Ribosome-inactivating proteins, inactive precursor forms thereof, a process for making and a method of using

FIELD OF THE INVENTION
The present invention relates to recombinant biology and specifically to ribosome-inactivating proteins.
BACKGROUND OF THE INVENTION
Ribosome-inactivating proteins (RIPs) are plant proteins that are capable of catalytically inactivating eukaryotic ribosomes and are consequently extremely potent inhibitors of eukaryotic protein synthesis. RIPs have been divided into two classes: type 1 and type 2 RIPs (see Barbieri and Stirpe (1982), Cancer Surveys, 1:489-520). There is significant amino acid sequence homology between members of both type 1 and type 2 RIPs, and with the bacterial Shiga and Shiga-like toxins which also have the same mechanism of action (see Hovde et al. (988), Proc. Natl. Acad. Sci. USA, 85:2568-2572).
Type 2 RIPs consist of two polypeptides; an RIP (or A-chain) which is covalently attached via a disulfide bond to a lectin-Iike protein (or B-chain). The B-chain binds to ceil surface carbohydrates and facilitates subsequent cellular internalization of the RIP A-chain moiety, which results in rapid inactivation of protein synthesis and cell death. Type 2 RIPs are therefore extremely potent cytotoxins and animal poisons, the best studied example of which is ricin.
In contrast, type 1 RIPs characterized to date consist of a single polypeptide chain equivalent in activity to that of A-chain RIPs but lacking a covalently attached B-chain. Consequently, type 1 RIPs are scarcely toxic to intact cells but retain their extreme potency against cell-free protein translation systems. Typical IC.sub.50 concentrations of type 1 RIPs are 0.5 to 10 ng/ml (0.16 to 33 pM). Until the discoveries detailed hereinbelow, reported type 1 RIPs were a remarkably homogeneous class of basic proteins with Mr values of about 30,000. Type 1 RIPs are found in a great variety of dicot and monocot plants and they may be ubiquitous. They are often abundant proteins in seeds, roots or latex for example. Their in vivo Function is unclear but it has been proposed that they may be antiviral agents (see Stevens et al. (1981), Experientia, 37:257-259) or antifungal agents (see Roberts and Seltrennikkoff (1986), Bioscience Reports, 6:19-29).
To date, one article has discussed the presence of an inhibitor of animal cell-free protein synthesis in maize, as well as other cereal crops (see Coleman and Roberts (1982), Biochimica et Biophysica Acta, 696:239-244). The preparation of the maize inhibitor was via ammonium sulfate precipitation and phosphocellulose column chromatography. It is generally believed that the inhibitor isolated from maize was pure. The reported molecular weight of the inhibitor was 23 kiloDaltons (kD), with a reported IC.sub.50 of 50 to 100 ng/ml in an ascites cell-free protein synthesis assay.
Where the effect of RIPs on ribosames has been examined, both type 1 and type 2 RIPs possess a unique and highly specific N-glycosidase activity which cleaves the glycosidic bond of adeninc 4324 of the rat liver ribosomal 28S RNA (see Endo (1988), In:Immunotoxins, Frankel (ed.), suprs).
Commercial interest in RIPs has primarily focused on their use in construction of therapeutic toxins targeted to specific cells such as tumor cells by attachment of a targeting polypeptide, most frequently a monoclonal antibody (see Immunotoxins (1988), supra). This mimics the binding functionality of the B-chain of type 2 RIPs but replaces the non-specific action of B chains with a highly selective ligand. Another recent potential use is in HIV therapy (see U.S. Pat. No. 4,869,903 to Lifson et al., (Gonelabs Incorporated and The Regents of the University of California)).
However, while a maize-derived protein synthesis inhibitor, like protein synthesis inhibitors from other Panicoideae, would appear to be useful for construction of cytotoxic conjugates, no artisan to date has reported to have successfully characterized a Panicoideae RIP. This is somewhat surprising in view of the success achieved with RIPs from non-Panicoideae plants, including cereals such as barley (see Lambert et al. (1988), In:Immunotoxins, supra). In part, the lack of success to date by skilled artisans in successfully utilizing the maize RIP described by Coleman and Roberts may be attributed to the fact that the protein synthesis inhibitor was relatively uncharacterized and reported IC.sub.50 was relatively poor.
There is interest in expressing recombinant RIP in commonly employed host eukaryotic cells, because of the capacity to provide correct post-translational processing. However, as RIPs effectively inhibit protein synthesis in eukaryotic cells, a predictable problem is that heterologous expression of an RIP will result in host cell death. Thus, eukaryotic cells are generally not used as recombinant host cells. Although eukaryotic cells may be used in certain circumstances, the RIP must be constructed so as to be secreted prior to the cell experiencing toxicity (see EP 0 335 476 to Gelfand et al. (Cetus Corp.)). Therefore, prokaryotic host cells are generally used as hosts, notwithstanding disadvantages such as the inability to glycosylate and properly fold heterologously-expressed proteins.
It is thus an object of the invention to provide a method of preparing inactive forms of RIPs, in which an inactive RIP may be expressed by eukaryotic host cells and then converted to an active form.
It is yet another object of the invention to provide the DNA sequence of a gene encoding at least one inactive form of RIP, as well as expression vehicles, host cells and cell cultures containing such DNA sequence.
Other objects and advantages of the present invention will become apparent from the teachings presented hereinafter.
It is to these objects to which the present invention is directed.
SUMMARY OF THE INVENTION
in a first aspect, the present invention is directed to a substantially pure protein having an amino acid sequence effectively homologous to the amino acid sequence set forth in FIG. 1, termed a proRIP, wherein the proRIP has a selectively removable, internal peptide linker sequence and is incapable of substantially inactivating eukaryotie ribosomes, but which can be converted by removal of the linker into a protein having .alpha. and .beta. fragments and being capable of substantially inactivating eukaryotic ribosomes, wherein the .alpha. fragment has an amino acid sequence effectively homologous to residues 17 to 161 of FIG. 1 and the .beta. fragment has an amino acid sequence effectively homologous to residues 187 to 287 of FIG. 1.
In a second aspect, the present invention is directed to a substantially pure protein, termed a proRIP, wherein the proRIP has a selectively removable, internal peptide linker sequence and is incapable of substantially inactivating eukaryotic ribosomes, but which can be converted by removal of the linker into a protein having .alpha. and .beta. fragments, termed an RIP, that is capable of substantially inaetivating eukaryotic ribosomes, said proRIP comprising (1) a Panicoideae RIP selected from barley RIP, ricin A-chain RIP, saporin RIP, abrin A-chain RIP, SLT-1 RIP, and .alpha.-trichosanthin RIP, Luffin-A RIP, and Mirabills antiviral protein RIP and (2) a removable, internal peptide linker sequence inserted between amino acid residues 152-162 of Ricinus communis agglutinin, amino acid residues 138-148 of Abrin-a A-chain, amino acid residues of 138-148 of Luffin-a, 139-149 of Luffin-b, amino acid residues of 138-148 Momordin, amino acid residues 139-149 of Trichosanthin, amino acid residues 151-161 of PAP-S, amino acid residues 145-155 of MAP, amino acid residues 153-163 of Saporin, amino acid residues 148-158 of Barley Translation Inhibitor and amino acid residues 174-184 of Dianthin 30.
In a third aspect, the present invention is directed to a substantially pure protein, termed an RIP, having .alpha. and .beta. fragments and being capable of substantially inactivating eukaryotic ribosomes, wherein the .alpha. fragment has an amino acid sequence effectively homologous to residues 17 to 161 of FIG. 1 and the .beta. fragment has an amino acid sequence effectively homologous to residues 187 to 287 of FIG. 1.
In a fourth aspect, the present invention is directed to a fusion protein capable of substantially inactivating eukaryotic ribosomes, said protein having an amino acid sequence effectively homologous to one of the amino acid sequences set forth in FIGS. 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
In a fifth aspect, the present invention is directed to a conjugate comprising a targeting vehicle and a protein, termed a proRIP, wherein the proRIP has a selectively removable, internal peptide linker sequence and is incapable of substantially inactivating eukaryotic ribosomes, but which can be converted by removal of the linker into a protein having .alpha. and .beta. fragments and being capable of substantially inactivating eukaryotic ribosomes, wherein the .alpha. fragment has an amino acid sequence effectively homologous to residues 17 to 161 of FIG. 1 and the .beta. fragment has an amino acid sequence effectively homologous to residues 187 to 287 of FIG. 1.
In a sixth aspect, the present invention is directed to a conjugate comprising a targeting vehicle and a fusion protein that is capable of substantially inactivating eukaryotic ribosomes, said protein having an amino acid sequence effectively homologous to an amino acid sequence set. forth in FIGS. 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
In a seventh aspect, the present invention is directed to a conjugate comprising a targeting vehicle and a protein, termed a proRIP, wherein the proRIP has a selectively removable, internal peptide linker sequence and is incapable of substantially inactivating eukaryotic ribosomes, but which can be converted by removal of the linker into a protein having .alpha. and .beta. fragments, termed an RIP, that is capable of substantially inactivating eukaryotic ribosomes, said proRIP comprising (1) a Panicoideae RIP selected from barley RIP, ricin A-chain RIP, saporin RIP, abrin A-chain RIP, SLT-1 RIP, and a-trichosanthin RIP, Luffin-A RIP, and Mirabills antiviral protein RIP and (2) a removable, internal peptide linker sequence inserted between amino acid residues 152-162 of Ricinus communis agglutinin, amino acid residues 138-148 of Abrin-a A-chain, amino acid residues of 138-148 of Luffin-a, 139-149 of Luffin-b, amino acid residues of 138-148 Momordin, amino acid residues 139-149 of Trichosanthin, amino acid residues 151-161 of PAP-S, amino acid residues 145-155 of MAP, amino acid residues 153-163 of Saporin, amino acid residues 148-158 of Barley Translation Inhibitor and amino acid residues 174-184 of Dianthin 30.
In a eighth aspect, the present invention is directed to a method for converting a proRIP into an RIP, said method comprising the following steps:
a) providing a homogeneous protein, termed a proRIP, wherein the proRIP has a selectively removable, internal peptide linker sequence and is incapable of substantially inactiveting eukaryotic ribosomes, but which can be converted by removal of the linker into a protein having .alpha. and .beta. fragments, termed an RIP, that is capable of substantially inactivating eukaryotic ribosomes; and
b) contacting the proRIP with a cleaving agent capable of deleting the linker to form a protein having .alpha. and .beta. fragments, termed an RIP, that is capable of substantially inactivating eukaryotic ribosomes.
In a ninth aspect, the present invention is directed to DNA isolate encoding a protein, said protein having an amino acid sequence effectively homologous to the amino acid sequence set forth in FIG. 1, termed a proRIP, wherein the proRIP has a selectively removable, internal peptide linker sequence and is incapable of substantially inactiveting eukaryotic ribosomes, but which can be converted by removal of the linker into a protein having .alpha. and .beta. fragments and being capable of substantially inactiveting eukaryotic ribosomes, wherein the a fragment has an amino acid sequence effectively homologous to residues 17 to 161 of FIG. 1 and the .beta. fragment has an amino acid sequence effectively homologous to residues 187 to 287 of FIG. 1.
In a tenth aspect, the present invention is directed to a DNA sequence encoding a protein being capable of substantially inactivating eukaryotic ribosomes, said protein having an amino acid sequence effectively homologous to one of the amino acid sequences set forth in FIGS. 8, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
In an eleventh aspect, the present invention is directed to a DNA isolate encoding a protein, termed a proRIP, wherein the proRIP has a selectively removable, internal peptide linker sequence and is incapable of substantially inactivating eukaryotic ribosomes, but which can be converted by removal of the linker into a protein having .alpha. and .beta. fragments, termed an RIP, that is capable of substantially inactivating eukaryotic ribosomes, said proRIP comprising (1) a Panicoideae RIP selected from barley RIP, ricin A-chain RIP, saporin RIP, abrin A-chain RIP, SLT-1 RIP, and .alpha.-trichosanthin RIP, Luffin-A RIP, and Mirabills antiviral protein RIP and (2) a removable, internal peptide linker sequence inserted between amino acid residues 152-162 of Ricinus communis agglutinin, amino acid residues 138-148 of Abrin-a A-chain, amino acid residues of 138-148 of Luffin-a, 139-149 of Luffin-b, amino acid residues of 138-148 Momordin, amino acid residues 139-149 of Trichosanthin, amino acid residues 151-161 of PAP-S, amino acid residues 145-155 of MAP, amino acid residues 153-163 of Saporin, amino acid residues 148-158 of Barley Translation Inhibitor and amino acid residues 174-184 of Dianthin 30.
In other aspects, the invention is directed to expression vehicles capable of effecting the production of such aforementioned proteins in suitable host cells. It also includes the host cells and cell cultures which result from transformation with these expression vehicles.

BRIEF DESCRIPTION OF THE DRAWINGS
A number of aspects of the present invention are further illustrated in the accompanying Drawings, in which:
FIGS. 1a through 1c collectively depicts an intact recombinant maize proRIP nucleotide sequence (SEQ. ID. NO. 1) and amino acid sequence (SEQ. ID. NO. 2) of a protein of Mr 33,327.
FIG. 2 shows a schematic representation of the processing of maize proRIP to an active RIP.
FIG. 3 shows a comparison of the maize proRIP amino acid sequence with that of barley RIP.
FIG. 4 shows a comparison of the maize proRIP amino acid sequence with that of ricin A-chain.
FIGS. 5A shows the comparative alignment of the N-terminal amino acid sequence of an .alpha. fragment of the maize .alpha..beta. RIP .alpha. fragment with the N-terminal sequences of RIPs from other sources; and FIGS. 5B shows the alignment of maize .alpha..beta. RIP with regions of homology in the amino acid sequences of other RIPs.
FIG. 6 shows an effect of active maize .alpha..beta. RIP on mammalian cell-free protein synthesis.
FIGS. 7a through 7b collectively depicts a cDNA sequence of (SEQ. ID. NO. 3) the maize pro-RIP sequence engineered for expression in Escherichia coli.
FIGS. 8a through 8c collectively depicts a predicted DNA sequence (SEQ. ID. NO. 4) and deduced amino acid sequence (SEQ. ID. NO. 5) of R30.
FIG. 9a shows a plasmid map of plasmid pGR and FIG. 9b shows a plasmid map of plasmid pGR1.
FIGS. 10a through 10c depicts a predicted DNA sequence (SEQ. ID. NO. 6) and deduced amino acid sequence (SEQ. ID. NO. 7) of R34-DL.
FIGS. 11a through 11c depicts a predicted DNA sequence (SEQ. ID. NO. 8) and deduced amino acid sequence (SEQ. ID. NO. 9) of R30-DL.
FIGS. 12a through 12c depicts the predicted DNA sequence (SEQ. ID. NO. 10) and deduced amino acid sequence (SEQ. ID. NO. 11) for RDT.
FIGS. 13a through 13c collectively depicts the predicted DNA sequence (SEQ. ID. NO. 12) and deduced amino acid sequence (SEQ. ID. NO 13) for RDT-NP.
FIGS. 14a through 14d collectively depicts the predicted DNA sequence (SEQ. ID. NO. 14) and deduced amino acid sequence (SEQ. ID. NO 15) of RDT-A.
FIGS. 15a through 15d collectively depicts the predicted DNA sequence (SEQ. ID. NO. 16) and deduced amino acid sequence (SEQ. ID. NO 17) of RDT-G-A.
FIGS. 16a through 16e collectively depicts the predicted DNA sequence (SEQ. ID. NO. 18) and deduced amino acid sequence (SEQ. ID. NO. 19) of RDT-G-G-A.
FIGS. 17a through 17c collectively depicts the predicted DNA sequence (SEQ. ID. NO. 20) and deduced amino acid sequence (SEQ. ID. NO. 21) of RDT-BHSR.
FIGS. 18a through 18e collectively depicts the predicted DNA sequence (SEQ. ID. NO. 22) and deduced amino acid sequence (SEQ. ID. NO. 23) of RDT-BHS-GGA.
FIGS. 19a through 19e collectively depicts the predicted DNA sequence (SEQ. ID. NO 24) and deduced amino acid sequence (SEQ. ID. NO. 25) of RDT-DS-GGA.

DETAILED DESCRIPTION OF THE INVENTION
The entire teachings of all references cited herein are incorporated by reference.
Definitions
Nucleic acids, amino acids, peptides, protective groups, active groups and so on, when abbreviated, are abbreviated according to the IUPACIUB (Commission on Biological Nomenclature) or the practice in the fields concerned.
The term "proRIP" means a precursor protein that contains an amino-terminal segment, a linker and a carboxy-terminal segment and that is not capable of inactivating eukaryotic ribosomes.
The term "leader" refers to an N-terminal amino acid sequence of a proRIP that need not be present in the mature, fully active form of the .alpha..beta. RIP.
The term "linker" refers to an internal amino acid sequence within a proRIP, whereby the linker is of a length and contains residues effective to render the proRIP incapable of catalytically inhibiting translation of a eukaryotic ribosome.
The term "RIP" means a protein that is capable of inactiveting eukaryotic ribosomes. The term ".alpha..beta. RIP" means an RIP having an .alpha. fragment, which may or may not contain a leader, and a .beta. fragment and being capable of substantially inactivating eukaryotic ribosomes.
The term "IC.sub.50 " means the concentration of a protein necessary to inhibit protein synthesis by 50 percent in a cell-free protein synthesis assay.
The term "inhibiting amount" refers to the specific ability of RIPs to cause the death or injury of cells against which they are targeted.
The term "target cells" means those cells having ribosomes which the .alpha..beta. RIP of the present invention is capable of inhibiting. The target cells may be present in living organisms or they may be preserved or maintained in vitro. The cells may be individual or associated to form an organ. Exemplary target cells include any eukaryotic cell (e.g., mammalian, insect, fungal and plant cells).
The term "targeting vehicle" means a carrier moiety containing a ligand capable of binding to a receptor of a specific cell or tissue.
"Gene" refers to the entire DNA portion involved in the synthesis of a protein. A gene embodies the structural or cading portion which begins at the 5' end from a translation start codon and extends at the 3' end to a stop codon. It also contains a promoter region, usually located 5' or upstream to the structural coding portion, which initiates and regulates the expression of a structural gene and a 3' nontranslated region downstream from the translated region.
"Expression" refers to a two-part process for the transcription and translation of a gene. The DNA defining the gene is transcribed into a precursor RNA, which is processed to its mature form, messenger RNA (mRNA). During translation, the cell's ribosomes, in conjunction with transfer RNA, translate the RNA "message" into proteins.
PREFERRED EMBODIMENTS OF THE INVENTION
Surprisingly, it has been discovered that studied members of Panicoideae contain .alpha..beta. RIP and proRIP. Panicoideae is a subfamily of Gramineae (order) and Graminaceae (family). The subfamily Panicoideae contains three tribes: Maydeae (e.g., Tripsacura, Coix, Euchlaena and Zea), Andropogoneae (e.g., Sorghum) and Paniceae. For further taxonomic information, see Arber (1934), The Gramineae, A Study of Cereal, Bamboo and Grass, Cambridge University Press, p 410-411.
The present invention pertains to proteins which are derived from a plant within the subfamily Panicoideae. As taught herein, proteins obtained from various plants within the subfamily Panicoidae have shown antigenic cross reactivity (i.e., showing evidence of proRIP in Panicoideae well as .alpha. and .beta. fragments of an .alpha..beta. RIP).
By "derived" from a plant within the subfamily Panicoideae means a protein that is effectively homologous, as defined below, with a proRIP or .alpha..beta. RIP from Panicoideae, regardless of the manner in which the protein is produced. Given the present teachings it now becomes possible to prepare generally homogeneous proRIP and .alpha..beta. RIP exclusive of irrelevant proteins and contaminants naturally associated therewith in the cellular environment or in extracellular fluids. For example, a substantially pure protein will show constant and reproducible characteristics within standard experimental deviations for parameters such as the following: molecular weight, chromatographic behavior, and such other parameters. The term, however, is not meant to exclude artificial or synthetic mixtures of a protein with other compounds. The term is not meant to exclude the presence of minor impurities which do not interfere with the biological activity of the protein and which may be present, for example, due to incomplete purification.
Both the proRIP and .alpha..beta. RIP may be purified directly from mature and germinating seeds and developing kernels of plants within the subfamily. Generally, the purification of the Panicoidae .alpha..beta. RIP and proRIP may be accomplished as set forth below.
Seeds or immature kernels of plants within the subfamily Panicoideae may be homogenized to disrupt the individual seeds or kernels. This can be accomplished by any type of commercially available homogenizer.
The Panicoideae proRIP and/or .alpha..beta. RIP may be purified from the homogenization product by any appropriate protein purification technique. Exemplary techniques include gel filtration chromatographic techniques, such as conventional liquid chromatography, ion exchange chromatography, high performance liquid chromatography, and reverse phase chromatography.
Upon purification, the Panicoideae proRIP will have insignificant ribosome inactivating ability relative to its corresponding .alpha..beta. RIP. For example, maize proRIP has an IC.sub.50 of greater than about 10 micrograms per milliliter (.mu.g/ml) in a cell-free protein synthesis assay, whereas the maize .alpha..beta. RIP has an IC.sub.50 of about 1 nanogram per milliliter (ng/ml) in a mammalian cell-free protein translation assay.
The maize proRIP has a molecular weight of about 34 kD, as determined by SDS-PAGE (see Laemmli (1970), supra), and will move as a single peak on ion exchange chromatography. Homogeneous maize .alpha..beta. RIP will comprise two associated fragments, an .alpha. and .beta. fragment, having molecular weights of approximately 16.5 kD and 11.0 kD, respectively (as determined by sodium dodecyl sulfate polyacrylamide-gel electrophoresis (SDS-PAGE), see Laemmli (1970), Nature, 22:680-685). The homogeneous protein will exhibit two dissociated peaks on reverse phase chromatography, and a single associated peak on ion exchange chromatography. Polyclonal anti-sera against each fragment both crossreact with a polypeptide present in maize kernels having a molecular weight of about 34 kD as determined by SDS-PAGE. This demonstrates that the two fragments of the maize .alpha..beta. RIP are in fact derived from a common precursor (i.e., the maize proRIP).
