met Arg Arg Thr Ser Lys Leu Thr Thr Phe Ser LeuLeu Phe Ser Leu Val Leu Leu Ser Ala Ala Leu Ala______________________________________ or a signal sequence coding for the signal peptide of the following sequence (a.sub.2) (SEQ ID NO:7): ______________________________________Met Pro Ser Leu Phe Ala Arg Asn Gln Arg Phe Ser LeuAla Thr Leu Leu Leu Leu Leu Glu Leu Leu Thr Gly Asn LeuArg Met Ala Asp Ala______________________________________ is used as a signal sequence.

The amino acid sequences (a.sub.1), (a.sub.2) and (a.sub.4), (SEQ ID NOS:1, 7 and 2, respectively) can, for example, be encoded by the nucleotide sequences (Na.sub.1) (SEQ ID NO:8), (Na.sub.2) and (Na.sub.4) below:

__________________________________________________________________________(Na.sub.1):ATTGGTGTGT GTTATGGCAT GCTGGGCAAC AATCTACCGT CAGCAAACGATGTTATAGGT CTTTATAGAT CAAATAACAT AAAGAGAATG AGACTCTATGATCCTAATCA AGCTGCTCTA GAAGCACTTA GAAATTCTGG CATTGAACTCATTCTTGGGG TGCCAAACTC TGACCTTCAA GGCCTTGCCA CCAATCCTGACACTTCTCGT CAATGGGTGC AAAAAAACGT GTTGAACTTT TGGCCTAGTGTCAAAATCAA GTACGTGGCA GTTGGAAATG AAGTGAGTCC CGTTGGAGGCTCTTCTTCGG TAGCCCAATA TGTTCTACCT GCCATCCAAA ATGTATACCGAGCAATAAGA GCTCAAGGCC TTCATGATCA AATCAAGGTT TCAACATCTATTGACATGAC CCTAATAGGA AACTCTTTCC CTCCATCGCA AGGTTCCTTCAGGGGTGATG TGAGATCATA CCTAGATCCC ATAATTGGGT ACTTGGTATATGCAAATGCA CCATTACTAG TCAATGTGTA CCCTTATTTT AGTTACACTGGTAACCCCCG TGACATATCA CTTCCCTATG CTCTTTTCAC AGCACCAAATGTTGTGGTAT GGGATGGTCA ATATGGGTAC CAAAATTTGT TTGATGCTATGTTGGATTCA GTACATGCAG CCATTGATAA CACTAAGATT GGTTATGTGGAGGTTGTTGT ATCCGAGAGT GGGTGGCCAT CAGATGGAGG ATTTGCTGCCACTTATGACA ACGCACGCGT GTACTTAGAC AATTTGGTTC GTCGTGCTAATAGAGGAAGC CCAAGAAGGC CTTCGAAGCC CACTGAGACT TATATATTTGCCATGTTCGA TGAAAATCAA AAAAATCCAG AGATAGAGAA ACATTTTGGGCTCTTCAATC CCAACAAACA AAAAAAA(Na.sub.2) (SEQ ID NO: 9):ATGCCTTCTC TCTTCGCTAG AAACCAGAGG TTCTCATTGG CTACTC.TCCTGCTTCTTCTG GAACTATTGA CAGGAAACCT TCGCATGGCA GATGCT(Na.sub.4) (SEQ ID NO: 10):TACCCATTTG GGTTTGGAGG AAAGAGGCTA GGGAAAGTTG TTATTGACGACTTCAATGCA ACAACTTCCA TTAAGAGTGA TGTG__________________________________________________________________________

The invention also relates to a unit for expression of the recombinant DNA defined above, advantageously carried out by a vector, termed expression vector.

For an expression in procaryotic microorganisms, especially in Escherichia coli, the recombinant DNA must be inserted in an expression unit containing, in particular, an effective promoter, followed by a ribosome binding site upstream of the gene to be expressed, as well as an effective transcription stop sequence downstream of the gene to be expressed. This unit must also contain a selection marker or be introduced into the host cell at the same time as a unit for expression of a selection marker (for example using an expression vector which carries both of these units). All these sequences must be chosen in accordance with the host cell.

For an expression in eukaryotic cells such as ascomycetes, the expression unit according to the invention comprises the recombinant DNA defined above with the means needed for its expression.

For an expression in ascomycete cells such as yeast, for example Saccharomyces cerevisiae, it is appropriate to insert the recombinant DNA between, on the one hand sequences recognised as an effective promoter, and on the other hand a transcription terminator. The expression unit carries a selection marker or is introduced into the host cell at the same time as a selection marker. Preferably, this selection marker is an auxotrophic marker (which complements a mutation of the recipient cells) which permits the selection of cells which have integrated the recombinant DNA in a high copy number, either into their genome or into a multicopy vector. For an expression in ascomycete cells such as those of filamentous fungi, for example those of the genera Aspergillus, Neurospora, Podospora, Trichoderma or Cryphonectria, the expression unit according to the invention carries the recombinant DNA defined above with the means needed for its expression, and optionally a selection marker and/or telomeric sequences. It is, in effect, possible to select transformants which have integrated a DNA of interest using a selection marker located either on the same unit as the DNA of interest or on another unit, these two units then being introduced by cotransformation. The recombinant DNA of the invention may be either integrated in the genome of the filamentous fungi, or preserved in extrachromosomal form by means of sequences enabling this DNA to be replicated and split.

For an expression in plant cells, it is appropriate to insert the recombinant DNA defined above between a promoter and a terminator which are effective in plants.

The promoter is preferably a strong constitutive promoter, for example the 35S promoter of the cauliflower mosaic virus, or a promoter controlling the tissue- or organ-specific expression, such as the promoter of the small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase, which is expressed preferentially in the leaves and most especially the mesophyll tissues (Kuhlemeier et al., 1987, Ann Rev Plant Physiol 38: 221-257). It is also possible to use a specific promoter controlling, for example, an expression in the seeds or during a precise stage of development of the plant, or a promoter which is inducible following a thermal shock, a wound or interaction between the plant and parasites (Kuhlemeier et al., 1987, reference cited above), if an expression of recombinant DNA is desired in these situations.

The terminator sequence containing polyadenylation sites which can be isolated from plant genes or from genes which are expressed in plants, such as, for example, the nopaline synthase terminator Agrobacterium tumefaciens, is used.

The invention also relates to a bacterium, for example of the species E. coli, which contains the recombinant DNA defined above with the means needed for its replication and its expression. This bacterium may be used in the preparation of a protein having .beta.-1,3-glucanase activity.

The invention also relates to a bacterium, for example of the species E. coli, which contains the recombinant DNA defined above with the means enabling it to be replicated, which bacterium may hence be used for the cloning of this recombinant DNA, and also to a bacterium capable of infecting a plant with transfer of genetic material, for example of one of the species Agrobacterium rhizogenes and Agrobacterium tumefaciens, which contains this DNA in a context enabling it to be replicated and may hence be used for transforming plant cells. The transformation of plant cells with the above recombinant DNA may also be performed by another biological method such as the pollen tube method (Zhong-xun Luo et al., Plant Molec. Biol. Rep., 1988, 6, 165-176) and the direct transformation of germinating seeds (Toepfer R. et al., 1989, The Plant Cell., 1, 133-139), or by a physical method such as the use of polyethylene glycol, electroporation (Chistou P. et al., 1987, Proc. Ntl. Acad. Sci. USA, 84, 3662-3699) and bombardment using microprojectiles (Klein T. M. et al., 1988, Proc. Ntl. Acad. Sci. USA, 85, 8502-8505).

The invention also relates to a plant cell, characterised in that it is transformed by the recombinant DNA defined above with the means needed for its expression. This plant cell can originate from a major crop species such as, for example, maize, soybean, beet, wheat, barley, poppy, rape, sunflower, alfafa and sorghum, a floral species such as rose, carnation and gerbera or a culinary species such as carrot, tomato, lettuce, chicory, pepper, melon and cabbage. Especially highly valued species are Brassica napus rape, Helianthus annuus sunflower and Nicotiana tabacum tobacco.

The step of transformation which involves one or a few cells is followed by a step of multiplication of these transformed cells so as to obtain calluses, which can give rise to transformed plants by processes of organogenesis or embryogenesis.

The invention hence also relates to a plant or plant part, characterised in that it contains the recombinant DNA defined above with the means needed for its expression. An especially highly valued plant part is the part capable of forming a complete new plant, in particular after sowing, burying in the ground or transplanting, or of producing seeds. Such a plant part is, for example, a grain, a mature fertilised ovule, a seed, a cutting, a runner, and the like. These plants can be any one of the above species, and more especially of the species Nicotiana tabacum, Helianthus annuus and Brassica napus.

The invention also relates to a method for obtaining plants resistant to parasites, such as phytopathogenic fungi, which comprises a step of transformation of plant cells with this recombinant DNA, followed by a step of multiplication of the transformed cells and a step of regeneration of the plants.

Preferably, the step of transformation of the plant cells is performed in vitro using an agrobacterium (that is to say a bacterium of the genus Agrobacterium) which has integrated recombinant DNA of interest.

The invention also relates to plants resistant to pathogenic agents, which are capable of being obtained using the method defined above.

The invention also relates to the use of a plant containing the recombinant DNA defined above with the means needed for its expression, as a parent in a selection programme for creating new plant varieties.

The invention also relates to a novel protein having .beta.-1,3-glucanase activity, which comprises the sequence (a.sub.1) (SEQ ID NO:1) and optionally, immediately downstream of the sequence (a.sub.1), the sequence (a.sub.4) (SEQ ID NO:2) truncated in its carboxy-terminal portion by 0 to 27 amino acids, and to a novel protein comprising the sequence (a.sub.5) (SEQ ID NO:3).

This protein preferably possesses an apparent molecular mass of 36.+-.3, 37.+-.3 or 39.+-.3 kDa.

This protein is of interest as an enzyme for conversion of biomass which contains .beta.-1,3-glucans, in particular in some sectors of the papermaking industry and in the agri-foodstuffs industry, especially brewing.

The invention also relates to a method for preparing this protein, which comprises the culturing of bacteria, plant cells, plant calluses, plants or plant parts containing the recombinant DNA defined above, lysis thereof and isolation and purification of this protein.

A better understanding of the invention will be gained from the description below, divided into sections, which comprises experimental results and a discussion of the latter. Some of these sections relate to experiments performed with the object of carrying out the invention, and others to examples of embodiment of the invention which are naturally given purely by way of illustration.

A large part of the collective techniques below, which are well known to a person skilled in the art, is described in detail in the work by Sambrook et al.: "Molecular cloning: a Laboratory manual" published in 1989 by Cold Spring Harbor Press editions, New York (2nd edition).

BRIEF DESCRIPTION OF THE DRAWINGS

A better understanding of the description below will be gained by reference to FIGS. 1 to 7.

FIG. 1 shows a restriction map of the HindIII-EcoRI fragment contained in plasmid pBR 1310 and containing the complementary DNA coding for soybean .beta.-1,3-glucanase.

FIGS. 2A-2D show the nucleotide sequence (SEQ ID NO:11) of the HindIII-HindIII insert, part of the complementary DNA of soybean .beta.-1,3-glucanase, the restriction sites used for cloning in M13mp19 and for the subsequent constructions being indicated by arrows, as well as the peptide sequence (SEQ ID NO:12) deduced from this complementary DNA.

FIGS. 3A-3D show the nucleotide sequence (SEQ ID NO:13) of the HindIII-HindIII fragment of the complementary DNA of soybean .beta.-1,3-glucanase after mutagenesis (at the end of section 6c), the restriction sites used for cloning in M13mp19 and for the subsequent constructions being indicated by arrows, as well as the peptide sequence of the protein translated.

FIGS. 4A-4C show the nucleotide sequence (SEQ ID NO:15) of the NdeI-HindIII fragment of the coding portion of plasmid pBR59, an expression plasmid in E. coli, flanked by NdeI and HindIII restriction sites, and the peptide sequence (SEQ ID NO:16): of the protein translated.

FIGS. 5A-5E show the nucleotide sequence (SEQ ID NO:17) of the complete recombinant gene and the peptide sequence of (SEQ ID NO:18) of the protein translated.

FIGS. 6A-6B show the peptide sequence (SEQ ID NO:25) of the common portion of the proteins translated in E, coli and in tobacco.

FIGS. 7A and 7B show an alignment, on the basis of the method of Needleman and Wunsch, 1970, J. Mol. Biol. 48, 443-453, of the peptide sequence (SEQ ID NO:12) deduced from the complementary DNA of soybean .beta.-1,3-glucanase (see FIGS. 2A-2D) and the closest known peptide sequence (SEQ ID NO:26), that deduced from the complementary DNA of Nicotiana plumbaginifolia .beta.-1,3-glucanase (Swissprot data bank ref. Gub$-Nipl).

DETAILED DESCRIPTION OF THE INVENTION

Section1: Preparation of polyclonal antibodies against tobacco .beta.-1,3-glucanase a) Purification of tobacco .beta.-1,3-glucanase.

A tobacco .beta.-1,3-glucanase was purified to homogeneity from tobacco calluses as described below. Tobacco calluses were cultured in vitro on a Murashige and Skoog medium (Murashige T. and Skoog F., 1962, Physiol. Plant., 15, 473-497). Cell extracts are obtained by grinding the plant material in a 50 mM Tris-HCl buffer solution, pH 8.4, containing 15 mM .beta.-mercaptoethanol and 5% of polyvinylpyrrolidone.

The protein is purified from this extract by ammonium sulphate precipitation, liquid chromatography on a cation exchange column based on synthetic polymer and exclusion chromatography (molecular sieving) on a crosslinked agarose, according to the protocol described below.

Step 1:

The protein extract is treated with ammonium sulphate (43% saturation). The proteins which have precipitated are collected by centrifugation (15,000 g for 30 min), solubilised in a buffer solution (100 mM ammonium acetate, pH 5.2) and dialysed overnight at 4.degree. C. against a 100 mM ammonium acetate buffer solution, pH 5.2.

Immediately before proceeding, the acetate concentration of the buffer solution of the protein extract is brought to 10 mM by passage through ready-to-use minicolumns (Pharmacia PD-10).

Step 2:

The protein extract is then purified by ion exchange chromatography using a column based on synthetic polymer (Pharmacia Mono-S column) according to the Pharmacia FPLC technique.

The extract is applied to a Mono-S column equilibrated with a 10 mM ammonium acetate buffer, pH 5.2. The proteins retained on the column are eluted with a linear gradient from 10 to 500 mM ammonium acetate.

