Salivary biomarkers of brain injury

Information

  • Patent Grant
  • 11414705
  • Patent Number
    11,414,705
  • Date Filed
    Tuesday, December 31, 2019
    4 years ago
  • Date Issued
    Tuesday, August 16, 2022
    a year ago
Abstract
Provided is a method of diagnosing and/or monitoring mild traumatic brain injury (mTBI) or concussion in a subject. The method comprises determining a level of at least one miRNA in a saliva sample from the subject. Also provided is a sensor element, a detection system, composition and a kit for diagnosing and/or monitoring TBI, and a method of determining an appropriate treatment for a subject with suspected mTBI or concussion.
Description
REFERENCE TO SEQUENCE LISTING

The present application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Mar. 21, 2022, is named 2022-03-21_SequenceListing_ST25_text_file_11241-001US3.txt and is 10,633 bytes in size.


FIELD OF THE INVENTION

The present invention relates to compositions, kits, systems and methods for diagnosing and/or monitoring traumatic brain injury (TBI). More particularly, the present invention relates to the diagnosis and monitoring of TBI using miRNA biomarkers.


BACKGROUND TO THE INVENTION

Traumatic brain injury (TBI) is the leading cause of death and disability under the age of 45 years in Western countries. Its healthcare burden and social costs are expected to continue to rise and, by 2020, the World Health Organization projects TBI to become the third leading cause of disability worldwide.


Despite many studies, no reliable biomarkers have been found to assess the severity of TBI and predict recovery. This is especially true for mild TBI (mTBI), which remains currently difficult to assess in clinical practice. Although TBI patients are initially assessed by the Glasgow Coma Score (GCS) and neuroimaging techniques, which require costly equipment, the current diagnostic tools are lacking in the ability to precisely define and quantify the actual severity of the brain injury, thus leading to an easy detection of severe but not of mTBI, which represents the vast majority of cases (75-90%).


The correct diagnosis of mTBI is particularly important in patients, such as athletes, soldiers and children, who are at greater risk of repetitive mTBI and a catastrophic form of brain injury known as second impact syndrome (SIS) where the synergistic effects of repeated TBI result in profound damage and even death. Early diagnosis and evaluation of the severity of TBI thus becomes crucial for patients' wellbeing and ultimately saving their life.


The quest for TBI biomarkers has received significant impetus by the increased profile of sport concussion in the media. In the last few years many studies have focused on biomarkers that can support clinical decision making pitch-side or in a sports clinic. However, protein biomarkers reported in the literature lack specificity or sensitivity, or are not detectable for some time after injury. This may be due to the fact that following concussion, which is a form of TBI, brain-derived compounds are only released in very small amounts and the blood-brain barrier remains mostly closed.


MicroRNAs (miRNAs) are an abundant class of highly conserved, non-coding RNA molecules of approximately 22 nucleotides in length that induce mRNA degradation, translational repression or both via pairing with partially complementary sites in the 3′UTR of target genes. The human genome encodes over 2,000 miRNAs, which may target about 60% of all genes. However, despite the abundance of miRNAs, their biomolecular functions and involvement in pathology remain to be fully elucidated. They play a central role in many biological processes including cell cycle, cell metabolism, apoptosis and immune responses, and are attracting increasing interest in clinical research as potential biomarkers for the detection, identification and classification of cancers and other disease states including neurodegenerative diseases.


The present invention was devised with these issues in mind.


SUMMARY

The disclosure provides methods and detection systems relating to diagnosing, monitoring, and treating traumatic brain injury (TBI) including mild traumatic brain injury (mTBI) in a human subject who has suffered an injury to the head by detecting one or more miRNA molecules in a biological sample from the subject. In the context of the following disclosure, the terms ‘level’ and ‘amount’ in reference to the level or amount of an miRNA molecule or molecules in a biological sample are used interchangeably.


In embodiments, the disclosure provides a method of diagnosing and/or monitoring mTBI in a subject, the method comprising determining a level of at least one miRNA in a saliva sample obtained from the subject, wherein the at least one miRNA is selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p, or any combination thereof. In embodiments, an upregulated level of the at least one miRNA is indicative of mTBI. In embodiments, the subject is diagnosed as having mTBI if the level of the at least one miRNA is above a predetermined threshold or increased relative to a control. In embodiments, the predetermined threshold is equivalent to a fold change of 2 or more in the 2-delta delta CT (2-ΔΔCT) method. In embodiments, the at least one miRNA is miR-27b-3p. In embodiments, the at least one miRNA is let-7i-5p. In embodiments, the at least one miRNA is miR-142-3p. In embodiments, the at least one miRNA is miR-107. In embodiments, the at least one miRNA is miR-135b-5p.


In embodiments, the method comprises determining a level of at least two miRNAs in a saliva sample obtained from the subject. In embodiments, the at least two miRNAs are selected from miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 or miR-135b-5p. In embodiments, an upregulated level of the at least two miRNAs is indicative of mTBI. In embodiments, the subject is diagnosed as having mTBI if the level of the at least two miRNAs is above a predetermined threshold or increased relative to a control. In embodiments, the predetermined threshold is equivalent to a fold change of 1.5 or more in the 2-delta delta CT method.


In embodiments, the saliva sample is obtained 24 hours to 15 days after injury. In embodiments, the saliva sample is obtained 24 hours to 7 days after injury. In embodiments, the saliva sample is obtained 2 to 5 days after injury.


In embodiments, the method comprises determining a level of each of the miRNAs miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p.


In embodiments, the method further comprises determining a level of one or more additional miRNAs selected from let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, and miR-424-5p, miR-30a-5p, miR-107, miR-135b-5p, miR-199b-5p, miR-324-5p, or miR-652-3p.


The disclosure also provides a sensor element for a detection system for diagnosing and/or monitoring mTBI, the sensor element comprising a substrate functionalised with a probe specific for at least one of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 or miR-135b-5p. In embodiments, the probe comprises a nucleic acid able to bind to the at least one miRNA. In embodiments, the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complement of the sequence of the target miRNA. In embodiments, the probe comprises a nucleic acid having at least 70% identity with a sequence which is the complement of SEQ ID NO: 25, 26, 35, 39 or 40.


The disclosure also provides a detection system for diagnosing and/or monitoring mTBI, comprising a sensor element as described herein, and a detection device capable of detecting the binding of a target miRNA to the probe. In embodiments, the detection system further comprises a means to determine whether the target miRNA is upregulated.


The disclosure also provides a method for determining a course of action for a subject suspected of having mTBI, comprising applying a saliva sample obtained from the subject to a detection system as described herein, if an upregulated level of the at least one miRNA is detected providing a treatment for mTBI.


The disclosure also provides a method of treating a subject with suspected mTBI, the method comprising i) determining whether an upregulated level of at least one miRNA selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p is detectable in a saliva sample obtained from the subject, and ii) if an upregulated level of at least one miRNA is detected providing treatment for mTBI to the subject.


The disclosure also provides a method of detecting an miRNA in a saliva sample, the method comprising obtaining a saliva sample from a human subject, contacting the saliva sample with at least one oligonucleotide primer complementary to at least one miRNA selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p, amplifying the at least one miRNA using a polymerase chain reaction, and detecting the amplified miRNA.


The disclosure also provides a method of diagnosing and treating mild traumatic brain injury (mTBI) in a human subject in need thereof, wherein the subject in need is one who has received an injury to the head, the method comprising detecting an amount of at least one miRNA in a saliva sample obtained from the subject, wherein the at least one miRNA is selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p; identifying the subject as suffering from mTBI where the amount of the at least one miRNA is increased relative to a predetermined threshold value or relative to the amount of the miRNA in a control sample; and treating the subject identified as suffering from mTBI according to one or more of the following: subjecting the subject to a verbal, cognitive, motor, or optical test, or any combination of the foregoing, subjecting the subject to diagnostic imaging in the form of a CT or MRI, or a combination thereof, administering to the subject one or more neuroprotective therapies.


In embodiments, the saliva sample is obtained 24 hours to 15 days after the injury. In embodiments, the method further comprises obtaining one or more additional saliva samples from the subject at one or more additional times after the injury and repeating the detecting and amplifying steps for each additional sample. In embodiments, the one or more additional saliva samples is obtained at day 2, 3, 5, 7, 10, 14, or 15 after the injury. In embodiments, the detecting an amount of the at least one miRNA is performed using a PCR-based assay. In embodiments, the predetermined threshold is equivalent to a fold change of 1.5 or more using the 2-delta delta CT (2-ΔΔCT) method. In embodiments, the predetermined threshold is equivalent to a fold change of 2 or more using the 2-delta delta CT (2-ΔΔCT) method. In embodiments, the method comprises determining a level of at least two miRNAs in the saliva sample. In embodiments, the at least two miRNAs are selected from miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 or miR-135b-5p. In embodiments, the method comprises determining the amount of each of the miRNAs miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p. In embodiments, the method further comprises determining the amount of one or more additional miRNAs selected from let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, miR-424-5p, miR-30a-5p, miR-107, miR-135b-5p, miR-199b-5p, miR-324-5p, and miR-652-3p.





BRIEF DESCRIPTION OF THE FIGURES


FIG. 1A-1B: miR-425-5p and miR-502 expression in 3 different categories of trauma and HV MiR-425-5p and miR-502 expression in 10 HV, 10 mTBI+EC (1 day), 10 mTBI+EC (15 days), 10 EC (1 day), 10 EC (15 days), 10 sTBI+EC (1 day) and 10 sTBI+EC (15 days) patients, detected by qRT-PCR analysis. MiR-425-5p expression was found to be remarkably decreased in mTBI+EC (1 day) compared to HV (p<0.01), mTBI+EC (15 days) (p<0.001) and sTBI+EC (1 day) (p<0.01) (FIG. 1A). MiR-502 expression was found to be remarkably decreased in mTBI+EC (1 day) compared to HV (p<0.05), mTBI+EC (15 days) (p<0.01) and sTBI+EC (1 day) (p<0.05) (FIG. 1B).



FIG. 2A-2B: miR-21 and miR-335 expression in 3 different categories of trauma and HV MiR-21 and miR-335 expression in 10 HV, 10 mTBI+EC (1 day), 10 mTBI+EC (15 days), 10 EC (1 day), 10 EC (15 days), 10 sTBI+EC (1 day) and 10 sTBI+EC (15 days) patients, detected by qRT-PCR analysis. MiR-21 expression was found to be significantly up-regulated in sTBI+EC (1 day and 15 days) compared to HV (p<0.01) (FIG. 2A). MiR-335 expression was found to be remarkably up-regulated in sTBI+EC (1 day) compared to HV (p<0.001), EC (15 days) (p<0.001) and mTBI+EC (1 day) (p<0.05) (FIG. 2B).



FIG. 3A-3B: Time course of miR-425-5p (FIG. 3A) and miR-502 (FIG. 3B) expression in 3 different categories of trauma and HV. MiR-425-5p and miR-502 expression in 30 HV, 30 mTBI+EC, 30 EC, 30 sTBI+EC patients at different time points from injury (T0, T4-12 h, T48-72 h, 15 days) detected by qRT-PCR analysis. MiR-425-5p expression was found to be remarkably decreased in mTBI+EC at T0 and T4-12 h compared to HV, sTBI+EC and EC (p<0.05). MiR-502 expression was found to be remarkably decreased in mTBI+EC at T0 and T4-12 h compared to HV, sTBI+EC and EC (p<0.05). P values were determined by Tukey's post-hoc test. * significantly different from HV



FIG. 4A-4B: Time course of miR-21 (FIG. 4A) and miR-335 (FIG. 4B) expression in 3 different categories of trauma and HV. MiR-21 and miR-335 expression in 30 HV, 30 mTBI+EC, 30 EC, and 30 sTBI+EC patients at different time points from injury (T0, T4-12 h, T48-72 h, 15 days) detected by qRT-PCR analysis. MiR-21 expression was found to be significantly up-regulated in sTBI+EC at T4-12 h, T48-72 h and 15 days compared to HV (p<0.01). MiR-335 expression was found to be remarkably up-regulated in sTBI+EC at T0, T4-12 h, T48-72 h and 15 days compared to HV and mTBI+EC (p<0.001) but not EC only. P values were determined by Tukey's post-hoc test. * significantly different from HV



FIG. 5: Boxplot of relative expression of the 5 microRNAs which showed a significant upregulation (p<0.05) in the validation group and assessed by RT-PCR. A non parametric test (Mann-Whitney U test) was used to compare the level of microRNAs in the two independent groups.



