This application contains a Sequence Listing electronically submitted via EFS-web to the United States Patent and Trademark Office as a text file named “Sequence_Listing.txt.” The electronically filed Sequence Listing serves as both the paper copy required by 37 C.F.R. §1.821(c) and the computer readable file required by 37 C.F.R. §1.821(c). The information contained in the Sequence Listing is incorporated herein by reference in its entirety.
The invention relates to the field of nanomedicine and, more particularly, to cerium oxide nanoparticles displaying redox functionality and useful for inhibiting tumor cells while not affecting normal cells, and associated methods.
Many studies on neoplastic transformation and tumor progression focused and still focus on tumor cells. However, one important aspect in tumor progression is the interaction between cancer cells and the stromal microenvironment [1]. The stroma was initially thought to have only supportive function in tumor development, but there is increasing evidence that stromal components actively take part in tumor progression and, therefore, are major players in tumor invasion [2-4]. Beside inflammatory and endothelial cells another crucial cellular component of the stroma is the myofibroblast (MF), a modulated fibroblast which has acquired the capacity to express the biomarker alpha-smooth muscle actin (αSMA) [5]. Myofibroblasts remodel the connective tissue during wound healing, but also interact with cancer cells at all stages of tumor progression and may thus control such phenomena as tumor invasion and angiogenesis [6].
Although it is known that reactive oxygen species (ROS) can be key regulators at all stages of cancer development [7], the molecular mechanisms underlying the ROS-dependent tumor-stroma interaction in tumor progression and its potential therapeutic modulation to prevent tumor invasion have not been fully elucidated until recently. A better understanding of the ROS initiated molecular mechanisms mediating interaction between the tumor and the tumor microenvironment would be helpful for the development of novel therapeutic strategies, as invasion and metastases are the most common problems in cancer therapy.
Nanomedicine, the medical application of nanotechnology, deals with the application of structures of the size 100 nanometers or smaller in at least one dimension and seeks to deliver a valuable set of research tools and clinically helpful devices in the near future [8]. The small size of nanoparticles endows them with properties that can be very useful in carcinogenesis, particularly in imaging and anti-cancer therapy. A nanoparticle-based therapeutic approach may have the potential as supplementation therapy supporting the classical anticancer strategies such as radiation or the use of anticancer drugs. If future studies show that a nanoparticle-based anticancer therapy has less harmful effects, it is aimed for the application of nanoparticles as major anticancer approach. In both cases, the treatment with nanoparticles should result in killing tumor cells or in prevention of tumor invasion while leaving normal healthy cells intact.
In that context, nano-sized magnetic iron particles are increasingly being used in cancer therapy. Once uptaken by tumor cells, such particles can be magnetically heated leading to localized cell death while healthy cells remain alive [9,10]. Free oxygen radicals generated by exposure to cerium oxide nanoparticles (CNP) produced significant oxidative stress, which killed lung carcinoma cells [11]. However, the toxicity of CNP is still controversial as an antioxidant function of CNP is described as well. Vacancy engineered CNP exhibited superoxide dismutase mimetic activity in human epidermal keratinocytes [12] and in a cell-free test tube system [13].
With the foregoing in mind, the present invention advantageously provides cerium oxide nanoparticles which are capable of inhibiting tumor cancer cells while being inoffensive to normal cells. As it was described earlier that TGFβ1 increased the intracellular superoxide (O2−) concentration via activation of NAD(P)H oxidase in human lung [14], and skin fibroblasts [4], the effect of CNP in context of prevention of myofibroblast formation and tumor invasion in tumor-stroma interaction was evaluated for skin-derived tumor cells. In an in-vitro cell culture model and dermis equivalent, nanoparticles of cerium oxide exhibit an inhibitory effect on the formation of myofibroblasts. Furthermore, concentrations of cerium oxide being non-toxic on normal cells showed an inhibitory, even cytotoxic and anti-invasive effect on squamous tumor cells. To our knowledge, this is the first report indicating a dual functionality of cerium oxide nanoparticles in tumor-stroma interaction.
Some of the features, advantages, and benefits of the present invention having been stated, others will become apparent as the description proceeds when taken in conjunction with the accompanying drawings, presented for solely for exemplary purposes and not with intent to limit the invention thereto, and in which:
The present invention will now be described more fully hereinafter with reference to the accompanying drawings, in which preferred embodiments of the invention are shown.
Unless otherwise defined, all technical and scientific terms used herein are intended to have the same meaning as commonly understood in the art to which this invention pertains and at the time of its filing. Although various methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. However, the skilled should understand that the methods and materials used and described are examples and may not the only ones suitable for use in the invention.
Moreover, it should also be understood that any temperature, weight, volume, time interval, pH, salinity, molarity or molality, range, concentration and any other measurements, quantities or numerical expressions given herein are intended to be approximate and not exact or critical figures unless expressly stated to the contrary. Hence, where appropriate to the invention and as understood by those of skill in the art, it is proper to describe the various aspects of the invention using approximate or relative terms and terms of degree commonly employed in patent applications, such as: so dimensioned, about, approximately, substantially, essentially, consisting essentially of, comprising, and effective amount.
Further, any publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety as if they were part of this specification. However, in case of conflict, the present specification, including any definitions, will control. In addition, the materials, methods and examples given are illustrative in nature only and not intended to be limiting.
Accordingly, this invention may be embodied in many different forms and should not be construed as limited to the illustrated embodiments set forth herein. Rather, these illustrated embodiments are provided so that this disclosure will be thorough, complete, and will fully convey the scope of the invention to those skilled in the art. Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.
Cell culture media (Dulbecco's modified Eagle's medium (DMEM) was purchased from Invitrogen (Karlsruhe, Germany) and the defined fetal calf serum (FCS gold) was from PAA Laboratories (Linz, Austria). All chemicals including protease as well as phosphatase inhibitor cocktails 1 and 2 were obtained from Sigma (Taufkirchen, Germany) or Merck Biosciences (Bad Soden, Germany) unless otherwise stated. The protein assay kit (Bio-Rad DC, detergent compatible) was from BioRad Laboratories (München, Germany), N-acetyl-L-cysteine (NAC) and sodium selenite were from Merck Biosciences. Matrigel and polycarbonate cell culture inserts (6.5 mm diameter, 8 μm pore size) were delivered from BD Biosciences (Heidelberg, Germany). The Oxyblot Protein Oxidation Detection kit was from Millipore (Schwalbach, Germany). The enhanced chemiluminescence system (SuperSignal West Pico/Femto Maximum Sensitivity Substrate) was supplied by Pierce (Bonn, Germany). Monoclonal mouse antibody raised against human-αSMA and α-tubulin were supplied by Sigma. Polyclonal rabbit antibody raised against human HIF-1 was supplied by New England Biolabs (Frankfurt a.M., Germany). The following secondary antibodies were used: polyclonal horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (DAKO, Glostrup, Denmark) and anti-rabbit immunoglobulin G antibodies were from Dianova (Hamburg, Germany). Recombinant human TGFβ1 (rTGFβ1) was from R&D Systems (Wiesbaden, Germany).
Cell Culture
Human dermal fibroblasts (HDF) were established by outgrowth from foreskin biopsies of healthy human donors with an age of 3-6 years. Cells were used in passages 2-12, corresponding to cumulative population doubling levels of 3-27 [15]. Dermal fibroblasts and the squamous carcinoma cell line SCL-1, originally derived from the face of a 74-year-old woman [16] (generously provided by Prof. Dr Norbert Fusenig, DKFZ Heidelberg, Germany), were cultured as described [17]. Myofibroblasts (MF) were generated by treatment of HDFs with different concentrations of recombinant TGFβ1 (5 ng/ml) for 48 h in HDF conditioned medium (CMHDF) [4].
Preparation of Conditioned Medium
Conditioned medium was obtained from human dermal fibroblasts (CMHDF) and myofibroblasts (CMMF). For this, seeded 1.5×106 HDF cells were grown to subconfluence (˜70% confluence) in 175-cm2 culture flasks. The serum-containing medium was removed, and after washing in phosphate-buffered saline (PBS) the cells were incubated in serum-free DMEM or treated with rTGFβ1 (5 ng/ml) in serum-free DMEM for 48 hours. This medium was removed, and after washing in PBS all cells were incubated in 15 ml serum-free DMEM for a further 48 hours before collection of the conditioned medium of HDF (CMHDF) and myofibroblasts (CMMF).
To prevent myofibroblast formation, HDF were treated with rTGFβ1 (5 ng/ml) in CMHDF in combination with CNP for 48 h. The conditioned medium (CMHDF,TGF,CNP) was collected as described above. Conditioned media were used fresh or stored at −20° C. for at the most 2 weeks before use.
Synthesis of Cerium Oxide Nanoparticles
Cerium oxide nanoparticles were synthesized in water and in dextran (molecular weight: 1000 Da) using previously described methods. Briefly, cerium nitrate hexahydrate was dissolved in deionized water and the pH of the solution was maintained between 3.5 to 4.0 for water based nanoparticles. Stoichiometric amounts of hydrogen peroxide and ammonium hydroxide were added to oxidize the dissolved cerium ions as cerium oxide nanoparticles (CNPs). The pH of the solution needs to be maintained below 4.0 to avoid precipitation of CNPs. For synthesis of dextran coated nanoparticles stoichiometric amounts of dextran was first dissolved in deionized water followed by cerium nitrate hexahydrate. The solution was stirred for 2 h followed by addition of ammonium hydroxide (30% w/w). The pH of the solution was kept below 9.5 to avoid precipitation of cerium hydroxide. The resulting cerium oxide nanoparticles were analyzed using UV-visible spectroscopy for determining the oxidation state of nanoparticles and transmission electron microscopy for particle size.
UV-Visible Spectrophotometry
The UV-visible spectral data were obtained using Varian Lambda 750 UV-VIS NIR instrument with a diffuse reflectance detector. The spectra were recorded immediately after the synthesis and after the complete aging treatment of nanoparticles. Deionized water and dextran solution was used as the control for water based CNPs and dextran-stabilized CNPs respectively. The reversal of oxidation state of nanoparticles confirms the presence of higher concentration of CNPs with trivalent oxidation states in water-synthesized nanoparticles.