At each step, the .beta.-1,3-glucanase is identified by its molecular weight (polyacrylamide gel electrophoresis in the presence Of SDS--visualisation with silver), and its activity is measured by a colorimetric method (see section 8 below) using laminarin (.beta.-1,3-glucan extracted from Laminaria digitataz--Sigma--ref. L9634) as a substrate.

b) Preparation of polyclonal antibodies.

Rabbits were then injected with 25 .mu.g of tobacco .beta.-1,3-glucanase in 500 .mu.l of Freund's complete adjuvant. Three booster injections of 25 .mu.g in Freund's incomplete adjuvant (500 .mu.l) were carried out at 3-week intervals. The immune serum was drawn 3 weeks after the final injection.

This immune serum recognises tobacco .beta.-1,3-glucanase; it also recognises soybean .beta.-1,3-glucanase. It was, in effect, verified that it enables the latter protein to be visualised by the Western blot technique (described in section 13 below) from an extract of total soybean (Glycine max cv Mandarin) proteins.

Section 2: Construction of a phage library of complementary DNA from messenger RNAs of soybean cell cultures. a) Preparation of messenger RNAs of soybean cells.

The total RNA of 5-day-old soybean cells (Glycine max cv Mandarin), cultured in vitro in the absence of auxin according to the method described by Leguay et al., 1987, Develop. Genetics 8: 351-364, was extracted according to the method described by Jouanneau et al., 1984 Plant Physiol 74; 663-668, summarised below. The cells, washed beforehand in saline solution, are ground in liquid nitrogen; the homogenate is then extracted with a mixture of redistilled phenol and chloroform. After an ethanol precipitation step, the total RNA is dissolved in a solution buffered to pH 7.6.

The poly(A).sup.+ fraction of the messenger RNA (mRNA) was isolated after 2 cycles of affinity chromatography on an oligo(dT)-cellulose column as described in Sambrook et al., ("Molecular cloning: A Laboratory manual", second edition, Cold Spring Harbor Laboratory 1989). Quantification of the messenger RNAs is carried out by spectrophotometry according to a protocol well known to a person skilled in the art.

b) Synthesis of complementary DNAs

Complementary DNAs (cDNAs) were synthesised according to the method described by Gubler and Hoffman, 1983 (Gene, 25: 263-269), which method favours the synthesis and cloning of complete cDNAs: 7 .mu.g of mRNA were treated in this manner for the manufacture of the first strand of cDNA using the Promega "Protoclone GT system" kit (ref. P3010).

c) Cloning of complementary DNAs.

The synthesised double-stranded cDNA is then methylated using EcoRI methylase under the conditions described in the reference work by Sambrook et al. (op. cit.). This enzyme enables the possible EcoRI sites of the cDNA to be protected against cleavage by the endonuclease EcoRI, this protection disappearing for the replicates of the cDNA (which are not methylated).

Synthetic EcoRI linkers (double-stranded DNA fragments containing the EcoRI site) are then added by ligation to the ends of the cDNA. After cleavage with the endonuclease EcoRI and removal of the linkers by chromatography on a column of G-50 molecular sieve (Pharmacia), the cDNA is ligated using T4 DNA ligase in phage lambda gt11, a cloning and expression vector described by Huynh et al., "DNA cloning: a practical approach" IRL Press, D. M. Glover 1985, p. 49, according to the Promega protocol (ref. T3011) "lambda gt11 system", the phage DNA being opened beforehand with the restriction endonuclease EcoRI and dephosphorylated. Aliquot portions of the ligation medium are then packaged in phage particles using the kit marketed by Amersham ("In vitro packaging system for lambda DNA", ref. N334).

The number of recombinants is then estimated by counting the lytic plaques obtained on a bacterial lawn of E. coli strain Y1090 (Sambrook et al., ref. above, op. cit.). Approximately 10.sup.6 clones were obtained. The plating out of an aliquot portion of the phage suspension on a bacterial lawn in the presence of X-gal (5-bromo-4-chloro-3-indolyl .beta.-D-galactoside) and isopropyl .beta.-D-thiogalactoside (IPTG), according to the technique described by Huynh et al., ref. above, enabled it to be determined that 81% of these phages integrated a soybean cDNA.

3: Section Immunological screening of the phage library of complementary DNA constructed from soybean cell messenger RNAs.

The production of a library in the vector lambda gt11 makes it possible to carry out the expression of the cloned cDNAs, that is to say to synthesise the proteins encoded by the messenger RNAs which were used for constructing this library. This synthesis takes place after induction with IPTG (isopropyl .beta.-D-thiogalactoside); the synthesised proteins can then be recognised by the antibodies obtained against tobacco .beta.-1,3-glucanase (see section 1). The clones producing these proteins can then be identified and isolated according to a protocol known to a person skilled in the art and described, for example, in Sambrook et al. (op. cit.).

10.sup.6 phages of the soybean cDNA library are plated out on Petri dishes, and lytic plaques are obtained after 2 h 30 min of incubation at 42.degree. C. A nitrocellulose filter (Schleicher and Schell, BA 85) impregnated with IPTG is placed on the surface of the dishes and left in contact with the agar medium for 4 h at a temperature of 37.degree. C., and then replaced by a second filter which is left for 6 h on the same medium.

The filters removed from the dish are then immersed for 30 min in a solution, referred to as TNT solution, composed of 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.05% of Tween 20 detergent, and then for 30 minutes in a buffer, referred to as blocking buffer, composed of gelatin in 1% solution in TNT solution. The filters are then treated for 3 h in a solution containing the anti-.beta.-1,3-glucanase polyclonal antibodies obtained above (see Section 1), diluted in the blocking buffer. They were then immersed for 10 minutes successively in each of the following solutions:

TNT solution+0.1% BSA (bovine serum albumin) TNT solution+0.1% BSA+0.1% Nonidet P40 detergent (Sigma) TNT solution+0.1% BSA.

The antigen-antibody complex formed is then visualised using secondary antibodies conjugated by coupling with a peroxidase ("Immuno conjugate GAR/IgG (H+L)/Po" of Nordic Immunology, Tilburg, Holland). The chemical visualisation reaction employs 4-chloro-1-naphthol as a chromogenic substrate (giving a blue precipitate). The positive lyric plaques, that is to say those corresponding to clones which synthesise .beta.-1,3-glucanase, are then identified on the Petri dish, and the bacteriophages are removed and purified by means of a secondary immunological screening, performed in a strictly identical manner to the primary screening. One of these clones was selected for continuation of the study.

Section 4: Partial characterisation of the phage DNA of the soybean .beta.-1,3-glucanase clone. a) Preparation of phage DNA.

The selected phage clone is amplified and its DNA is extracted according to the protocol described in the Amersham kit "cDNA cloning system GT11" (ref. RPN 1280), summarised below. The phages are removed using a coring tool and transferred to a culture of E. coli strain Y1090; after 15 min, 5 ml of Luria medium (Gibco) containing 5 mM of CaCl.sub.12 and 50 .mu.g/ml of ampicillin are added. After incubation for 4 h at 43.degree. C. with agitation, the culture is centrifuged at 3,000 rpm for 10 min. The DNA of the phage particles present in the supernatant is then extracted and purified by treatment with polyethylene glycol and sodium chloride NaCl, centrifugation, treatment with proteinase K and precipitation.

b) Analysis of the phage DNA of the selected clones

DNA of the .beta.-1,3-glucanase clones was hydrolysed with the restriction enzyme EcoRI. A single approximately 2,300-bp EcoRI-EcoRI fragment was thereby obtained by cleavage at the cloning sites. There is hence no EcoRI site in the complementary DNA.

Analysis by agarose gel electrophoresis of the fragments obtained by the action of several endonucleases on the approximately 2,300-bp EcoRI-EcoRI fragment enabled it to be shown that the latter contains a PvuII site a few base pairs from one of the EcoRI sites.

Section 5: Construction of plasmid pBR1310, isolation of the complementary DNA insert coding for soybean .beta.-1,3-glucanase and determination of its sequence. a) Cloning into plasmid pGEM-3Z

By hydrolysis of the clone selected using the restriction enzyme EcoRI and PvuII, the approximately 2,300 bp EcoRI-PvuII fragment containing the soybean .beta.-1,3-glucanase cDNA was isolated after electrophoresis on low-melting-temperature agarose gel.

Plasmid pGEM-3Z (Promega, Madison, Wis, U.S.A.) was opened using the restriction endonucleases EcoRI and SmaI, then purified and isolated by electrophoresis on low-melting-temperature agarose gel. This plasmid comprises a "polylinker" (cloning multisite) successively containing EcoRI, SmaI and HindIII restriction sites.

Ligation using T4 DNA ligase of the approximately 2,300-bp EcoRI-PvuII fragment, containing the cDNA coding for soybean .beta.-1,3-glucanase, into this plasmid thus opened enables a plasmid referred to as plasmid pBR1310 (ligation of the SmaI and PvuII blunt ends with disappearance of these sites) to be obtained, which plasmid is cloned into the E. coli bacterium strain JM109 (Sambrook et al., op. cit.). The vector obtained was then extracted and purified by the alkaline lysis method (Birnboim and Doly, in Sambrook et al., op. cit.).

The use of several restriction enzymes made it possible to draw up the restriction map of the HindIII-EcoRI fragment contained in plasmid pBR1310 and containing the cDNA coding for .beta.-1,3-glucanase, shown in FIG. 1.

The HindIII-HindIII fragment (of approximately 1490 bp) was prepared by the digestion of the HindIII-EcoRI fragment with the endonuclease HindIII, purified by electrophoresis on low-melting-temperature agarose gel and isolated. This fragment was cloned into the DNA of the replicative form of the single-stranded phage M13mp19 (Pharmacia) opened at the HindIII restriction site. The vector M13 containing the 1490-bp HindIII-HindIII insert is referred to as M13BR137. The sequence of this insert is determined according to the dideoxyribonucleotide method (Sanger et al., PNAS-USA, 14, 5463-5467, 1977).

b) Analysis of the cDNA sequence of soybean 62 -1,3-glucanase.

A better understanding of the description below will be gained with the aid of FIGS. 2A-2D.

This sequence contains a single open reading frame (not interrupted by a stop codon) compatible with the apparent molecular weight observed by agarose gel electrophoresis: the sequence beginning with an ATG codon at position 114 and terminating with the TAA stop codon at position 1224-1226 coding for a protein of 370 amino acids.

The University of Wisconsin's UWGCG software: Devereux et al., 1984, Nucl. Ac. Res., 12, 8711-8721-option: Testing for a signal peptide according to the method of G. von Heijne, 1986, Nucl. Ac. Res., 14, 483-490, provides in this sequence for a single portion coding for a signal peptide for an expression in eukaryotic cells, the following sequence (Na.sub.2) referred to as a pre sequence (beginning at nucleotide 114 and terminating at nucleotide 209):

__________________________________________________________________________ATGCCTTCTC TCTTCGCTAG AAACCAGAGG TTCTCATTGG CTACTCTCCTGCTTCTTCTG GAACTATTGA CAGGAAACCT TCGCATGGCA GATGCT__________________________________________________________________________ coding for the signal peptide of 32 amino acids of the following sequence (a.sub.2) (SEQ ID NO:7): ______________________________________Met Pro Ser Leu Phe Ala Arg Asn Gln Arg Phe Ser Leu AlaThr Leu Leu Leu Leu Leu Glu Leu Leu Thr Gly Asn Leu ArgMet Ala Asp Ala______________________________________

A signal peptide is expected by a person skilled in the art, since .beta.-1,3-glucanases are proteins which can be naturally either accumulated in the vacuoles of plant cells or secreted, thereby demanding the presence of a signal peptide.

The already-known peptide sequence closest to that of the protein of 370 amino acids deduced from the complementary DNA of soybean .beta.-1,3-glucanase (SEQ ID NO:12) is that of the protein of 369 amino acids deduced from the complementary DNA of a Nicotiana plumbaginifolia .beta.-1,3-glucanase (SEQ ID NO:22) (see Swissprot data bank ref. Gub$Nipl. and De Loose et al., 1988, Gene, 70, 13-23).

A comparison of these two sequences using the method of Needleman and Wunsch, 1970, J. Mol. Biol, 48,443-453, employed in the University of Wisconsin's UWGCG software: Devereux et al., 1984, Nucl. Ac. Res. 12,8711-8721, GAP option, shows that 224 amino acids are identical, equivalent to an approximately 60% homology. This algorithmic method considers all possible alignments and creates an alignment, shown in FIGS. 7A and 7B, in which the largest possible number of identical amino acids are paired and the number of holes in the aligned sequences is minimal.

Comparison of the amino-terminal region of the predicted mature soybean .beta.-1,3-glucanase with the published amino-terminal sequences of .beta.-1,3-glucanases

Four plant .beta.-1,3-glucanases are known at present, the amino-terminal sequences of which have been determined experimentally. They are the .beta.-1,3-glucanases of Nicotiana tabacum (H. Shinshi et al., 1988, Proc. Natl. Acad. Sci. USA 85, 5541-5545), of Nicotiana plumbaginifolia (M. De Loose et al., 1988, Gene, 70, 13-23), of Phaseolus vulgaris bean (B. V. Edington et al., 1991, Plant Molecular Biology, 16, 81-94) and of Hordeum vulgare barley (P. B. Hoj et al., 1988, Febs Lett., 230, 67-71).

Their amino-terminal sequences display a strong homology, of the order of 80% for the 15 amino-terminal amino acids. In the case of the dicotyledons (Nicotiana tabacum, Nicotiana plumbaginifolia and Phaseolus vulgaris), they all begin with a Gln followed, after a possible Ser, by the sequence Ile Gly Val Cys Tyr Gly (amino acid residues 1-6 of SEQ ID NO:12). It may be noted that the sequence of mature soybean (dicotyledon) .beta.-1,3-glucanase predicted by the above software also begins with the sequence Gln Ile Gly Val Cys Tyr Gly (amino acid residues 1-6 of SEQ ID NO:12).

Section 6: Construction of a vector for expression

in E. coli: plasmid pBR59.

a) Silent mutagenesis of the coding portion to remove the SacI restriction site (at position 575) of the coding portion.

The sequence GAG CTC of the SacI restriction site located at position 575 of the vector M13BR137 is replaced, by directed mutagenesis as described below, by the sequence GAG CAC. The codon GCT, corresponding to an alanine residue in the initial cDNA sequence, is hence replaced by the codon GCA, also corresponding to an alanine residue (silent mutation).