FIG. 6: Receiver-operating characteristic (ROC) curve and corresponding area under the curve (AUC) statistics for biomarkers identified in the validation cohort.





DETAILED DESCRIPTION

The present invention provides methods of diagnosing or monitoring traumatic brain injury (TBI) in a subject, as well as methods for treating a subject identified as suffering from TBI.


According to a first aspect of the invention, there is provided a method for diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the method comprising detecting the presence of and/or determining a level of at least one miRNA in a sample from the subject.


The at least one miRNA (also referred to herein as “miR”) may be selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g, miR-335, miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625*, miR-671-3p, hsa-let-7c-5p, hsa-let-7i-5p miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, miR-424-5p, miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p; miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629. These miRNAs may be referred to herein as miRNAs of interest or target miRNAs.


In some embodiments, the at least one miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g, miR-335, hsa-miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625*, and miR-671-3p. These microRNAs have been found to be biomarkers expressed in all TBI patients (mild or severe).


In some embodiments, the at least one miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g and miR-335.


In some embodiments, the at least one miRNA is selected from the group consisting of let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, and miR-424-5p; miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p.


In some embodiments, the at least one miRNA is selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p.


In some embodiments, the at least one miRNA is selected from the group consisting of miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-194, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629.


For the avoidance of doubt, it will be understood that “the at least one miRNA is selected from a group of miRNAs”, as used herein, means that the method in question, whether carried out for a diagnostic, prognostic, or therapeutic purpose, can be carried out with any one of the listed miRNAs or with any plurality of the listed miRNAs (e.g., two, three, four, or more of the listed miRNAs). It follows that any one or more of the listed miRNAs may be explicitly excluded. For example, where the at least one miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g and miR-335, the method may include detecting and/or assessing the level of any combination of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, and miR-let-7g to the exclusion of miR-335.


According to an aspect of the invention, there is provided a method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the method comprising determining a level of at least two miRNAs in a sample from the subject, wherein the miRNA is selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p.


According to an aspect of the invention, there is provided a method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the method comprising determining a level of at least one miRNA in a sample from the subject, wherein the miRNA is selected from the group consisting of: miR-425-5p; miR-502; miR-21; and miR-335.


Traumatic brain injury occurs when an external force traumatically injures the brain. There are different systems for classifying TBI based on, for example, severity, type of injury and prognosis. The most commonly used system for classifying TBI is the Glasgow Coma Scale (GCS), which grades a person's level of consciousness on a scale of 3-15 based on verbal, motor, and eye-opening reactions to stimuli. In general, a TBI with a GCS score of 13 or above is defined as mild, 9-12 as moderate and 8 or below as severe. Another system, the Mayo Classification System, has three main classifications including definite moderate-severe TBI, probable mild TBI, and possible TBI. Multiple criteria are used in each diagnosis including loss of consciousness, post-traumatic amnesia, skull fracture, and evidence of neuroradiological abnormalities including subdural haematoma, cerebral contusion, and hemorrhagic contusion. The classification of TBI using the GCS or Mayo systems will be known to those skilled in the art.


As used herein, references to “mild”, “moderate” and “severe” TBI are made in accordance with the GCS. References herein to “moderate-to-severe” TBI encompass both moderate and severe TBI in accordance with the GCS.


As used herein, a reference to mild TBI (mTBI) is also a reference to concussion.


The diagnosis and/or monitoring of TBI using the biomarkers of the present invention is expected to support clinical decision making and treatment regimens in a variety of contexts, including the following situations: as part of the initial assessment by paramedics to determine whether patients should be transported to a facility with neurosurgical expertise, a major trauma centre or a local trauma unit; in the emergency department of hospitals to determine appropriate treatment, including the need for a CT brain scan; pitch-side, to assist decision making as to the removal of a player from play and assessment of the need to take a player to hospital; in sports clinics, to confirm a concussive event and enable decision making with regard to returning to play; in combat situations, to determine the need to dispatch a rescue team and evacuate a victim. Thus, subjects for whom the present invention provides particular benefit include accident victims, sports players and military personnel.


In any case, but perhaps particularly where the subject is at greater risk for a TBI (e.g., where the subject is a professional athlete or enlisted in the military), a sample may be obtained from the subject at a time prior to any known or recent trauma (e.g., near the beginning of a sporting career or prior to a military deployment) and any miRNAs of interest can be assessed at that time or later, when the subject has experienced a possible TBI. Such samples may thereby provide an internal reference standard.


In some embodiments, the subject is human.


The TBI may be mild TBI (mTBI), moderate TBI or severe TBI (sTBI). In some embodiments, the TBI is moderate-to-severe TBI (m-sTBI).


The level of the miRNA or of each miRNA in the sample may be determined quantitatively or semi-quantitatively. By “quantitatively”, it will be understood that the absolute amount or concentration of the miRNA or of each miRNA in the sample is determined. The absolute amount of the miRNA or of each miRNA in the sample can then be compared to a predetermined threshold (e.g. a published literature value for expected normal levels), a known level of the same or a reference miRNA in a control sample taken from a healthy subject, or the amount of a reference miRNA in the sample taken from the subject. In some embodiments, the subject is diagnosed as having a TBI when the level of the miRNA is below the predetermined threshold, or decreased relative to a reference or control sample. In other embodiments, the subject is diagnosed as having a TBI when the level of the miRNA is increased compared to the predetermined threshold.


By “semi-quantitatively”, it will be understood that the level of the or each miRNA of interest is measured relative to a reference.


The reference may be an invariant miRNA, i.e. a miRNA having an expression level that remains substantially unchanged between healthy subjects and those having a TBI. A subject may be diagnosed as suffering from a TBI if the level of the miRNA or of each miRNA of interest is increased or decreased relative to that of an invariant miRNA. Suitable invariant miRNAs include miR-331, miR-223*, miR-23a-3p and miR148b-3p. miR-23a-3p and miR148b-3p are invariant in saliva only.


In some embodiments, the level of the miRNA or of each miRNA in the sample obtained from the subject may be about 0.01 times to about 100 times, about 0.05 times to about 50 times, about 0.1 times to about 10 times, about 0.5 times to about 5 times, about 1.0 to about 3 times, or about 1.5 times to about 2.0 times lower or higher than the level in the control sample, the reference level or the published value.


Where a device or method is employed to generate a value, we may qualify that value with the term “about” in order to capture the stated value and any variation of that value inherent to the device or method employed. Where values or ranges of values are specifically disclosed, “about” may mean plus-or-minus 10% of the stated value or range. For example, about 10 minutes may mean 9-11 minutes.


The level of the miRNA or of each miRNA of interest can be determined using methods known to those skilled in the art. In some embodiments, determining the level of the miRNA or of each miRNA of interest comprises amplifying the miRNA. In some embodiments, total miRNA may be first isolated from the sample using standard techniques, for example using the miRNeasy mini kit (Qiagen). The amount of the miRNA of interest can then be determined. In some embodiments, the level of the miRNA or of each miRNA of interest in the sample is determined using PCR (polymerase chain reaction). For example, quantitative PCR may be used for quantitative determination of the level of the miRNA or of each miRNA of interest.


PCR may also be used for semi-quantitative determination, by comparing the level of the miRNA or of each miRNA of interest in the sample with that of a reference (e.g. an invariant miRNA).


Suitable techniques for miRNA detection and/or quantification, which will be known to those skilled in the art, include qPCR, miRNA assays, next-generation sequencing (NGS), and multiplex miRNA profiling assays.


In some embodiments, the level of the miRNA or of each miRNA of interest is determined using in-situ hybridization, for example using a probe (e.g., a labelled probe) specific for the miRNA.


The level of miRNA may be determined in a sample which was obtained from the subject immediately after injury (i.e. less than 1 hour after injury), and/or in a sample obtained at one or more time points a few hours or days after injury. Thus, changes in the miRNA level can be detected over time to enable monitoring of a TBI. In the event miRNA levels change over time, the methods described herein for monitoring TBI can be expanded to include maintaining or adjusting the subject's treatment regimen accordingly.


Depending on the specific miRNA and the type of TBI, the level of miRNA in the subject may change significantly over time. In some embodiments, it may therefore be advantageous to measure the miRNA relatively soon after injury to enable an accurate diagnosis. In some embodiments, the level of miRNA is determined in a sample obtained from the subject no more than 72 hours, no more than 48 hours, no more than 36 hours, no more than 24 hours, no more than 12 hours, no more than 6 hours, no more than 4 hours, no more than 2 hours or no more than 1 hour after injury.


The level of some miRNAs is substantially stable over time, thus allowing a diagnosis to be made a few hours, days or even weeks after injury. In some embodiments, the level of miRNA is determined in a sample obtained from the subject up to 20, 18, 15, 12, 10, 8, 5 or 2 days from injury.


In some embodiments, the level of miRNA is determined in a sample obtained from the subject immediately after injury (e.g. at T=0 h), at 4-12 hours after injury, at 48-72 hours after injury, or at 15 days after injury.


In some embodiments, the level of miRNA is determined in a sample obtained from the subject at least 24 hours after injury. In some embodiments, the level of miRNA is determined in a sample obtained from the subject 15 days or fewer after injury. In some embodiments, the level of miRNA is determined in a sample obtained from the subject between 24 hours and 15 days after injury, or between 24 hours and 10 days after injury, or between 24 hours and 7 days after injury, or between 48 hours and 5 days after injury.


In some embodiments, the TBI is mild TBI (mTBI) or moderate-to-severe TBI (m-sTBI) and the at least one miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g, miR-335, hsa-miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625*, and miR-671-3p.


In some embodiments, the TBI is mild TBI (mTBI) and the miRNA is selected from the group consisting of miR-425-5p and miR-502. The subject may be diagnosed as having mTBI if the level of miR-425-5p and/or miR-502 is determined to be below a predetermined threshold, or is decreased relative to a reference.


In some embodiments, a level of miR-425-5p and/or miR-502 which is below a predetermined threshold, or decreased relative to a reference, is diagnostic of mTBI when the level is determined in a sample obtained less than 48 hours after injury.


In some embodiments, the TBI is moderate-to-severe TBI (m-sTBI) and the miRNA is selected from the group consisting of miR-21 and miR-335. The subject may be diagnosed as having moderate-to-severe TBI if the level of miR-21 and/or miR-335 is determined to be above a predetermined threshold, or increased relative to a reference.


In some embodiments, a level of miR-21 and/or miR-335 which is above a predetermined threshold, or increased relative to a reference, is diagnostic of moderate-to-severe TBI when the level is determined in a sample obtained up to 15 days after injury.


In some embodiments, the TBI is moderate-to-severe TBI (m-sTBI) and the at least one miRNA is selected from the group consisting of miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-194, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629.


The subject may be diagnosed as having m-sTBI if the level of miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-618, miR-95, miR-130a, miR-152, miR-194, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642 and/or miR-99a is determined to be above a predetermined threshold, or is increased relative to a reference.


The subject may be diagnosed as having m-sTBI if the level of miR-192, miR-429, miR-520D-3p and/or miR-629 is determined to be below a predetermined threshold, or is decreased relative to a reference.


The miRNAs may be used individually to diagnose TBI. For example, in sport concussion, miR-502 or miR-425-5p could be used to confirm that a traumatic brain injury has occurred.


Thus, a further aspect of the present invention is a method of determining the severity of TBI, and the steps of this method can be repeated to monitor the subject over time. It will be appreciated that a positive result for a single miRNA (e.g. the level of a single miRNA is determined to be above/below a predetermined threshold, or is increased/decreased relative to a reference) is sufficient to determine the severity of TBI. For example, if the level of miR-425-5p is below a predetermined threshold, or decreased relative to a reference, the severity of the TBI is determined to be mild (mTBI). However, it may be convenient to combine different miRNAs (e.g. in a test panel) to facilitate the assessment of TBI severity.


In some embodiments, the method comprises determining a level of a plurality (e.g., two or more) miRNAs in the sample. In some embodiments the two or more miRNAs are selected from the group consisting of miR-425-5p; miR-502; miR-21; and miR-335.


In some embodiments, the method comprises determining the level of:


(i) a first miRNA selected from miR-425-5p and miR-502; and


(ii) a second miRNA selected from miR-21 and miR-335.


A subject may be diagnosed as having a TBI if the level of miR-425-5p or miR-502 is determined to be below a predetermined threshold, or is decreased relative to a reference, or the level of miR-21 or miR-335 is determined to be above a predetermined threshold, or increased relative to a reference.


