The present invention relates to an RNA sequence analyzer, an RNA sequence analysis method, a program, and a recording medium. More specifically, the present invention relates to an RNA sequence analyzer, an RNA sequence analysis method, a program, and a recording medium for predicting RNA secondary structures from RNA sequences, and for predicting gene portions that is transcribed from DNA sequences.
An RNA sequence consists of four type of bases of A (adenine), C (cytosine), G (guanine), and U (uracil). RNA sequences may have inverted repeat sequences in which complementary bases (A and U, G and C, and rarely G and U) are bound together to constitute a secondary structure.
For example, Yasuo Uemura et al.: “Tree adjoining grammars for RNA structure prediction” in Theoretical Computer Science 210, 1999, pp. 277-303 (hereinafter, “Literature 1”) describes an RNA secondary structure prediction method by energy minimalization using the structural modeling based on the tree grammars, and a parsing algorithm.
Elena Rivas and Sean R. Rddy: “The language of RNA: a formal grammar that includes pseudoknots” in BIOINFORMATICS vol. 16 no. 4 2000, pp. 334-340 (hereinafter, “Literature 2”) describes an RNA secondary structure prediction method by energy minimalization using the structural modeling based on CFGs such as Crossed-interaction grammars having original extension, and a parsing algorithm.
Michael Zuker: Prediction of RNA Secondary Structure by Energy minimization, Jul. 8, 1996 (hereinafter, “Literature 3”) discloses an Mfold (product name) that is an RNA sequence analysis system using a RNA secondary structure prediction method by Dynamic Programming without using a formal grammar and a parser. According to these literatures, RNA secondary structure prediction accuracy is enhanced by a combination of the scheme such as the use of the formal grammars or the dynamic programming and the energy minimalization scheme.
In this example, the tree grammar parser does not always derive the parse trees. If the input RNA sequence does not correspond to the grammar (if parsing fails), the parse trees are not input to the tree grammar parser (i.e., the number of parse trees is zero). If the tree grammar parser derives multiple parse trees, one parse tree having a minimal free energy obtained as a result of the energy calculation is selected. The tree grammar parser can find a partial structure having the minimal free energy at each step of a derivation process. The tree grammar parser can also output a parse tree having a optimal energy. Thus, the tree grammar parser can realize acceleration and accuracy enhancement by conducting the energy calculation during the parsing process.
Nevertheless, the conventional RNA secondary structure prediction system using the scheme of performing the parsing with energy calculation by means of the tree grammar parser or the like has the following disadvantages. No systematic and efficient method has been proposed for the conventional RNA secondary structure prediction, for integrated management of RNA sequences and extracted grammars, and making the secondary structure prediction more efficiently using the accumulated grammars and RNA sequences.
No systematic and efficient method for searching for an RNA sequence that possibly has a given secondary structure has been proposed.
No systematic and efficient method for easily extracting a secondary structure common to a plurality of RNA sequences has been proposed.
No systematic and efficient method for calculating a similarity based on RNA secondary structures from given RNA sequences has been proposed.
Further, as a method for gene discovery from DNA sequences, there is generally known a method using homology searches, a motif searches or the like. However, the scheme has a disadvantage in that it cannot be used to discover an unknown gene. As explained in the Background Art part, the formal grammar capable of predicting the structural topology of the RNA sequence is obtained. Disadvantageously, however, any gene discovery method using the parse tree derived by the known formal grammar has not yet been proposed.
As explained, the conventional system or the like has many disadvantages. As a result, the conventional system or the like is inferior in convenience and utilization efficiency for both users and a manager of the system or the like.
It is, therefore, scope of the present invention to provide an RNA sequence analyzer, an RNA sequence analysis method, a program, and a recording medium capable of integrally managing RNA sequences and extracted grammars, and making a secondary structure prediction, executing a new analysis scheme or the like more efficiently using the accumulated grammars and RNA sequences.
An RNA sequence analyzer according to one aspect of the present invention includes: a grammar storage unit that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing unit that derives parse trees by applying an RNA sequence to the grammars; a goodness-of-fit calculation unit that calculates goodnesses of fit of the parse trees derived by the parsing unit; a sorting unit that sorts the parse trees having the goodnesses of fit that satisfy preset conditions in a descending order of the goodnesses of fit; and an output unit that outputs the parse trees sorted by the sorting unit as secondary structure candidates of the RNA sequence.
According to this analyzer, structural topologies of RNA secondary structures with grammars corresponding to the structural topologies are stored, parse trees are derived by applying an RNA sequence to the grammars, goodnesses of fit of the derived parse trees are calculated, the parse trees having the goodnesses of fit that satisfy preset conditions are sorted in a descending order of the goodnesses of fit, and the sorted parse trees are output as secondary structure candidates of the RNA sequence. Thus, one sequence can be parsed based on multiple grammars. That is, the sequence is subjected to parsing and goodness-of-fit calculation for each parse tree derived from each grammar, thereby obtaining the goodness of fit for each structural topology. As a result, the goodnesses of fit are obtained for the respective grammars, and the grammars can be ranked by sorting the goodnesses of fit. Accordingly, the structural topologies for the grammars can be ranked. Therefore, the structural topologies can be ranked in a descending order of possibility for the given RNA sequence.
An RNA sequence analyzer according to another aspect of the present invention includes: a grammar storage unit that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; a parsing unit that derives parse trees by applying RNA sequences to the grammar; a goodness-of-fit calculation unit that calculates goodnesses of fit of the parse trees derived by the parsing unit; and an output unit that outputs the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology.
According to this analyzer, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, parse trees are derived by applying RNA sequences to the grammar, goodnesses of fit of the derived parse trees are calculated, and the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, are output as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology. Therefore, multiple sequences can be parsed based on one grammar. That is, for a given specific structural topology, a corresponding grammar is obtained. Using the grammar, all of or part of the RNA sequences stored in the RNA sequence database are parsed, respectively, and a group of the RNA sequences which can be successfully parsed with goodnesses of fit that satisfy preset conditions are output as a result. It is thereby possible to search for the RNA sequences that may possibly have the given specific structural topology.
An RNA sequence analyzer according to still another aspect of the present invention includes: a grammar storage unit that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing unit that derives parse trees by applying RNA sequences to the grammars; a goodness-of-fit calculation unit that calculates goodnesses of fit of the parse trees derived by the parsing unit; an extraction unit that extracts the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived; and a common structure matrix creation unit that displays the structural topologies and the RNA sequences in a two-dimensional matrix, that gives marks to lattice parts corresponding to the RNA sequences extracted by the extraction unit and the structural topologies in the two-dimensional matrix, and that thereby visualizes the structural topologies common to the RNA sequences.
According to this analyzer, structural topologies of RNA secondary structures with grammars corresponding to the respective structural topologies are stored, parse trees are derived by applying RNA sequences to the grammars, goodnesses of fit of the derived parse trees, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived are extracted, the structural topologies and the RNA sequences are displayed in a two-dimensional matrix, marks are given to lattice parts corresponding to the extracted RNA sequences and the structural topologies in the two-dimensional matrix, and the structural topologies common to the RNA sequences are thereby visualized. Hence, it is possible to easily find the structures common to the RNA sequences.
An RNA sequence analyzer according to still another aspect of the present invention includes: a grammar storage unit that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; an RNA sequence production unit that produces RNA sequences transcribed from a DNA sequence input by a user; a parsing unit that derives parse trees by applying the grammar to the RNA sequences produced by the RNA sequence production unit; a goodness-of-fit calculation unit that calculates goodnesses of fit of the parse trees derived by the parsing unit; and a gene prediction unit that predicts parts of the DNA sequence corresponding to the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, as gene candidates.
According to this analyzer, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, RNA sequences transcribed from a DNA sequence input by a user are produced, parse trees are derived by applying the grammar to the produced RNA sequences, goodnesses of fit of the derived parse trees are calculated, and parts of the DNA sequence corresponding to the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, are predicted as gene candidates. Hence, it is possible to predict that there is a probability that the part of the DNA sequence corresponding to the RNA sequence having a known topology should be a gene.