High Resolution Transmission Electron Microscopy (HRTEM)
High resolution transmission electron micrographs were obtained using FEI Tecnai F 30 microscope operated at 300 kV with a point-to-point resolution of 0.2 nm. The samples were prepared by depositing a drop of CNP in water and dextran on a carbon coated copper grid. The grids were dried overnight in vacuum before imaging.
Cellular Uptake of Nanoparticles
Serum-starved human dermal fibroblasts in Dulbecco's Modified Eagle Medium (DMEM) were treated with 150 μM CeO2/dextran for 48 h. Thereafter, cells were harvested and washed with phosphate-buffered saline (PBS) to remove excess media. As CeO2/dextran is not detectable by phase contrast microscopy, transmission electron microscopy was used to determine the cellular uptake of nanoceria. For electronmicroscopy, pelleted samples of cerium oxide-treated cells were fixed for 2 h in 4% paraformaldehyde and 2.5% glutaraldehyde (Serva, Heidelberg, Germany) in 0.1 M phosphate buffer at pH 7.4 at room temperature. Next, the pellets were thoroughly washed with four changes of PBS, followed by a postfixation for 60 min in 1% osmium tetroxide (Serva) in the same buffer. The specimens were dehydrated in a graded series of acetone, and embedded in Spurr's medium (Serva) at 70° C. for 24 h.
Ultrathin sections were cut from the embedded tissue with a Reichert Ultracut (Vienna, Austria) using a diamond knife. The sections were collected on coated copper grids, and subsequently stained with uranyl acetate and lead citrate according to earlier published data [18]. The grids were analyzed using a Hitachi H 600 electron microscope. Documentation was carried out by using an optical system and the Digital Micrograph software (Gatan, Munich, Germany). For light microscopical controls semithin section were cut and stained with 1% Toluidine blue and 1% Borax.
Injection and Determining Cerium Oxide Nanoparticles in Skin
Eight-week-old, CD-1 mice were divided into two groups. Controls were given weekly doses of 100 μl sterile PBS only by intravenous (IV) administration. The nanoceria group received five doses (one dose a week) of 0.5 mg/kg of nanoceria suspended in 100 μl of sterile saline (IV). Both groups were sacrified on the sixth week. Skin tissue from the back of each animal was excised and hair removed. The tissue was patted dry, weighed and placed in 70% nitric acid overnight to start the digestion process. Samples were then microwave digested. The temperature was ramped to 200° C. over 20 min and held there for another 20 min. Samples were then boiled down to less than 1 ml each and reconstituted in water to an exact volume of 10 ml. Cerium levels were assessed using inductively coupled plasma mass spectroscopy (ICP-MS).
Cell Viability
The cytotoxic effect of cerium oxide nanoparticles (CNP) was measured by the MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay [19]. The activity of mitochondrial dehydrogenases, as indicator of cellular viability, results in formation of a purple formazan dye. Briefly, MTT solution (0.5 mg/ml) was added to the cell cultures treated for various times with the nanoparticles. The cells were incubated for an additional 1 hour. The medium was removed and the cells were lysed in dimethyl sulfoxide. Formazan formation was measured at 570 nm. The results were shown as a percentage of mock-treated control which was set at 100%.
RNA Isolation and Quantitative Real-Time RT-PCR
Total RNA was isolated and transcribed into cDNA as described [20]. Expression of mRNA was analyzed by real-time RT-PCR using a LightCycler system (Roche; Mannheim, Germany) as described [20]. Real-time RT-PCR was performed with 40 ng cDNA in glass capillaries containing LightCycler FastStart DNA Master SYBR Green I Reaction Mix (Roche), 2 mM MgCl2 and 1 μM of primers. Quantitation of the PCR amplicons was performed using the LightCycler Software. Hypoxanthine phosphoribosyltransferase (HPRT1) was used as internal normalization control [21]. Sequences of primer pairs are given in Table 1.
SDS-PAGE and Western Blotting
SDS-PAGE was performed according to the standard protocols published elsewhere [22] with minor modifications. Briefly, cells were lysed after incubation with rTGFβ1 in 1% SDS with 1:1000 protease inhibitor cocktail (Sigma; Taufkirchen, Germany). After sonication, the protein concentration was determined by using a modified Lowry method (Bio-Rad DC). 2×SDS-PAGE sample buffer (1.5 M Tris-HCl pH 6.8, 6 ml 20% SDS, 30 ml glycerol, 15 ml β-mercaptoethanol and 1.8 mg bromophenol blue was added, and after heating, the samples (10 μg total protein/lane) were applied to 10% (w/v) SDS-polyacrylamide gels. After electroblotting, immunodetection was carried out (1:1000 dilution of primary antibodies (mouse monoclonal anti-SMA and tubulin), 1:20000 dilution of anti-mouse antibody conjugated to HRP). Antigen-antibody complexes were visualized by an enhanced chemiluminescence system. Alpha-tubulin was used as internal control for equal loading.
Preparation of Collagen Lattices and Dermal Equivalents
Three-dimensional collagen lattices were prepared as described [23] with minor modifications. Briefly, type I collagen from rat tail tendon was redissolved at 3.2 mg/ml in sterile 0.2% acetic acid. Human dermal fibroblasts were seeded at 1.25×105 cells/ml into a NaOH-neutralized solution containing 0.8 mg collagen/ml 1×DMEM with 5% FCS and grown for 24 h at 37° C. in 3.5-cm-diameter uncoated bacterial culture dishes. Cells in that mechanically relaxed lattices were allowed to contract the gel matrix. The medium was replaced by serum-free medium or serum-free medium containing non-toxic concentrations of CNP, and the collagen lattices incubated for a further 24 h before addition of recombinant TGFβ1. After 48 h each collagen lattice was photographed and the diameter (in cm) used as a measure of the contractile force of the (myo)fibroblasts.
The dermal equivalents (DE) were prepared as previously described [24, 25]. Briefly, a suspension of 2×105 dermal fibroblasts/cm2 was added in each well of a 24-well plate on top of a collagen-chitosan-glycosaminoglycan (cc-GAG) biopolymer and the DE was cultured for 14 d in DMEM plus 10% FCS containing 50 μg/ml ascorbic acid under submerged conditions in a humidified atmosphere. The medium was changed every 2 d. DE were fixed in 4% paraformaldehyde and embedded in paraffin. Sections of 6 μm thickness were stained using hematoxylin-eosin (HE). In addition, DE were incubated for 2 d with recombinant TGFβ1 or in combination with 150 μM CNP. Thereafter, the DE were washed in PBS and digested with 3 mg Clostridium histolyticum collagenase/ml PBS for 30-45 min at 37° C. After centrifugation, the cells were lysed with 1:1000 diluted protease and phosphatase inhibitors and subjected to western blot analysis.
Invasion Assay
Cell culture inserts (transwells) were overlaid with 125 μg/ml growth factor reduced Matrigel and placed in a 24-well plate. SCL-1 tumor cells (5×104 cells/insert) either mock-treated or pretreated with antioxidants (NAC, selenite) or CNP were seeded on top of the matrigel in serum-free DMEM. CMHDF, CMMF. or CMHDF,TGF,CNP (see above) were used as chemoattractant in the lower chamber. After 72 h at 37° C., the tumor cells were rubbed off the upper side of the filter using cotton swabs, and the SCL-1 cells, which invaded to the lower side of the insert, were stained with Coomassie Blue solution (0.05% Coomassie Blue, 20% MeOH, 7.5% acetic acid). The number of invaded cells was estimated by counting 25 random microscopic fields/insert.
Determination of Oxidized (Carbonylated) Proteins Oxyblot Analysis
Dermal fibroblasts or tumor cells were grown to subconfluence on tissue culture dishes. After removal of serum-containing medium, HDF were cultured in CMHDF and either mock-treated or pretreated for 40 h with 150 μM CeO2 nanoparticles prior to addition of 10 ng rTGFβ1/ml for additional 8 h. Tumor cells were mock-treated or treated with 150 μM CNP for 16 h. As positive control, the cells were treated with 250 μM H2O2 for 1 h. Thereafter, cells were lysed and carbonyl groups of oxidized proteins were detected with the OxyBlot™ Protein Oxidation Detection Kit, following the manufacturer's protocol. Briefly, the protein concentration was determined by using a modified Lowry method (Bio-Rad DC). The protein amounts of the samples were aligned. 5 μg of this cell lysate was incubated with 2,4-dinitrophenyl (DNP) hydrazine to form the DNP hydrazone derivatives. Labeled proteins were separated by SDS-PAGE and immunostained using rabbit anti-DNP antiserum (1:500) and goat anti-rabbit IgG conjugated to horseradish peroxidase (1:2000). Blots were developed by enhanced chemiluminescence.
Measurement of Intracellular ROS
Generation of ROS was determined using 2′,7′-Dichlorodihydrofluorescein diacetate (H2DCF-DA), a dye that diffuses across the lipid membranes into cells and is subsequently oxidized by intracellular ROS forming the highly fluorescent DCF. Subconfluent HDF and SCL-1 tumor cells were exposed to 50 μM or 150 μM CNP in serum-free DMEM in 24-well plates. Untreated subconfluent SCL-1 cells were used as negative controls. Medium was substituted after 24 h by 100 μM H2DCF-DA containing Hanks Balanced Salt Solution (HESS). DCF fluorescence was detected at an excitation wavelength of 485 nm and emission wavelength of 520 nm in 15 minutes intervals in a FLUOstar OPTIMA plate reader (BMG Labtech, Offenburg, Germany). Mean fluorescence intensities and standard error of mean were determined for each reading point by using the statistical software Prism 3.0 (GraphPad, San Diego, Calif., USA).
Statistical Analysis
Means were calculated from at least three independent experiments, and error bars represent standard error of the mean (s.e.m.). Analysis of statistical significance was done by Student t test or ANOVA with *P<0.05, **P<0.01, and ***P<0.001 as levels of significance.