In some embodiments, the TBI is mild TBI (mTBI) and the at least one miRNA is selected from the group consisting of let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miRmmiR-29a-3p, miR-29c-3p, miR-424-5p, miR-30a-5p, miR-107, miR-135b-5p, miR-199b-5p, miR-324-5p, and miR-652-3p, or a combination thereof. The subject may be diagnosed as having mTBI if there is a fold change of at least 0.5, at least 1.0, at least 1.5, at least 2.0, at least 2.5, at least 3.0, at least 3.5 or at least 4.0 in level of the microRNA compared to a reference. In some embodiments, the subject is diagnosed as having mTBI if the level(s) of the microRNA(s) is/are increased compared to a reference.


In some embodiments, the TBI is mTBI or concussion and the at least one miRNA is selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p, or any combination thereof. In embodiments an upregulated level of the at least one miRNA, an increase above a predetermined threshold or an increase relative to a control is indicative of mTBI or concussion.


The sequences and accession numbers for miRNAs described herein are provided in Table 1:











TABLE 1







miRBase


miRNA
sequence
Accession no.







hsa-miR-21
uagcuuaucagacugauguuga (SEQ ID No. 1)
MIMAT0000076





hsa-miR-425-5p
aaugacacgaucacucccguuga (SEQ ID No. 2)
MIMAT0003393





hsa-miR-502-5p (also
auccuugcuaucugggugcua (SEQ ID No. 3)
MIMAT0002873


known as hsa-miR-502)







hsa-miR-335-5p (also
ucaagagcaauaacgaaaaaugu (SEQ ID No. 4)
MIMAT0000765


known as hsa-miR-335)







hsa-miR-301b-3p (also
cagugcaaugauauugucaaagc (SEQ ID No. 5)
MIMAT0004958


known as hsa-miR-301b)







hsa-miR-184
uggacggagaacugauaagggu (SEQ ID No. 6)
MIMAT0000454





hsa-miR-505-3p (also
cgucaacacuugcugguuuccu (SEQ ID No. 7)
MIMAT0002876


known as hsa-miR-505)







hsa-miR-203a-3p (also
gugaaauguuuaggaccacuag (SEQ ID No. 8)
MIMAT0000264


known as hsa-miR-203a,




hsa-miR-203)







hsa-miR-654-3p
uaugucugcugaccaucaccuu (SEQ ID No. 9)
MIMAT0004814





hsa-miR-655-3p (also
auaauacaugguuaaccucuuu (SEQ ID No. 10)
MIMAT0003331


known as hsa-miR-655)







hsa-miR-331-3p (also
gccccugggccuauccuagaa (SEQ ID No. 11)
MIMAT0000760


known as hsa-miR-331)







hsa-miR-223-5p (also
cguguauuugacaagcugaguu (SEQ ID No. 12)
MIMAT0004570


known as hsa-miR-223*)







hsa-miR-let-7g
ugagguaguaguuuguacaguu (SEQ ID No. 13)
MIMAT0000414





hsa-miR-126* (also
cauuauuacuuuugguacgcg (SEQ ID No. 14)
MIMAT0000444


known as hsa-miR-126-




5p)







hsa-miR-193a-5p
ugggucuuugcgggcgagauga (SEQ ID No. 15)
MIMAT0004614





hsa-miR-144*(also
ggauaucaucauauacuguaag (SEQ ID No. 16)
MIMAT0004600


known as hsa-miR-144-




5p)







hsa-miR-190 (also
cuauauaucaaacauauuccu (SEQ ID No. 17)
MIMAT0026482


known as hsa-miR-190a




or hsa-miR-190a-3p)







hsa-miR-194 (also
uguaacagcaacuccaugugga (SEQ ID No. 18)
MIMAT0000460


known as hsa-miR-194-




5p)







hsa-miR-365 (also
uaaugccccuaaaaauccuuau (SEQ ID No. 19)
MIMAT0000710


known as hsa-miR-365a-




3p)







hsa-miR-590-3p(also
uaauuuuauguauaagcuagu (SEQ ID No. 20)
MIMAT0004801


known as hsa-miR-590)







hsa-miR-624
uaguaccaguaccuuguguuca (SEQ ID No. 21)
MI0003638





hsa-miR-625*(also
gacuauagaacuuucccccuca (SEQ ID No. 22)
MIMAT0004808


known as hsa-miR-625-




3p)







hsa-miR-671-3p
uccgguucucagggcuccacc (SEQ ID No. 23)
MIMAT0004819





hsa-let-7c-5p
ugagguaguagguuguaugguu (SEQ ID No. 24)
MIMAT0000064





hsa-let-7i-5p (also
ugagguaguaguuugugcuguu (SEQ ID No. 25)
MIMAT0000415


known as hsa-let-7i)







hsa-miR-142-3p
uguaguguuuccuacuuuaugga (SEQ ID No. 26)
MIMAT0000434





hsa-miR-148a-3p (also
ucagugcacuacagaacuuugu (SEQ ID No. 27)
MIMAT0000243


known as hsa-miR-148a)







hsa-miR-15b-5p (also
uagcagcacaucaugguuuaca (SEQ ID No. 28)
MIMAT0000417


known as hsa-miR-15b)







hsa-miR-16-5p (also
uagcagcacguaaauauuggcg (SEQ ID No. 29)
MIMAT0000069


known as hsa-miR-16)







hsa-miR-181a-5p (also
aacauucaacgcugucggugagu (SEQ ID No. 30)
MIMAT0000256


known as hsa-miR-181a)







hsa-miR-20a-5p (also
uaaagugcuuauagugcagguag (SEQ ID No. 31)
MIMAT0000075


known as hsa-miR-




20; hsa-miR-20a)







hsa-miR-20b-5p (also
caaagugcucauagugcagguag (SEQ ID No. 32)
MIMAT0001413


known as hsa-miR-20b)







hsa-miR-221-3p (also
agcuacauugucugcuggguuuc (SEQ ID No. 33)
MIMAT0000278


known as hsa-miR-221)







hsa-miR-24-3p (also
uggcucaguucagcaggaacag (SEQ ID No. 34)
MIMAT0000080


known as hsa-miR-24)







hsa-miR-27b-3p (also
uucacaguggcuaaguucugc (SEQ ID No. 35)
MIMAT0000419


known as hsa-miR-27b)







hsa-miR-29a-3p (also
uagcaccaucugaaaucgguua (SEQ ID No. 36)
MIMAT0000086


known as hsa-miR-29a)







hsa-miR-29c-3p (also
uagcaccauuugaaaucgguua (SEQ ID No. 37)
MIMAT0000681


known as hsa-miR-29c)







hsa-miR-30a-5p
uguaaacauccucgacuggaag (SEQ ID No. 38)
MIMAT0000087


(also known as hsa-miR-




30a)







hsa-miR-107 (also
agcagcauuguacagggcuauca (SEQ ID No. 39)
MI0000114


known as hsa-miR-107-




10)







hsa-miR-135b-5p (also
uauggcuuuucauuccuauguga (SEQ ID No. 40)
MIMAT0000758


known as hsa-miR-135b)







hsa-miR-199b-5p(also
cccaguguuuagacuaucuguuc (SEQ ID No. 41)
MIMAT0000263


known as hsa-miR-199b)







hsa-miR-324-5p
cgcauccccuagggcauuggugu (SEQ ID No. 42)
MIMAT0000761





hsa-miR-652-3p (also
aauggcgccacuaggguugug (SEQ ID No. 43)
MIMAT0003322


known as hsa-miR-652)







hsa-miR-424-5p(also
cagcagcaauucauguuuugaa (SEQ ID No. 44)
MIMAT0001341


known as hsa-miR-424)







hsa-miR-10a (also
uacccuguagauccgaauuugug (SEQ ID No. 45)
MIMAT0000253


known as hsa-miR-10-




5p)







hsa-miR-132 (also
uaacagucuacagccauggucg (SEQ ID No. 46)
MIMAT0000426


known as hsa-miR-132-




3p)







hsa-miR-223 (also
ugucaguuugucaaauacccca (SEQ ID No. 47)
MIMAT0000280


known as hsa-miR-223-




3p)







hsa-miR-143 (also
ugagaugaagcacuguagcuc (SEQ ID No. 48)
MIMAT0000435


known as hsa-miR-143-




3p)







hsa-miR-148b (also
ucagugcaucacagaacuuugu (SEQ ID No. 49)
MIMAT0000759


known as hsa-miR-148b-




3p)







hsa-miR-18a (also
uaaggugcaucuagugcagauag (SEQ ID No. 50)
MIMAT0000072


known as hsa-miR-




18; hsa-miR-18a-5p)







hsa-miR-192 (also
cugaccuaugaauugacagcc (SEQ ID No. 51)
MIMAT0000222


known as hsa-miR-192-




5p)







hsa-miR-429
uaauacugucugguaaaaccgu (SEQ ID No. 52)
MIMAT0001536





hsa-miR-618
aaacucuacuuguccuucugagu (SEQ ID No. 53)
MIMAT0003287





hsa-miR-95 (also known
ucaauaaaugucuguugaauu (SEQ ID No. 54)
MIMAT0026473


as hsa-miR-95-5p)







hsa-miR-130a (also
cagugcaauguuaaaagggcau (SEQ ID No. 55)
MIMAT0000425


known as hsa-miR-130a-




3p)







hsa-miR-152 (also
agguucugugauacacuccgacu (SEQ ID No. 56)
MIMAT0026479


known as hsa-miR-152-




5p)







hsa-miR-27b (also
uucacaguggcuaaguucugc (SEQ ID No. 57)
MIMAT0000419


known as hsa-miR-27b-




3p)







hsa-miR-301 (also
cagugcaauaguauugucaaagc (SEQ ID No. 58)
MIMAT0000688


known as hsa-miR-301a-




3p or hsa-miR-301a)







hsa-miR-326
ccucugggcccuuccuccag (SEQ ID No. 59)
MIMAT0000756





hsa-miR-345 (also
gcugacuccuaguccagggcuc (SEQ ID No. 60)
MIMAT0000772


known as hsa-miR-345-




5p)







hsa-miR-361 (also
uuaucagaaucuccagggguac (SEQ ID No. 61)
MIMAT0000703


known as hsa-miR-361-




5p)







hsa-miR-422a
acuggacuuagggucagaaggc (SEQ ID No. 62)
MIMAT0001339





hsa-miR-579 (also
uucauuugguauaaaccgcgauu (SEQ ID No. 63)
MIMAT0003244


known as hsa-miR-579-




3p)







hsa-miR-642 (also
gucccucuccaaaugugucuug (SEQ ID No. 64)
MIMAT0003312


known as hsa-miR-642a-




5p; hsa-miR-642)







hsa-miR-99a (also
aacccguagauccgaucuugug (SEQ ID No. 65)
MIMAT0000097


known as hsa-miR-99a-




5p)







hsa-miR-520D-3p (also
aaagugcuucucuuuggugggu (SEQ ID No. 66)
MIMAT0002856


know as hsa-miR-520D)







hsa-miR-629 (also
uggguuuacguugggagaacu (SEQ ID No. 67)
MIMAT0004810


known as hsa-miR-629-




5p)







hsa-miR-23a-3p (also
aucacauugccagggauuucc (SEQ ID No. 68)
MIMAT0000078


known as hsa-miR-23a)







hsa-miR-148b-3p (also
ucagugcaucacagaacuuugu (SEQ ID No. 69)
MIMAT0000759


known as hsa-miR-148b)









Conveniently the sample may be any appropriate fluid or tissue sample obtained from the subject. For example, the biological sample may comprise at least one of the group consisting of: urine, saliva, whole blood, plasma, serum, sputum, semen, faeces, a nasal swab, tears, a vaginal swab, a rectal swab, a cervical smear, a tissue biopsy, and a urethral swab. In some embodiments the sample is a fluid sample. Suitably, the sample is one that can be readily obtained from the individual, such as urine, saliva, blood and sputum. In some embodiments, the sample comprises saliva, blood, plasma or serum. It will be appreciated that in some embodiments the process of obtaining the sample does not form part of the invention described herein.


In some embodiments, the sample comprises or is constituted by serum. Not only does serum have practical advantages, but it is also free of anticoagulants such as heparin, a potential inhibitor of PCR reactions. Serum may also be less affected by haemolysis, compared to plasma.