An RNA sequence analyzer according to still another aspect of the present invention includes: a grammar storage unit that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; a parsing unit that derives parse trees by applying the grammar to RNA sequences; a goodness-of-fit calculation unit that calculates goodnesses of fit of the parse trees derived by the parsing unit; and a similarity calculation unit that calculates a similarity among the RNA sequences based on the goodnesses of fit calculated by the goodness-of-fit calculation unit.
According to this analyzer, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, parse trees are derived by applying the grammar to RNA sequences, goodnesses of fit of the derived parse trees are calculated, a similarity among the RNA sequences is calculated based on the calculated goodnesses of fit. Hence, it is possible to easily obtain the similarity of the RNA sequences based on the underlying RNA structures.
An RNA sequence analyzer according to still another aspect of the present invention includes: a grammar storage unit that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing unit that derives parse trees by applying RNA sequences to the grammars; a goodness-of-fit calculation unit that calculates goodnesses of fit of the parse trees derived by the parsing unit; and an extraction unit that extracts the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived; a goodness-of-fit matrix creation unit that creates a goodness-of-fit matrix which displays the structural topologies and the RNA sequences in a two-dimensional matrix, and which displays the goodnesses of fit on lattice parts corresponding to the RNA sequences extracted by the extraction unit and the structural topologies in the two-dimensional matrix; and a common structure extraction unit that sorts the structural topologies according to the goodnesses of fit for the goodness-of-fit matrix created by the goodness-of-fit matrix creation unit, that parses other RNA sequences based on the grammars corresponding to an order of the sorted structural topologies, and obtains the parse trees having maximum goodnesses of fit, and that extracts the other RNA sequences corresponding to the parse trees having the goodnesses of fit that satisfy the preset conditions.
According to this analyzer, structural topologies of RNA secondary structures with grammars corresponding to the structural topologies are stored, parse trees are derived by applying RNA sequences to the grammars, goodnesses of fit of the derived parse trees are calculated, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived are extracted, a goodness-of-fit matrix which displays the structural topologies and the RNA sequences in a two-dimensional matrix, and which displays the goodnesses of fit on lattice parts corresponding to the extracted RNA sequences and the structural topologies in the two-dimensional matrix, is created, the structural topologies are sorted according to the goodnesses of fit for the goodness-of-fit matrix, other RNA sequences are parsed based on the grammar corresponding to an order of the sorted structural topologies, the parse trees having optimum goodnesses of fit are obtained, and the other RNA sequences corresponding to the parse trees having the goodnesses of fit that satisfy the preset conditions are extracted. Hence, it is possible to easily find the RNA sequences having the common structure.
An RNA sequence analysis method according to one aspect of the present invention includes: a grammar storage step that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing step that derives parse trees by applying an RNA sequence to the grammars; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; a sorting step that sorts the parse trees having the goodnesses of fit that satisfy preset conditions in a descending order of the goodnesses of fit; and an output step that outputs the parse trees sorted by the sorting step as secondary structure candidates of the RNA sequence.
According to this analysis method, structural topologies of RNA secondary structures with grammars corresponding to the structural topologies are stored, parse trees are derived by applying an RNA sequence to the grammars, goodnesses of fit of the derived parse trees are calculated, the parse trees having the goodnesses of fit that satisfy preset conditions are sorted in a descending order of the goodnesses of fit, and the sorted parse trees are output as secondary structure candidates of the RNA sequence. Thus, one sequence can be parsed based on multiple grammars. That is, the sequence is subjected to parsing and goodness-of-fit calculation for each parse tree derived from each grammar, thereby obtaining the goodness of fit for each structural topology. As a result, the goodnesses of fit are obtained for the respective grammars, and the grammars can be ranked by sorting the goodnesses of fit. Accordingly, the structural topologies for the grammars can be ranked. Therefore, the structural topologies can be ranked in a descending order of possibility for the given RNA sequence.
An RNA sequence analysis method according to another aspect of the present invention includes: a grammar storage step that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; a parsing step that derives parse trees by applying RNA sequences to the grammar; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; and an output step that outputs the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology.
According to this analysis method, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, parse trees are derived by applying RNA sequences to the grammar, goodnesses of fit of the derived parse trees are calculated, and the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, are output as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology. Therefore, multiple sequences can be parsed based on one grammar. That is, for a given specific structural topology, a corresponding grammar is obtained. Using the grammar, all of or part of the RNA sequences stored in the RNA sequence database are parsed, respectively, and a group of the RNA sequences which can be successfully parsed with goodnesses of fit that satisfy preset conditions are output as a result. It is thereby possible to search for the RNA sequences that may possibly have the given specific structural topology.
An RNA sequence analysis method according to still another aspect of the present invention includes: a grammar storage step that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing step that derives parse trees by applying RNA sequences to the grammars; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; an extraction step that extracts the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived; and a common structure matrix creation step that displays the structural topologies and the RNA sequences in a two-dimensional matrix, that gives marks to lattice parts corresponding to the RNA sequences extracted by the extraction step and the structural topologies in the two-dimensional matrix, and that thereby visualizes the structural topologies common to the RNA sequences.
According to this analysis method, structural topologies of RNA secondary structures with grammars corresponding to the respective structural topologies are stored, parse trees are derived by applying RNA sequences to the grammars, goodnesses of fit of the derived parse trees, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived are extracted, the structural topologies and the RNA sequences are displayed in a two-dimensional matrix, marks are given to lattice parts corresponding to the extracted RNA sequences and the structural topologies in the two-dimensional matrix, and the structural topologies common to the RNA sequences are thereby visualized. Hence, it is possible to easily find the structures common to the RNA sequences.
An RNA sequence analysis method according to still another aspect of the present invention includes: a grammar storage step that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; an RNA sequence production step that produces RNA sequences transcribed from a DNA sequence input by a user; a parsing step that derives parse trees by applying the grammar to the RNA sequences produced by the RNA sequence production step; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; and a gene prediction step that predicts parts of the DNA sequence corresponding to the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, as gene candidates.
According to this analysis method, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, RNA sequences transcribed from a DNA sequence input by a user are produced, parse trees are derived by applying the grammar to the produced RNA sequences, goodnesses of fit of the derived parse trees are calculated, and parts of the DNA sequence corresponding to the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, are predicted as gene candidates. Hence, it is possible to predict that there is a probability that the part of the DNA sequence corresponding to the RNA sequence having known topology should be a gene part.
An RNA sequence analysis method according to still another aspect of the present invention includes: a grammar storage step that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; a parsing step that derives parse trees by applying the grammar to RNA sequences; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; and a similarity calculation step that calculates a similarity among the RNA sequences based on the goodnesses of fit calculated by the goodness-of-fit calculation step.
According to this analysis method, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, parse trees are derived by applying the grammar to RNA sequences, goodnesses of fit of the derived parse trees are calculated, a similarity among the RNA sequences is calculated based on the calculated goodnesses of fit. Hence, it is possible to easily obtain the similarity of the RNA sequences based on the underlying RNA structures.
An RNA sequence analysis method according to still another aspect of the present invention includes: a grammar storage step that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing step that derives parse trees by applying RNA sequences to the grammars; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; and an extraction step that extracts the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived; a goodness-of-fit matrix creation step that creates a goodness-of-fit matrix which displays the structural topologies and the RNA sequences in a two-dimensional matrix, and which displays the goodnesses of fit on lattice parts corresponding to the RNA sequences extracted by the extraction step and the structural topologies in the two-dimensional matrix; and a common structure extraction step that sorts the structural topologies according to the goodnesses of fit for the goodness-of-fit matrix created by the goodness-of-fit matrix creation step, that parses other RNA sequences based on the grammar corresponding to an order of the sorted structural topologies, and obtains the parse trees having optimum goodnesses of fit, and that extracts the other RNA sequences corresponding to the parse trees having the goodnesses of fit that satisfy the preset conditions.