The single-stranded form of the vector M13BR137 is isolated according to the protocol described by Sambrook et al., op. cit., from a culture of the E. coli bacterial strain DH5.alpha.F' (Gibco-BRL) transformed beforehand with this vector according to the protocol recommended by the manufacturer. On this single-stranded template, mutagenesis is performed according to the protocol of the "Oligonucleotide-directed in vitro mutagenesis system" kit (Amersham--ref. RPN 1523--version 2), using an oligonucleotide synthesised chemically on the Millipore Biosearch 8700 DNA synthesiser, the sequence of which is shown below (SEQ ID NO:19):

GATCATGAAG GCCTTGTGCT CTTATTGCTT GG

The directed mutagenesis technique described in detail in the booklet accompanying this kit, and summarised below, consists in hybridising the above oligonucleotide with the single-stranded form of the vector M13BR137, and then in reacting Klenow polymerase and T4 DNA ligase in the presence of the thionucleotide dCTP-.alpha.-S (.alpha.-thiodeoxycytidine triphosphate) so as to obtain a circular double-stranded form of the recombinant phage, one of the strands of which carries the desired mutation and is protected from cleavage by the endonuclease NciI and degradation by exonuclease III. On the other strand (which has served as a template) a break is then introduced using the endonuclease NciI, and this strand is thereafter removed by the subsequent action of exonuclease III.

The resulting vector, referred to as vector M13BR138, was cloned into E. coli strain DH5.alpha.GF' and sequenced; it possesses, as expected, a sequence mutated by replacement of a codon GCT by a codon GCA, which has eliminated the SacI restriction site from the coding portion.

b) Mutagenesis of the 5' portion of the insert coding for soybean .beta.-1,3-glucanase to introduce NdeI and BamHI restriction sites.

The single-stranded form of the vector M13BR138 is isolated as described above, and a directed mutagenesis is then carried out under the same conditions as before using the chemically synthesised oligonucleotide the sequence of which is noted below (SEQ ID NO:20)

GAGAAGGCAT GGATCCAAAC ATATGAATAC ACCAC

The vector derived from this mutagenesis, referred to as vector M13BR139, is cloned into the E. coli bacterial strain DH5.alpha.F'; it was sequenced, which confirmed the introduction of NdeI and BamHI restriction sites upstream of the ATG translation initiation codon.

c) Mutagenesis of the 3'portion of the insert of the vector M13BR139 to introduce HindIII and SacI restriction sites.

The single-stranded form of the vector M13BR139 is isolated, and a directed mutagenesis is then carried out on the 3'portion of the insert using the oligonucleotide of the following sequence and under the conditions already described SEQ ID NO:21:

CAGAGATTTT GAAGCTTAGG AGCTCAACCT TACACATC

The vector resulting from this mutagenesis, referred to as vector M13BR140, is cloned into the E. coli bacterial strain DH5.alpha.F'. Its sequence was determined, which confirmed the creation of HindIII and SacI restriction sites downstream of the TAA stop codon. This sequence is shown in FIGS. 3A-3D and in SEQ ID NO:13.

d) Construction of plasmid pBR141.

The replicative form of the vector M13BR140 is isolated and purified according to the protocol of Birnboim and Doly described in Sambrook et al., op. cit. The NdeI-HindIII insert containing the .beta.-1,3-glucanase coding portion was isolated by digestion with the restriction enzymes NdeI and HindIII, and purified by agarose gel electrophoresis and electroelution (Sambrook et al., op. cit.). This insert is then ligated using T4 DNA ligase in the large NdeI-HindIII fragment of plasmid p373,2, the construction and constitutive elements of which are described in Patent Application EP-A-0,360,641 (FIGS. 3A-3D of this document shows the restriction map of this plasmid), opened beforehand by digestion with the restriction enzymes NdeI and HindIII. This large fragment contains, in particular, successively from the NdeI end to the HindIII end, a promoter analogous to the "tac" promoter (Sambrook et al., op. cit.) which is inducible with isopropyl .beta.-D-galactoside, a gene coding for .beta.-lactamase (conferring resistance to ampicillin) in a context permitting its expression, an origin of replication in E. coli and a transcription terminator derived from the phage fd. The vector obtained, referred to as plasmid pBR141, is cloned into E. coli strain RR1. The structure of the plasmid is verified by producing a restriction map.

e) Construction of plasmid pBR59

The plasmid DNA of the clone containing plasmid pBR141 is extracted according to the protocol of Birnboim and Doly (Sambrook et al., op. cit.).

Removal of the envisaged prokaryotic pre sequence (see section 5) of soybean .beta.-1,3-glucanase is carried out by removal of the sequence comprised between the NdeI and SphI restriction sites and replacement of this sequence by the synthetic linker of sequence given below (SEQ ID NO:22):

TATGATTGGT GTGTGTTATG GCATGACTAA CCACACACAA TACC so as to re-form the sequence coding for the protein devoid of the signal peptide envisaged in prokaryotic cells, the first amino acid of this protein, namely the glutamine residue (capable of cyclising to pyroglutamate, which makes it impossible to determine the amino-terminal sequence), being replaced by a translation initiation methionine residue.

Ligation of this linker using T4 DNA ligase enables a plasmid, referred to as plasmid pBR59, to be obtained, which plasmid is cloned into the E. coli bacterial strain RR1. In this vector, the .beta.-1,3-glucanase is under the control of a promoter (described in Patent Application EP-A-0,360,641) analogous to the "tac" promoter (Sambrook et al., op. cit.) which is inducible with isopropyl .beta.-D-thiogalactoside (IPTG). The sequence of the coding portion of plasmid pBR59, flanked by the NdeI and HindIII sites, is shown in FIGS. 4A-4C and in SEQ ID NO:15.

Section 7: Expression of soybean .beta.-1,3-glucanase in E. coli.

The E. coli strain RR1 containing the expression vector pBR59 and an E. coli strain RR1 containing plasmid p373,2 are cultured in Luria medium (Gibco) containing 100 mg/1 of the antibiotic ampicillin overnight at 37.degree. C. After a dilution of the culture to 1/100 in the same medium, the bacteria are returned to culture for 1 hour at 37.degree. C. and IPTG is then added at a final concentration of 1 mM. Culturing is then continued for 3 hours and the bacteria are harvested by centrifugation.

The bacteria are resuspended in a buffer, referred to as loading buffer, of the following composition:

0.125M Tris-HCl, pH 6.8 4% sodium dodecyl sulphate 20% glycerol 0.02% bromophenol blue 10% .beta.-mercaptoethanol and the mixture is then brought to 100.degree. C. for 10 min (causing lysis of the bacteria and denaturation of the proteins). 10 .mu.g of solubilised proteins are applied to a polyacrylamide electrophoresis gel according to the protocol described by Laemmli (U. K. Laemmli, Nature 227, 1970, 680-685). After electrophoresis, the gel is stained using Coomassie blue. The presence of three extra bands absent in the case of the control strain is noted in the case of the .beta.-1,3-glucanase clone. Section 8: Measurement of the enzymatic activity of the recombinant soybean .beta.-1,3-glucanase expressed in E. coli, isolation and purification of three forms of this protein and determination of their amino-terminal sequences. 1. Measurement of the enzymatic activity of the recombinant .beta.-1,3-glucanase.

.beta.-1,3-glucanase activity is measured by a colorimetric method enabling the amount of monomers or oligomers liberated by the enzyme from a substrate (laminarin) to be estimated by determining the reducing power of the sugars thus liberated. This method, described by G. Ashwell, 1957, in "Methods in Enzymology III", 73-105, S. P. Colowick and N. U. Kaplan Eds., is summarised below.

50 .mu.l of a solution containing 50 mg/ml of laminarin (.beta.-1,3-glucan extracted from Laminaria digitata--Sigma--ref. L9634) are added to a solution containing a concentration of .beta.-1,3-glucanase chosen so as to fall within a linear response range. The volume of the reaction mixture is adjusted to 500 .mu.l using a 0.2M sodium acetate buffer solution, pH 5.0. After incubation for one hour at 40.degree. C., a 200 .mu.l aliquot portion is added to 200 .mu.l of Somogyi's reagent (mixture of 25 ml of an aqueous solution comprising 2.5% of Na.sub.2 CO.sub.3, 2.5% of KNaC.sub.4 H.sub.4 O.sub.6.4H.sub.2 O, 2% of NaHCO.sub.3, 20% of Na.sub.2 SO.sub.4 and 1 ml of aqueous solution containing 15% of CuSO.sub.4.5H.sub.2 O) and then brought to 100.degree. C. for 45 min. The tubes are then cooled in ice before adding 200 .mu.l of Nelson's reagent (aqueous solution of 5.5% of ammonium molybdate, 4.6% of concentrated sulphuric acid and 12% of Na.sub.2 SO.sub.4.7H.sub.2 O).

The volume of the mixture is adjusted to 5 ml with distilled water and its absorbance is measured by spectrophotometry at a wavelength of 500 nm.

The amount of reducing sugars liberated is estimated by comparison with the absorbance values obtained with a calibration series established using a glucose solution. The .beta.-1,3-glucanase enzymatic activity is expressed in nanomoles of glucose equivalent liberated per minute under the conditions of the enzymatic test described above.

2. Isolation and purification of three forms of recombinant .beta.-1,3-glucanase: a) Method

The different forms of the recombinant protein were isolated and purified from the centrifugate obtained in section 7 (end of the first paragraph). The isolation and purification comprise steps of extraction, ammonium sulphate precipitation, FPLC liquid chromatography on a cation exchange column based on synthetic polymer and exclusion chromatography (molecular sieving) on a crosslinked agarose, according to the protocol described below:

STEP 1:

The bacterial pellet is treated with agitation at 4.degree. C. with a pH 8 buffer solution (30 mM Tris, 1 mM EDTA). After centrifugation (15,000 g, 30 min), the supernatant collected (lysate) constitutes the crude extract.

STEP 2:

The protein extract is precipitated with ammonium sulphate (60% saturation). The proteins which have precipitated are collected by centrifugation (15,000 g for 30 min), solubilised in a buffer solution (100 mM ammonium acetate, pH 5.2) and dialysed overnight at 4.degree. C. against a 100 mM ammonium acetate buffer solution, pH 5.2.

Immediately before proceeding, the concentration of the buffer solution of the protein extract is brought to 10 mM by passage through ready-to-use minicolumns (Pharmacia PD-10).

STEP 3:

The protein extract is then purified by ion exchange chromatography on a column based on synthetic polymer (Pharmacia Mono-S column) according to the Pharmacia FPLC technique.

The extract is applied to the Mono-S column equilibrated with a 10 mM ammonium acetate buffer, pH 5.2. The proteins retained on the column are eluted with a linear gradient from 10 to 500 mM ammonium acetate.

STEP 4:

The fractions containing a .beta.- 1,3-glucanase activity are concentrated by ultrafiltration on a Centricon 10 concentration cartridge (Amicron). The purification of the protein is continued by chromatography (molecular sieving) on a crosslinked agarose (Pharmacia Superose 12 column). Elution is carried out with a 500 mM ammonium acetate buffer, pH 5.2.

At each step, the different forms of recombinant .beta.-1,3-glucanase are identified by their molecular weight (polyacrylamide gel electrophoresis in the presence of SDS--visualisation with silver), by their activities measured by the colorimetric method described above and by their positive reactions with the polyclonal antibodies directed towards tobacco .beta.-1,3-glucanase prepared in section 1.

b) Results

Three forms of the recombinant protein possessing a .beta.-1,3-glucanase activity, of apparent molecular weights 36.+-.3, 37.+-.3 and 39.+-.3 kDa, are thereby isolated and purified. (The molecular weight of the protein deduced from the coding sequence is 37,387 Da). Their respective measured specific activities are 1.65, 1.75 and 1.76 nanomoles of glucose equivalent liberated per minute per microgram of proteins, values which are not significantly different.

3. Determination of the amino-terminal sequence of the three forms of recombinant .beta.-1,3-glucanase.

Sequencing of the amino-terminal ends of the three forms of recombinant .beta.-1,3-glucanase was carried out. The samples to be treated are brought to the surface of a PVDF (polyvinylidene difluoride) filter, which is introduced into a protein sequencer (Model 470 A, marketed by the company Applied Biosystems USA) equipped with a chromatograph (Applied Biosystems Model 430) which continuously analyses the phenylthiohydantoin derivatives formed, after each degradation cycle.

The respective amino-terminal sequences determined are shown below, the symbol X representing an amino acid not determined (SEQ ID NOS:23, 24, and 24, respectively):

______________________________________Met Ile Gly Val X Tyr Gly Met LeuMet Ile Gly Val X Tyr Gly Met Leu Gly Asn Asn Leu ProMet Ile Gly Val X Tyr Gly Met Leu Gly Asn Asn Leu Pro______________________________________

These sequences correspond to the sequence deduced from the coding portion of plasmid pBR59 (see FIGS. 4A-4C). There is hence no post-translational maturation of the amino-terminal portion. The observed differences in molecular weight for a similar specific activity are hence probably the result of a carboxy-terminal post-translational maturation which occurs on 27 amino acids approximately.

Section 9: Construction of a vector for expression in plant cells: the binary vector pBR60. a) Preparation of a complete recombinant gene for soybean .beta.-1,3-glucanase and cloning thereof into the binary vector pBIN19.

The DNA carrying the coding sequence was obtained by cleavage of the vector M13BR140, obtained in section 6c) (see FIGS. 3A-D and SEQ NO:13), using the restriction enzymes BamHI and SacI, and purified by electrophoresis on low-melting-temperature agarose gel. This DNA was inserted between a promoter sequence comprising so-called 35S promoter of the cauliflower mosaic virus (35S CaMV) and a terminator sequence comprising the nopaline synthase terminator of Agrobacterium tumefaciens.

b) Preparation of the promoter sequence comprising

the 35S promoter of the cauliflower mosaic virus.

The approximately 900-bp HindIII-BamHI fragment containing the 35S promoter is isolated from plasmid pBI121 (Clontech) by cleavage using the endonucleases HindIII and BamHI followed by agarose gel electrophoresis. This fragment is cut again with HindII. The approximately 410-bp fragment carrying the BamHI site is treated with T4 DNA ligase in the presence of a HindIII linker (synthetic sequence containing a HindIII site). After cleavage with the endonuclease HindIII and agarose gel electrophoresis, the resulting HindIII-BamHI fragment (of approximately 420-bp) is isolated and purified.

c) Preparation of the terminator sequence comprising the nopaline synthase (NOS) terminator of Agrobacterium tumefaciens.

An approximately 250-bp fragment containing the nopaline synthase terminator was isolated from plasmid pBI121 (Clontech) by cleavage using the restriction enzymes SacI and EcoRI followed by agarose gel electrophoresis.