In some embodiments, the sample is saliva. Saliva can be easily obtained from the patient (e.g. pitch-side, or in the field), without specialist training or medical equipment.


miRNAs which have been found to be indicative of mTBI in saliva include: hsa-let-7ca-5p, hsa-let-7i-5p, hsa-miR-1421-3p, hsa-miR-148a-3p, hsa-miR-15b-5p, hsa-miR-16-5p, hsa-miR-181a-5p, hsa-miR-20a-5p, hsa-miR-20b-5p, hsa-miR-221-3p, hsa-miR-24-3p, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-340-5p, hsa-miR-424-5p; miR-30a-5p; miR-107; miR-135b-5p; miR-199b is selected from the group consisting of −5p; miR-324-5p; and miR-652-3p.


miRNAs which have been found to be indicative of mTBI in saliva include: miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p.


The present invention provides a method of diagnosing and/or monitoring mild traumatic brain injury (mTBI) in a subject, the method comprising determining a level of at least one miRNA in a saliva sample obtained from the subject, wherein the at least one miRNA is selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p, or any combination thereof.


Optionally the at least one miRNA is miR-27b-3p. Alternatively the at least one miRNA is let-7i-5p. Conveniently, the at least one miRNA is miR-142-3p. In embodiments the at least one miRNA is miR-107. In other embodiments the at least one miRNA is miR-135b-5p.


In embodiments, an upregulated level in saliva of the at least one miRNA selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p is indicative of mTBI or concussion. In embodiments, the subject is diagnosed as having mTBI if the level of the at least one miRNA is above a predetermined threshold or increased relative to a control.


An upregulated level indicative of mTBI can be equivalent to a fold change of 2.0 or more obtained via the 2-ΔΔCT method. In embodiments an upregulated level indicative of mTBI can be equivalent to a fold change of 2.0 or more obtained via the 2-ΔΔCT method for at least one miRNA selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p.


The method of diagnosing and/or monitoring mTBI in a subject can comprise contacting a saliva sample obtained from the subject with at least one miRNA-specific oligonucleotide probe having at least 70% identity to the complement of a sequence selected from SEQ ID Nos: 25, 26, 35, 39 or 40.


The method can further comprise quantifying the at least one miRNA-specific oligonucleotide probe and comparing said expression level to a reference miRNA or a control expression level obtained or derived from a healthy subject. A 1.5 fold or greater difference, such as a 2.0 fold or greater difference, between the subject and the control is indicative of mTBI.


The methods of the present invention may comprise determining a level of at least a second miRNA in the saliva sample obtained from the subject.


The methods of the present invention may comprise determining a level of at least two miRNAs in the saliva sample obtained from the subject. In embodiments a first of the at least two miRNAs are selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p. In embodiments the at least two miRNAs are selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p.


Optionally, the at least two miRNAs are let-7i-5p and miR-142-3p.


Alternatively the at least two miRNAs are let-7i-5p and miR-27b-3p.


Conveniently the at least two miRNAs are let-7i-5p and miR-107.


In embodiments the at least two miRNAs are let-7i-miR-135b-5p.


In further embodiments the at least two miRNAs are miR-142-3p and miR-27b-3p.


Optionally, the at least two miRNAs are miR-142-3p and miR-107.


Alternatively the at least two miRNAs are miR-142-3p and miR-135b-5p.


Conveniently the at least two miRNAs are miR-27b-3p and miR-107.


In embodiments the at least two miRNAs are miR27b-3p and miR-135b-5p.


In further embodiments the at least two miRNAs are miR-107 and miR-135b-5p.


In embodiments the method includes determining a level of the miRNAs miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p.


In embodiments the method further comprises determining a level of one or more additional miRNAs selected from the group consisting of let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, and miR-424-5p, miR-30a-5p, miR-107, miR-135b-5p, miR-199b-5p, miR-324-5p and miR-652-3p.


An upregulated level of two or more miRNAs indicative of mTBI can be equivalent to a fold change of 1.5 or more, or 2.0 or more, for example obtained via the 2-ΔΔCT method (also referred to as the ‘double delta Ct method’ or the ‘2 delta Ct method’ where the method of detection is a quantitative polymerase chain reaction (“PCR”) based method.


In embodiments, the level of miRNA is determined in a saliva sample obtained from the subject at least 24 hours after injury. In some embodiments, the level of miRNA is determined in a saliva sample obtained from the subject 15 days or fewer after injury. In some embodiments, the level of miRNA is determined in a saliva sample obtained from the subject between 24 hours and 15 days after injury, or between 24 hours and 10 days after injury, or between 24 hours and 7 days after injury, or between 48 hours and 5 days after injury.


Levels of miRNAs may be used to track recovery of a subject from injury. Thus, the present invention encompasses monitoring the recovery of a subject from TBI, as an alternative or in addition to the initial diagnosis.


In some embodiments, the method comprises monitoring TBI and the level of the at least one miRNA is determined in a sample obtained from the subject at least 2, at least 3, at least 5, at least 7, at least 10 or at least 14 days after injury. In some embodiments, the level of the at least one miRNA is determined in a sample obtained from the subject 15 days after injury. In some embodiments, the level of the at least one miRNA is determined in at least two samples obtained at different time intervals after injury, thus allowing recovery to be monitored. For example, miRNA levels could be determined at 7 and 14 days following injury, or at 5, 10 and 15 days following injury. A return of miRNA levels to normal may be indicative of recovery of the subject from the TBI.


In some embodiments, a subject is determined to have recovered from mTBI if the level of miR-425-5p and/or miR-502 is no longer below a predetermined threshold or no longer decreased relative to a reference.


In some embodiments, a subject is determined to have recovered from moderate-to-severe TBI if the level of miR-21 and/or miR-335 is no longer above a predetermined threshold or no longer increased relative to a reference.


The diagnosis of a subject as suffering from a TBI, and in particular diagnosis of mild TBI or moderate-to-severe TBI, may facilitate in the determination of an appropriate treatment. The present invention thus provides a test that enables healthcare workers, such as physicians, clinicians, paramedics, and even non-medical personnel (e.g. teachers, sports coaches, military personnel) to decide on appropriate action for a subject suspected of having a TBI. A subject determined as having a TBI may therefore receive the most appropriate treatment as a result of a diagnosis being made. The method of the invention may thus further comprise directing appropriate therapy to a subject diagnosed with a TBI.


A subject diagnosed with TBI may be further evaluated, e.g. by CT scanning. In some embodiments, the subject is admitted to hospital. In some embodiments, if moderate-to-severe TBI can be ruled out, the subject may not need to be admitted to hospital for evaluation. A subject diagnosed with moderate-to-severe TBI may be admitted to hospital, or a specialist centre with neurotrauma expertise.


A subject diagnosed with a TBI (particularly mTBI) outside a hospital environment, for example, at a sporting event, during combat or during play, may be removed from play or combat immediately. The subject may subsequently be started on a graduated return to play or combat.


In a further aspect, there is provided a method for determining whether it is appropriate to administer to a subject a therapy for alleviating TBI, the method comprising: determining a level of at least one miRNA in a sample from the subject; and determining whether or not it is appropriate to administer a therapy for alleviating TBI, based on the level of the at least one miRNA.


It will be appreciated that the step of administering the therapy to the subject does not form a part of the claimed method, unless specifically stated.


In some embodiments the method may further comprise administering to the subject an appropriate treatment. In some embodiments, the treatment may comprise a therapy for alleviating TBI. Accordingly, the invention features methods of diagnosing and treating TBI in a subject, the method comprising the steps of (a) obtaining a sample (e.g., a sample of blood, plasma, urine, or saliva) from the subject; (b) detecting one or more miRNAs (selected from those described herein); diagnosing the patient as having a TBI when the level(s) of the miRNA(s) differ from a reference standard (as described herein); and administering a treatment for the TBI.


In a further aspect, the invention provides a method of determining an appropriate treatment to a subject suspected of suffering from a TBI, the method comprising identifying whether or not the subject has a TBI by determining a level of at least one miRNA in a sample from the subject.


If a subject is identified as having a TBI, an appropriate treatment may include one or more of the following: further evaluating the subject, for example by further tests (e.g. verbal, cognitive, motor and/or optical tests), CT and/or MRI scanning; removing the subject from activity (e.g. the activity during which the TBI was incurred); admitting the subject to hospital or a specialist clinic; surgery; and administering a therapy for alleviating TBI to the subject.


The therapy for alleviating TBI may include neuroprotective drugs, e.g. drugs to treat cerebral swelling such as mannitol and hypertonic saline, and/or other neuroprotective measures, such as avoidance of hypertensive resuscitation and the use of sedation.


In some embodiments, the subject may be subsequently monitored to track their recovery, for example in a hospital or clinic setting.


According to a further aspect of the invention, there is provided a method of detecting and/or determining a level of a target miRNA in a subject, the method comprising the steps of (a) obtaining a sample from the subject; and (b) detecting and/or determining the level of the target miRNA in the sample by contacting the sample with a probe that is specific for the target miRNA.


The sample may be any appropriate fluid or tissue sample obtained from the subject, as defined above. In some embodiments, the sample is blood, serum, plasma, urine or saliva.


In some embodiments, the method may comprise determining the level of two or more target miRNAs in the sample.


According to a further aspect of the invention, there is provided a therapy for alleviating TBI for use in a method of treating a subject in need thereof, wherein said subject is identified as having a TBI by determining a level of at least one miRNA in a sample from the subject.


The step of determining the level of the target miRNA may comprise contacting the sample with a substrate functionalized with the probe, for example a chip comprising the probe. The substrate or chip may conveniently include multiple probes, each specific for a different target miRNA.


The subject may have suffered an injury, in particular a head injury. The subject may be suspected as having a TBI. The subject may be suspected of having mTBI or concussion. In some embodiments, the sample is obtained no more than 72 hours, no more than 48 hours, no more than 36 hours, no more than 24 hours, no more than 12 hours, no more than 6 hours, no more than 4 hours, no more than 2 hours or no more than 1 hour after injury. In some embodiments the sample is obtained 24 hours or more after the injury. In further embodiments the sample is obtained from the subject 15 days or fewer after injury. In some embodiments the sample is obtained from the subject between 24 hours and 15 days after injury, or between 24 hours and 10 days after injury, or between 24 hours and 7 days after injury, or between 48 hours and 5 days after injury.


In some embodiments, the method further comprises treating the subject. The treatment may include one or more of the following: further evaluating the subject, for example by further tests (e.g. verbal, cognitive, motor and/or optical tests), CT and/or MRI scanning; removing the subject from activity (e.g. the activity during which the TBI was incurred); admitting the subject to hospital or a specialist clinic; and administering a therapy for alleviating TBI to the subject. In some embodiments, the treatment comprises administering an effective amount of a neuroprotective drug.


Thus, in yet a further aspect the invention provides a method of treating TBI, the method comprising:


determining a level of at least one miRNA in a sample from the subject; and


if the level of the at least one miRNA is indicative of mTBI, administering a treatment appropriate for mTBI; or


if the level of the at least one miRNA is indicative of m-sTBI, administering a treatment appropriate for m-sTBI.


It will be appreciated by those skilled in the art that different treatment pathways may be used for mTBI and m-sTBI.


In yet a further aspect the invention provides a method of treating a subject with suspected mTBI, the method comprising:


i) determining whether an upregulated level of at least one miRNA selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p is detectable in a saliva sample obtained from the subject, and


ii) if an upregulated level of at least one miRNA is detected providing a treatment for mTBI to the subject.


A subject with mTBI may be treated as follows:


An athlete diagnosed with mTBI would typically be started on a graduated return to play protocol (as defined by the Berlin Consensus Conference on Concussion and individual sport authorities, e.g. RFU). This would involve a period of rest followed by a gradual increase in level of exertion and exposure to contact. An athlete with mTBI would typically not be able to play for a period that varies between 6 and 23 days, depending on level of medical supervision and age. Conversely, if mTBI was excluded, the athlete would not have any restrictions and could train as normal the following day.


If diagnosed in a pre-hospital setting, mTBI would be an indication for a patient to seek medical attention (e.g. in hospital or in primary care), whereas, if mTBI was excluded no medical review would be indicated.


A person with mTBI must not be left unsupervised for 24-48 hours and must not drive or operate a fork lift or open machinery until recovered.


Military personnel diagnosed with mTBI would be removed from the operational theatre and would be rested, whereas, if mTBI could be excluded, that person would continue on active duties.


In the NHS, a person with mTBI may be kept in hospital for observation or may have a CT scan according to the guidance issued by NICE, whereas if mTBI could be excluded, that patient could be discharged straightaway.


A person diagnosed with mTBI would typically be asked not to return to work or study for a certain period of time.


A person diagnosed with mTBI may be referred to a mild TBI clinic or a neurology clinic or a neurosurgery clinic. Typical interventions for mTBI consist of education, advice in regard to work, study and driving, medical management of typical sequelae such as headache or anxiety or mood disorder or post-traumatic stress disorder with medication and/or psychological intervention if necessary, and referral to other services as indicated, e.g. neuropsychology, neurovestibular or ophthalmology.


