Patent Application
20080193483
The invention provides modified vaccinia Ankara (MVA), a replication-deficient strain of vaccinia virus, expressing human immunodeficiency virus (HIV) env, gag, and pol genes.
2. Description of the Related Art
Many novel candidates and approaches have been developed in the pursuit to identify an effective human immunodeficiency virus (HIV) vaccine. The induction of strong cell-mediated immunity and broadly reactive anti-envelope antibodies that can neutralize primary HIV-1 may be necessary in the making of an effective HIV-1 vaccine, and the ideal vaccine may need to induce both T and B cell responses. Plasmid DNA vaccination can elicit both humoral and cellular immune responses (Tang et al. 1992 Nature 356: 152-154; Ulmer et al. 1993 Science 259:1745-1749; and Wolff et al. 1990 Science 247:1465-1468) that protect nonhuman primates against challenges with nonpathogenic AIDS viruses (Boyer et al. 1997 Nat. Med. 3:526-532; and Letvin et al. 1997 PNAS U.S.A. 94:9378-9383.) and afford modest protection against disease from pathogenic simian immunodeficiency virus (SIV) (Egan et al. 2000 J. Virol. 74:7485-7495; and Lu et al. 1996 J. Virol. 70: 3978-3991).
Vaccines that have been designed to raise cellular immunity can in some cases control virulent viral challenges and prevent the development of AIDS in rhesus macaques (Amara et al. 2001 Science 292: 69-74; Barouch et al. 2000 Science 290: 486-492; Barouch et al. 2001 J. Virol. 75:5151-5158; Rose et al. 2001 Cell 106:539-549; and Shiver et al. 2002 Nature 415: 331-335). Priming the immune response with plasmid DNA followed by a recombinant poxvirus booster such as the modified vaccinia virus Ankara (Amara et al. 2001 Science 292:69-74 and Robinson et al. 2000 AIDS Rev. 2:105-110) or a VLP-protein boost plus IL-12/GM-CSF (O'Neill et al. 2003 AIDS Res. Hum. Retrovir. 19: 883-890 and O'Neill et al. 2002 J. Med. Primatol. 31: 217-227) are two of the many different approaches to raising cellular immunity. Including multiple HIV-1 gene regions on the same vector augments the DNA prime-MVA boost approach, as both gag and env responses are important to protection against virus challenge (Amara et al. 2002 J. Virol. 76:6138-6146). Lacking this potential advantage are HIV-1 DNA vaccines that encode only Gag or encode Gag, Env, and other viral proteins on separate DNA constructs (Barouch et al. 2000 Science 290: 486-492; Barouch et al. 2002 Nature 415:335-339 and Kang et al. 1999 Biol. Chem. 380: 353-364). Escape by HIV is possible when the immune response is driven by a single dominant epitope (Barouch et al. 2000 Science 290: 486-492; Barouch et al. 2002 Nature 415:335-339 and Mortara et al. 1998 J. Virol. 72: 1403-1410); thus, a multi-epitope or multi-protein response appears advantageous.
It is well established that VLP assembly and release from cells depend on proper intracellular protease regulation to preserve the Gag polyprotein (Gottlinger et al 1989 PNAS USA 86: 5781-5785; Karacostas et al. 1993 Virology 193:661-671 and Peng et al. 1989 J. Virol. 63:2550-2556) and may be observed upon transfection of Gag-only expression systems (Huang et al. 2001 J. Virol. 75: 4947-4951; Kang et al. 1999 Biol. Chem. 380: 353-364 and Schneider et al. 1997 J. Virol. 71:4892-4903). Previous studies demonstrated that alteration of the 25th residue of protease, from Asp (D) to Asn (N), resulted in complete loss of protease activity (Gottlinger et al. 1989 PNAS USA 86: 5781-5785; Kohl et al. 1988 PNAS USA 85:4686-4690 and Loeb et al. 1989 J. Virol. 63: 111-121). Furthermore, Jacobsen et al. (1995 Virology 206:527-534) demonstrated that mutagenesis of protease at positions 48 (G48V) and 90 (M90L) led to less efficient enzymatic activity and delayed processing of the gag and gag-pol polyproteins. Protease mutations at either amino acid positions 48 and 90 delay, but do not abolish, protease enzymatic activity, unlike the D25N mutation, and permit production of infectious virus when present within an otherwise wild-type provirus. A recent study suggested that the two protease mutations at positions 48 and 90 are not limiting, not only in terms of high-level production of HIV-1 proteins, but also with regard to assembly of VLPs (Ellenberger et al. 2004 Virology 319: 118-130).
One of the most promising HIV vaccines is the heterologous prime-boost approach. The prime may consist of a recombinant plasmid DNA or viral vector-expressing HIV proteins. The heterologous boost would be a recombinant viral vector (poxvirus or adenovirus) or second viral vector, optimizing the boost for the vaccine insert immunogen and not the vector itself. Using the same recombinant viral vector for the prime and boost may lead to a diminished immune response similar to preexisting immunity to the recombinant vector (Vogels et al 2003 J. Virol. 77: 8263-8271). Priming with a recombinant plasmid DNA and boosting with a recombinant MVA enhances the cellular responses to a common immunogen contained in both vectors (Amara et al. 2001 Science 292: 69-74; Hanke et al. 1998 Vaccine 16: 439-445; Schneider et al. 1998 Nat. Med. 4: 397-402; and Schneider et al. 2001 Vaccine 19: 4595-4602). At the peak effector phase of the immune response to the vaccine protocol, induced CD8 cells can reach very high frequencies of total CD8 cells (Allen et al 2000 J. Immunol. 164:4968-4978; Amara et al. 2001 Science 292: 69-74; and Horton et al. 2002 J. Virol. 76: 7187-7202).
The invention is related to a pharmaceutical composition comprising a recombinant MVA virus expressing an HIV env, gag, and pol gene or modified gene thereof for production of an HIV Env, Gag, and Pol antigen by expression from said recombinant MVA virus, where the HIV env gene is modified to encode an HIV Env protein composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacking part or all of the cytoplasmic domain of gp41, and a pharmaceutically acceptable carrier; where the HIV env, gag, or pol gene or modified gene thereof is taken from clade AG and said HIV env gene or modified gene thereof has SEQ ID NO: 1 or a sequence having at least about 97%, 98%, 99% or 99.9% identity thereto, and the HIV gag and pol gene(s) or modified gene(s) thereof has SEQ ID NO: 2 or a sequence having at least about 97%, 98%, 99% or 99.9% identity thereto; or the HIV env, gag, or pol gene or modified gene thereof is taken from clade B and the HIV env gene or modified gene thereof has SEQ ID NO: 3 or a sequence having at least about 97%, 98%, 99% or 99.9% identity thereto, and the HIV gag and pol gene(s) or modified gene(s) thereof has SEQ ID NO: 4 or a sequence having at least about 97%, 98%, 99% or 99.9% identity thereto; or the HIV env, gag, or pol gene or modified gene thereof is taken from clade C and the HIV env gene or modified gene thereof has SEQ ID NO: 5 or a sequence having at least about 97%, 98%, 99% or 99.9% identity thereto, and the HIV gag and pol gene(s) or modified gene(s) thereof has SEQ ID NO: 6 or a sequence having at least about 97%, 98%, 99% or 99.9% identity thereto; and related methods of making and methods of using thereof.
The following microorganism has been deposited in accordance with the terms of the Budapest Treaty with the American Type Culture Collection (ATCC), Manassas, Va., on the date indicated:
MVA 1974/NIH Clone 1 was deposited as ATCC Accession No.: PTA-5095 on Mar. 27, 2003 with the American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, Va. 20110-2209, USA. This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culture of the deposit for 30 years from date of deposit. The deposit will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Applicant and ATCC which assures permanent and unrestricted availability of the progeny of the culture of the deposit to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC § 122 and the Commissioner's rules pursuant thereto (including 37 CFR § 1.14). Availability of the deposited strain is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws.
Vaccinia virus, a member of the genus Orthopoxvirus in the family of Poxyiridae, was used as live vaccine to immunize against the human smallpox disease. Successful worldwide vaccination with vaccinia virus culminated in the eradication of variola virus, the causative agent of the smallpox (“The global eradication of smallpox. Final report of the global commission for the certification of smallpox eradication”. History of Public Health, No. 4, Geneva: World Health Organization, 1980). Since that WHO declaration, vaccination has been universally discontinued except for people at high risk of poxvirus infections (e.g. laboratory workers).
More recently, vaccinia viruses have also been used to engineer viral vectors for recombinant gene expression and for the potential use as recombinant live vaccines (Mackett, M. et al 1982 PNAS USA 79:7415-7419; Smith, G. L. et al. 1984 Biotech Genet Engin Rev 2:383-407). This entails DNA sequences (genes) which code for foreign. antigens being introduced, with the aid of DNA recombination techniques, into the genome of the vaccinia viruses. If the gene is integrated at a site in the viral DNA which is non-essential for the life cycle of the virus, it is possible for the newly produced recombinant vaccinia virus to be infectious, that is to say able to infect foreign cells and thus to express the integrated DNA sequence (EP Patent Applications No. 83,286 and No. 110,385). The recombinant vaccinia viruses prepared in this way can be used, on the one hand, as live vaccines for the prophylaxis of infectious diseases, on the other hand, for the preparation of heterologous proteins in eulcaryotic cells.
For vector applications health risks would be lessened by the use of a highly attenuated vaccinia virus strain. Several such strains of vaccinia virus were especially developed to avoid undesired side effects of smallpox vaccination. Thus, the modified vaccinia Ankara (MVA) has been generated by long-term serial passages of the Ankara strain of vaccinia virus (CVA) on chicken embryo fibroblasts (for review see Mayr, A. et al. 1975 Infection 3:6-14; Swiss Patent No. 568,392). The MVA virus is publicly available from American Type Culture Collection as ATCC No.: VR-1508. MVA is distinguished by its great attenuation, that is to say by diminished virulence and ability to replicate in primate cells while maintaining good immunogenicity. The MVA virus has been analyzed to determine alterations in the genome relative to the parental CVA strain. Six major deletions of genomic DNA (deletion I, II, III, IV, V, and VI) totaling 31,000 base pairs have been identified (Meyer, H. et al. 1991 J Gen Virol 72:1031-1038). The resulting MVA virus became severely host cell restricted to avian cells.
Furthermore, MVA is characterized by its extreme attenuation. When tested in a variety of animal models, MVA was proven to be avirulent even in immunosuppressed animals. More importantly, the excellent properties of the MVA strain have been demonstrated in extensive clinical trials (Mayr A. et al. 1978 Zentralbl Bakteriol [B] 167:375-390; Stickl et al. 1974 Dtsch Med Wschr 99:2386-2392). During these studies in over 120,000 humans, including high-risk patients, no side effects were associated with the use of MVA vaccine.
MVA replication in human cells was found to be blocked late in infection preventing the assembly to mature infectious virions. Nevertheless, MVA was able to express viral and recombinant genes at high levels even in non-permissive cells and was proposed to serve as an efficient and exceptionally safe gene expression vector (Sutter, G. and Moss, B. 1992 PNAS USA 89:10847-10851). Additionally, novel vaccinia vector vaccines were established on the basis of MVA having foreign DNA sequences inserted at the site of deletion III within the MVA genome (Sutter, G. et al. 1994 Vaccine 12:1032-1040).