Table 1 Sequences of Primers for real-time RT-PCR
Genes Primer (5′-3′)
αSMA Forward: CTGTTCCAGCCATCCTTCAT (SEQ ID NO: 1)
Reverse: TCATGATGCTGCTGTTGTAGGTGGT (SEQ ID NO: 2)
HPRT1 Forward: ATTCTTTGCTGACCTGCTGGATT (SEQ ID NO: 3)
Reverse: CTTAGGCTTTGTATTTTGCTTTTC (SEQ ID NO: 4)
Results
This study focused on the progression of tumors and the importance of invasion during tumor-stroma interaction. Tumor cells continuously modulate the stromal microenvironment, which is important for tumor invasion [2]. Fibroblasts are basically involved in the process leading to invasion of tumor cells in the skin [1,4].
TGFβ1-Mediated Formation of Myofibroblasts
It is described that reactive oxygen species are important for many pathological processes like tumor invasion and inflammation. It is known that TGFβ1 initiates a ROS-triggered mesenchymal-mesenchymal transition (MMT) of human dermal fibroblasts to myofibroblasts [4]. Antioxidants downregulate the TGFβ1-dependent expression of αSMA. A time course analysis of TGFβ1-mediated αSMA expression in human dermal fibroblasts was performed. αSMA protein levels were measured in subconfluent fibroblast monolayer cultures in control conditioned medium (CMHDF) or after treatment with recombinant TGFβ1 for 8 to 48 h. Treatment of HDF with recombinant TGFβ1 resulted in a significant time-dependent increase in the αSMA protein amount starting at 16 h post treatment compared with mock-treated control cells (
TGFβ1 increased the intracellular concentration of reactive oxygen species [26]. Therefore, we addressed the question of whether ROS modulate induction of αSMA. Again, a significant increase in TGFβ1-initiated αSMA protein levels was detected compared with mock-treated controls (
Antioxidants Increase Invasive Capacity of Tumor Cells
As classical antioxidants and the micronutrient selenium prevent tumor cell-mediated formation of myofibroblasts which support the invasion of tumor cells [4], the question was addressed of whether the direct treatment of tumor cells with that antioxidants affect tumor invasion. Therefore, cells of the squamous tumor cell line SCL-1 (or the melanoma cell line A375; data not shown) were incubated with antioxidants like N-acetyl-L-cysteine or selenite. The invasive capacity of treated cells and mock-treated cells was tested after a 48 h incubation period. The conditioned medium of myofibroblasts (CMMF) resulted in a 2-fold increase in the number of invading tumor cells compared to CMHDF-treated cells. Interestingly, the invasive capacity of SCL-1 cells was further increased by NAC and selenite. A 2.5- to 3.5-fold increase in the number of invading tumor cells was observed compared to CMMF (
Characterization of CeO2 Nanoparticles
As cerium oxide based nanoparticles (CNP) have been shown to have prooxidant or antioxidant activity depending on the environmental pH [27], the effect of CNP on stromal and tumor cells was investigated herein. The absorbance edge of Ce3+ lies between 250-350 nm while the absorbance edge of Ce4+ lies beyond 350 nm. The absorbance of freshly synthesized CNP in water (open circle) and in dextran (closed circle) is beyond 350 nm indicating the predominance of tetravalent oxidation state (Ce4+) in both preparations (
Superoxide Dismutase and Catalase Activity of Cerium Oxide Nanoparticles
The SOD mimetic activity of CNPs was tested as described previously (Chem Comm 2007, Biomaterials 2008). In addition the nanoparticles were buffered to pH 3 and 7 to determine the effect of change in pH on the SOD activity of nanoparticles. Three different sets of nanoparticles were tested: viz. CNPs with predominant Ce3+ oxidation state, with predominant Ce4+ oxidation state and dextran-coated nanoparticles (mixed oxidation state). It can be observed from
The catalase activity of CNPs was tested using Amplex red assay (Invitrogen) as described previously (Chem Comm 2010). Additionally the nanoparticles were buffered to pH 3 and 7 to observe any effect in the catalase activity of nanoparticles. As seen from
CNP Distribution in Cell Culture and In Vivo
Transmission electron microscopy (TEM) was used to follow the cellular uptake of CNP. The TEM micrographs of human dermal fibroblasts (a, c) and SCL-1 tumor cells (b, d) show an uptake of the CeO2 nanoparticles at 16 h upon treatment (c, d) compared to mock-treated controls (a, b) (
In another set of experiments the distribution of cerium oxide nanoparticles in the skin of a murine model was established.
Cytotoxicity of Cerium Oxide Nanoparticles on Fibroblasts
Recent studies deal with a free radical scavenging mechanism of CNP in mammalian cells. CeO2 particles of less than 20 nm have been shown to increase cellular survival [28]. Herein, the MTT assay was used to determine optimal concentrations at which more than 80% of dermal fibroblasts survived at least 48 h after incubation with no change in morphology. Concentrations up to 300 μM did not show any cytotoxic effect at 48 h after CNP incubation (
Cerium Oxide Nanoparticles Prevent Myofibroblast Formation.
It has previously been suggested that CeO2 nanoparticles may exert cytoprotective effects based on the chemical properties of that material [29-31]. we performed real-time RT-PCR to study the effect of CNP on levels of αSMA mRNA in human dermal fibroblasts. The ‘housekeeping’ gene HPRT was used as internal control. TGFβ1 caused a 10-fold increase in αSMA steady-state mRNA levels at 24 h after treatment compared to mock-treated controls. Preincubation with non-toxic concentrations of CNP significantly counteracted the TGFβ1-initiated transcription of αSMA mRNA (
Three-dimensional free-floating collagen gels [32,33] were used to exclude an artificial effect of TGFβ1 and CNP due to cells in monolayer cultures. Cells in that mechanically released lattices were allowed to contract them. The occurrence of myofibroblasts is characterized by their capability to contract the free-floating collagen gel (
These data were confirmed by preincubation of the fibroblasts with CNP in a 3-dimensional dermal equivalent (DE) [26] (
Oxidation of Proteins by TGFβ1-Mediated Reactive Oxygen Species
ROS can directly generate damage in DNA, lipids and proteins. As TGFβ1 initiates the reactive oxygen species-dependend expression of αSMA [4], the effect of CNP on ROS production was studied. An increase in the concentration of intracellular ROS leads to oxidized (carbonylated) proteins, a hallmark of oxidative stress [36]. The question was addressed of whether CNP prevent TGFβ1-mediated production of ROS and consequently avoid the oxidation of proteins. In mock-treated fibroblasts (CMHDF) a low amount of oxidized proteins was detected whereas in TGFβ1-treated cells the amount of oxidized proteins was significantly increased (
Cytotoxicity of Cerium Oxide Nanoparticles on Squamous Tumor Cells
As tumor progression is associated with activation of the stroma via molecular crosstalk between tumor cells and stromal cells, we studied the effect of CNP on the squamous tumor cell line SCL-1. The MTT assay was used to determine concentrations at which SCL-1 tumor cells show cytotoxicity.
Involvement of CNP in Tumor Invasion
Prevention of transdifferentiation by antioxidants inhibits the myofibroblast-mediated increase in tumor invasion [4]. Myofibroblasts were found at the invasion front of some tumors [37], suggesting that myofibroblasts are involved in processes of tumor invasion and metastasis. In this study we tested whether the invasive capacity of tumor cells may be modulated by CNP-dependent inhibition of myofibroblast formation. The formation of myofibroblasts was prevented by treatment of subconfluent HDF cultures in CMHDF,TGF with CNP. After treatment of HDF with different concentrations of CNP and TGFβ1, the medium was replaced by serum-free DMEM for an additional 48 hours. These media (CMHDF,TGF,CNP) were used for invasion assays (
Furthermore, the question was addressed whether the direct treatment of tumor cells with CNP affects tumor invasion. Therefore, squamous tumor cells SCL-1 were incubated with different concentrations of CNPs. Fourty-eight hafter treatment the invasive capacity of these SCL-1 cells and mock-treated control cells were tested with conditioned media from HDF (CMHDF) and from myofibroblasts (CMMF) (
Oxidation of Proteins by CNP-Initiated Reactive Oxygen Species in Tumor Cells.
As a modulation of intracellular ROS levels by nanoparticles is suggested, we studied the effect of CNP on ROS production in the squamous SCL-1 cell line and human dermal fibroblasts (HDF). Therefore, time-course analysis of ROS generation after treatment with CNP of subconfluent HDF or SCL-1 cells was performed (
Accumulation of Hypoxia-Inducible Factor 1 (HIF-1)
Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric transcription factor playing a critical role in tumor cells [38]. HIF-1 is highly expressed in tumor cells but having a high turnover rate as well. The factor is rapidly degraded by the proteasomal pathway. Hypoxic conditions or chemical inhibitors of the hydroxylases, such as cobalt, inhibit HIF-1 degradation and stabilize its expression. Treatment of SCL-1 cells with a non-toxic concentration of 100 μM cobalt chloride for 4 h resulted in a significant increase in HIF-1 protein levels compared to mock-treated cells (
With the rapidly increasing number of publications on the health effects of nanomaterials, nanoparticles have drawn attention to their potential harmful effects [39]. The unique properties of these materials such as large specific area and greater reactivity resulted in questions regarding potential toxicological effects [40]. Even though the potential cytotoxic effects of nanoparticles on human health are controversially discussed, a few preliminary studies have demonstrated toxic effects [41,42]. On the other hand, some types of nanoparticles, for example cerium oxide based nanoparticles (CNP, nanoceria), seem to have more beneficial effects. Due to the valence and oxygen defect properties and their unique ability to switch oxidation states between III (Ce3+) and IV (Ce4+), CNP are described to have antioxidant activity (12,43]. As other data postulate a prooxidant mechanism of CNP in human cells depending on the structure as well as exogenous and endogenous conditions [11,44], the question was addressed in our study of whether that discussed bifunctional character may be used as a therapeutical tool in tumor-stroma interaction. In skin cancer, tumor cells interact with their cellular microenvironment, such as (stromal) fibroblasts [1,2,4]. The data herein showed that non-toxic concentrations of dextran-coated CNP with a size of 3-5 nm in diameter prevent the TGF 1-initiated and ROS-triggered expression of αSMA, a biomarker of myofibroblasts. Furthermore, the invasive capacity of tumor cells was dramatically lowered by inhibition of myofibroblast formation via CNP. That finding is in line with the prevention of myofibroblast formation by classical antioxidants and subsequent inhibition of tumor invasion [4,37]. Therefore, our data indicate an antioxidant mechanism of CNP in fibroblasts which is underlined by a CNP-dependent lowering of oxidized proteins. As TGF 1 increases the intracellular superoxide (O2−) level [4,14] and CNP exerts a superoxide dismutase (SOD) mimetic activity under a neutral pH, the conclusion seems likely that the ROS-triggered formation of myofibroblasts is inhibited by CNP. In that context, the intracellular production of O2− by incubation of dermal fibroblasts with the redox cycling agent paraquat (Pe) was prevented by pretreatment of the cells with CNP (data not shown). Recently, it was shown that CNP with a size >300 nm in diameter and a >10-fold higher concentration induced ROS-dependent DNA damage towards human dermal fibroblasts in vitro [44]. In conclusion, a non-toxic and even protective antioxidant effect of CNP from the dominating influence of tumor cell-derived soluble factors (e.g. TGF 1) depends on particle size, concentration, and oxidation state. The oxidation state IV was demonstrated to detoxify O2− [43,45] resulting in a shift of the Ce3+/Ce4+-ratio towards oxidation state III.