A patient with mTBI would need to be monitored for delayed post-traumatic pituitary dysfunction according to the guidance issued by the Society of British Neurological Surgeons.


In the medico-legal context, the diagnosis of mTBI is often unclear and speculative, as the radiological investigations are typically normal and symptoms are non-specific. Objective confirmation of mTBI may lead to an award for damages and care needs. An appropriate treatment for mTBI may include: removing the subject from activity; treatment in situ or in the community; further evaluating the subject in hospital without overnight admission (typically mTBI patients are discharged with promptly with head injury advice); or admission to hospital for a period of observation (typically 1-2 days). The subject may be further evaluated using tests (e.g. verbal, cognitive, motor and/or optical tests). CT scanning is generally only required if certain indications are present, including suspected skull fracture, post-traumatic seizure, focal neurological deficit, repeated vomiting, a GCS score of less than 13 on initial assessment (less than 14 for children, or less than 15 for infants under 1 year), in accordance with NICE guidelines.


An appropriate treatment for m-sTBI may include: MRI or CT scanning (particularly within 1 hour of injury); admission to hospital (which may include admission to intensive care and/or transfer to a specialist clinic or major trauma centre with neurosurgical facilities); neuromonitoring; surgery; administering a therapy for alleviating TBI, such as administering neuroprotective drugs, e.g. drugs to treat cerebral swelling such as mannitol and hypertonic saline, and/or other neuroprotective measures, such as avoidance of hypertensive resuscitation and the use of sedation.


Thus, the present invention enables subjects with a TBI to be quickly stratified into mTBI or m-sTBI, so that they may receive the most appropriate treatment.


According to a further aspect of the invention, there is provided a detection system for diagnosing and/or monitoring TBI, the detection system comprising a sensor element comprising a substrate functionalized with a probe specific for a target miRNA The detection system can further comprise a detection device that is capable of detecting the binding of a target miRNA to the probe.


According to a yet further aspect of the invention, there is provided a sensor element for use in a detection system for diagnosing and/or monitoring TBI, the sensor element comprising a substrate functionalized with a probe specific for a target miRNA.


The sensor element may further comprise a sample addition zone for receiving a sample (e.g. a fluid sample) thereon.


The probe is capable of selectively binding the miRNA of interest. The substrate may be functionalized with a plurality of probes. The probes may all be the same, or two or more different probes may be provided. For example, in some embodiments, the substrate may be functionalized with a first probe specific for a first miRNA, and a second probe specific for a second miRNA. The first and second probes may be grouped together, for example on different portions of the sensor element.


In a further aspect of the invention, there is provided a composition for use in a method of diagnosing and/or monitoring traumatic brain injury (TBI) in a subject, the composition comprising a probe specific for a target miRNA. The composition may comprise any one of the listed miRNAs or with any plurality of the listed miRNAs (e.g., two, three, four, or more of the listed miRNAs).


In some embodiments, the target miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g, miR-335, miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625*, miR-671-3p, hsa-let-7c-5p, hsa-let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p, miR-424-5p, miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629.


In some embodiments, the target miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g, miR-335, hsa-miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625*, and miR-671-3p. These microRNAs have been found to be biomarkers expressed in all TBI patients (mild or severe).


In some embodiments, the target miRNA is selected from the group consisting of miR-505, miR-203, miR-654-3p, miR-655, miR-184, miR-301b, miR-425-5p, miR-502, miR-21, miR-let-7g and miR-335.


In some embodiments, the target miRNA is selected from the group consisting of let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, and miR-424-5p; miR-30a-5p; miR-107; miR-135b-5p; miR-199b-5p; miR-324-5p; miR-652-3p.


In some embodiments the target miRNA is selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p. In some embodiments at two target miRNAs are selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p


In some embodiments, the target miRNA is selected from the group consisting of miR-10a, miR-132, miR-223, miR-143, miR-148b, miR-18a, miR-192, miR-429, miR-618, miR-95, miR-130a, miR-152, miR-194, miR-27b, miR-301, miR-326, miR-345, miR-361, miR-422a, miR-579, miR-642, miR-99a, miR-520D-3p and miR-629.


In some embodiments, the target miRNA is selected from the group consisting of miR-425-5p, miR-502, miR-21 and miR-335.


The probe may comprise a biological molecule such as a protein (e.g. an antibody) or a nucleic acid. In some embodiments, the probe comprises a nucleic acid. The nucleic acid may comprise a sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to a sequence which is the complement of the full-length sequence of the target miRNA. In some embodiments, the nucleic acid comprises a sequence which is 100% identical to a sequence which is the complement of the sequence of the target miRNA (i.e. the receptor comprises a nucleic acid sequence which is the exact complement of the target miRNA sequence).


The probes may be attached to a surface of the substrate by any suitable means, such as by coupling chemistry known to those skilled in the art. In some embodiments, each probe is attached to a surface of the substrate via a linker. In some embodiments, the probe comprises a moiety for immobilizing the probe on the substrate, or for attaching the probe to a linker immobilized on the substrate.


Alternatively or in addition, the probe may comprise a detectable label. The detectable label may be, for example, radioactive, fluorescent, luminescent, or antibody-based (e.g., it may constitute a conventional tetrameric antibody or a detectable fragment thereof).


The substrate of the sensor element may be formed from any suitable material. In some embodiments, the substrate comprises or is formed from metal, plastic, glass, silica, silicon, graphite, graphene, or any combination thereof. In some embodiments, the substrate comprises multiple layers. For example, a substrate may be prepared by forming a surface or layer of graphene on a layer of silicon carbide or silica. The graphene surface may be chemically modified, for example to graphene-oxide (GO) or graphene-amine (GA). Methods for forming graphene layers, such as epitaxial growth and sublimation growth, will be known to those skilled in the art.


Conveniently, probes comprising or constituted by a nucleic acid can be attached to a GO surface via a linker, using an amide coupling reagent (e.g. (O-(7-azabenzotriazole-1-yl)-N,N,N,N′-tetramethyluronium hexafluorophosphate (HATU)). A sensor element comprising a surface functionalized with a nucleic acid probe can then be used to selectively detect its complementary miRNA.


Suitable linkers may comprise an aniline moiety (or a derivative thereof), a benzoic acid moiety (or a derivative thereof) or an ethendiamine moiety (or a derivative thereof). An aniline linker may be formed by attaching a nitrobenzene molecule (or derivative) to a graphene surface (e.g. using a diazonium salt), and reducing the nitrobenzene to aniline. The amine group of the aniline may then be used to attach to the probe. Similarly, a diazonium salt (e.g. 4-benzoic acid diazonium tetrafluoroborate) can be used to attach a benzoic acid or benzoic acid derivative to a graphene surface. An ethanediamine moiety may be attached to carboxylated graphene or graphene oxide.


The sensor element may be comprised within a test strip. The test strip may be disposable.


The detection device may be configured to detect the binding of a target miRNA to the receptor by any suitable means known to those skilled in the art, for example by detecting changes in electrical impedance, hydrogen ion concentration, or conformational changes resulting from hybridisation.


The detection device may further include a user interface to output data to a user.


In some embodiments, the detection device includes a database of treatment information. The device may be capable of identifying suitable treatment options from the database depending on the levels of the miRNA of interest. The treatment information may be provided to the user via the user interface.


Conveniently, the detection device may be portable, e.g. hand-held. The detection device may comprise a data storage unit for storing miRNA levels and other information relating to the subject. In some embodiments, the device comprises a data communication means for communicating data to other devices. For example, the device may communicate data wirelessly through WiFi, 3G, 4G, Bluetooth, or through a mobile app. This may conveniently enable the data to be easily accessed by medical professionals if necessary.


It is thus envisaged that the detection device of the invention provides an affordable, portable, point of care means for diagnosing and monitoring TBI non-invasively. The device may be used by ambulance crews, the military, schools, sports clubs and healthcare professionals, enabling the correct assessment and triage of patients suspected to have a TBI.


A further aspect of the present invention is a system for detecting and/or monitoring mTBI in a subject.


A type of detection system is based on complementarity between a target miRNA and a nucleic acid probe, generally an oligonucleotide probe. Therefore the present invention embraces a detection system for detecting and/or monitoring mTBI in a subject comprising a substrate functionalised with an oligonucleotide capable of binding to at least one of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 or miR-135b-5p. The oligonucleotide can have a sequence complementary to at least a portion of at least one of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 or miR-135b-5p, or the oligonucleotide can have a sequence complementary to at least a portion of SEQ ID NO: 25, 26, 35, 39 or 40. The complementary or base pairing region can be 7 or 8 or more nucleotides in length. In embodiments the complementary or base pairing region can be 9, 10, 12, 15 or more nucleotides in length or the complementary or base pairing region can be the full length of the miRNA. The substrate functionalised with an oligonucleotide can be a bead or a nanoparticle. The detection system can have further components capable of converting bound nucleic acid probe-miRNA into a detectable signal.


Another type of detection system is based on RT-PCT. Therefore the present invention embraces a detection system for detecting and/or monitoring mTBI in a subject comprising a primer pair designed for amplification of a cDNA complement of at least one miRNA selected from the group consisting of miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 or miR-135b-5p.


In a further aspect there is provided a kit for use in the present methods. The kit may comprise at least probe (e.g. a protein, such as an antibody, or a nucleic acid) which is capable of selectively binding the miRNA of interest. In some embodiments, the kit comprises an array comprising a plurality of probes. In some embodiments, the at least one probe is a primer for carrying out PCR. The kit may further comprise instructions for use, for example instructions for use in the diagnosis and/or monitoring of TBI. The kit may further comprise suitable buffers and reagents, such as amplification primers and enzymes (e.g. DNA polymerase, reverse transcriptase for conversion of miRNA to cDNA).


It will be appreciated that statements made herein in relation to any aspect of the invention may equally apply to any other aspect of the invention, as appropriate.


DETAILED DESCRIPTION OF THE INVENTION

Embodiments of the invention will now be described by way of example and with reference to the accompanying Figures.


EXAMPLES

As miRNAs are emerging as promising biomarkers in a range of different pathologies, the present inventors sought to explore their role in TBI.


Example 1

Materials and Methods


Patients and Samples Collection


Study participants were recruited from the Surgical Reconstruction and Microbiology Research Centre (SRMRC) at Queen Elizabeth Hospital of Birmingham (UK) as part of Brain Biomarkers after Trauma (The Golden Hour Study) study (Ethics Ref. 13/WA/0399).


First, we performed screening of 754 miRNAs in 5 mTBI with extra-cranial injury (EC) patients, 5 sTBI+EC injury patients and healthy volunteers (HV) at 1 day and 15 days from injury with the aim to select specific candidate biomarkers able to discriminate mild from severe TBI and predict the recovery of mTBI after 15 days. Based on this information (Table 2), it was then possible to confirm the results study in an enlarged cohort of patients of 40 individuals grouped in 4 different categories: HV (n=10), EC (n=10), mTBI+EC (n=10), sTBI+EC (n=10). Healthy volunteers were consented and enrolled in the RECOS study. EC injury patients had radiographically-confirmed fractures, no head trauma, no infection, no history of neurological or psychiatric disorders and no alcohol or drug dependency. Mild TBI with EC included those with a non-penetrating head trauma and Glasgow Coma Scale (GCS) score >13. Severe TBI with EC included patients with GCS score of 8 or below. All patients were gender and age matched to HVs.


Sample Processing


Peripheral blood samples were taken at 1 day and 15 days from injury in each patient. The blood samples were processed for serum isolation within 2 h after withdrawal. Whole blood was left to stand for about 30′ at room temperature before being centrifuged at 3000 rpm for 10′ at 4° C. Serum was divided into aliquots and stored at −80° C. until analysis.


