Recombinant DNA vectors for expression of somatotropins

Abstract

A family of somatotropin vectors with which micro-organisms, preferably bacteria such as, but not limited to E. coli, can be transformed to enable the expression of bovine somatotropin at high levels using conventional fermentation and induction conditions.

Description

BACKGROUND OF THE INVENTION

[0002] In mammals, growth hormones (somatotropins) are initially expressed in a pre-hormone form comprising a leader sequence which is removed during secretion of the mature, biologically active hormone from pituitary cells. As used herein, “mature” somatotropin (“ST”) means having an amino acid length essentially like those of the ST secreted into the bloodstream of the aninial, e.g., N-Ala-Phe-Pro- or N-Phe-Pro-bovine ST, N-Phe-Pro-human, -porcine (identical to canine) or -equine ST, etc.

[0003] Attempts to bacterially express human and bovine STs in non-secretion systems using structural genes having the sequences of their cDNAs were at first unsuccessful. Researchers succeeded after introducing silent mutations into the front end of the structural gene. P. H. Seeburg et al., attributed the original difficulties to translation being impeded by secondary structure of the mRNA corresponding to cDNA, and taught lessening such secondary structure to enable significant expression. DNA, Vol. 2, No. 1, 1983, pp. 37-45; U.S. Pat. Nos. 5,254,463 and 5,260,201.

[0004] It has been possible to obtain commercially viable ST expression levels using DNA containing certain silent mutations. However, the need for new vectors that are highly productive and less expensive to use has been difficult to satisfy because the relationships between the configurations and expression levels of “mature” somatotropin vectors remain poorly understood and highly unpredictable.

SUMMARY OF THE INVENTION

[0005] Described herein is a family of ST vectors with which micro-organisms, preferably bacteria such as, but not limited to E. coli, can be transformed to enable the expression of bovine ST (“bST”) at high levels using conventional fermentation and induction conditions. This family is exemplified by the 44 vectors listed in Table I each of which comprises the corresponding sequence of SEQ ID NOs 1 through 44, as indicated in Table I. Each of SEQ ID NOs 1 through 44, extends from an EcoRI site (GAATTC) before the promoter region, through the promoter, ribosome binding site (“RBS”) and entire bST structural gene, ending with the translation stop codon for the structural gene.

DETAILED DESCRIPTION OF THE INVENTION

[0006] Each of the vectors having SEQ ID NOs 1-44 includes a synthetic promoter, herein designated “cpex-20”, which is disclosed in PCT Appln. PCT/US00/40014 filed Mar. 31, 2000, which claims priority of U.S. Provisional Patent Appln. No. 60/127,449, filed Apr. 1, 1999. This promoter is situated between the EcoRI site (GAATTC) and the AscI site (GGCGCGCC). Various other conventional and novel promoters can be used in these vectors in lieu of cpex-20 to achieve good levels of ST expression.

[0007] To construct the expression vector pXT709, the synthetic EcoRI-HindIII DNA fragment shown in FIG. 1 (SEQ ID NO:50) was ligated into pBR322 (Boehringer Mannheim, Indianapolis, Ind.) which had been digested with EcoRI and HindIII. The resulting plasmid, designated pXT709, was then transformed into recA+ E. coli K-12 host strain and somatotropin production was induced with nalidixic acid.

[0008] To construct similar plasmids comprising the other sequences listed in the Sequence Listing (namely SEQ ID NOs 1-15, and 17-44), the corresponding synthetic DNA fragments could be similarly prepared and ligated into pBR322. Furthermore, the many other techniques and/or procedures for ligating the described DNA fragments, as shown in the Sequence Listing, into various other plasmids are known and routinely practiced by those of ordinary skill in the art. Moreover, plasmids suitable for transforming E. coli and/or other bacteria so as to achieve somatotropin production from cultures of the transformed bacteria are known and regularly used by ordinarily skilled artisans.