In this study, the direct treatment of tumor cells with concentrations of CNP which are non-toxic for (stromal) fibroblasts increased the intracellular ROS level leading to cellular toxicity and lowered invasive capacity. The elevated amount of ROS is mediated by the mixed valence states of Ce3+ and Ce4+ on the surface of the nanoceria and depends on the pH value. Earlier published data [27, 46] convincingly showed that the cerium oxide nanoparticles trigger a Fenton-like reaction, if O2− or H2O2 are available which was described for tumor cells [7, 38] and showed herein. As a result, more aggressive ROS types such as hydroxyl (HO.) and hydroperoxyl (HO2.) radicals are generated which damage the cells. The autocatalytic and autoregenerative capacity of CNP (Ce3+Ce4+
Ce3+) given under physiological pH conditions is abrogated under an acidic pH. Here, the ratio of Ce3+/Ce4+ is rapidly shifted to an irreversible higher concentration of Ce3+. Transmittance curves underline that hypothesis [46]. As a result, less Ce4+ is available per time for a potential antioxidant and detoxifying reaction and a prooxidant reaction is boosted in tumor cells.
What is the reason for a lowered pH in tumor cells? More than 50 years ago, the Nobel prize laureate Otto Warburg described that cancer cells greedily consume glucose and produce lactic acid even under aerobic conditions resulting in an acidic cytosolic pH. This phenomenon is called the ‘Warburg effect’ [47,48]. Recently, the Warburg effect, which is part of the concept of metabolic remodelling in tumor cells, returns to the cancer stage [49, 50]. A continuously elevated concentration of reactive oxygen species in tumor cells (see
In summary, this study is the first to show that cerium oxide nanoparticles have a dual function in tumor-stroma interaction, namely beneficial for stromal cells and harmful for tumor cells, based on the Warburg effect. Nanoceria reveal an inhibitory effect on the formation of myofibroblasts. Furthermore, concentrations of cerium oxide being non-toxic on normal (stromal) cells (e.g. fibroblasts) showed an inhibitory, even ROS-dependent cytotoxic and anti-invasive effect on squamous tumor cells. The understanding of the interaction between tumor cells, its surrounding stroma and engineered nanoparticles could result in novel therapeutic strategies to combat metastatic spread more efficiently in the future.
Accordingly, in the drawings and the above specification there have been disclosed typical preferred embodiments of the invention and although specific terms may have been employed, the terms are used in a descriptive sense only and not for purposes of limitation. The invention has been described in considerable detail with specific reference to these illustrated embodiments. It will be apparent, however, that various modifications and changes can be made within the spirit and scope of the invention as described in the foregoing specification and as defined in the appended claims.
This application is a continuation of application Ser. No. 12/834,302, filed Jul. 12, 2010, which claims the benefit of Provisional Application No. 61/224,602, filed on Jul. 10, 2009. Each of these applications is hereby incorporated by reference in its entirety.
This invention was made with government support by the National Science Foundation under award #CBET07081712. The government has certain rights in the invention.
Number | Name | Date | Kind |
---|---|---|---|
5089860 | Deppe et al. | Feb 1992 | A |
5411647 | Johnson et al. | May 1995 | A |
5486359 | Caplan et al. | Jan 1996 | A |
5910311 | Boussourira | Jun 1999 | A |
5961993 | Boussourira | Oct 1999 | A |
6042714 | Lin et al. | Mar 2000 | A |
6103247 | Boussourira | Aug 2000 | A |
6139985 | Borglum et al. | Oct 2000 | A |
6316012 | N'Guyen | Nov 2001 | B1 |
6327074 | Bass et al. | Dec 2001 | B1 |
6368577 | Kropf et al. | Apr 2002 | B1 |
6406685 | Philippe | Jun 2002 | B1 |
6468551 | Diec | Oct 2002 | B1 |
6497863 | Wachter | Dec 2002 | B1 |
6497875 | Sorrell et al. | Dec 2002 | B1 |
6501590 | Bass et al. | Dec 2002 | B2 |
6592746 | Schmid-Schoenbein et al. | Jul 2003 | B1 |
6654161 | Bass et al. | Nov 2003 | B2 |
6844387 | Bass et al. | Jan 2005 | B2 |
6890896 | Shashoua | May 2005 | B1 |
7005504 | Hsei et al. | Feb 2006 | B2 |
7075707 | Rapaport et al. | Jul 2006 | B1 |
7141227 | Chan | Nov 2006 | B2 |
7270813 | Shimp et al. | Sep 2007 | B2 |
7347987 | McGinnis et al. | Mar 2008 | B2 |
7419516 | Seal et al. | Sep 2008 | B1 |
7431758 | Ota et al. | Oct 2008 | B2 |
7442686 | Lasko et al. | Oct 2008 | B2 |
7458384 | Seal et al. | Dec 2008 | B1 |
7471706 | Bass et al. | Dec 2008 | B2 |
7504356 | Self et al. | Mar 2009 | B1 |
7507480 | Sugama | Mar 2009 | B2 |
7534453 | Rzigalinski et al. | May 2009 | B1 |
7563459 | Phillips | Jul 2009 | B2 |
7642250 | Williams | Jan 2010 | B2 |
7687505 | Sugaya | Mar 2010 | B2 |
7725802 | Eroz et al. | May 2010 | B2 |
7727559 | McGinnis et al. | Jun 2010 | B2 |
7772375 | Greferath et al. | Aug 2010 | B2 |
7888119 | Sugaya et al. | Feb 2011 | B2 |
7899093 | Bass et al. | Mar 2011 | B1 |
7906147 | Hainfield | Mar 2011 | B2 |
7924617 | Yip | Apr 2011 | B2 |
7959690 | Seal et al. | Jun 2011 | B1 |
7959949 | Seal et al. | Jun 2011 | B2 |
8080420 | Sugaya | Dec 2011 | B2 |
8084096 | Fei et al. | Dec 2011 | B1 |
8097270 | Ketelson et al. | Jan 2012 | B2 |
8153158 | Sugaya et al. | Apr 2012 | B2 |
8172901 | Altman et al. | May 2012 | B2 |
8172997 | Seal et al. | May 2012 | B2 |
20030050709 | Noth et al. | Mar 2003 | A1 |
20030187077 | Chane-Ching | Oct 2003 | A1 |
20030228277 | Gehlsen | Dec 2003 | A1 |
20040013658 | Fulton et al. | Jan 2004 | A1 |
20040048808 | Hamdi et al. | Mar 2004 | A1 |
20040062753 | Rezania et al. | Apr 2004 | A1 |
20050036928 | Katusic et al. | Feb 2005 | A1 |
20050159820 | Yoshikawa et al. | Jul 2005 | A1 |
20050164377 | Miyabayashi et al. | Jul 2005 | A1 |
20050171192 | Gehlsen | Aug 2005 | A1 |
20060110440 | Sugaya et al. | May 2006 | A1 |
20060134789 | Sugaya et al. | Jun 2006 | A1 |
20060141137 | Anderson et al. | Jun 2006 | A1 |
20060246152 | McGinnis et al. | Nov 2006 | A1 |
20060280729 | Mistry | Dec 2006 | A1 |
20070003621 | Nangia et al. | Jan 2007 | A1 |
20070072825 | Williams | Mar 2007 | A1 |
20070123996 | Sugaya et al. | May 2007 | A1 |
20070166311 | Greferath et al. | Jul 2007 | A1 |
20070202193 | McGinnis et al. | Aug 2007 | A1 |
20080089836 | Hainfield et al. | Apr 2008 | A1 |
20080166412 | Sugaya et al. | Jul 2008 | A1 |
20080311390 | Seal et al. | Dec 2008 | A1 |
20090071848 | Seal et al. | Mar 2009 | A1 |
20090087493 | Dai et al. | Apr 2009 | A1 |
20090098574 | Brisson et al. | Apr 2009 | A1 |
20090127505 | Seal et al. | May 2009 | A1 |
20090269410 | McGinnis et al. | Oct 2009 | A1 |
20100015050 | Panyam et al. | Jan 2010 | A1 |
20100098768 | Andreescu et al. | Apr 2010 | A1 |
20100151000 | Thomas et al. | Jun 2010 | A1 |
20100221344 | Seal et al. | Sep 2010 | A1 |
20100247428 | Kim et al. | Sep 2010 | A1 |
20110111007 | McGinnis et al. | May 2011 | A1 |
20110135740 | Sugaya et al. | Jun 2011 | A1 |
20110159056 | Sugaya et al. | Jun 2011 | A1 |
20110268662 | Seal et al. | Nov 2011 | A1 |
20110319259 | Fei et al. | Dec 2011 | A1 |
20120070500 | Cimini et al. | Mar 2012 | A1 |
20120093931 | McGinnis et al. | Apr 2012 | A9 |
Number | Date | Country |
---|---|---|
WO 9915891 | Apr 1999 | WO |
WO 03059263 | Jul 2003 | WO |
WO 2006118954 | Nov 2006 | WO |
WO 2007002662 | Jan 2007 | WO |
2008064357 | May 2008 | WO |
WO 2008064357 | May 2008 | WO |
WO 2009132277 | Oct 2009 | WO |
2009147214 | Dec 2009 | WO |
Entry |
---|
JM Perez, A Asati, S Nath, C Kaittanis. “Synthesis of Biocompatible Dextran-Coated Nanoceria with pH-Dependent Antioxidant Properties.” Small, vol. 4 No. 5, 2008, pp. 552-556. |
JR Griffiths. “Are Cancer Cells Acidic?” British Journal of Cancer, vol. 64, 1991, pp. 425-427. |
O De Wever, P Demetter, M Mareel, M Bracke. “Stromal myofibroblasts are drivers of invasive cancer growth.” International Journal of Cancer, vol. 123, 2008, pp. 2229-2238, available Sep. 5, 2008. |
