Patent Grant
10508279
This application claims the benefit of priority to Chinese Application No. 201710616371.6, entitled “A recombinant Escherichia coli for high efficiency production of fructosylated chondroitin and method for making thereof”, filed Jul. 26, 2017 and which are herein incorporated by reference in the entirety.
The invention relates to the field of biotechnology engineering, and more particularly relates to a recombinant Escherichia coli for efficient production of fructosylated chondroitin and the method for constructing the recombinant strain.
Chondroitin sulfate (CS) is an unbranched acidic polysaccharide made of alternating units of D-glucuronic acid (D-GlcUA) and N-acetyl-galactosamine (GalNAc) connected by β-1,3 bond and β-1,4 bond. It is widely distributed in human cartilage, tendon, disc and other connective tissues. CS, hyaluronic acid, heparin, and keratan sulfate can make glycosaminoglycans. CS and its analogues have a variety of biological activity and medicinal value. They are clinically used to treat rheumatism and arthritis and confer cartilage anti-deformability and gel-like properties. They are so called human body's “soft gold”. In addition, CS and analogues can be used as dietary supplement and humectants in the fields of food and cosmetics.
At present, the main method for industrial production of chondroitin sulfate and analogues is extraction from animal tissues, such as animal cartilage of pigs, cattle, sharks, etc., by alkali hydrolysis and protease hydrolysis. However, the extraction method has many problems, such as the restricted supply of raw materials, complicated production technology, unstable product quality, low level of industrialization and serious environmental pollution, which severely limit the development of industrial production of chondroitin sulfate and analogues. Therefore, domestic and foreign scholars continue to search for microbial fermentation methods for efficient production of chondroitin sulfate and analogues.
In recent years, researchers have systematically studied the production of chondroitin sulfate and its analogues using biochemical and metabolic engineering approaches. In 1988, it was found that the capsular polysaccharide from Escherichia. coli O10:K4:H4 is a chondroitin sulfate analogue (fructosylated chondroitin). In 1996, the yield of fructosylated chondroitin reached 300 mg·L−1 using the fermentation method. The yield of fructosylated chondroitin was further improved by overexpression of key enzymes such as chondroitin Polymerase KfoC and antiterminator RfaH. Further improving the yield of fructosylated chondroitin for industrial production is an urgent problem to be solved.
To solve the above problems, the present invention provides a recombinant E. coli that can produce high yield of fructosylated chondroitin and methods for producing fructosylated chondroitin using the recombinant strain. The present invention can efficiently produce fructosylated chondroitin via overexpressing key enzymes of fructosylated chondroitin synthesis pathway, laying a foundation for the industrial production of fructosylated chondroitin.
The present invention provides a recombinant E. coli that can produce fructosylated chondroitin efficiently, and the recombinant E. coli overexpresses phosphoglucosamine mutase and aminotransferase.
In one embodiment of the present invention, the phosphoglucosamine mutase and aminotransferase are connected to an expression vector through ribosome binding site 1 (RBS1), and the nucleotide sequence of the RBS1 is set forth in SEQ ID NO:5.
In one embodiment of the present invention, the phosphoglucosamine mutase is fused with the aminotransferase.
In one embodiment of the present invention, the amino acid sequence of said phosphoglucosamine mutase is set forth in SEQ ID NO:1, and the amino acid sequence of said aminotransferase is set forth in SEQ ID NO:2.
In one embodiment of the present invention, the RBS1, the phosphoglucosamine mutase gene (glmM), the linker GGGS and the aminotransferase gene (glmS) are fused together sequentially, and the fused gene is inserted into an expression vector whose nucleotide sequence is set forth in SEQ ID NO:7. The nucleotide sequence of RBS1 is set forth in SEQ ID NO:5, and the nucleotide sequence of the linker GGGS is set forth in SEQ ID NO:6.
In one embodiment of the present invention, the host of the recombinant E. coli is E. coli K4 ATCC23502.
The present invention provides a method of constructing a recombinant E. coli producing fructosylated chondroitin, comprises the following steps:
(1) obtaining the gene of phosphoglucosamine mutase whose amino acid sequence is set forth in SEQ ID NO:1, and the gene of aminotransferase whose amino acid sequence is set forth in SEQ ID NO:2;
(2) obtaining the DNA sequence of RBS1 whose nucleotide sequence is set forth in SEQ ID NO:5, and the DNA sequence of the linker GGGS whose nucleotide sequence is set forth in SEQ ID NO:6;
(3) obtaining the expression vector pETM6R1 whose nucleotide sequence is set forth in SEQ ID NO:7;
(4) fusing the RBS1, the phosphoglucosamine mutase gene, the linker GGGS and the aminotransferase gene together sequentially, and inserting the fused gene into expression vector pETM6R1 to obtain a recombinant plasmid pETM6R1-RBS1-glmM-GGGS-glmS;
(5) introducing the recombinant plasmid in step (4) into E. coli K4 ATCC 23502 to obtain a recombinant E. coli.