RNA Isolation, Reverse Transcription and miRNAs Profiling by TaqMan Low Density Array (TLDA)


Initial screening (discovery set) were performed on 5 mTBI+EC and 5 sTBI+EC patients, which were compared to HV at the two different time points (1 day and 15 days from the injury). The serum of these patients was used to profile the transcriptome of 754 miRNAs. Serum samples were centrifuged at 2000 rpm for 10′ to pellet and remove any circulating cell or debris. MiRNAs were extracted from 400 μl of serum samples by using Qiagen miRNeasy mini kit (Qiagen, GmbH, Hilden, Germany), according to Qiagen supplementary protocol for purification of small RNAs from serum and plasma and finally eluted in 30 μl volume of RNase free water. The concentration and purity of the resulting RNA was determined with a ND-1000 UV-Vis Spectrophotometer (NanoDrop). 20 ng of serum RNAs was retrotranscribed and pre-amplified, according to the manufacturer's instructions. Pre-amplified products were loaded onto TLDAs, TaqMan Human MicroRNA Array v3.0 A and B (Applied Biosystems LifeTechnologies™). PCRs on TLDAs were performed on 7900HT Fast RealTime PCR System (Applied Biosystem, LifeTechnologies™)


Data Analysis


To obtain an accurate miRNA profiling, we used the global median normalization method. Similar to microarray analysis, Ct values from each sample were normalized to the median Ct of the array. Moreover, by computing the Pearson correlation among the Ct medians and means of each array and Ct of each miRNA, we identified two miRNAs that showed an expression profile close to the median and mean of TLDAs, i.e., miR-331 and miR-223*. These miRNAs were also confirmed to be among the most stable in TLDAs by applying two different methods [DataAssistv.3software (Applied Biosystem Life Technologies™)] and geNorm Algorithm. Accordingly, miR-331 and miR-223* were used as reference genes for validation by single TaqMan assays. Expression fold changes were calculated by the 2-ΔΔCT method. Differentially expressed miRNAs (DE miRNAs) were identified by Significance of Microarrays Analysis (SAM) computed by Multi experiment viewer v4.8.1, applying a two-class unpaired test among ΔCts and using a p-value based on 100 permutations; imputation engine: K-nearest neighbours (10 neighbours); false discovery rate<0.15 was used as correction for multiple comparisons. We accepted as reliable only DE miRNAs concordant by using all endogenous controls.


Single TaqMan Assays


Ten differentially expressed miRNAs were chosen from the arrays as potential candidate biomarkers with the aim to discriminate mild from severe TBI and to monitor the recovery of mild TBI. These candidates were used to validate the data in an enlarged cohort of 30 patients (validation set) grouped in 3 different categories (mTBI+EC, sTBI+EC and EC only) and 10 controls (HV) at two different time points (1 and 15 days from injury) by single TaqMan assays (Applied Biosystems, Life Technologies™). Samples were extracted and retrotrascribed as described above and RT-qPCR analysis was performed in Bio-Rad iQ5 Real-time PCR Detection System (Bio-Rad, CA, USA). Expression fold changes were calculated by the 2-ΔΔCT method.


Statistical Analysis


The data were check for normal distribution and transformed to perform parametric tests. Comparisons across groups at each time and within groups over time were performed by the one-way analysis of variance and Tukey's post-hoc test on transformed data. A receiver operating characteristic analysis was utilised to calculate sensitivity and specificity of each biomarker in diagnosing either mTBI or sTBI expressed as area under the curve (AUC). All analyses were carried on SPSS v.20 (IBM). Differences were considered as statistically significant at p-value <0.05.


Results


Expression Profiles by TaqMan Low Density Arrays (TLDA)


From 754 screenable miRNAs of TLDA, we identified ten circulating miRNAs at 1 day and 13 at 15 days in mTBI+EC, 19 at 1 day and 22 at 15 days in sTBI+EC differentially expressed (Table 2). From this list, hsa-miR-126*, miR-193a-5p, miR-144*, miR-190, miR-194, miR-365, miR-590-3p, miR-624, miR-625* and miR-671-3p were excluded for further analysis because they were expressed in most of the patients, hence not suitable candidate biomarkers for mild or severe trauma only. However, the above microRNAs can identify TBI of any severity and are therefore useful TBI biomarkers. On the other hand, miR-184, miR-301b, miR-502 and miR-505 uniquely and differentially expressed in mTBI+EC at 1 day, were selected as early candidate biomarkers of mTBI. In addition, miR-203, miR-425-5p, miR-654-3p and miR-655 differentially expressed at 15 days post mTBI+EC were selected as candidate biomarkers able to track the recovery of mTBI.


Finally, two miRNAs, miR-21 and miR-335, constantly expressed at both time points in sTBI+EC, were selected for further studies.









TABLE 2







Fold change of microRNAs differentially expressed in


5 mTBI + EC (1 and 15 days) and 5 sTBI + EC


(1 and 15 days) patients, compared to 5 HV and detected by TLDA.










mTBI + EC 1
mTBI + EC 15
sTBI + EC 1
sTBI + EC 15


day VS HV
days VS HV
day VS HV
days VS HV

















hsa-miR-
0.1383
hsa-miR-
24.901
hsa-let-7g
0.3250
hsa-miR-
14.979


184

193a-5p



130a


hsa-miR-
0.1278
hsa-miR-
20.946
hsa-miR-
11.953
hsa-miR-
9.8921


190

194

10a

152


hsa-miR-
0.0798
hsa-miR-
4.1763
hsa-miR-
8.1875
hsa-miR-
0.0277


425-5p

203

132

190


hsa-miR-
0.0538
hsa-miR-
3.7087
hsa-miR-
26.193
hsa-miR-
13.655


502

365

143

193a-5p


hsa-miR-
7.7696
hsa-miR-
3.0166
hsa-miR-
20.095
hsa-miR-
12.301


505

425-5p

148b

194


hsa-miR-
0.1570
hsa-miR-
0.0878
hsa-miR-
26.806
hsa-miR-
12.662


126*

654-3p

18a

21


hsa-miR-
0.2758
hsa-miR-
0.0756
hsa-miR-
0.0634
hsa-miR-
18.977


144*

655

190

27b


hsa-miR-
0.3842
hsa-miR-
4.0584
hsa-miR-
0.2245
hsa-miR-
21.954


590-3p

671-3p

192

301


hsa-miR-
0.0836
hsa-miR-
0.2978
hsa-miR-
29.785
hsa-miR-
93.099


624

126*

193a-5p

326


hsa-miR-
0.0435
hsa-miR-
0.2645
hsa-miR-
7.1654
hsa-miR-
45.050


301b

144*

21

335




hsa-miR-
0.3035
hsa-miR-
4.6799
hsa-miR-
37.699




590-3p

223

345




hsa-miR-
0.1643
hsa-miR-
37.192
hsa-miR-
37.295




624

335

361




hsa-miR-
0.1521
hsa-miR-
5.5771
hsa-miR-
77.373




625*

365

422a






hsa-miR-
0.1294
hsa-miR-
4.7203






429

579






hsa-miR-
29.527
hsa-miR-
41.515






618

642






hsa-miR-
20.788
hsa-miR-
8.4425






95

671-3p






hsa-miR-
0.2759
hsa-miR-
12.218






144*

99a






hsa-miR-
0.0304
hsa-miR-
0.2905






624

144*






hsa-miR-
0.0981
hsa-miR-
0.2579






625*

520D-3p








hsa-miR-
0.4188








590-3p








hsa-miR-
0.1575








625*








hsa-miR-
0.2793








629









Single TaqMan Assay for Candidate Biomarkers of mTBI


In order to validate these findings, we subsequently tested the expression of selected miRNAs in three separate and independent groups (10 mTBI+EC, 10 sTBI+EC, 10 EC) at the two chosen time points (1 and 15 days from injury) by using single TaqMan assays. The results were compared to 10 HV. The fold changes were calculated by the 2-ΔΔCT method, using miR-331 and miR-223* as reference genes.


Among the candidate biomarkers of mTBI at both time points (miR-184, miR-301b, miR-502, miR-505, miR-203, miR-425-5p, miR-654-3p and miR-655), two showed interesting results and were significantly and differentially expressed in the three different categories compared to HV. In particular, miR-425-5p and miR-502 showed a similar trend (FIG. 1). They were both significantly downregulated in mTBI+EC (mean of 0.387±0.201 and 0.314±0.146) respectively at 1 day from injury compared to HV (p<0.001), EC (p<0.001) and sTBI+EC (p<0.001). At 15 days from mild injury, miR425-5p and miR-502 returned back to normal levels (0.886±0.310 and 1.157±0.258). The expression of miR-425-5p and miR-502 was also found similar to HV in EC samples at both 1 day and 15 days from injury, thus suggesting that these two biomarkers are differentially expressed in brain injury patients only. Moreover, neither of them showed any significant difference in sTBI+EC compared to HV at both time points. Therefore, miR-425-5p and miR-502 could be considered the most promising candidate biomarkers for the early diagnosis and monitoring of mTBI at 15 days after trauma. AUCs for these biomarkers are shown in Table 3.


Single TaqMan Assay for Candidate Biomarkers of sTBI


miR-21 and miR-335 were analysed as potential biomarkers of sTBI since they both appeared upregulated at both time points of sTBI+EC in the initial screening. They showed to be strong candidates in the second dataset of patients as well (FIG. 2). Mir-21 was significantly upregulated at both time points in sTBI with EC (7.106±4.192 and 4.012±1.577) with respect to HV (p,0.001), EC (p<0.001) and mTBI (p<0.001). No significant differences were found in the remaining categories compared to HV. miR-335 showed upregulation in sTBI+EC and at both time points (16.824±14.195 and 12.324±8.931, respectively). On day 1, there this group were significantly different from controls (p=0.001) and mTBI+EC (p=0.031) but not EC. Interestingly, a significant upregulation in EC patients was found at 1 day (7.951±4.870), but not at 15 days from injury (1.260±0.531). For this reason, on day 15, miR335 was significantly higher in the sTBI+EC group with respect to HV (p=0.002), EC (p=0.007) and mTBI+EC (p=0.001). miR-335 did not show any significant difference in mTBI+EC at both time points compared to HV. AUCs for these biomarkers are also shown in Table 3.









TABLE 3







Area under the curve










Asymptotic 95%




Confidence Interval















Lower
Upper



Variable(s)
Area
Bound
Bound






miR-502 1 day
.993
.972
1.000



miR-502 15 days
Not Significant





miR-425-5p 1 day
.994
.977
1.000



miR-425-5p 15 days
Not Significant





miR-21 1 day
.979
.934
1.000



miR-21 15 days
.975
.929
1.000



miR-335 1 day
.758
.592
 .921



miR-335 15 days
.957
.884
1.000









Discussion


The present study investigated if changes in the levels of miRNAs can be applied to the diagnosis of TBI, and evaluating its severity. Four miRNAs were identified as being differentially expressed in TBI; miR-425-5p, miR 502, miR-21 and miR-335.


miR-425-5p showed significant results at day 1 in mTBI+EC compared to the HV and similar results were obtained in all other categories. Its downregulation within the first 24 h from the mild injury and the its return back to normal levels after 15 days, makes miR-425-5p a suitable candidate biomarker of mild trauma.


miR-502 was also found to be differentially expressed in mTBI+EC. The trend of this miRNA was very similar to miR-425-5p. It showed specificity for brain injured patients and could also be used to track recovery, since it returns back to normal value after 15 days form the mild injury.


Following sTBI, 2 miRNAs (miR-21, miR-335) were noted to be expressed at both 1 and 15 days and were thus selected as potential biomarkers for sTBI. miR-21 and miR-335 were significantly up-regulated at both time points when compared with controls in sTBI+EC. Therefore, the overexpression confirmed the results of the array and showed the potential of these molecules as biomarkers of sTBI.


The selected panel of miRNAs have the potential to diagnose TBI accurately and enable the stratification of patients according to severity which, in turn, allows the delivery of the most appropriate treatment.


Example 2

Patients and Sample Collection


Study participants were recruited from the Surgical Reconstruction and Microbiology Research Centre (SRMRC) at Queen Elizabeth Hospital of Birmingham (UK) as part of SIR (The Steroids and Immunity from injury through to Rehabilitation) study (Ethics Ref. 11/SW/0177), ReCoS (The REpetitive COncussion in Sport) study (Ethics Ref. 11-0429AP28) and Golden Hour study (Ethics Ref. 13/WA/0399). Written informed consent was received from participants or valid proxy (family or a professional not directly involved in the study) prior to inclusion in the study.


The second dataset of samples used serum samples from a total of 120 individuals grouped in 4 different categories: HV (n=30), EC (n=30), mTBI+EC (n=30), sTBI+EC (n=30) and blood was taken at different time points (T0-1 h, T4-12 h, T48-72 h, 15 days) in each patient. Healthy volunteers were consented and enrolled in the ReCoS study. EC injury patients had radiographically-confirmed orthopaedic fractures, no head trauma, no infection, no history of neurological or psychiatric disorders and no alcohol or drug dependency. Mild TBI with EC included those with anon-penetrating head trauma and Glasgow Coma Scale (GCS) score ≥13. Severe TBI with EC included patients with GCS≤8.