AS Karakoti, NA Monteiro-Riviere, R Aggarwal, JP Davis, RJ Narayan, WT Self, J McGinnis, S Seal. “Nanoceria as Antioxidant: Synthesis and Biomedical Applications.” JOM, Mar. 2008, vol. 60(3) pp. 33-37. |
Pubmed Abstract for Karakoti et al. “Nanoceria as Antioxidant: Synthesis and Biomedical Applications.” JOM, Mar. 2008, vol. 60(3) pp. 33-37. Pubmed ID: 20617106. http://www.ncbi.nlm.nih.gov/pubmed/20617106 (accessed Dec. 31, 2015). 2 printed pages. |
Dong et al., “Activation of glassy carbon electrodes by dispersed metal oxide particles”, J. Electrochem Soc., 1984, pp. 813-819. |
Karakoti et al., Direct Synthesis of Nanoceria in Aqueous Polyhydroxyl Solutions, Journal of Physical Chemistry C, vol. 11, 2007, pp. 17232-17240. |
Perez et al., Synthesis of Biocompatible Dextran-Coated Nanoceria With pH-Dependent Antioxidant Properties, Small, vol. 4(5), 2008, pp. 552-556. |
Karakoti et al., Nanoceria as Antioxidant: Synthesis and Biomedical, JOM (1989) Mar. 1, 2008; 60(3):33037. |
Mohammad et al., Antioxidant Properties of Some nanoparticle May Enhance Wound Healing in T2DM Patient, Digest Journal of Nanomaterials and Biostructures vol. 3, No. 4, Dec. 2008, p. 159-162. |
Patil et al. , Surface-Derivatized Nanoceria With Human Carbonic Anhydrase II Inhibitors and Fluorophores: A Potential Drug Delivery Device, J. Phys. Chem. C. 2007, vol. 111, No. 24, pp. 8437-8442. |
Patil et al., Synthesis of Nanocrystalline Ceria Particles for High Temperature oxidation Resistant Coating, Journal of Nanoparticle Research, 2002, vol. 4, pp. 433-438. |
Jin et al., Nanoparticle-Medicated Drug Delivery and Gene Therapy, Biotechnol. Prog., 2007, vol. 23, pp. 32-41. |
Eck et al, PEGylated Gold Nanoparticles Conjugated to Monoclonal F19 Antibodies as Targeted labeling Agents for Human Pancreatic Carcinoma Tissue, ACS Nano, 2008, vol. 2 (11), pp. 2263-2272. |
Nafee et al, Dissertation entitled Cationically-modified nanoparticles for the pulmonary delivery of the telomerase inhibitor 2′-OMethyl RNA for the treatment of lung cancer. Dissertaion zur Erlangung des Grades des Doktors der Naturwissenschaffen der Naturwissenschaftlich-Technischen Fakult't III Chemie, Pharmazie, Bio-und Werkstoffwissenschafen der Universit des Saarlandes, 2008. |
Oliver et al., Synthesis of Pegylated Immunonanparticles. Pharmaceutical Research, Aug. 2002, vol. 19, No. 8, pp. 1137-1143. |
Otsuka et al., PEGylated nanoparticles for biological and pharmaceutical applications, Advanced Drug Delivery Reviews, 2003, vol. 55, pp. 403-419. |
Qi et al, Redispersible Hybrid Nanopowders: Cerium Oxide Nanoparticle Complexes with Phosphonated-PEG Oligomers, ACS Nano, 2008, vol. 2 (5), pp. 879-888. |
Sokolov et al., Real-Time Vital Optical Imaging of Precancer Using Anti-Epidermal Growth Factor Receptor Antibodies Conjugated to Gold Nanoparticles, Cancer Res. , 2003, vol. 63: 1999-2004. |
Suh et al., Multifunctional nanosystems at the interface of physical and life sciences, Physicaplus, Apr. 15, 2010, Iss. No. 13. |
Suzuki et al., Preparation and Characteristics of Magnetitelabelled Antibody With Use of Poly(ethylene glycol) Derivatives, Biotechnol. Appl. Biochem., 1995, vol. 21, 00 335-345. |
Nazem et al., Nanotechnology for Alzheimer's Disease Detection and Treatment, Insciences J. 2011, 1 (4), 169-193. |
Pirmohamed et al., Nanoceria exhibit redox state-dependent catalasemimetic activity, Chem. Comm.,2010, 46 pages, 2736-2738, US. |
Chen et al., Rare earth nanoparticles prevent retinal degeneratioinal induced by intracellular peroxides, Nature Publishing Group, 2006, pp. 1-9, US. |
Tarnuzzer et al., Vacancy Engineered Ceria Nanoatructures for Protection From Radiation-Induced Cellular Damage, nano Lett., vol. 5, No. 12, 205, pp. 2573-2577, US. |
Heckert et al., The role of cerium redox state in the SOD mimetic activity of nanoceria, Biomaterials, 29, 2008, pp. 2705-2709, US. |
Sokolov, et al. ,“Real-time vital optical imaging of precancer using anti-epidermal growth factor receptor antibodies conjugated to gold nanoparticles.” Cancer Res. 2003, vol. 63:1999, 2004. |
Niu, J., et al. “Cardiovascular effects of cerium oxide nanoparticles in a transgenic murine model of cardiomyopathy,” Cardiovas. Res. Nov. 30, 2006, Nov. 2006, vol. 73, No. 3, pp. 549-559. |
Qureshi, M.A., et al. “Increased exhaled nitric oxide following autologous peripheral hemotopietic stem cell transplantation; a potential marker of idopathic pneumonia syndrome,” Chest, Jan. 2004, vol. 125, No. 1, pp. 281-287. |
Ohgushi, et al., “Stem Cell Technology and Bioceramics: From Cell to Gene Engineering”, J. Biomed. Mat. Res. 48: 913-927; 1999. |
Dal Maschio, et al., “Influence of Ce3+/Ce 4+ ratio on phase stability and residual stress field in ceria-yttria stabilized zirconia plasma-sprayed coatings”, J. Mat. Sci. 27: 5591-5596; 1992. |
Ramsfjell, et al., “Distinct Requirements for Optimal Growth and In Vitro Expansion of Human CD341CD382 Bone Marrow Long-Term Culture-Initiating Cells (LTC-IC), Extended LTC-IC, and Murine In Vivo Long-Term Reconstituting Stem Cells”, Blood 99: 4093-4102; 1999. |
Devasenpathi, et al., “Forming near net shape free-standing components by plasma spraying”, Mat. Let. 57: 882-886; 2002. |
Imamura, et al. “Drusen, choridal neovascularization and retinal pigment epithelium dysfunction in SOD1-deficient mice: A model of age-related macular degeneration,” PNAS, vol. 103, No. 30; 11282-11287 (Jul. 25, 2006). |
Hollyfield, et al. “Oxidative damage-induced inflammation initiates age-related macular degeneration,” Nature Medicine, vol. 14, pp. 194-198 (2008). |
Birch, et al. Age-related macular degeneration: a target for nanotechnology derived medicines. International Journal of Nanomedicine, 2007, 2(1), 65-77. |
Maulik, N. Reactive oxygen species drives myocardial angiogenesis? Antioxidants & Redox Signaling, 2006, 8 (11-12) 2161-2168. |
Kuchibhatla et al., “Hierarchical assembly of inorganic nanostructure building blocks to octahedral superstructures a true template-free self-assembly”, Nanotechnology, 2007, vol. 18, pp. 1-4. |
Ohia, et al. “Pharmacological consequences of oxidative stress in ocular tissues,” Mutation Research, 2005, 579, 22-36. |
Liu, et al. “Subtype lesions of neovascular age-related macular degeneration in Chinese paitents,” Braefe's Arch Clin Exp Opthalmol, 2007, 245, 1441-1445. |
Silva. “Seeing the benefits of ceria,” Nature Nanotechnology, 2006, 1, 92-94. |
Hahn, et al. “Maculas affected by Age-Related Macular Degeneration Contain Increased Chelatable Iron in the Retinal Pigment Epithelium and Bruch's Membrane,”Arch. Opthalmol. 2003, 121, 1099-1105. |
Haywood, et al. “Inflammation and Angiogenesis in Osteoarthritis,” Arthritis & Rheumatism, 2003, 48 (8), 2173-2177. |
Chen, et al. Rare Earth Nanoparticles Prevent Retinal Degeneration Induced by Intracellular Peroxides: Nature Nano Technology, 1(2) 142-148 (2006). |
Moongkarndi, et al. “Antiproliferation, antioxidation and induction of apoptosis by Garcinia mangostana (mangosteen) on SKBR3 human breast cancer cell line,” J. of Ethno-Pharmacology, vol. 90, (2004) pp. 161-166. |
Margrain, et al. “Do blue light filters confer protection against age-related macular degeneration?”, Progress in Retinal and Eye Research, vol. 23 (2004) pp. 523-531. |
Bailey, et al. “Cerium Oxide Nanoparticles Extend Cell Longevity and Act as Free Radical Scavengers,” online (retrieved on Apr. 24, 2006) from: http://www.med.miami.edu/mnbws/Rzigalinski11.html. |
Tsai, Ming-Shyong. “The Study of the synthesis of nano-grade cerium oxide powder,” Materials Letters 58, 2270-2274 (2004). |
Rzigalinski, Beverly Ann, et al. “Cerium Oxide nanoparticles increase the lifespan of cultured brain cells and protect against free radical mechanical trauma” FASEB Journal, vol. 17 No. 4-5, Page Abstract No. 377.24 URL, XP008095016 & FASEB Meeting on Experimental Biology: Translating the Genome, San Diego, CA, USA, Apr. 11-15, 2003 ISSN: 0892-6638 *Abstract*. |