According to this analysis method, structural topologies of RNA secondary structures with grammars corresponding to the structural topologies are stored, parse trees are derived by applying RNA sequences to the grammars, goodnesses of fit of the derived parse trees are calculated, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived are extracted, a goodness-of-fit matrix which displays the structural topologies and the RNA sequences in a two-dimensional matrix, and which displays the goodnesses of fit on lattice parts corresponding to the extracted RNA sequences and the structural topologies in the two-dimensional matrix, is created, the structural topologies are sorted according to the goodnesses of fit for the goodness-of-fit matrix, other RNA sequences are parsed based on the grammar corresponding to an order of the sorted structural topologies, the parse trees having optimum goodnesses of fit are obtained, and the other RNA sequences corresponding to the parse trees having the goodnesses of fit that satisfy the preset conditions are extracted. Hence, it is possible to easily find the RNA sequences having the common structure.
A computer program that makes a computer to execute an RNA sequence analysis method according to one aspect of the present invention includes: a grammar storage step that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing step that derives parse trees by applying an RNA sequence to the grammars; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; a sorting step that sorts the parse trees having the goodnesses of fit that satisfy preset conditions in a descending order of the goodnesses of fit; and an output step that outputs the parse trees sorted by the sorting step as secondary structure candidates of the RNA sequence.
According to this program, structural topologies of RNA secondary structures with grammars corresponding to the structural topologies are stored, parse trees are derived by applying an RNA sequence to the grammars, goodnesses of fit of the derived parse trees are calculated, the parse trees having the goodnesses of fit that satisfy preset conditions are sorted in a descending order of the goodnesses of fit, and the sorted parse trees are output as secondary structure candidates of the RNA sequence. Thus, one sequence can be parsed based on multiple grammars. That is, the sequence is subjected to parsing and goodness-of-fit calculation for each parse tree derived from each grammar, thereby obtaining the goodness of fit for each structural topology. As a result, the goodnesses of fit are obtained for the respective grammars, and the grammars can be ranked by sorting the goodnesses of fit. Accordingly, the structural topologies for the grammars can be ranked. Therefore, the structural topologies can be ranked in a descending order of possibility for the given RNA sequence.
A computer program that makes a computer to execute an RNA sequence analysis method according to another aspect of the present invention includes: a grammar storage step that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; a parsing step that derives parse trees by applying RNA sequences to the grammar; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; and an output step that outputs the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology.
According to this program, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, parse trees are derived by applying RNA sequences to the grammar, goodnesses of fit of the derived parse trees are calculated, and the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, are output as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology. Therefore, multiple sequences can be parsed based on one grammar. That is, for a given specific structural topology, a corresponding grammar is obtained. Using the grammar, all of or part of the RNA sequences stored in the RNA sequence database are parsed, respectively, and a group of the RNA sequences which can be successfully parsed with goodnesses of fit that satisfy preset conditions are output as a result. It is thereby possible to search for the RNA sequences that may possibly have the given specific structural topology.
A computer program that makes a computer to execute an RNA sequence analysis method according to still another aspect of the present invention includes: a grammar storage step that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing step that derives parse trees by applying RNA sequences to the grammars; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; an extraction step that extracts the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived; and a common structure matrix creation step that displays the structural topologies and the RNA sequences in a two-dimensional matrix, that gives marks to lattice parts corresponding to the RNA sequences extracted by the extraction step and the structural topologies in the two-dimensional matrix, and that thereby visualizes the structural topologies common to the RNA sequences.
According to this program, structural topologies of RNA secondary structures with grammars corresponding to the respective structural topologies are stored, parse trees are derived by applying RNA sequences to the grammars, goodnesses of fit of the derived parse trees, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived are extracted, the structural topologies and the RNA sequences are displayed in a two-dimensional matrix, marks are given to lattice parts corresponding to the extracted RNA sequences and the structural topologies in the two-dimensional matrix, and the structural topologies common to the RNA sequences are thereby visualized. Hence, it is possible to easily find the structures common to the RNA sequences.
A computer program that makes a computer to execute an RNA sequence analysis method according to still another aspect of the present invention includes: a grammar storage step that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; an RNA sequence production step that produces RNA sequences transcribed from a DNA sequence input by a user; a parsing step that derives parse trees by applying the grammar to the RNA sequences produced by the RNA sequence production step; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; and a gene prediction step that predicts parts of the DNA sequence corresponding to the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, as gene candidates.
According to this program, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, RNA sequences transcribed from a DNA sequence input by a user are produced, parse trees are derived by applying the grammar to the produced RNA sequences, goodnesses of fit of the derived parse trees are calculated, and parts of the DNA sequence corresponding to the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, are predicted as gene candidates. Hence, it is possible to predict that there is a probability that the part of the DNA sequence corresponding to the RNA sequence having a known topology should be a gene.
A computer program that makes a computer to execute an RNA sequence analysis method according to still another aspect of the present invention includes: a grammar storage step that stores a structural topology of RNA secondary structures with a grammar corresponding to the structural topology; a parsing step that derives parse trees by applying the grammar to RNA sequences; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; and a similarity calculation step that calculates a similarity among the RNA sequences based on the goodnesses of fit calculated by the goodness-of-fit calculation step.
According to this program, a structural topology of an RNA secondary structures with a grammar corresponding to the structural topology are stored, parse trees are derived by applying the grammar to RNA sequences, goodnesses of fit of the derived parse trees are calculated, a similarity among the RNA sequences is calculated based on the calculated goodnesses of fit. Hence, it is possible to easily obtain the similarity of the RNA sequences based on the underlying RNA structures.
A computer program that makes a computer to execute an RNA sequence analysis method according to still another aspect of the present invention includes: a grammar storage step that stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies; a parsing step that derives parse trees by applying RNA sequences to the grammars; a goodness-of-fit calculation step that calculates goodnesses of fit of the parse trees derived by the parsing step; and an extraction step that extracts the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived; a goodness-of-fit matrix creation step that creates a goodness-of-fit matrix which displays the structural topologies and the RNA sequences in a two-dimensional matrix, and which displays the goodnesses of fit on lattice parts corresponding to the RNA sequences extracted by the extraction step and the structural topologies in the two-dimensional matrix; and a common structure extraction step that sorts the structural topologies according to the goodnesses of fit for the goodness-of-fit matrix created by the goodness-of-fit matrix creation step, that parses other RNA sequences based on the grammars corresponding to an order of the sorted structural topologies, and obtains the parse trees having maximum goodnesses of fit, and that extracts the other RNA sequences corresponding to the parse trees having the goodnesses of fit that satisfy the preset conditions.
According to this program, structural topologies of RNA secondary structures with grammars corresponding to the structural topologies are stored, parse trees are derived by applying RNA sequences to the grammars, goodnesses of fit of the derived parse trees are calculated, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived are extracted, a goodness-of-fit matrix which displays the structural topologies and the RNA sequences in a two-dimensional matrix, and which displays the goodnesses of fit on lattice parts corresponding to the extracted RNA sequences and the structural topologies in the two-dimensional matrix, is created, the structural topologies are sorted according to the goodnesses of fit for the goodness-of-fit matrix, other RNA sequences are parsed based on the grammar corresponding to an order of the sorted structural topologies, the parse trees having optimum goodnesses of fit are obtained, and the other RNA sequences corresponding to the parse trees having the goodnesses of fit that satisfy the preset conditions are extracted. Hence, it is possible to easily find the RNA sequences having the common structure.
Furthermore, the present invention relates to the recording medium. The recording medium according to the present invention records the program described above.
This recording medium can realize the program using a computer by making the computer read the program recorded on the recording medium, and exhibit the same advantages as those of each program.
Exemplary embodiments of an RNA sequence analyzer, an RNA sequence analysis method, a program, and a recording medium according to the present invention will be explained hereinafter in detail with reference to the accompanying drawings. It should be noted that the present invention is not limited to the embodiments.
Particularity in the embodiments, the present invention is explained by examples that employ tree grammars as structure modeling grammars. However, the present invention is not limited to the examples and it should be noted that any formal grammars can be similarly applied.
[Outline of System]
The outline of a system according to the present invention will be explained first, followed by the configuration, procedures, and the like of the system.