The maize proRIP amino acid sequence (as set forth in FIG. 1) contains five sequence subsegments: (1) a leader sequence, from residues 1 to 16, (2) an .alpha. fragment, from residues 17 to 161, (3) an internal linker sequence, from residues 162 to 186, and (4) a .beta. fragment, from residues 187 to 287 and a C-terminal segment from residues 288-301.
The net charges of these polypeptides are as follows: leader sequence -3; a fragment, +10; linker, -5; .beta. fragment, +6 and C-terminal segment, -5. Removal of the leader and linker results in a dramatic change in net charge from the maize proRIP (+3) to maize .alpha..beta. RIP (+16). Additionally, the proRIP isolated from maize has an observed pI of about 6.5 which agrees well with the value of about 6.1 derived from the deduced amino acid sequence. The pI of the active maize .alpha..beta. RIP is .gtoreq.9, compared to the calculated value from the deduced amino acid sequence of about 9.06 (i.e., after deletion of the acidic leader, linker and C-terminal sequences). Thus, the maize .alpha..beta. RIP has a basic pI, which is consistent with the pI of other RIPs.
When the internal linker sequence of the proRIP is removed (see FIG. 2), the .alpha..beta. RIP has significant ribosome inactivating activity. The activity has been found to be significant regardless of whether the leader sequence has been removed (e.g., by recombinant methods). However, the proRIP is most active when the leader sequence is also removed and when up to fourteen C-terminus residues are also removed. In nature, it is thought that the linker is cleaved by endogenous proteases released by germinating seeds. Significantly, it has been discovered that the linker may also be cleaved in vitro by certain proteases, e.g., papain, subtilisin Carlberg to yield active maize .alpha..beta. RIP from the precursor. While not intended to be bound by theory, it is thought that papain likely mimics the effect of endogenous endoproteinases released during germination.
It appears that, after removal of the internal linker, the two fragments of the processed polypeptide are held together by noncovalent forces. That is, the association of the two polypeptide chains does not depend upon interchain disulfide bonds or the formation of a peptide bond between the fragments.
Although not intended to be bound by theory, it is believed that the linker forms an external loop with exposed amino acid residues that are susceptible to proteolysis. Support for this suggestion comes from the alignment of the amino acid sequence of the maize proRIP with that of ricin A chain, the three dimensional structure of which is known (see Montfort et al, (1987), J. Biol. Chem., 262:5398). The Glu 177, Arg 180, Asn 209 and Trp 211 of ricin A have been implicated in the active site region of the molecule (see Robertus (1988), In:Immunotoxins, supra).
Based on this alignment, homologous residues of maize .alpha..beta. RIP can be positioned within the three dimensional structure of ricin A chain. The superimposed structures indicate that the C-terminal lysine of the .alpha. fragment (at residue 162) is in corresponding alignment with an externally positioned threonine (at residue 156) of the ricin A-chain. Also, the N-terminal alanine of the .beta. fragment (at residue 187) is in corresponding alignment with an externally positioned glycine (at residue 157) of the ricin A-chain.
Any of a variety of procedures may be used to clone proRIP-encoding gene sequence. One method for cloning the proRIP gene sequence entails determining the amino acid sequence of the proRIP molecule. To accomplish this task proRIP or .alpha..beta. RIP protein may be purified (as described above), and analyzed to determine the amino acid sequence of the proRIP or .alpha..beta. RIP. Any method capable of elucidating such a sequence can be employed, however, Edman degradation is preferred. The use of automated sequenators is especially preferred.
It is possible to synthesize in vitro the proRIP and .alpha..beta. RIP from their constituent amino acids. A suitable technique includes the solid phase method (see Merrifield (1963), J. Amer. Chem. Soc., 85:2149-2154; and Solid Phase Peptide Synthesis (1969), (eds.) Stewart and Young). Automated synthesizers are also available.
The peptides thus prepared may be isolated and purified by procedures well known in the art (see Current Protocols in Molecular Biology (1989), (eds.) Ausebel, et al., Vol. 1 and Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual).
Using the amino acid sequence information, the DNA sequences capable of encoding them are examined in order to clone the gene encoding the proRIP. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid.
Although it is possible to determine the entire amino acid sequence of the proRIP or .alpha..beta. RIP, it is preferable to determine the sequence of peptide fragments of the molecule, and to use such sequence data to prepare oligonucleotide probes which can be used to isolate the entire proRIP gene sequence. The proRIP peptide fragments can be obtained by incubating the intact molecule with cyanogen bromide, or with proteases such as papain, chymotrypsin or trypsin.
Using the genetic code one or more different oligonueleotides can be identified. The probability that a particular oligonucleotide will, in fact, constitute the actual proRIP encoding sequence can be estimated by considering abnormal base pairing relationships and the frequency with which a particular codon is actually used (to encode a particular amino acid) in eukaryotic cells. Using these rules, a single oligonucleotide, or a set of oligonucleotides, that contains a theoretical "most probable" nucleotide sequence capable of encoding the proRIP or .alpha..beta. RIP peptide sequences may be identified.
The oligonucleotide, or set of oligonucleotides, containing the theoretical "most probable" sequence capable of encoding the proRIP gone fragments may be used to identify the sequence of a complementary oligonucleotide, or set of oligonucleotides, which is capable of hybridizing to the "most probable" sequence, or set of sequences. An oligonucleotide containing such a complementary sequence can be employed as a probe to identify and isolate the toxin gene (see Sambrook et al. (1989), supra).
By hybridizing an oligonucleotide having a sequence complementary to the "most probable" gene sequence, one obtains a DNA molecule (or set of DNA molecules), capable of functioning as a probe to identify and isolate the proRIP gene.
The present invention also relates to DNA sequences that encode recombinant proRIP and .alpha..beta. RIP. The recombinantly-produced proRIP and .alpha..beta. RIP share the following properties with the proRIP and .alpha..beta. RIP isolated from nature and characterized according to the teachings herein: (1) portions of the amino acid sequence deduced from the nucleotide sequence are equivalent to amino acid sequences obtained directly from nature; (2) the polypeptide is recognized by anti-RIP antibodies; (3) the molecular weight of the proRIP and .alpha..beta. RIP polypeptides encoded corresponds with the naturally occurring proteins; (4) each proRIP protein is convertible to an .alpha..beta. RIP; and (5) each proRIP and .alpha..beta. RIP protein exhibits relatively equivalent ribosome inactivating activity.
The process for genetically engineering the proRIP or .alpha..beta. RIP according to the invention is facilitated through the cloning of genetic sequences which are capable of encoding the proRIP or .alpha..beta. RIP, or effectively homologous variants thereof as discussed below, and through the expression of such genetic sequences. As used herein, the term "genetic sequences" is intended to refer to a nucleic acid molecule (preferably DNA). Genetic sequences which are capable of encoding the toxin may be derived from a variety of sources. These sources include genomic DNA, cDNA, synthetic DNA, and combinations thereof.
Cells containing the desired sequence may be isolated, and genomic DNA fragmented by one or more restriction enzymes. The genomic DNA may or may not include naturally-occurring introns. The genomic DNA digested with selected restriction endonucleases yields fragments containing varying numbers of base pairs (bp).
Specifically comprehended as part of this invention are genomic DNA sequences encoding allelic variant forms of the proRIP gene which may or may not include naturally occurring introns. The allelic gene may be derived using a hybridization probe made from the DNA or RNA of the proRIP gene as well as its flanking regions. "Flanking regions" are meant to include those DNA sequences 5' and 3' of the proRIP encoding sequences.
The DNA isolate encoding the proRIP gene may also be obtained from a cDNA library. The mRNA may be isolated from a suitable source employing standard techniques of RNA isolation, and the use of oligo-dT cellulose chromatography to enrich for poly-A mRNA. A cDNA library is then prepared from the mixture of mRNA using a suitable primer, preferably a nucleic acid sequence which is characteristic of the desired cDNA. A single stranded DNA copy of the mRNA is produced using the enzyme reverse transcriptase. From the single stranded cDNA copy of the mRNA, a double-stranded cDNA molecule may be synthesized using either reverse transcriptase or DNA polymerase.
It is also possible to use primers to amplify the DNA from cells of appropriately prepared seeds and immature kernels by the polymerase chain reaction (PCR). PCR involves exponentially amplifying DNA in vitro using sequence specified oligonucleotides (see Mullis et al. (1987), Meth. Enz., 155:335-350); Horton et al. (1989), Gene, 77:61; and PCR Technology: Principles and Applications for DNA Amplification, (ed.) Erlich (1989).
The DNA encoding the proRIP or .alpha..beta. RIP may be chemically synthesized by manual procedures, e.g., the phosphotriester and phosphodiester methods (see Caruthers (1983), In:Methodology of DNA and RNA, (ed.) Weissman); or automated procedures, e.g., using diethylphosphoramidites are used as starting materials (see Beaucage et al. (1981), Tetrahedron Letters, 22:1859-1962). The DNA may be constructed by standard techniques of annealing and ligating fragments or by other methods.
Thereafter, the desired sequences may be isolated and purified by procedures well known in the art (see Current Protocols in Molecular Biology (1989), supra and Sambrook et al. (1989), Molecular Cloning: A Laboratory Manual, supra).
The nucleotide sequence of the maize proRIP cDNA and the deduced amino acid sequence of such the corresponding maize proRIP is set forth in FIG. 1. However, one need not be confined to the amino acid sequences of proRIP and .alpha..beta. RIP found in nature. Thus, it is possible to selectively produce both proRIP and .alpha..beta. RIP via the application of recombinant DNA technology. This in turn allows the production of sufficient quality and quantity of material to ereate novel forms of the protein unimpeded by the restriction necessarily inherent in the isolation methods involving production and extraction of the protein from natural sources.
A comparison of the maize proRIP (SEQ ID NO:2) with that of barley, a monocot, is set forth in FIG. 3. The upper sequence shows maize .alpha..beta. RIP and the lower sequence barley RIP (SEQ. ID. NO. 26), as taught by Asano et al. (1986), Carlsberg Res. Commun., 51:129. Identical residues are denoted by a solid line, conservative substitutions by a dotted line, and dashes indicate insertions to maximize homology. Residues are numbered on the left.
As set forth in in FIG. 3, there is an overall homology of about 28 percent (about 34 percent including conservative substitutions) between the maize .alpha..beta. RIP and barley RIP. However, the unique nature of the linker region of maize proRIP is clearly shown by the resulting gap that has been introduced in the published barley sequence to maintain homology. A lower, but significant, degree of homology is seen when the maize proRIP (SEQ ID NO:2) sequence is compared to the sequence of ricin A-chain (as set forth in FIG. 4). The upper sequence is maize .alpha..beta. RIP and the lower sequence is ricin A (SEQ. ID. NO. 27), as taught by Lamb et al. (1985), Eur. J. Biochem., 148:265. Identical residues are denoted by a solid line and conservative substitutions by a dotted line, dashes indicate insertions to maximize homology. Residues are numbered on the left, the numbering of the ricin sequence corresponds to that of the mature protein.
As set forth in FIG. 4, a gap was again introduced in the published ricin A sequence to maximize homology corresponding to the linker region of the maize proRIP.
Further comparison of the maize proRIP sequence with published full-length sequences of other non-Panicoideae RIPs indicate that there are four regions of significant homology between these proteins (as set forth in FIGS. 5a and 5b).
FIG. 5A shows the first region and the comparative alignment of the N-terminal amino acid sequence of the maize .alpha..beta. RIP .alpha. fragment residues 13 to 49 of SEQ ID NO: 2 with the N-terminal sequences of RIPs from other sources. The sequences are taken from: barley (residues 1 to 39 of SEQ ID NO: 26) (see Asano et al. (1986), supra); ricin A-chain (residues 25 to 58 of SEQ ID NO: 27) (see Lamb et al. (1985), supra); dodecandrin (SEQ. ID. NO. 28) (see Ready et al. (1985), Biochem. Biophys, Acta, 791:314); pokeweed anti-viral protein 2 (SEQ. ID. NO. 29) (see Bjorn et al. (1985), Biochim. Biophys. Acta, 790:154); Shiga-like toxin (SEQ. ID. NO. 30) (see Calderwood et al. (1987), Proc. Nat. Acad. Sci. USA, 84:4364); and .alpha.-trichosanthin (SEQ. ID. NO. 31), momordins (SEQ. ID. NO. 32), bryodin (SEQ. ID. NO. 33), gelonin (SEQ. ID. NO. 34), dodecandrin, pokeweed antiviral protein-2, saporin 5 (SEQ. ID. NO. 35) and saporin 4 (SEQ. ID. NO. 36) (see Montecucchi et al. (1989), Int. J. Peptide Res., 33:263). Positions showing homology in four or more sequences are noted by solid lines (showing identical residues) or dotted lines (showing conservatively substituted residues).
FIG. 5b shows that the other three regions are internally oriented. FIG. 5b specifically shows. the alignment of maize .alpha..beta. RIP residues 84 to 98; 201 to 215 and 237 to 249 of SEQ ID BIL 2 with regions of homology in the amino acid sequences of other RIPs. The sequences are available from the following references: barley (residues 76 to 91; 168 to 182 and 208 to 218 of SEQ ID NO: 26) (see Asano et al. (1986), supra and Leah et al. (1991), J Biol. Chem., 266:1564-1573); ricin A-chain (residues 70 to 84; 171 to 185 and 207 to 217 of SEQ ID NO: 27) (see Lamb et al. (1985), supra); abrin A-chain (SEQ. ID. NO. residues 64 to 78 are SEQ ID NO: 47, residues 159 59 173 are SEQ ID NO: 48 and residues 194 to 204 are SEQ ID NO: 49) (see Funatsu et al. (1988), Agric. Biol. Chem. 52:1095); saporin-6 (SEQ. ID. NO. residues 62 to 76 are SEQ ID NO: 37, residues 170 to 184 are SEQ. ID. No. 38 and residues 205 to 214 are SEQ ID NO: 46) (see Benatti et al. (1989) Eur. J. Biochem., 183:465); Shiga-like toxin 1A (residues 62 to 76 are SEQ ID NO: 50, residues 183 to 197 are SEQ ID NO: 51 and residues 222 to 231 are SEQ ID NO: 52) (see Calderwood et al. (1987), supra); and .alpha.-trichosanthin (residues 58 to 67 are SEQ ID NO: 53, residues 77 to 81, residues 161 to 175 are SEQ ID NO: 54, residues 161 to 175, residues 196 to 207 are SEQ ID NO: 55, and residues 196 to 207 are SEQ ID NO: 56) (see Montecucchi et al. (1989), supra); Xuejun and Jiahuai (1986), Nature, 321:477; Chow et al. (1990), J. Biol. Chem., 265: 8670-8674 and Maragonore et al. (1987), J. Biol. Chem., 262:11628-11633). Positions showing identity or conservative substitutions in four or more sequences are underlined, dashes indicate insertions to maximize homology. Vertical lines indicate residues that are conserved in all seven sequences. The starting amino acid of each sequence is indicated (note that trichosanthin contains an insertion sequence at residues 67 to 76).
The sequences and partial sequences of various additional Type I RIPs are set forth in the following articles: luffin-A (see Islam et al. (1990), Agric. Biol. Chem., 54:2967-2978); mirabilis antiviral protein (see Habuka et al. (1989) J. Bio. Chem., 264:6629-6637); trichokirin, (see Casellas et al. (1988), Eur. J. Bioehem., 176:581-588); momordins (see Barbieri et al. (1980), Biochem. J., 186:443-452); dianthins (see Reisbig and Bruland (1983), Arch. Bioehem. Biophys., 224:700-706); saporins (see Maras et al., (1990), Biochem. Intl., 21:831-838) and Lappi et al. (1985), Biochem. Biophys. Res Commun., 129:934-942; and momoreoehin-S (see Bolognesi et al. (1989), Biochim. Biophys. Acta, 993:287-292).
As set forth in FIG. 5b, RIPs for which a full-length sequence has been determined contain regions with significant homology. Additionally, the similarities of N-terminal sequences in an even greater number of RIPs have been compared (set forth in FIGS. 5a and 5b). It is likely that these regions have particular effect upon the function of the respective RIPs. The RIPs set forth in FIG. 5a are intended for exemplification purposes only. RIPs characterized in the future that meet the above criteria are also considered to be a part of this invention.
An RIP having a known amino acid sequences may now be altered into an inactive, proRIP form by the insertion of a linker, wherein the insertion of the linker substantially reduces the ribosome inactivating ability of the RIP. By "substantially reduce" is meant that the insertion of a cleavable linker into an active RIP lowers the IC.sub.50 value of the resultant protein by at least 10-fold, preferably 100-fold, and more preferably 1000-fold.
Based on the information deduced from the maize system set forth herein, it now becomes possible to engineer inactive forms of any RIP having a three dimensional structure similar to the three dimensional structure of ricin A chain. Cleavage of the linker will result in an .alpha..beta. RIP not heretofore found in nature.
The art has discussed the methodology for modifying the three dimensional structure of proteins (see, for example, Van Brunt (1986), Biotechnology, 4:277-283). The first step involves selecting plausible sites on the RIP between which the linker may be inserted. One of those sites is the exposed amino acid residues surrounding residue 156 of ricin A-chain or its equivalent in other RIP sequences. Residue 156 is located in a surface loop connecting helices D and E in the three dimensional structure of Ricin A. Thus, the present invention is intended to encompass the insertion of a peptide linker within a surface loop analogous to the surface loop of connecting helices D and E in the three dimensional structure of Ricin A, provided that the insertion of the linker substantially reduces the ribosome inactiveting ability of the RIP. Specifically, in the surface loop connecting helices D and E in the three dimensional structure of Ricin A is defined by amino acids 152-162 (as published by Funatsu, et al. (1991), Biochimie, 73:1157-1161).
As stated previously, ricin A-chain has been shown to have sequence homology to many single chain RIPs. The present invention is intended to include the construction of .alpha..beta. RIP and proRIP forms of any RIP. For example, regions in other RIPs analogous to amino acid sequence 152-162 in ricin A chain are as follows:
______________________________________RIP Amino Acid Numbers*______________________________________Ricinus communis agglutinin 152-162Abrin-a A-chain 138-148Luffin-a 138-148Luffin-b 139-149Momordin 138-148Trichosanthin 139-149PAP-S 151-161MAP 145-155Saporin 153-163Barley Translation Inhibitor 148-158Dianthin 30 174-184______________________________________ *All amino acid numbers are taken from Funatsu, et al. (1991), supra, except for the amino acid numbers for Dianthin 30, which are taken from Legname, et al. (1991), Biochimica et Biophysica Acta., 1090: 119-122.
Other Type I and Type II RIPs have also been purified to homogeneity and these include; momorcharins (see Yeung et al. (1986), Int. J. Peptide Res., 28:518-524); tritins (see Roberts and Stewart (1979), Biochem., 18:2615-2621); rye (see Coleman and Roberts (1982), Biochim. Biophys. Acta, 696:239-244); agrostins and RIPs from Hura crepitans (see Stirpe et al. (1983), Biochem. J., 216:617-625); Asparagus officianalis (see Stirpe et al. (1983), Biochem. J., 216:617-625); Cucumis melo (see Ferreras et al. (1989), Biochem Intl., 19:201-207); Cucurbitaceae (see Ng et al., Int. J. Biochem., 21:1353-1358); Petrocoptis (see Ferreras et al., Cell. Molec. Biol., 35:89-95); volkensin-a (see Barbieri et al. (1984), FEBS Lett., 171:277-279); viscumin-a (see Olsnes et al. (1982), J. Biol. Chem., 257:13263-123270); modeccin-a (see Gasperi-Campani (1978), Biochem. J., 174:491-496); Momordia charantia lectin-a (see Lin e tal. (1978), Linn. Toxicon., 16:653-660 ); and Phloraclerdron californicum lectin-a (see Franz et al. (1989), FEBS lett., 248:115-118).
Proteins from the following other plants have also been shown to possess ribosome inactivating activity: Stellarea holostea, Lychnis flos-cuculi, Hordeum murinum, Aegylops geniculata, Euphorbia serrata, Capsella bursa-pastoris, Muscari comosum (see Merino et al. (1990), J. Exp Botany, 41: 67-70); and proteins from Croton tiglium and Jatropha curcas (see Stirpe et al. (1976), Biochem J., 156: 1-6).
Recombinant procedures make possible the production of effectively homologous proteins possessing part or all of the primary structural conformation and/or one or more of the biological properties of the .alpha..beta. RIP. For purpose of this investigation, an amino acid sequence is effectively homologous to a second amino acid sequence if at least 70 percent, preferably at least 80 percent, and most preferably at least 90 percent of the active portions of the amino acid sequence are identical and retains its intended function. Thus more importantly and critical to the definition, an effectively homologous sequence to the .alpha..beta. RIP retains the capacity to interact with and inactivate eukaryotic ribosomes. The effectively homologous sequence to the proRIP must retain the capacity to be converted into an .alpha..beta. RIP. That is, the effectively homologous proRIP must have a linker sequence which, when cleaved, will yield a biologically functional .alpha..beta. RIP.
General categories of potentially-equivalent amino acids are set forth below, wherein, amino acids within a group may be substituted for other amino acids in that group: (1) glutamic acid and aspartic acids; (2) lysine, arginine and histidine; (3) hydrophobic amino acids such as alanine, valine, leucine and isoleucine; (4) asparagine and glutamine; (5) threonine and serine; (6) phenylalanine, tyrosine and tryptophan; and (7) glycine and alanine.
It is envisioned that, compared with changes to the .alpha. and .beta. fragments, more significant changes may be made to the proRIP in the leader and linker regions. That is, since the leader and linker sequences are to be cleaved, the length and amino acid residues in their sequences may better be tolerated and considered insignificant, because it will not alter the functionality of the final product.
Thus, the linker sequence of the proRIP need not be limited to the amino acid sequence set forth in FIG. 1. Generally, the linker may be of a length, may be of an amino acid sequence, and may be internally positioned so as to substantially reduce the ribosome inactivating activity of the RIP. Obviously, since the Panicoideae linker(s) is the only known RIP linker found in nature, it is expected that such an amino acid sequence will logically be a primary candidate for insertion into other RIPs. However the present invention is intended to encompass linkers having effectively homologous sequences to a selected maize linker. The factors to be considered in synthetically preparing effectively homologous linkers for .alpha..beta. RIPs generally are the same as set forth above for selecting effectively homologous linkers for a selected maize linker. For example, the length of the linker may be modified, provided that (1) the linker is cleavable, and (2) upon cleavage of the linker the resultant protein has an IC.sub.50 value that is at least about 10 times lower than the IC.sub.50 value of the protein containing the linker.
