This application claims priority to and the benefit of Korean Patent Application No. 10-2021-0079055, filed on Jun. 18, 2021, the disclosure of which is incorporated herein by reference in its entirety.
The present invention relates to a recombinant strain that produces neoagarooligosaccharids from agarose, which is a representative polysaccharide constituting red algae, and a use thereof.
Saccharomyces boulardii is a generally recognized as safe (GRAS) non-pathogenic yeast first discovered in the peels of lychee and mangosteen. It is known that Saccharomyces boulardii can survive in the human gastrointestinal tract due to its high tolerance to low pH and heat (Douradinha B., et al. (2014) Bioengineered. 5, 21-29, Czerucka D., et al. al. (2007) Aliment. Pharmacol. Ther. 26(6), 767-78). Saccharomyces boulardii is the only probiotic yeast found to be effective in double-blind studies.
Unlike digestible food, non-digestible food reaches the large intestine and is utilized by the intestinal microbial community. As a result, non-digestible food changes the intestinal environment and affects overall human health (Pistollato F., et al. (2016) Nutr Rev. 74, 624-634, Sonnenburg E. D., et al. (2014) Cell Metab. 20, 779-786). Agarose, which is a representative polysaccharide constituting red algae, is one of the non-digestible foods commonly found in East Asia (Kolb N., et al. (2004) Food Technol Biotechnol. 42, 57-61). Agarose is decomposed into neoagarooligosaccharides such as neoagarotetraose and neoagarobiose by endo-type beta-agarase, and the neoagarooligosaccharides have been reported to have various physiological and biological functions such as anti-obesity, anti-diabetic, anti-inflammatory, anti-tumor activity, and prebiotic effects (Torres M. D., et al. (2019) Mar Drugs. 17, 314, Hong S. J., et al. (2017) Mar Drugs. 15, 90, Lee M. H., et al. (2017) BMB Rep. 50, 263, Lin F., et al. (2019) Mar Drugs. 17, 154, Wang W., et al. (2017) Sci Rep. 7, 442-52, Kim M., et al. (2020) Biomaterials. 263, 120391, Hu G., et al. (2006) Anaerobe. 12, 260-266). In particular, the tetrasaccharide neoagarotetraose, which is a type of neoagarooligosaccharide, was also found to have various functional properties such as anti-inflammatory and antioxidant activity, and prebiotic effects (Zhang N., et al. (2017) Food Agric Immunol. 28, 1408-1423, Xu X-Q., et al. (2018) Food Chem. 240, 330-337).
At this time, when an intestinal microbial factory that can produce useful proteins such as prebiotics directly in the intestines is developed, more accurate research on the impact of intestinal microorganisms on health will become possible, and furthermore, it may be used to treat actual diseases.
However, there have been no reports of successful research in producing neoagarooligosaccharides that can be used as prebiotics from red algae agar or agarose in the yeast Saccharomyces boulardii, which is a eukaryotic cell and a probiotic.
The present invention is directed to providing a probiotic recombinant yeast capable of producing prebiotic substances in the intestines.
The present invention is also directed to providing a composition for producing a prebiotic including a probiotic recombinant yeast and a substrate, and a production method thereof.
In order to produce prebiotic substances from probiotic yeast using metabolic engineering technology, the present inventors attempted to produce neoagarooligosaccharides including neoagarotetraose for the first time by introducing a Bacteroides plebeius-derived enzyme BpGH16A gene into the yeast Saccharomyces boulardii. The present inventors completed the present invention by quantifying neoagarooligosaccharides produced after fermenting Saccharomyces boulardii with agarose using a method of quantifying neoagarooligosaccharides utilizing high-performance liquid chromatography (HPLC) and preparing Saccharomyces boulardii, which is a probiotic yeast that can express BpGH16A, which is a beta-agarase, and secrete the enzyme outside the strain.
Accordingly, the present invention provides recombinant Saccharomyces boulardii transformed with a gene encoding beta-agarase.
The purpose of the recombinant Saccharomyces boulardii of the present invention is to ultimately use it to produce neoagarooligosaccharides using agarose as a substrate. However, since Saccharomyces boulardii cannot absorb agarose as a substrate into the strain and metabolize it, a means is required to secrete the beta-agarase enzyme, which can decompose agarose into neoagarooligosaccharides, outside the strain. Therefore, the recombinant Saccharomyces boulardii of the present invention may be transformed with a gene encoding a signal peptide capable of secreting the beta-agarase outside the strain.