Schematically, this system has the following basic features. An RNA sequence analyzer in this system stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies, derives parse trees by applying the RNA sequence to the grammars; calculates goodnesses of fit of the respective derived parse trees, sorts the parse trees having the goodnesses of fit that satisfy preset conditions in a descending order of the goodnesses of fit, and outputs the sorted parse trees as secondary structure candidates of the RNA sequence. Examples of the formal grammars include tree grammars, context-free grammars, and the like. Since the tree grammars are quite feasible for modeling pseudoknots, it is preferable to use the tree grammars as the modeling grammars for RNA secondary structures.
The RNA sequence analyzer according to the present invention calculates goodnesses of fit of the derived parse trees, and outputs RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology.
Further, the RNA sequence analyzer derives parse trees from which parse trees having goodnesses of fit that satisfy preset conditions are derived, displays each structural topology and each RNA sequence in a two-dimensional matrix, gives marks to lattice parts corresponding to the extracted RNA sequences and structural topologies in the two-dimensional matrix, and thereby visualizes structural topologies common to the RNA sequences.
The RNA sequence analyzer according to the present invention, produces RNA sequences transcribed from a DNA sequence input by a user, derives parse trees by applying the grammar to the RNA sequences, calculates goodnesses of fit of the derived parse trees; and predicts, as gene candidates, DNA sequence parts corresponding to the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived.
Moreover, the analyzer according to the present invention stores structural topologies of RNA secondary structures with grammars corresponding to the structural topologies, derives parse trees by applying the grammars to RNA sequences, calculates goodnesses of fit of the derived parse trees, and calculates a similarity among the RNA sequences based on the calculated goodnesses of fit for the underlying RNA structures.
[System Configuration]
The configuration of the system will first be explained.
In
In
In
In
The various databases stored in the storage section 106 (the RNA sequence database 106a to the common structure matrix 106c) are storage units for a hard disk device or the like, and store various programs, tables, files, databases, webpage files, and the like used for various processings.
Among the constituent elements of the storage section 106, the RNA sequence database 106a is a database that stores RNA sequences. The RNA sequence database 106a may be an external RNA sequence database accessed through the Internet, or an in-house database created by copying the database, by storing original sequence information, or by adding individual annotation information and the like to the database. The RNA sequence database 106a may store RNA sequences produced in advance based on a DNA sequence database for cDNAs or the like or RNA sequences dynamically produced as needed.
A grammar database 106b is a grammar storage unit that stores structural topologies of RNA secondary structures with grammars corresponding to the respective structural topologies.
The common structure matrix 106c is a table (storage area) for displaying the structural topologies and the RNA sequences in a two-dimensional matrix.
In
In
In
Among these sections, the structure prediction section 102a has a function (a parsing section 102b) that performs parsing for the RNA sequences according to input grammars, and that derives parse trees, a function (a goodness-of-fit calculation section 102c) that calculates goodnesses of fit of the respective derived parse trees, and the like.
The similarity calculation section 102d is a similarity calculation unit that calculates a similarity among RNA sequences.
The common structure matrix creation section 102f is an extraction unit that extracts RNA sequences from which the parse trees having goodnesses of fit that satisfy preset conditions are derived, a common structure matrix creation unit that displays the structural topologies and the RNA sequences in the two-dimensional matrix, that gives marks to lattice parts corresponding to the RNA sequences extracted by the extraction units and the structural topologies in the two-dimensional matrix, and that thereby visualizes structural topologies common to the RNA sequences, a goodness-of-fit matrix creation unit that creates a goodness-of-fit matrix for displaying the goodnesses of fit in the lattice parts corresponding to the RNA sequences extracted by the extraction unit and the structural topologies in the two-dimensional matrix, and a common structure extraction unit that sorts the structural topologies according to the goodnesses of fit for the goodness-of-fit matrix created by the goodness-of-fit creation unit, that performs parsing for the other RNA sequences based on the grammar corresponding to an order of the sorted structural topologies, that obtains a parse tree having the optimum goodness of fit, and that extracts the other RNA sequences corresponding to the parse trees having the goodnesses of fit satisfying the preset conditions.
The gene prediction section 102g is an RNA sequence production unit that produces RNA sequences transcribed from a DNA sequence input by a user, and a gene prediction unit that predicts, as gene candidates, DNA sequence parts corresponding to the RNA sequences from which the parse trees having the goodnesses of fit satisfying the preset conditions are derived. Details of processings performed by these sections will be explained later.
[System Processings]
One example of processings performed by the system according to the embodiment constituted as explained above will next be explained with reference to FIGS. 7 to 11.
[RNA Secondary Structure Prediction Processing]
The detail of an RNA secondary structure prediction processing will first be explained with reference to
Grammars that represent known RNA structural topologies are first accumulated in the grammar database 106b. The user inputs an RNA sequence, the structure of which is unknown and the secondary structure of which the user is to specify, to the RNA sequence analyzer 100 through the input device 112 (at a step SA-1). If so, the structure prediction section 102a fetches grammars from the grammar database 106b by a processing performed by the parsing section 102b (at a step SA-2), and parses the RNA sequence by applying the respective grammars to the RNA sequence (at a step SA-3). The user may input the RNA sequence by selecting a desired sequence from the RNA sequence database 106a, by selecting the desired sequence from the external database in the external system 200, or by directly inputting the desired sequence.
The structure prediction section 102a calculates goodnesses of fit of the respective parse trees that is obtained as a result of successful parsing and that is derived, based on a free energy increments (ΔG) obtained by, for example, calculating a sum of free energies of loops, base pairs, and the other secondary structure elements, or the like, by a processing performed by the goodness-of-fit calculation section 102c. As the goodness-of-fit calculation method, one of the methods disclosed in Literatures 1 to 3 and the conventional methods may be used.
The structure prediction section 102a sorts the parse trees having the goodnesses of fit that satisfy the preset conditions in a descending order of goodness of fit (at a step SA-4).
The structure prediction section 102a outputs the sorted parse trees and the goodnesses of fit of the parse trees to the output device 114 through the input and output control interface section 108. Thus, one sequence input by the user can be parsed based on multiple grammars. That is, the sequence is subjected to parsing and goodness-of-fit calculation for each grammar, thereby obtaining the goodness of fit. As a result, goodnesses of fit corresponding to the respective grammars can be obtained. The grammars can be ranked by sorting the goodnesses of fit. Accordingly, the structural topologies for the grammars can be ranked, thereby making it possible to see the structural topologies in a descending order of possibility for the given RNA sequence. The RNA secondary structure prediction processing is thereby finished.
[RNA Sequences of Similar Structures Extraction Processing]
The detail of RNA sequences of similar structures extraction processing will be explained with reference to
The user selects a grammar corresponding to a specific structural topology from the grammar database 106b. The structure prediction section 102a fetches RNA sequences from the RNA sequence database 106a by a processing performed by the parsing section 102b (at a step SB-1), fits the selected grammar to the respective RNA sequences (at a step SB-2), and parses the RNA sequences (at a step SB-3).
The goodness-of-fit calculation section 102c calculates goodnesses of fit of derived parse trees. The structure prediction section 102a extracts, as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology modeled by the designated grammar, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived (at a step SB-4).
The structure prediction section 102a outputs the extracted RNA sequences to the output device 114 through the input and output control interface 108 as RNA sequences that may possibly have the secondary structures consistent with the structural topology modeled by the grammar (at a step SB-5). The RNA sequences of similar structures extraction processing is thereby finished.
[Common Structure Extraction Processing]
The detail of a common structure extraction processing will be explained with reference to
The structure prediction section 102a fetches one or two or more RNA sequences from the RNA sequence database 106a (at steps SC-1 and SC-2), and applies one or two or more grammars, which are fetched from the grammar database 106b (at a step SC-3), to each RNA sequence (at a step SC-4). The RNA sequence analyzer 100 may perform either a parallel processing or a sequential processing for fetching the RNA sequences and the grammars and parsing.
The goodness-of-fit calculation section 102c calculates goodnesses of fit of derived parse trees, and extracts the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, by a processing performed by the common structure matrix creation section 102f (at a step SC-5).