Primary criteria for selecting an effectively homologous linker include altering the net charge of the .alpha..beta. RIP (e.g., more acidic); creating a conformational shift in the protein or providing steric hindrance to the active site of the protein.
As noted previously, the maize .alpha..beta. RIP, like other RIPs, is basic. However, the maize proRIP has a slightly acidic pI. Thus, it is preferred that any effectively homologous linker selected for the maize proRIP will be acidic.
The linker should be of a length which, while capable of altering the three-dimensional structure of the protein, when cleaved will permit the protein to retain most of the three dimensional features of the active .alpha..beta. RIP molecule.
To ensure that the linker is clearable it is generally required that the conformation of the proRIP be such that the linker cleavage sites are readily accessible to a selected cleavage agent.
It is also envisioned that at least one restriction enzyme site may be engineered into the genetic sequence encoding an RIP, allowing DNA sequences encoding various polypeptide linkers to be inserted into the gene and tested for their ability to create an inactive, yet activatable RIP.
Nucleotide replacement may be achieved by the addition, deletion or substitution of various nucleotides, provided that the proper reading frame is maintained. Exemplary techniques for nucleotide replacement include polynucleotide-mediated, site-directed mutagenesis, i.e., using a single strand as a template for extension of the oligonucleotide to produce a strand containing the mutation (see Zoller et al. (1982), Nuc. Acids Res., 10:6487-6500); Norris et al. (1983), Nuc. Acids Res., 11:5103-5112; Zoller et al. (1984), DNA, 3:479-488; and Kramer et al. (1982), Nuc. Acids Res., 10:6475-6485) and PCR, i.e., using sequence specified oligonucleotides to incorporate selected changes by exponentially amplifying DNA in vitro (see PCR Technology: Principles and Applications for DNA Amplification, Erlich, (ed.) (1989), supra; and Horton et al., supra).
Most commonly, cleavage will be effected outside of the replicatire environment, for example, following harvest of microbial culture. Thus, when genetically modifying the proRIP, it may be preferable, in some instances, that the internal linker domain of the proRIP be retained, or altered so as to mimic the manner in which a natural, inactive proRIP is processed to the active .alpha. and .beta. fragments.
Any chemical or enzymatic method which recognizes a specific sequence or structure and causes an appropriate cleavage at a selected site may be utilized for the present invention. For example, it may be desirable to design carboxy termini and amino termini of the linker sequences that are subject to cleavage with selected agents. Exemplary of such sequences are Pro-Xxx-Gly-Pro (where Xxx is unspecified), which is selectively cleaved by collagenase; Ile-Glu-Gly-Arg, which is selectively cleaved by Factor Xa; and Gly-Pro-Arg, which is selectively cleaved by thrombin (see Nilsson et al. (1988), In: Advances in Gene Technology; Protein Engineering and Production, (ed.) Brew et al.).
A chemical or enzymetic method may not be suitable if its cleavage site occurs within the active amino acid sequences of the .alpha. and .beta. fragments. That cleavage within the native amino acid sequence of the .alpha. and .beta. fragments will generally have a greater likelihood of deleteriously affecting the enzymatic activity of the .alpha..beta. RIP. It is possible to select a specific cleavage sequence of only one amino acid residue so long as that residue does is not accessible in the amino acid sequences of the .alpha. and .beta. fragments. It is preferred, however, to utilize a specific cleavage sequence which contains two or more amino acid residues, i.e., an extended specific cleavage sequence. This type of sequence takes advantage of the extended active sites of various enzymes. Additionally, by utilizing an extended specific cleavage sequence, it is highly probable that cleavage will only occur at the desired site and not at other sites within the protein.
The cleavage techniques discussed here are by way of example and are but representative of the many variants which will occur to the skilled artisan in light of the specification.
In some instances it may prove desirable to effect cleavage of the proRIP within the cell. For example, an expression vehicle with an appropriate promoter may be provided with a DNA sequence coding for enzymes which convert the proRIP to the active form, operating in tandem with the other DNA sequence coding expression of the proRIP.
Further, as is well known, protein sequences may be modified by post-translation processing such as by becoming associated with other molecules, for example, glycosides, lipids, or such inorganic ions as phosphate. The ionization status will also vary depending on the pH of the medium or the pH at which crystallization or precipitation of the isolated form occurs. Further, the presence of air may cause oxidation of labile groups, such as --SH. Thus, included within the definition of the proRIP and .alpha..beta. RIP, and fragments, thereof are all such modifications of a particular primary structure, e.g., both glycosylated and non-glycosylated forms, neutral forms, acidic and basic salts, lipid or other associated peptide forms, side chain alterations due to oxidation or derivatization, and any other such modifications of an amino acid sequence which would be encoded by the same genetic codon sequence.
By appropriate choice of restriction sites, the desired DNA fragment may be positioned in a biologically functional vector which may contain appropriate control sequences not present in the selected DNA fragment. By "biologically functional" is meant that the vector provides for replication and/or expression in an appropriate host, either by maintenance as an extrachromosomal element or by integration into the host genome. A large number of vectors are available or can be readily prepared, and are well known to skilled artisans.
In general, vectors containing the appropriate promoters, which can be used by the host organism for expression of its own protein, also contain control sequences, ribosome binding sites, and transcription termination sites. Generally, the replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. Finally, the vectors should desirably have a marker gene that is capable of providing a phenotypical property which allows for identification of host cells containing the vector.
When expressing the .alpha..beta. RIP, the DNA fragments encoding the .alpha. fragment and the .beta. fragment may be inserted into separate vectors, or into the same vector. Specifically, when the .alpha. and .beta. fragments are contained in separate vectors, the host cells may be transformed via either cotransformation or targeted transformation techniques.
Construction of suitable vectors containing the desired coding and control sequences may be produced by using well-known techniques (see Sambrook et al. (1989), supra). Thereafter, the vector constructions may be used in transforming an appropriate host cell. Suitable host cells include cells derived from unicellular as well as multicellular organisms which are capable of being grown in cultures or by fermentation.
Various unicellular microorganisms can be used for both cloning and expression. Prokaryotes include members of the Enterobacteriaceae, such as strains of Escherichia coli, and Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus, Streptococcus, and Haemophilus influenzae.
In addition to prokaryotes, eukaryotic cells may be employed. As previously stated, eukaryotic cells have not heretofore been used as recombinant host cells for RIPs. By providing inactive forms of RIPs, the present invention provides skilled artisans with the flexibility to use eukaryotic cells as recombinant hosts. By transforming eukaryotic cells with the proRIP gene, the protein may be expressed at high levels without being toxic to the host cell. Since the protein is lacking in bioactivity pending extra-cellular cleavage, the effect of expressing a proRIP to enhance the biosafety of the procedure. The proRIP may then be selectively chemically or enzymatically converted to the desired .alpha..beta. RIP.
Exemplary eukaryotic microbes include yeast. Saccharomyces crevisae, or common baker's yeast, is the most commonly used among eukaryotic microorganisms, although a number of other hosts are commonly available.
In addition to eukaryotic microbes, cultures of cells derived from multicellular organisms may also be used as hosts. Examples of useful host mammalian cell lines are Sp2/O, VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, BHK, COS-7 and MDCK cell lines. Other suitable hosts and expression systems are the baculovirus systems maintained in cultured insect cells, e.g., from Spodoptera frugiperda.
Finally, cells from and portions of higher plants have been found useful as recombinant hosts, and appropriate control sequences are available for expression in these systems. Suitable plant cells include cells derived from, or seedlings of, tobacco, petunia, tomato, potato, rice, maize and the like.
The expression vehicle may be inserted into the host cell by any suitable method. Conventional technologies for introducing biological material into living cells include electroporation (see Shigekawa and Dower (1988), Biotechniques, 6:742; Miller, et al. (1988), Proc. Natl. Acad. Sci. USA, 85:856-860; and Powell, (1988), Appl. Environ. Microbiol., 54:655-660); direct DNA uptake mechanisms (see Mandel and Higa (1972), J. Mol. Biol., 53:159-162; Dityatkin, et al. (1972), Biochimica et Biophysica Acta, 281:319-323; Wigler, et al. (1979), Cell, 16:77; and Uchimiya, et al. (1982), In: Proc. 5th Intl. Cong. Plant Tissue and Cell Culture, A. Fujiwara (ed.), Jap. Assoc. for Plant Tissue Culture, Tokyo, pp. 507-508); fusion mechanisms (see Uchidaz, et al. (1980), in:Introduction of Macromolecules Into Viable Mammalian Cells, Baserga et at. (eds.) Wistar Symposium Series, 1:169-185); infectious agents (see Fraley, et al. (1986), CRC Crit. Rev. Plant Sci., 4:1-46; and Anderson (1984), Science, 226:401-409); microinjection mechanisms (see Crossway, et al. (1986), Mol. Gen. Genet., 202:179-185); and high velocity projectile mechanisms (see EPO 0 405 696 to Miller, Schuchardt, Skokut and Gould, (DowElanco). The appropriate procedure may be chosen in accordance with the plant species used.
Generally after transformation, the host cells may be grown for about 48 hours to allow for expression of marker genes. The cells are then placed in selective medium and/or screenable media, where untransformed cells are distinguished from transformed cells, either by death or a biochemical property. The transformed cells are grown under conditions appropriate to the production of the desired protein, and assayed for expression thereof. Exemplary assay techniques include enzyme-linked immunosorbent assay, radioimmunoassay, or fluorescence-activated cell sorter analysis, immunohistochemistry and the like. Selected positive cultures are subcloned in order to isolate pure transformed colonies. A suitable technique for obtaining subclones is via the limiting dilution method.
Uses
Essentially all of the uses that the prior art has envisioned for RIPs are intended for the novel .alpha..beta. RIP and proRIP set forth herein (see Immunotoxins (1988), supra; and U.S. Pat. No. 4,869,903 to Lifson et al. (Genelabs Incorporated and the Regents of the University of California)).
By providing inactive precursor forms of the .alpha..beta. RIP, it is now possible to provide protein synthesis inhibitors with uses in practical and improved ways not before possible. The inactive form of the .alpha..beta. RIP offers the additional advantage, over active RIPs, of not being active until removal of the linker sequence. Although the RIP is not toxic to the majority of mammalian cells it is known that RIP may be made specifically eytotoxie by attachment to a targeting vehicle which is capable of binding to and into target cells.
Exemplary targeting vehicles include any peptide hormone, growth factor, or other polypeptide cell recognition protein for which a specific receptor exists. A few examples include: antibodies and antibody fragments, lectins, insulin, glucagon, endorphins, growth hormone, melanocyte-stimulating hormone, transferrin, bombesin, low density lipoprotein, luteinizing hormone and asialoglycoprotein that bind selectively to target cells (see Immunotoxins (1988), supra). It is well established that conjugates which contain RIP exhibit maximal cytotoxicity only when the RIP moiety is released from the targeting vehicle.
Since the .alpha..beta. RIP and proRIP do not contain a reactive sulfhydryl group, it may be necessary to modify the proteins using chemical crosslinking reagents in order to link such proRIP and .alpha..beta. RIP to targeting vehicles.
Conjugates of a monoclonal antibody and the .alpha..beta. RIP and proRIP may be made using a variety of bifunctional protein coupling agents. General examples of such reagents are N-succinimidyl-3-(2-pyridyldithio)-propionate, 2-iminothiolane, bifunctional derivatives of imidoesters such as dimethyl adipimidate, active esters such as disuccinimidyl suberate, aldehydes such as glutaraldehyde, bis-azido compounds such as bis(p-diazoniumbenzoyl)ethylenediamine, diisocyanates such as toluene 2,6-diisocyanate, and bis-active fluorine compounds such as 1,5-difluoro-2,4-dinitrobenzene (see, for example, WO 86/05098). In addition, recombinant DNA methodologies may be employed to construct a cytotoxic fusion protein. For a general discussion of chimeric toxins (see, for example, Pastan and FitzGerald (1989), The Journal of Biological Chemistry, 264:15157-15160; and U.S. Pat. No. 4,892,827 to Pastan et al. (The United States of America as represented by the Department of Health and Human Services)).
EXAMPLES
The present invention is illustrated in further detail by the following examples. The examples are for the purposes of illustration only, and are not to be construed as limiting the scope of the present invention. All temperatures not otherwise indicated are Centigrade. All parts and percentages are by weight unless otherwise specifically noted. All DNA sequences are given in the conventional 5' to 3' direction. All amino acid sequences are given in conventional amino-terminus to carboxy-terminus direction.
Example 1
Isolation of Maize .alpha..beta. RIP
All steps were performed at 4.degree. C., except for high performance liquid chromatography (HPLC) which was performed at room temperature. Five hundred grams (500 g) of finely ground mature maize kernels were extracted for at least 2 hours and up to 24 hours (hr) with 1500 ml, 25 mM sodium phosphate, pH 7.2 (PB) +50 mM sodium chloride. After the extract was strained through several layers of cheesecloth, the protein precipitating between 55 percent and 85 percent ammonium sulfate was collected and redissolved in PB, then dialyzed overnight against the same buffer. The solution was clarified by centrifugation and applied to a 2.5.times.10 centimeter (cm) DE-52 cellulose column equilibrated with PB. The protein passing straight through the column was collected and applied to a Mono S 10/10 column (Pharmacia LKB Biotechnology, Piscataway, N.J.) equilibrated with PB, and eluted with a linear gradient of 0 to 200 mM sodium chloride in PB over 90 minutes at 2 milliliter/minute (ml/min). Alternatively, the protein can be precipitated with 85 percent ammonium sulfate and be dialyzed overnight before applying to the Mono S 10/10 column.
Fractions containing ribosome inactivating protein activity (as measured by rabbit reticulocyte protein synthesis assay, described below) were pooled and concentrated to 0.5 ml in Centricon-10 devices (Amicon, Danvers, Mass.), and applied to a Superose 12 column equilibrated in PB (Pharmacia LKB Biotechnology) at a flow-rate of 0.4 ml/min. Fractions containing ribosome inactivating protein activity (as measured by a rabbit reticulocyte protein synthesis assay, described below) (the first major peak) were pooled. At this stage, the .alpha..beta. RIP was usually quite pure as identified by SDS-PAGE (see Laemmli (1970), supra). If necessary, further purification can be achieved by applying the protein to a Mono S 5/5 column (Pharmacia LKB Biotechnology) equilibrated with PB and eluted at 1 ml/min with 0 to 50 mM sodium chloride in PB over 5 minutes, then 50 to 200 mM sodium chloride in PB over 25 min.
Results from a typical purification are presented in Table 1. The effect of purified maize .alpha..beta. RIP on mammalian protein synthesis is shown in FIG. 6.
TABLE 1______________________________________Purification of maize RIP from Mature Kernels Total Protein units* Yield Fold IC.sub.50Step (mg) .times. 10.sup.6 (%) Purification (ng/ml)______________________________________Crude extract 6816 384 100 1.0 32385% 1010 115 30 2.0 161Ammoniumsulfatepost-DE52 428 144 38 5.9 54treatmentMono S10/10 10.2 58 15 102 3.2poolSuperose 12 1.8 33 8.6 327 0.99poolMono S 5/5 1.32 32.4 8.4 436 0.74pool______________________________________ *One unit of activity is the amount of protein required to produce 50% inhibition in the rabbit reticulocyte lysate protein synthesis assay.
A. Rabbit Reticulocyte Cell-Free Protein Synthesis Assay
The inhibitory activity of the maize .alpha..beta. RIP toward mammalian protein synthesis was measured in a rabbit reticulocyte lysate system following the procedures of Pelham and Jackson (see (1976), Eur. J. Biochem., 67:247-256).
A mix of the following reagents was prepared (2.5 milliliter (ml) total volume): 125 microliter (.mu.l) 200 mM Tris-HCl, pH 7.6+40 mM magnesium acetate +1.6M potassium chloride; 12.5 .mu.l 3 mM hemin hydrochloride in 50 percent ethylene glycol; 1.0 ml untreated rabbit reticulocyte lysate (Promega, Madison, Wis.); 1.0 ml H.sub.2 O; 62.5 .mu.l amino acid mix; 125 .mu.l 20 mM ATP +4 mM GTP; 125 .mu.l 200 mM creatine phosphate; 50 .mu.l 2.5 mg/ml creatine phosphokinase in 50 percent ethylene glycol. The amino acid mix contained 50 .mu.M of each amino acid except glycine (100 .mu.M), arginine, isoleucine, methionine and tryptophan (10 .mu.M each) and contained no leucine. All stock solutions were previously adjusted to pH 7.5 prior to addition.
Five microliters (5 .mu.l) of appropriate dilutions of samples to be assayed were placed in the wells of a 96-well plate and 50 .mu.l of the mix added. After 10 minutes, 50 nanoCuries (nCi) .sup.14 C-leucine in 10 .mu.l was added to each well. After a further 10 minutes, the reaction was quenched with 10 .mu.l 1.5M potassium hydroxide and incubated for 45 minutes. Twenty-five microliters (25 .mu.l ) of each sample was then pipetted onto individual 2.1 cm Whatman 3 MM paper disks (Whatman, Clifton, N.J.) and after drying for 2 to 3 minutes, the disks were washed successively by swirling in a flask with 250 ml 10 percent trichloroacetic acid, 250 ml 5 percent trichloroacetic acid (twice), 125 ml ethanol, 250 ml 1:1 ethanol/acetone, and 125 ml acetone. After drying, the filters were placed into vials with 10 ml scintillation cocktail and counted.
B. Antisera and Western Blot Analysis:
The .alpha. and .beta. polypeptide bands were cut from 3 millimeter (mm) SDS-PAGE gels after brief staining with Coomassie blue and were electroeluted using an electroelution device (Bio-Rad, Richmond Calif.) according to the manufacturer's directions. The polypeptide preparations were then used to immunize rabbits to yield polyclonal anti-sera (prepared by RIBI Immunochem, Mont.).
Western blots from Phastgels.TM. reagent (Pharmacia LKB Biotechnology) were performed by removing the gel from the plastic backing and then electroblotting onto Immobilon paper (Millipore Corporation, Bedford, Mass.). Blots were developed using the maize .alpha..beta. RIP primary antiserum at 1:2000 dilution and alkaline phosphatase-conjugated goat anti-rabbit secondary antibody (Bio-Rad), according to the manufacturer's instructions.
Example 2
Isolation of Maize proRIP
The polyclonal antisera against the .alpha. and .beta. fragments were used to identify a common 34 kD precursor polypeptide in crude extracts of maize kernels (maize proRIP). The presence of the maize proRIP was monitored during subsequent purification by Western blot analysis as set forth above. All steps of the purification were performed at 4.degree. C., except for HPLC which was performed at room temperature.
Two hundred fifty grams (250 g) of immature maize kernels were homogenized in 600 ml 25 mM sodium phosphate, pH 7.2 (PB) +5 .mu.g/ml antipapain. After the extract was strained through several layers of cheesecloth, the protein precipitating between 45 and 80 percent ammonium sulfate was collected and redissolved in 15 ml PB, then passed over a 2.5.times.15 cm Sephadex G-25 column (Pharmacia LKB Biotechnology) equilibrated in PB. Fractions containing protein were pooled and diluted to -60 ml with water. The solution was applied to a Q-Sepharose (fast-flow) column packed in a 10/10 FPLC column (Pharmacia LKB Biotechnology) equilibrated with PB, and eluted with a 0 to 300 mM NaCl gradient at 2 ml/min over 75 minutes. Fractions containing the 34 kD precursor were pooled and concentrated by a Centriprep 10 device (Amicon) to 1.5 ml. This was diluted four-fold with water and applied to a Mono Q 5/5 column (Pharmacia LKB Biotechnology) equilibrated in PB. The column was eluted with a 0 to 250 mM NaCl gradient over 60 minutes. Fractions containing the 34 kD polypeptide were pooled, concentrated to 0.5 ml and applied to a Superose 12 column (Pharmacia LKB Biotechnology) equilibrated in PB. The major peak from this column contained the 34 kD maize RIP precursor and appropriate fractions were pooled and stored at -20.degree. C.
Example 3
PAGE Analysis of Maize .alpha..beta. RIP and proRIP
SDS-PAGE was performed with a Phastsystem.TM. reagent (Pharmacia LKB Biotechnology) using 20 percent Phastgels.TM. reagent and following the manufacturer's instructions. Native PAGE was performed at pH 4.2 as described in the Phastsystem.TM. reagent application file no. 300, method 1 (Pharmacia LKB Biotechnology).
SDS-PAGE of highly purified, active maize .alpha..beta. RIP exhibited two polypeptides: an .alpha. fragment (16.5 kD) and a .beta. fragment (11.0 kD) under both reducing and non-reducing conditions. A single band was seen in native PAGE analysis of purified, active maize .alpha..beta. RIP. The minimal Mr value of the associated, native maize .alpha..beta. RIP was therefore 27.5 kD.
By SDS-PAGE, highly purified maize proRIP migrated with a value of 34 kD.
Example 4
In vitro Activation of Maize proRIP by Papain
A purified sample of proRIP was incubated at 0.5 mg/ml with papain, a plant thiol protease, at 0.01 mg/ml in sodium acetate buffer, pH 6 containing 2 mM dithiothreitol. After 1 to 2 hours at room temperature, the 34 kD proRIP was digested to a stable product exhibiting a polypeptide pattern almost identical to that of native, active maize .alpha..beta. RIP. There was a concomitant increase in ribosome inactivating activity in the incubation; the undigested proRIP had no ribosome inactivating activity up to 2 .mu.g/ml, whereas papain-treated proRIP had an IC.sub.50 of <80 ng/ml. in contrast trypsin had no effect on maize proRIP.