The promoter sequence, the coding sequence of the complementary DNA of .beta.-1,3-glucanase and the terminator sequence were ligated using T4 DNA ligase in the binary vector pBIN19 opened using the endonucleases HindIII and EcoRI. This vector carries two genes for resistance to kanamycin, one capable of being expressed in bacteria, and the other, located immediately upstream of the complete recombinant gene (see Bevan, 984, Nucl. Ac. Res., 12, 8711-8721), capable of being transferred to plant cells. The gene for resistance to kanamycin will serve as a selection marker during the steps of transformation and analysis of the progeny of the transformed plants.

The vector obtained is referred to as plasmid pBR60. The nucleotide sequence of the complete recombinant gene, verified by sequencing, together with the peptide sequence deduced are shown in FIGS. 5A-5E. The plasmid is cloned into E. coli strain MC1061 (Clontech).

Section 1: Transfer into Agrobacterium tumefaciens of plasmid pBR60 containing the recombinant gene for .beta.-1,3-glucanase. a) Transfer into Acrobacterium tumefaciens.

This transfer is carried out as described below by three-way conjugation between the E. coli strain MC1061 containing the vector pBR60 and Agrobacterium tumefaciens strain LBA4404 (Clontech) using E. coli strain HB101 containing the mobilising plasmid pRK2013 (D. M. Figurski et al., 1979, Pro. Ntl. Ac. Sci. USA, 76, 1648-1652).

The E. coli strain MC1061 containing plasmid pBR60 and an E. coli strain HB101 (Clontech) containing the mobilising plasmid pRK2013 are cultured at 37.degree. C. in Luria medium (Gibco) in the presence of 25 mg/l of kanamycin.

Agrobacterium tumefaciens strain LBA4404 is cultured at 28.degree. C. in Luria medium (Gibco) in the presence of 100 mg/l of rifampicin (it is resistant to this antibiotic); 200 .mu.l of each of the three cultures are mixed, plated out on Luria agar medium (Gibco) and incubated overnight at 28.degree. C. The bacteria are then resuspended in 5 ml of Luria medium and aliquot portions are plated out on Petri dishes containing an agar minimum medium (described in 'Plant Molecular Biology Manual" Gelvin et al., Kluwer Academic Press, 1988) in the presence of 100 mg/l of rifampicin and 25 mg/l of kanamycin. Under these conditions, only Agrobacterium tumefaciens colonies which have integrated plasmid pBR60 grow (E. coli strains cannot grow under these conditions). These colonies contain the recombinant gene for .beta.-1,3-glucanase in a context permitting its replication.

The resistance of the selected colonies to both antibiotics is verified by transplanting them on the same selection medium twice in succession. The presence of the recombinant gene for .beta.-1,3-glucanase in Agrobacterium tumefaciens is verified by the Southern blot method on a total DNA preparation (cell lysis, purification of the DNA by extraction using a phenol/chloroform mixture, according to the protocol described by Gelvin in the work cited above, cleavage of the purified DNA using restriction enzymes, agarose gel electrophoresis, transfer onto a membrane and hybridisation according to techniques well-known to those skilled in the art).

b) Transfer into Agrobacterium rhizogenes

This transfer is carried out in the same manner as the transfer into Agrobacterium tumefaciens described in a), with Agrobacterium rhizogenes strain A4 described by GUERCHE et al., (1987) Mol. gen. genet. 206, 382.

Section 11: Obtaining transformed tobacco plants

Nicotiana tabacum tobacco cultured in vitro was infected with Agrobacterium tumefaciens containing plasmid pBR60 according to the procedure of Horsch et al., well-known to a person skilled in the art (Horsch R. B. et al., 1985, Science 227, 1229-1231), the main steps of which are described below.

Discs of axenic N. tabacum tobacco plants (variety Wisconsin Havana 38, sensitive to pathogenic fungi) are incubated in a culture of A. tumefaciens harbouring plasmid pBR60. The discs, drained on Whatman paper, were transferred onto culture media in Petri dishes in order to multiply the transformed cells so as to obtain calluses, and then to produce buds in the presence of cefotaxime (500 .mu.g/ml), which is designed to remove Agrobacterium tumefaciens, and kanamycin (100 .mu.g/ml).

Buds resistant to kanamycin were then transferred onto a medium permitting the induction of roots in the presence of cefotaxime and kanamycin. The plantlets are then transplanted into pots in a substrate composed of peat and compost, and left to grow in a greenhouse. All the transformed plants (R0 generation) which survived the steps of regeneration and acclimatisation in the greenhouse proved morphologically normal and fertile. They were self-fertilised and gave seeds (R1 generation).

Section 12; Analysis of the genomic DNA of the transformed tobacco plants (R0 generation) according to the Southern blot technique.

The high molecular weight genomic DNA was isolated from mature leaves of transgenic plants of the R0 generation according to the method of extraction using cetyltrimethylammonium bromide and of purification by precipitation, described in the work "Plant Molecular Biology Manual" already cited.

10 .mu.g of this genomic DNA were digested overnight at 37.degree. C. with 20 units of the restriction enzymes HindIII and EcoRI. The restriction fragments obtained were separated by electrophoresis on agarose gel (1%). The DNA was transferred according to the Southern blot method onto a Nylon filter (Amersham Hybond N.sup.+), and hybridised with a nucleotide probe comprising a portion of the sequence of the recombinant gene, labelled by coupling to peroxidase (ECL kit, Amersham). The membranes are then washed and visualised according to the protocol recommended by Amersham.

Analysis of the films enables the following conclusions to be drawn:

some plants do not possess copies of the transferred recombinant gene (absence of signal), most of the plants tested contain at least one copy without rearrangement of the construction: 35S CaMV promoter--coding sequence of the complementary DNA of .beta.-1,3-glucanase--NOS terminator, some profiles suggest that there are internal rearrangements in the construction, but these events are rare. Section 13: Demonstration of the expression of soybean .beta.-1,3-glucanase in transformed tobacco plants (of RO generation). a) Preparation of crude protein extracts of transformed tobacco plants (R0 generation).

Crude protein extracts were prepared from various plant tissues (root, stem, leaf, and the like). The tissue fragments were frozen in liquid nitrogen, reduced to powder and stored at -20.degree. C. The powder was extracted at 4.degree. C. in the presence of a 0.1M ammonium acetate buffer, pH 5.2, and subjected to a centrifugation at 10,000 g. The total protein concentration was determined on the supernatants, hereinafter referred to as crude protein extracts, following the technique of Bradford (Bradford, M. M., 1976, Anal. Biochem., 72, 248-254).

b) Demonstration by immunoblotting (Western blot)

The crude protein extracts of different transformed plants and of untransformed (control) plants are subjected to a Western blot, a technique well-known to a person skilled in the art and described, in particular, by H. Towbin et al., Proc. Ntl. Acad. Sci. USA, 76, 1972, 4350-4354, which comprises the following steps:

denaturation by heating to 100.degree. C. for 10 min in a buffer, called loading buffer, consisting of 0.125M Tris-HCl, pH 6.8, 4% SDS, 0,002% bromophenol blue, 20% glycerol, 10% .beta.-mercaptoethanol (according to the protocol described by Laemmli, U. K. Laemmli, Nature, 227, 1970, 680-685); electrophoretic separation of the different proteins contained in the solubilisate according to the protocol described by Laemmli (ref. above); electrotransfer of the said proteins contained in the gel onto a PVDF membrane (according to the technique of H. Towbin et al., Proc. Natl. Acad. Sci. USA 76, 1979, 4350-4354).

Immunodetection is carried out according to a protocol which comprises the following steps:

saturation of the PVDF membrane onto which the proteins have been transferred by incubation for not less than 2 hours at 37.degree. C. in a 3% solution of gelatin, 3 washes in phosphate-buffered saline containing 0.05% of Tween 20 detergent, incubation (for 1 hour at 37.degree. C.) in the presence of the immune serum prepared above (containing polyclonal antibodies which recognise the recombinant protein) diluted to 1/10,000 in phosphate-buffered saline, 3 washes in phosphate-buffered saline containing 0.05% of Tween 20 detergent.

The antigen-antibody complex is then visualised using an alkaline phosphatase-conjugated streptavidin/biotin system with the Amersham kit RPN 23 ("Blotting detection kit"), used according to the manufacturer's directions.

The blot obtained shows the presence of a protein of approximately 37.+-.3 kDa for the transformed plants which is absent from the control plants (the protein deduced from cDNA sequence, from which its assumed signal peptide for an expression in eukaryotic cells has been cleaved, has a molecular weight of 38,156 Da).

Analysis according to the Western blot technique was performed on 30 transformed plants (responding positively to Southern blot). 28 plants showed an expression of the recombinant .beta.-1,3-glucanase in Western blot.

c) Comparison of the electrophoretic migrations of soybean .beta.-1,3-glucanases (recombinant proteins and natural protein).

The apparent molecular weight obtained for the recombinant protein expressed in the transformed tobacco plants was compared with that obtained for the natural protein present in an extract of soybean cells (see section 1) and natural tobacco .beta.-1,3-glucanase present in an extract of tobacco cells (see section 1), by electrophoretic migration on parallel lanes according to the protocol described by Laemmli (U. K. Laemmli, Nature 227, 1970, 680-685). The sizes of these proteins were compared with those of proteins of known molecular masses (molecular weight markers of between 14,000 and 97,400 Da of Bio-Rad--ref. 61-0304).

The blots obtained after Western blot show that soybean .beta.-1,3-glucanase synthesised in tobacco possesses the same apparent molecular weight as that of the natural soybean protein: 37.+-.3 kDa. The post-translational maturation of this protein is hence performed in the same manner in a plant other than soybean. This apparent molecular weight of soybean .beta.-1,3-glucanase is approximately 3 kDa higher than that of tobacco .beta.-1,3-glucanase, whose molecular weight is 34,969 Da (H. Shinshi et al., 1988, Proc. Natl. Aca. Sci. USA, 85, 5541-5545). The molecular weight of soybean .beta.-1,3-glucanase is hence in the region of 38 kDa, which is very close to the molecular weight predicted in section 5 for the mature protein of 338 amino acids predicted in section 5, which is 38,156 Da.

Section.14: Measurement of the resistance of transformed formed tobacco plants (R1 generation) to pathogenic fungi.

Tobacco plants regenerated (R0 generation) in the presence of kanamycin were self-pollinated. The mature seeds (R1 generation) are sown on Murashige and Skoog medium supplemented with 100 .mu.g/ml of kanamycin.

The kanamycin-resistant plantlets of the R1 generation, derived from 13 chosen transformed plants, from a Nicotiana tabacum var. Wisconsin Havana 38 plant sensitive to the fungus Chalara elegans (also known as Thielaviopsis basicola), abbreviated to W38, were transferred to the greenhouse for evaluation of their resistance to this fungus. The latter was chosen since it is representative of the pathogenic fungi of tobacco possessing .beta.-1,3-glucans in their wall. The study covered numbers of plantlets varying from 16 to 25 depending on the progeny of the transformed plants. The protocol chosen in this study is described below:

The plantlets are cultivated in pots (3.times.3 cm). On appearance of the 5th leaf, the plants are inoculated by depositing a suspension of 5.times.10.sup.5 endoconidia of this fungus on the neck.

The endoconidia are taken from mycelial cultures of this fungus maintained on potato dextrose agar medium (Difco) at 22.degree. C. and in the dark. The resistance to Chalara elegans is evaluated 45 days after inoculation.

The plants are scored according to the symptoms of infection and according to their level of vegetative development.

Two scorings are implemented:

Measurement of the weight (in grams) of the aerial parts of the plants Measurement of a resistant index taking into account the impact of the disease on the whole of the plant.

The classes are defined according to the following criteria:

Score 0: plant dead Score 1: terminal bud still green, root system destroyed Score 2: development of the plants not exceeding 25% of that of the control, root system completely necrotic Score 3: development of the plants attaining 50% of the development of the control, root system displaying healthy portions Score 4: development of the plants identical to the control.

The resistance index of the progeny of a transformed plant represents the mean of the scores assigned to the plantlets derived from this plant.

The table below collates the main results obtained:

TABLE 1______________________________________Measurement of the resistance of progeny oftransformed tobacco plants to pathogenic fungi Number Resistance Weight of the tested Index aerial parts______________________________________TransformedplantsNo. 5 24 1 0.22No. 10 23 0.87 0.22No. 17 21 1.04 0.29No. 20 17 1.41 0.50No. 22 23 1 0.35No. 29 19 1.1 0.46No. 30 16 0.5 0.14No. 37 20 0.25 0.46No. 43 25 0.56 0.075No. 45 23 0.30 0.65No. 49 21 0.19 0.72No. 55 22 0.09 0.05No. 59 25 0.48 0.14Control plantsW38 25 0.12 0.06______________________________________ W38: Untransformed Nicotiana tabacum var. Wisconsin Havana 38 plant

It is seen on studying the above table that 12/13 of the progeny of transformed tobacco plants have a resistance index and a weight of the aerial parts which are higher than those of the progeny of the untransformed W38 plant.

The transformation of tobacco plants with the recombinant DNA of the invention hence confers on their progeny an increased resistance to pathogenic fungi.

Section 15: Purification of the recombinant .beta.-1,3-glucanase from the leaves of transformed tobacco plants (R1 generation) and determination of its amino-terminal sequence. 1) Purification of the recombinant .beta.-1,3-glucanase

The recombinant protein was purified from crude extracts of transformed tobacco leaf proteins, by ammonium sulphate precipitation and FPLC liquid chromatography on a cation exchange column based on synthetic polymer on a crosslinked agarose, according to the protocol described below:

Protocol for purification of the recombinant .beta.-1,3-glucanase

STEP 1: The protein extract is precipitated with ammonium sulphate (60% saturation). The proteins which have precipitated are recovered by centrifugation (15,000 g for 30 min), solubilised in a buffer solution (100 mM ammonium acetate, pH 5.2) and dialysed overnight at 4.degree. C. against a 100 mM ammonium acetate buffer solution, pH 5.2.

Immediately before proceeding, the concentration of the buffer solution of the protein extract is brought to 10 mM by passage through ready-to-use minicolumns (Pharmacia PD-10).

STEP 2: The protein extract is then purified by ion exchange chromotography based on synthetic polymer (Pharmacia Mono-S column) using an FPLC technique (Pharmacia).

The extract is applied to the Mono-S column equilibrated with a 10 mM ammonium acetate buffer, pH 5.2. The proteins retained on the column are eluted with a linear gradient from 10 to 500 mM ammonium acetate.

At each step, the soybean .beta.-1,3-glucanase is identified by its molecular weight (polyacrylamide gel electrophoresis in the presence of SDS--visualisation with silver), and by its immunoblot (see Section 13b)) and its activity, measured by the colorimetric method described in Section 8 1).