The recombinant MVA vaccinia viruses can be prepared as set out hereinafter. A DNA-construct which contains a DNA-sequence which codes for a foreign polypeptide flanked by MVA DNA sequences adjacent to a naturally occurring deletion, e.g. deletion III, or other non-essential sites, within the MVA genome, is introduced into cells infected with MVA, to allow homologous recombination. Once the DNA-construct has been introduced into the eulcaryotic cell and the foreign DNA has recombined with the viral DNA, it is possible to isolate the desired recombinant vaccinia virus in a manner known per se, preferably with the aid of a marker. The DNA-construct to be inserted can be linear or circular. A plasmid or polymerase chain reaction product is preferred. The DNA-construct contains sequences flanking the left and the right side of a naturally occurring deletion, e.g. deletion III, within the MVA genome. The foreign DNA sequence is inserted between the sequences flanking the naturally occurring deletion. For the expression of a DNA sequence or gene, it is necessary for regulatory sequences, which are required for the transcription of the gene, to be present on the DNA. Such regulatory sequences (called promoters) are known to those skilled in the art, and include for example those of the vaccinia 11 ka gene as are described in EP-A-198,328, and those of the 7.5 kDa gene (EP-A-110,385). The DNA-construct can be introduced into the MVA infected cells by transfection, for example by means of calcium phosphate precipitation (Graham et al. 1973 Virol 52:456-467; Wigler et al. 1979 Cell 16:777-785), by means of electroporation (Neumann et al. 1982 EMBO J. 1:841-845), by microinjection (Graessmann et al. 1983 Meth Enzymol 101:482-492), by means of liposomes (Straubinger et al. 1983 Meth Enzymol 101:512-527), by means of spheroplasts (Schaffher 1980 PNAS USA 77:2163-2167) or by other methods known to those skilled in the art.
The etiological agent of acquired immune deficiency syndrome (AIDS) is recognized to be a retrovirus exhibiting characteristics typical of the lentivirus genus, referred to as human immunodeficiency virus (HIV). The phylogenetic relationships of the human lentiviruses are shown in
The earliest phylogenetic analyses of HIV-1 isolates focused on samples from Europe/North America and Africa; discrete clusters of viruses were identified from these two areas of the world. Distinct genetic subtypes or clades of HIV-1 were subsequently defined and classified into three groups: M (major); O (outlier); and N (non-M or O) (
Most current knowledge about HIV-1 genetic variation comes from studies of group M viruses of diverse geographic origin. Data collected during the past decade indicate that the HIV-1 population present within an infected individual can vary from 6% to 10% in nucleotide sequence. HIV-1 isolates within a lade may exhibit nucleotide distances of 15% in gag and up to 30% in gp120 coding sequences. Interclade genetic variation may range between 30% and 40% depending on the gene analyzed.
All of the HIV-1 group M subtypes can be found in Africa. Clade A viruses are genetically the most divergent and were the most common HIV-1 subtype in Africa early in the epidemic. With the rapid spread of HIV-1 to southern Africa during the mid to late 1990s, lade C viruses have become the dominant subtype and now account for 48% of HIV-1 infections worldwide. Clade B viruses, the most intensively studied HIV-1 subtype, remain the most prevalent isolates in Europe and North America.
High rates of genetic recombination are a hallmark of retroviruses. It was initially believed that simultaneous infections by genetically diverse virus strains were not likely to be established in individuals at risk for HIV-1. By 1995, however, it became apparent that a significant fraction of the HIV-1 group M global diversity included interclade viral recombinants. It is now appreciated that HIV-1 recombinants will be found in geographic areas such as Africa, South America, and Southeast Asia, where multiple HIV-1 subtypes coexist and may account for more than 10% of circulating HIV-1 strains. Molecularly, the genomes of these recombinant viruses resemble patchwork mosaics, with juxtaposed diverse HIV-1 subtype segments, reflecting the multiple crossover events contributing to their generation. Most HIV-1 recombinants have arisen in Africa and a majority contains segments originally derived from lade A viruses. In Thailand, for example, the composition of the predominant circulating strain consists of a lade A gag plus pol gene segment and a lade E env gene. Because the lade E env gene in That HIV-1 strains is closely related to the clade E env present in virus isolates from the Central African Republic, it is believed that the original recombination event occurred in Africa, with the subsequent introduction of a descendent virus into Thailand. Interestingly, no full-length HIV-1 subtype E isolate (i.e., with subtype E gag, pol, and env genes) has been reported to date.
The discovery that α and β chemokine receptors function as coreceptors for virus fusion and entry into susceptible CD4+ cells has led to a revised classification scheme for HIV-1 (
As is the case for all replication-competent retroviruses, the three primary HIV-1 translation products, all encoding structural proteins, are initially synthesized as polyprotein precursors, which are subsequently processed by viral or cellular proteases into mature particle-associated proteins (
The Gag proteins of HIV, like those of other retroviruses, are necessary and sufficient for the formation of noninfectious, virus-like particles. Retroviral Gag proteins are generally synthesized as polyprotein precursors; the HIV-1 Gag precursor has been named, based on its apparent molecular mass, Pr55Gag. As noted previously, the mRNA for Pr55Gag is the unspliced 9.2-kb transcript (
The HIV Pr55Gag precursor oligomerizes following its translation and is targeted to the plasma membrane, where particles of sufficient size and density to be visible by EM are assembled. Formation of virus-like particles by Pr55Gag is a self-assembly process, with critical Gag-Gag interactions taking place between multiple domains along the Gag precursor. The assembly of virus-like particles does not require the participation of genomic RNA (although the presence of nucleic acid appears to be essential), pol-encoded enzymes, or Env glycoproteins, but the production of infectious virions requires the encapsidation of the viral RNA genome and the incorporation of the Env glycoproteins and the Gag-Pol polyprotein precursor Pr160Gag-Po1.
Downstream of gag lies the most highly conserved region of the HIV genome, the pol gene, which encodes three enzymes: PR, RT, and IN (see
Early pulse-chase studies performed with avian retroviruses clearly indicated that retroviral Gag proteins are initially synthesized as polyprotein precursors that are cleaved to generate smaller products. Subsequent studies demonstrated that the processing function is provided by a viral rather than a cellular enzyme, and that proteolytic digestion of the Gag and Gag-Pol precursors is essential for virus infectivity. Sequence analysis of retroviral PRs indicated that they are related to cellular “aspartic” proteases such as pepsin and renin. Like these cellular enzymes, retroviral PRs use two apposed Asp residues at the active site to coordinate a water molecule that catalyzes the hydrolysis of a peptide bond in the target protein. Unlike the cellular aspartic proteases, which function as pseudodimers (using two folds within the same molecule to generate the active site), retroviral PRs function as true dimers. X-ray crystallographic data from HIV-1 PR indicate that the two monomers are held together in part by a four-stranded antiparallel β-sheet derived from both N- and C-terminal ends of each monomer. The substrate-binding site is located within a cleft formed between the two monomers. Like their cellular homologs, the HIV PR dimer contains flexible “flaps” that overhang the binding site and may stabilize the substrate within the cleft; the active-site Asp residues lie in the center of the dimer. Interestingly, although some limited amino acid homology is observed surrounding active-site residues, the primary sequences of retroviral PRs are highly divergent, yet their structures are remarkably similar.
By definition, retroviruses possess the ability to convert their single-stranded RNA genomes into double-stranded DNA during the early stages of the infection process. The enzyme that catalyzes this reaction is RT, in conjunction with its associated RNaseH activity. Retroviral RTs have three enzymatic activities: (a) RNA-directed DNA polymerization (for minus-strand DNA synthesis), (b) RNaseH activity (for the degradation of the tRNA primer and genomic RNA present in DNA-RNA hybrid intermediates), and (c) DNA-directed DNA polymerization (for second- or plus-strand DNA synthesis).
The mature HIV-1 RT holoenzyme is a heterodimer of 66 and 51 kd subunits. The 51-kd subunit (p51) is derived from the 66-kd (p66) subunit by proteolytic removal of the C-terminal 15-kd RNaseH domain of p66 by PR (see
In the RT-primer-template-dNTP structure, the presence of a dideoxynucleotide at the 3′ end of the primer allows visualization of the catalytic complex trapped just prior to attack on the incoming dNTP. Comparison with previously obtained structures suggests a model whereby the fingers close in to trap the template and dNTP prior to nucleophilic attack of the 3′-OH of the primer on the incoming dNTP. After the addition of the incoming dNTP to the growing chain, it has been proposed that the fingers adopt a more open configuration, thereby releasing the pyrophosphate and enabling RT to bind the next dNTP. The structure of the HIV-1 RNaseH has also been determined by x-ray crystallography; this domain displays a global folding similar to that of E. coli RNaseH.
A distinguishing feature of retrovirus replication is the insertion of a DNA copy of the viral genome into the host cell chromosome following reverse transcription. The integrated viral DNA (the provirus) serves as the template for the synthesis of viral RNAs and is maintained as part of the host cell genome for the lifetime of the infected cell. Retroviral mutants deficient in the ability to integrate generally fail to establish a productive infection.
The integration of viral DNA is catalyzed by integrase, a 32-kd protein generated by PR-mediated cleavage of the C-terminal portion of the HIV-1 Gag-Pol polyprotein (see
Retroviral IN proteins are composed of three structurally and functionally distinct domains: an N-terminal, zinc-finger-containing domain, a core domain, and a relatively nonconserved C-terminal domain. Because of its low solubility, it has not yet been possible to crystallize the entire 288-amino-acid HIV-1 IN protein. However, the structure of all three domains has been solved independently by x-ray crystallography or NMR methods. The crystal structure of the core domain of the avian sarcoma virus IN has also been determined. The N-terminal domain (residues 1 to 55), whose structure was solved by NMR spectroscopy, is composed of four helices with a zinc coordinated by amino acids His-12, His-16, Cys-40, and Cys-43. The structure of the N-terminal domain is reminiscent of helical DNA binding proteins that contain a so-called helix-turn-helix motif, however, in the HIV-1 structure this motif contributes to dimer formation. Initially, poor solubility hampered efforts to solve the structure of the core domain. However, attempts at crystallography were successful when it was observed that a Phe-to-Lys change at IN residue 185 greatly increased solubility without disrupting in vitro catalytic activity. Each monomer of the HIV-1 IN core domain (IN residues 50 to 212) is composed of a five-stranded P-sheet flanked by helices; this structure bears striking resemblance to other polynucleotidyl transferases including RNaseH and the bacteriophage MuA transposase. Three highly conserved residues are found in analogous positions in other polynucleotidyl transferases; in HIV-1 IN these are Asp-64, Asp-116 and Glu-152, the so-called D,D-35-E motif. Mutations at these positions block HIV IN function both in vivo and in vitro. The close proximity of these three amino acids in the crystal structure of both avian sarcoma virus and HIV-1 core domains supports the hypothesis that these residues play a central role in catalysis of the polynucleotidyl transfer reaction that is at the heart of the integration process. The C-terminal domain, whose structure has been solved by NMR methods, adopts a five-stranded P-barrel folding topology reminiscent of a Src homology 3 (SH3) domain. Recently, the x-ray structures of SIV and Rous sarcoma virus IN protein fragments encompassing both the core and C-terminal domains have been solved.
The HIV Env glycoproteins play a major role in the virus life cycle. They contain the determinants that interact with the CD4 receptor and coreceptor, and they catalyze the fusion reaction between the lipid bilayer of the viral envelope and the host cell plasma membrane. In addition, the HIV Env glycoproteins contain epitopes that elicit immune responses that are important from both diagnostic and vaccine development perspectives.