Cook, et al. “Neuronal Damage induced by polychlorinated biphenyls is partically reversed by cerium oxide nanoparticles” [online] vol. 2003, 2003, XP008095032 Retrieved from the internet: URL http://sfn.scholarone.com/itin2003/main.htm]?new—page—id=126&abstract—id=14513&p—num=669.13&is—tech=0> [retrieved on Aug. 5, 2008] *abstract*. |
Tusnekawa, S., et al. “Lattice relaxation of monosize Ce02-x nanocrystalline particles” Applied Surface Science Elsevier Netherlands, vol. 152, No. 1-2, Nov. 1999, pp. 53-56. |
Hooper, Claire, Y., et al. “New treatment in age-related macular degeneration” Clinical & Experimental Opthalmology, Oct. 2003, pp. 376-391. |
Qi, et al. “Redispersible Hybrid Nanopowders; Cerium Oxide Nanoparticle complexes with Phosphonated-PEG Oligomers,” ACS Nano, 2008, vol. 2(5), pp. 879-888. |
Otsuka, et al. “PEGylated nanoparticles for biological and pharmaceutical applications,” Advanced Drug Delivery Reviews, 2003, vol. 55, pp. 403-419. |
Olivier, et al. “Synthesis of pegylated immunonanoparticles.” Pharmaceutical Research, Aug. 2002, vol. 19, No. 8, pp. 1137-1143. |
Shui, Y.B., et al. “Morphological observation on cell death an dphagocytosis induced by ultraviolet irradiation in a cultured human lens epithelial cell line,” Dec. 2000, vol. 71, pp. 609-618. |
Xijuan, et al. “Size-dependent optical properties of nanocrystalline Ce02:Er obtained by combustion synthesis,” Sep. 24, 2001, Phys. Chem. Chem Phys., vol. 3, pp. 5266-5269. |
Guo, “Green and red upconversion luminescence in Ce02:Er3+ powders produced by 785 nm laser,” Jounral of Solid State Chemistry 180, p. 127-131, 2007. |
Perez, J. M., et al. “Synthesis of Biocompatible Dextran-Coated Nanoceria with pH-Dependent Antioxidant Properties,” Small, vol. 4 No. 5, 2008, pp. 552-556. |
Pirmohamed, et al. “Nanoceria exhibit redox state-dependent catalase mimetic activity,” Chem. Comm, 2010, 46, pp. 2736-2738. |
Nazem, et al. “Nanotechnology for Alzheimer's disease detection and treatment.” Insciences J., 2011, vol. 1(4), pp. 169-193. |
Karakoti, et al. “Direct Synthesis of Nanoceria in Aqueous Polyhydroxyl Solutions.” J. Phys. Chem. C, vol. 111, No. 46, 2007, pp. 17232-17240. |
Tarnuzzer, et al. “Vacancy Engineered Ceria Nanostructures for Protection from Radiation-Induced Cellular Damage,” Nano Lett, vol. 4, No. 12, pp. 2573-2577. |
Heckert, et al. “The role of cerium redox state in the SOD mimetic activity of nanoceria,” Biomaterials, 29, 2008, pp. 2705-2709. |
Schubert, et al. “Cerium and yttrium oxide nanoparticles are neuroprotective,” Feb. 2006, Biochemical and Biophysical Research Communications, 342, p. 86-91. |
Zhang, et al. Cerium oxide nanoparticles: size selective formation and structure analysis, Jan. 2002, Applied Physics Letters, vol. 81, No. 1, p. 127-129. |
Patil, et al. “Surface-derived nanoceria with human carbonic anhydrase II inhibitors and flourphores: a potential drug delivery device.” J. Phys. Chem. C., 2007, vol. 111, No. 24, pp. 8437-8442. |
Patil, et al. “Synthesis of nanocrystalline ceria particles for high temperature oxidation resistant coating,” Journal of Nanoparticle Research, 2002, vol. 4: ppl. 433-438. |
Jin, et al. “Nanopartical-mediated drug delivery and gene therapy,” Biotechnol. Prog, 2007, vol. 23, pp. 32-41. |
Eck, et al. “PEGylated gold nanoparticles conjugated to monoclonal F19 antibodies as targeted labeling agents for human pancreatic carcinoma tissue,” ACS Nano, 2008, vol. 2(11) pp. 2263-2272. |
Nafee. Dissertation entitled “Cationically-modified nanoparticles for the polmonary delivery of the telomerase inhibitor 2′-O-Methyl RNA for the treatment of lung cancer,” Dissertation zur Erlangung des Grades des Doktors der, Naturwissenschaftern der Naturwissenschaftilch-Technischen Fakul't III Chemie, Pharmazie, Bio-und Werstoffwissenschaften der Universit des Saarlandes, 2008. |
Suh et al., “Multifunctional nanosystems at the interface of physical and life sciences”, Nano Today, 2009, vol. 4, pp. 27-36. |
Suzuki et al., “Preparation and characteristics of magnetite labelled antibody with the use of poly(ethylene glycol) derivatives”, Biotechnol. Appl. Biochem., 1995, vol. 21, pp. 335-345. |
Monte et al., “Inhibition of lymphocyte induced angiogenesis by free radical scavengers”, Free Radic Biol Med, 1994, vol. 17, pp. 259-266. |
Drisko, J.A. et al., “The use of Antioxidants with First-Line Chemotherapy in Two Cases of Ovarian Cancer”, J Am Coll Nut, 2003, vol. 22(2), pp. 118-123. |
Korsvik et al., “Superoxide dismutase mimetic properties exhibited by vacancy engineered ceria nanoparticles”, Chem. Commun., 2007, pp. 1056-1058. |
Yu et al., “Large-scale nonhydrolytic sol-gel synthesis of uniform-sized ceria nanocrystals with spherical, wire, and tadpole shapes”, Angew. Chem. Int. Ed., 2005, vol. 44, pp. 7411-7414. |
Ahluwalia et al., “Critical role of hypoxia sensor-HIF1 alpha in VEGF gene activation, implication for angiogenesis and tissue injury healing”, Current Medicinal Chemistry, 2012, vol. 19, p. 94. |
Perez, J.M. et al., “Synthesis of Biocompatible Dextran-Coated Nanoceria with pH-Dependent Antioxidant Properties”, 2008, Small, vol. 4, No. 5, pp. 552-556. |
Griffiths, J.R., “Are Cancer Cells Acidic?”, British Journal of Cancer, 1991, vol. 64, pp. 425-427. |
De Wever, O. et al., “Stromal myofibroblasts are drivers of invasive cancer growth”, International Journal of Cancer, 2008, vol. 123, pp. 2229-2238. |
Lam, M.A., et al., “Nitric Oxide and Nitroxides Can Act as Efficient Scavengers of Protein-Derived Free Radicals”, Chem Res. Toxicol, 2008, vol. 21, pp. 2111-2119. |
Karakoti, A.S., et al., “Nanoceria as Antioxidant: Synthesis and Biomedical Applications”, JOM, 2008, vol. 60(3), pp. 33-37. |
Clinicaltrials.gov, “Clinical Trial for the Treatment of Diabetic Foot Ulcers Using a Nitric Oxide Releasing Patch: PATHON”, (http://web.archive.org/web/20091130234819/http://clinicaltrials.gov/show/NCT/00428727) published online Nov. 30, 2009. |
Deshpande et al., “Size dependency variation in lattice parameter and valency states in nanocrystalline cerium oxides”, Appl;ied Physics Letters, 2005, vol. 87, pp. 133113-1-133113-3. |
Rasmussen et al., “Penetration of intact skin by quantum dots with diverse physiochemical properties”, Toxicological Sciences, 2006, vol. 91, pp. 159-165. |
Park et al., “Oxidative stress induced by cerium oxide nanoparticles in cultured BEAS-2B cells”, Toxicology, 2008, vol. 245, pp. 90-100. |
MSDS from Aldrich for cerium oxide powder bulk product, Feb. 2013, 6 pages. |
Kuchibhatla, S. et al., “Hierarchicial assembly of inorganic nanostructure building blocks to octahedral superstructures—atrue template-free self-assembly”, Nanotechnology, 2007, vol. 17 pp. 1-4. |
Kuchibhatla, S, “Probing and Tuning the Size, Morphology, Chemistry and Structure of Nanoscale Cerium Oxide”, Diss. University of Central Florida, 2008, 175 pages. |
Giri, S et al., “Nanoceria: A Rare-Earth Nanoparticle as a Novel Anti-Angiogenic Therapeutic Agent in Ovarian Cancer”, PLOS ONE, Jan. 2013, vol. 8, Issue 1, e54578. |
PCT/US2011/0044329; PCT International Search Report and Written Opinion, Dec. 8, 2011. |
De Wever, 0., et al, “Role of tissue stroma in cancer cell invasion.” J. Pathol. vol. 200, pp. 429-447 (2003). |
Liotta, L. A. , et al, “The microenvironment of the tumour-host interface.” Nature vol. 411, pp. 375-379 (2001). |
Pupa, S. M. et al. “New insights into the role of extracellular matrix during tumor onset and progression.” J. Cell. Physiol. vol. 192, pp. 259-267 (2002). |
Cat, B, et al. “Enhancement of tumor invasion depends on transdifferentiation of skin fibroblasts mediated by reactive oxygen species.” J. Cell Sci. vol. 119, pp. 2727-2738 (2006). |
Kunz-Schughart, et al, “Tumor-associated fibroblasts (part II): functional impact on tumor tissue.” Histol. Histopathol. vol. 17, pp. 623-637 (2002). |
Desmouliere, A. et al. “The stroma reaction myofibroblast: a key player in the control of tumor cell behavior.” Int. J. Dev. Biol. vol. 48: pp. 509-517 (2004). |
Cerutti, P. et al. “The role of the cellular antioxidant defense in oxidant carcinogenesis.” Environ. Health Perspect. vol. 102, pp. 123-129 (1994). |