The present invention also provides a method of producing fructosylated chondroitin by batch fermentation of said recombinant E. coli. The fermentation medium contains 10 g·L−1 glycerol, 1 g·L−1 soy peptone, 2 g·L−1 KH2PO4, 10 g·L−1 K2HPO4, 0.1 g·L−1 MgCl2, 1 g·L−1 (NH4)2SO4, and 0.5 g·L−1 sodium citrate; the feeding medium contains 400 g·L−1 glycerol, 40 g·L−1 soy peptone; and the method is performed by cultivating the recombinant strain with a fed-batch fermentation at 37° C.
In one embodiment of the present invention, said batch fermentation is performed in a 5-L bioreactor with an inoculation ratio of 5-15%; 0.05-0.15 mmol IPTG is added to induce the expression of exogenous genes at 5-10 hr after inoculation, and the inducing temperature is 35-38° C.
In one embodiment of the present invention, the feeding strategy used in the fermentation is pH-stat. The feeding starts when the dissolved oxygen suddenly rises during the fermentation process. When the pH exceeds 7.0, the feeding process starts. When pH falls below 7.0, the feeding process stops.
The present invention using the method of fusion gene expression to achieve high efficiency expression of phosphoglucosamine mutase and aminotransferase genes. The recombinant E. coli strain can improve the yield of fructosylated chondroitin. Compared to the wild type E. coli K4 ATCC 23502, the yield of fructosylated chondroitin from recombinant strain is increased by 108.9% from 1.91 g·L−1 to 3.99 g·L−1. The method of the invention has great potential for increasing the yield of fructosylated chondroitin in industrial production.
The following examples are intended for illustration purpose only, and not intended to limit the scope of the invention.
Materials and Methods:
Information of related nucleotide sequences:
(1) SEQ ID NO:1 is the amino acid sequence of phosphoglucosamine mutase from Escherichia coli.
(2) SEQ ID NO:2 is the amino acid sequence of aminotransferase from Escherichia coli.
(3) SEQ ID NO:3 is the nucleotide sequence of a regulatory DNA fragment RBS1-glmM-GGGS-glmS.
(4) SEQ ID NO:4 is the nucleotide sequence of inducible promoter pTrc.
(5) SEQ ID NO:5 is the nucleotide sequence of RBS1.
(6) SEQ ID NO:6 is the nucleotide sequence of GGGS.
(7) SEQ ID NO:7 is the nucleotide sequence of vector of pETM6R1.
The glucuronic acid of the fructosylated chondroitin was determined by the modified carbazole assay. The concentration of fructosylated chondroitin was 2.88 times of that of the glucuronic acid.
The phosphoglucosamine mutase glmM gene and the aminotransferase glmS gene were cloned from Escherichia coli K4 (ATCC23502). The E. coli K4 was inoculated into 25 mL Luria-Bertani (LB) liquid medium and cultured at 37° C., 200 rpm, for 12 hr. The bacterial cells were then harvested and the genomic DNA of the E. coli cells was extracted using a bacterial genomic DNA extraction kit.
Based on published genomic sequence database, primer pairs RH-glmM-S1/RH-glmM-A (SEQ ID NO:8/SEQ ID NO:9) and RH-glmS-S/RH-glmS-A (SEQ ID NO:10/SEQ ID NO:11) were designed for amplification of the glmM and the glmS gene, respectively. Using the extracted genomic DNA as template, the E. coli. glmM and the glmS gene were amplified by standard PCR.
The fusion fragment RBS1-glmM-GGGS-glmS was obtained via the standard fusion PCR amplification system using the glmM-S1/RH-glmS-A primer pair and the obtained glmM and glmS gene sequence as templates.
The nucleotide sequences of primers RH-glmM-S1 and RH-glmM-A, RH-glmS-S and RH-glmS-A were shown as follows (from 5′ to 3′):
AAGAGGGCGCGGCAGAGAAGGAGGAGGTAAGAAAT
AGTTACTCAACCGTAACCGATTTTG
The fusion fragment RBS1-glmM-GGGS-glmS was purified using agarose gel electrophoresis and the purified product was ligated into the pMD19 T vector. The ligation system (total 10 μL) contained: 5 μL ligase solution, 4 μL the fusion fragment, 1 μL The pMD19 T vector. The ligation reaction was performed at 16° C. overnight. The ligated product was transformed into JM109 competent cells. Single colonies were picked up and positive transformants were confirmed by PCR amplification and DNA sequencing analysis. The successfully constructed recombinant plasmid was named as pMD19-RBS1-glmM-GGGS-glmS.
Fusion fragment RBS2-glmM-GGGS-glmS and RBS3-glmM-GGGS-glmS were obtained by the same method of Example 1, with the primer RH-glmM-S 1 substituted by RH-glmM-S2 (SEQ ID NO:12) and RH-glmM-S3 (SEQ ID NO:13), respectively.