Example 5
Chemically-Determined Amino Acid Sequences
A. N-Terminal Amino Acid Sequences of Maize .alpha..beta. RIP .alpha. Fragment and .beta. Fragment.
A sample of maize .alpha..beta. RIP was electrophoresced by the method of Laemmli (1970), supra) in 1.5 mm thick gels and the gel electroblotted onto immobilon PVDF paper (Millipore) using a Transphor.TM. apparatus (Pharmacia LKB Biotechnology). The paper was stained briefly with Coomassie blue and the bands corresponding to the .alpha. and .beta. kD polypeptides were cut out. These were N-terminal sequenced directly from the PVDF paper using a 470A gas phase sequencer (Applied Biosystems, Foster City, Calif.). The following data was obtained (bracketed residues denote lower confidence assignments):
N-Terminal sequence of a fragment (residues 17 to 48 of FIG. 1):
K R I V P K I T E I F P V E D A N Y P V S A F I A[G] V X K D V I
An additional minor species (-20 percent of the total species) had the following N-Terminal sequence (residues 13 to 22 of FIG. 1) of:
A Q T N K [L] I V P K
N-Terminal sequence (residues 187 to 215 of FIG. 1) of .beta. fragment:
A A D P Q A D T K S X L V K L V V M V S/C E G L X F N T V S
B. .alpha. fragment C-Terminal Amino Acid Sequence
The carboxy-terminal amino acid sequence of the .alpha. maize .alpha..beta. RIP .alpha. fragment was determined using sequencing grade carboxypeptidase P from Penicillium japonicum (Boehringer Mannheim, Indianapolis, Ind.). A sample of .alpha. fragment was purified by reverse-phase HPLC using a Vydac 5.mu. C4 4.6.times.30 mm RP column. The column was equilibrated with 0.1 percent trifluoroacetic acid (TFA), and eluted with 0 to 40 percent of 0.1 percent TFA+80 percent acetonitrile over 8 minutes, then 40 to 60 percent of 0.1 percent TFA +80 percent acetonitrile over 20 minutes. The .beta. fragment eluted after 21.9 minutes and the .alpha. fragment eluted after 23.3 minutes.
A lyophilized sample of the .alpha. fragment was dissolved in 20 mM sodium acetate, pH 5.8+4M urea. The digestion mix contained the following in 0.1 ml: 1.6 .mu.g carboxypeptidase P, 66 .mu.g .beta. fragment, 0.12M sodium acetate pH 4.2, 0.8M urea. After 1, 5, 15, 60, 120 and 480 minutes, duplicate 8 .mu.l aliquots from the digestion were added to 8 .mu.l 0.4M sodium borate, pH 10.5 and frozen on dry ice.
Amino acid analysis was performed essentially as described by Jones (1986), In: Methods of Protein Microcharacterization (ed.) J. E. Shively. The following sequence is obtained: NH.sub.2 -Asp-Leu-Ala-(Lys)n-COOH, where n=2-4. This was the carboxy terminus of the .alpha. polypeptide, therefore this and the N-terminus sequence of the .beta. fragment define the linker region contained in the precursor (see amino acid sequence of the recombinant maize proRIP derived from cDNA in FIG. 1).
C. N-Terminal Amino Acid Sequence of Maize proRiP
No N-Terminal sequence data was obtained from a sample of the 34 kD maize proRIP indicating that this polypeptide is N-terminal blocked.
Example 6
Isolation and Characterization of cDNA for Maize proRIP
A. Isolation
Immature kernels from field grown Pioneer hybrid 3737 were harvested, shelled from the cob, and stored at -20.degree. C. Ten grams (10 g) of kernels were frozen in liquid nitrogen for several minutes then ground to a powder in a Waring blender. The powder was suspended in 20 ml of ice cold TENS buffer (10 mM Tris pH 7.4, 1 mM EDTA, 0.5 percent SDS, 0.3M NaCl) and extracted immediately with an equal volume of phenolchloroform-isoamyl alcohol (25:24:1) saturated with TENS buffer. The aqueous phase was collected and extracted three more times with fresh phenol mixtures.
Nucleic acids were precipitated from the aqueous phase by adjusting it to 0.3M sodium acetate pH 5.5 and adding 2.5 volumes of 100 percent ethanol. Nueleic acids were collected by centrifugation and suspended directly in 1 ml phenol-ehloroform-isoamyl alcohol plus 1 ml TENS and extracted by vortexing. The nucleic acid was precipitated from the aqueous phase by ethanol precipitation as above. The precipitate was collected by centrifugation and resuspended in TE buffer (10 mM Tris pH 7.4, 1 mM EDTA). Single strand nucleic acid was precipitated by adjusting the solution to 2M LiCl and incubating for 4 to 12 hours at 4.degree. C. Centrifugation yielded a pellet which consisted of between 2.2 to 2.5 mg of total RNA.
Poly(A)-containing RNA was enriched from the total RNA sample by using Hybond mAP.TM. mRNA purification affinity paper (Amersham Corporation, Arlington Heights Ill.). The supplier's protocol was followed. Typically 5 to 10 .mu.g of poly(A) enriched RNA were recovered per milligram of total RNA.
Five micrograms (5 .mu.g) of poly(A) enriched RNA were converted into double stranded cDNA using a cDNA Synthesis.TM. kit (Pharmacia LKB Biotechnology). The cDNA was ligated into the cloning vector Lambda gt11 (Stratagene Inc., La Jolla Calif.) following the supplier's instructions. Packaging of the ligated vector-insert mixture was done with the Gigapack plus packaging extract (Stratagene, Inc.) again following the supplier's protocol.
The PicoBlue Immunodetection.TM. kit (Stratagene, Inc.) was used to screen the Lambda gt11 maize kernel cDNA library using rabbit polyclonal antisera raised against the maize proRIP, as described above.
Positive clones were purified to homogeneity and the cDNA inserts characterized by Eco RI restriction enzyme analysis. One of the largest Eco RI-generated cDNA inserts (about 1,100 bp) was ligated into the Eco RI site of plasmid pUC19 (Bethesda Research Labs, Gaithersberg, Md.). Clones carrying the proRIP cDNA insert in both orientations were identified by restriction digestion and used for large scale plasmid purification.
B. Sequencing the Maize proRIP cDNA
The nucleotide sequence of the proRIP cDNA (set forth in FIG. 1) was determined by dideoxy chain termination sequencing using the Sequenase.TM. DNA sequencing kit (United States Biochemical Corp., Cleveland Ohio). The double stranded pUC19-RIP was used as template following the manufacturer's instructions. The first round of sequencing was initiated by the M13/pUC forward sequencing primer (Bethesda Research Labs). Subsequent primers were derived from the sequenced maize proRIP cDNA. Both strands of the cDNA were fully sequenced at least once.
The open reading frame encoding the .alpha..beta. RIP protein was confirmed by comparing the cDNA deduced amino acid sequence (set forth in FIG. 1) to the chemically determined protein sequence data.
Example 7
Determination of C-terminal Processing of Maize proRIP
Attempts at chemically determining the C-terminal sequence if the .beta. fragment gave equivocal results, as only the only residue that could be firmly identified was alanine. However, alanine accounts for 25% of the 60 C-terminal residues of pro-RIP. The extent of C-terminal proteolytic processing of maize pro-RIP to generate .alpha..beta. RIP was therefore determined by accurately establishing the molecular weight of the .beta. fragment by electronspray mass spectrometry (ES/MS). Samples of pure .beta. fragment were prepared by reverse-phase HPLC as described in Example 5 from three different preparations of purified .alpha..beta. RIP prepared as described in Example 1. These were then subjected to ES/MS analysis at the Harvard Microchemical Facility. A value of 11,020 (.+-.20) for the molecular mass of the .beta. fragment was obtained. Using this accurate value, in combinations with the previously-determined N-terminal sequence of the .beta. fragment (Example 5) and deduced amino acid sequence of the pro-RIP (Example 6), the C-terminus of the naturally-occurring .beta. fragment was established as Ala-287. Thus, 14 residues (1,336 Daltons, residues 288-301) are removed from the C-terminus of maize proRIP during processing to generate active .alpha..beta. RIP.
Example 8
Expression of Maize proRIP and Derivatives in Escherichia coil
Various genetic derivatives of maize proRIP may be expressed in E. coli and tested for ribosome inactiveting activity. A summary of several constructions and their properties is given below.
A. R34 (the amino acid and nucleotide sequences of which are set forth in FIG. 7) represents the recombinant proRIP gene engineered for expression in Escherichia coli which encodes a protein of Mr 33,327 and as expected is not a potent inhibitor of protein synthesis. Upon papain or subtilisin Carlsberg treatment it is processed into two associated polypeptides (of approximately 17+12 kD) by SDS Phastgel.TM. analysis with very potent ribosome inactivating activity. N34 (not shown) represents the native proRIP as isolated from nature.
B. R30 (the amino acid and nucleotide sequences of which are set forth in FIG. 8). R30 represents the proRIP with no N-terminal leader and no linker.
Expression of the recombinant maize proRIP in E. coli was accomplished by engineering the cDNA via PCR amplification. A 5' primer was synthesized which contained termination codons in all three reading frames to stop translation of vector-encoded proteins upstream of the maize proRIP cDNA. The primer also contained a Shine-Dalgarno sequence several base pairs upstream of an ATG start codon followed by 23 bases which were homologous to the maize proRIP cDNA. The 3' primer spans the 3' cDNA end-pUC19 junction (the primers were shown by the underlined regions set forth in FIG. 1). PCR amplification of the cDNA in pUC19 using the GeneAmp.TM. kit (Perkin Elmer-Cetus, Norwalk, Conn.) yielded a predominant amplification product of approximately 1100 base pairs, as expected.
The engineered, amplified product, was purified from an agarose gel and ligated into the filled-in Hind III site of the expression vector pGEMEX-1 (Promega Corp., Madison, Wis.) to give plasmid pGR, set forth in FIG. 9a.
This was transformed into E. coli DH5a (Bethesda Research Labs). Plasmids containing the maize proRIP cDNA were isolated by colony hybridization (see Sambrook et al., supra) with a 5' maize proRIP cDNA probe and characterized. Those containing the cDNA probe for the maize proRIP in the correct orientation were tested for expression. Plasmids were transformed into competent E. coli JM109(DE3) (Promega Corp., Madison, Wis.), transformed cells were grown in 15 ml cultures under ampicillin selection to an optical density at 600 nm of 0.4 to 1.0. Isopropylthio-.beta.-galactoside (IPTG) was added to 1.3 mM to induce the production of recombinant proRIP and the cultures were grown an additional 4 hours at 37.degree. C. The cells were collected by centrifugation and stored as a pellet at -20.degree. C.
The protein produced from the maize proRIP cDNA was analyzed by iysing the induced cells in TE containing 1 mg/ml lysozyme 37.degree. C. for 15 minutes. The lysate was fractionated into a crude supernatant and pellet by microcentrifugation. The fractions were analyzed by SDS-PAGE using 20 percent Phastgels.TM. reagent (Pharmacia LKB Biotechnology). Coomassie blue staining and Western blot analysis of the gels with anti-maize proRIP sera identified a 34 kD band which was greatly increased upon induction of the cells with IPTG. Cells not carrying the plasmid or containing the plasmid with the maize proRIP cDNA in the inverted orientation did not contain this 34 kD immuno-reactive band. The majority of the recombinant maize proRIP was contained in the cellular pellet suggesting the material was insoluble under these conditions.
To test if R34 could acquire the folding pattern of N34 the pellet fraction of an induced culture was dissolved in 6M guanidine HCl and allowed to denature at room temperature for 3 hours. The material was then diluted 200-fold into ice cold TE and incubated at 4.degree. C. overnight to allow refolding of the denatured R34. The diluted material was then concentrated by a Centricon 10 device (Amicon). To test whether refolded R34 could undergo the correct proteolytic processing to the fragmented form of the maize proRIP, the material was treated with 10 .mu.g/ml papain for various times, and samples were analyzed by SDS-Phastgel and Western blot analysis. The R34 material was processed to a stable mixture of two immuno-reactive bands which comigrate with N34 papain-processed material indicating the correct proteolytic processing had occurred.
In an effort to simplify purification of the R34 polypeptide from induced lysates, the gene 10 coding region of the pGEMEX-1 vector was removed by cutting the maize proRIP gene-containing plasmid (pGR) with Xba I and gel purifying the vector/proRIP DNA away from the gene 10 encoding DNA. Recircularization of pGR, now minus the gene 10 coding region, resulted in a plasmid called pGR1 set forth in FIG. 9b.
The plasmid pGR1 was transformed into JM109(DE3) cells and tested for production of R34 following induction with IPTG. As with pGR, large amounts of R34 were identified in cellular lysates both by Western blot and Coomassie blue staining. Unlike pGR, R34 produced from pGR1 was soluble and fractionated in the supernatant of lysed cells. This soluble material was treated with papain at 10 .mu.g/ml and the RB34 produced from pGR1 was cleaved to products which comigrate with N34, papain-cleaved product. The papain-treated material inhibited translation of reticulocyte lysates at significantly higher dilutions than the untreated material, indicating that the soluble R34 was processed to an active form.
C. R34-DL represents the proRIP without the linker (the amino acid and nucleotide sequences of which are set forth in FIG. 10. The sequences encoding .alpha. and .beta. were joined directly without intervening linker DNA, i.e., nucleotides A-520 to A-594, inclusive of the intact recombinant maize proRIP nucleotide sequence (see FIG. 1) are deleted. The R34-DL gene encoded a 30.6 kD protein which was a potent inhibitor of protein synthesis. Treatment of R34-DL with papain resulted in a 28 kD polypeptide with increased ribosome inactivating activity over the untreated molecule.
Confirmation that removal of the linker from maize proRIP activated the molecule was obtained independently through genetic engineering. The 75 bp linker encoding region of R34 (A-520 to A-594 inclusive) was deleted using PCR amplification. The new construction R34-DL joined directly, in frame, the DNA encoding both the .alpha. and .beta. fragments.
In the pGEMEX-1 system the R34-DL gene directed the synthesis of a polypeptide approximately 30.6 kD, which was recognized by antisera specific for the maize proRIP. At high dilution, coli lysates containing R34-DL protein were potent inhibitors of protein synthesis in rabbit reticulocyte lysates, in marked contrast to E. coli lysates containing the R34 polypeptide.
These genetic deletion data confirm that removal of the linker served to activate the R34 (proRIP) molecule. This experiment also demonstrated that covalent linkage of the .alpha. and the .beta. polypeptide fragments resulted in an active .alpha..beta. RIP. The maize proRIP did not require a break in the polypeptide backbone for enzymatic activity, removal of the linker region was sufficient to confer potent ribosome inactivating activity.
In addition, when R34-DL lysates were treated with papain a slight decrease in the molecular weight of R34-DL protein is noted (from 30.6 kD to approximately 28 kD). The R34-DL polypeptide remained intact, that is, it was not cleaved to the characteristic maize .alpha..beta. RIP .alpha. and .beta. fragments. Associated with this small change in molecular weight was an increase in protein synthesis inhibition in the E. coli lysates. These data indicated that in bacterial lysates removal of the linker region activated the ribosomal inactivating activity of the protein at least 250-fold, but that additional processing from the ends of the protein increased the activity.
D. Another genetic construction was made using PCR technology to remove the leader region from R34-DL. The new construction called R30-DL (nucleotides C-40 to C-84 and A-520 to A-594), inclusive, of the intact recombinant maize proRIP nucleotide sequence are deleted) encoded a protein (approximately 29.5 kD) which was slightly smaller than R34-DL (the amino acid sequence and the nucleotide sequence of which are set forth in FIG. 11). E. coli lysates containing R30-DL appeared to be even more potent inhibitors of protein synthesis than R34-DL lysates. Papain treatment of R30-DL containing lysates further enhanced protein synthesis inhibiting activity. Following this treatment the R30-DL protein underwent a slight decrease in molecular weight representing processing at the ends of the polypeptide.
Example 9
Expression of a Fully-Activated Maize RIP Derivative
A segment of the R30-DL gene was deleted which encodes several acidic residues at the carboxy terminus of the protein. The deletion was accomplished using the PCR engineering methods.
A thermocycler (Perkin-Elmer Cetus, Norwalk, Conn.) was used for the indicated constructions. A typical run was a one minute denaturation step, a 2 minute annealing, and a 3 minute extension step. Temperatures used were 94.degree. C., 37.degree. C. or 50.degree. C., and 72.degree. C. respectively. Following 25 cycles the reaction was held at 72.degree. C. for 7 minutes for extension of unfinished products.
Amplification engineering reactions were done in four separate tubes of 100 .mu.L each. The tubes were combined following amplification. Normally 100 ng of template was included in each tube. DNA primers were synthesized on a PCR Mate or 380A DNA synthesizer (Applied Biosystems) and were purified on acrylamide gels. Fifty pmol of each primer were included in each reaction. The reaction conditions for the amplification were those recommended by Perkin Elmer Cetus (10 mM Tris-HCl pH8.3, 50 mM KCl, 1.5 mM MgCl.sub.2, 0.001 percent gelatin, 200 .mu.M dNTPs and 2.5 units of Taq DNA polymerase or AmpliTaq.TM. thermostable DNA polymerase).
Several methods of genetic engineering were employed to produce the genetic derivatives described below. Standard methods of DNA purification, restriction enzyme digestion, agarose gel analysis, DNA fragment isolation, ligation and transformation were employed (see Current Protocols in Molecular Biology (1989), supra and Sambrook et al. (1989), supra).
Enzymes used for the engineering were from one of three manufacturers (Pharmacia LKB Biotechnology; Bethesda Research Labs; or New England Biolabs, Beverly, Mass.). Buffers and protocols used were provided by the manufacturer.
Using PCR, a modified RIP fragment was amplified from an RIP plasmid template, purified, then used to replace the unmodified region in the RIP gene. All fragment replacements were done in RIP genes already inserted into a pGEMEX expression plasmid.
A pGEMEX plasmid containing R30-DL, which had the 3' half of the gene removed by Nco I and Stu I digestion followed by gel purification was used as the template for PCR. The 3' half of the RIP gene was replaced with the PCR modified fragment described below.
A 3' PCR primer was synthesized which encoded the 7 amino acid residue deletion near the carboxy terminus and introduced a new unique Bam HI site. The 5' primer directed the deletion of the .alpha..beta. linker and included a Nco I site. The sequences of the 5' primer and the 3' primer for the PCR amplification of RDT are given in below. ##STR1##
The primers were used to amplify a modified DNA fragment from a pGEMEX R34-DL template. The amplified fragment was phenol extracted and ethanol precipitated. The insert DNA was cut with Nco I and ligated into the pGEMEX-R30-DL vector.
The new RIP gene derivative is designated RDT and encodes a protein of predicted a 28,233 Daltons and pI of .about.9.5. The RDT gene encodes a protein with a truncated leader, deleted linker and truncated carboxy terminus.
The predicted DNA sequence and deduced amino acid sequence for RDT is shown in FIG. 12.
The RDT gene, expressed in E. coli using the pGEMEX system described above, was purified from bacterial lysates to apparent homogeneity. RDT protein appears to be a more potent inhibitor of protein synthesis than R30-DL. Using the retieulocyte lysate protein synthesis assay, purified RDT has a IC.sub.50 value of 1 ng/ml.
Example 10
Modification of RDT for Fusion to Other Polypeptides
RDT was further engineered to produce another gene called RDT-NP. This construction differs from RDT in having two unique restriction sites engineered into the gene. The sites were introduced using PCR methods described in Example 9. The PCR primer was designed such that it included the desired change and a unique restriction site in the maize RIP DNA sequence. A 99 bp primer was developed to introduce the Not I and Pst I sites at the 3' end of the primer and had to be built back to the unique Neo I site for cloning purposes. The sequences of the 5' primer and 3' primer for the PCR amplification are shown below ##STR2##
The restriction sites (Not I and Pst I) correspond to the site of the alpha/beta linker insertion in the RIP polypeptide. RDT-NP allows DNA segments encoding various polypeptide linkers to be inserted into the gene and tested for their ability to create an inactive, yet protease activatable RIP. The predicted DNA sequence and deduced amino acid sequence for RDT-NP is shown in FIG. 13.
The RDT-NP polypeptide had a predicted molecular weight of 28,446 Daltons and pI of 9.5. Crude lysates of E. coli expressing RDT-NP from a pGEMEX vector are potent inhibitors of eukaryotic protein synthesis.
Example 11
Maize RIP Fused to a Protein A Antibody-Binding Domain
To create an RIP molecule which would bind to immunoglobulin IgG, a single Antibody Binding Region (ABR) domain from the Staphyloeoccus aureus antibody binding Protein A was subcloned from the plasmid pRIT5 (Pharmacia LKB Biotechnology) using PCR techniques. The antibody binding domain of protein A (ABR-A) was PCR engineered to have a Bam HI site at its 5' end and a Bgl II site at it's 3' end. This allowed insertion of the ABR-A domain into the RDT Bam HI site while retaining the unique Bam HI site. The predicted DNA sequence and deduced amino acid sequence of RDT-A is shown in FIG. 14.
RDT-A was expressed in E. coli cells using the pGEMEX system. The resulting polypeptide had a predicted molecular weight of 35,198 Daltons and pI of 9.2. it was recognized by antisera to both protein A and maize RIP indicating the chimeric nature of the protein. Crude lysates of bacteria expressing RDT-A had potent eukaryotic protein synthesis inhibition activity.
RDT-A was shown to bind specifically to IgG Sepharose (Pharmacia LKB Biotechnology) following the manufacturer's instructions. Binding was best at pH 7.0. When washed at pH 5.0 the ehimeric protein was released in small but detectable quantities from the resin. RDT alone does not bind to the gel.
Example 12
Maize RIP-fused to Protein A and Protein G Antibody-binding Domain
To increase the binding ability of the RDT-A to IgG antibodies the Antibody Binding Domain from Streptococcal Group G protein G (ABR-G) was synthesized using oligonucleotides. The sequence synthesized was that of the naturally occurring sequence described by Guss et al. ((1986), EMBO Journal, 5:1567-1575). The only change was the addition of Bam HI and Bgl II sites at the 5' and 3' ends respectively of the synthetic DNA.
The ABR-G fragment was inserted into the Bam HI site of RDT-A. Two classes of clones have been studied. RDT-G-A contains a single ABR-G domain inserted in the correct orientation between the 3' end of RDT and the 5' end of ABR-A. A second class contains two properly oriented ABR-G domains. The predicted DNA sequence and deduced amino acid sequence for RDT-G-A are shown in FIG. 15; and the predicted nucleotide sequence and deduced amino acid sequence for RDT-G-G-A are shown in FIG. 16.
When these genes were expressed in E. coli using the pGEMEX system the expected chimeric proteins were produced. The RDT-G-A produced a protein of predicted molecular weight 44,576 Daltons (pI 7.2). RDT-G-G-A produced a slightly larger polypeptide predicted to be 53,955 Daltons with a predicted pI of 5.4.