Freitas, R. A. “What is nanomedicine?” Nanomedicine vol. 1, pp. 2-9 (2005). |
Barry, S. E. “Challenges in the development of magnetic particles for therapeutic applications.” Int. J. Hyperth. vol. 24, pp. 451-466 (2008). |
Corchero, J. L., et al “Biomedical applications of distally controlled magnetic nanoparticles.” Trends Biotechnol. vol. 27, pp. 468-476 (2009). |
Lin, W. et al. Toxicity of Cerium Oxide Nanoparticles in Human Lung Cancer Cells:, Int. J. of Toxicol., vol. 251 pp. 451-457 (2006). |
Ristow, M. “Oxidative metabolism in cancer growth.” Curr. Opin. Clin. Nutr. Metab. Care. vol. 9, pp. 339-345 (2006). |
Karakoti, A. s. et al. “PEGylated Nanoceria as Radical Scavenger with Tunable Redox Chemistry.” J. Am. Chern. Soc. vol. 131, pp. 14144-14145 (2009). |
Thannickal, V. J., et al. “Reactive oxygen species in cell signaling.” Am. J. Physiol. Lung Cell Mol. Physiol. vol. 279, pp. L1005-L1028 (2000). |
Bayreuther K. et al. “Terminal differentiation, aging, apoptosis, and spontaneous transformation in fibroblast stem cell systems in vivo and in vitro.” Ann. N. Y. Acad. Sci. vol. 663 1 pp. 167-179 (1992). |
Boukamp, P. et al. “Phenotypic and genotypic characteristics of a cell line from a squamous cell carcinoma of human skin.” J. Natl. Cancer Inst. vol. 68, pp. 415-427 (1982). |
Stuhlmann, D. et al. “Modulation of homologous gap junctional intercellular communication of human dermal fibroblasts via a paracrine factors generated by squamous tumor cells.” Carcinogenesis vol. 24, pp. 1737-1748 (2003). |
Reynolds, E. S. “The use of lead citrate citrate at high pH as electron opaque stain in electron microscopy.” J. Cell Biol. vol. 17, pp. 208-212 (1963). |
MocxSMAnn, T. “Rapid colorimetric growth and survival: application to assay for cellular proliferation and cytotoxicity assays. (1983).” J. Immunol. Methods vol. 65, pp. 55-63. |
Speckmann, B. et al. “Selenoprotein P expression is controlled through interaction of the coactivator PGC-1alpha with Fox01a and hepatocyte nuclear factor 4alpha transcription factors.” Hepatology vol. 48, pp. 1998-2006 (2008). |
Nishimura, M. et al. “Effects of prototypical drug• metabolizing enzyme inducers on mRNA expression of housekeeping genes in primary cultures of human and rat hepatocytes.” Biochem. Biophys. Res. Commun. vol. pp. 346, 1033-1039 (2006). |
Laemmli, “U K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.” Nature vol. 227, pp. 680-685 (1970). |
Mauch, C. et al. “Regulation of collagen synthesis in fibroblasts within a three-dimensional collagen gel.” Exp. Cell Res. vol. 178, pp. 493-503 (1988). |
Damour, 0. et al. “A dermal substrate made of collagen-GAG-chitosan for deep burn coverage: first clinical uses.” Clin. Mater. vol. 15, pp. 273-276 (1994). |
Schlotmann, K. et al. “Cosmetic efficacy claims in vitro using a three-dimensional human skin model.” Int. J. Cosmet. Sci. vol. 23, pp. 309-318 (2001). |
Stuhlmann, D. et al. “Paracrine effect of TGF-betal on downregulation of gap junctional intercellular communication between human dermal fibroblasts.” Biochem. Biophys. Res. Commun. vol. 319, pp. 321-326 (2004). |
Heckert, E. G. et al. “Fenton-like reaction catalyzed by rare earth inner transition metal cerium.” Environ. Sci. Technol. vol. 42, pp. 5014-5019 (2008). |
Rzigalinski, B. A., et al. “Radical nanomedicine.” Nanomedicine vol. 1, pp. 399-412 (2006). |
Korsvik, C. et al. “Superoxide dismutase mimetic properties exhibited by vacancy engineered ceria nanoparticles.” Chern. Commun. vol. 14, pp. 1056-1058 (2007). |
Perez, J. M. et al. “Synthesis of biocompatible dextran-coated nanoceria with pH-dependent antioxidant properties.” ASMAII vol. 4, pp. 552-556 (2008). |
Auffan, M. et al. “Ce02 nanoparticles induce DNA damage towards human dermal fibroblasts in vi t:ro.” Nanotoxicol. vol. 3, pp. 161-171 (2009). |
Treiber, N. et al. “Overexpression of manganese superoxide dismutase in human dermal fibroblasts enhances the contraction of free floating collagen lattice: implications for ageing and hyperplastic scar formation.” Arch. Dermatol. Res. vol. 301, pp. 273-287 (2009). |
Kessler, D. et al. “Fibroblasts in mechanically stressed collagen lattices assume a “synthetic” phenotype.” J. Biol. Chern. vol. 276, pp. 36575-36585 (2001). |
Arora, P.D., et al. “Dependence of collagen remodelling on alpha-smooth muscle actin expression by fibroblasts.” J. Cell. Physiol. vol. 159, pp. 161-175 (1994). |
Ljinen, P. et al. “Transforming growth factor-beta 1 promotes contraction of collagen gel by cardiac fibroblasts through their differentiation into myofibroblats.” Methods Find. Exp. Clin. Pharmacal. vol. 25, pp. 79-86 (2003). |
Levine, R. L., et al. “Carbonyl assays for determination of oxidatively modified proteins.” Methods Enzymol. vol. 233, pp. 346-357 (1994). |
de Wever, et al, “Role of myofibroblasts at the invasion front.” Biol. Chern. vol. 383, pp. 55-67 (2002). |
Nadege, D. et al. “Mitochondria: from bioenergetics to the metabolic regulation of carcinogenesis.” Front. Biosci. vol. 14, pp. 4015-4034 (2009). |
Moller, P. et al. “Role of oxidative damage in toxicity of particulates.” Free Radic. Res. vol. 44, pp. 1-46 (2010). |
Oberdorster, G. et al. “Nanotoxicology: an emerging discipline evolving from studies of ultrafine particles.” Environ. Health Perspect. vol. 113, pp. 823-829 (2005). |
Shvedova, A. A. et al. “Exposure to carbon nanotube material: assessment of nanotube cytotoxicity using human keratinocyte cells.” J. Toxicol. Environ. Health A vol. 66, pp. 1909-1926 (2003). |
Warheit, D. B. “Nanoparticles: Health impacts ? Mater.” Today vol. 7, pp. 32-35 (2004). |
Heckert, E. et al. “The role of cerium state in the SOD mimetic activity redox of nanoceria.” Biomaterials vol. 29, pp. 2705-2709 (2008). |
Seo YH, et al, “Profiling protein thiol oxidation in tumor cells using sulfenic acid-specific antibodies.” Proceedings of the National Academy of Sciences of the United States of America vol. 106: pp. 16163-16168, 2009. |
Sies H. “Strategies of Antioxidant Defense.” European Journal of Biochemistry vol. 215: pp. 213-219, 1993. |
Sies H, et al, Oxidative Stress—Damage to Intact-Cells and Organs, Philosophical Transactions of the Royal Society of London Series B—Biological Sciences vol. 311: pp. 617-631, 1985. |
Stolk J, et al, “Characteristics of the inhibition of NADPH oxidase activation in neutrophils by apocynin, a methoxysubstituted catechol.” Am J Respir Cell Mol Biol vol. 11: pp. 95-102, 1994. |
Storz P. “Reactive oxygen species in tumor progression.” Front Biosci vol. 10: pp. 1881-1896, 2005. |
Stuhlmann D, et al, “Modulation of homologous gap junctional intercellular communication of human dermal fibroblasts via a paracrine factor(s) generated by squamous tumor cells.” Carcinogenesis vol. 24: pp. 1737-1748, 2003. |
Swietach P, et al, “Regulation of tumor pH and the role of carbonic anhydrase 9.” Cancer Metastasis Rev vol. 26: pp. 299-310, 2007. |
Tang Y, et al, “Caveolin-1 is related to invasion, survival, and poor prognosis in hepatocellular cancer.” Med Oncol, vol. 29: pp. 977-984, 2012. |
Thannickal VJ, et al, “Tyrosine phosphorylation regulates H2O2 production in lung fibroblasts stimulated by transforming growth factor beta 1.” Journal of Biological Chemistry vol. 273: pp. 23611-23615, 1998. |
Thannickal VJ, et al, “Reactive oxygen species in cell signaling.” American Journal of Physiology-Lung Cellular and Molecular Physiology vol. 279: pp. L1005-L1028, 2000. |
Thompson TC, et al, “The role of caveolin-1 in prostate cancer: clinical implications.” Prostate Cancer Prostatic Dis vol. 13: pp. 6-11, 2010. |
Tomayko MM, et al, “Determination of Subcutaneous Tumor Size in Athymic (Nude) Mice.” Cancer Chemotherapy and Pharmacology vol. 24: pp. 148-154, 1989. |
Valko M, et al, “Free radicals and antioxidants in normal physiological functions and human disease.” Int J Biochem Cell Biol vol. 39: pp. 44-84, 2007. |
Wittgen HG, et al. “Reactive oxygen species in melanoma and its therapeutic implications.” Melanoma Res vol. 17: pp. 400-409, 2007. |