The nucleotide sequences of primers RH-glmM-S2 and RH-glmM-S3 were shown as follows (from 5′ to 3′):
TATTTAAACTATCACGACATAAGGAGGTC
CGACATAACGTTAGAAAAGAATAAGG
Promoter pTrc was cloned from vector pTrcHisA by standard PCR amplification using primer pair pTrcHisA-S/pTrcHisA-A (SEQ ID NO:14/SEQ ID NO:15).
The nucleotide sequences of primer pair pTrcHisA-S and pTrcHisA-A were shown as follows (from 5′ to 3′):
ATCGAGATCGATCTCGATCCCGCGAAATT
GGTAATTTTTAATAATAAAGTTAATCG
The pTrc gene fragment and pETM6 vector were digested by restriction enzymes AvrII and XbaI, respectively. The digested fragments were purified by agarose gel electrophoresis and the purified fragments were used for ligation. The ligation products was transformed into JM109 competent cells and positive recombinant plasmid was verified by sequencing. The recombinant vector was designated as pETM6R1.
The E. coli JM109 strain that carried recombinant plasmid pMD19-RBS1-glmM-GGGS-glmS was incubated in 25 mL LB media at 37° C., 200 rpm for 12 hours, and the plasmid DNA was extracted by a plasmid DNA extraction kit. In Example 1, XbaI and XhoI restriction site were introduced into the RH-glmM-S1 and the RH-glmS-A primer, respectively. The recombinant plasmid pMD19-RBS1-glmM-GGGS-glmS and pETM6R1 were digested with XbaI and XhoI. The digested fragments were purified and ligated together. Then, the obtained ligation product was transformed into JM109 competent cells. The positive recombinant cells were verified by sequencing, and the recombinant plasmid was designated as pETM6R1-RBS1-glmM-GGGS-glmS. Finally, extracted recombinant plasmid was transformed into E. coli K4, and the positive recombinant E. coli K4 carrying pETM6R1-RBS1-glmM-GGGS-glmS was designated as ZQ33.
Using the same method as described in Example 4, fusion fragment RBS2-glmM-GGGS-glmS and RBS3-glmM-GGGS-glmS were insert into pETM6R1 to obtain plasmid pETM6R1-RBS2-glmM-GGGS-glmS and pETM6R1-RBS3-glmM-GGGS-glmS, respectively. The recombinant plasmids were transformed into E. coli K4 and the recombinant strains carrying plasmid pETM6R1-RBS2-glmM-GGGS-glmS and pETM6R1-RBS3-glmM-GGGS-glmS were designated as ZQ31 and ZQ32, respectively.
Recombinant strains ZQ31, ZQ32 and ZQ33 were fermented, respectively. Single colonies of the recombinant strains were grown in a LB media with 10 mg·mL−1 ampicillin at 37° C., 200 rpm for 10 hr. The seed cultures were transferred to a shake flask with a 1% inoculation volume. The cultivation in shake flask was performed on a rotary shaker at 200 rpm at 37° C. The inducer isopropyl β-D-1-thiogalactopyranoside (IPTG, 0.04 mmol) was added to induce the expression of exogenous glmM and glmS gene after 5 hr incubation at 37° C. Fermentation samples were periodically withdrawn to determine the fructosylated chondroitin production. The sample was centrifuged at 10,000 rpm for 15 min, the fermentation supernatant was transferred to another tube, and 3 volumes ethanol was added to precipitate fructosylated chondroitin at 4° C. for 10 hr. The precipitate was collected by centrifugation (10,000 rpm for 10 min) and dissolved in ultra-pure water. The suspension was used for determination of the yield of fructosylated chondroitin.
Recombinant strain ZQ33 was selected for Fed-batch fermentation, which was performed in a 5-L bioreactor by a pH-stat control mode. The initial volume was 2.5 L and the inoculation ratio was 10%. The temperature was maintained at 37° C. and the pH was controlled at 7.0 by aqueous ammonia. The medium for cultivation contained 10 g·L−1 glycerol, 1 g·L−1 soy peptone, 2 g·L−1 KH2PO4, 10 g·L−1 K2HPO4, 0.1 g·L−1 MgCl2, 1 g·L−1 (NH4)2SO4, and 0.5 g·L−1 sodium citrate. The feeding medium contained 400 g·L-1 glycerol, and 40 g·L-1 soy peptone. The fed-batch fermentation strategy uses fermentation pH as a feeding indicator. When glycerol was consumed during the fermentation and dissolved oxygen level showed a sharp increase, which leads to the pH increase to over 7 and triggers the start of feeding. When the culture pH drops to below 7, the feeding process stops. This feeding strategy continues until the end of the fermentation. IPTG was added to induce the expression of exogenous genes after 5 hr of fermentation. The yield of fructosylated chondroitin was measured every 4 hr as described in Example 6.
While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention, which is defined by the appended claims. All figures, tables, appendices, patents, patent applications and publications, referred to above, are hereby incorporated by reference.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2017 1 0616371 | Jul 2017 | CN | national |
| Number | Name | Date | Kind |
|---|---|---|---|
| 9758803 | Merighi | Sep 2017 | B2 |
| Number | Date | Country | |
|---|---|---|---|
| 20190032062 A1 | Jan 2019 | US |