The signal peptide plays a role in secreting beta-agarase, specifically an enzyme expressed from the BpGH16A gene represented by SEQ ID NO: 1 in Saccharomyces boulardii, and may be one or more of a chicken lysozyme signal peptide (CL), a Saccharomyces cerevisiae-derived α-binding factor signal peptide (α-MF), a Saccharomyces diastaticus-derived STA1 signal peptide (STA1), and a Saccharomyces cerevisiae-derived SED1 signal peptide (SED1). In one specific example, it was confirmed that when SED1 was used as the signal peptide, a secretion amount of enzyme and a production amount of neoagarooligosaccharides were the best.
The chicken lysozyme signal peptide (CL) may be represented by SEQ ID NO: 2, the Saccharomyces cerevisiae-derived α-binding factor signal peptide (α-MF) may be represented by SEQ ID NO: 3, the Saccharomyces diastaticus-derived STA1 signal peptide (STA1) may be represented by SEQ ID NO: 4, and the Saccharomyces cerevisiae-derived SED1 signal peptide (SED1) may be represented by SEQ ID NO: 5.
The transformation of Saccharomyces boulardii with a gene encoding the beta-agarase and/or signal peptide can be performed using a recombinant vector including the gene or CRISPR-Cas9, which is a genetic recombination technology.
When using a recombinant vector such as a plasmid for the transformation of the Saccharomyces boulardii, auxotrophic mutants, for example, a mutant Saccharomyces boulardii strain in which one or more of the HIS3, TRP1 and URA3 genes are inactivated may be used.
In addition, the present invention provides a composition for producing prebiotics including the recombinant Saccharomyces boulardii and agarose as a substrate.
The recombinant Saccharomyces boulardii of the present invention can produce prebiotics by secreting beta-agarase outside the strain and decomposing agarose as a substrate, and in addition, Saccharomyces boulardii is a probiotic strain and may provide prebiotics and probiotics at the same time.
Accordingly, the present invention provides a synbiotic composition including the recombinant Saccharomyces boulardii and agarose as a substrate.
The prebiotics may be neoagarooligosaccharides, and specifically, may be neoagarobiose, neoagarotetraose, and neoagarohexaose, which are produced through the decomposition of agarose.
In addition, the composition may further include other probiotics in addition to the Saccharomyces boulardii strain, specifically, may include strains belonging to the Lactobacillus genus, Bifidobacterium genus, and Enterococcus genus, and more specifically, may include any probiotic strain that can ingest and metabolize neoagarooligosaccharides without limitation.
In addition, the present invention includes a method of producing neoagarooligosaccharides, including: reacting the culture fluid or extract of the recombinant Saccharomyces boulardii with agarose as a substrate; and separating and purifying neoagarooligosaccharides from the product of the above step
The description of the recombinant Saccharomyces boulardii and neoagarooligosaccharide is omitted to prevent duplication with the above-mentioned content.
Specifically, the culture or fermentation of the strain to produce beta-agarase from the recombinant Saccharomyces boulardii of the present invention is performed at a temperature of 20 to 40° C., preferably 30 to 40° C. for 1 to 7 days, preferably for 2 to 5 days.
Hereinafter, the present invention will be described in detail by way of Examples. The following Examples merely illustrate the present invention but do not limit the scope of the present invention.
To use auxotrophic markers during strain production, strains with inactivated HIS3, TRP1, and URA3 genes were generated. The HIS3 gene was inactivated based on strain SB-TU in which TRP1 and URA3 were inactivated (Liu J-J., et al. (2016) Appl Environ Microbiol. 82, 2280-2287). The HIS3 gene was amplified using the primer pair gHIS3_F and gHIS3_R (Table 1), the resulting PCR product was digested by SacI and NotI, and ligated into the pRS42H vector to generate plasmid p42H_gHIS3 (Table 2). The repair DNA required after HIS3 inactivation was amplified by PCR using primers dDNA_HIS3_F and dDNA_HIS3_R (Table 1). Yeast transformation was performed using the PEG-LiAc method (Gietz R. D., et al. (1995) Yeast. 11, 335-360). After yeast transformation, Saccharomyces boulardii strain SB-HTU, in which HIS3, TRP1, and URA3 genes were inactivated, was prepared and used in the experiment (Table 3).