Woiniak A, et al, “The effect of antitumor drugs on oxidative stress in B16 and S91 melanoma cells in vitro.” Med Sci Monit vol. 11: pp. BR22-9, 2005. |
Zhou M, et al, “A stable nonfluorescent derivative of resorufin for the fluorometric determination of trace hydrogen peroxide: applications in detecting the activity of phagocyte NADPH oxidase and other oxidases.” Anal Biochem vol. 253: pp. 162-168, 1997. |
Zhou, X.D. et al., “Processing of Nanometer-Scale CeO2 Particles”, Chem. Mater., 2003, vol. 15, pp. 378-382. |
Ades EW, et al, HMEC-1: “establishment of an immortalized human microvascular endothelial cell line.” J Invest Dermatol vol. 99: pp. 683-690, 1992. |
Alili L, et al, “Suppression of tumor invasion by inorganic nanoparticles.” Cancer Research vol. 69 pp. (23 Suppl.): Boston, C42, 2009. |
Alili L, et al, “Combined cytotoxic and anti-invasive properties of redox-active nanoparticles in tumor-stroma interactions.” Biomaterials vol. 32: pp. 2918-2929, 2011. |
Altekruse SF, et al, “SEER Cancer Statistics Review”, 1975-2007. National Cancer Institute. Bethesda, MD, 2010. |
Bardos Ji, et al, “Negative and positive regulation of HIF-1: a complex network.” Biochim Biophys Acta vol. 1755: pp. 107-120, 2005. |
Bayreuther K, et al “Terminal differentiation, aging, apoptosis, and spontaneous transformation in fibroblast stem cell systems in vivo and in vitro.” Ann N Y Acad Sci vol. 663: pp. 167-179, 1992. |
Bhatia S, et al, “Treatment of metastatic melanoma: an overview.” Oncology (Williston Park) vol. 23: pp. 488-496, 2009. |
Boulares AH, et al, “Role of poly(ADP-ribose) polymerase (PARP) cleavage in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells.” J Biol Chem vol. 274: pp. 22932-22940, 1999. |
Brenneisen P, et al, “Central role of Ferrous/Ferric iron in the ultraviolet B irradiation-mediated signaling pathway leading to increased interstitial collagenase (matrix-degrading metalloprotease (MMP)-1) and stromelysin-1 (MMP-3) mRNA levels in cultured human dermal fibroblasts.” J Biol Chem vol. 273: pp. 5279-5287, 1998. |
Celardo I, et al, “Cerium oxide nanoparticles: a promise for applications in therapy.” J Exp Thor Oncol vol. 9: pp. 47-51, 2011. |
Deshpande S, et al, “Size dependency variation in lattice parameter and valency states in nanocrystalline cerium oxide.” Appl. Phys. Lett. vol. 87, pp. 133113, 2005. |
Deshpande S, et al, “Size dependency variation in lattice parameter and valency states in nanocrystalline oxide.” Appl. Phys. Lett. 87, pp. 133113, 2005. |
De Wever O, et al, “Role of myofibroblasts at the invasion front.” Biological Chemistry vol. 383: pp. 55-67, 2002. |
Fang J, et al, “Tumor-targeted induction of oxystress for cancer therapy.” J Drug Target. vol. 15: pp. 475-486, 2007. |
Freitas RA, Jr. “What is nanomedicine?” Nanomedicine vol. 1: pp. 2-9, 2005. |
Fruehauf JP, et al, “Reactive oxygen species: an Achilles' heel of melanoma?” Expert Rev Anticancer Ther vol. 8: pp. 1751-1757, 2008. |
Gao W, et al, “Effect of gold nanoparticles on glutathione depletion-induced hydrogen peroxide generation and apoptosis in HL7702 cells.” Toxicol Lett vol. 205: pp. 86-95, 2011. |
Garbe C, et al, “Melanoma epidemiology and trends.” Clin Dermatol vol. 27: pp. 3-9, 2009. |
Garbe C, et al, “Treatment of melanoma.” Dtsch Arztebl Int vol. 105: pp. 845-851, 2008. |
Giard DJ, et al, “In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors.” J Natl Cancer Inst vol. 51: pp. 1417-1423, 1973. |
Heckert EG, et al, “The role of cerium redox state in the SOD mimetic activity of nanoceria.” Biomaterials vol. 29: pp. 2705-2709, 2008. |
Helmlinger G, et al, “Interstital pH and pO2 gradients in solid tumors in vivo: high-resolution measurements reveal a lack of correlation.” Nat Med vol. 3: pp, 177-182, 1997. |
Jahroudi N, et al, “The role of endothelial cells in tumor invasion and metastasis.” J Neurooncol vol. 23: pp. 99-108, 1995. |
Jemal A, at al, “Cancer statistics”, 2008. CA Cancer J Clin vol. 58: pp. 71-96, 2008. |
Kappus H, et al, “Toxic drug effects associated with oxygen metabolism: redox cycling and lipid peroxidation.” Experientia vol. 37: pp. 1233-1241, 1981. |
Karakoti AS, et al, “Direct synthesis of nanoceria in aqueous polyhydroxyl solutions.” Journal of Physical Chemistry C vol. 111: pp. 17232-17240, 2007. |
Karakoti AS, et al, “Nanoceria as Antioxidant: Synthesis and Biomedical Applications.” Jom (1989) vol. 60: pp. 33-37, 2008. |
Karakoti AS, et al, “Redox-active radical scavenging nanomaterials.” Chem Soc Rev. vol. 39: pp. 4422-4432, 2010. |
Kawiak A, et al, “Induction of Apoptosis in HL-60 Cells through the ROS-Mediated Mitochondrial Pathway by Ramentaceone from Drosera aliciae.” Journal of Natural Products vol. 75: pp. 9-14, 2012. |
K. Kawiak et al, “Induction of Apoptosis in HL-60 Cells through the ROS-Mediated Mitochondrial Pathway by Ramentaceone from Drosera aliciae.” Journal of Natural Products vol. 75: pp. 9-14, 2012. ietzmann T, et al, “Reactive oxygen species in the control of hypoxia-inducible factor-mediated gene expression.” Semin Cell Dev Biol vol. 16: pp. 474-486, 2005. |
Korsvik C, et al, “Superoxide dismutase mimetic properties exhibited by vacancy engineered ceria nanoparticles.” Chem Commun (Camb): pp. 1056-1058, 2007. |
Kuchibhatla S, et al, “One dimensional nanostructured materials.” Progress in Materials Science vol. 52: pp. 699-913, 2007. |
Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature vol. 227: pp. 680-685, 1970. |
Laurent A, et al, “Controlling tumor growth by modulating endogenous production of reactive oxygen species.” Cancer Res vol. 65: pp. 948-956, 2005. |
Levi F, et al, “High constant incidence rates of second primary neoplasms.” Eur J Cancer Prev vol. 17: pp. 385-388, 2008. |
Li P, et al, “Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.” Cell vol. 91: pp. 479-489, 1997. |
Lin W, et al, “Toxicity of cerium oxide nanoparticles in human lung cancer cells.” Int J Toxicol vol. 25: pp. 451-457, 2006. |
Luanpitpong S, et al, “Regulation of lung cancer cell migration and invasion by reactive oxygen species and caveolin-1.” J Biol Chem vol. 285: pp. 38832-38840, 2010. |
Malecki JM, et al, “LY294002 and olomoucine synergize in promoting death of melanoma cells through activation of caspase-3 and apoptosis.” Melanoma Res. vol. 20: pp. 52-58, 2010. |
Mosmann T. “Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays.” J Immunol Methods vol. 65: pp. 55-63, 1983. |
Nagata S. “Apoptosis by death factor.” Cell vol. 88: pp. 355-365, 1997. |
Nangaku M, et al, “A novel class of prolyl hydroxylase inhibitors induces angiogenesis and exerts organ protection against ischemia.” Arterioscler Thromb Vasc Biol vol. 27: pp. 2548-2554, 2007. |
Parums DV, et al, “JC70: a new monoclonal antibody that detects vascular endothelium associated antigen on routinely processed tissue sections.” J Clin Pathol vol. 43: pp. 752-757, 1990. |
Pirmohamed T, et al, “Nanoceria exhibit redox state-dependent catalase mimetic activity.” Chem. Commun. vol. 46: pp. 2736-273, 2010. |
Quiles JL, et al, “Antioxidant nutrients and adriamycin toxicity.” Toxicology vol. 180: pp. 79-95, 2002. |
Reynolds ES. “Use of Lead Citrate at High Ph as an Electron-Opaque Stain in Electron Microscopy.” Journal of Cell Biology vol. 17: pp. 208, 1963. |
Roberts RA, et al, “Toxicological and pathophysiological roles of reactive oxygen and nitrogen species.” Toxicology vol. 276: pp. 85-94, 2010. |
Ruas JL, et al, “Hypoxia-dependent activation of HIF into a transcriptional regulator.” Semin Cell Dev Biol vol. 16: pp. 514-522, 2005. |
Sanchez Y, et al, “Regulation of genistein-induced differentiation in human acute myeloid leukaemia cells (HL60, NB4) Protein kinase modulation and reactive oxygen species generation.” Biochemical Pharmacology vol. 77: pp. 384-396, 2009. |
Saphir A. “Angiogenesis: the unifying concept in cancer?” J Natl Cancer Inst vol. 89: pp. 1658-1659, 1997. |
Number | Date | Country | |
---|---|---|---|
61224602 | Jul 2009 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 12834302 | Jul 2010 | US |
Child | 13548795 | US |