2) Determination of the amino-terminal sequence of the recombinant .beta.-1,3-glucanase

After purification of the recombinant .beta.-1,3-glucanase according to the protocol described above, sequencing of the amino-terminal end was carried out. The samples to be treated are brought to the surface of a PVDF (polyvinylidene difluoride) filter by electrotransfer according to the method described by H. TOWBIN et al. Proc. Ntl. Acad. Sci. USA (1979), 4350-4354, after polyacrylamide gel electrophoresis in the presence of SDS. The filter is introduced into a protein sequencer (model 470 A marketed by the company Applied Biosystems (USA)) equiped with a chromatograph (Applied Biosystems model 430) which continuously analyses the phenylthiohydantion derivatives formed, after each degradation cycle.

It was not possible to determine an amino-terminal sequence, despite the good operation of the sequencer, checked by the determination of the amino-terminal sequence of a control protein: the lactoglobulin.

It is thus probable that the amino-terminal sequence of the recombinant .beta.-1,3-glucanase begins with a Gln, as predicted by comparison of the already determined amino-terminal sequences of dicotyledons (see section 5).

It has indeed already been shown that the amino-terminal Gln was blocked for another soybean .beta.-1,3-glucanase (TAKEUCHI et al., 1990, Plant Physiol. 93, 673-682).

Section 16: Obtaining transformed rape plants.

The transformation is carried out according to the protocol of P. Guerche et al. (P. Guerche et al., 1987, Mol. Gen. Genet., 206, 382). The different culture media are those described by Pelletier et al. (Pelletier et al., 1983, Mol. Gen. Genet., 191, 244). Their composition is detailed below (Table 2).

a) Obtaining transformed roots.

Stem segments are removed from the apical tip of rape plants (Brassica napus: spring varieties Brutor and Westar and winter variety) approximately 1 m in height. These segments are surface sterilised, rinsed in sterile water, cut into segments 1.5 cm in length approximately and placed in a tube containing medium A.

Inoculation of the tip of this segment is performed by application of a suspension of the Agrobacterium rhizogenes strain containing plasmid pBR60.

Transformed roots appear on the stem segment after 1 to 2 weeks; they are removed and placed on agar medium B (15 g/l) supplemented with 500 .mu.g of cefotaxime/ml.

b) Regeneration of transformed plants.

Root fragments are incubated for 15 days on medium D containing 3 mg/l of 2,4-dichlorophenoxyacetic acid, and then placed on RCC medium for induction of buds. Rooted plants are then obtained by passage of the buds through media F and G.

Section 17: Demonstration of the expression of soybean .beta.-1,3-glucanase in transformed rape plants. a) Preparation of crude protein extracts of transformed rape plants (R0 generation)

Crude protein extracts were prepared from leaves of the plant. These extracts were frozen in liquid nitrogen, reduced to powder and stored at -20.degree. C. The powder was extracted at 4.degree. C. in the presence of a 0.4M ammonium acetate buffer, pH 5.2, and subjected to a centrifugation at 10,000 g. The total protein concentration was determined on the supernatants, hereinafter referred to as crude protein extracts, following the technique of Bradford (Bradford, M. M., 1976, Anal. Biochem., 72,248-254).

b) Demonstration by immunoblotting (Western blot)

The crude protein extracts of different transformed plants and of untransformed (control) plants are subjected to a Western blot, a technique well-known to a person skilled in the art and described above.

The antigen-antibody complex is then visualised using an alkaline phosphatase-conjugated streptavidin/biotin system with Amersham kit RPN 23 ("Blotting detection kit"), used according to the manufacturer's directions.

The blot obtained shows the presence of a protein of approximately 37.+-.3 kDa for the transformed plants, which is absent from the control plants.

Analysis according to the Western blot technique was performed on 30 transformed plants (responding positively to Southern blot). 38 plants showed an expression of the recombinant .beta.-1,3-glucanase in Western blot.