The HIV Env glycoprotein is synthesized from the singly spliced 4.3-kb Vpu/Env bicistronic mRNA (see
The HIV Env glycoprotein complex, in particular the SU (gp120) domain, is very heavily glycosylated; approximately half the molecular mass of gp160 is composed of oligosaccharide side chains. During transport of Env from its site of synthesis in the ER to the plasma membrane, many of the side chains are modified by the addition of complex sugars. The numerous oligosaccharide side chains form what could be imagined as a sugar cloud obscuring much of gp120 from host immune recognition. As shown in
A primary function of viral Env glycoproteins is to promote a membrane fusion reaction between the lipid bilayers of the viral envelope and host cell membranes. This membrane fusion event enables the viral core to gain entry into the host cell cytoplasm. A number of regions in both gp120 and gp41 have been implicated, directly or indirectly, in Env-mediated membrane fusion. Studies of the HA2 hemagglutinin protein of the orthomyxoviruses and the F protein of the paramyxoviruses indicated that a highly hydrophobic domain at the N-terminus of these proteins, referred to as the fusion peptide, plays a critical role in membrane fusion. Mutational analyses demonstrated that an analogous domain was located at the N-terminus of the HIV-1, HIV-2, and SIV TM glycoproteins (see
C-terminal to the gp41 fusion peptide are two amphipathic helical domains (see
In the steps leading to membrane fusion CD4 binding induces conformation changes in Env that facilitate coreceptor binding. Following the formation of a ternary gp120/CD4/coreceptor complex, gp41 adopts a hypothetical conformation that allows the fusion peptide to insert into the target lipid bilayer. The formation of the gp41 six-helix bundle (which involves antiparallel interactions between the gp41 N- and C-helices) brings the viral and cellular membranes together and membrane fusion takes place.
The present invention relates to generation of a CD8+ T cell immune response against an antigen and also eliciting an antibody response. More particularly, the present invention relates to “prime and boost” immunization regimes in which the immune response induced by administration of a priming composition is boosted by administration of a boosting composition. The present invention is based on inventors' experimental demonstration that effective boosting can be achieved using modified vaccinia Ankara (MVA) vectors, following priming with any of a variety of different types of priming compositions including recombinant MVA itself.
A major protective component of the immune response against a number of pathogens is mediated by T lymphocytes of the CD8+ type, also known as cytotoxic T lymphocytes (CTL). An important function of CD8+ cells is secretion of gamma interferon (IFNγ), and this provides a measure of CD8+ T cell immune response. A second component of the immune response is antibody directed to the proteins of the pathogen.
The present invention employs MVA which, as the experiments described below show, has been found to be an effective means for providing a boost to a CD8+ T cell immune response primed to antigen using any of a variety of different priming compositions and also eliciting an antibody response.
Remarkably, the experimental work described below demonstrates that use of embodiments of the present invention allows for recombinant MVA virus expressing an HIV antigen to boost a CD8+ T cell immune response primed by a DNA vaccine and also eliciting an antibody response. The MVA was found to induce a CD8+ T cell response after intramuscular immunization.
Based on previous work (Amara et al 2001 Science 292:69-74), it is predicted that non-human primates immunized with plasmid DNA and boosted with the MVA would effectively protect against intramucosal challenge with live virus. Advantageously, the inventors contemplate that a vaccination regime using intradermal, intramuscular or mucosal immunization for both prime and boost can be employed, constituting a general immunization regime suitable for inducing CD8+ T cells and also eliciting an antibody response, e.g. in humans.
The present invention in various aspects and embodiments employs an MVA vector encoding an HIV antigen for boosting a CD8+ T cell immune response to the antigen primed by previous administration of nucleic acid encoding the antigen and also eliciting an antibody response.
A general aspect of the present invention provides for the use of an MVA vector for boosting a CD8+ T cell immune response to an HIV antigen and also eliciting an antibody response.
One aspect of the present invention provides a method of boosting a CD8+ T cell immune response to an HIV antigen in an individual, and also eliciting an antibody response, the method including provision in the individual of an MVA vector including nucleic acid encoding the antigen operably linked to regulatory sequences for production of antigen in the individual by expression from the nucleic acid, whereby a CD8+ T cell immune response to the antigen previously primed in the individual is boosted.
An immune response to an HIV antigen may be primed by immunization with plasmid DNA or by infection with an infectious agent.
A further aspect of the invention provides a method of inducing a CD8+ T cell immune response to an HIV antigen in an individual, and also eliciting an antibody response, the method comprising administering to the individual a priming composition comprising nucleic acid encoding the antigen and then administering a boosting composition which comprises an MVA vector including nucleic acid encoding the antigen operably linked to regulatory sequences for production of antigen in the individual by expression from the nucleic acid.
A further aspect provides for use of an MVA vector, as disclosed, in the manufacture of a medicament for administration to a mammal to boost a CD8+ T cell immune response to an HIV antigen, and also eliciting an antibody response. Such a medicament is generally for administration following prior administration of a priming composition comprising nucleic acid encoding the antigen.
The priming composition may comprise any viral vector, such as a vaccinia virus vector such as a replication-deficient strain such as modified vaccinia Ankara (MVA) or NYVAC (Tartaglia et al. 1992 Virology 118:217-232), an avipox vector such as fowlpox or canarypox, e.g. the strain known as ALVAC (Paoletti et al. 1994 Dev Biol Stand 82:65-69), or an adenovirus vector or a vesicular stomatitis virus vector or an alphavirus vector.
The priming composition may comprise DNA encoding the antigen, such DNA preferably being in the form of a circular plasmid that is not capable of replicating in mammalian cells. Any selectable marker should not be resistance to an antibiotic used clinically, so for example Kanamycin resistance is preferred to Ampicillin resistance. Antigen expression should be driven by a promoter which is active in mammalian cells, for instance the cytomegalovirus immediate early (CMV IE) promoter.
In particular embodiments of the various aspects of the present invention, administration of a priming composition is followed by boosting with a boosting composition, or first and second boosting compositions, the first and second boosting compositions being the same or different from one another. Still further boosting compositions may be employed without departing from the present invention. In one embodiment, a triple immunization regime employs DNA, then adenovirus as a first boosting composition, then MVA as a second boosting composition, optionally followed by a further (third) boosting composition or subsequent boosting administration of one or other or both of the same or different vectors. Another option is DNA then MVA then adenovirus, optionally followed by subsequent boosting administration of one or other or both of the same or different vectors.
The antigen to be encoded in respective priming and boosting compositions (however many boosting compositions are employed) need not be identical, but should share at least one CD8+ T cell epitope. The antigen may correspond to a complete antigen, or a fragment thereof. Peptide epitopes or artificial strings of epitopes may be employed, more efficiently cutting out unnecessary protein sequence in the antigen and encoding sequence in the vector or vectors. One or more additional epitopes may be included, for instance epitopes which are recognized by T helper cells, especially epitopes recognized in individuals of different HLA types. Priming and boosting may be administered intradermally, intramuscularly or mucosally.
An HIV antigen of the invention to be encoded by a recombinant MVA virus includes polypeptides having immunogenic activity elicited by an amino acid sequence of an HIV Env, Gag, Pol, Vif, Vpr, Tat, Rev, Vpu, or Nef amino acid sequence as at least one CD8+ T cell epitope. This amino acid sequence substantially corresponds to at least one 10-900 amino acid fragment and/or consensus sequence of a known HIV Env or Pol; or at least one 10-450 amino acid fragment and/or consensus sequence of a known HIV Gag; or at least one 10-100 amino acid fragment and/or consensus sequence of a Imown HIV Vif, Vpr, Tat, Rev, Vpu, or Nef.
Although a full length Env precursor sequence is presented for use in the present invention, Env is optionally deleted of subsequences. For example, regions of the gp120 surface and gp41 transmembrane cleavage products can be deleted.
Although a full length Gag precursor sequence is presented for use in the present invention, Gag is optionally deleted of subsequences. For example, regions of the matrix protein (p17), regions of the capsid protein (p24), regions of the nucleocapsid protein (p7), and regions of p6 (the C-terminal peptide of the Gag polyprotein) can be deleted.
Although a full length Pol precursor sequence is presented for use in the present invention, Pol is optionally deleted of subsequences. For example, regions of the protease protein (p10), regions of the reverse transcriptase protein (p66/p51), and regions of the integrase protein (p32) can be deleted.
Such an HIV Env, Gag, or Pol can have overall identity of at least 50% to a known Env, Gag, or Pol protein amino acid sequence, such as 50-99% identity, or any range or value therein, while eliciting an immunogenic response against at least one strain of an HIV.
Percent identify can be determined, for example, by comparing sequence information using the GAP computer program, version 6.0, available from the University of Wisconsin Genetics Computer Group (UWGCG). The GAP program utilizes the alignment method of Needleman and Wunsch (J Mol Biol 1970 48:443), as revised by Smith and Waterman (Adv Appl Math 1981 2:482). Briefly, the GAP program defines identity as the number of aligned symbols (i.e., nucleotides or amino acids) which are identical, divided by the total number of symbols in the shorter of the two sequences. The preferred default parameters for the GAP program include: (1) a unitary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov and Burgess (Nucl Acids Res 1986 14:6745), as described by Schwartz and Dayhoff (eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington, D.C. 1979, pp. 353-358); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.
In a preferred embodiment, an Env of the present invention is a variant form of at least one HIV envelope protein. Preferably, the Env is composed of gp120 and the membrane-spanning and ectodomain of gp41 but lacks part or all of the cytoplasmic domain of gp41.
Known HIV sequences are readily available from commercial and institutional HIV sequence databases, such as GENBANK, or as published compilations, such as Myers et al. eds., Human Retroviruses and AIDS, A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences, Vol. I and II, Theoretical Biology and Biophysics, Los Alamos, N. Mex. (1993), or http://hiv-web.1an1.gov/.
Substitutions or insertions of an HIV Env, Gag, or Pol to obtain an additional HIV Env, Gag, or Pol, encoded by a nucleic acid for use in a recombinant MVA virus of the present invention, can include substitutions or insertions of at least one amino acid residue (e.g., 1-25 amino acids). Alternatively, at least one amino acid (e.g., 1-25 amino acids) can be deleted from an HIV Env, Gag, or Pol sequence. Preferably, such substitutions, insertions or deletions are identified based on safety features, expression levels, illmunogenicity and compatibility with high replication rates of MVA.
Amino acid sequence variations in an HIV Env, Gag, or Pol of the present invention can be prepared e.g., by mutations in the DNA. Such HIV Env, Gag, or Pol include, for example, deletions, insertions or substitutions of nucleotides coding for different amino acid residues within the amino acid sequence. Obviously, mutations that will be made in nucleic acid encoding an HIV Env, Gag, or Pol must not place the sequence out of reading frame and preferably will not create complementary domains that could produce secondary mRNA structures.
HIV Env, Gag, or Pol-encoding nucleic acid of the present invention can also be prepared by amplification or site-directed mutagenesis of nucleotides in DNA or RNA encoding an HIV Env, Gag, or Pol and thereafter synthesizing or reverse transcribing the encoding DNA to produce DNA or RNA encoding an HIV Env, Gag, or Pol, based on the teaching and guidance presented herein.
Recombinant MVA viruses expressing HIV Env, Gag, or Pol of the present invention, include a finite set of HIV Env, Gag, or Pol-encoding sequences as substitution nucleotides that can be routinely obtained by one of ordinary skill in the art, without undue experimentation, based on the teachings and guidance presented herein. For a detailed description of protein chemistry and structure, see Schulz, G. E. et al., 1978 Principles of Protein Structure, Springer-Verlag, New York, N.Y., and Creighton, T. E., 1983 Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, Calif. For a presentation of nucleotide sequence substitutions, such as codon preferences, see Ausubel et al. eds. Current Protocols in Molecular Biology, Greene Publishing Assoc., New York, N.Y. 1994 at §§ A.1.1-A.1.24, and Sambrook, J. et al. 1989 Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold. Spring Harbor, N.Y. at Appendices C and D.