Crude bacterial lysates of cells expressing RDT-G-A or RDT-G-G-A were potent inhibitors or eukaryotic protein synthesis in the rabbit reticulocyte assay described in Example 2. Papain treatment of the lysates further increases activity. Analysis of the papain treated lysates indicates that the intact RDT domain is released from the ABR domains.
Both RDT-G-A and RDT-G-G-A bind tightly to IgG Sepharose (Pharmacia LKB Biotechnology). Binding is stable at pH 5.0 Elution was accomplished with 0.5M ammonium acetate pH 3.5 or by boiling the resin in SDS.
Example 13
Introduction of a Disulfide-Containing, Proteolytically-Sensitive Linker Peptide Between RDT and Antibody-binding Domains
The maize RIP (RDT) antibody binding domain (GGA) fusions described above (see Examples 11 and 12) have been shown to have both RIP and antibody binding activity. A third component was added to the constructions which would allow separation of the domains following proteolysis with trypsin and reduction with reducing agents. This was accomplished by inserting a segment of DNA between the RDT and GGA domains which encodes a protein with two cysteine residues. The cysteine residues form a disulfide bond with a 7 amino acid loop. The resulting disulfide bonded loop contains the recognition sequence for the protease trypsin. Completion of this construction required several steps as indicated below.
A. Construction of RDT-BHSR
To simplify the insertion of sequences between the RDT and GGA domains in the gene RDT-GGA, two restriction sites were added. This was done by cutting the plasmid containing RDT-GGA with the enzymes Bam HI and Eco RI. The GGA encoding region was removed from the plasmid and replaced with the synthetic oligonucleotide linker shown below (the top nucleotide sequence is SEQ ID NO: 43 and the bottom nucleotide sequence is SEQ ID NO: 45. ##STR3##
The linker restores the Bam HI and Eco RI sites while adding Hpa I and Sal I sites. The resulting construction RDT-BHSR (the predicted nucleotide sequence and deduced amino acid sequence is shown in FIG. 17).
B. Construction of RDT-BHSR-GGA
A Sal I site was placed on the end of the GGA domains by PCR amplification of the segment using the primer shown below (SEQ. ID. NO 44): ##STR4## and a 3' primer which primes downstream of the Eco RI site. Following amplification, the PCR product was cut with Sal I and Eco RI and ligated into the Sal I and Eco RI sites of RDT-BHSR to create a new construction called RDT-BHSR-GGA (the predicted nucleotide sequence and deduced amino acid sequence is shown in FIG. 18).
C. Construction of RDT-DS-GGA
A linker was designed and synthesized which encodes a trypsin cleavage site flanked by two cysteine residues. The cysteine residues were expected to form a disulfide bond under appropriate conditions. The predicted nucleotide and deduced amino acid sequence for the DS linker (the top nucleotide sequence is SEQ ID NO: 57, the bottom nucleotide sequence is SEQ ID NO: 58 and the amino acid sequence is SEQ ID NO: 59) is set forth below: ##STR5##
The gene RDT-BHSR-GGA was cut with Bam HI and Sal I and the synthetic double stranded oliqonucleotide as shown below was ligated into the gene to create RDT-DS-GGA (see FIG. 19 for the predicted DNA sequence and deduced amino acid sequence of RDT-BHSR-GGA).
The gene RDT-DS-GGA was expressed in E. coli using the T7 expression system and purified on an IgG Sepharose column as described below.
D. Expression in Escherichia coli of RDT-DS-GGA Using the T7 System
The expression system used was based on the T7 system as described by Moffat and Studier ("Use of T7 RNA Polymerase to Direct Expression of Cloned Genes", F. W. Studier et al. (1990), Methods in Enzymoloqy 185:60-89). The expression strain JM109(DE3) is lysogenic for the T7 RNA polymerase gene under lac promoter control. Typically, JM109(DE3) (Genotype: recA1, endoA1, gyrA96, thi-, hsdR17, supE44, relA1, D(lac, pro), F' traD36 proAB lacIq, lacZ DM15 : DE3, Promega, Madison Wis.) was transformed with the RDT-DS-GGA expression plasmid the night before an expression experiment. The freshly transformed cells were harvested from plates and transferred to Luria Broth (5.times.107 cells/ml). The culture was shaken vigorously at 37.degree. C. for 30-60 minutes then induced with 1-10 mM IPTG. The cultures were harvested 3 hours following induction by centrifugation. Cell pellets were stored at -20.degree. C.
Cell pellets were subjected to two freeze thaw cycles before being suspended in 1/5 volume lysis buffer (10 mM Tris pH 8.0, 1 mM EDTA, 150 mM NaCl, 0.1% Triton X-100, 1 mg/ml Lysozyme, 100 .mu.g/ml DNase and 100 .mu.g/ml RNase). The cells were allowed to incubate in lysis buffer 15 minutes at 37.degree. C. The extract was fractionated by centrifugation at 4000.times.G for 10 minutes at room temperature. The supernatant was collected and stored at -20.degree. C. for purification.
E. Purification
A 5 ml column of IgG Sepharose 6FF (Pharmacia, Piscataway N.J.) was prepared as directed by manufacturer's instructions. The column was equiliberated in TST (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Tween 20).
The lysate was mixed with an equal volume of TST containing protease inhibitors (100 uM antipain and 2 mM PMSF, Sigma Chemical, St Louis, Mo.) and applied to the column. The column was washed with 5-10 volumes TST. Elution of bound material was with 2 column volumes 0.5M NaAcetate pH 3.5. After elution the sample was dialyzed against 4 liters 20 mM Tris pH 8.0, 100 mM NaCl, 2 mM EDTA overnight 4.degree. C. The affinity purified RDT-DS-GGA was concentrated in a Centriprep 30 concentrating unit. SDS Polyacrylamide gel analysis of the purified RDT-DS-GGA protein indicated it was greater than 95% pure. The material ran as a single band at approximately 55 kD.
F. Trypsin Treatment of RDT-DS-GGA
The purified RDT-DS-GGA was treated with sequencing grade trypsin (Boehringer Mannhelm, Indianapolis Ind.) at a 1:100 (wt:wt) ratio 35.degree. C. for 2 minutes (50 mM Tris pH 8.0, 2 mM CaCl.sub.2). The reaction was stopped by adding a 10.times. weight excess of soybean trypsin inhibitor (Sigma Chemical, St Louis, Mo.).
G. Characterization of RDT-DS-GGA
Analysis of trypsin treated RDT-DS-GGA was done using 20% Phast Gels (Pharmacia, Piscataway N.J.) with or without reducing agents in the sample buffer. Under oxidizing conditions untreated RDT-DS-GGA migrates at approximately 55 kD whereas trypsin-treated RDT-DS-GGA migrates at approximately 42 kD. We have shown that RDT alone is not cleaved by trypsin under these conditions and therefore conclude that the 42 kD polypeptide is a result of trypsin cleavage within the GGA domains. When analyzed under reducing conditions the 42 kD polypeptide splits into a major band at 28 kD (co-migrating with RDT) and some smaller molecular weight fragments. The 28 kD band is recognized by anti-maize RIP antibodies. These data indicate that the engineered trypsin site between the RDT and GGA domains is clipped by trypsin and the domains are held together via a disulfide bond. These observations were confirmed by testing RDT-BHSR-GGA under the same conditions. When treated with trypsin RDT-BHSR-GGA produces a 42 kD species which is stable under reducing conditions.
Trypsin treated RDT-DS-GGA is quantitatively retained by a IgG-Sepharose column indicating that the trypsin truncated fusion protein binds IgG. When the column is eluted with reducing agent (TST with 10 mM DTT) a single 28 kD band is quantitatively eluted. The band is recognized by maize RIP antibodies and has potent RIP activity.
Example 14
Detection of Maize proRIP and .alpha..beta. RIP Homologs in PanicodeaeA. Immunological Detection
Seeds from the following species of Panicoideae were ground to a fine consistency in a mortar and pestle (after removal of the glume if necessary): Zea mays mays, Z.m. mexicana, Z.m. parviglumis, Z. luxurians, Z. mexicana, Z. mexicana , Tripsacura dactyloides , Coix lachryma-jobi , Sorghum bicolor.
Soluble proteins were extracted from mature dry seed by the following techniques. The proteins were extracted for 2 hours with 50 mM sodium phosphate buffer, pH 7.5 containing 25 .mu.g/ml leupeptin, 25 .mu.g/ml antipain, 2 mM EDTA and 4 mM phenylmethane sulfonyl fluoride. Three milliliter extraction buffer per gram seed tissue was used. After centrifugation to remove insoluble material, an aliquot of the extract was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis using 17-27% gradient gels, then eleetroblotted onto PVDF paper (Millipore). The blot was probed using rabbit antisera against maize RIP .alpha. and .beta. fragments (1:2000 dilution each) as primary antibody and goat anti-rabbit IgG antibody as secondary antibody, then developed with NBT/BCIP.
Except for the Coix extract, all the extracts tested showed cross-reactivity with the maize RIP antisera. A prominent band at .about.34 kD was observed corresponding to proRIP, and bands at .about.16.5 and 11.0 kD were also observed, corresponding to .alpha. and .beta. fragments respectively. This indicates that RIP forms equivalent to maize proRIP and the activated .alpha..beta. form are present in many members of the subfamily Panicoideae.
B. Detection by DNA Hybridization
Total DNA from the following species was isolated according to the procedures described by Saghai-Marcoof et al., PNAS, 81:8014-8018, 1984. The following species of Panicoideae were included: 3 accessions of Zea mays ssp. parviglumis; Zea luxurians; Zea mays ssp. mexicana; Coix lachryma-jobi; Sorghum bicolor; and Zea mays ssp. mays var. B73.
Generally, about 8 .mu.g of the extracted DNA from each sample was digested to completion with 20 units of Hind III, Eco RI and Sst I in 20 microliters of a reaction mixture containing the appropriate reaction buffer at 37.degree. C. for 2 hours.
Next, the total extracted DNA from each sample was subjected to the Southern hybridization technique (see Southern (1975), J. Mol. Biol., 98:503-517). The DNA fragments were fractionated on the basis of their size by means of electrophoresis on a 0.8% agarose gel. The double-stranded DNA fragments were modified into single-stranded DNA fragments in an alkali solution; and then a nylon filter was placed into close contact with the gel to transfer the modified DNA segments onto the filter in the presence of a high salt concentration solution.
Hybridization was carried out using, as the probe, the cDNA clone of the RIP gene (the probe fragment is provided from base position 2 to 1075 in FIG. 1). The probe was radiolabeled with .sup.32 P and the signals in Southern transfers were visualized by autoradiography.
The Southern blots were hybridized with the cDNA clone of the RIP gene. A single fragment with strong homology to the clone was observed for each enzyme/species combination except the Coix accession. The inbred line of maize has a single major band with two minor bands. The other species which, with the exception of Sorghum, are not inbred showed between 2 and 5 minor bands. The Coix had either 4 or 5 such bands depending on the enzyme used.
Although the invention has been described in considerable detail, with reference to certain preferred embodiments thereof, it will be understood that variations and modifications can be affected within the spirit and scope of the invention as described above and as defined in the appended claims.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 81(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1076 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 28..933(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GAATTCGGCACGAGCAAAGAGAAGGGAATGGCCGAGATAACCCTAGAGCCG51MetAlaGluIleThrLeuGluPro15AGTGATCTTATGGCGCAAACAAACAAAAGAATAGTGCCAAAGTTCACT99SerAspLeuMetAlaGlnThrAsnLysArgIleValProLysPheThr101520GAAATCTTCCCCGTGGAGGACGCGAACTACCCTTACAGCGCCTTCATC147GluIlePheProValGluAspAlaAsnTyrProTyrSerAlaPheIle25303540GCGTCGGTCCGGAAAGACGTGATCAAACACTGCACCGACCATAAAGGG195AlaSerValArgLysAspValIleLysHisCysThrAspHisLysGly455055ATCTTCCAGCCCGTGCTGCCACCGGAGAAGAAGGTCCCGGAGCTATGG243IlePheGlnProValLeuProProGluLysLysValProGluLeuTrp606570TTCTACACAGAGCTCAAAACTAGGACCAGCTCCATCACGCTCGCCATA291PheTyrThrGluLeuLysThrArgThrSerSerIleThrLeuAlaIle758085CGCATGGACAACCTGTACCTCGTGGGCTTCAGGACCCCGGGCGGGGTG339ArgMetAspAsnLeuTyrLeuValGlyPheArgThrProGlyGlyVal9095100TGGTGGGAGTTCGGCAAGGACGGCGACACCCACCTCCTCGGCGACAAC387TrpTrpGluPheGlyLysAspGlyAspThrHisLeuLeuGlyAspAsn105110115120CCCAGGTGGCTCGGCTTCGGCGGCAGGTACCAGGACCTCATCGGCAAC435ProArgTrpLeuGlyPheGlyGlyArgTyrGlnAspLeuIleGlyAsn125130135AAGGGTCTGGAGACCGTCACCATGGGCCGCGCCGAAATGACCAGGGCC483LysGlyLeuGluThrValThrMetGlyArgAlaGluMetThrArgAla140145150GTCAACGACCTGGCGAAGAAGAAGAAGATGGCGACACTGGAGGAGGAG531ValAsnAspLeuAlaLysLysLysLysMetAlaThrLeuGluGluGlu155160165GAGGTGAAGATGCAGATGCAGATGCCGGAGGCCGCTGATCTGGCGGCG579GluValLysMetGlnMetGlnMetProGluAlaAlaAspLeuAlaAla170175180GCGGCAGCGGCTGACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAG627AlaAlaAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys185190195200CTGGTGGTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCCCGC675LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg205210215ACGGTGGACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACCGTG723ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal220225230ACGCAGGGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCC771ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla235240245TTCGAGTGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAG819PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys250255260CTTGGCATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTT867LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal265270275280AAGAATCAAACTACTGCCGCTGCCGCTACTGCTGCCAGTGCTGACAAC915LysAsnGlnThrThrAlaAlaAlaAlaThrAlaAlaSerAlaAspAsn285290295GACGACGACGAGGCCTGATCAATGCAACGACACATCATGATCTGCTGCTGCACTT970AspAspAspGluAla300AATTACTATGTTCGTATACAAATAAATACACCCGGCGTACGCGGTGTTCCTTATATGGTC1030TAAAATGTAGCCAGTAAATTTTAAACTACTTTCTCGTGCCGAATTC1076(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 301 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAlaGluIleThrLeuGluProSerAspLeuMetAlaGlnThrAsn151015LysArgIleValProLysPheThrGluIlePheProValGluAspAla202530AsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspValIle354045LysHisCysThrAspHisLysGlyIlePheGlnProValLeuProPro505560GluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArg65707580ThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuVal859095GlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGly100105110AspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGly115120125ArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMet130135140GlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLys145150155160LysMetAlaThrLeuGluGluGluGluValLysMetGlnMetGlnMet165170175ProGluAlaAlaAspLeuAlaAlaAlaAlaAlaAlaAspProGlnAla180185190AspThrLysSerLysLeuValLysLeuValValMetValCysGluGly195200205LeuArgPheAsnThrValSerArgThrValAspAlaGlyPheAsnSer210215220GlnHisGlyValThrLeuThrValThrGlnGlyLysGlnValGlnLys225230235240TrpAspArgIleSerLysAlaAlaPheGluTrpAlaAspHisProThr245250255AlaValIleProAspMetGlnLysLeuGlyIleLysAspLysAsnGlu260265270AlaAlaArgIleValAlaLeuValLysAsnGlnThrThrAlaAlaAla275280285AlaThrAlaAlaSerAlaAspAsnAspAspAspGluAla290295300(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1105 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GCTTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGGCCGAGATAACCCTAGAGCCG60AGTGATCTTATGGCGCAAACAAACAAAAGAATAGTGCCAAAGTTCACTGAAATCTTCCCC120GTGGAGGACGCGAACTACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATC180AAACACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAGAAGAAGGTC240CCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACCAGCTCCATCACGCTCGCCATA300CGCATGGACAACCTGTACCTCGTGGGCTTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTC360GGCAAGGACGGCGACACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGC420AGGTACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGCCGCGCCGAA480ATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAGATGGCGACACTGGAGGAGGAG540GAGGTGAAGATGCAGATGCAGATGCCGGAGGCCGCTGATCTGGCGGCGGCGGCAGCGGCT600GACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTGGTCATGGTGTGCGAGGGG660CTGCGGTTCAACACCGTGTCCCGCACGGTGGACGCGGGGTTCAACAGCCAGCACGGGGTG720ACCTTGACCGTGACGCAGGGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCC780TTCGAGTGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGCATCAAG840GATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAATCAAACTACTGCCGCTGCC900GCTACTGCTGCCAGTGCTGACAACGACGACGACGAGGCCTGATCAATGCAACGACACATC960ATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACAAATAAATACACCCGGCGTACG1020CGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATTTTAAACTACTTTCTCGTGCCG1080AATTCACTGGCCGGCATGCTATATA1105(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1074 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..911(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLysAGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145ATGGCGACACTGGAGGAGGAGGAGGTGAAGATGCAGATGCAGATGCCG536MetAlaThrLeuGluGluGluGluValLysMetGlnMetGlnMetPro150155160GAGGCCGCTGATCTGGCGGCGGCGGCAGCGGCTGACCCACAGGCCGAC584GluAlaAlaAspLeuAlaAlaAlaAlaAlaAlaAspProGlnAlaAsp165170175ACGAAGAGCAAGCTGGTGAAGCTGGTGGTCATGGTGTGCGAGGGGCTG632ThrLysSerLysLeuValLysLeuValValMetValCysGluGlyLeu180185190CGGTTCAACACCGTGTCCCGCACGGTGGACGCGGGGTTCAACAGCCAG680ArgPheAsnThrValSerArgThrValAspAlaGlyPheAsnSerGln195200205210CACGGGGTGACCTTGACCGTGACGCAGGGGAAGCAGGTGCAGAAGTGG728HisGlyValThrLeuThrValThrGlnGlyLysGlnValGlnLysTrp215220225GACAGGATCTCCAAGGCGGCCTTCGAGTGGGCTGACCACCCCACCGCT776AspArgIleSerLysAlaAlaPheGluTrpAlaAspHisProThrAla230235240GTGATCCCCGACATGCAGAAGCTTGGCATCAAGGATAAGAACGAAGCA824ValIleProAspMetGlnLysLeuGlyIleLysAspLysAsnGluAla245250255GCGAGGATCGTTGCGCTCGTTAAGAATCAAACTACTGCCGCTGCCGCT872AlaArgIleValAlaLeuValLysAsnGlnThrThrAlaAlaAlaAla260265270ACTGCTGCCAGTGCTGACAACGACGACGACGAGGCCTGATCAATGC918ThrAlaAlaSerAlaAspAsnAspAspAspGluAla275280285AACGACACATCATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACAAATAAATACA978CCCGGCGTACGCGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATTTTAAACTACT1038TTCTCGTGCCGAATTCACTGGCCGGCATGCTATATA1074(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 286 