Plasmid construction to select an optimal signal peptide for beta-agarase secretion was performed as follows. The gene BACPLE_01670 encoding BpGH16A was cloned into the pRS426GPD plasmid. The BpGH16A gene fragment was amplified by PCR from genomic DNA of Bacteroides plebeius DSM 17135 (DSMZ, Braunschweig, Germany) using different primer pairs depending on the type of signal peptide (Table 1). A signal peptide sequence predicted at the N-terminus of BpGH16A was removed and then used. A total of four signal peptides, including a chicken lysozyme signal peptide (CL), a Saccharomyces cerevisiae-derived α-binding factor signal peptide (α-MF), a Saccharomyces diastaticus-derived STA1 signal peptide (STA1), and a Saccharomyces cerevisiae-derived SED1 signal peptide (SED1), were compared (Liu J-J., et al. (2016) Appl Environ Microbiol. 82, 2280-2287, Inokuma K., et al. (2016) Biotechnol Bioeng. 113, 2358-2366, Yanagisawa M., et al. (2016) Enzyme Microb Technol. 85, 82-89). In addition, to construct a control strain without a signal peptide, PCR was performed using the primer pair 16A_W/OSP_F_Spel and 16A_W/OSP_R_Xhol (Table 1). Plasmids such as p426_Bp_W/OSP, p426_Bp_CL, p426_Bp_aMF, p426_Bp_STA1, and p426_Bp_SED1 were generated, and yeast transformation using SB-HTU was performed using the PEG-LiAc method. That is, strains SB-HTU_16A_C, SB-HTU_16A_A, SB-HTU_16A_S, and SB-HTU_16A_D were prepared for a signal peptide comparison experiment (Table 3). As a control strain, SB-HTU_E, which includes only the pRS426GPD vector without BpGH16A and a signal peptide, and SB-HTU_W, which includes the BpGH16A gene but no signal peptide, were prepared and used.
For stable expression of BpGH16A, guide RNA plasmid p42K_CS5 was used to integrate the BpGH16A gene into the genome of Saccharomyces boulardii (Table 2). p42K_CS5 was generated by inverse PCR of the pRS42K plasmid including a guide RNA sequence using the primer pair gRNA_CS5_F and gRNA_CS5_R (Table 1). The 20-bp targeting sequence of the guide RNA binds to the front of the PAM sequence (NGG) at an empty locus on chromosome XV (CS5). BpGH16A and SED1 signal peptides were integrated by homologous recombination without affecting the function of other genes. For homologous recombination, plasmid p426_16A_D was amplified using the primer pair dDNA-CS5-F and dDNA-CS5-R as donor DNA for CRISPR-Cas9-based genomic integration (Table 1). To overcome inefficiencies associated with genomic integration, PCR products constructed using the primer pair dDNA-CS5-F and dDNA-CS5-R were amplified once again by PCR using the primer pair CS5+60_F and CS5+60_R to increase a homology region to 120-bp (Table 1). In a yeast transformation process, 1 μg of Cas9-NAT, 20 μg of 16A-D-CS5, and 2 μg of p42K_CS5 were added to Saccharomyces boulardii and transformed using the PEG-LiAc method. Verification of genomic integration was performed by yeast colony PCR using the primer pair Conf-CS5-F and Conf-CS5-R (Table 1).
ACTAGTGCAGAAAATTTAAATAATAAATCATACGAGTG
ACTAGTATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCC
ACTAGTATGAAATTATCAACTGTCCTATTATCTGCCGGTT
plebeius, deletion signal peptide
S. boulardii
S. boulardii; TRP1 and URA3 disruption
S. boulardii; HIS3, TRP 1, and URA3 disruption
S. boulardii; BpGH16A, SED1 signal peptide
To produce neoagarooligosaccharides from the strain Saccharomyces boulardii prepared according to Example 1, 2.5 g/L of agarose was provided as a substrate at a temperature of 37° C. and fermentation was performed at 200 rpm in a 125-mL flask for 72 hours. To prevent coagulation of agarose during fermentation, agarose (Sigma-Aldrich) with a low gelation temperature was used. First, strains SB-HTU_16A_C, SB-HTU_16A_A, SB-HTU_16A_S, and SB-HTU_16A_D were cultured in yeast synthetic complete (YSC) medium at 37° C. and 200 rpm. Pre-cultured cells were centrifuged at 10,170×g for 10 minutes and washed twice with sterile distilled water, and harvested cells were inoculated into 20 mL of YSC medium containing 20 g/L of glucose and 2.5 g/L of agarose in 50 mM KHP buffer (pH 5.5). The initial cell density was inoculated at an optical density 600 nm (OD600) of 1.0. As a control, fermentation of strains SB-HTU_16A_E and SB-HTU_16A_W was also performed under the same conditions.
Cell growth was measured by measuring OD600 using a UV-visible spectrophotometer (Bio-Rad, Hercules, CA, USA). HPLC analysis was performed to analyze and quantify the reaction products of Saccharomyces boulardii and agarose, including neoagarotetraose, glucose, acetic acid, and ethanol. The column used during analysis was an Aminex HPX-87H column (Bio-Rad), which was equipped with a refractive index (RI) detector. The column and RI detector temperatures were set at 65° C. and 55° C., respectively, and the column used 0.005 M sulfuric acid as a mobile phase at a flow rate of 0.5 mL/min.