Thus, one of ordinary skill in the art, given the teachings and guidance presented herein, will now how to substitute other amino acid residues in other positions of an HIV env, gag, or pol DNA or RNA to obtain alternative HIV Env, Gag, or Pol, including substitutional, deletional or insertional variants.
Within the MVA vector, regulatory sequences for expression of the encoded antigen will include a natural, modified or synthetic poxvirus promoter. By “promoter” is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3′ direction on the sense strand of double-stranded DNA). “Operably linked” means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is “under transcriptional initiation regulation” of the promoter. Other regulatory sequences including terminator fragments, polyadenylation sequences, marker genes and other sequences may be included as appropriate, in accordance with the knowledge and practice of the ordinary person skilled in the art: see, for example, Moss, B. (2001). Poxyiridae: the viruses and their replication. In Fields Virology, D. M. Knipe, and P. M. Howley, eds. (Philadelphia, Lippincott Williams & Wilkins), pp. 2849-2883. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, 1998 Ausubel et al. eds., John Wiley & Sons.
Promoters for use in aspects and embodiments of the present invention must be compatible with poxvirus expression systems and include natural, modified and synthetic sequences.
Either or both of the priming and boosting compositions may include an adjuvant, such as granulocyte macrophage-colony stimulating factor (GM-CSF) or encoding nucleic acid therefor.
Administration of the boosting composition is generally about 1 to 10 months after administration of the priming composition, preferrably about 1 to 6 months, preferably about 1 to 4 months, preferably about 1 to 3 months.
Preferably, administration of priming composition, boosting composition, or both priming and boosting compositions, is intradermal, intramuscular or mucosal immunization.
Administration of MVA vaccines may be achieved by using a needle to inject a suspension of the virus. An alternative is the use of a needleless injection device to administer a virus suspension (using, e.g., Biojector™ needleless injector) or a resuspended freeze-dried powder containing the vaccine, providing for manufacturing individually prepared doses that do not need cold storage. This would be a great advantage for a vaccine that is needed in rural areas of Africa.
MVA is a virus with an excellent safety record in human immunizations. The generation of recombinant viruses can be accomplished simply, and they can be manufactured reproducibly in large quantities. Intradermal, intramuscular or mucosal administration of recombinant MVA virus is therefore highly suitable for prophylactic or therapeutic vaccination of humans against AIDS which can be controlled by a CD8+ T cell response.
The individual may have AIDS such that delivery of the antigen and generation of a CD8+ T cell immune response to the antigen is of benefit or has a therapeutically beneficial effect.
Most likely, administration will have prophylactic aim to generate an immune response against HIV or AIDS before infection or development of symptoms.
Components to be administered in accordance with the present invention may be formulated in pharmaceutical compositions. These compositions may comprise a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g. intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
As noted, administration is preferably intradermal, intramuscular or mucosal.
Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
For intravenous, cutaneous, subcutaneous, intramuscular or mucosal injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection. Preservatives, stabilizers, buffers, antioxidants and/or other additives may be included as required.
A slow-release formulation may be employed.
Following production of MVA particles and optional formulation of such particles into compositions, the particles may be administered to an individual, particularly human or other primate. Administration may be to another mammal, e.g. rodent such as mouse, rat or hamster, guinea pig, rabbit, sheep, goat, pig, horse, cow, donkey, dog or cat.
Administration is preferably in a “prophylactically effective amount” or a “therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy), this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, or in a veterinary context a veterinarian, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 16th edition, 1980, Osol, A. (ed.).
In one preferred regimen, DNA is administered at a dose of 250 μg to 2.5 mg/injection, followed by MVA at a dose of 106 to 109 infectious virus particles/injection.
A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
Delivery to a nonhuman mammal need not be for a therapeutic purpose, but may be for use in an experimental context, for instance in investigation of mechanisms of immune responses to an antigen of interest, e.g. protection against HIV or AIDS.
Further aspects and embodiments of the present invention will be apparent to those of ordinary skill in the art, in view of the above disclosure and following experimental exemplification, included by way of illustration and not limitation, and with reference to the attached figures.
1. Plasmid shuttle vector LAS-1—This plasmid shuttle vector, which inserts into deletion III of the MVA genome, was constructed in the following steps: The P11 vaccinia virus promoter and the Escherichia coli glucuronidase (GUS) gene were removed from pLW-51 (Wyatt, L. S. et al. 2004 AIDS Res. Human Retroviruses 20:645-653) by AscI and SacI digestion. The P11 vaccinia promoter and green fluorescent protein (GFP) with AscI and SacI ends, obtained by PCR amplification from pLW-44 (Bisht, H. et al. 2004 PNAS USA 101:6641-6646), were ligated into the vector making pLW-51GFP. The psynII promoter was removed from pLW-51GFP by XhoI and NotI digestion, blunted, and religated to make LAS-1.
2. Plasmid shuttle vector LAS-2—This plasmid shuttle vector, which inserts into deletion II of the MVA genome, was constructed in the following manner: pLW-37 was made by annealing 2 oligos comprising complementary strands of the mH5 promoter (Wyatt, L. S. et al. 1996 Vaccine 14:1451-58) with HincII site at the beginning and SmaI end and inserting this into the SmaI site of pLW-16 (Wyatt, L. S. et al. 1999 Vaccine 18:392-397). The last 217 bases of MVA flank 2 were duplicated with KpnI, AscI, and SacI sites on the end of the inside oligo and KpnI site on the end of the outside oligo, and inserted into the KpnI site of pLW-37. This plasmid, designated pLW-37a, was digested with AscI and SacI, and P11 vaccinia promoter and green fluorescent protein (GFP) with AscI and SacI ends (obtained by PCR amplification of P11 promoter and GFP from pLW-44 as described above) was inserted into it. The resulting plasmid was designated pLAS-2.
I. pLW-51
The plasmid transfer vector pLW-51 was constructed as follows. The mH5 promoter (Wyatt et al. 1996 Vaccine 14:1451-1458) was inserted into plasmid pG01 (Sutter and Moss. 1992 PNAS USA 89:10847-10851), which contains 926 and 530 bp of DNA that flank deletion III (del III). Gag-pol sequences from HIV lade B (strain BH10) DNA in plasmid GA2/JS2 (GenBank accession #AF42688) (Smith et al., 2004 AIDS Res Human Retroviruses 20:654-665) were amplified using the polymerase chain reaction (PCR) and inserted into the TA cloning plasmid pCR2.1 (Invitrogen Corp., Carlsbad, Calif.). The first 1872 nucleotides of the HIV strain BH10 gag-pol open reading frame (ORF) were replaced with the corresponding portion of the HXB2 gag ORE to enhance virus-like particle (VLP) formation. This chimeric gag-pol ORE was inserted into the modified pG01 plasmid after the mH5 promoter. The last 280 bp of the left MVA flank was duplicated and the P11 vaccinia virus promoter and the Escherichia coli glucuronidase (GUS) gene were inserted between the two direct repeats in order to implement a transient markerstabilization recombinant virus isolation protocol (Wyatt et al. 2004 AIDS Res. Human Retrovir. 20:645-653).
Plasmid pG01
Plasmids. Sequences of MVA DNA flanking the site of a 3500-bp deletion in the HindIII A fragment of the MVA genome were amplified by PCR and cloned into pGEM 4Z (Promega). The primers for the left 900-bp DNA flank were 5′-CAGCAGGAATTCGTTGGTGGTCGCCATGGATGGTGT-3′ (SEQ ID NO: 14) and 5′-GGGGGGGGTACCTACCAGCCACCGAAAGAG-3′ (SEQ ID NO: 15) (sites for restriction enzymes EcoRI and Kpn I are underlined). The primers for the right 600-bp DNA flank were 5′-GGGGGGCTGCAGTTTGGAAAGTTTTATAGGGGGGGGCTGCAGTTTGGAAAGTT TTATAGG-3′ (SEQ ID NO: 16) and 5′-GGGGGGAAGCTTAACTAGTTTCTGGTG-3′ (SEQ ID NO: 17) (sites for the restriction enzymes Pst I and HindIII are underlined). Between these flanks of MVA DNA, the Escherichia coli lacZ gene under control of the vaccinia virus late promoter P1 and the E. coli gpt gene under control of the vaccinia virus early/late promoter P7.5 were cloned (Sutter and Moss 1992 PNAS USA 89:10847-10851).
II. pLW44
pLW44 contains a gene encoding enhanced GFP regulated by the vaccinia virus P11 late promoter.
III. pLW-16
A new plasmid transfer vector, pLW-17, was constructed to allow insertion into deletion II located on the left side of the MVA genome (H. Meyer, et al. 1991 J. Gen. Virol. 72:1031-1038) as follows. Flank 1 was prepared by PCR using primers beginning at nucleotide 52 preceding the left side of deletion II, cloned into a T-A cloning vector, digested with SphI, and cloned into the SphI site of pGEM-4Z (Promega, Madison, Wis.). Flank 2 was prepared by PCR using primers containing EcoRI and KpnI compatible ends from the right side of deletion II and cloned into EcoRI and KpnI sites of pGEM-4Z. This plasmid containing the two flanking regions of deletion II was designated pLW-16. The modified H5 promoter was excised from pLW-9 by digestion with SmaI and PstI and cloned into SmaI and PstI sites of pLW-16, resulting in the new plasmid transfer vector, pLW-17. The F coding sequence of RSV-A2 was excised from a plasmid kindly provided by P. Collins and blunt ligated into the SmaI site of pLW-17 (Wyatt, L. S. et al. 1999 Vaccine 18:392-397).
This example describes the construction of a modified vaccinia virus Ankara (MVA) recombinant virus, MVA 65A/G, expressing clade A/G HIV strain 928 Env and Gag Pol. The salient features of this recombinant virus are:
1) A transient screening marker of green fluorescent protein (GFP) was used in construction of MVA 65A/G, so that the GFP is eliminated in the final virus product.
2) The A/G env gene is inserted into del II of MVA genome and the A/G gag pol is inserted in del III.
3) Both env and gag pol of MVA 65A/G are controlled by vaccinia PmH5 promoter.
4) The MVA virus used to make the recombinant MVA 65A/G is MVA 1974/NIH Clone 1.
The plasmid transfer vectors, pJD5 and pJD6 (
1. Gag/pol gene sequence of HIV A/G 928 (from pGA2/928/928+3RT) containing three mutations to inactivate reverse transcriptase activity (corresponding to that given for Clade B recombinant) with the integrase removed was cloned into pCR2.1 using FailSafe PCR kit. The gag/pol gene was cloned into MVA deletion m transfer vector pLAS-1 (containing transient screening marker GFP flanked by two direct repeats to eliminate GFP in the final virus) via SalI restriction endonuclease site, and gene expression was under control of the early/late modified H5 promotor. Sequences of the HIV A/G 928 gag/pol gene was confirmed by DNA sequencing, and this construct was designated pJD5 gag pol (
2. Env gene sequence of HIV A/G 928 (removed from pGA1/928/928 from Harriet Robinson) was truncated via PCR removal of 114 amino acids in the cytoplasmic tail of gp41 and cloned into pCR2.1. Silent mutations to eliminate 2 early poxvirus termination 5TNT signals were made (QuikChange Kit, Stratagene). The modified, truncated env gene was cloned into MVA deletion II transfer vector pLAS-2 (containing transient screening marker GFP flanked by two direct repeats to eliminate GFP in the final virus), with gene expression under control of the early/late modified H5 promotor. Sequence of the HIV A/G 928 env gene was confirmed by DNA sequencing, and this construct was designated pJD6 (
1. MVA 1974/NIH Clone 1 virus, which was derived from an MVA received from Anton Mayr (Munich, Germany) at passage 572 from Feb. 22, 1974 by terminally diluting 3 times at the National Institutes of Health, was used for recombination.