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysMetAlaThrLeuGluGluGluGluValLysMetGlnMetGln145150155160MetProGluAlaAlaAspLeuAlaAlaAlaAlaAlaAlaAspProGln165170175AlaAspThrLysSerLysLeuValLysLeuValValMetValCysGlu180185190GlyLeuArgPheAsnThrValSerArgThrValAspAlaGlyPheAsn195200205SerGlnHisGlyValThrLeuThrValThrGlnGlyLysGlnValGln210215220LysTrpAspArgIleSerLysAlaAlaPheGluTrpAlaAspHisPro225230235240ThrAlaValIleProAspMetGlnLysLeuGlyIleLysAspLysAsn245250255GluAlaAlaArgIleValAlaLeuValLysAsnGlnThrThrAlaAla260265270AlaAlaThrAlaAlaSerAlaAspAsnAspAspAspGluAla275280285(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1029 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 36..863(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:GCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGGCCGAGATAACCCTA53MetAlaGluIleThrLeu15GAGCCGAGTGATCTTATGGCGCAAACAAACAAAAGAATAGTGCCAAAG101GluProSerAspLeuMetAlaGlnThrAsnLysArgIleValProLys101520TTCACTGAAATCTTCCCCGTGGAGGACGCGAACTACCCTTACAGCGCC149PheThrGluIlePheProValGluAspAlaAsnTyrProTyrSerAla253035TTCATCGCGTCGGTCCGGAAAGACGTGATCAAACACTGCACCGACCAT197PheIleAlaSerValArgLysAspValIleLysHisCysThrAspHis404550AAAGGGATCTTCCAGCCCGTGCTGCCACCGGAGAAGAAGGTCCCGGAG245LysGlyIlePheGlnProValLeuProProGluLysLysValProGlu55606570CTATGGTTCTACACAGAGCTCAAAACTAGGACCAGCTCCATCACGCTC293LeuTrpPheTyrThrGluLeuLysThrArgThrSerSerIleThrLeu758085GCCATACGCATGGACAACCTGTACCTCGTGGGCTTCAGGACCCCGGGC341AlaIleArgMetAspAsnLeuTyrLeuValGlyPheArgThrProGly9095100GGGGTGTGGTGGGAGTTCGGCAAGGACGGCGACACCCACCTCCTCGGC389GlyValTrpTrpGluPheGlyLysAspGlyAspThrHisLeuLeuGly105110115GACAACCCCAGGTGGCTCGGCTTCGGCGGCAGGTACCAGGACCTCATC437AspAsnProArgTrpLeuGlyPheGlyGlyArgTyrGlnAspLeuIle120125130GGCAACAAGGGTCTGGAGACCGTCACCATGGGCCGCGCCGAAATGACC485GlyAsnLysGlyLeuGluThrValThrMetGlyArgAlaGluMetThr135140145150AGGGCCGTCAACGACCTGGCGAAGAAGAAGAAGGCGGCTGACCCACAG533ArgAlaValAsnAspLeuAlaLysLysLysLysAlaAlaAspProGln155160165GCCGACACGAAGAGCAAGCTGGTGAAGCTGGTGGTCATGGTGTGCGAG581AlaAspThrLysSerLysLeuValLysLeuValValMetValCysGlu170175180GGGCTGCGGTTCAACACCGTGTCCCGCACGGTGGACGCGGGGTTCAAC629GlyLeuArgPheAsnThrValSerArgThrValAspAlaGlyPheAsn185190195AGCCAGCACGGGGTGACCTTGACCGTGACGCAGGGGAAGCAGGTGCAG677SerGlnHisGlyValThrLeuThrValThrGlnGlyLysGlnValGln200205210AAGTGGGACAGGATCTCCAAGGCGGCCTTCGAGTGGGCTGACCACCCC725LysTrpAspArgIleSerLysAlaAlaPheGluTrpAlaAspHisPro215220225230ACCGCTGTGATCCCCGACATGCAGAAGCTTGGCATCAAGGATAAGAAC773ThrAlaValIleProAspMetGlnLysLeuGlyIleLysAspLysAsn235240245GAAGCAGCGAGGATCGTTGCGCTCGTTAAGAATCAAACTACTGCCGCT821GluAlaAlaArgIleValAlaLeuValLysAsnGlnThrThrAlaAla250255260GCCGCTACTGCTGCCAGTGCTGACAACGACGACGACGAGGCC863AlaAlaThrAlaAlaSerAlaAspAsnAspAspAspGluAla265270275TGATCAATGCAACGACACATCATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACA923AATAAATACACCCGGCGTACGCGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATT983TTAAACTACTTTCTCGTGCCGAATTCACTGGCCGGCATGCTATATA1029(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 276 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:MetAlaGluIleThrLeuGluProSerAspLeuMetAlaGlnThrAsn151015LysArgIleValProLysPheThrGluIlePheProValGluAspAla202530AsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspValIle354045LysHisCysThrAspHisLysGlyIlePheGlnProValLeuProPro505560GluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArg65707580ThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuVal859095GlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGly100105110AspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGly115120125ArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMet130135140GlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLys145150155160LysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLysLeu165170175ValValMetValCysGluGlyLeuArgPheAsnThrValSerArgThr180185190ValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrValThr195200205GlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAlaPhe210215220GluTrpAlaAspHisProThrAlaValIleProAspMetGlnLysLeu225230235240GlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuValLys245250255AsnGlnThrThrAlaAlaAlaAlaThrAlaAlaSerAlaAspAsnAsp260265270AspAspGluAla275(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 985 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 37..822(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:GCTTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAAAGAATAGTGCCA54MetLysArgIleValPro15AAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAACTACCCTTACAGC102LysPheThrGluIlePheProValGluAspAlaAsnTyrProTyrSer101520GCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAACACTGCACCGAC150AlaPheIleAlaSerValArgLysAspValIleLysHisCysThrAsp253035CATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAGAAGAAGGTCCCG198HisLysGlyIlePheGlnProValLeuProProGluLysLysValPro404550GAGCTATGGTTCTACACAGAGCTCAAAACTAGGACCAGCTCCATCACG246GluLeuTrpPheTyrThrGluLeuLysThrArgThrSerSerIleThr55606570CTCGCCATACGCATGGACAACCTGTACCTCGTGGGCTTCAGGACCCCG294LeuAlaIleArgMetAspAsnLeuTyrLeuValGlyPheArgThrPro758085GGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGACACCCACCTCCTC342GlyGlyValTrpTrpGluPheGlyLysAspGlyAspThrHisLeuLeu9095100GGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGGTACCAGGACCTC390GlyAspAsnProArgTrpLeuGlyPheGlyGlyArgTyrGlnAspLeu105110115ATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGCCGCGCCGAAATG438IleGlyAsnLysGlyLeuGluThrValThrMetGlyArgAlaGluMet120125130ACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAGGCGGCTGACCCA486ThrArgAlaValAsnAspLeuAlaLysLysLysLysAlaAlaAspPro135140145150CAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTGGTCATGGTGTGC534GlnAlaAspThrLysSerLysLeuValLysLeuValValMetValCys155160165GAGGGGCTGCGGTTCAACACCGTGTCCCGCACGGTGGACGCGGGGTTC582GluGlyLeuArgPheAsnThrValSerArgThrValAspAlaGlyPhe170175180AACAGCCAGCACGGGGTGACCTTGACCGTGACGCAGGGGAAGCAGGTG630AsnSerGlnHisGlyValThrLeuThrValThrGlnGlyLysGlnVal185190195CAGAAGTGGGACAGGATCTCCAAGGCGGCCTTCGAGTGGGCTGACCAC678GlnLysTrpAspArgIleSerLysAlaAlaPheGluTrpAlaAspHis200205210CCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGCATCAAGGATAAG726ProThrAlaValIleProAspMetGlnLysLeuGlyIleLysAspLys215220225230AACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAATCAAACTACTGCC774AsnGluAlaAlaArgIleValAlaLeuValLysAsnGlnThrThrAla235240245GCTGCCGCTACTGCTGCCAGTGCTGACAACGACGACGACGAGGCCTGATCAATG829AlaAlaAlaThrAlaAlaSerAlaAspAsnAspAspAspGluAla250255260AACGACACATCATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACAAATAAATACA889CCCGGCGTACGCGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATTTTAAACTACT949TTCTCGTGCCGAATTCACTGGCCGGCATGCTATATA985(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 261 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys145150155160LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg165170175ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal180185190ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla195200205PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys210215220LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal225230235240LysAsnGlnThrThrAlaAlaAlaAlaThrAlaAlaSerAlaAspAsn245250255AspAspAspGluAla260(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 978 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..815(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLys1AGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145GCGGCTGACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTG536AlaAlaAspProGlnAlaAspThrLysSerLysLeuValLysLeuVal150155160GTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCCCGCACGGTG584ValMetValCysGluGlyLeuArgPheAsnThrValSerArgThrVal165170175GACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACCGTGACGCAG632AspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrValThrGln180185190GGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCCTTCGAG680GlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAlaPheGlu195200205210TGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGC728TrpAlaAspHisProThrAlaValIleProAspMetGlnLysLeuGly215220225ATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAAT776IleLysAspLysAsnGluAlaAlaArgIleValAlaLeuValLysAsn230235240CAAACTACTGCCGCTGCCGCTACTGCTGGATCCGCCTGATCAATGC822GlnThrThrAlaAlaAlaAlaThrAlaGlySerAla245250255AACGACACATCATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACAAATAAATACA882CCCGGCGTACGCGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATTTTAAACTACT942TTCTCGTGCCGAATTCACTGGCCGGCATGCTATATA978(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 254 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys145150155160LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg165170175ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal180185190ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla195200205PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys210215220LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal225230235240LysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySerAla245250(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 987 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..824(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLys1AGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145GCGGCCGCCGCTGCAGACCCACAGGCCGACACGAAGAGCAAGCTGGTG536AlaAlaAlaAlaAlaAspProGlnAlaAspThrLysSerLysLeuVal150155160AAGCTGGTGGTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCC584LysLeuValValMetValCysGluGlyLeuArgPheAsnThrValSer165170175CGCACGGTGGACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACC632ArgThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThr180185190GTGACGCAGGGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCG680ValThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAla195200205210GCCTTCGAGTGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAG728AlaPheGluTrpAlaAspHisProThrAlaValIleProAspMetGln215220225AAGCTTGGCATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTC776LysLeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeu230235240GTTAAGAATCAAACTACTGCCGCTGCCGCTACTGCTGGATCCGCCTGATCAATG831ValLysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySerAla245250255AACGACACATCATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACAAATAAATACA891CCCGGCGTACGCGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATTTTAAACTACT951TTCTCGTGCCGAATTCACTGGCCGGCATGCTATATA987(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 257 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAlaAlaAlaAspProGlnAlaAspThrLysSerLys145150155160LeuValLysLeuValValMetValCysGluGlyLeuArgPheAsnThr165170175ValSerArgThrValAspAlaGlyPheAsnSerGlnHisGlyValThr180185190LeuThrValThrGlnGlyLysGlnValGlnLysTrpAspArgIleSer195200205LysAlaAlaPheGluTrpAlaAspHisProThrAlaValIleProAsp210215220MetGlnLysLeuGlyIleLysAspLysAsnGluAlaAlaArgIleVal225230235240AlaLeuValLysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySer245250255Ala(2) INFORMATION FOR SEQ ID NO:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1161 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..998(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLys1AGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145GCGGCTGACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTG536AlaAlaAspProGlnAlaAspThrLysSerLysLeuValLysLeuVal150155160GTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCCCGCACGGTG584ValMetValCysGluGlyLeuArgPheAsnThrValSerArgThrVal165170175GACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACCGTGACGCAG632AspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrValThrGln180185190GGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCCTTCGAG680GlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAlaPheGlu195200205210TGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGC728TrpAlaAspHisProThrAlaValIleProAspMetGlnLysLeuGly215220225ATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAAT776IleLysAspLysAsnGluAlaAlaArgIleValAlaLeuValLysAsn230235240CAAACTACTGCCGCTGCCGCTACTGCTGGATCCGCTGATAACAATTTC824GlnThrThrAlaAlaAlaAlaThrAlaGlySerAlaAspAsnAsnPhe245250255AACAAAGAACAACAAAATGCTTTCTATGAAATCTTGAATATGCCTAAC872AsnLysGluGlnGlnAsnAlaPheTyrGluIleLeuAsnMetProAsn260265270TTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTAAAAGATGAC920LeuAsnGluGluGlnArgAsnGlyPheIleGlnSerLeuLysAspAsp275280285290CCAAGCCAAAGTGCTAACCTATTGTCAGAAGCTAAAAAGTTAAATGAA968ProSerGlnSerAlaAsnLeuLeuSerGluAlaLysLysLeuAsnGlu295300305TCTCAAGCACCGAAAGATCGATCCGCCTGATCAATGCAACGACACAT1015SerGlnAlaProLysAspArgSerAla310315CATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACAAATAAATACACCCGGCGTAC1075GCGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATTTTAAACTACTTTCTCGTGCC1135GAATTCACTGGCCGGCATGCTATATA1161(2) INFORMATION FOR SEQ ID NO:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 315 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys145150155160LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg165170175ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal180185190ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla195200205PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys210215220LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal225230235240LysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySerAlaAspAsn245250255AsnPheAsnLysGluGlnGlnAsnAlaPheTyrGluIleLeuAsnMet260265270ProAsnLeuAsnGluGluGlnArgAsnGlyPheIleGlnSerLeuLys275280285AspAspProSerGlnSerAlaAsnLeuLeuSerGluAlaLysLysLeu290295300AsnGluSerGlnAlaProLysAspArgSerAla305310315(2) INFORMATION FOR SEQ ID NO:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1422 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..1256(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLys1AGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145GCGGCTGACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTG536AlaAlaAspProGlnAlaAspThrLysSerLysLeuValLysLeuVal150155160GTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCCCGCACGGTG584ValMetValCysGluGlyLeuArgPheAsnThrValSerArgThrVal165170175GACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACCGTGACGCAG632AspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrValThrGln180185190GGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCCTTCGAG680GlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAlaPheGlu195200205210TGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGC728TrpAlaAspHisProThrAlaValIleProAspMetGlnLysLeuGly215220225ATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAAT776IleLysAspLysAsnGluAlaAlaArgIleValAlaLeuValLysAsn230235240CAAACTACTGCCGCTGCCGCTACTGCTGGATCCAAACCAGAAGTGATC824GlnThrThrAlaAlaAlaAlaThrAlaGlySerLysProGluValIle245250255GATGCGTCTGAATTAACACCAGCCGTGACAACTTACAAACTTGTTATT872AspAlaSerGluLeuThrProAlaValThrThrTyrLysLeuValIle260265270AATGGTAAAACATTGAAAGGCGAAACAACTACTGAAGCTGTTGATGCT920AsnGlyLysThrLeuLysGlyGluThrThrThrGluAlaValAspAla275280285290GCTACTGCAGAAAAAGTCTTCAAACAATACGCTAACGACAACGGTGTT968AlaThrAlaGluLysValPheLysGlnTyrAlaAsnAspAsnGlyVal295300305GACGGTGAATGGACTTACGACGATGCGACTAAGACCTTTACAGTTACT1016AspGlyGluTrpThrTyrAspAspAlaThrLysThrPheThrValThr310315320GAAAAACCAGAAGTGATCGATGCGTCTGAATTAACACCAGCCGTGACA1064GluLysProGluValIleAspAlaSerGluLeuThrProAlaValThr325330335AGATCCGCTGATAACAATTTCAACAAAGAACAACAAAATGCTTTCTAT1112ArgSerAlaAspAsnAsnPheAsnLysGluGlnGlnAsnAlaPheTyr340345350GAAATCTTGAATATGCCTAACTTAAACGAAGAACAACGCAATGGTTTC1160GluIleLeuAsnMetProAsnLeuAsnGluGluGlnArgAsnGlyPhe355360365370ATCCAAAGCTTAAAAGATGACCCAAGCCAAAGTGCTAACCTATTGTCA1208IleGlnSerLeuLysAspAspProSerGlnSerAlaAsnLeuLeuSer375380385GAAGCTAAAAAGTTAAATGAATCTCAAGCACCGAAAGATCGATCCGCC1256GluAlaLysLysLeuAsnGluSerGlnAlaProLysAspArgSerAla390395400TGATCAATGCAACGACACATCATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACA1316AATAAATACACCCGGCGTACGCGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATT1376TTAAACTACTTTCTCGTGCCGAATTCACTGGCCGGCATGCTATATA1422(2) INFORMATION FOR SEQ ID NO:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 402 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys145150155160LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg165170175ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal180185190ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla195200205PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys210215220LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal225230235240LysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySerLysProGlu245250255ValIleAspAlaSerGluLeuThrProAlaValThrThrTyrLysLeu260265270ValIleAsnGlyLysThrLeuLysGlyGluThrThrThrGluAlaVal275280285AspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaAsnAspAsn290295300GlyValAspGlyGluTrpThrTyrAspAspAlaThrLysThrPheThr305310315320ValThrGluLysProGluValIleAspAlaSerGluLeuThrProAla325330335ValThrArgSerAlaAspAsnAsnPheAsnLysGluGlnGlnAsnAla340345350PheTyrGluIleLeuAsnMetProAsnLeuAsnGluGluGlnArgAsn355360365GlyPheIleGlnSerLeuLysAspAspProSerGlnSerAlaAsnLeu370375380LeuSerGluAlaLysLysLeuAsnGluSerGlnAlaProLysAspArg385390395400SerAla(2) INFORMATION FOR SEQ ID NO:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1683 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..1520(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLys1AGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145GCGGCTGACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTG536AlaAlaAspProGlnAlaAspThrLysSerLysLeuValLysLeuVal150155160GTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCCCGCACGGTG584ValMetValCysGluGlyLeuArgPheAsnThrValSerArgThrVal165170175GACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACCGTGACGCAG632AspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrValThrGln180185190GGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCCTTCGAG680GlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAlaPheGlu195200205210TGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGC728TrpAlaAspHisProThrAlaValIleProAspMetGlnLysLeuGly215220225ATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAAT776IleLysAspLysAsnGluAlaAlaArgIleValAlaLeuValLysAsn230235240CAAACTACTGCCGCTGCCGCTACTGCTGGATCCAAACCAGAAGTGATC824GlnThrThrAlaAlaAlaAlaThrAlaGlySerLysProGluValIle245250255GATGCGTCTGAATTAACACCAGCCGTGACAACTTACAAACTTGTTATT872AspAlaSerGluLeuThrProAlaValThrThrTyrLysLeuValIle260265270AATGGTAAAACATTGAAAGGCGAAACAACTACTGAAGCTGTTGATGCT920AsnGlyLysThrLeuLysGlyGluThrThrThrGluAlaValAspAla275280285290GCTACTGCAGAAAAAGTCTTCAAACAATACGCTAACGACAACGGTGTT968AlaThrAlaGluLysValPheLysGlnTyrAlaAsnAspAsnGlyVal295300305GACGGTGAATGGACTTACGACGATGCGACTAAGACCTTTACAGTTACT1016AspGlyGluTrpThrTyrAspAspAlaThrLysThrPheThrValThr310315320GAAAAACCAGAAGTGATCGATGCGTCTGAATTAACACCAGCCGTGACA1064GluLysProGluValIleAspAlaSerGluLeuThrProAlaValThr325330335AGATCCAAACCAGAAGTGATCGATGCGTCTGAATTAACACCAGCCGTG1112ArgSerLysProGluValIleAspAlaSerGluLeuThrProAlaVal340345350ACAACTTACAAACTTGTTATTAATGGTAAAACATTGAAAGGCGAAACA1160ThrThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThr355360365370ACTACTGAAGCTGTTGATGCTGCTACTGCAGAAAAAGTCTTCAAACAA1208ThrThrGluAlaValAspAlaAlaThrAlaGluLysValPheLysGln375380385TACGCTAACGACAACGGTGTTGACGGTGAATGGACTTACGACGATGCG1256TyrAlaAsnAspAsnGlyValAspGlyGluTrpThrTyrAspAspAla390395400ACTAAGACCTTTACAGTTACTGAAAAACCAGAAGTGATCGATGCGTCT1304ThrLysThrPheThrValThrGluLysProGluValIleAspAlaSer405410415GAATTAACACCAGCCGTGACAAGATCCGCTGATAACAATTTCAACAAA1352GluLeuThrProAlaValThrArgSerAlaAspAsnAsnPheAsnLys420425430GAACAACAAAATGCTTTCTATGAAATCTTGAATATGCCTAACTTAAAC1400GluGlnGlnAsnAlaPheTyrGluIleLeuAsnMetProAsnLeuAsn435440445450GAAGAACAACGCAATGGTTTCATCCAAAGCTTAAAAGATGACCCAAGC1448GluGluGlnArgAsnGlyPheIleGlnSerLeuLysAspAspProSer455460465CAAAGTGCTAACCTATTGTCAGAAGCTAAAAAGTTAAATGAATCTCAA1496GlnSerAlaAsnLeuLeuSerGluAlaLysLysLeuAsnGluSerGln470475480GCACCGAAAGATCGATCCGCCTGATCAATGCAACGACACATCATGATCTGC1547AlaProLysAspArgSerAla485490TGCTGCACTTAATTACTATGTTCGTATACAAATAAATACACCCGGCGTACGCGGTGTTCC1607TTATATGGTCTAAAATGTAGCCAGTAAATTTTAAACTACTTTCTCGTGCCGAATTCACTG1667GCCGGCATGCTATATA1683(2) INFORMATION