The common structure matrix creation section 102f displays structural topologies modeled by the grammars and the RNA sequences in the two-dimensional matrix, gives marks to lattice parts corresponding to the extracted RNA sequences and structural topologies in the two-dimensional matrix, and thereby visualizes structural topologies common to the RNA sequences (at a step SC-6).
The marks may be given in a specific color to the target lattice parts as illustrated in
[Structure Similarity Calculation Processing]
The detail of a structure similarity calculation processing will be explained with reference to
The user inputs multiple (two in the example illustrated in
The similarity calculation section 102d fetches one or two or more grammars from the grammar database 106b (at a step SE-2), and parses the input RNA sequences by applying the grammars to the respective input RNA sequences, by a processing performed by the parsing section 102b (at a step SE-3). The goodness-of-fit calculation section 102c calculates goodnesses of fit of derived parse trees (at a step SE-4).
The similarity calculation section 102d performs a vector operation, an inner product calculation, and the like for each RNA sequence while making the parse trees, derived by applying the grammars to the input RNA sequences, and the goodnesses of fit of the derived parse trees (if the goodnesses of fit are not derived, special values are set) correspond to one another (at a step SE-5), thereby calculating a similarity among the RNA sequences (at a step SE-6).
It is assumed, for example, that the input i RNA sequences are RNA1, RNA2, . . . , and RNAi, the N grammars stored in the grammar database 106b are G1, G2, . . . , and GN, and the goodness of fit obtained when the parsing of an RNA sequence x based on a grammar g is successful is r (x, g). It is also assumed herein that the goodness of fit is a real value and that as a goodness of fit is higher, the RNA sequence can form the structure having the goodness of fit more easily.
It is also assumed herein that for a goodness-of-fit vector Ri with respect to an input RNA sequence RNAj, a kth element Rj[k] of the vector Rj is r (RNAj, Gk) obtained when parsing RNAj based on Gk is successful, or “X” obtained when the parsing fails.
The similarity calculation section 102d performs the similarity calculation processing by the following method. The user inputs goodness-of-fit vectors R1 and R2 with respect to two RNA sequences first.
The similarity calculation section 102d obtains similarity vectors S1 and S2 and the penalty P. The “penalty P” represents the number of elements k for which only one of elements R1[k] and R2[k] is indicated as “unsuccessful parsing (X)”. The “similarity vectors S1 and S2” represent vectors obtained by extracting only elements for which neither R1[k] nor R2[k] are indicated as “unsuccessful parsing (X)”.
The similarity calculation section 102d then calculates a distance D between the similarity vectors S1 and S2 by the following method. The number of elements (vector dimensions) of the similarity vectors S1 and S2 is assumed as M. Using the Euclidian distance generally used in similarity calculation, the distance D is calculated according to the following Equation.
D=sqrt(Σ{(S1[k]−S2[k])2})
(where sqrt represents a square root and Σ represents a sum for k=1 to M)
If the distance D is large, the similarity is low. If the penalty P is large, the similarity is low. Therefore, using the penalty P and the distance D, the similarity Sim is calculated according to the following Equation.
Sim=aP/D
(where a represents a constant (0<a<1))
Sim is output as the similarity. If the constant a is set low, more importance is attached to the penalty P than the distance D. The similarity calculation processing is thereby finished.
[Gene Prediction Processing]
The detail of a gene prediction processing will be explained with reference to
The user first inputs a DNA sequence having an unknown gene part to the RNA sequence analyzer 100 through the input device 112. If so, the RNA sequence analyzer 100 automatically transforms the input DNA sequence to an RNA sequence transcribed from the DNA sequence (hereinafter, “predicted RNA sequence”) and thereby produces the predicted RNA sequence by a processing performed by the gene prediction section 102g (at a step SF-1). The user may input the DNA sequence by selecting a desired DNA sequence from the external database in the external system 200 or the in-house database or by directly inputting the desired sequence.
If the structure prediction section 102a inputs this predicted RNA sequence to the parsing section 102b (at a step SF-2), one or two or more grammars are fetched from the grammar database 106b by a processing performed by the parsing section 102b (at a step SF-3), and the respective grammars are made fit to the predicted RNA sequence (at a step SF-4).
The goodness-of-fit calculation section 102c calculates goodnesses of fit of parse trees derived by the parsing section 102b (at a step SF-5). The gene prediction section 102g predicts a DNA sequence part corresponding to the predicted RNA sequence, from which the parse tree having the goodness of fit that satisfies preset conditions is derived, as a gene candidate (at a step SF-6). Namely, the part of the predicted RNA sequence among the DNA sequence is output as an area having a high probability of being a gene.
Thus, it is possible to predict-that there is a probability that the part of the DNA sequence corresponding to the predicted RNA sequence having a known topology should be a gene. The gene prediction processing is thereby finished.
[Embodiment]
The embodiment of the present invention will be explained with reference to FIGS. 13 to 23.
1 Preparation
In this section, some specific RNA secondary structure topologies are defined and grammars that model the respective topologies are specified in preparation for the embodiment. In this embodiment, for convenience of explanation, context free grammars are used. However, even if tree grammars for RNA (Literature 1) having a higher modeling capability are used, the following examples can be similarly applied.
1.1 Secondary Structure Topology
Two RNA secondary structure topologies illustrated in
A stem loop includes a stem (H(a)) and a hairpin loop (L(a)). A double-parallel-stem loop includes two stem loops arranged in parallel. The double-parallel-stem loop also includes a loop part (I(b)) that connects the two stems together, other than the stems (H1(b) and H2(b)) and the hairpin loops (L1(b) or L2(b)).
More specific features of these structural topologies can be considered. For example, it is possible to consider such topologies as those having more detailed features including size restrictions to each stem and each loop, whether a mismatching (an internal loop or a bulge loop) is permitted for the base pair constituting the stem, and whether a specific base sequence is present at a specific location. In this embodiment, therefore, RNA secondary structure topologies T1 and T2 having the following features will be defined.
Topology T1
A stem loop structure (see
The base pair constituting the stem (H(a)) does not include mismatches.
The size of the stem (H(a)) is more than or equal to one base-pairs in length.
The length of the hairpin loop (L(a)) is more than or equal to one base.
Topology T2
A double-parallel-stem loop structure (see
Two topologies T1 are connected in parallel.
The length of the loop (I(b)) between the stem (H1(b)) and the stem (H2(b)) is more than or equal to one base.
1.2 Secondary Structure Modeling by Context Free Grammars
The context free grammars modeling the two topologies T1 and T2 are defined below. Context Free Grammars are defined as a four tuple.
G=(N, Σ, P, S)
N represents a finite set of nonterminal symbols, Σ represents a finite set of terminal symbols, P represents a finite set of production rules, and S represents a start symbol.
However, it is assumed in this embodiment that Σ is {a, u, g, c}, the start symbol is S, and N includes only nonterminal symbols that appear in the production rules P. Therefore, by designating P only, the context free grammar G can be defined. For the sake of convenience, if the context free grammar G is specified, only the finite set of production rules P are designated herein.
(1) The topology T1 is modeled by a context free grammar G1 including the following production rules.
S→xH{overscore (x)}
H→xH{overscore (x)}\L
L→xL\x
In the rules, xεΣ, and {overscore (x)} represents a complementary base of x which constitutes, together with x, a base pair.
Namely, if only a Watson-Crick base pair is assumed, the first production rule is equivalent to the following rule.
S→aHu|uHa|gHc|cHg
If a non-Watson-Crick base pair is permitted, a rule of S→gHu or the like may be added.
In G1, base pairs (constituting the stem) are produced based on the following rules:
S→xH{overscore (x)} and H→xH{overscore (x)}.
In addition, bases (constituting the loop) that do not form the base pairs are produced based on the rules, L→xL and L→x. Thus, the RNA secondary structures can be produced based on the grammar G1. In this manner, for a context free grammar G, a set SS(G) of all RNA secondary structures that can be produced based on G could be specified.
The statement “G1 models the topology T1” holds if and only if “G1 can produce all the RNA secondary structures consistent with the topology T1, and all the RNA secondary structures that can be produced based on G1 are consistent with topology T1”.