2. Secondary CEF made from 10 day old SPAFAS fertile chicken eggs (distributed by B&E Eggs, Stevens, Pa.) in six-well culture plates were infected at an MOI of 0.05 of MVA and transfected with approximately 1.5 μg of JD5 or JD6 (
3. Following a two day incubation at 37° C., the viruses were harvested, frozen and thawed 3×, and plated out on CEF.
4. At 3 days post-infection, those foci of infections that expressed GFP (indicating that recombination had occurred between the plasmid and the infecting virus) were picked and replated on CEF. Again, those foci that expressed GFP were picked. This process was repeated once more.
5. These 3× plaque-purified GFP-expressing foci were plated out in duplicate CEF plates and two plates were analyzed for GFP fluorescence and Gag or Env expression with T24 monoclonal antibody (envelope expression) or mAb 3537 (183-H12-5C, NIH AIDS Research and Reference Reagent Program) specific for Gag. Individual foci were picked from the duplicate replicate plate of those samples with little or no GFP fluorescence as well as mostly Gag or Env staining foci.
6. These foci were again plated out in duplicate, and analyzed the same way 1-2 additional times. The resulting recombinant viruses derived expressed either Gag Pol (vJD5gag/pol) or Env (vJD6env) proteins but had deleted the GFP gene by recombination of the double repeats.
1. To make the double MVA recombinant, MVA 65A/G, the two single recombinant MVA viruses, vJD5gag pol and vJD6 env, expressing Gag Pol and Env respectively, were used to infect CEF cells together at a MOI of 5, grown at 37C for 2 days and harvested (
2. Duplicate plates of the harvest were infected at different dilutions, and one plate was fixed and stained with T24 mAb and number of foci of infected cells that had rounded up CPE (characteristic of Gag Pol recombinants) were scored in order to assure there were double recombinants in the population. Then, foci with the rounded up morphology were picked from the unstained duplicate plate.
3. These foci were plated out at various dilutions in triplicate and immunostained for Env expression (T24 mAb) and Gag expression (3537 mAb). Those foci that stained for both Env and Gag expression were plaque purified 5 additional times.
4. The virus was expanded in CEF cells and a LVD Seed stock of MVA/HIV 65A/G 5.5×108 pfu/ml was produced. Mycoplasma testing by ATCC was negative. Sterility testing by BioReliance was negative. DNA sequencing confirmed both the env and the gag pol ORFs, as well as the deletion of the GFP reporter gene.
1. Aliquots of MVA 65A/G infected BS-C-1 cell lysates were analyzed by radioimmunoprecipitation (RIP) with monoclonal antibodies T24 and 3537 for expression of Envelope and Gag proteins, respectively (
2. Repeated passage of MVA 65A/G and analyzing the resultant virus has confirmed that MVA 65A/G is stable through 10 passages of the LVD Seed stock.
3. Sequencing a region of the MVA/HIV 62 genome consisting of the HIV inserts as well as a 1000 base pair region of the MVA genome flanking either sides of the HIV confirmed that the GFP gene has been deleted and the sequence of the HIV inserted genes are correct.
4. Immunogenicity was assessed by 107 pfu of purified MVA 65A/G inoculated into mice at 0 and 4 weeks. ELISA serum antibodies were assayed in a capture ELISA utilizing gp140 lade A env as the antigen. Table 1 shows the lade A env is immunogenic.
In summary, we have made a recombinant MVA virus, MVA 65A/G, which expresses the A/G 928 modified, truncated envelope and mutated gag pol. The MVA double recombinant virus was made by homologous recombination of single MVA recombinants, one expressing Env and one expressing Gag Pol. These single MVA recombinants were made using a transiently expressed GFP marker that was deleted in the final viruses. MVA/HIV 65A/G was shown to be stable through repeated passage of the LVD Seed Stock.
The immunogenicity of MVA 65A/G recombinant virus as measured by ELISA utilizing MVA lade A gp140 env as the antigen showed that MVA 65A/G envelope was not as immunogenic as hoped (See Table 1). This example describes the modification to the MVA 65A/G plasmid transfer vector, pJD-6, which was made to increase expression and immunogenicity of the A/G envelope, and its comparison to the original MVA 65A/G virus.
Modification to pJD-6
The plasmid transfer vector, pJD-6 was modified in the following way:
1. The A/G envelope gene was PCR amplified from pJD-6 with oligos which incorporated a SmaI site at the 5′ end of the lade A/G and a NotI site at the 3′ end of the env gene. This insert was cloned into the SmaI and NotI site of the pLAS-2 insertion vector making a transfer vector, JD-16 (
2. In pJD-6, the A/G 928 env was cloned into the multiple cloning site of pLAS-2 using the NotI restriction site. In this arrangement there is an intervening initiation codon between the promotor and the initiation codon of the envelope (part of the SphI restriction enzyme site). In pJD-16, the A/G 928 env was cloned into the multiple cloning site of pLAS-2 using the SmaI site at the beginning of the gene and Not I at the end of the gene, thus eliminating this intervening initiation codon. Thus, the intervening sequences between the end of the promoter and the start site of the env gene within the multiple cloning region are the only difference in the two plasmids as described below:
To make the double recombinant MVA virus with the JD-16 plasmid, the single MVA recombinant virus expressing the gag pol of the A/G virus, vJD5gag pol, as described above in the original MVA 65A/G construct, was used to infect CEF, and pJD-16 was transfected into this infected culture. Virus isolation proceeded as described above for the original MVA/HIV 65A/G virus and the resulting double recombinant virus (Clone D1.3266-15), was designated MVA/HIV 65A/G(SmaI).
Characterization and Comparison of the Original MVA/HIV 65A/G with the Modified MVA/HIV 65A/G(SmaI)
1. Aliquots of MVA/HIV 65A/G and MVA/HIV 65A/G(SmaI) infected BS-C-1 cells were analyzed by RIP with monoclonal Antibodies T24 and T32 mAb for the env (
2. Immunogenicity of the modified 65A/G(SmaI) virus was assessed in mice immunized 2× with either MVA 65A/G or modified MVA 65A/G(SmaI) at 107 dose given IM three weeks apart. The average ELISA titer from serum of five mice (individually assayed) with the designated virus was determined. Serum antibody responses were assayed by a 2 day ELISA utilizing secreted Clade A 928 strain gp140 as the antigen. The results in
The 2 different viruses were also tested for their ability to induce a cellular immune response of the Gag protein as measured by intracellular cytokine staining. Mice (5/group) were immunized twice with 107 pfu of the designated viruses. Splenocytes from individual mice were assayed directly ex vivo after overnight culture with 2 different gag p24 peptide-pulsed P815 cells. CD8+ IFN-γ+ cells were enumerated by flow cytometry. As shown in
3. Repeated passage of MVA 65A/G(SmaI) and analyzing the expression of the resultant virus has confirmed that the envelope expression of modified MVA 65A/G(SmaI) is highly unstable as shown in Table 2.
Thus, removal of the intervening codon initiation site, through recloning of the envelope into a closer site to the promoter, made a virus which expressed larger quantities of env and was much more immunogenic; however it could not be pursued as a candidate vaccine because it was highly unstable (Table 3).
This example describes the construction of a modified vaccinia virus Ankara (MVA) recombinant virus, MVA/HIV 62B, expressing lade B HIV strains ADA Env and chimeric HXB2/BH10 Gag Pol. This virus differs from an earlier MVA lade B recombinant, MVA/HIV 48, (which also expresses identical HIV strain ADA Env and HXB2/BH10 Gag Pol) in 4 ways:
1) MVA/HIV 62B uses a transient screening marker of green fluorescent protein (GFP) instead of GUS screening marker used in MVA/HV 48.
2) The env gene is inserted into del II of MVA genome and the gag pol is inserted in del III. In MVA/HIV 48, both env and gag pol are inserted into del IR.
3) Both env and gag pol of MVA/HIV 62B are controlled by PmH5, the same promoter controlling gag pol in MVA/HIV 48.
4) The MVA virus used to make the recombinant MVA/HIV 62B is MVA 1974/NIH Clone 1 instead of MVA 1983/NIH Clone 1 used to make MVA/HIV 48.
The plasmid transfer vectors, pLAS-1 HXB2/BH10 Gag Pol, and pLAS-2 ADA Env (
1. The clade B gag pol was truncated so that the integrase was remove and was cloned into the plasmid so that it was controlled by the mH5 promoter. This gene contained the complete HXB2 sequence of the gag. The pol gene has reverse transcriptase safety mutations in amino acid 185 within the active site of RT, in amino acid 266 which inhibits strand transfer activity, and at amino acid 478 which inhibits the Rnase H activity. In addition, the integrase gene is deleted past EcoRI site.
2. pLAS-1 was constructed from pLW-51GFP by cutting out the Psyn II vaccinia promoter, blunting and religating. Clade B HXB2/BH10 gag pol sequences from MVA/HIV 48 was cloned into pLAS-1, making the plasmid transfer vector, pLAS-1 HXB2/BH10 Gag Pol (
3. The ADA envelope is a truncated version with silent 5TNT mutations. The envelope was truncated in the cytoplasmic tail of the gp41 gene, deleting 115 amino acids of the cytoplasmic tail. This truncation was shown by us to increase the amount of envelope protein on the surface of infected cells and enhance immunogenicity of the envelope protein in mice, and stability of the recombinant virus in tissue culture.
4. pLAS-2 was constructed by a insertion of a direct repeat of the MVA flank as described under LAS-2 construction followed by an insertion of GFP controlled by P11 vaccinia promoter. Addition of the above ADA modified env sequences from MVA/HIV 48 made plasmid transfer vector pLAS-2 ADA Env (
1. MVA 1974/NIH Clone 1 virus, which was derived from an MVA received from Anton Mayr (Munich, Germany) at passage 572 from Feb. 22, 1974 by terminally diluting 3 times at the National Institutes of Health, was used for recombination.
2. Secondary CEF cells were infected at an MOI of 0.05 of MVA and transfected with 2 μg of pLAS-1 HXB2/BH10 Gag Pol or 2 μg of pLAS-2 ADA Env (
3. Following a two day incubation at 37° C., the viruses were harvested, frozen and thawed 3×, and plated out on CEF.
4. At 3 days post-infection, those foci of infections that exhibited GFP fluorescence (indicating that recombination had occurred between the plasmid and the infecting virus) were picked and replated on CEF. Again, those foci that expressed GFP were picked.
5. These 2× plaque-purified GFP-expressing foci were plated out in triplicate CEF plates and two plates were analyzed for GFP fluorescence and Gag or Env expression. Individual foci were picked from the 3rd replicate plate of those samples with little or no GFP fluorescence as well as mostly Gag or Env staining foci.
6. These foci were again plated out in triplicate, and analyzed the same way 2 additional times (3× for the Gag Pol construct). The resulting viruses derived expressed either Gag Pol (MVA 60) or Env (MVA 61) proteins but had deleted the GFP gene by recombination of the double repeats.