FOR SEQ ID NO:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 489 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys145150155160LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg165170175ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal180185190ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla195200205PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys210215220LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal225230235240LysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySerLysProGlu245250255ValIleAspAlaSerGluLeuThrProAlaValThrThrTyrLysLeu260265270ValIleAsnGlyLysThrLeuLysGlyGluThrThrThrGluAlaVal275280285AspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaAsnAspAsn290295300GlyValAspGlyGluTrpThrTyrAspAspAlaThrLysThrPheThr305310315320ValThrGluLysProGluValIleAspAlaSerGluLeuThrProAla325330335ValThrArgSerLysProGluValIleAspAlaSerGluLeuThrPro340345350AlaValThrThrTyrLysLeuValIleAsnGlyLysThrLeuLysGly355360365GluThrThrThrGluAlaValAspAlaAlaThrAlaGluLysValPhe370375380LysGlnTyrAlaAsnAspAsnGlyValAspGlyGluTrpThrTyrAsp385390395400AspAlaThrLysThrPheThrValThrGluLysProGluValIleAsp405410415AlaSerGluLeuThrProAlaValThrArgSerAlaAspAsnAsnPhe420425430AsnLysGluGlnGlnAsnAlaPheTyrGluIleLeuAsnMetProAsn435440445LeuAsnGluGluGlnArgAsnGlyPheIleGlnSerLeuLysAspAsp450455460ProSerGlnSerAlaAsnLeuLeuSerGluAlaLysLysLeuAsnGlu465470475480SerGlnAlaProLysAspArgSerAla485(2) INFORMATION FOR SEQ ID NO:20:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 847 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..845(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLys1AGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145GCGGCTGACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTG536AlaAlaAspProGlnAlaAspThrLysSerLysLeuValLysLeuVal150155160GTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCCCGCACGGTG584ValMetValCysGluGlyLeuArgPheAsnThrValSerArgThrVal165170175GACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACCGTGACGCAG632AspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrValThrGln180185190GGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCCTTCGAG680GlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAlaPheGlu195200205210TGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGC728TrpAlaAspHisProThrAlaValIleProAspMetGlnLysLeuGly215220225ATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAAT776IleLysAspLysAsnGluAlaAlaArgIleValAlaLeuValLysAsn230235240CAAACTACTGCCGCTGCCGCTACTGCTGGATCCGTTAACGTCGACGAA824GlnThrThrAlaAlaAlaAlaThrAlaGlySerValAsnValAspGlu245250255TTCACTGGCCGGCATGCTATATA847PheThrGlyArgHisAlaIle260265(2) INFORMATION FOR SEQ ID NO:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 265 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys145150155160LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg165170175ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal180185190ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla195200205PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys210215220LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal225230235240LysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySerValAsnVal245250255AspGluPheThrGlyArgHisAlaIle260265(2) INFORMATION FOR SEQ ID NO:22:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1695 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..1532(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLys1AGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145GCGGCTGACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTG536AlaAlaAspProGlnAlaAspThrLysSerLysLeuValLysLeuVal150155160GTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCCCGCACGGTG584ValMetValCysGluGlyLeuArgPheAsnThrValSerArgThrVal165170175GACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACCGTGACGCAG632AspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrValThrGln180185190GGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCCTTCGAG680GlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAlaPheGlu195200205210TGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGC728TrpAlaAspHisProThrAlaValIleProAspMetGlnLysLeuGly215220225ATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAAT776IleLysAspLysAsnGluAlaAlaArgIleValAlaLeuValLysAsn230235240CAAACTACTGCCGCTGCCGCTACTGCTGGATCCGTTAACGTCGACAAA824GlnThrThrAlaAlaAlaAlaThrAlaGlySerValAsnValAspLys245250255CCAGAAGTGATCGATGCGTCTGAATTAACACCAGCCGTGACAACTTAC872ProGluValIleAspAlaSerGluLeuThrProAlaValThrThrTyr260265270AAACTTGTTATTAATGGTAAAACATTGAAAGGCGAAACAACTACTGAA920LysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThrThrGlu275280285290GCTGTTGATGCTGCTACTGCAGAAAAAGTCTTCAAACAATACGCTAAC968AlaValAspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaAsn295300305GACAACGGTGTTGACGGTGAATGGACTTACGACGATGCGACTAAGACC1016AspAsnGlyValAspGlyGluTrpThrTyrAspAspAlaThrLysThr310315320TTTACAGTTACTGAAAAACCAGAAGTGATCGATGCGTCTGAATTAACA1064PheThrValThrGluLysProGluValIleAspAlaSerGluLeuThr325330335CCAGCCGTGACAAGATCCAAACCAGAAGTGATCGATGCGTCTGAATTA1112ProAlaValThrArgSerLysProGluValIleAspAlaSerGluLeu340345350ACACCAGCCGTGACAACTTACAAACTTGTTATTAATGGTAAAACATTG1160ThrProAlaValThrThrTyrLysLeuValIleAsnGlyLysThrLeu355360365370AAAGGCGAAACAACTACTGAAGCTGTTGATGCTGCTACTGCAGAAAAA1208LysGlyGluThrThrThrGluAlaValAspAlaAlaThrAlaGluLys375380385GTCTTCAAACAATACGCTAACGACAACGGTGTTGACGGTGAATGGACT1256ValPheLysGlnTyrAlaAsnAspAsnGlyValAspGlyGluTrpThr390395400TACGACGATGCGACTAAGACCTTTACAGTTACTGAAAAACCAGAAGTG1304TyrAspAspAlaThrLysThrPheThrValThrGluLysProGluVal405410415ATCGATGCGTCTGAATTAACACCAGCCGTGACAAGATCCGCTGATAAC1352IleAspAlaSerGluLeuThrProAlaValThrArgSerAlaAspAsn420425430AATTTCAACAAAGAACAACAAAATGCTTTCTATGAAATCTTGAATATG1400AsnPheAsnLysGluGlnGlnAsnAlaPheTyrGluIleLeuAsnMet435440445450CCTAACTTAAACGAAGAACAACGCAATGGTTTCATCCAAAGCTTAAAA1448ProAsnLeuAsnGluGluGlnArgAsnGlyPheIleGlnSerLeuLys455460465GATGACCCAAGCCAAAGTGCTAACCTATTGTCAGAAGCTAAAAAGTTA1496AspAspProSerGlnSerAlaAsnLeuLeuSerGluAlaLysLysLeu470475480AATGAATCTCAAGCACCGAAAGATCGATCCGCCTGATCAATGCAACGACACAT1549AsnGluSerGlnAlaProLysAspArgSerAla485490CATGATCTGCTGCTGCACTTAATTACTATGTTCGTATACAAATAAATACACCCGGCGTAC1609GCGGTGTTCCTTATATGGTCTAAAATGTAGCCAGTAAATTTTAAACTACTTTCTCGTGCC1669GAATTCACTGGCCGGCATGCTATATA1695(2) INFORMATION FOR SEQ ID NO:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 493 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys145150155160LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg165170175ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal180185190ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla195200205PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys210215220LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal225230235240LysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySerValAsnVal245250255AspLysProGluValIleAspAlaSerGluLeuThrProAlaValThr260265270ThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThr275280285ThrGluAlaValAspAlaAlaThrAlaGluLysValPheLysGlnTyr290295300AlaAsnAspAsnGlyValAspGlyGluTrpThrTyrAspAspAlaThr305310315320LysThrPheThrValThrGluLysProGluValIleAspAlaSerGlu325330335LeuThrProAlaValThrArgSerLysProGluValIleAspAlaSer340345350GluLeuThrProAlaValThrThrTyrLysLeuValIleAsnGlyLys355360365ThrLeuLysGlyGluThrThrThrGluAlaValAspAlaAlaThrAla370375380GluLysValPheLysGlnTyrAlaAsnAspAsnGlyValAspGlyGlu385390395400TrpThrTyrAspAspAlaThrLysThrPheThrValThrGluLysPro405410415GluValIleAspAlaSerGluLeuThrProAlaValThrArgSerAla420425430AspAsnAsnPheAsnLysGluGlnGlnAsnAlaPheTyrGluIleLeu435440445AsnMetProAsnLeuAsnGluGluGlnArgAsnGlyPheIleGlnSer450455460LeuLysAspAspProSerGlnSerAlaAsnLeuLeuSerGluAlaLys465470475480LysLeuAsnGluSerGlnAlaProLysAspArgSerAla485490(2) INFORMATION FOR SEQ ID NO:24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1722 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 51..1559(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:TCCCTCTAGATGCGGCCTAATTAATTAAGCTTAAAAGGAGGAAAAAAATTATGAAA56MetLys1AGAATAGTGCCAAAGTTCACTGAAATCTTCCCCGTGGAGGACGCGAAC104ArgIleValProLysPheThrGluIlePheProValGluAspAlaAsn51015TACCCTTACAGCGCCTTCATCGCGTCGGTCCGGAAAGACGTGATCAAA152TyrProTyrSerAlaPheIleAlaSerValArgLysAspValIleLys202530CACTGCACCGACCATAAAGGGATCTTCCAGCCCGTGCTGCCACCGGAG200HisCysThrAspHisLysGlyIlePheGlnProValLeuProProGlu35404550AAGAAGGTCCCGGAGCTATGGTTCTACACAGAGCTCAAAACTAGGACC248LysLysValProGluLeuTrpPheTyrThrGluLeuLysThrArgThr556065AGCTCCATCACGCTCGCCATACGCATGGACAACCTGTACCTCGTGGGC296SerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeuValGly707580TTCAGGACCCCGGGCGGGGTGTGGTGGGAGTTCGGCAAGGACGGCGAC344PheArgThrProGlyGlyValTrpTrpGluPheGlyLysAspGlyAsp859095ACCCACCTCCTCGGCGACAACCCCAGGTGGCTCGGCTTCGGCGGCAGG392ThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGlyGlyArg100105110TACCAGGACCTCATCGGCAACAAGGGTCTGGAGACCGTCACCATGGGC440TyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThrMetGly115120125130CGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAGAAG488ArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLysLysLys135140145GCGGCTGACCCACAGGCCGACACGAAGAGCAAGCTGGTGAAGCTGGTG536AlaAlaAspProGlnAlaAspThrLysSerLysLeuValLysLeuVal150155160GTCATGGTGTGCGAGGGGCTGCGGTTCAACACCGTGTCCCGCACGGTG584ValMetValCysGluGlyLeuArgPheAsnThrValSerArgThrVal165170175GACGCGGGGTTCAACAGCCAGCACGGGGTGACCTTGACCGTGACGCAG632AspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrValThrGln180185190GGGAAGCAGGTGCAGAAGTGGGACAGGATCTCCAAGGCGGCCTTCGAG680GlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAlaPheGlu195200205210TGGGCTGACCACCCCACCGCTGTGATCCCCGACATGCAGAAGCTTGGC728TrpAlaAspHisProThrAlaValIleProAspMetGlnLysLeuGly215220225ATCAAGGATAAGAACGAAGCAGCGAGGATCGTTGCGCTCGTTAAGAAT776IleLysAspLysAsnGluAlaAlaArgIleValAlaLeuValLysAsn230235240CAAACTACTGCCGCTGCCGCTACTGCTGGATCCTCTTGCGCTCGTGTC824GlnThrThrAlaAlaAlaAlaThrAlaGlySerSerCysAlaArgVal245250255CGTCGTTCGAGCTGCGGTGTCGACAAACCAGAAGTGATCGATGCGTCT872ArgArgSerSerCysGlyValAspLysProGluValIleAspAlaSer260265270GAATTAACACCAGCCGTGACAACTTACAAACTTGTTATTAATGGTAAA920GluLeuThrProAlaValThrThrTyrLysLeuValIleAsnGlyLys275280285290ACATTGAAAGGCGAAACAACTACTGAAGCTGTTGATGCTGCTACTGCA968ThrLeuLysGlyGluThrThrThrGluAlaValAspAlaAlaThrAla295300305GAAAAAGTCTTCAAACAATACGCTAACGACAACGGTGTTGACGGTGAA1016GluLysValPheLysGlnTyrAlaAsnAspAsnGlyValAspGlyGlu310315320TGGACTTACGACGATGCGACTAAGACCTTTACAGTTACTGAAAAACCA1064TrpThrTyrAspAspAlaThrLysThrPheThrValThrGluLysPro325330335GAAGTGATCGATGCGTCTGAATTAACACCAGCCGTGACAAGATCCAAA1112GluValIleAspAlaSerGluLeuThrProAlaValThrArgSerLys340345350CCAGAAGTGATCGATGCGTCTGAATTAACACCAGCCGTGACAACTTAC1160ProGluValIleAspAlaSerGluLeuThrProAlaValThrThrTyr355360365370AAACTTGTTATTAATGGTAAAACATTGAAAGGCGAAACAACTACTGAA1208LysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThrThrGlu375380385GCTGTTGATGCTGCTACTGCAGAAAAAGTCTTCAAACAATACGCTAAC1256AlaValAspAlaAlaThrAlaGluLysValPheLysGlnTyrAlaAsn390395400GACAACGGTGTTGACGGTGAATGGACTTACGACGATGCGACTAAGACC1304AspAsnGlyValAspGlyGluTrpThrTyrAspAspAlaThrLysThr405410415TTTACAGTTACTGAAAAACCAGAAGTGATCGATGCGTCTGAATTAACA1352PheThrValThrGluLysProGluValIleAspAlaSerGluLeuThr420425430CCAGCCGTGACAAGATCCGCTGATAACAATTTCAACAAAGAACAACAA1400ProAlaValThrArgSerAlaAspAsnAsnPheAsnLysGluGlnGln435440445450AATGCTTTCTATGAAATCTTGAATATGCCTAACTTAAACGAAGAACAA1448AsnAlaPheTyrGluIleLeuAsnMetProAsnLeuAsnGluGluGln455460465CGCAATGGTTTCATCCAAAGCTTAAAAGATGACCCAAGCCAAAGTGCT1496ArgAsnGlyPheIleGlnSerLeuLysAspAspProSerGlnSerAla470475480AACCTATTGTCAGAAGCTAAAAAGTTAAATGAATCTCAAGCACCGAAA1544AsnLeuLeuSerGluAlaLysLysLeuAsnGluSerGlnAlaProLys485490495GATCGATCCGCCTGATCAATGCAACGACACATCATGATCTGCTGCTGCACTT1596AspArgSerAla500AATTACTATGTTCGTATACAAATAAATACACCCGGCGTACGCGGTGTTCCTTATATGGTC1656TAAAATGTAGCCAGTAAATTTTAAACTACTTTCTCGTGCCGAATTCACTGGCCGGCATGC1716TATATA1722(2) INFORMATION FOR SEQ ID NO:25:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 502 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:MetLysArgIleValProLysPheThrGluIlePheProValGluAsp151015AlaAsnTyrProTyrSerAlaPheIleAlaSerValArgLysAspVal202530IleLysHisCysThrAspHisLysGlyIlePheGlnProValLeuPro354045ProGluLysLysValProGluLeuTrpPheTyrThrGluLeuLysThr505560ArgThrSerSerIleThrLeuAlaIleArgMetAspAsnLeuTyrLeu65707580ValGlyPheArgThrProGlyGlyValTrpTrpGluPheGlyLysAsp859095GlyAspThrHisLeuLeuGlyAspAsnProArgTrpLeuGlyPheGly100105110GlyArgTyrGlnAspLeuIleGlyAsnLysGlyLeuGluThrValThr115120125MetGlyArgAlaGluMetThrArgAlaValAsnAspLeuAlaLysLys130135140LysLysAlaAlaAspProGlnAlaAspThrLysSerLysLeuValLys145150155160LeuValValMetValCysGluGlyLeuArgPheAsnThrValSerArg165170175ThrValAspAlaGlyPheAsnSerGlnHisGlyValThrLeuThrVal180185190ThrGlnGlyLysGlnValGlnLysTrpAspArgIleSerLysAlaAla195200205PheGluTrpAlaAspHisProThrAlaValIleProAspMetGlnLys210215220LeuGlyIleLysAspLysAsnGluAlaAlaArgIleValAlaLeuVal225230235240LysAsnGlnThrThrAlaAlaAlaAlaThrAlaGlySerSerCysAla245250255ArgValArgArgSerSerCysGlyValAspLysProGluValIleAsp260265270AlaSerGluLeuThrProAlaValThrThrTyrLysLeuValIleAsn275280285GlyLysThrLeuLysGlyGluThrThrThrGluAlaValAspAlaAla290295300ThrAlaGluLysValPheLysGlnTyrAlaAsnAspAsnGlyValAsp305310315320GlyGluTrpThrTyrAspAspAlaThrLysThrPheThrValThrGlu325330335LysProGluValIleAspAlaSerGluLeuThrProAlaValThrArg340345350SerLysProGluValIleAspAlaSerGluLeuThrProAlaValThr355360365ThrTyrLysLeuValIleAsnGlyLysThrLeuLysGlyGluThrThr370375380ThrGluAlaValAspAlaAlaThrAlaGluLysValPheLysGlnTyr385390395400AlaAsnAspAsnGlyValAspGlyGluTrpThrTyrAspAspAlaThr405410415LysThrPheThrValThrGluLysProGluValIleAspAlaSerGlu420425430LeuThrProAlaValThrArgSerAlaAspAsnAsnPheAsnLysGlu435440445GlnGlnAsnAlaPheTyrGluIleLeuAsnMetProAsnLeuAsnGlu450455460GluGlnArgAsnGlyPheIleGlnSerLeuLysAspAspProSerGln465470475480SerAlaAsnLeuLeuSerGluAlaLysLysLeuAsnGluSerGlnAla485490495ProLysAspArgSerAla500(2) INFORMATION FOR SEQ ID NO:26:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 280 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:AlaAlaLysMetAlaLysAsnValAspLysProLeuPheThrAlaThr151015PheAsnValGlnAlaSerSerAlaAspTyrAlaThrPheIleAlaGly202530IleArgAsnLysLeuArgAsnProAlaHisPheSerHisAsnGluPro354045ValLeuProProValGluProAsnValProProSerArgTrpPheHis505560ValValLeuLysAlaSerProThrSerAlaGlyLeuThrLeuAlaIle65707580ArgAlaAspAsnIleTyrLeuGluGlyPheLysSerSerAspGlyThr859095TrpTrpGluLeuThrProGlyLeuIleProGlyAlaThrTyrValGly100105110PheGlyGlyThrTyrArgAspLeuLeuGlyAspThrAspLysLeuThr115120125AsnValAlaLeuGlyArgGlnGlnLeuGluAspAlaValThrAlaLeu130135140HisGlyArgThrLysAlaAspLysAlaSerGlyProLysGlnGlnGln145150155160AlaArgGluAlaValThrThrLeuLeuLeuMetValAsnGluAlaThr165170175ArgPheGlnThrValSerGlyPheValAlaGlyLeuLeuHisProLys180185190AlaValGluLysLysSerGlyLysIleGlyAsnGluMetLysAlaGln195200205ValAsnGlyTrpGlnAspLeuSerAlaAlaLeuLeuLysThrAspVal210215220LysProProProGlyLysSerProAlaLysPheThrProIleGluLys225230235240MetGlyValArgThrAlaGluGlnAlaAlaAlaThrLeuGlyIleLeu245250255LeuPheValGluValProGlyGlyLeuThrValAlaLysAlaLeuGlu260265270LeuPheHisAlaSerGlyGlyLys275280(2) INFORMATION FOR SEQ ID NO:27:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 290 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:MetTyrAlaValAlaThrTrpLeuCysPheGlySerThrSerGlyTrp151015SerPheThrLeuGluAspAsnAsnIlePheProLysGlnTyrProIle202530IleAsnPheThrThrAlaGlyAlaThrValGlnSerTyrThrAsnPhe354045IleArgAlaValArgGlyArgLeuThrThrGlyAlaAspValArgHis505560GluIleProValLeuProAsnArgValGlyLeuProIleAsnGlnArg65707580PheIleLeuValGluLeuSerAsnHisAlaGluLeuSerValThrLeu859095AlaLeuAspValThrAsnAlaTyrValValGlyTyrArgAlaGlyAsn100105110SerAlaTyrPhePheHisProAspAsnGlnGluAspAlaGluAlaIle115120125ThrHisLeuPheThrAspValGlnAsnArgTyrThrPheAlaPheGly130135140GlyAsnTyrAspArgLeuGluGlnLeuAlaGlyAsnLeuArgGluAsn145150155160IleGluLeuGlyAsnGlyProLeuGluGluAlaIleSerAlaLeuTyr165170175TyrTyrSerThrGlyGlyThrGlnLeuProThrLeuAlaArgSerPhe180185190IleIleCysIleGlnMetIleSerGluAlaAlaArgPheGlnTyrIle195200205GluGlyGluMetArgThrArgIleArgTyrAsnArgArgSerAlaPro210215220AspProSerValIleThrLeuGluAsnSerTrpGlyArgLeuSerThr225230235240AlaIleGlnGluSerAsnGlnGlyAlaPheAlaSerProIleGlnLeu245250255GlnArgArgAsnGlySerLysPheSerValTyrAspValSerIleLeu260265270IleProIleIleAlaLeuMetValTyrArgCysAlaProProProSer275280285GlnPhe290(2) INFORMATION FOR SEQ ID NO:28:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 29 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:ValAsnThrIleIleTyrAsnValGlySerThrThrIleSerAsnTyr151015AlaThrPheMetAspAsnLeuArgAsnGluAlaLysAsp2025(2) INFORMATION FOR SEQ ID NO:29:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:AsnIleValPheAspTyrGluAsnAlaThrProGluThrTyrSerAsn151015PheLeuThrSerLeuArgGluAlaValLysAsp2025(2) INFORMATION FOR SEQ ID NO:30:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 25 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:LysGluPheThrLeuAspPheSerThrAlaLysThrTyrAspSerLeu151015AsnValIleArgSerAlaIleGlyThr2025(2) INFORMATION FOR SEQ ID NO:31:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:AspValSerPheArgLeuSerGlyAlaThrSerSerSerTyrGlyVal151015PheIleSerAsnLeuArgLysAlaLeuProAsn2025(2) INFORMATION FOR SEQ ID NO:32:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:AspValSerPheArgLeuSerGlyAlaAspProArgSerTyrGlyMet151015PheIleLysAspLeuArgAsnAlaLeuProPhe2025(2) INFORMATION FOR SEQ ID NO:33:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:AspValSerPheArgLeuSerGlyAlaThrThrThrSerTyrGlyVal151015PheIleLysAsnLeuArgGluAlaLeuProTyr2025(2) INFORMATION FOR SEQ ID NO:34:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:GlyLeuAspThrValSerPheSerThrLysGlyAlaThrTyrIleThr151015TyrValAsnPheLeuAsnGluLeuArgValLysLeuLysPro202530(2) INFORMATION FOR SEQ ID NO:35:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 29 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:ValThrSerIleThrLeuAspLeuValAsnProThrAlaGlyGlnTyr151015SerSerPheValAspLysIleArgAsnAsnValLysAsp2025(2) INFORMATION FOR SEQ ID NO:36:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 