These are quite obvious from derivation processes in G1. All the possible derivation in G1 are in the following form.
In the following derivation, n and I satisfy n 1 and I 1.
In the derivation above, x1x2 . . . xn and {overscore (x)}n . . . {overscore (x)}2{overscore (x)}1 correspond to the stem, and y1 . . . yI-1yI corresponds to the hairpin loop. Since n and I satisfy n 1 and I 1, the size of the stem is more than or equal to one base-pairs in length and that of the hairpin loop is more than or equal to one base.
This demonstrates, therefore, that G1 can model T1.
(2) The topology T2 is modeled by a context free grammar G2 including the following production rules.
S→S1IS2
S1→xH{overscore (x)}
S2→xH{overscore (x)}
H→xH{overscore (x)}\L
L→xL\x
I→xL
A context free grammar G0 including the following production rules is a universal context free grammar that can produce all RNA secondary structures that can be produced based on context free grammars.
S→SS\xS{overscore (x)}\xS\Sx\x\λ
In the rule, λ represents a null character. For example, G0 can simulate any derivation in G1. Namely, the following derivation can be carried out by G0.
In this derivation, the produced RNA secondary structures are entirely equal to those produced according to G1 except for the nonterminal symbols. It is thus demonstrated that G0 can produce all secondary structures that can be produced based on G1. In other words, the following inclusive relation holds.
SS(G0)⊃SS(G1)
It is also obvious that the following relation holds for any context free grammar G.
SS(G0)⊃SS(G)
It is assumed hereinafter that the overall secondary structures produced by such a universal grammar are “all secondary structures”.
1.3 Parse Tree and Goodness of Fit
A question of whether a given RNA sequence can form a secondary structure that satisfies the properties of a given RNA secondary structural topology corresponds to a question of whether a grammar that models a target topology can derive a target sequence. This question can be solved by a parsing algorithm for the grammars.
The parsing algorithm determines whether a given grammar can derive a given sequence. If it is determined that the given grammar can derive the given sequence, derivation processes of the derivation, that is, a parse tree is output. In the framework of the grammar that models the secondary structures, the parse tree corresponds to the specific secondary structure. Therefore, it can be interpreted that the parsing algorithm outputs a specific secondary structure consistent with the target topology if exists.
It is now considered whether an RNA sequence s1=ggggaaacccc can form the secondary structures consistent with the topologies T1 and T2.
The sequence s1 can be derived by G1 as follows. This shows that the sequence S1 can form the secondary structure consistent with T1.
S→gHc→ggHcc→gggHccc→ggggHcccc→ggggLcccc→ggggaLcccc→ggggaaLcccc→ggggaaacccc (1)
Alternatively, the sequence s1 can be derived by G1 as follows.
S→gHc→ggHcc→gggHccc→gggLccc→ggggLccc→ggggaLccc→ggggaaLccc→ggggaaaLccc→ggggaaacccc (2)
It is noted, however, that the sequence s1 cannot be derived by G2. This follows that the sequence s1 cannot form the secondary structure consistent with the topology T2.
If more than one parse trees are obtained as shown in the example of
Examples of goodness-of-fit evaluation methods used so far will be shown below. However, the goodnesses of fit used by the present invention are not limited to the examples.
(1) Goodness-of-Fit Evaluation Based on Base-Pairs
Generally, an RNA molecule is stabilized in terms of energy thanks to a hydrogen bond generated when forming a base pair. Therefore, in this evaluation method, the secondary structure having more base pairs is simply given a higher priority. That is, as the goodness of fit of a parse tree, the number of base-pairs of the corresponding secondary structure is used. According to this evaluation method, if the goodnesses of fit of the parse trees in the above examples are evaluated, the goodness of fit of the parse tree illustrated in
As a classical algorithm based on this evaluation method, there is known Nussinov's folding algorithm explained in Nussinov. R., Piecxenk, G., geiggs, j. R., and Kleitman, D. J.: “Algorithms for loop matchings” in SIAM journal of Applied Mathematics, 35, pp. 68-82, 1978.
(2) Goodness-of-Fit Evaluation Based on Free Energy Increments (ΔG)
In order to evaluate a physico-chemical stability of an RNA secondary structure, there is known a calculation method using free energy (ΔG) parameters determined by a thermodynamic experiment conducted to a small model RNA molecule. The free energy increments (ΔG) of a certain secondary structure is approximated to a sum of free energies of secondary structure elements, such as base pairs and loops, which constitute the secondary structure. According to the free energy parameters, the structure is made stable by the base pairs and made unstable by the loops. Detailed parameters for the respective secondary structure elements are shown in Turner, D. H., Sugimoto, N., Jaeger, J. A., Longfellow, C. E., Freier, S. M., and Kierzek, R.: “Improved parameters for prediction of RNA structure” in Cold Spring Harbor Symposia Quantitative Biology, 52, pp. 123-133, 1987. In this specification,
Using the free energy parameters, free energy increments (ΔG) of the structures (1) and (2) illustrated in
Care should be taken here to the method of calculating the free energies of base pairs. One energy value is allocated to two base pairs that are continuously stacked. Namely, for the calculation of the free energy of the structure (1), ΔG(gc, gc) is calculated for the first and the second gc base pairs from 5′ side, ΔG(gc, gc) is calculated for the second and the third gc base pairs, and ΔG(gc, gc) is calculated for the third and the fourth gc base pairs. For the calculation of the free energy of the structure (2), by contrast, ΔG(gc, gc) is calculated for the first and the second gc base pairs from 5′ side, and ΔG(gc, gc) is calculated for the second and the third gc base pairs.
If it is specified that the goodness of fit of a parse tree is −ΔG, then the goodness of fit of the structure (1) is 1.3 and that of the structure (2) is 1.4. As a result, the structure (2) having a higher goodness of fit is adopted.
As a typical RNA secondary structure prediction system based on ΔG, there is known Zuker's Mfold (Literature 3).
(3) Goodness-of-Fit Evaluation Based on Derivation Probability
Stochastic Grammars are formal grammars having production rules to which application probabilities are added, respectively. Suppose a stochastic context free grammar G1 having the production rules of the grammar G1 to which the following probabilities p are added will be considered.
p(S→aHu)=0.2
p(S→uHa)=0.2
p(S→gHc)=0.3
p(S→cHg)=0.3
p(H→aHu)=0.2
p(H→uHa)=0.2
p(H→gHc)=0.3
p(H→cHg)=0.2
p(H→L)=0.1
p(L→aL)=0.2
p(L→uL)=0.2
p(L→gL)=0.15
p(L→cL)=0.15
p(L→a)=0.1
p(L→u)=0.1
p(L→g)=0.05
p(L→c)=0.05
A derivation probability of the sequence s1 by this G1 is calculated as follows. Namely, the derivation probability of the sequence s1 having the structure (1) is calculated as follows.
The derivation probability of the sequence s1 having the structure (2) is calculated as follows.
p(S→gHc)×p(H→gHc)×p(H→gHc)×p(H→L)×p(L→gL)×p(L→aL)×p(L→aL)×p(L→aL)×p(L→C)=0.3×0.3×0.3×0.1×0.15×0.2×0.2×0.2×0.05=0.000000162
Accordingly, if a natural logarithm of a derivation probability is used as the goodness of fit of a parse tree, then the goodness of fit of the parse tree (1) is 1n0.00000324=−12.6, that of the parse tree (2) is 1n0.000000162=−15.6. As a result, the structure (1) having a higher goodness of fit is adopted.
Probabilistic parameters to be added to the respective production rules, based on which this evaluation method is executed, may be learned by a maximum likelihood estimation method, an inside-outside algorithm or the like, or may be estimated by heuristics or the like. In a Literature of Sakakibara et al.: “Stochastic Context-fee Grammars for tRNA modeling” in Nucleic Acids Research, 22, 5112-5120, 1994, for example, a method for learning stochastic context free grammars that models tRNA structures from a plurality of tRNA sequences is developed.
While several goodness-of-fit evaluation methods have been explained above, −ΔG is used as the goodness of fit hereinafter.