1. To make the double MVA recombinant, MVA/HIV 62B, the two single recombinant MVA viruses, MVA 60 and MVA 61, expressing Gag Pol and Env respectively, were used to infect CEF cells together at a MOI of 5, grown at 37° C. for 2 days and harvested (
2. Duplicate plates of the harvest were infected at different dilutions, and one plate was fixed and stained with T8 mAb and number of foci of infected cells that had rounded up CPE (characteristic of Gag Pol recombinants) were scored in order to assure there were double recombinants in the population. Then, foci with the rounded up morphology were picked from the unstained duplicate plate.
3. These foci were plated out at various dilutions in triplicate and immunostained for Env expression (T8 mAb) and Gag expression (3537 mAb, 183-H12-5C, NIH AIDS Research and Reference Regent Program). Those foci that stained for both Env and Gag expression were plaque purified further.
4. The virus was expanded in CEF cells and a LVD Seed stock of MVA/HIV 62 was produced. Mycoplasma testing by ATCC was negative. Sterility testing by BioReliance was negative.
1. Aliquots of MVA/HIV 62B infected BS-C-1 cell lysates were analyzed by radioimmunoprecipitation (RIP) with monoclonal antibodies T8 and 3537 for expression of Envelope and Gag proteins, respectively (
2. Repeated passage of MVA/HIV 62B and analyzing the resultant virus has confirmed that MVA 62B is relatively stable through 10 passages of the LVD Seed stock.
3. Sequencing a region of the MVA/HIV 62B genome consisting of the HIV inserts as well as a 1000 base pair region of the MVA genome flanking either sides of the HIV inserts confirmed that the GFP gene has been deleted and the sequence of the HIV inserted genes are correct. Sequence of ADA Env is given in
4. Immunogenicity was assessed by 107 pfu of purified MVA 62B inoculated into mice at 0 and 4 weeks. ELISA serum antibodies were assayed in a capture ELISA utilizing gp140 ADA env as the antigen. Table 4 shows the ADA env is immunogenic.
In summary, we have made a recombinant MVA virus, MVA/HIV 62B, which expresses ADA modified, truncated Envelope and HXB2/BH10 Gag Pol. The MVA double recombinant virus was made by homologous recombination of single MVA recombinants, one expressing Env and one expressing Gag Pol. These single MVA recombinants were made using a transiently expressed GFP marker that was deleted in the final viruses. The MVA 62 B virus was shown to make particles and was immunogenic in mice. MVA/HIV 62B was shown to be stable through repeated passage of the LVD Seed Stock.
The immunogenicity of MVA 62B in mice as measured by ELISA utilizing MVA clade B gp140 as the antigen (Table 4) showed that MVA 62B envelope was not as immunogenic as hoped. This example describes the modifications to the MVA 62B plasmid transfer vector, pLAS-2 ADA Env, which were made to increase expression and immunogenicity of the ADA envelope in the final MVA 62 B double recombinant viruses.
The plasmid transfer vector, pLAS-2 ADA Env was modified in the following ways:
1. The ADA env was cut out of JD-9 ADA Env by treating with the restriction enzyme, XmaI (an isoschizmer of SmaI which cuts making overlapping ends compared to the blunt cut of SmaI), and inserted into the XmaI site in LAS-2 making plasmid pLAS ADA Env (SmaI) or as it was designated pLW-66 (
2. pLAS-2 ADA Env was digested with restriction enzyme Sal I followed by XhoI to cut out the SphI site (which contains an initiation codon) and religated together to make pJD-17 (
3. In plasmid pLAS-2 ADA Env, the ADA envelope had been cloned into the Not I site generating the following nucleotide sequence between the promoter. In pLW-66, the ADA env was cloned into the XmaI site (SmaI) generating the following sequence between the vaccinia mH5promoter and the ADA env initiation codon as depicted below. In pJD-17 the SphI site had simply been removed. This all shown below:
To make the double recombinant MVA virus with the pLW-66 and pJD-17 plasmids, the single MVA recombinant virus expressing the gag pol of the clade B virus, MVA 60, as described above, was used to infect CEF cells, and pLW-66 or pJD -17 was transfected into these infected CEF cultures. Virus isolation proceeded as described above for the original MVA/HIV 62B virus and the two clones of each resulting double recombinant viruses were designated as follows:
Characterization and Comparison of the Original MVA/HIV 62B with the Modified MVA/HIV 62B Viruses
1. Aliquots of MVA/HIV 62B and 4 modified MVA 62B virus infected BS-C-1 cells were analyzed by RIP with monoclonal antibody T8 for the env (
2. Immunogenicity of the modified MVA62B constructs were assessed in mice immunized 2× with either the original or modified MVA 62B viruses at 107 dose given IM three weeks apart.
The different viruses were also tested for their ability to induce a cellular immune response to the Env or Gag protein as measured by intracellular cytokine staining (ICS).
Mice (5/group) were immunized twice with 107 pfu of the designated viruses. Splenocytes from individual mice were assayed directly ex vivo after overnight culture with the env peptide or gag p24 peptide-pulsed P815 cells. CD8+ IFN-γ+ cells were enumerated by flow cytometry.
As shown in
As shown in
3. Repeated passage of the modified MVA/HIV 62B viruses and analyzing the resultant virus has confirmed that MVA 62B is relatively stable through 10 passages of the LVD Seed stock.
Thus, removal of the intervening codon initiation site, through recloning of the envelope into a closer site to the promoter, made viruses which expressed larger amounts of env and were much more immunogenic. These viruses are being pursued as candidate vaccine viruses (Table 5).
MVA 56 Construction and Characterization
This example describes the construction of a modified vaccinia virus Ankara (MVA) recombinant virus, MVA/HIV lade B expressing HIV strain ADA env and chimeric HXB2/BH10 gag pol. This virus differs from an earlier MVA recombinant, MVA/HIV 48, (which also expresses the HIV strain ADA env and the HXB2/BH10 gag pol) in 3 ways:
1. MVA/HIV 56 uses a transient screening marker of green fluorescent protein (GFP) instead of the GUS screening marker used in MVA/HIV 48.
2. The ADA env of MVA/HIV 56 is controlled by a new modified vaccinia virus promoter, Pm2H5, which allows more early expression of ADA env than the Psyn II promoter used to express the ADA env in MVA/HIV 48. (The gag pol is controlled by the vaccinia virus mH5promoter, the same promoter controlling the gag pol in MVA 48.)
3. The MVA virus used to make the recombinant MVA/HIV 56 is MVA 1974/NIH Clone 1 instead of MVA 1983/NIH Clone 1, used to make MVA/HIV 48.
It differs from later constructs of original MVA 62B and modified MVA 62B in that the env and gag genes are controlled by double vaccinia virus promoters which are in tandem, like in MVA 48, and insert into only deletion m of the MVA genome. This gives this type of construct a construction advantage over the MVA 62B constructs since one has to go through only one set of plaque purifications as compared to the construction regime of the MVA 62B constructs.
All lade B constructs described have the same modified ADA env and modified HXB2/BH10 gag pol.
The plasmid transfer vector, pLAS-6, used to make MVA/HIV 56 by homologous recombination was constructed as follows:
1. The GUS screening marker was cut out of the plasmid, pLW-48 (see WO 002/072759), and replaced with the GFP screening marker run by the vaccinia virus P11 promoter (pLW-51 GFP). This GFP screening marker was used transiently to 2× plaque-purify recombinant virus, but was deleted in the final recombinant by homologous recombination (because GFP was flanked by two direct repeats).
2. The Psyn II vaccinia promoter was cut out of pLW-51GFP by XhoI and NotI digestion and replaced with a new further modified H5 vaccinia virus promoter, pm2H5, in the same sites. This new plasmid was named pLAS-5.
Sequence of m2H5 promoter:
3. The ADA env, was removed from pLW-48 by NotI enzyme digestion of the plasmid and cloned into the NotI site of pLAS-5 controlled by the vaccinia virus m2H5 promoter. The HXB2/BH10 gag pol gene was removed from pLW-48 by SalI digestion and placed in the SalI site under the control of the mH5 promoter to make the plasmid transfer vector, pLAS-6 (
2. Secondary CEF cells were infected at an MOI of 0.05 of MVA and transfected with 2 μg of pLAS-6, the plasmid described above. Following a two day incubation at 37° C., the virus was harvested, frozen and thawed 3×, and plated out on CEF.
3. At 3 days, those foci of infections that expressed GFP (indicating that recombination had occurred between the plasmid and the infecting virus), were picked and replated on CEF. Again, those foci that expressed GFP were picked.
4. These 2× plaque-purified GFP-expressing foci were plated out in triplicate CEF plates and two plates were analyzed for GFP fluorescence and gag pol expression. Individual foci were picked from the 3rd replicate plate of those samples with little or no GFP staining as well as mostly gag staining foci.
5. These foci were again plated out in triplicate, and analyzed the same way 2 additional times. The resulting virus derived expressed the gag protein but had deleted the GFP gene by recombination of the double repeats. By immunostaining, this virus also expressed the env protein. The virus was expanded in CEF cells and a LVD Seed stock was produced and sterility and mycoplasma tested by BioReliance and ATCC, respectively.
1. Aliquots of MVA/HIV 56 infected cell lysates were analyzed by radioimmunoprecipitation (RIP) with monoclonal antibodies for expression of both the envelope and gag proteins, both in the presence and absence of ARA-C. In RIP, bands of the correct size corresponding to each of these proteins was detected, both in the presence and absence of ARA-C indicating both early and late expression of recombinant protein (
2. MVA/HIV 56 was shown to produce gag particles in the supernatant of infected cells by pelleting the 35S labeled particles from supernatant of MVA/HIV 56-infected BS-C-1 cells on a 20% sucrose cushion and analyzing by PAGE.
3. Sequencing a region of the MVA/HIV 56 genome consisting of the HIV inserts as well as a 1000 base pair region of the MVA genome flanking either side of the HIV inserts confirmed that the GFP gene had been deleted and the sequence of the HIV inserted genes was correct.
4. Repeated passage of the modified MVA/HIV 62B viruses and analyzing the resultant virus has confirmed that MVA 62B is relatively stable through 5 passages of the LVD Seed stock.
5. Immunogenicity of MVA 56 was assessed in mice immunized 2× with 107 pfu three weeks apart.
In summary, we have made a recombinant MVA virus, MVA/HIV 56, which has high expression of ADA modified truncated envelope and HXB2/BH10 gag pol and inserts into deletion m of the MVA genome. The MVA recombinant virus was made using a transiently expressed GFP marker that was deleted in the final virus. High expression of the ADA envelope was possible because of a new hybrid early/late promoter, Pm2H5. The MVA 56 recombinant makes gag particles which has been shown by pelleting the particles through sucrose and analyzing by PAGE. Sequencing of the recombinant region of the MVA genome confirmed the absence of GFP and the correct sequence of the HIV genes. Env ELISA confirmed the immunogenicity of the ADA envelope and cellular response to both the envelope and p24 gag were detected.
This example describes the construction of a modified vaccinia virus Ankara (MVA) recombinant virus, MVA/HIV 71C, expressing an Indian clade C HIV IN3 Env and Gag Pol. The salient features of this recombinant virus are:
1. A transient screening marker of green fluorescent protein (GFP) was used in construction of MVA/HIV 71C, so that the GFP is eliminated in the final virus product.