TABLE 2__________________________________________________________________________Composition of the different media used for obtaining transformed rapeplants MediumComposition(mg/1) A B RCC F G__________________________________________________________________________NH.sub.4 NO.sub.3 1,650 1,650 1,650 825KNO.sub.3 1,900 2,500 1,900 1,900 950(NH.sub.4).sub.2 SO.sub.4 134NaH.sub.2 PO.sub.4 150KH.sub.2 PO.sub.4 170 170 170 85CaCl.sub.2.2H.sub.2 O 440 750 440 440 220MgSO.sub.4.7H.sub.2 O 370 250 370 370 185H.sub.3 BO.sub.3 12.4 3 12.4 6.2 6.2MnSO.sub.4.4H.sub.2 O 33.6 10 33.6 22.3 22.3ZnSO.sub.4.7H.sub.2 O 21 2 21 8.6 8.6KI 1.66 0.75 1.66 0.83 0.83Na.sub.2 MoO.sub.4.2H.sub.2 O 0.5 0.25 0.5 0.25 0.25CuSo.sub.4.5H.sub.2 O 0.05 0.025 0.05 0.25 0.25CoCl.sub.2.6H.sub.2 O 0.05 0.025 0.05 0.25 0.25FeSO.sub.4.7H.sub.2 O 22.24 27.8 27.8 27.8 22.24Na.sub.2 EDTA 29.84 37.3 37.3 37.3 29.84Inositol 100 100 100 100 100Nicotinic acid 0.5 1 0.5 1 0.5Pyridoxine HCl 0.5 1 0.5 1 0.5Thiamine 10 10Glycine 2 2 2Glucose 10,000 20,000 10,000Sucrose 10,000 10,000 10,000D-mannitol 70,000 10,000NAA 1 1 0.1 0.1BA 1 0.5 0.52,4D 0.25Adenine sulphateIPA 0.5GA.sub.3 0.02Tween 80 10Agar 8,000 8,000 8,000 8,000pH 5.8 5.8 5.8 5.8 5.8Gentamicin (sulphate) 10__________________________________________________________________________ NAA = naphthaleneacetic acid BA = 6benzylaminopurine 2,4D = 2,4dichlorophenoxyacetic acid IPA = N.sup.6(2-isopentenyl)adenine GA.sub.3 = gibberellic acid EDTA = ethylenediaminetetraacetic acid __________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 26(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 309 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:IleGlyValCys TyrGlyMetLeuGlyAsnAsnLeuProSerAlaAsn151015AspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMetArgLeu20 2530TyrAspProAsnGlnAlaAlaLeuGluAlaLeuArgAsnSerGlyIle354045GluLeuIleLeuGlyValProAsnSerAspLeu GlnGlyLeuAlaThr505560AsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsnPhe6570758 0TrpProSerValLysIleLysTyrValAlaValGlyAsnGluValSer859095ProValGlyGlySerSerSerValAlaGlnTyrValLeuProAlaIle 100105110GlnAsnValTyrGlnAlaIleArgAlaGlnGlyLeuHisAspGlnIle115120125LysValSerThrSerI leAspMetThrLeuIleGlyAsnSerPhePro130135140ProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAspPro145150 155160IleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeuValAsnVal165170175TyrProTyrPheSerTyrThrGlyAsnProAr gAspIleSerLeuPro180185190TyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGlnTyr195200205GlyTyrGlnAsnLeuPheAspAlaMetLeuAspSerValHisAlaAla210215220IleAspAsnThrLysIleGlyTyrValGluValValValSerGluSer225 230235240GlyTrpProSerAspGlyGlyPheAlaAlaThrTyrAspAsnAlaArg245250255ValTyrLeuAspA snLeuValArgArgAlaAsnArgGlySerProArg260265270ArgProSerLysProThrGluThrTyrIlePheAlaMetPheAspGlu275 280285AsnGlnLysAsnProGluIleGluLysHisPheGlyLeuPheAsnPro290295300AsnLysGlnLysLys305(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:TyrProPheGlyPheGlyGlyLysArgLeuGlyLysValValIleAsp1510 15AspPheAsnAlaThrThrSerIleLysSerAspVal2025(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 338 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GlnIleGlyValCysTyrGlyMetLeuGlyAsnAsnLeuProSerAla151015AsnAspValIleGlyLeuTyrArgSerAsnAsnIleL ysArgMetArg202530LeuTyrAspProAsnGlnAlaAlaLeuGluAlaLeuArgAsnSerGly354045IleG luLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeuAla505560ThrAsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsn6570 7580PheTrpProSerValLysIleLysTyrValAlaValGlyAsnGluVal859095SerProValGlyGlySerSerS erValAlaGlnTyrValLeuProAla100105110IleGlnAsnValTyrGlnAlaIleArgAlaGlnGlyLeuHisAspGln115120 125IleLysValSerThrSerIleAspMetThrLeuIleGlyAsnSerPhe130135140ProProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAsp 145150155160ProIleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeuValAsn165170175Val TyrProTyrPheSerTyrThrGlyAsnProArgAspIleSerLeu180185190ProTyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGln195 200205TyrGlyTyrGlnAsnLeuPheAspAlaMetLeuAspSerValHisAla210215220AlaIleAspAsnThrLysIleGlyTyrValG luValValValSerGlu225230235240SerGlyTrpProSerAspGlyGlyPheAlaAlaThrTyrAspAsnAla245250 255ArgValTyrLeuAspAsnLeuValArgArgAlaAsnArgGlySerPro260265270ArgArgProSerLysProThrGluThrTyrIlePheAlaMe tPheAsp275280285GluAsnGlnLysAsnProGluIleGluLysHisPheGlyLeuPheAsn290295300ProAsnLysGln LysLysTyrProPheGlyPheGlyGlyLysArgLeu305310315320GlyLysValValIleAspAspPheAsnAlaThrThrSerIleLysSer3 25330335AspVal(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetAlaProSerGlyLysSer ThrLeuLeuLeuLeuPheLeuLeuLeu151015CysLeuProSerTrpAsnAlaGlyAla2025(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 89 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:MetSerSerProLeuLysAsnAlaLeuValThrAlaMetLeuAlaGly1510 15GlyAlaLeuSerSerProThrLysGlnHisValGlyIleProValAsn202530AlaSerProGluValGlyProGlyLysTyrSerPheLysGln ValArg354045AsnProAsnTyrLysPheAsnGlyProLeuSerValLysLysThrTyr505560LeuLysTyrGlyVal ProIleProAlaTrpLeuGluAspAlaValGln65707580AsnSerThrSerGlyLeuAlaGluArg85(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetArgArgThrSerLysLeuThrThrPheSerLeuLeuPheSerLeu15 1015ValLeuLeuSerAlaAlaLeuAla20(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 32 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:MetProSerLeuPheAlaArgAsnGlnArgPheSerLeuAlaThrLeu151015LeuLeuLeuLeuGluLeuLeuThrGlyAsnLeuArgMet AlaAspAla202530(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 927 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)( xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:ATTGGTGTGTGTTATGGCATGCTGGGCAACAATCTACCGTCAGCAAACGATGTTATAGGT60CTTTATAGATCAAATAACATAAAGAGAATGAGACTCTATGATCCTAATCAAGCTGCTCTA120GAAGCACTTAGAAATTCTGGCATTGAACTCATT CTTGGGGTGCCAAACTCTGACCTTCAA180GGCCTTGCCACCAATCCTGACACTTCTCGTCAATGGGTGCAAAAAAACGTGTTGAACTTT240TGGCCTAGTGTCAAAATCAAGTACGTGGCAGTTGGAAATGAAGTGAGTCCCGTTGGAGGC300TCTTCTTC GGTAGCCCAATATGTTCTACCTGCCATCCAAAATGTATACCAAGCAATAAGA360GCTCAAGGCCTTCATGATCAAATCAAGGTTTCAACATCTATTGACATGACCCTAATAGGA420AACTCTTTCCCTCCATCGCAAGGTTCCTTCAGGGGTGATGTGAGATCATAC CTAGATCCC480ATAATTGGGTACTTGGTATATGCAAATGCACCATTACTAGTCAATGTGTACCCTTATTTT540AGTTACACTGGTAACCCCCGTGACATATCACTTCCCTATGCTCTTTTCACAGCACCAAAT600GTTGTGGTATGGGATGGTCAATATGG GTACCAAAATTTGTTTGATGCTATGTTGGATTCA660GTACATGCAGCCATTGATAACACTAAGATTGGTTATGTGGAGGTTGTTGTATCCGAGAGT720GGGTGGCCATCAGATGGAGGATTTGCTGCCACTTATGACAACGCACGCGTGTACTTAGAC780 AATTTGGTTCGTCGTGCTAATAGAGGAAGCCCAAGAAGGCCTTCGAAGCCCACTGAGACT840TATATATTTGCCATGTTCGATGAAAATCAAAAAAATCCAGAGATAGAGAAACATTTTGGG900CTCTTCAATCCCAACAAACAAAAAAAA 927(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 96 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:ATGCCTTCTCTCTTCGCTAGAAACCAGAGGTTCT CATTGGCTACTCTCCTGCTTCTTCTG60GAACTATTGACAGGAAACCTTCGCATGGCAGATGCT96(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 84 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single (D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:TACCCATTTGGGTTTGGAGGAAAGAGGCTAGGGAAAGTTGTTATTGACGACTTCAATGCA60ACAACTTCCATTAAGAGTGATGTG84(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1483 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 114..1223(ix) FEATURE: (A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 213..1223(ix) FEATURE:(A) NAME/KEY: sig.sub.-- peptide(B) LOCATION: 114..212(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTGGCGATCATCAAGCCTAATA60GAGGGCTAATCCTTCACTTG TTTGTTTTGTGGTGTATTATTACATTTTGCACCATG116Met33CCTTCTCTCTTC GCTAGAAACCAGAGGTTCTCATTGGCTACTCTCCTG164ProSerLeuPheAlaArgAsnGlnArgPheSerLeuAlaThrLeuLeu30-25-20CTTCTTCTGGAACTA TTGACAGGAAACCTTCGCATGGCAGATGCTCAA212LeuLeuLeuGluLeuLeuThrGlyAsnLeuArgMetAlaAspAlaGln15-10-5ATTGGTGTGTGTTATGGCATG CTGGGCAACAATCTACCGTCAGCAAAC260IleGlyValCysTyrGlyMetLeuGlyAsnAsnLeuProSerAlaAsn151015GATGTTATAGGTCTTTAT AGATCAAATAACATAAAGAGAATGAGACTC308AspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMetArgLeu202530TATGATCCTAATCAAGCT GCTCTAGAAGCACTTAGAAATTCTGGCATT356TyrAspProAsnGlnAlaAlaLeuGluAlaLeuArgAsnSerGlyIle354045GAACTCATTCTTGGGGTGCCA AACTCTGACCTTCAAGGCCTTGCCACC404GluLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeuAlaThr505560AATCCTGACACTTCTCGTCAATGGGTG CAAAAAAACGTGTTGAACTTT452AsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsnPhe65707580TGGCCTAGTGTCAAAATCAAG TACGTGGCAGTTGGAAATGAAGTGAGT500TrpProSerValLysIleLysTyrValAlaValGlyAsnGluValSer859095CCCGTTGGAGGCTCTTCT TCGGTAGCCCAATATGTTCTACCTGCCATC548ProValGlyGlySerSerSerValAlaGlnTyrValLeuProAlaIle100105110CAAAATGTATACCAAGCA ATAAGAGCTCAAGGCCTTCATGATCAAATC596GlnAsnValTyrGlnAlaIleArgAlaGlnGlyLeuHisAspGlnIle115120125AAGGTTTCAACATCTATTGAC ATGACCCTAATAGGAAACTCTTTCCCT644LysValSerThrSerIleAspMetThrLeuIleGlyAsnSerPhePro130135140CCATCGCAAGGTTCCTTCAGGGGTGAT GTGAGATCATACCTAGATCCC692ProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAspPro145150155160ATAATTGGGTACTTGGTATAT GCAAATGCACCATTACTAGTCAATGTG740IleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeuValAsnVal165170175TACCCTTATTTTAGTTAC ACTGGTAACCCCCGTGACATATCACTTCCC788TyrProTyrPheSerTyrThrGlyAsnProArgAspIleSerLeuPro180185190TATGCTCTTTTCACAGCA CCAAATGTTGTGGTATGGGATGGTCAATAT836TyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGlnTyr195200205GGGTACCAAAATTTGTTTGAT GCTATGTTGGATTCAGTACATGCAGCC884GlyTyrGlnAsnLeuPheAspAlaMetLeuAspSerValHisAlaAla210215220ATTGATAACACTAAGATTGGTTATGTG GAGGTTGTTGTATCCGAGAGT932IleAspAsnThrLysIleGlyTyrValGluValValValSerGluSer225230235240GGGTGGCCATCAGATGGAGGA TTTGCTGCCACTTATGACAACGCACGC980GlyTrpProSerAspGlyGlyPheAlaAlaThrTyrAspAsnAlaArg245250255GTGTACTTAGACAATTTG GTTCGTCGTGCTAATAGAGGAAGCCCAAGA1028ValTyrLeuAspAsnLeuValArgArgAlaAsnArgGlySerProArg260265270AGGCCTTCGAAGCCCACT GAGACTTATATATTTGCCATGTTCGATGAA1076ArgProSerLysProThrGluThrTyrIlePheAlaMetPheAspGlu275280285AATCAAAAAAATCCAGAGATA GAGAAACATTTTGGGCTCTTCAATCCC1124AsnGlnLysAsnProGluIleGluLysHisPheGlyLeuPheAsnPro290295300AACAAACAAAAAAAATACCCATTTGGG TTTGGAGGAAAGAGGCTAGGG1172AsnLysGlnLysLysTyrProPheGlyPheGlyGlyLysArgLeuGly305310315320AAAGTTGTTATTGACGACTTC AATGCAACAACTTCCATTAAGAGTGAT1220LysValValIleAspAspPheAsnAlaThrThrSerIleLysSerAsp325330335GTGTAAGGTTGGAATCCTACT CCTCAAAATCTCTGTTATTCCACCCATAAAAT1273ValAAGAGAGAATATGTTGTTTGTGTGAAATATGTATATATCCTTCAGTCTTGGATGAATAAA1333ATTTGTGAAAATTTTATTTTTTTTTTTTTTGGACTAGAAATAGCCTGATACTTAATTATT 1393ATCTTTTTATACCACACGTTGGTTTCCTTCATGAGTACAAACCGAAATAAAACCAACAAT1453TAATCTTGTTTTATTACAACACACAAGCTT1483(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:( A) LENGTH: 370 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:MetProSerLeuPheAlaArgAsnGlnArgPheSerLeuAlaThrLeu33-30-25- 2 0LeuLeuLeuLeuGluLeuLeuThrGlyAsnLeuArgMetAlaAspAla15-10-5GlnIleGlyValCysTyrGlyMetLeuGlyAsnAsnLeuProSerAla1 51015AsnAspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMetArg202530LeuTyrAsp ProAsnGlnAlaAlaLeuGluAlaLeuArgAsnSerGly354045IleGluLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeuAla50 5560ThrAsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsn657075PheTrpProSerValLysIleLysTyrValAlaValG lyAsnGluVal80859095SerProValGlyGlySerSerSerValAlaGlnTyrValLeuProAla100105 110IleGlnAsnValTyrGlnAlaIleArgAlaGlnGlyLeuHisAspGln115120125IleLysValSerThrSerIleAspMetThrLeuIleGlyAsnSerPh e130135140ProProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAsp145150155ProIleIleGlyTyrLeu ValTyrAlaAsnAlaProLeuLeuValAsn160165170175ValTyrProTyrPheSerTyrThrGlyAsnProArgAspIleSerLeu180 185190ProTyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGln195200205TyrGlyTyrGlnAsnLeuPheAspAlaM etLeuAspSerValHisAla210215220AlaIleAspAsnThrLysIleGlyTyrValGluValValValSerGlu225230235 SerGlyTrpProSerAspGlyGlyPheAlaAlaThrTyrAspAsnAla240245250255ArgValTyrLeuAspAsnLeuValArgArgAlaAsnArgGlySerPro 260265270ArgArgProSerLysProThrGluThrTyrIlePheAlaMetPheAsp275280285GluAsnGln LysAsnProGluIleGluLysHisPheGlyLeuPheAsn290295300ProAsnLysGlnLysLysTyrProPheGlyPheGlyGlyLysArgLeu3053 10315GlyLysValValIleAspAspPheAsnAlaThrThrSerIleLysSer320325330335AspVal(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1483 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 114..1223(ix) FEATURE:(A) NAME/KEY: sig.sub.-- peptide(B) LOCATION: 114..212(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 213..1223(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:AAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTGGCGATCATCAAGCCTAATA60GAGGGCTAATCCTTCACTTGTTTGTTTTGTGGTGTATTCATATGTTTGG ATCCATG116Met33CCTTCTCTCTTCGCTAGAAACCAGAGGTTCTCATTG GCTACTCTCCTG164ProSerLeuPheAlaArgAsnGlnArgPheSerLeuAlaThrLeuLeu30-25-20CTTCTTCTGGAACTATTGACAGGAAACCTTCGCATGGCA GATGCTCAA212LeuLeuLeuGluLeuLeuThrGlyAsnLeuArgMetAlaAspAlaGln15-10-5ATTGGTGTGTGTTATGGCATGCTGGGCAACAATCTACCGTCAGCA AAC260IleGlyValCysTyrGlyMetLeuGlyAsnAsnLeuProSerAlaAsn151015GATGTTATAGGTCTTTATAGATCAAATAACATAAAGAGAATG AGACTC308AspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMetArgLeu202530TATGATCCTAATCAAGCTGCTCTAGAAGCACTTAGAAATTCT GGCATT356TyrAspProAsnGlnAlaAlaLeuGluAlaLeuArgAsnSerGlyIle354045GAACTCATTCTTGGGGTGCCAAACTCTGACCTTCAAGGCCTTGCC ACC404GluLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeuAlaThr505560AATCCTGACACTTCTCGTCAATGGGTGCAAAAAAACGTGTTGAACTTT 452AsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsnPhe65707580TGGCCTAGTGTCAAAATCAAGTACGTGGCAGTTGGAAATGAAGTG AGT500TrpProSerValLysIleLysTyrValAlaValGlyAsnGluValSer859095CCCGTTGGAGGCTCTTCTTCGGTAGCCCAATATGTTCTACCT GCCATC548ProValGlyGlySerSerSerValAlaGlnTyrValLeuProAlaIle100105110CAAAATGTATACCAAGCAATAAGAGCACAAGGCCTTCATGAT CAAATC596GlnAsnValTyrGlnAlaIleArgAlaGlnGlyLeuHisAspGlnIle115120125AAGGTTTCAACATCTATTGACATGACCCTAATAGGAAACTCTTTC CCT644LysValSerThrSerIleAspMetThrLeuIleGlyAsnSerPhePro130135140CCATCGCAAGGTTCCTTCAGGGGTGATGTGAGATCATACCTAGATCCC 692ProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAspPro145150155160ATAATTGGGTACTTGGTATATGCAAATGCACCATTACTAGTCAAT GTG740IleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeuValAsnVal165170175TACCCTTATTTTAGTTACACTGGTAACCCCCGTGACATATCA CTTCCC788TyrProTyrPheSerTyrThrGlyAsnProArgAspIleSerLeuPro180185190TATGCTCTTTTCACAGCACCAAATGTTGTGGTATGGGATGGT CAATAT836TyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGlnTyr195200205GGGTACCAAAATTTGTTTGATGCTATGTTGGATTCAGTACATGCA GCC884GlyTyrGlnAsnLeuPheAspAlaMetLeuAspSerValHisAlaAla210215220ATTGATAACACTAAGATTGGTTATGTGGAGGTTGTTGTATCCGAGAGT 932IleAspAsnThrLysIleGlyTyrValGluValValValSerGluSer225230235240GGGTGGCCATCAGATGGAGGATTTGCTGCCACTTATGACAACGCA CGC980GlyTrpProSerAspGlyGlyPheAlaAlaThrTyrAspAsnAlaArg245250255GTGTACTTAGACAATTTGGTTCGTCGTGCTAATAGAGGAAGC CCAAGA1028ValTyrLeuAspAsnLeuValArgArgAlaAsnArgGlySerProArg260265270AGGCCTTCGAAGCCCACTGAGACTTATATATTTGCCATGTTC GATGAA1076ArgProSerLysProThrGluThrTyrIlePheAlaMetPheAspGlu275280285AATCAAAAAAATCCAGAGATAGAGAAACATTTTGGGCTCTTCAAT CCC1124AsnGlnLysAsnProGluIleGluLysHisPheGlyLeuPheAsnPro290295300AACAAACAAAAAAAATACCCATTTGGGTTTGGAGGAAAGAGGCTAGGG 1172AsnLysGlnLysLysTyrProPheGlyPheGlyGlyLysArgLeuGly305310315320AAAGTTGTTATTGACGACTTCAATGCAACAACTTCCATTAAGAGT GAT1220LysValValIleAspAspPheAsnAlaThrThrSerIleLysSerAsp325330335GTGTAAGGTTGAGCTCCTAAGCTTCAAAATCTCTGTTATTCCACCCATAA