Sample Processing


The blood samples were processed for serum isolation within 2 h after withdrawal. Whole blood was left to stand for about 30′ at room temperature before being centrifuged at 3000 rpm for 10′ at 4° C. Serum was divided into aliquots and stored at −80° C. until analysis.


RNA isolation, data analysis, assays and statistical analysis were carried out as described in Example 1.


Results


Single TaqMan Assay for Candidate Biomarkers of mTBI


In order to validate the findings of Example 1, the expression of selected miRNAs in 3 separate and independent groups (30 mTBI+EC, 30 sTBI+EC, 30 EC) was measured at different time points (T0, T4-12 h, T48-72 h and 15 days from the injury) by using single TaqMan assays. The results were compared to 10 HV. The fold changes were calculated by the 2-ΔΔCT method, using miR-331 and miR-223* as reference.


Among the candidate biomarkers of mTBI at both time points (miR-184, miR-502, miR-505, miR-301b, miR-203, miR-425-5p, miR-654-3p and miR-655), only two showed interesting results and were significantly and differentially expressed in the 3 different categories compared to HV. Specifically, miR-425-5p and miR-502 showed a similar trend (FIG. 3). They were both significantly downregulated in mTBI+EC, miR-425-5p at T0-1 h (p=0.01845), and at T4-12 h (p=0.01962) respectively compared to HV, or EC and sTBI+EC (p<0.05), and miR-502 at T0-1 h and at T4-12 h compared to HV (p=0.02538 and p=0.03718 respectively), or EC and sTBI+EC (p<0.01). After 48 h from mild injury, miR425-5p and miR-502 returned back to normal levels. The expression of miR-425-5p and miR-502 was also found in EC group at a comparable level to HV, thus suggesting that these two biomarkers are downregulated in brain injury patients only. Moreover, neither of them showed any significant downregulation in sTBI+EC compared to HV at all time points. Therefore, miR-425-5p and miR-502 could be considered the most promising candidate biomarkers for the early diagnosis and monitoring of mTBI. AUCs for these biomarkers at the most relevant time points, are shown in Table 4.


Single TaqMan Assay for Candidate Biomarkers of sTBI


MiR-21 and miR-335 were analysed as potential biomarkers of sTBI since they both appeared upregulated at both time points of sTBI+EC in the initial screening. They showed to be strong candidates in the second dataset of patients also (FIG. 4). Mir-21 was significantly upregulated in sTBI with EC at all time points after 4 h from injury with respect to HV, EC and mTBI+EC (p=0.00306 at T4-12 h, p=0.00844 at T48-72 h and p=0.00077 at 15 days). No significant differences were found in the remaining categories compared to HV. MiR-335 showed upregulation in sTBI+EC and at all time points compared to HV (p=0.00109 at T0-1 h, p=0.00284 at T4-12 h, p=0.00012 T48-72 h and p=0.01284 at 15 days) and mTBI+EC but not significant upregulation was found compared to EC. AUCs for these biomarkers are also shown in Table 4.









TABLE 4







Area under the curve of the four candidate biomarkers of TBI at


different time points. Only most relevant time points are shown.









Asymptotic 95%



Confidence Interval














Lower
Upper


Variable(s)
Area
Sig
Bound
Bound












miR-425-5p T0













mTBI vs HV
1
.002
1
1


mTBI vs sTBI
.911
.020
.778
1.000


mTBI vs EC
.950
.01
.860
1.000









miR-502 T0













mTBI vs HV
1
.001
1.000
1.000


mTBI vs sTBI
.990
.001
.960
1.000


mTBI vs EC
.990
.001
.940
1.000









miR-21 T4-12 h













sTBI vs HV
.961
.003
.880
1.000


sTBI vs mTBI
.960
.001
.870
1.000


sTBI vs EC
.900
.004
.740
1.000









miR-335 T0













sTBI vs HV
.990
.000
.960
1.000


sTBI vs mTBI
.780
.023
.590
.960


sTBI vs EC
.500
1
.240
0.780









Discussion


This study validated the previous finding that changes in the levels of miRNAs can be applied to the diagnosis of TBI, and evaluating its severity. The study confirmed that the following four miRNAs are differentially expressed in TBI; miR-425-5p, miR 502, miR-21 and miR-335.


miR-425-5p showed significant results at T0 and T4-12 h in mTBI+EC compared to the HV and similar results were obtained in all other categories. Its downregulation return back to normal levels after T48-72 h, confirms that miR-425-5p a suitable candidate biomarker of mild trauma.


miR-502 was also confirmed to be differentially expressed in mTBI+EC. The trend of this miRNA was very similar to miR-425-5p. It showed specificity for brain injured patients and could also be used to track recovery, since it returns back to normal value after T48-72 h form the mild injury.


Following sTBI, 2 miRNAs (miR-21, miR-335) were noted to be expressed at all time points analysed and were thus confirmed as potential biomarkers for sTBI. miR-21 and miR-335 were significantly up-regulated when compared with controls in sTBI+EC. Therefore, the overexpression confirmed the potential of these molecules as biomarkers of sTBI.


Example 3

Saliva samples were collected from concussed professional athletes after 2-3 days from injury and the microRNAs present in the saliva was analysed. The athletes were diagnosed clinically as having mTBI.


Materials and Methods


MicroRNAs were analysed using nCounter technology (nanoString Technologies®), which uses molecular “barcodes” and microscopic imaging to detect and count up to several hundred unique transcripts in one hybridization reaction. Each colour-coded barcode is attached to a single target-specific probe corresponding to a microRNAs of interest.


Analysis was carried out according to the manufacturer's protocol which includes the following steps:


Hybridization: The technology employs two ˜20-base probes per microRNA that hybridize in solution. A reporter probe carries the signal, while a capture probe allows the complex to be immobilized for data collection.


Purification and Immobilization: After hybridization, the excess probes are removed and the probe/target complexes are aligned and immobilized in the nCounter Cartridge.


Data Collection: Sample cartridges are placed in a digital analyzer instrument for data collection. Colour codes on the surface of the cartridge are counted and tabulated for each target molecule.


Results


Table 4 below is a list of microRNAs which were found to be significantly and differentially expressed in concussed athletes compared to healthy volunteers. The table shows the fold change in expression of the microRNAs in the patients compared to the control group. The fold changes were calculated using miR-23a-3p and miR-148b-3p as reference genes. differentially expressed in concussed athletes compared to healthy volunteers. The table shows the fold change in expression of the microRNAs in the patients compared to the control group. The fold changes were calculated using miR-23a-3p and miR-148b-3p as reference genes.











TABLE 5






microRNA
Fold change


















hsa-let-7c-5p
2.80



hsa-let-7i-5p
1.82



hsa-miR-142-3p
1.41



hsa-miR-148a-3p
1.72



hsa-miR-15b-5p
2.30



hsa-miR-16-5p
2.32



hsa-miR-181a-5p
1.54



hsa-miR-20a-5p + hsa-miR-20b-5p§
2.16



hsa-miR-221-3p
2.90



hsa-miR-24-3p
1.94



hsa-miR-27b-3p
3.45



hsa-miR-29a-3p
4.03



hsa-miR-29c-3p
1.44



hsa-miR-424-5p
2.88



hsa-miR-30a-5p
2.16



hsa-miR-107
1.72



hsa-miR-135b-5p
1.97



hsa-miR-199b-5p
1.88



hsa-miR-324-5p
5.61



hsa-miR-652-3p
3.43





§the values for miR-20a-5p and miR-20b-5p were combined due to the nCounter technology not being able to distinguish between them.






Discussion


This study shows that microRNAs present in saliva are an indicator of concussion/mTBI. This is significant because saliva is more easily obtained than blood, and thus detection of salivary microRNAs offers a rapid and convenient means for diagnosing TBI, particularly pitch-side.


Example 4

Materials and Methods


Study Approval


Study participants were recruited through the Surgical Reconstruction and Microbiology Research Centre (SRMRC), based at Queen Elizabeth Hospital of Birmingham (UK), as part of the ReCoS (The REpetitive COncussion in Sport) study (Ethics Ref. 11-0429AP28). Written informed consent was received from participants prior to inclusion in the study.


Saliva samples from a total of 20 subjects (discovery group) were analysed. In particular, saliva samples of 10 concussed and 10 non-concussed athletes were used to screen proteins and 6 concussed and 6 non-concussed athletes for microRNA analysis. Saliva of concussed players was collected 48-72 hours after concussion certified by the attending enhanced care team in accordance with the current protocol for the relevant sport. From these data, we calculated the sample size needed for validation in a larger cohort of patients with alpha=0.05 and power=0.9. The sample size required was 29 subjects based on the most variant miRNA identified in the discovery group.


A second set of samples (validation group) was obtained from a total of 22 concussed and 10 non concussed players. Samples were collected between 2 and 5 days after concussion.


Sample Processing


Five ml of saliva were collected in a 50 ml sterile plastic universal container tube kept on ice for no more than 30′. Samples were then centrifuged at 2600×g for 15′ at 4-C. Saliva was then divided into aliquots and to each ml of saliva, RNase inhibitor (500 units/mL) was added for the analysis of miRNAs.


Samples were stored at −80-C until analysis.


RNA Isolation


Total RNA was isolated from 400 μl of saliva by using Qiagen miRNeasy Mini Kit (Qiagen, GmbH, Hilden, Germany), according to Qiagen Supplementary Protocol for purification of RNA (including small RNAs) from serum or plasma. Finally, RNA was eluted in 200 μl RNAse-free water and subsequently precipitated by adding 20 μg glycogen, 0.1 volumes 3 M sodium acetate and 2.5 volumes ice cold 100% ethanol. After incubation at −80° C. overnight, RNA was centrifuged and washed twice in ice cold 75% ethanol and resuspended in 7 μl RNAse-free water. RNA was quantified by Nanodrop.


Circulating miRNA Profiling Through NanoString Technology


Expression profile of miRNAs from saliva was performed through NanoString technology by using nCounter Human v3 miRNA Expression Assay Kits (NanoString Technologies) in an nCounter FLEX (Prep Station and Digital Analyzer) (NanoString Technologies), according to manufacturer instructions. Profiling was performed on 6 concussed and 6 non concussed athletes. Three μl (approximately 150 ng) of total RNA were used for sample preparation. Data analysis was performed through nSolver 2.6 software; miRNAs used as endogenous controls were selected through global median normalization (GMN) method: we computed Pearson correlation between the count means for each lane and the counts of each miRNA, identifying those miRNAs whose expression was closer to the count mean of the cartridge (miR-23a-3p, miR-29b-3p, miR-148b-3p). Statistical analysis was performed through Significance of Microarrays Analysis (SAM) (http://www.tm4.org), using a p-value based on 100 permutations; imputation engine: K-nearest neighbours (10 neighbours); false discovery rate (FDR)<0.05.


Single TaqMan Assays


Twenty-one differentially expressed miRNAs were chosen from the arrays as potential candidate biomarkers of concussion. These candidates were used to validate the data in an enlarged cohort of 22 concussed athletes and 10 non concussed athletes (validation group). Saliva was collected after 2-5 days from injury and analysed by single TaqMan assays (Applied Biosystems, Life Technologies™). Samples were extracted as described above, retrotranscribed (Applied Biosystems, Life Technologies™) and RT-qPCR analysis was performed in a Bio-Rad iQ5 Real-time PCR Detection System (Bio-Rad, CA, USA). Expression fold changes were calculated by the 2-ΔΔCT method by using miR-23a-3p and miR-148b-3p as reference genes.


Statistical Analysis


A non parametric test (Mann-Whitney U test) was used to compare the level of miRNAs in the two independent groups. A p value <0.05 was accepted as significant.


In addition, a Receiver Operating Characteristic (ROC) analysis was utilised to calculate sensitivity and specificity of each biomarker in diagnosing concussion, expressed as Area Under the Curve (AUC). All analyses were carried on SPSS v.22 (IBM).


Results


Nanostring Profiling


Among the 800 microRNAs analysed by nCounter NanoString in saliva of concussed and non-concussed athletes, 21 miRNAs were selected as differentially expressed across the two populations: hsa-let-7c-5p, hsa-let-7i-5p, hsa-miR-15b-5p, hsa-miR-16-5p, hsa-miR-20a-5p+hsa-miR-20b-5p, hsa-miR-24-3p, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-107, hsa-miR-135b-5p, hsa-miR-142-3p, hsa-miR-148a-3p, hsa-miR-181a-5p, hsa-miR-199b-5p, hsa-miR-221-3p, hsa-miR-324-5p, hsa-miR-424-5p, hsa-miR-652-3p. Results showed a significant upregulation for all the miRNAs mentioned above.