2. The 71C env gene is inserted into del H of MVA genome and the 71C gag pol is inserted in del III.
3. Both env and gag pol of MVA 71C are controlled by vaccinia m-H5 promoter.
4. The MVA virus used to make the recombinant MVA/HIV 71C is MVA 1974/NIH Clone 1.
The plasmid transfer vectors, pDC3 and pJD15,
1. The gene sequence of HIV C IN3 gag pol (from Indian isolate GenBank #AF286231 from Harriet Robinson, Emory University) containing three mutations to inactivate reverse transcriptase activity (corresponding to that given for lade B recombinant) with the integrase removed was cloned into pCR2.1 using FailSafe PCR kit. The gag/pol gene was cloned into MVA deletion m transfer vector pLAS-1 (containing screening marker GFP flanked by two direct repeats to eliminate GFP in the final virus) via SmaI restriction endonuclease site, and gene expression was under control of the early/late modified H5 promotor. Sequence of the HIV C IN3 gag pol gene was confirmed by DNA sequencing, and this construct was designated pDC3 (
2. The gene sequence of HIV C IN3 env (from Indian isolate GenBank #AF286231 from Harriet Robinson, Emory University) was truncated via PCR removal of 120 amino acids in the cytoplasmic tail of gp41 and cloned into pCR2.1. Silent mutations to eliminate 2 early poxvirus termination 5TNT signals were made (QuikChange Kit, Stratagene). The modified, truncated env gene was cloned into MVA deletion II transfer vector pLAS-2 (containing screening marker GFP flanked by two direct repeats to eliminate GFP in the final virus) in the Not I site followed by removal of the SphI site within the cloning region by cutting sequentially with SalI, then XhoI and ligating the ends to make pJD-15. Gene expression in this plasmid is under control of the early/late modified H5 promotor. Sequence of the HIV C IN3 env gene was confirmed by DNA sequencing, in this construct was designated pJD-15 (
1. MVA 1974/NIH Clone 1 virus, which was derived from an MVA received from Anton Mayr (Munich, Germany) at passage 572 from Feb. 22, 1974 by terminally diluting 3 times at the National Institutes of Health, was used for recombination.
2. Secondary CEF made from 10 day old SPAFAS fertile chicken eggs (distributed by B&E Eggs, Stevens, Pa.) in six-well culture plates were infected at an MOI of 0.05 of MVA and transfected with approximately 3.0 μg of pDC3 (
3. Following a two day incubation at 37° C., the virus was harvested, frozen and thawed 3×, and plated out on CEF plates.
4. At 3 days post-infection, those foci of infections that expressed GFP (indicating that recombination had occurred between the plasmid and the infecting virus) were picked and replated on CEF. Again, those foci that expressed GFP were picked.
5. These 2× plaque-purified GFP-expressing foci were plated out in duplicate CEF plates and two plates were analyzed for GFP fluorescence and for Gag expression with MAb 183-H12-5C (3537) specific for Gag. Individual foci were picked from the duplicate replicate plate of those samples with little or no GFP staining as well as mostly Gag staining foci.
6. These foci were again plated out in duplicate, and analyzed the same way 3 additional times. The resulting recombinant virus expressed Gag Pol proteins but had deleted the GFP gene by recombination of the double repeats. A seed stock was made, first by growing up the final picked plaques in 1 well of 6 well plate, then T-25 flasks, followed by growth in T-150 flasks. This virus, labeled MVA 68C (LAS1 gag pol), was used to make the double recombinant.
1. To make the double MVA recombinant expressing both the Env and the Gag Pol proteins, single recombinant MVA virus expressing Gag Pol (MVA 68C), was used to infect CEF cells at a MOI of 0.05, followed by transfection of 1 μg of pJD15, and grown at 37° C. for 2 days and harvested (
2. At 3 days post-infection, those foci of infections that expressed GFP (indicating that recombination had occurred between the plasmid and the infecting virus) were picked and replated on CEF. Again, those foci that expressed GFP were picked.
3. These 2× plaque-purified GFP-expressing foci were plated out in duplicate CEF plates and two plates were analyzed for GFP fluorescence and for Env expression with T-43 mAb specific for Env protein. Individual foci were picked from the duplicate replicate plate of those samples with little or no GFP fluorescence as well as mostly Env staining foci.
4. These foci were again plated out in duplicate, and analyzed the same way 4 additional times. The resulting double recombinant virus expressed Env and Gag Pol proteins but had deleted the GFP gene by recombination of the double repeats. An LVD seed stock was made, first by growing up the final picked plaques in 1 well of 6 well plate, then T-25 flask, followed by growth in T-150 flasks. This virus, labeled MVA/HIV 71C (lab. name-Clone 2 C4 6.21121), expressed both Env and Gag by immunostaining. Characterization of MVA Double Recombinant Virus, MVA/HIV 71C
1. Aliquots of MVA/HIV 71C infected BS-C-1 cell lysates were analyzed by radioimmunoprecipitation (RIP) with monoclonal antibodies T-43 and 3537 for expression of Envelope and Gag proteins, respectively (
2. Repeated passage of MVA/HIV 71C and analyzing the resultant virus has confirmed that it is relatively stable through 9 passages of the LVD Seed stock.
3. Sequencing a region of the MVA/HIV 71C genome consisting of the HIV inserts as well as a 1000 base pair region of the MVA genome flanking either sides of the HIV inserts confirms that the GFP genes have been deleted and the sequence of the HIV inserted genes are correct which include the three mutations in the reverse transcriptase gene.
4. The immunogenicity of a dose 107 pfu of purified MVA/HIV 71C inoculated into mice at 0 and 4 weeks by the intramuscular route has been assessed. ELISA serum antibodies were assayed in a capture ELISA utilizing gp140 clade C env as the antigen. Table 6 shows that the clade C env is immunogenic.
In summary, we have made a recombinant MVA virus, MVA/HIV 71C, which expresses the Clade C IN3 modified, truncated envelope and mutated gag pol. The MVA double recombinant virus was made by homologous recombination of single MVA recombinant expressing Gag Pol protein, with a plasmid expressing clade C Env. This double MVA recombinant was made using transiently expressed GFP marker that was deleted in the final virus. RIP experiments showed expression of MVA/HIV 71C Env and Gag Pol proteins, as well as production of gag particles. The double recombinant was shown to be relatively stable through repeated passage of the LVD Seed Stock. Immunogenicity experiments in mice show the lade C env to be immunogenic (see Table 6).
600,000c
acapture ELISA utilizing gp140 clade C env as antigen;
bimmunize 5 mice each with 107 dose given IM at 0 and 4 weeks. Bled at 2 weeks post 2nd immunization;
creciprocal end point dilution.
We developed an AIDS vaccine for Western and West-Central Africa founded on HIV-1 subtype CRF02_AG. Rhesus macaques were primed with Gag-Pol-Env-expressing plasmid DNA and boosted with a recombinant modified vaccinia virus Ankara (rMVA), expressing matched proteins. Two DNA vaccine constructs (IC1-90 and IC48) that differed by point mutations in gag and pol were compared. IC1-90 produces primarily immature (core comprises unprocessed Pr55Gag) HIV-like particles (VLPs) and IC48 produces mature VLP with processed Pr55Gag, immature VLP, and intracellular protein aggregates. Both vaccines raised significant cellular responses for Gag, Pol, and Env. Approximate twofold higher ELISPOT responses to Gag and Env epitopes were observed for IC48 animals than for IC1-90 animals at the peak post-MVA effector (P=0.028) and late memory (P=0.051) phases, respectively. Greater breadth for IC48-primed animals was observed than for IC1-90-primed animals at peak response (P=0.03). Our results indicated that the vaccines elicited high frequency T cell responses and primed anti-Env antibody. They also suggest that expression of different forms of VLP has a significant effect on elicited cellular and humoral immunity.
To assess the assembly of VLPs, transfection culture supernatants were banded through a sucrose gradient and subsequent fractions were examined for the presence of Gag. Peak VLP fractions were analyzed by immunoblotting using rabbit polyclonal anti-p24 antibody (
To confirm partial inhibition of protease activity permitted VLP assembly and possible particle maturation, cells transfected with protease-mutant vaccine constructs were examined by electron microscopy (
Total Gag expression was detected by antigen-capture ELISA following 293T cell transfection; IC1-90 expression appeared sharply diminished as compared with IC48, 131, and 878 ng/ml, respectively. In the supernatant and cell lysate, Gag protein levels were 77 and 54 ng/ml (IC1-90) and 624 and 254 ng/ml (IC48), respectively. However, as previously reported (Schneider, R. et al. 1997 J. Virol. 71:4892-4903), the detection efficiency of Gag p55 was substantially less than that of Gag p24. Therefore, quantification of total Gag protein of transfection supernatants by Western blot analysis as measured by phosphorimager demonstrated that IC1-90 expressed Gag protein to a level similar to IC48, 1771, and 1570 relative units. For IC1-90, the Gag protein was primarily p55 (61% of the immunoreactive protein). Production of Env protein was also detected by ELISA, and IC1-90 and IC48 Env levels were similar, 696 and 665 ng/ml, respectively. A greater percentage of total Env protein was detected in the supernatant for both constructs.
Three DNA primes at 0, 8, and 26 weeks and a single rMVA booster at 41 weeks were administered in 1 ml by IM needle injections. DNA priming was 0.6 mg of either IC1-90 or IC48 per injection and MVA booster was at 1×108 pfu. All 16 macaques received identical aliquots only differing by the priming agent, IC1-90, or IC48. Physical examinations, daily observations, measuring for weight, hematology, and clinical chemistry were completed. No local redness or indurations at the injection site were observed.
Vaccine-elicited T cells expanded rapidly after the MVA booster (
At the peak response, both of tested plasmid DNAs successfully primed the MVA booster for an anti-viral IFN-γ ELISPOT response to Gag, Pol, and Env sequences. The analyses revealed greater than twofold differences between the IC48 and IC1-90 primes (
A broad ELISPOT response for both Gag and Env was present 1 week after the MVA booster (
Consistent with the height of the ELISPOT response, T cells from IC48-primed animals recognized more peptide pools than observed with IC1-90-primed animals (Table 7). In the IC1-90 group, 6 of 8 animals responded to at least one Gag pool with an overall average of 2.5 of 5 pools being recognized (Table 7,
aELISPOT counts of twice the background (>100) were considered positive.
bCombination of IFN-γ and IL-2 expression.
cOne week after MVA booster.
dEight weeks after MVA booster.
eGag, 5 pools; Pol, 6 pools (includes protease pool); Env, 7 pools.
fND, not done.
gAverage CD8+ cell response per animal, 2.2 pools.
hAverage CD4+ cell response per animal, 6.25 pools.
A broad response for both Gag and Env was retained 8 weeks post-MVA booster (
To determine the frequencies of responding CD4 and CD8 T cells, intracellular cytokine assays were performed (
In several animals, CD4 cells specific for Gag epitopes expanded to frequencies as high as 0.5% of the total CD4 T cells (
Based on
The average number of peptide pools recorded as positive by intracellular cytokine staining to include both IFN-γ and IL-2 expression were found to be relatively comparable between DNA priming groups regardless of the gene region (Table 7). At the peak immune response, IC1-90 animals would require a 31% and 11% increase in peptide pool responses to equal the response of IC48 animals for CD8 and CD4 cells, respectively. However, threefold more peptide pools induced IFN-γ and IL-2 expression in CD4 cells than CD8 cells (6.25 vs. 2.2 pools). This same threefold ratio was observed for both IC1-90- and IC48-primed animals.