AAT1273ValAAGAGAGAATATGTTGTTTGTGTGAAATATGTATATATCCTTCAGTCTTGGATGAATAAA1333ATTTGTGAAAATTTTATTTTTTTTTTTTTTGGACTAGAAATAGCCTGATACTTAATTATT1393ATCTTTTTATACCACACGTT GGTTTCCTTCATGAGTACAAACCGAAATAAAACCAACAAT1453TAATCTTGTTTTATTACAACACACAAGCTT1483(2) INFORMATION FOR SEQ ID NO:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 370 amino acids(B) TYPE: amino acid (D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:MetProSerLeuPheAlaArgAsnGlnArgPheSerLeuAlaThrLeu33-30-25- 20LeuLeuLeuLeuGluLeuLeu ThrGlyAsnLeuArgMetAlaAspAla15-10-5GlnIleGlyValCysTyrGlyMetLeuGlyAsnAsnLeuProSerAla15 1015AsnAspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMetArg202530LeuTyrAspProAsnGlnAlaAlaLeuGluAla LeuArgAsnSerGly354045IleGluLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeuAla505560ThrAsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsn657075PheTrpProSerValLysIleLysTyrValAlaValGlyAsnGluVal80 859095SerProValGlyGlySerSerSerValAlaGlnTyrValLeuProAla100105110IleGlnAsnValTyr GlnAlaIleArgAlaGlnGlyLeuHisAspGln115120125IleLysValSerThrSerIleAspMetThrLeuIleGlyAsnSerPhe130 135140ProProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAsp145150155ProIleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeu ValAsn160165170175ValTyrProTyrPheSerTyrThrGlyAsnProArgAspIleSerLeu1801851 90ProTyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGln195200205TyrGlyTyrGlnAsnLeuPheAspAlaMetLeuAspSerValHisAla 210215220AlaIleAspAsnThrLysIleGlyTyrValGluValValValSerGlu225230235SerGlyTrpProSerAspGlyGly PheAlaAlaThrTyrAspAsnAla240245250255ArgValTyrLeuAspAsnLeuValArgArgAlaAsnArgGlySerPro260 265270ArgArgProSerLysProThrGluThrTyrIlePheAlaMetPheAsp275280285GluAsnGlnLysAsnProGluIleGluLysHis PheGlyLeuPheAsn290295300ProAsnLysGlnLysLysTyrProPheGlyPheGlyGlyLysArgLeu305310315GlyLy sValValIleAspAspPheAsnAlaThrThrSerIleLysSer320325330335AspVal(2) INFORMATION FOR SEQ ID NO:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1038 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 4..1017(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:CATATGATTGGTGTGTGTTATGGCATGCTGGGCAACAATCTACCGTCA 48MetIleGlyValCysTyrGlyMetLeuGlyAsnAsnLeuProSer151015GCAAACGATGTTATAGGTCTTTATAGATCAAATAACATAAAGA GAATG96AlaAsnAspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMet202530AGACTCTATGATCCTAATCAAGCTGCTCTAGAAGCACTTA GAAATTCT144ArgLeuTyrAspProAsnGlnAlaAlaLeuGluAlaLeuArgAsnSer354045GGCATTGAACTCATTCTTGGGGTGCCAAACTCTGACCTTC AAGGCCTT192GlyIleGluLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeu505560GCCACCAATCCTGACACTTCTCGTCAATGGGTGCAAAAAAACG TGTTG240AlaThrAsnProAspThrSerArgGlnTrpValGlnLysAsnValLeu657075AACTTTTGGCCTAGTGTCAAAATCAAGTACGTGGCAGTTGGAAATGAA 288AsnPheTrpProSerValLysIleLysTyrValAlaValGlyAsnGlu80859095GTGAGTCCCGTTGGAGGCTCTTCTTCGGTAGCCCAATATGTTC TACCT336ValSerProValGlyGlySerSerSerValAlaGlnTyrValLeuPro100105110GCCATCCAAAATGTATACCAAGCAATAAGAGCACAAGGCC TTCATGAT384AlaIleGlnAsnValTyrGlnAlaIleArgAlaGlnGlyLeuHisAsp115120125CAAATCAAGGTTTCAACATCTATTGACATGACCCTAATAG GAAACTCT432GlnIleLysValSerThrSerIleAspMetThrLeuIleGlyAsnSer130135140TTCCCTCCATCGCAAGGTTCCTTCAGGGGTGATGTGAGATCAT ACCTA480PheProProSerGlnGlySerPheArgGlyAspValArgSerTyrLeu145150155GATCCCATAATTGGGTACTTGGTATATGCAAATGCACCATTACTAGTC 528AspProIleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeuVal160165170175AATGTGTACCCTTATTTTAGTTACACTGGTAACCCCCGTGACA TATCA576AsnValTyrProTyrPheSerTyrThrGlyAsnProArgAspIleSer180185190CTTCCCTATGCTCTTTTCACAGCACCAAATGTTGTGGTAT GGGATGGT624LeuProTyrAlaLeuPheThrAlaProAsnValValValTrpAspGly195200205CAATATGGGTACCAAAATTTGTTTGATGCTATGTTGGATT CAGTACAT672GlnTyrGlyTyrGlnAsnLeuPheAspAlaMetLeuAspSerValHis210215220GCAGCCATTGATAACACTAAGATTGGTTATGTGGAGGTTGTTG TATCC720AlaAlaIleAspAsnThrLysIleGlyTyrValGluValValValSer225230235GAGAGTGGGTGGCCATCAGATGGAGGATTTGCTGCCACTTATGACAAC 768GluSerGlyTrpProSerAspGlyGlyPheAlaAlaThrTyrAspAsn240245250255GCACGCGTGTACTTAGACAATTTGGTTCGTCGTGCTAATAGAG GAAGC816AlaArgValTyrLeuAspAsnLeuValArgArgAlaAsnArgGlySer260265270CCAAGAAGGCCTTCGAAGCCCACTGAGACTTATATATTTG CCATGTTC864ProArgArgProSerLysProThrGluThrTyrIlePheAlaMetPhe275280285GATGAAAATCAAAAAAATCCAGAGATAGAGAAACATTTTG GGCTCTTC912AspGluAsnGlnLysAsnProGluIleGluLysHisPheGlyLeuPhe290295300AATCCCAACAAACAAAAAAAATACCCATTTGGGTTTGGAGGAA AGAGG960AsnProAsnLysGlnLysLysTyrProPheGlyPheGlyGlyLysArg305310315CTAGGGAAAGTTGTTATTGACGACTTCAATGCAACAACTTCCATTAAG 1008LeuGlyLysValValIleAspAspPheAsnAlaThrThrSerIleLys320325330335AGTGATGTGTAAGGTTGAGCTCCTAAGCTT 1038SerAspVal(2) INFORMATION FOR SEQ ID NO:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 338 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:MetIleGlyValCysTyrGlyMetLeuGlyAsnAsnLeu ProSerAla151015AsnAspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMetArg202530LeuTyrAspProAsnGlnAlaAlaLeuGluAlaLeuArgAsnSerGly354045IleGluLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeuAla50 5560ThrAsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsn65707580PheTrpProSerValLysIl eLysTyrValAlaValGlyAsnGluVal859095SerProValGlyGlySerSerSerValAlaGlnTyrValLeuProAla100 105110IleGlnAsnValTyrGlnAlaIleArgAlaGlnGlyLeuHisAspGln115120125IleLysValSerThrSerIleAspMetThrLeuIleGly AsnSerPhe130135140ProProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAsp145150155160P roIleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeuValAsn165170175ValTyrProTyrPheSerTyrThrGlyAsnProArgAspIleSerLeu 180185190ProTyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGln195200205TyrGlyTyrGlnAsnLeuPh eAspAlaMetLeuAspSerValHisAla210215220AlaIleAspAsnThrLysIleGlyTyrValGluValValValSerGlu225230235 240SerGlyTrpProSerAspGlyGlyPheAlaAlaThrTyrAspAsnAla245250255ArgValTyrLeuAspAsnLeuValArgArgAlaAsn ArgGlySerPro260265270ArgArgProSerLysProThrGluThrTyrIlePheAlaMetPheAsp275280285G luAsnGlnLysAsnProGluIleGluLysHisPheGlyLeuPheAsn290295300ProAsnLysGlnLysLysTyrProPheGlyPheGlyGlyLysArgLeu305 310315320GlyLysValValIleAspAspPheAsnAlaThrThrSerIleLysSer325330335AspVal(2) INFORMATION FOR SEQ ID NO:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1829 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 438..1547(ix) FEATURE:(A) NAME/KEY: mat.sub.-- peptide(B) LOCATION: 537..1547(ix) FEATURE:(A) NAME/KEY: sig.sub.-- peptide(B) LOCATION: 438..536(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:AAGCTTGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCCTCAGAAGACC60AAAGGGCCAATTGAGACTTTTCAACAAAGGG TAATATCCGGAAACCTCCTCGGATTCCAT120TGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAA180TGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCC240AAAGAT GGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCT300TCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCAC360TATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGA GAGAACACGG420GGGACTCTAGAGGATCCATGCCTTCTCTCTTCGCTAGAAACCAGAGGTTC470MetProSerLeuPheAlaArgAsnGlnArgPhe33-30 -25TCATTGGCTACTCTCCTGCTTCTTCTGGAACTATTGACAGGAAACCTT518SerLeuAlaThrLeuLeuLeuLeuLeuGluLeuLeuThrGlyAsnLeu20-15 -10CGCATGGCAGATGCTCAAATTGGTGTGTGTTATGGCATGCTGGGCAAC566ArgMetAlaAspAlaGlnIleGlyValCysTyrGlyMetLeuGlyAsn515 10AATCTACCGTCAGCAAACGATGTTATAGGTCTTTATAGATCAAATAAC614AsnLeuProSerAlaAsnAspValIleGlyLeuTyrArgSerAsnAsn15 2025ATAAAGAGAATGAGACTCTATGATCCTAATCAAGCTGCTCTAGAAGCA662IleLysArgMetArgLeuTyrAspProAsnGlnAlaAlaLeuGluAla30 3540CTTAGAAATTCTGGCATTGAACTCATTCTTGGGGTGCCAAACTCTGAC710LeuArgAsnSerGlyIleGluLeuIleLeuGlyValProAsnSerAsp4550 55CTTCAAGGCCTTGCCACCAATCCTGACACTTCTCGTCAATGGGTGCAA758LeuGlnGlyLeuAlaThrAsnProAspThrSerArgGlnTrpValGln6065 70AAAAACGTGTTGAACTTTTGGCCTAGTGTCAAAATCAAGTACGTGGCA806LysAsnValLeuAsnPheTrpProSerValLysIleLysTyrValAla758085 90GTTGGAAATGAAGTGAGTCCCGTTGGAGGCTCTTCTTCGGTAGCCCAA854ValGlyAsnGluValSerProValGlyGlySerSerSerValAlaGln95 100105TATGTTCTACCTGCCATCCAAAATGTATACCAAGCAATAAGAGCACAA902TyrValLeuProAlaIleGlnAsnValTyrGlnAlaIleArgAlaGln110 115120GGCCTTCATGATCAAATCAAGGTTTCAACATCTATTGACATGACCCTA950GlyLeuHisAspGlnIleLysValSerThrSerIleAspMetThrLeu125130 135ATAGGAAACTCTTTCCCTCCATCGCAAGGTTCCTTCAGGGGTGATGTG998IleGlyAsnSerPheProProSerGlnGlySerPheArgGlyAspVal140145 150AGATCATACCTAGATCCCATAATTGGGTACTTGGTATATGCAAATGCA1046ArgSerTyrLeuAspProIleIleGlyTyrLeuValTyrAlaAsnAla155160165 170CCATTACTAGTCAATGTGTACCCTTATTTTAGTTACACTGGTAACCCC1094ProLeuLeuValAsnValTyrProTyrPheSerTyrThrGlyAsnPro175 180185CGTGACATATCACTTCCCTATGCTCTTTTCACAGCACCAAATGTTGTG1142ArgAspIleSerLeuProTyrAlaLeuPheThrAlaProAsnValVal190 195200GTATGGGATGGTCAATATGGGTACCAAAATTTGTTTGATGCTATGTTG1190ValTrpAspGlyGlnTyrGlyTyrGlnAsnLeuPheAspAlaMetLeu205210 215GATTCAGTACATGCAGCCATTGATAACACTAAGATTGGTTATGTGGAG1238AspSerValHisAlaAlaIleAspAsnThrLysIleGlyTyrValGlu220225 230GTTGTTGTATCCGAGAGTGGGTGGCCATCAGATGGAGGATTTGCTGCC1286ValValValSerGluSerGlyTrpProSerAspGlyGlyPheAlaAla235240245 250ACTTATGACAACGCACGCGTGTACTTAGACAATTTGGTTCGTCGTGCT1334ThrTyrAspAsnAlaArgValTyrLeuAspAsnLeuValArgArgAla255 260265AATAGAGGAAGCCCAAGAAGGCCTTCGAAGCCCACTGAGACTTATATA1382AsnArgGlySerProArgArgProSerLysProThrGluThrTyrIle270 275280TTTGCCATGTTCGATGAAAATCAAAAAAATCCAGAGATAGAGAAACAT1430PheAlaMetPheAspGluAsnGlnLysAsnProGluIleGluLysHis285290 295TTTGGGCTCTTCAATCCCAACAAACAAAAAAAATACCCATTTGGGTTT1478PheGlyLeuPheAsnProAsnLysGlnLysLysTyrProPheGlyPhe300305 310GGAGGAAAGAGGCTAGGGAAAGTTGTTATTGACGACTTCAATGCAACA1526GlyGlyLysArgLeuGlyLysValValIleAspAspPheAsnAlaThr315320325 330ACTTCCATTAAGAGTGATGTGTAAGGTTGAGCTCGAATTTCCCCGATCGTT1577ThrSerIleLysSerAspVal335CAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCC GGTCTTGCGATGATTA1637TCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGT1697TATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAG1757AAAACAAAATATAGCGCGC AAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTAC1817TAGATCGAATTC1829(2) INFORMATION FOR SEQ ID NO:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 370 amino acids(B) TYPE: amino acid (D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:MetProSerLeuPheAlaArgAsnGlnArgPheSerLeuAlaThrLeu33-30-25- 20LeuLeuLeuLeuGluLeuLe uThrGlyAsnLeuArgMetAlaAspAla15-10-5GlnIleGlyValCysTyrGlyMetLeuGlyAsnAsnLeuProSerAla15 1015AsnAspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMetArg202530LeuTyrAspProAsnGlnAlaAlaLeuGluAla LeuArgAsnSerGly354045IleGluLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeuAla505560ThrAsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsn657075PheTrpProSerValLysIleLysTyrValAlaValGlyAsnGluVal80 859095SerProValGlyGlySerSerSerValAlaGlnTyrValLeuProAla100105110IleGlnAsnValTy rGlnAlaIleArgAlaGlnGlyLeuHisAspGln115120125IleLysValSerThrSerIleAspMetThrLeuIleGlyAsnSerPhe130 135140ProProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAsp145150155ProIleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeu ValAsn160165170175ValTyrProTyrPheSerTyrThrGlyAsnProArgAspIleSerLeu180185 190ProTyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGln195200205TyrGlyTyrGlnAsnLeuPheAspAlaMetLeuAspSerValHisAla 210215220AlaIleAspAsnThrLysIleGlyTyrValGluValValValSerGlu225230235SerGlyTrpProSerAspGlyGl yPheAlaAlaThrTyrAspAsnAla240245250255ArgValTyrLeuAspAsnLeuValArgArgAlaAsnArgGlySerPro260 265270ArgArgProSerLysProThrGluThrTyrIlePheAlaMetPheAsp275280285GluAsnGlnLysAsnProGluIleGluLysHis PheGlyLeuPheAsn290295300ProAsnLysGlnLysLysTyrProPheGlyPheGlyGlyLysArgLeu305310315GlyL ysValValIleAspAspPheAsnAlaThrThrSerIleLysSer320325330335AspVal(2) INFORMATION FOR SEQ ID NO:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 32 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:GATCATGAAGGCCTTGTGCTCTTATTGCTTGG32(2) INFORMATION FOR SEQ ID NO:20:(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:GAGAAGGCATGGATCCAAACATATGAATACACCAC35(2) INFORMATION FOR SEQ ID NO:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 38 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:CAGAGATTTTGAAGCTTAGGAGCTCAACCTTACACATC 38(2) INFORMATION FOR SEQ ID NO:22:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 44 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:TATGATTGGTGTGTGTTATGGCATGACTAACCAC ACACAATACC44(2) INFORMATION FOR SEQ ID NO:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 9 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:MetIleGlyValXaaTyrGlyMetLeu 15(2) INFORMATION FOR SEQ ID NO:24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 14 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:MetIleGlyValXaaTyrGlyMetLeuGlyAsnAsnLeuPro1510(2) INFORMATION FOR SEQ ID NO:25:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 337 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:IleGlyValCysTyrGlyMetLeuGl yAsnAsnLeuProSerAlaAsn151015AspValIleGlyLeuTyrArgSerAsnAsnIleLysArgMetArgLeu2025 30TyrAspProAsnGlnAlaAlaLeuGluAlaLeuArgAsnSerGlyIle354045GluLeuIleLeuGlyValProAsnSerAspLeuGlnGlyLeuAlaTh r505560AsnProAspThrSerArgGlnTrpValGlnLysAsnValLeuAsnPhe65707580TrpProSerVa lLysIleLysTyrValAlaValGlyAsnGluValSer859095ProValGlyGlySerSerSerValAlaGlnTyrValLeuProAlaIle100 105110GlnAsnValTyrGlnAlaIleArgAlaGlnGlyLeuHisAspGlnIle115120125LysValSerThrSerIleAspMetThrLeu IleGlyAsnSerPhePro130135140ProSerGlnGlySerPheArgGlyAspValArgSerTyrLeuAspPro145150155 160IleIleGlyTyrLeuValTyrAlaAsnAlaProLeuLeuValAsnVal165170175TyrProTyrPheSerTyrThrGlyAsnProArgAspIleSerLeuP ro180185190TyrAlaLeuPheThrAlaProAsnValValValTrpAspGlyGlnTyr195200205GlyTyrGlnAsn LeuPheAspAlaMetLeuAspSerValHisAlaAla210215220IleAspAsnThrLysIleGlyTyrValGluValValValSerGluSer225230 235240GlyTrpProSerAspGlyGlyPheAlaAlaThrTyrAspAsnAlaArg245250255ValTyrLeuAspAsnLeuValArgArg AlaAsnArgGlySerProArg260265270ArgProSerLysProThrGluThrTyrIlePheAlaMetPheAspGlu275280 285AsnGlnLysAsnProGluIleGluLysHisPheGlyLeuPheAsnPro290295300AsnLysGlnLysLysTyrProPheGlyPheGlyGlyLysArgLeuGly305 310315320LysValValIleAspAspPheAsnAlaThrThrSerIleLysSerAsp325330335Val(2) INFORMATION FOR SEQ ID NO:26:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 370 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:MetAspThrSerHisLysHisIleAlaLeuGlnMetAlaAlaIleIle15 1015LeuLeuGlyLeuLeuValSerSerThrGluIleValGlyAlaGlnSer202530ValGlyValCysTyrGlyMetLeuGly AsnAsnLeuProProAlaSer354045GlnValValGlnLeuTyrLysSerLysAsnIleArgArgMetArgLeu505560 TyrAspProAsnGlnAlaAlaLeuGlnAlaLeuArgGlySerAsnIle65707580GluValMetLeuGlyValProAsnSerAspLeuGlnAsnIleAlaAla 859095AsnProSerAsnAlaAsnAsnTrpValGlnArgAsnValArgAsnPhe100105110TrpProAlaVal LysPheArgTyrIleAlaValGlyAsnGluValSer115120125ProValThrGlyThrSerSerLeuThrArgTyrLeuLeuProAlaMet130135 140ArgAsnIleArgAsnAlaIleSerSerAlaGlyLeuGlnAsnAsnIle145150155160LysValSerSerSerValAspMetThrLeuIle GlyAsnSerPhePro165170175ProSerGlnGlySerPheArgAsnAspValArgSerPheIleAspPro180185 190IleIleGlyPheValArgArgIleAsnSerProLeuLeuValAsnIle195200205TyrProTyrPheSerTyrAlaGlyAsnProArgAspIleSerLeuPro 210215220TyrAlaLeuPheThrAlaProAsnValValValGlnAspGlySerLeu225230235240GlyTyrArgAsnLeu PheAspAlaMetSerAspAlaValTyrAlaAla245250255LeuSerArgAlaGlyGlyGlySerIleGluIleValValSerGluSer260 265270GlyTrpProSerAlaGlyAlaPheAlaAlaThrThrAsnAsnAlaAla275280285ThrTyrTyrLysAsnLeuIleGlnHisValLys ArgGlySerProArg290295300ArgProAsnLysValIleGluThrTyrLeuPheAlaMetPheAspGlu3053103153 20AsnAsnLysAsnProGluLeuGluLysHisPheGlyLeuPheSerPro325330335AsnLysGlnProLysTyrProLeuSerPheGlyPheSerAspArgTyr 340345350TrpAspIleSerAlaGluAsnAsnAlaThrAlaAlaSerLeuIleSer355360365GluMet370