Single TaqMan Assay


In order to validate these findings, we subsequently tested the expression of the 21 selected miRNAs in a separate and independent group, composed of 22 concussed athletes and 10 non concussed athletes. Saliva was collected after 2-5 days from injury, by using single TaqMan assays. Fold changes were calculated by the 2-ΔΔCT method, using miR-23a-3p and miR-148b-3p as reference markers.


Among these candidate biomarkers for concussion 5 were significantly upregulated in the validation group. Specifically, miR-27b-3p (p=0.02), let-7i-5p (p=0.001), miR-142-3p (p=0.008), miR-107 (p=0.03), miR-135b-5p (p=0.02) confirmed the results obtained by Nanostring analysis (FIG. 5). These results are also shown in Table 6 which shows that the control group have a fold change of between 0.6 and 1.4. A fold change above this is considered indicative of concussion. The median fold change seen for the concussed athletes is a fold change of approximately 2.5 for each of the identified 5 miRNAs. A fold change value calculated by the 2-ΔΔCT method of 2.0 or greater for any of these identified 5 biomarkers would give a diagnosis of concussion.














TABLE 6






miR
let
miR
miR
miR



27b-3p
7i-5p
142-3p
107
135b-5p







control
0.6-1.4
0.6-1.4
0.6-1.4
0.6-1.4
0.6-1.4


concussed
4.494754264
4.691358
5.35579639
3.33647
6.022724008


average







concussed
2.462406429
3.266526
2.98367692
2.387747
2.539442


median









Boxplot of relative expression and AUCs for these biomarkers (0.755, 0.845, 0.791, 0.732 and 0.755 respectively) are shown in FIG. 6 and in Table 7.









TABLE 7







Area Under the Curve (AUC) of miRNAs


selected as biomarkers of concussion










Variables
AUC













miR-27b-3p
0.755



let-7i-5p
0.845



miR-142-3p
0.791



miR-107
0.732



miR-135b-5p
0.755









Discussion


In this study, we examined saliva, a potentially novel fluid for the examination of biomarkers in the context of head injury and concussion (mTBI).


Five miRNAs were found significantly upregulated in the saliva of the concussed population only. Each of miRNA-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p were significantly upregulated in concussed athletes. Each of these five biomarkers have the ability to distinguish concussed athletes from non-concussed athletes especially after 2-5 days from injury.

Claims
  • 1. A method of diagnosing and treating mild traumatic brain injury (mTBI) in a human subject in need thereof, wherein the subject in need is one who has received an injury to the head, the method comprising: detecting an amount of at least one miRNA in a saliva sample obtained from the subject, wherein the at least one miRNA comprises: (i) miR-142-3p;(ii) miR-107;(iii) miR-135b-5p; or(iv) miR-27b-3p, let-7i-5p, miR-142-3p, miR-107, and miR-135b-5p collectively;identifying the subject as suffering from mTBI where the amount of the at least one miRNA is increased relative to a predetermined threshold value or relative to the amount of the miRNA in a control sample; andtreating the subject identified as suffering from mTBI by administering to the subject one or more neuroprotective therapies.
  • 2. The method of claim 1, wherein the saliva sample is obtained 24 hours to 15 days after the injury.
  • 3. The method of claim 1, further comprising obtaining one or more additional saliva samples from the subject at one or more additional times after the injury and repeating the detecting, identifying, and treating steps for each additional sample.
  • 4. The method of claim 3, wherein the one or more additional saliva samples is obtained at day 2, 3, 5, 7, 10, 14, or 15 after the injury.
  • 5. The method of claim 1, wherein the detecting an amount of the at least one miRNA is performed using a PCR-based assay.
  • 6. The method of claim 5, wherein the predetermined threshold is equivalent to a fold change of 1.5 or more using the 2-delta delta CT (2-ΔΔCT) method.
  • 7. The method of claim 5, wherein the predetermined threshold is equivalent to a fold change of 2 or more using the 2-delta delta CT (2-ΔΔCT) method.
  • 8. The method of claim 1, wherein the method comprises determining a level of at least two miRNAs in the saliva sample.
  • 9. The method of claim 8, wherein the at least two miRNAs are selected from miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 or miR-135b-5p.
  • 10. The method of claim 1, wherein the at least one target miRNA comprises miR-27b-3p, let-7i-5p, miR-142-3p, miR-107 and miR-135b-5p collectively.
  • 11. The method of claim 1, wherein the method further comprises determining the amount of one or more additional miRNAs selected from let-7c-5p, let-7i-5p, miR-142-3p, miR-148a-3p, miR-15b-5p, miR-16-5p, miR-181a-5p, miR-20a-5p, miR-20b-5p, miR-221-3p, miR-24-3p, miR-27b-3p, miR-29a-3p, miR-29c-3p, miR-424-5p, miR-30a-5p, miR-107, miR-135b-5p, miR-199b-5p, miR-324-5p, and miR-652-3p.
  • 12. The method of claim 1, wherein the at least one miRNA is miR-142-3p.
  • 13. The method of claim 1, wherein the at least one miRNA is miR-107.
  • 14. The method of claim 1, wherein the at least one miRNA is miR-135b-5p.
Priority Claims (1)
Number Date Country Kind
1603967 Mar 2016 GB national
CROSS-REFERENCE TO RELATED APPLICATIONS

The present application is a divisional of U.S. patent application Ser. No. 15/852,128, filed Dec. 22, 2017, which issued as U.S. Pat. No. 10,563,262 on Feb. 18, 2020, which is a Continuation-in-Part of PCT International Application PCT/GB2017/050231, filed on Jan. 30, 2017, which claims the benefit of priority under 35 U.S.C. § 119 (e) to GB Patent Application No. 1603967.9, filed Mar. 8, 2016. Each of these applications is incorporated herein by reference in their entirety.

US Referenced Citations (6)
Number Name Date Kind
20130022982 Wang et al. Jan 2013 A1
20150037403 Faden et al. Feb 2015 A1
20150203916 Ikonomidis et al. Jul 2015 A1
20150344954 Patel et al. Dec 2015 A1
20160041165 Siman Nov 2016 A1
20180179592 Oltra Garcia et al. Jun 2018 A1
Foreign Referenced Citations (22)
Number Date Country
103237901 Aug 2013 CN
103667445 Mar 2014 CN
104293791 Jan 2015 CN
2013504331 Feb 2013 JP
2016105097 Jun 2016 JP
95102480 Dec 1996 RU
2207626 Jun 2003 RU
66524 Sep 2007 RU
93660 May 2010 RU
2491595 Aug 2013 RU
2011032155 Mar 2011 WO
2011109440 Sep 2011 WO
2013159091 Oct 2013 WO
2015153864 Aug 2015 WO
2015134551 Sep 2015 WO
2015164431 Oct 2015 WO
2015196191 Dec 2015 WO
2016153549 Sep 2016 WO
2017019976 Feb 2017 WO
2017044650 Mar 2017 WO
2018175422 Sep 2018 WO
2018175941 Sep 2018 WO
Non-Patent Literature Citations (27)
Entry
Boone et al. Surg Neurol Int 2015;6:177 (7 pages).
EP Application No. 17822770.8 European Search Report and Communication under rule 164(2)(b) dated Jan. 15, 2021.
Hu et al., “Expression of miRNAs and Their Cooperative Regulation of the Pathophysiology in Traumatic Brain Injury”, PLoS ONE, Jun. 1, 2012, vol. 7, No. 6, p. e39357, DOI: 10.1371/journal.pone.0039357.
Balakathiresan et al., “MicroRNA let-7i Is a Promising Serum Biomarker for Blast-Induced Traumatic Brain Injury”, Journal of Neurotrauma, May 1, 2012, e-published Apr. 13, 2012, 29(7):1379-1387.
Castaldi et al., “miChip: an array-based method for microRNA expression profiling using locked nucleic acid capture probes”, Nature Protocols, Feb. 7, 2008, vol. 3 No. 2, pp. 321-329.
Dipietro et al., “MicroRNAs as Novel Biomarkers for the Diagnosis and Prognosis of Mild and Severe Traumatic Brain Injury”, Journal of Neurotrauma, Jun. 2017, Apr. 10, 2017, 34(11):1948-1956.
Han et al., “Diagnostic value of elevated serum miRNA-I 43 levels in sepsis”, Journal of International Medical Research, May 25, 2016, pp. 875-881, vol. 44, No. 4.
Lei et al., “Microarray based analysis of microRNA expression in rat cerebral cortex after traumatic brain injury”, Brain Research, Aug. 11, 2009, e-published Jun. 6, 2009, 1284:191-201.
Lim et al., “MicroRNAs in Cerebral Ischemia”, Translational Stroke Research, Jul. 31, 2010, pp. 287-383, vol. 1, No. 4.
Redell et al., “Altered Expression of miRNA-21 and Its Targets in the Hippocampus After Traumatic Brain Injury”, Journal of Neuroscience Research, Feb. 2011, e-published Dec. 8, 2010, 89(2):212-221.
Redell et al., “Human Traumatic Brain Injury Alters Plasma microRNA Levels”, Journal of Neurotrauma, Oct. 2010, e-published Nov. 23, 2010, 27(12):2147-2156.
Reis et al., “What's New in Traumatic Brain Injury: Update on Tracking, Monitoring and Treatment”, International Journal of Molecular Sciences, May 26, 2015, 16(6):11903-11965.
Sharma et al., “Identification of Serum MicroRNA Signatures for Diagnosis of Mild Traumatic Brain Injury in a Closed Head Injury Model”, Nov. 7, 2014, PLoS One, Nov. 7, 2014, 9(11):e112019.
TaqMan miRNA Megaplex PreAmp primers human Pool A/B (v2.0) [online]. [retrieved on May 11, 2020]. Retrieved from the Internet: <https://www.thermofisher.com/order/catalog/product/4444913#/4444913>. (Year: 2020).
TaqMan miRNA Megaplex PreAmp primers human Pool A/B (v3.0) [online]. [retrieved on May 11, 2020]. Retrieved from the Internet: <https://www.thermofisher.com/order/catalog/product/4444913#/4444913>. (Year: 2020).
Truettner et al., “Therapeutic hypothermia alters microRNA responses to traumatic brain injury in rats”, Journal of Cerebral Blood Flow & Metabolism, Sep. 2011, e-published Apr. 20, 2011, 31(9):1897-1907.
Wang et al., “Differential expression of circulating microRNAs in blood and haematoma samples from patients with intracerebral haemorrhage”, Journal of International Medical Research, Mar. 28, 2016, pp. 419-432, vol. 44, No. 3.
International Search Report dated Jun. 13, 2017, for PCT Application No. PCT/GB2017/050231, filed Jan. 30, 2017, 10 pages.
EP Application No. 17703217.4 Examination Report dated Oct. 2, 2019.
RU Application No. 2018135107 Office Action dated Dec. 7, 2020 (English Translation).
Catalog # Mbs825516, “hsa-mir-335 Real-time RT-PCR Detection Kit User Manual”, Mar. 24, 2015, XP055715451, Retrieved from the Internet: URL:https://cdn.mybiosource.com/tds/protocol manuals/800000-9999999/ MBS825516.pdf [retrieved on Jul. 16, 2020].
EP Application No. 20169652.3 Extended European Search Report dated Jul. 28, 2020.
EP Application No. 20169635.8 Extended European Search Report dated Jul. 28, 2020.
Balakathiresan et al., “Serum and amygdala microRNA signatures of posttraumatic stress: Fear correlation and biomarker potential”, Journal of Psychiatric Research, May 2014, pp. 65-73, vol. 57, http://dx.doi.org/10.1016/j.ipsychires.2014.05.020.
Flower et al., “Sedation in Traumatic Brain Injury”, Hindawi Publishing Corporation, Emergency Medicine International, vol. 2012, Article ID 637171, 11 pages, doi:10.1155/2012/637171.
Van Den Bergh, “Pharmacotherapy of traumatic brain injury”, Netherlands Journal of Critical Care, Jan. 2016, vol. 24, No. 1, 6 pages.
Xin-Tong GE et al., “miR-21 improves the neurological outcome after traumatic brain injury in rats”, Scientific Reports, 2014, 11 pages, DOI: 10.1038/srep06718.
Related Publications (1)
Number Date Country
20200385808 A1 Dec 2020 US
Divisions (1)
Number Date Country
Parent 15852128 Dec 2017 US
Child 16732254 US
Continuation in Parts (1)
Number Date Country
Parent PCT/GB2017/050231 Jan 2017 US
Child 15852128 US