The antibody response was strongly boosted by the MVA. By Western blot analysis, negligible binding antibody was elicited by DNA priming, but 11 of 16 animals (6 IC1-90 and 5 IC48 monkeys) showed Env reactivity against an HIV-1 subtype AG virus lysate 3 weeks following the MVA. All 11 reactive animals produced antibody which detected Env gp120 and only one animal responded to Gag p24. There was no difference between the two groups of primed animals.
Anti-Env titers were determined for the vaccinated animals by solid-phase Env ELISA. At 3 weeks post-MVA, the average reciprocal titers were 1075(±1569) and 2119(±1898) for the IC1-90- and IC48-primed animals, respectively. The titers fell to 953(±979) and 850(±563), respectively, at 8 weeks after the booster. There was no substantial difference observed between the two groups of animals.
Tests for neutralizing antibody revealed very low levels of activity for the primary isolate used for the vaccine; only one animal scored positive. The primary isolate, a recombinant HIV-1 subtype AG, was relatively resistant to neutralization by many other sera and neutralizing monoclonal antibodies. The neutralizing activity of the plasma also did not score for HIV-1-MN (subtype B), a laboratory-adapted isolate against HIV-1.
DNA constructs were made in the pGA1 expression vector (GenBank accession no.: AF425297) that includes intron A in the promoter cassette and uses the CMV immediate-early promoter and the bovine growth hormone polyadenylation sequence to express RNAs (Chapman, B. S. et al. 1991 PNAS USA 19:3979-3986 and Ross, T. M. et al. 2000 Nat. Immunol. 1:127-131). An incident recombinant HIV-1 subtype AG (CRF02_AG) strain IC0928 was reverse transcribed (GenBank accession no.: AY227361 and AY227362), and fragments produced by DNA PCR were cloned into the pGA1 expression vector (Ellenberger, D. L. et al. 2002 Virology 302:155-163 and Ellenberger, D. et al. 2004 Virology 319:118-130). Construction and description of pGA1/IC48 (IC48) have been previously described (Ellenberger, D. et al 2004 Virology 319:118-130). pGA1/IC1-90 (IC1-90) differs from IC48 by point mutations in gag and pol. Briefly, IC1-90 lacks the introduced point mutations in gag NC zinc fingers and pol RT as previously described for IC48 (Ellenberger, D. et al. 2004 Virology 319:118-130, Smith, J. M. et al. 2004 AIDS Res. Hum. Retrovir. 20:1335-1347 and Smith, J. M. et al. 2004 AIDS Res. Hum. Retrovir. 20:654-665). IC1-90 and IC48 also differ in their protease sequence where there are two substitutions in IC1-90, an Arg-to-Gly substitution at position 70 and Met-to-Leu substitution at position 90. IC48 has a Gly-to-Val substitution at position 48 as previously described. The protease mutations were made using a site-directed mutagenesis kit (Stratagene, La Jolla, Calif.) following the manufacturer's protocol. All mutations were confirmed by sequencing.
A recombinant MVA expressing gag, pol, and env regions derived from IC0928 is described above. Briefly, it was constructed with gag-pol inserted into deletion III and a truncated env into del II as described previously for MVA/SHIV89.6 (Earl, P. L. et al. 2002 Virology 294:270-281) with the modification that a transient GFP marker for obtaining recombinant virus was used, similar to the transient GUS described by Wyatt et al. (Wyatt, L. S. et al. 2004 AIDS Res. Hum. Retrovir. 20:645-653).
Human 293T cells, a human kidney-derived cell line, were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum. 293T cells were added at 106 cells/well of Costar 6-well plates in 2 ml of DMEM growth medium and incubated for 24 h at 37° C. in a 5% CO2 humidified atmosphere. After 24 h, LipofectAmine2000 reagent (Invitrogen, Carlsbad, Calif.) and plasmid DNA were mixed according to the manufacturer's protocol and added to each well. Supernatants were harvested 24 or 48 h following the addition of transfection reagents.
Following 24 h of transient transfection of 293T cells, culture supernatants were recovered, clarified by centrifugation at 200×g for 5 min, and 1 ml was layered on top of 10-50% sucrose gradients. Gradients of 10 ml consisting of 2 ml each of 50%, 40%, 30%, 20%, and 10% sucrose solutions were added to ultraclear centrifuge tubes from bottom to top. Gradients were centrifuged at 40,000 rpm for 16 h in SW41Ti rotor. Fractions of 1 ml were recovered, top to bottom. Fraction aliquots were analyzed by HIV-1 p24-antigen-capture assay.
Transfected 293T cells were fixed in the multi-well plate using 1 ml of 2.5% glutaraldehyde in 0.1 M cacodylate buffer for 2 h at 4° C. After three washes with the same buffer, 1.0% osmium tetroxide in 0.1 M cacodylate buffer was added, incubated for 1 h, dehydrated through an ethanol series, and embedded with Eponate 12 resin. Following polymerization of the resin, the cells were sectioned en face, stained with 4% uranyl acetate in water and lead citrate, and observed on a Hitachi H-7500 transmission electron microscope.
Assay was performed using an HIV-1 antigen-capture EIA kit (Coulter, Hialeah, Fla.) according to the manufacturer's instructions.
Pooled human immunoglobulin anti-HIV (catalog no. 3957) was obtained from the National Institute of Allergy and Infectious Diseases AIDS Research and Reference Reagent Program (Rockville, Md.). Env ELISA was done as previously described (Ellenberger, D. et al. 2004 Virology 319:118-130).
Sixteen young adult male outbred rhesus macaques (Macaca mulatta) of Indian origin were randomized by weight into two vaccine groups of 8. The IC1-90 group received 0.6 mg of IC1-90 DNA and the IC48 group received 0.6 mg of IC48 DNA intramuscularly (IM) at weeks 0, 8, and 26. DNA immunizations were delivered in phosphate-buffered saline with a needle and syringe. A total of 3 injections were delivered to the upper lateral right thigh in a volume of 1 ml/injection. Fifteen weeks following the 3rd DNA immunization (week 41), all animals received 1×108 pfu of a modified vaccinia Ankara virus (MVA/HIV) booster IM using a needle and syringe in the upper lateral right thigh. The MVA immunization was delivered in phosphate-buffered saline in a volume of 1 ml. Injection sites were monitored for local inflammatory reactions.
Western blot analysis of whole virus lysate and sucrose-purified VLP was performed as previously described (Sambrook, J. et al. 1989 Molecular Cloning: A Laboratory Manual (2nd ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Whole virus lysate (IC0928) was run on 4-15% gradient SDS gel and transferred to nitrocellulose. Plasma samples were diluted 1:100 in blocking buffer. The secondary antibody was anti-human IgG (Fab)-phosphatase and detection was completed by using the BCIP/NBT phosphatase substrate system (KPL, Gaithersburg, Md.) according to manufacturer's instructions. Analysis of sucrose-purified VLP was completed using rabbit polyclonal anti-p24 (catalog no. 4250) which was obtained from the National Institute of Allergy and infectious Diseases AIDS Research and Reference Reagent Program. HIV-1 Gag protein bands were visualized using the ECL Western blotting detection reagent (Amersham Pharmacia Biotech, Piscataway, N.J.) as described by the manufacturer. Expression levels were determined using a phosphoimager.
To measure the levels of Env IgG in sera of immunized monkeys, 96-well U-bottom plates were coated with sheep antibody to the C-terminus of gp120 followed by purified CRF02—AG gp140 as previously described (Earl, P. L. et al. 2002 Virology 294:270-281). The time of incubation of serum dilutions was increased from 2 h to overnight for enhanced sensitivity of the ELISA.
Neutralization was measured as a function of reductions in luciferase reporter gene expression after a single round of infection in TZM-b1 cells. TZM-b1 cells were obtained from the NIH AIDS Research and Reference Reagent Program, as contributed by John Kappes and Xiaoyun Wu. Briefly, 200 TCID50 of virus was incubated with serial threefold dilutions of serum sample in triplicate in a total volume of 150 μL for 1 h at 37° C. in 96-well flat-bottom culture plates. Freshly trypsinized cells (10,000 cells in 100 μl of growth medium containing 75 μg/ml DEAE dextran) were added to each well. Indinavir was added at a final concentration of 1 μM to prevent replication in the case of HIV-1 MN. One set of control wells received cells+virus (virus control) and another set received cells only (background control). After a 48-h incubation, 100 μl of cells was transferred to a 96-well black solid plates (Costar) for measurements of luminescence using Bright Glo substrate solution as described by the supplier (Promega). An assay stock of virus pseudotyped with gp160 from the CRF02_AG vaccine strain was prepared by transfection in 293T cells and titrated in TZM-b1 cells. The assay stock of HIV-1 MN was prepared in H9 cells.
HIV-1 recombinant subtype CRF02_AG peptides were 15mers overlapping by 11 derived from the vaccine strain. Peptides were assembled into pools containing approximately 25 peptides. Peptides were dissolved in DMSO at 50-100 mg/ml and stock solutions maintained at −70° C. Peptide working solutions were kept at −20° C. for 1 week.
ELISPOT assays were done as previously described (Amara et al., 2001 and Amara et al., 2002), except that 2 μg/ml of antibody to human CD28 and CD49d (Becton Dickinson, San Jose, Calif.) was included in incubations (Waldrop, S. L. et al. 1998 J. Immunol. 161:5284-5295). Purified PBMC were plated in duplicate in 96-well plates at 2×105 cells/well with peptide pools used at a final concentration of 10 μg/ml for each peptide. Four wells received only media. Plates were incubated at 37° C., 5% CO2 for 36 h, and spots counted using an ELISPOT reader. Background was set at 2× the average of the negative control wells plus 10. This background value was subtracted from the raw counts of the peptide wells before conversion to 1 million PBMC. Only ELISPOT counts of twice the background (>100) were considered significant.
Intracellular cytokine (ICC) staining assays for IFN-γ and IL-2 have been described previously (Amara, R. R. et al. 2001 Science 292:69-74 and Amara, R. R. et al. 2002 J. Virol. 76:6138-6146). For those assays, one million PBMC were resuspended in 100 μl of RPMI in a 5-ml polypropylene tube and stimulated with 100 μg/ml of the peptide pool in the presence of anti-CD28 and anti-CD49d antibody at a final concentration of 1 μg/ml. The cells were incubated at 37° C., in a tissue culture incubator at an angle of 5° in 100 μl. At 2 h, 900 μl of medium with 10 μg of Brefeldin A was added and the incubation continued for an additional 4 h. Cells were then stained for CD3, CD8, CD69, IFN-γ, and IL-2 fixed with 1% formaldehyde in PBS, and acquired within 24 h on a FACScaliber (Becton Dickinson, San Jose, Calif.). Approximately 150,000 lymphocytes were acquired for each sample. Data were analyzed using FloJo software (Tree Star, Inc., San Carlos, Calif.).
The Wilcoxon test for independent samples and signed-rank test were used for comparison of immunogenicity tests from groups primed with the two DNA vaccines. A mixed-effects model using a linear regression of the aggregate ELISPOT values on group (IC-48 or IC1-90) and time with monkeys as the random effect was used. Also, a mixed-effects linear regression model was used for testing responses of CD4 versus CD8 T cells, T cell responses against Gag versus Env, and IFN-γ and IL-2 expression.
While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, and appendices, as well as patents, applications, and publications, referenced to above, are hereby incorporated by reference.
This application claims the benefit if U.S. Provisional Patent Application No. 60/604,918 filed Aug. 27, 2004, the entire disclosure of which is hereby expressly incorporated by reference.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US05/30977 | 8/29/2005 | WO | 00 | 2/26/2007 |
| Number | Date | Country | |
|---|---|---|---|
| 60604918 | Aug 2004 | US |