29 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:ValIleIleTyrGluLeuAsnLeuGlnGlyThrThrLysAlaGlnTyr151015SerThrIleLeuLysGlnLeuArgAspAspIleLysAsp2025(2) INFORMATION FOR SEQ ID NO:37:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:ValSerLeuGlyLeuLysArgAspAsnLeuTyrValValAlaTyr151015(2) INFORMATION FOR SEQ ID NO:38:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:AlaIleGlnMetThrAlaGluAlaAlaArgPheArgTyrIleGln151015(2) INFORMATION FOR SEQ ID NO:39:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 93 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:ACCGTCACCATGGGCCGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAG60AAGGCGGCTGACCCACAGGCCGACACGAAGAGC93(2) INFORMATION FOR SEQ ID NO:40:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 30 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:CGGATCCAGCAGTAGCGGCAGCGGCAGTAG30(2) INFORMATION FOR SEQ ID NO:41:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 99 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:ACCGTCACCATGGGCCGCGCCGAAATGACCAGGGCCGTCAACGACCTGGCGAAGAAGAAG60AAGGCGGCCGCCGCTGCAGACCCACAGGCCGACACGAAG99(2) INFORMATION FOR SEQ ID NO:42:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:CATGCCGGCCAGTGAATTCGG21(2) INFORMATION FOR SEQ ID NO:43:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:GATCCGTTAACGTCGACG18(2) INFORMATION FOR SEQ ID NO:44:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 33 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:ATATTAGTCGACAAACCAGAAGTGATCGATGCG33(2) INFORMATION FOR SEQ ID NO:45:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:GCAATTGCAGCTGCTTAA18(2) INFORMATION FOR SEQ ID NO:46:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 10 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:GluValAsnTrpLysLysIleSerThrAla1510(2) INFORMATION FOR SEQ ID NO:47:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:IleGluValGlyIleAspValThrAsnAlaTyrValValAlaTyr151015(2) INFORMATION FOR SEQ ID NO:48:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:IleIleGlnValAlaSerGluAlaAlaArgPheArgTyrIleSer151015(2) INFORMATION FOR SEQ ID NO:49:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:LeuGluAsnAsnTrpAspAsnLeuArgGlyVal1510(2) INFORMATION FOR SEQ ID NO:50:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:MetIleAspSerGlySerGlyAspAsnLeuPheAlaValAspVal151015(2) INFORMATION FOR SEQ ID NO:51:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:PheValThrValThrAlaGluAlaLeuArgPheGlnIleGlnArg151015(2) INFORMATION FOR SEQ ID NO:52:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 10 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:ThrLeuAsnTrpGlyArgLeuSerSerVal1510(2) INFORMATION FOR SEQ ID NO:53:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 10 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:AspGluValAlaLeuAspValThrAsnVal1510(2) INFORMATION FOR SEQ ID NO:54:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 5 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:TyrLeuMetGlyTyr15(2) INFORMATION FOR SEQ ID NO:55:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:LeuIleGlnSerThrSerGluAlaAlaArgTyrLysPheIleGlu151015(2) INFORMATION FOR SEQ ID NO:56:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 12 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:LeuGluAsnSerLeuTrpLeuAlaLeuSerLysGln1510(2) INFORMATION FOR SEQ ID NO:57:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 39 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:GATCCTCTTGCGCTCGTGTCCGTCGTTCGAGCTGCGGTG39(2) INFORMATION FOR SEQ ID NO:58:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 40 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:GAGAACGCGAGCACAGGCAGCAAGCTCGACGCCACAGCTG40(2) INFORMATION FOR SEQ ID NO:59:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 15 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:GlySerSerCysAlaArgValArgArgSerSerCysGlyValAsp151015(2) INFORMATION FOR SEQ ID NO:60:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:TyrTyrSerThrCysGlyThrGlnIleProThr1510(2) INFORMATION FOR SEQ ID NO:61:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:IleSerPhePheArgSerGlyGlyAsnAspAsn1510(2) INFORMATION FOR SEQ ID NO:62:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:IlePheHisTyrAspSerThrAlaAlaAlaAla1510(2) INFORMATION FOR SEQ ID NO:63:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:IlePheHisTyrAspSerThrAlaAlaAlaAla1510(2) INFORMATION FOR SEQ ID NO:64:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:LeuLeuHisTyrAspSerThrAlaAlaAlaGly1510(2) INFORMATION FOR SEQ ID NO:65:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:ThrLeuPheTyrTyrAsnAlaAsnSerAlaAla1510(2) INFORMATION FOR SEQ ID NO:66:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:IleSerGlyGlnGlySerPheThrGluLysIle1510(2) INFORMATION FOR SEQ ID NO:67:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:IleTyrGlyLysAlaGlyAspValLysLysGln1510(2) INFORMATION FOR SEQ ID NO:68:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:ValAsnLysLysAlaArgValValLysAspGlu1510(2) INFORMATION FOR SEQ ID NO:69:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:69:ThrLysAlaAspLysAlaSerGlyProLysGln1510(2) INFORMATION FOR SEQ ID NO:70:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:70:AspGlyValAsnLysLysValArgValValLys1510(2) INFORMATION FOR SEQ ID NO:71:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 250 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:71:GluAspArgProIleLysPheSerThrGluGlyAlaThrSerGlnSer151015TyrLysGlnPheIleGluAlaLeuArgGluArgLeuArgGlyGlyLeu202530IleHisAspIleProValLeuProAspProThrThrLeuGlnGluArg354045AsnArgTyrIleThrValGluLeuSerAsnSerAspThrGluSerIle505560GluValGlyIleAspValThrAsnAlaTyrValValAlaTyrArgAla65707580GlyThrGlnSerTyrPheLeuArgAspAlaProSerSerAlaSerAsp859095TyrLeuPheThrGlyThrAspGlnHisSerLeuProPheTyrGlyThr100105110TyrGlyAspLeuGluArgTrpAlaHisGlnSerArgGlnGlnIlePro115120125LeuGlyLeuGlnAlaLeuThrHisGlyIleSerPhePheArgSerGly130135140GlyAsnAspAsnGluGluLysAlaArgThrLeuIleValIleIleGln145150155160MetValAlaGluAlaAlaArgPheArgTyrIleSerAsnArgValArg165170175ValSerIleGlnThrGlyThrAlaPheGlnProAspAlaAlaMetIle180185190SerLeuGluAsnAsnTrpAspAsnLeuArgGlyValGlnGluSerVal195200205GlnAspThrPheProAsnGlnValThrLeuThrAsnIleArgAsnGlu210215220ProValIleValAspSerLeuSerHisProThrValAlaValLeuAla225230235240LeuMetLeuPheValCysAsnProProAsn245250(2) INFORMATION FOR SEQ ID NO:72:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 260 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:72:ValThrSerIleThrLeuAspLeuValAsnProThrAlaGlyGlnTyr151015SerSerPheValAspLysIleArgAsnAsnValLysAspProAsnLeu202530LysTyrGlyGlyThrAspIleAlaValIleGlyProProSerLysGlu354045LysPheLeuArgIleAsnPheGlnSerSerArgGlyThrValSerLeu505560GlyLeuLysArgAspAsnLeuTyrValValAlaTyrLeuAlaMetAsp65707580AsnThrAsnValAsnArgAlaTyrTyrPheArgSerGluIleThrSer859095AlaGluSerThrAlaLeuPheProGluAlaThrThrAlaAsnGlnLys100105110AlaLeuGluTyrThrGluAspTyrGlnSerIleGluLysAsnAlaGln115120125IleThrGlnGlyAspGlnSerArgLysGluLeuGlyLeuGlyIleAsp130135140LeuLeuSerThrSerMetGluAlaValAsnLysLysAlaArgValVal145150155160LysAspGluAlaArgPheLeuLeuIleAlaIleGlnMetThrAlaGlu165170175AlaAlaArgPheArgTyrIleGlnAsnLeuValIleLysAsnPhePro180185190AsnLysPheAsnSerGluAsnLysValIleGlnPheGluValAsnTrp195200205LysLysIleSerThrAlaIleTyrGlyAspAlaLysAsnGlyValPhe210215220AsnLysAspTyrAspPheGlyPheGlyLysValArgGlnValLysAsp225230235240LeuGlnMetGlyLeuLeuMetTyrLeuGlyLysProLysSerSerAsn245250255GluAlaAsnSer260(2) INFORMATION FOR SEQ ID NO:73:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 315 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:73:MetLysIleIleIlePheArgValLeuThrPhePhePheValIlePhe151015SerValAsnValValAlaLysGluPheThrLeuAspPheSerThrAla202530LysThrTyrValAspSerLeuAsnValIleArgSerAlaIleGlyThr354045ProLeuGlnThrIleSerSerGlyGlyThrSerLeuLeuMetIleAsp505560SerGlySerGlyAspAsnLeuPheAlaValAspValArgGlyIleAsp65707580ProGluGluGlyArgPheAsnAsnLeuArgLeuIleValGluArgAsn859095AsnLeuTyrValThrGlyPheValAsnArgThrAsnAsnValPheTyr100105110ArgPheAlaAspPheSerHisValThrPheProGlyThrThrAlaVal115120125ThrLeuSerGlyAspSerSerTyrThrThrLeuGlnArgValAlaGly130135140IleSerArgThrGlyMetGlnIleAsnArgHisSerLeuThrThrSer145150155160TyrLeuAspLeuMetSerHisSerGlyThrSerLeuThrGlnSerVal165170175AlaArgAlaMetLeuArgPheValThrValThrAlaGluAlaLeuArg180185190PheArgGlnIleGlnArgGlyPheArgThrThrLeuAspAspLeuSer195200205GlyArgSerTyrValMetThrAlaGluAspValAspLeuThrLeuAsn210215220TrpGlyArgLeuSerSerValLeuProAspTyrHisGlyGlnAspSer225230235240ValArgValGlyArgIleSerPheGlySerIleAsnAlaIleLeuGly245250255SerValAlaLeuIleLeuAsnCysHisHisHisAlaSerArgValAla260265270ArgMetAlaSerAspGluPheProSerMetCysProAlaAspGlyArg275280285ValArgGlyIleThrHisAsnLysIleLeuTrpAspSerSerThrLeu290295300GlyAlaIleLeuMetArgArgThrIleSerSer305310315(2) INFORMATION FOR SEQ ID NO:74:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 267 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:74:GlyAspValSerPheArgLeuSerGlyAlaThrSerSerSerTyrGly151015ValPheIleSerAsnLeuArgLysAlaLeuProAsnGluArgLysLeu202530TyrAspIleProLeuLeuArgSerSerLeuProGlySerGlnArgTyr354045AlaLeuIleHisLeuThrAsnTyrAlaAspGluThrIleSerValAla505560IleAspValThrAsnValTyrIleMetGlyTyrArgAlaGlyAspThr65707580SerTyrPhePheAsnGluAlaSerAlaThrGluAlaAlaLysTyrVal859095PheLysAspAlaMetArgLysValThrLeuProTyrSerGlyAsnTyr100105110GluArgLeuGlnThrAlaAlaGlyLysIleArgGluAsnIleProLeu115120125GlyLeuProAlaLeuAspSerAlaIleThrThrLeuPheTyrTyrAsn130135140AlaAsnSerAlaAlaSerAlaLeuMetValLeuIleGlnSerThrSer145150155160GluAlaAlaArgTyrLysPheIleGluGlnGlnIleGlyLysArgVal165170175AspLysThrPheLeuProSerLeuAlaIleIleSerLeuGluAsnSer180185190TrpSerAlaLeuSerLysGlnIleGlnIleAlaSerThrAsnAsnGly195200205GlnPheGluSerProValValLeuIleAsnAlaGlnAsnGlnArgVal210215220ThrIleThrAsnValAspAlaGlyValValThrSerAsnIleAlaLeu225230235240LeuLeuAsnArgAsnAsnMetAlaAlaMetAspAspAspValProMet245250255ThrGlnSerPheGlyCysGlySerTyrAlaIle260265(2) INFORMATION FOR SEQ ID NO:75:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 248 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:75:AspValArgPheSerLeuSerGlySerSerSerThrSerTyrSerLys151015PheIleGlyAspLeuArgLysAlaLeuProSerAsnGlyThrValTyr202530AsnLeuThrIleLeuLeuSerSerAlaSerGlyAlaSerArgTyrThr354045LeuMetThrLeuSerAsnTyrAspGlyLysAlaIleThrValAlaVal505560AspValSerGlnLeuTyrIleMetGlyTyrLeuValAsnSerThrSer65707580TyrPhePheAsnGluSerAspAlaLysLeuAlaSerGlnTyrValPhe859095LysGlySerThrIleValThrLeuProTyrSerGlyAsnTyrGluLys100105110LeuGlnThrAlaAlaGlyLysIleArgGluLysIleProLeuGlyPhe115120125ProAlaLeuAspSerAlaLeuThrThrIlePheHisTyrAspSerThr130135140AlaAlaAlaAlaAlaPheLeuValIleLeuGlnThrThrAlaGluAla145150155160SerArgPheLysTyrIleGluGlyGlnIleIleGluArgIleSerLys165170175AsnGlnValProSerLeuAlaThrIleSerLeuGluAsnSerLeuTrp180185190SerAlaLeuSerLysGlnIleGlnLeuAlaGlnThrAsnAsnGlyThr195200205PheLysThrProValValIleThrAspAspLysGlyGlnArgValGlu210215220IleThrAsnValThrSerLysValValThrLysAsnIleGlnLeuLeu225230235240LeuAsnTyrLysGlnAsnValAla245(2) INFORMATION FOR SEQ ID NO:76:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 250 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:AlaProThrLeuGluThrLeuAlaSerLeuAspLeuAsnAsnProThr151015ThrTyrLeuSerPheIleThrAsnIleArgThrLysValValAspLys202530ThrGluGlnCysThrIleGlnLysIleSerLysThrPheThrGlnArg354045TyrSerTyrIleAspLeuIleValSerSerThrGlnLysIleThrLeu505560AlaIleAspMetAlaAspLeuTyrValLeuGlyTyrSerAspIleAla65707580AsnAsnLysGlyArgAlaPhePhePheLysAspValThrGluAlaVal859095AlaAsnAsnPhePheProGlyAlaThrGlyThrAsnArgIleLysLeu100105110ThrPheThrGlySerTyrGlyAspLeuGluLysAsnGlyGlyLeuArg115120125LysAspAsnProLeuGlyIlePheArgLeuGluAsnSerIleValAsn130135140IleTyrGlyLysAlaGlyAspValLysLysGlnAlaLysPhePheLeu145150155160LeuAlaIleGlnMetValSerGluAlaAlaArgPheLysTyrIleSer165170175AspLysIleProSerGluLysTyrGluGluValThrValGlyGluTyr180185190MetThrAlaLeuGluAsnAsnTrpAlaLysLeuSerThrAlaValTyr195200205AsnSerLysProSerThrThrThrAlaThrLysCysGlnLeuAlaThr210215220SerProValThrIleSerProTrpIlePheLysThrValGluGluIle225230235240LysLeuValMetGlyLeuLeuLysSerSer245250(2) INFORMATION FOR SEQ ID NO:77:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 540 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:77:IlePheProLysGlnTyrProIleIleAsnPheThrThrAlaAspAla151015ThrValGluSerTyrThrAsnPheIleArgAlaValArgSerHisLeu202530ThrThrGlyAlaAspValArgHisGluIleProValLeuProAsnArg354045ValGlyLeuProIleSerGlnArgPheIleLeuValGluLeuSerAsn505560HisAlaGluLeuSerValThrLeuAlaLeuAspValThrAsnAlaTyr65707580ValValGlyCysArgAlaGlyAsnSerAlaTyrPhePheHisProAsp859095AsnGlnGluAspAlaGluAlaIleThrHisLeuPheThrAspValGln100105110AsnSerPheThrPheAlaPheGlyGlyAsnTyrAspArgLeuGluGln115120125LeuGlyGlyLeuArgGluAsnIleGluLeuGlyThrGlyProLeuGlu130135140AspAlaIleSerAlaLeuTyrTyrTyrSerThrCysGlyThrGlnIle145150155160ProThrLeuAlaArgSerPheMetValCysIleGlnMetIleSerGlu165170175AlaAlaArgPheGlnTyrIleGluGlyGluMetArgThrArgIleArg180185190TyrAsnArgArgSerAlaProAspProSerValIleThrLeuGluAsn195200205SerTrpGlyArgLeuSerThrAlaIleGlnGluSerAsnGlnGlyAla210215220PheAlaSerProIleGlnLeuGlnArgArgAsnGlySerLysPheAsn225230235240ValTyrAspValSerIleLeuIleProIleIleAlaLeuMetValTyr245250255ArgCysAlaProProProSerSerGlnPheSerLeuLeuIleArgPro260265270ValValProAsnPheAsnAlaAspValCysMetAspProGluProIle275280285ValArgIleValGlyArgAsnGlyLeuCysValAspValThrGlyGlu290295300GluPhePheAspGlyAsnProIleGlnLeuTrpProCysLysSerAsn305310315320ThrAspTrpAsnGlnLeuTrpThrLeuArgLysAspSerThrIleArg325330335SerAsnGlyLysCysLeuThrIleSerLysSerSerProArgGlnGln340345350ValValIleTyrAsnCysSerThrAlaThrValGlyAlaThrArgTrp355360365GlnIleTrpAspAsnArgThrIleIleAsnProArgSerGlyLeuVal370375380LeuAlaAlaThrSerGlyAsnSerGlyThrLysLeuThrValGlnThr385390395400AsnIleTyrAlaValSerGlnGlyTrpLeuProThrAsnAsnThrGln405410415ProPheValThrThrIleValGlyLeuTyrGlyMetCysLeuGlnAla420425430AsnSerGlyLysValTrpLeuGluAspCysThrSerGluLysAlaGlu435440445GlnGlnTrpAlaLeuTyrAlaAspGlySerIleArgProGlnGlnAsn450455460ArgAspAsnCysLeuThrThrAspAlaAsnIleLysGlyThrValVal465470475480LysIleLeuSerCysGlyProAlaSerSerGlyGlnArgTrpMetPhe485490495LysAsnAspGlyThrIleLeuAsnLeuTyrAsnGlyLeuValLeuAsp500505510ValArgArgSerAspProSerLeuLysGlnIleIleValHisProPhe515520525HisGlyAsnLeuAsnGlnIleTrpLeuProLeuPhe530535540(2) INFORMATION FOR SEQ ID NO:78:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 250 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:78:AspValSerPheArgLeuSerGlyAlaAspProArgSerTyrGlyMet151015PheIleLysAspLeuArgAsnAlaLeuProPheArgGluLysValTyr202530AsnIleProLeuLeuLeuProSerValSerGlyAlaGlyArgTyrLeu354045LeuMetHisLeuPheAsnTyrAspGlyLysThrIleThrValAlaVal505560AspValThrAsnValTyrIleMetGlyTyrLeuAlaAspThrThrSer65707580TyrPhePheAsnGlnProAlaAlaGluLeuAlaSerGlnTyrValPhe859095ArgAspAlaArgLysIleThrLeuProTyrSerGlyAsnTyrGluArg100105110LeuGlnIleAlaAlaGlyLysProArgGluLysLeuProIleGlyLeu115120125ProAlaIleAspSerAlaIleSerThrLeuLeuHisTyrAspSerThr130135140AlaAlaAlaGlyAlaLeuLeuValLeuIleGlnThrThrAlaGluAla145150155160AlaArgPheLysTyrIleGluGlnGlnIleGlnGluArgAlaTyrArg165170175AspGluValProSerIleAlaThrLeuSerLeuGluAsnSerLeuTrp180185190SerGlyLeuSerLysGlnIleGlnLeuAlaGlnGlyAsnAsnGlyIle195200205PheArgThrProIleValLeuValAspAsnLysGlyAsnArgValGln210215220IleThrAsnValThrSerLysValValThrSerAsnIleGlnLeuLeu225230235240LeuValThrArgAsnIleAlaGluGlyAsp245250(2) INFORMATION FOR SEQ ID NO:79:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 261 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:79:IleAsnThrIleThrPheAspAlaGlyAsnAlaThrIleAsnLysTyr151015AlaThrPheMetGluSerLeuArgAsnGluAlaLysAspProSerLeu202530LysCysTyrGlyIleProMetLeuProAsnThrAsnSerThrIleLys354045TyrLeuLeuValLysLeuGlnGlyAlaSerLeuLysThrIleThrLeu505560MetLeuArgArgAsnAsnLeuTyrValMetGlyTyrSerAspProTyr65707580AspAsnLysCysArgTyrHisIlePheAsnAspIleLysGlyThrGlu859095TyrSerAspValGluAsnThrLeuCysProSerSerAsnProArgVal100105110AlaLysProIleAsnTyrAsnGlyLeuTyrProThrLeuGluLysLys115120125AlaGlyValThrSerArgAsnGluValGlnLeuGlyIleGlnIleLeu130135140SerSerAspIleGlyLysIleSerGlyGlnGlySerPheThrGluLys145150155160IleGluAlaLysPheLeuLeuValAlaIleGlnMetValSerGluAla165170175AlaArgPheLysTyrIleGluAsnGlnValLysThrAsnPheAsnArg180185190AspPheSerProAsnAspLysValLeuAspLeuGluGluAsnTrpGly195200205LysIleSerThrAlaIleHisAsnSerLysAsnGlyAlaLeuProLys210215220ProLeuGluLeuLysAsnAlaAspGlyThrLysTrpIleValLeuArg225230235240ValAspGluIleLysProAspValGlyLeuLeuAsnTyrValAsnGly245250255ThrCysGlnAlaThr260(2) INFORMATION FOR SEQ ID NO:80:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 250 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:AlaAsnValSerPheSerLeuSerGlyAlaAspSerLysSerTyrSer151015LysPheIleThrAlaLeuArgLysAlaLeuProSerLysGluLysVal202530SerAsnIleProLeuLeuLeuProSerAlaSerGlyAlaSerArgTyr354045IleLeuMetGlnLeuSerAsnTyrAspAlaLysAlaIleThrMetAla505560IleAspValThrAsnValTyrIleMetGlyTyrLeuValAsnSerThr65707580SerTyrPheAlaAsnGluSerAspAlaLysLeuAlaSerGlnTyrVal859095PheLysGlySerThrLeuValThrIleProTyrSerGlyAsnTyrGlu100105110ArgLeuGlnAsnAlaAlaGlyLysIleArgGluLysIleProLeuGly115120125PheArgAlaLeuAspSerAlaLeuThrSerIlePheHisTyrAspSer130135140ThrAlaAlaAlaAlaAlaPheLeuValIleLeuGlnThrThrAlaGlu145150155160AlaSerArgPheLysTyrIleGluGlyGlnIleIleGluArgIlePro165170175LysAsnGluValProSerProAlaAlaLeuSerLeuGluAsnGluAla180185190TrpSerLeuLeuSerLysGlnIleGlnLeuAlaGlnThrAsnAsnGly195200205AlaPheArgThrProValValIleIleAspAsnLysGlyGlnArgVal210215220GluIleThrAsnLeuAlaSerLysValGlnIleLysAspValAsnSer225230235240LysLeuLeuLeuAsnLysGlnAsnIleAla245250(2) INFORMATION FOR SEQ ID NO:81:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 292 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:81:LysIleTyrLeuValAlaAlaIleAlaTrpIleLeuPheGlnSerSer151015SerTrpThrThrAspAlaAlaThrAlaTyrThrLeuAsnLeuAlaAsn202530ProSerAlaSerGlnTyrSerSerPheLeuAspGlnIleArgAsnAsn354045ValArgAspThrSerLeuIleTyrGlyGlyThrAspValGluValIle505560GlyAlaProSerThrThrAspLysPheLeuArgLeuAsnPheGlnGly65707580ProArgGlyThrValSerLeuGlyLeuArgArgGluAsnLeuTyrVal859095ValAlaTyrLeuAlaMetAspAsnAlaAsnValAsnArgAlaTyrTyr100105110PheLysAsnGlnIleThrSerAlaGluLeuThrAlaLeuPheProGlu115120125ValValValAlaAsnGlnLysGlnLeuGluTyrGlyGluAspTyrGln130135140AlaIleGluLysAsnAlaLysIleThrThrGlyAspGlnSerArgLys145150155160GluLeuGlyLeuGlyIleAsnLeuLeuIleThrMetIleAspGlyVal165170175AsnLysLysValArgValValLysAspGluAlaArgPheLeuLeuIle180185190AlaIleGlnMetThrAlaGluAlaAlaArgPheArgTyrIleGlnAsn195200205LeuValThrLysAsnPheProAsnLysPheAspSerGluAsnLysVal210215220IleGlnPheGlnValSerTrpSerLysIleSerThrAlaIlePheGly225230235240AspCysLysAsnGlyValPheAsnLysAspTyrAspPheGlyPheGly245250255LysValArgGlnAlaLysAspLeuGlnMetGlyLeuLeuLysTyrLeu260265270GlyArgProLysSerSerSerIleGluAlaAsnSerThrAspAspThr275280285AlaAspValLeu290__________________________________________________________________________

Ribosome-inactivating proteins, inactive precursor forms thereof, a process for making and a method of using

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

Divisions (1)

Continuations (1)

Continuation in Parts (1)