Next, It could be considered whether the RNA sequence s2=gcccauaggcaaagccuaugggc can form secondary structures consistent with the topologies T1 and T2. Similarly to the above, it may be determined whether s2 can be derived by G1 and G2. As a conclusion, the sequence s2 can be derived by either G1 or G2. Further, multiple derivations exist for each grammar.
Free energy increments (ΔG) for the respective structures are calculated as follows.
It is thus demonstrated that the goodness of fit of the parse tree having the optimum RNA secondary structure that may possibly be formed by the sequence s2 among those consistent with the topology T1 is 13.6. In addition, the goodness of fit of the parse tree having the optimum RNA secondary structure that may possibly be formed by the sequence s2 among those consistent with the topology T2 is 6.7. If the sequence s2 is parsed using the universal grammar G0, the structure (1) is found as the optimum structure. This follows that the structure (1) is the optimum structure among “all secondary structures”. By thus parsing based on the universal grammar, it is possible to find the optimum structure among all secondary structures.
“A parsing unit that applies an RNA sequence to a formal grammar and derives a parse tree, a goodness-of-fit calculation unit that calculates a goodness of fit of the parse tree derived by the parsing unit, and an optimum secondary structure output unit that outputs a secondary structure corresponding to the parse tree having the optimum goodness of fit”, which units form the basis for the present invention, are generally implemented by a parsing algorithm having goodness-of-fit calculation incorporated therein. This parsing algorithm will be referred to as “structure prediction algorithm”. The structure prediction algorithm based on the RNA tree grammar with G used as a goodness-of-fit index is disclosed in Literature 1.
2. Embodiment of the Present Invention
In this section, an embodiment in which the RNA sequences s1 and s2, the topologies T1 and T2, the context free grammars G0, G1, and G2 for modeling the topologies, and—G serving as the goodness of fit are used will be explained.
First of all, “the grammar storage unit that stores structural topologies of RNA secondary structures and production grammars corresponding to the respective structural topologies” store a name of a structural topology such as (Leu-tRNA, G′) or (16S rNA, G″) associated with a grammar that models the given structural topology. In this embodiment, the unit is assumed as a grammar DB which may include (stem loop T1, G1) and (double-parallel-stem loop T2, G2). In addition, it is assumed that an RNA sequence DB including the RNA sequences s1 and s2 is used.
(1) Output of Structure Candidates by a Grammar and Goodness-Of-Fit Calculation
If the user is to grasp structural topologies that may possibly be formed by a given RNA sequence in a descending order of goodness of fit, the user can do so in the following procedures according to the present invention. In this example, an instance in which the input sequence is s2 and the target topology sets are T1 and T2 will be shown.
Further, s2 is parsed based on G2, and the parse tree having the maximum goodness of fit of 6.7 is obtained (see
As a result, structure candidates fit to s2 in the selected topology sets are output as illustrated in
According to the conventional secondary structure prediction program, optimum or optimal secondary structures among those that may possibly be formed by the given sequence are sequentially output. Therefore, the user is required to determine what topologies the output structures have. According to the present invention, the structures and the topologies can be output. It is, therefore, expected to greatly reduce labor required to see the prediction result.
Further, if the present invention is carried out, the procedures for the check are not necessarily, strictly equal to those explained above. For example, the order of the procedures 1 and 2 may be changed, or the selection of the parse trees based on the thresholds in the procedure 5 may be included in the parsing in the procedure 4.
(2) Output of Sequence Candidates of Similar Structures.
If the user is to search for RNA sequences that may possibly have secondary structures consistent with a given structural topology, the user can do so in the following procedures according to the present invention. In this example, an instance in which the input topology is T2 and the target sequence sets are s1 and s2 will be shown.
If the present invention is carried out, the procedures for the search are not necessarily, strictly equal to those explained above. For example, the order of procedures 1, 2, and 3 may be arbitrarily exchanged, or the procedure 5 may be included in the parsing in the procedure 4.
(3) Extraction of Common Structure
If the user is to search for structural topologies common to a certain RNA sequence set, the user can do so in the following procedures according to the present invention. In this example, an instance in which the input sequence sets are s1 and s2 and the target topology sets are T1 and T2 will be shown.
In this example, s1 is parsed based on G1, and the parse tree having the optimum goodness of fit 1.4 is obtained (see
s1 is parsed based on G2, but the parse tree cannot be derived from s1.
s2 is parsed based on G1, and the parse tree having the optimum goodness of fit 13.6 is obtained (see
s2 is parsed based on G2, and the parse tree having the optimum goodness of fit 6.7 is obtained (see
If the matrix obtained based on the results is output, it is possible to easily check the structural topologies common to the target sequence sets. Alternatively, if the following additional procedures are executed, the common structure candidates can be output in an order.
Further, if the present invention is carried out, the procedures for the search are not necessarily, strictly equal to those explained above. For example, the order of the procedures 1 and 2 may be changed, or the procedure 5 may be included in the parsing in the procedure 4.
(4) Gene Finder
A sequence corresponding to an RNA gene tends to have quite a stable structure, so that the goodness of fit thereof is high. Therefore, according to the present invention, parsing is performed using the universal grammar, sequences having high goodnesses of fit are selected from the sequence DB and output as gene candidates. In this example, an instance in which the sequence sets are s1 and s2 will be shown.
s1 1 is parsed based on G0, and the parse tree having the optimum goodness of fit 1.4 is obtained.
s2 is parsed based on G0, and the parse tree having the optimum goodness of fit 13.6 is obtained.
If the present invention is carried out, the procedures for the gene finding are not necessarily, strictly equal to those explained above. For example, the order of the procedures 1 and 2 may be changed, or the procedure 4 may be included in the parsing in the procedure 3.
(5) Output of RNA Sequences Potentially Having the Similar Structures as That of the Given RNA Sequence Set
If the user is to search for RNA sequences that may possibly have the similar topology as that of a certain RNA sequence set, the user can do so according to the present invention in a combination of the invention (3) and the invention (2). In this example, an instance in which the input sequence is s=gcccaaaagggcagcccaaagggc, the target topology sets are T1 and T2, and the target sequence sets are s1 and s2 will be shown.
Further, s2 is parsed based on G2, and the parse tree having the optimum goodness of fit 6.7 is obtained (see
The output illustrated in
Accordingly, it is seen that s2 may possibly have a common structure to s for the topology T2.
If the present invention is carried out, the procedures for the search are not necessarily, strictly equal to those explained above. For example, the procedures 1, 2, and 3 may be arbitrarily exchanged, the procedure 6 may be included in the parsing in the procedure 5, or the selection of the parse trees based on the threshold in the procedure 10 may be included in the parsing in the procedure 9.
[Other Embodiments]
The embodiment of the present invention has been explained so far. However, the present invention is not limited to the embodiment but may be carried out by various other embodiments within the scope of the technical concept set forth in the claims.
For example, the instance in which the RNA sequence analyzer 100 conducts the RNA sequence analysis method in a standalone fashion has been explained. Alternatively, the RNA sequence analyzer 100 may conduct the RNA sequence analysis method in response to a request from a client terminal constituted separately from the RNA sequence analyzer 100, and may return the processing result to the client terminal.
Further, the structure prediction section 102a may derive a parse tree by the parsing section 102 while the goodness-of-fit calculation section 102c is allowed to conduct the goodness-of-fit calculation. Namely, the parsing section 102b that derives the parse tree and the goodness-of-fit calculation section 102c that calculates the goodness of fit of the derived parse tree may be realized by one algorithm. By so constituting, numerous parse trees (in an exponential order relative to a sequence length) that may possibly be derived for RNA sequences and tree grammars are present. It is, therefore, possible to solve the disadvantage in that if the parse trees are derived, the goodnesses of fit of the parse trees are calculated, and then the parse trees are sorted, a calculation time and a storage capacity in the exponential order are required.
Further, among the respective processings explained in the embodiment, all of or part of the processings explained to be performed automatically may be performed manually or all of or part of the processings explained to be performed manually may be performed automatically by a well-known method.
The structure prediction section 102a, in particular, may be realized as a plurality of tasks and the respective tasks may perform parallel processings.