[0009] SEQ ID NOs 1-17 have an identical RBS, CATAACATCAAGAGGATATGAAATT (SEQ ID NO:45), herein designated “dps”, that is native to E. coli. SEQ ID NOs 18-29 share a novel synthetic RBS, GTACAAATCATAGAGGGTATTTAAT (SEQ ID NO:46) which is herein designated “L49”. SEQ ID NOs 30-42 share a second novel synthetic RBS, AGACACTAAATAGAGGGTATTTAATT (SEQ ID NO:47) herein designated “L437”. Seq. Nos. 43-44 share a third novel synthetic RBS, TAAAAGAGACTAGGAGGAGATTAGA (SEQ ID NO:48), herein designated “R806”. Each RBS is situated between the AscI site and the ATG translation start codon of the bST structural gene. The AscI site begins at coordinate 76 of each sequence. The ATG start codon begins at approximately coordinate 109; this can vary slightly due to the RBSs employed having slightly different lengths.

[0010] All of the vectors listed in Table I (respectively comprising SEQ ID NOS 1-44) have structural genes that differ from cDNA encoding “mature” bST by containing various arrays of silent changes within the nucleotides encoding the first 16 codons of bST. As shown in FIG. 1, vector pXT709 (SEQ ID NO: 50) differs from pXT674 (SEQ ID NO: 49) by having an additional 12 codons within the structural gene changed from those of cDNA, 11 to E. coli-preferred codons and a twelfth to eliminate an undesirable restriction site, by changing the translation stop codon to two tandem stop codons, and by substituting a different terminator which has two lacUV5 promoters in tandem. pXT703 (comprising SEQ ID NO:15) and pXT747 (comprising SEQ ID NO:17) differ from pXT601 (comprising SEQ ID NO:2) and pXT686 (comprising SEQ ID NO:13), respectively, in the same way.

[0011] Each of the vectors comprising SEQ ID NOs 1 through 44 have expressed mature bST at unoptimized levels of at least about 3.5 grams/liter (“gm/l”), most of them above 4.5 gm/l, and some at 7 gm/l or higher, using the fermentation conditions described in Bogosian et al., J. Biol. Chem., vol. 264, pp. 531-39, Jan. 5, 1989, except that 50 ppm of nalidixic acid was used as the inducer instead of indole acrylic acid.

[0012] The expression levels of mature ST vectors are very unpredictable from published teachings, e.g., P. H. Seeburg et al. In fact, the vectors comprising the sequences of SEQ ID NOs 1 through 17, 30 through 35, and 37 through 42 have been found, using calculations as recommended in Seeburg et al., to have mRNA secondary structure greater than, rather than lessened from that of bST cDNA.

TABLE I
SEQ ID NO	RBS	pXT
1	dps	600
2	dps	601
3	dps	602
4	dps	658
5	dps	670
6	dps	672
7	dps	673
8	dps	674
9	dps	675
10	dps	676
11	dps	682
12	dps	683
13	dps	686
14	dps	689
15	dps	703
16	dps	709
17	dps	747
18	L49	487
19	L49	536
20	L49	541
21	L49	542
22	L49	548
23	L49	549
24	L49	562
25	L49	576
26	L49	579
27	L49	580
28	L49	581
29	L49	584
30	L437	491
31	L437	529
32	L437	530
33	L437	619
34	L437	605
35	L437	606
36	L437	607
37	L437	620
38	L437	631
39	L437	632
40	L437	633
41	L437	635
42	L437	681
43	R806	483
44	R806	564

[0013]

Claims

1. A vector useful for expressing mature bovine somatotropin in E. coli and comprising a DNA sequence selected from the group consisting of SEQ ID NOs 1 through 44.

2. A vector of claim 1 comprising a DNA sequence selected from the group consisting of SEQ ID NOs 1 through 17, 30 through 35 and 37 through 42.

3. A vector of claim 1 comprising a DNA sequence essentially like that of SEQ ID NO: 16.

4. E. coli transformed with a vector of claim 1, 2 or 3.

5. A process for making mature bovine somatotropin comprising fermenting an E. coli of claim 4 and inducing expression of the somatotropin.

6. DNA that is functional as an E. coli ribosome binding site, comprising the sequence of L49 (SEQ ID NO: 46), L437 (SEQ ID NO: 47), or R806 (SEQ ID NO: 48), or a DNA sequence complementary thereto.