Thin layer chromatography (TLC) analysis was performed to identify the hydrolysis products of agarose during fermentation. For each time point (0, 12, 24, 36, 48, and 72-h) during fermentation, 1 mL of cell culture including fermentation products was obtained. For accurate measurements, the resulting cell culture was boiled to terminate further enzymatic reactions. After centrifugation at 16,609×g for 15 minutes at 4° C., 1 μL of each supernatant was loaded onto a silica gel 60 plate (Merck, Damstadt, Germany). After drying the TLC plate, it was visualized using a solution of 10% (v/v) sulfuric acid in ethanol and a solution of 0.2% (w/v) naphthoresorcinol in ethanol sequentially (Yun E. J., et al. (2013) Appl Microbiol Biotechnol. 97, 2961-2970).
In order to produce neoagarotetraose using engineered yeast, secretion of beta-agarose, which enables agarose decomposition, is required in yeast. Therefore, the expression and secretion of endo-type beta-agarase BpGH16A by Saccharomyces boulardii were first tested. For testing, strain SB-HTU_16A_C was used, in which the chicken lysozyme signal peptide (CL), which was previously demonstrated to function in Saccharomyces boulardii (Liu J-J., et al. (2016) Appl Environ Microbiol. 82, 2280-2287), was introduced. In HPLC analysis of a SB-HTU_16A_C fermentation product, a peak was detected at a retention time of 7.6 minutes corresponding to neoagarotetraose (
Since the enzyme BpGH16A was confirmed to be expressed and secreted in Saccharomyces boulardii, the next step was to find the optimal signal peptide to increase neoagarotetraose production. A total of four types of signal peptides: CL, α-MF, STA1, and SED1 were tested. Each signal peptide was fixed in front of the BpGH16A sequence and introduced into the SB-HTU strain to find the signal peptide that produces the most neoagarotetraose. The production of neoagarotetraose by the engineered yeast was confirmed by TLC analysis after 72 hours of culture (
Although neoagarotetraose was generated in all groups to which the signal peptide was attached, it was not generated in two control groups (
Based on the signal peptide selection results, strain SB-HTU_16A_D including the SED1 signal peptide was cultured. Fermentation was performed for 72 hours in YSC medium containing 2.5 g/L of agarose and without uracil. Neoagarotetraose production was confirmed by TLC analysis (
The use of genomic integration technologies, such as the CRISPR-Cas9 system, can avoid problems that may occur in complex intestinal environments when using plasmids. These problems include plasmid instability in the absence of selective pressure, potential spread to other microorganisms, and increased metabolic burden associated with the maintenance of multicopy plasmids (Durmusoglu D., et al. (2020) bioRxiv. 915389). In the present invention, BpGH16A was introduced into the genome of Saccharomyces boulardii along with SED1 for stable expression of the enzyme. BpGH16A gene insertion was performed by CRISPR-Cas9-based homologous recombination (
Finally, the SB_16A_D strain including BpGH16A and SED1 was constructed in the Saccharomyces boulardii genome using CRISPR-Cas9, and flask fermentation was performed for 72 hours in a YSC medium including 2.5 g/L of agarose. Neoagarotetraose production was confirmed by TLC analysis (
Compared to using a plasmid vector system with an auxotrophic marker, the final OD600 after 72 hours of fermentation of the strain constructed with the CRISPR-Cas9 system was 2.3 times higher, but neoagarotetraose production was lower. The reason for this difference is estimated to be the relatively strong promoter and high copy number of the pRS426GPD plasmid (Mumberg D., et al. (1995) Gene. 156, 119-122). Nevertheless, the successful protein secretion of Saccharomyces boulardii constructed by genomic integration demonstrated the potential of Saccharomyces boulardii to be used as a microbial cell factory to produce useful proteins and substances in the human intestines.
The present invention presents a process of preparing a recombinant yeast that can produce neoagarooligosaccharides by decomposing agarose. In other words, it was found that neoagarooligosaccharides can be produced using agarose as a substrate using Saccharomyces boulardii produced through the present invention. This can be utilized to produce useful substances in the intestines, including prebiotics, using Saccharomyces boulardii, which is a probiotic yeast, and to develop recombinant enzymes.
Number | Date | Country | Kind |
---|---|---|---|
10-2021-0079055 | Jun 2021 | KR | national |
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/KR2022/008703 | 6/20/2022 | WO |