Furthermore, the processing procedures, control procedures, specific names, information including various pieces of registered data and parameters for search conditions and the like, screen examples, and database configurations explained above or illustrated in the drawings may be arbitrarily changed unless specified otherwise.
The respective constituent elements of the RNA sequence analyzer 100 illustrated in the drawings are functionally conceptual, and the RNA sequence analyzer 100 is not always required to be physically constituted as illustrated in the drawings.
For instance, all of or arbitrary part of the processing functions of the respective servers of the RNA sequence analyzer 100, particularly the respective processing functions performed by the control section can be realized by the CPU (Central Processing Unit) and programs interpreted and executed by the CPU, or can be realized as hardware based on wired logic. The programs are recorded on a recording medium to be explained later, and mechanically read by the RNA sequence analyzer 100 as needed.
The various databases and the like (the RNA sequence database 106a to the common structure matrix 106c) stored in the storage section 106a are storage units such as memory devices, e.g., a RAM and a ROM, fixed disk devices, e.g., a hard disk, a flexible disk, and an optical disk. They store various programs, tables, files, databases, webpage files, and the like used for various processings and provision of websites.
In addition, the RNA sequence analyzer 100 may be realized by connecting peripherals such as a printer, a monitor, and an image scanner to an information processing apparatus such as information processing terminals, e.g., well-known personal computers or workstations, and by installing software (including a program, data, or the like) for realizing the method of the present invention into the information processing apparatus.
The specific form of distribution and integration of the RNA sequence analyzer 100 is not limited to that illustrated in the drawings. All of or part of the RNA sequence analyzer 100 can be functionally or physically distributed or integrated in arbitrary units according to various loads and the like. For example, each database may be constituted independently as an independent database device, and part of the processings may be realized using a CGI (Common Gateway Interface).
Further, the program according to the present invention can be stored in a computer readable recording medium. It is assumed herein that examples of this “recording medium” include arbitrary “portable physical mediums” such as a flexible disk, a magneto-optical disk, a ROM, an EPROM, an EEPROM, a CD-ROM, an MO, and a DVD, arbitrary “fixed physical mediums” such as a ROM, a RAM, and an HD included in various computer systems, and “communication mediums” that temporarily hold the program such as a communication line or a carrier wave used when the program is transmitted through the network represented by a LAN, a WAN, or the Internet.
The “program” is a data processing method described in an arbitrary language or by an arbitrary description method, and the form of the “program” is not limited but may be a source code, a binary code, or the like. The “program” is not limited to a program constituted as a single program. Examples of the “program” include a program constituted to be distributed as a plurality of modules or libraries, and a program that fulfils its function in cooperation with another program represented by the OS (Operating System). The specific configurations, reading procedures, install procedures after reading, and the like of the respective devices shown in the embodiment for reading the recording medium may be well-known configurations and procedures.
Furthermore, the network 300 functions to connect the RNA sequence analyzer 100 and the external system 200 to each other, and may include any one of, for example, the Internet, the Intranet, a LAN (which may be either wired or wireless), a VAN, a personal computer communication network, a public telephone network (which may be either analog or digital), a dedicated line network (which may be either analog or digital), a CATV network, a portable line exchange network/portable packet exchange network such as an IMT 2000 network, a GSM network, or a PDC/PDC-P network, a wireless call network, a local wireless network such as Bluetooth, and satellite communications network such as CD, BS, or ISDB. That is, the present system can transmit and receive various pieces of data through an arbitrary network whether the system is wired or wireless.
As explained so far in detail, according to the present invention, structural topologies of RNA secondary structures with grammars corresponding to the structural topologies are stored, parse trees are derived by applying an RNA sequence to the grammars, goodnesses of fit of the derived parse trees are calculated, the parse trees having the goodnesses of fit that satisfy preset conditions are sorted in a descending order of the goodnesses of fit, and the sorted parse trees are output as secondary structure candidates of the RNA sequence. Thus, one sequence can be parsed based on multiple grammars. That is, the sequence is subjected to parsing and goodness-of-fit calculation for each parse tree derived from each grammar, thereby obtaining the goodness of fit for each structural topology. As a result, the grammars can be ranked by sorting the goodnesses of fit. Accordingly, the structural topologies for the grammars can be ranked. Hence, it is possible to provide the RNA sequence analyzer, the RNA sequence analysis method, the program, and the recording medium capable of ranking the structural topologies in a descending order of possibility for the given RNA sequence.
According to the present invention, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, parse trees are derived by applying RNA sequences to the grammar, goodnesses of fit of the derived parse trees are calculated, and the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, are output as RNA sequence candidates that could potentially form the secondary structures consistent with the structural topology. Therefore, multiple sequences can be parsed based on one grammar. That is, for a given specific structural topology, a corresponding grammar is obtained. Using the grammar, all of or part of the RNA sequences stored in the RNA sequence database are parsed, respectively, and a group of the RNA sequences which can be successfully parsed with goodnesses of fit that satisfy preset conditions are output as a result. Hence, it is possible to provide the RNA sequence analyzer, the RNA sequence analysis method, the program, and the recording medium capable of searching for the RNA sequences that may possibly have the given specific structural topology.
According to the present invention, structural topologies of RNA secondary structures with grammars corresponding to the respective structural topologies are stored, parse trees are derived by applying RNA sequences to the grammars, goodnesses of fit of the derived parse trees, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived are extracted, the structural topologies and the RNA sequences are displayed in a two-dimensional matrix, marks are given to lattice parts corresponding to the extracted RNA sequences and the structural topologies in the two-dimensional matrix, and the structural topologies common to the RNA sequences are thereby visualized. Hence, it is possible to provide the RNA sequence analyzer, the RNA sequence analysis method, the program, and the recording medium capable of easily finding the structures common to the RNA sequences.
According to the present invention, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, RNA sequences transcribed from a DNA sequence input by a user are produced, parse trees are derived by applying the grammar to the produced RNA sequences, goodnesses of fit of the derived parse trees are calculated, and parts of the DNA sequence corresponding to the RNA sequences, from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived, are predicted as gene candidates. Hence, it is possible to provide the RNA sequence analyzer, the RNA sequence analysis method, the program, and the recording medium capable of predicting that there is a probability that the part of the DNA sequence corresponding to the RNA sequence having known topology should be a gene part.
According to the present invention, a structural topology of RNA secondary structures with a grammar corresponding to the structural topology are stored, parse trees are derived by applying the grammar to RNA sequences, goodnesses of fit of the derived parse trees are calculated, a similarity among the RNA sequences is calculated based on the calculated goodnesses of fit. Hence, it is possible to provide the RNA sequence analyzer, the RNA sequence analysis method, the program, and the recording medium capable of easily obtaining the similarity of the RNA sequences based on the underlying RNA structures.
According to the present invention, structural topologies of RNA secondary structures with grammars corresponding to the structural topologies are stored, parse trees are derived by applying RNA sequences to the grammars, goodnesses of fit of the derived parse trees are calculated, the RNA sequences from which the parse trees having the goodnesses of fit that satisfy preset conditions are derived are extracted, a goodness-of-fit matrix which displays the structural topologies and the RNA sequences in a two-dimensional matrix, and which displays the goodnesses of fit on lattice parts corresponding to the extracted RNA sequences and the structural topologies in the two-dimensional matrix, is created, the structural topologies are sorted according to the goodnesses of fit for the goodness-of-fit matrix, other RNA sequences are parsed based on the grammar corresponding to an order of the sorted structural topologies, the parse trees having optimum goodnesses of fit are obtained, and the other RNA sequences corresponding to the parse trees having the goodnesses of fit that satisfy the preset conditions are extracted. Hence, it is possible to provide the RNA sequence analyzer, the RNA sequence analysis method, the program, and the recording medium capable of easily finding the RNA sequences potentially having the common structures.
As explained so far, the RNA sequence analyzer, the RNA sequence analysis method, the program, and the recording medium according to the present invention are suited, such as to the RNA secondary structure prediction, the RNA sequence analysis, and the gene analysis as well as developments of drugs using them.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2001-402081 | Dec 2001 | JP | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/JP03/00011 | 1/6/2003 | WO |