Claims

1. A DNA construct, which codes for a protein having .beta.-1,3-glucanase activity, wherein said protein comprises the following sequence (a.sub.1) (SEQ ID NO. 1) ##STR1##

2. A DNA construct according to claim 1, further comprising immediately downstream of the nucleotide sequence coding for the amino acid sequence (a.sub.1) (SEQ ID NO. 1), the nucleotide sequence coding for the amino acid sequence (a.sub.4) (SEQ ID NO. 2) below:

______________________________________Tyr Pro Phe Gly Phe Gly Gly Lys Arg Leu Gly LysVal Val Ile Asp Asp Phe Asn Ala Thr Thr Ser Ile Lys SerAsp Val______________________________________

truncated in its carboxy-terminal portion by 0 to 27 amino acids.

3. A DNA construct according to claim 2, further comprising immediately upstream of the nucleotide sequence coding for the amino acid sequence (a.sub.1) (SEQ ID NO. 1), a codon for Gln.

4. A DNA construct according to claim 3, which codes for a protein having .beta.-1,3-glucanase activity, which comprises the following sequence (a.sub.5) (SEQ ID NO. 3) ##STR2##

5. A DNA construct according to claim 3 which contains, upstream of said codon for Gln preceding the nucleotide sequence coding for the amino acid sequence (a.sub.1) (SEQ ID NO. 1), a region encoding a signal sequence.

6. A DNA construct according to claim 5, wherein said region encoding a signal sequence encodes a signal peptide of the following sequence (a.sub.2) (SEQ ID NO. 7)

______________________________________Met Pro Ser Leu Phe Ala Arg Asn Gln Arg Phe Ser Leu AlaThr Leu Leu Leu Leu Leu Glu Leu Leu Thr Gly Asn Leu ArgMet Ala Asp Ala.______________________________________

7. A DNA construct according to claim 1, wherein the nucleotide sequence coding for the amino acid sequence (a.sub.1) (SEQ ID NO. 1) is the following sequence (Na.sub.1) (SEQ ID NO. 8)

__________________________________________________________________________ATTGGTGTGT GTTATGGCAT GCTGGGCAAC AATCTACCGT CAGCAAACGATGTTATAGGT CTTTATAGAT CAAATAACAT AAAGAGAATG AGACTCTATGATCCTAATCA AGCTGCTCTA GAAGCACTTA GAAATTCTGG CATTGAACTCATTCTTGGGG TGCCAAACTC TGACCTTCAA GGCCTTGCCA CCAATCCTGACACTTCTCGT CAATGGGTGC AAAAAAACGT GTTGAACTTT TGGCCTAGTGTCAAAATCAA GTACGTGGCA GTTGGAAATG AAGTGAGTCC CGTTGGAGGCTCTTCTTCGG TAGCCCAATA TGTTCTACCT GCCATCCAAA ATGTATACCAAGCAATAAGA GCTCAAGGCC TTCATGATCA AATCAAGGTT TCAACATCTATTGACATGAC CCTAATAGGA AACTCTTTCC CTCCATCGCA AGGTTCCTTCAGGGGTGATG TGAGATCATA CCTAGATCCC ATAATTGGGT ACTTGGTATATGCAAATGCA CCATTACTAG TCAATGTGTA CCCTTATTTT AGTTACACTGGTAACCCCCG TGACATATCA CTTCCCTATG CTCTTTTCAC AGCACCAAATGTTGTGGTAT GGGATGGTCA ATATGGGTAC CAAAATTTGT TTGATGCTATGTTGGATTCA GTACATGCAG CCATTGATAA CACTAAGATT GGTTATGTGGAGGTTGTTGT ATCCGAGAGT GGGTGGCCAT CAGATGGAGG ATTTGCTGCCACTTATGACA ACGCACGCGT GTACTTAGAC AATTTGGTTC GTCGTGCTAATAGAGGAAGC CCAAGAAGGC CTTCGAAGCC CACTGAGACT TATATATTTGCCATGTTCGA TGAAAATCAA AAAAATCCAG AGATAGAGAA ACATTTTGGGCTCTTCAATC CCAACAAACA AAAAAAA.__________________________________________________________________________

8. A DNA construct according to claim 6, wherein the nucleotide sequence coding for the amino acid sequence (a.sub.2) (SEQ ID NO. 7) is the following sequence (Na.sub.2) (SEQ ID NO. 9)

__________________________________________________________________________ATGCCTTCTC TCTTCGCTAG AAACCAGAGG TTCTCATTGG CTACTCTCCTGCTTCTTCTG GAACTATTGA CAGGAAACCT TCGCATGGCA GATGCT.__________________________________________________________________________

9. A DNA construct according to claim 2 wherein the nucleotide sequence coding for the amino acid sequence (a.sub.4) (SEQ ID NO. 2) is the following sequence (Na.sub.4) (SEQ ID NO. 10)

__________________________________________________________________________TACCCATTTG GGTTTGGAGG AAAGAGGCTA GGGAAAGTTG TTATTGACGACTTCAATGCA ACAACTTCCA TTAAGAGTGA TGTG.__________________________________________________________________________

10. A bacterium which contains a DNA construct according to claim 1 operably linked to cis-acting signals effective for its replication and its expression in said bacterium.

11. A plant cell transformed with a DNA construct according to claim 1 operably linked to cis-acting signals effective for its expression in said cell.

12. A plant cell according to claim 11, which belongs to a species selected from the group consisting of Nicotiana tabacum, Helianthus annuus and Brassica napus.

13. A plant or plant part, which plant or plant part contains a DNA construct according to claim 1 operably linked to cis-acting signals effective for its expression in said plant or plant part.

14. A plant or plant part according to claim 13, which plant or plant part belongs to a species selected from the group consisting of Nicotiana tabacum, Helianthus annuus and Brassica napus.

15. A plant part according to claim 13, which is capable of forming a complete new plant or of producing seeds.

16. A plant part according to claim 15, which is a seed.

17. An isolated, purified protein having .beta.-1,3-glucanase activity, which comprises a region having the amino acid sequence (a.sub.1) (SEQ ID NO. 1)

______________________________________Ile Gly Val Cys Tyr Gly Met Leu Gly Asn Asn Leu Pro SerAla Asn Asp Val Ile Gly Leu Tyr Arg Ser Asn Asn Ile LysArg Met Arg Leu Tyr Asp Pro Asn Gln Ala Ala Leu Glu AlaLeu Arg Asn Ser Gly Ile Glu Leu Ile Leu Gly Val Pro AsnSer Asp Leu Gln Gly Leu Ala Thr Asn Pro Asp Thr Ser ArgGln Trp Val Gln Lys Asn Val Leu Asn Phe Trp Pro Ser ValLys Ile Lys Tyr Val Ala Val Gly Asn Glu Val Ser Pro ValGly Gly Ser Ser Ser Val Ala Gln Tyr Val Leu Pro Ala IleGln Asn Val Tyr Gln Ala Ile Arg Ala Gln Gly Leu His AspGln Ile Val Ser Thr Ser Ile Asp Met Thr Leu Ile GlyAsn Ser Phe Pro Pro Ser Gln Gly Ser Phe Arg Gly Asp ValArg Ser Tyr Leu Asp Pro Ile Ile Gly Tyr Leu Val Tyr AlaAsn Ala Pro Leu Leu Val Asn Val Tyr Pro Tyr Phe Ser TyrThr Gly Asn Pro Arg Asp Ile Ser Leu Pro Tyr Ala Leu PheThr Ala Pro Asn Val Val Val Trp Asp Gly Gln Tyr Gly TyrGln Asn Leu Phe Asp Ala Met Leu Asp Ser Val His Ala AlaIle Asp Asn Thr Lys Ile Gly Tyr Val Glu Val Val Val SerGlu Ser Gly Trp Pro Ser Asp Gly Gly Phe Ala Ala Thr TyrAsp Asn Ala Arg Val Tyr Asp Asn Leu Val Arg Arg AlaAsn Arg Gly Ser Pro Arg Arg Pro Ser Lys Pro Thr Glu ThrTyr Ile Phe Ala Met Phe Asp Glu Asn Gln Lys Asn Pro GluIle Glu Lys His Phe Gly Leu Phe Asn Pro Asn Lys Gln LysLys.______________________________________

18. An isolated, purified protein according to claim 17, further comprising immediately downstream of the sequence (a.sub.1) (SEQ ID NO. 1), a region having the amino acid sequence (a.sub.4) (SEQ ID NO. 2)

______________________________________Tyr Pro Phe Gly Phe Gly Gly Lys Arg Leu Gly LysVal Val Ile Asp Asp Phe Asn Ala Thr Thr Ser Ile Lys SerAsp Val.______________________________________

truncated in its carboxy-terminal portion by 0 to 27 amino acids.

19. An isolated, purified protein having .beta.-1,3-glucanase activity, comprising a region having the amino acid sequence (a.sub.5) (SEQ ID NO. 3)

______________________________________Gln Ile Gly Val Cys Tyr Gly Met Leu Gly Asn Asn Leu ProSer Ala Asn Asp Val Ile Gly Leu Tyr Arg Ser Asn Asn IleLys Arg Met Arg Leu Tyr Asp Pro Asn Gln Ala Ala Leu GluAla Leu Arg Asn Ser Gly Ile Glu Leu Ile Leu Gly Val ProAsn Ser Asp Leu Gln Gly Leu Ala Thr Asn Pro Asp Thr SerArg Gln Trp Val Gln Lys Asn Val Leu Asn Phe Trp Pro SerVal Lys Ile Lys Tyr Val Ala Val Gly Asn Glu Val Ser ProVal Gly Gly Ser Ser Ser Val Ala Gln Tyr Val Leu Pro AlaIle Gln Asn Val Tyr Gln Ala Ile Arg Ala Gly Gly Leu HisAsp Gln Ile Lys Val Ser Thr Ser Ile Asp Met Thr Leu IleGly Asn Ser Phe Pro Pro Ser Gln Gly Ser Phe Arg Gly AspVal Arg Ser Tyr Leu Asp Pro Ile Ile Gly Tyr Leu Val TyrAla Asn Ala Pro Leu Leu Val Asn Val Tyr Pro Tyr Phe SerTyr Thr Gly Asn Pro Arg Asp Ile Ser Leu Pro Tyr Ala LeuPhe Thr Ala Pro Asn Val Val Val Trp Asp Gly Gln Tyr GlyTyr Gln Asn Leu Phe Asp Ala Met Leu Asp Ser Val His AlaAla Ile Asp Asn Thr Lys Ile Gly Tyr Val Glu Val Val ValSer Glu Ser Gly Trp Pro Ser Asp Gly Gly Phe Ala Ala ThrTyr Asp Asn Ala Arg Val Tyr Leu Asp Asn Leu Val Arg ArgAla Asn Arg Gly Ser Pro Arg Arg Pro Ser Lys Pro Thr GluThr Tyr Ile Phe Ala Met Phe Asp Glu Asn Gln Lys Asn ProGlu Ile Glu Lys His Phe Gly Leu Phe Asn Pro Asn Lys GlnLys Lys Tyr Pro Phe Gly Phe Gly Gly Lys Arg Leu Gly LysVal Val Ile Asp Asp Phe Asn Ala Thr Thr Ser Ile Lys SerAsp Val.______________________________________

20. An isolated, purified protein according to claim 17, which possesses an apparent molecular mass of 36.+-.3 kDa.

21. An isolated, purified protein according to claim 17, which possesses an apparent molecular mass of 37.+-.3 kDa.

22. An isolated, purified protein according to claim 17, which possesses an apparent molecular mass of 39.+-.3 kDa.

23. A method for preparing a protein according to claim 17, which comprises culturing a bacterium of claim 10.

24. A method for preparing a protein according to claim 17, which comprises culturing a plant cell of claim 11.

25. A method for preparing a protein according to claim 17, which comprises culturing a plant or plant part of claim 13.