Patent Application
20080004230
The present invention relates to compositions and methods of use thereof related to SAM-I riboswitch.
Riboswitches are regulatory elements found within the 5′-untranslated regions (5′-UTRs) of many bacterial mRNAs. Riboswitches control gene expression in a cis-fashion through their ability to directly bind a specific small molecule metabolite. Ligand recognition is effected by the first domain of the riboswitch, termed the aptamer domain while the second, the expression platform, transduces the binding event into a regulatory switch. The switch includes an RNA element that can adapt to one of two mutually exclusive secondary structures. One of these structures is a signal for gene expression to be “on” and the other conformation turns the gene “off” (example in
Riboswitch aptamer domains are controlled by a diverse set of metabolites. In one example bacteria, amino acid metabolism in various Bacillus species is controlled by three known riboswitches: glycine, lysine and S-adenosylmethionine (SAM). Each has a distinct aptamer domain that has evolved to specifically recognize a specific ligand. Currently, there are two known distinct SAM riboswitches, one of which is dominant in gram positive bacteria, SAM-I, and one dominant in gram negative bacteria, SAM-II. The SAM-I riboswitch, which regulates methionine uptake and synthesis as well as SAM synthesis, contains a secondary structure comprised of four stem-loops surrounding a four-way junction motif In the almost 300 individual SAM-I riboswitches that have been identified, a number of nucleotides within and surrounding the junction are highly phylogenetically conserved (
A need exist to better control bacterial growth and generate effective treatments against bacterial infections. Embodiments of the present invention fulfill this need.
One aspect of the present invention provides for methods of identifying a compound that associates with a SAM-I riboswitch including modeling at least a portion of the atomic structure depicted in
Certain embodiments herein concern crystalline atomic structures of SAM-I riboswitches. In accordance with the methods, the structures may also be used for modeling and assessing the interaction of a riboswitch with a binding ligand.
In other embodiments herein, a compound may be identified that associates with the SAM-I riboswitch and reduces bacterial gene expression or associates with the SAM-I riboswitch and induces bacterial gene expression. In accordance with these embodiments, atomic coordinates of the atomic structure can include at least a portion of the atomic coordinates listed in Table 1 for atoms depicted in
Bacterial cells contemplated of use in the methods and compositions herein include, but are not limited to, Staphylococcus spp., Bacillus spp., Listeria spp., Clostridia spp., Streptomyces spp., Thermoanaerobacteria spp. and a combination thereof.
In certain embodiments, a SAM-I riboswitch disclosed herein can include one or more of the nucleotides listed in “Tertiary contacts” section of Table 2 where the nucleotide can be modified. In certain embodiments, the one or more modified nucleotides are selected from the group consisting of A45, G11, C44, G58 and U57. In particular embodiments, the modified nucleotide of the SAM-I riboswitch can increase gene expression in a bacterial cell. For example, a test compound that contains a modified nucleotide may induce expression of a gene that is deleterious to a bacterial cell. In other embodiments, the modified nucleotide can decrease gene expression in a cell. For example, a test compound that contains a modified nucleotide may reduce expression of a gene that is necessary for survival of a bacterial cell. In certain particular embodiments, the modified nucleotide decreases sulfur production in a cell.
Embodiments of the present invention concern a test compound that associates with at least a portion of the SAM-I riboswitch atomic structure depicted in at least one of
Certain embodiments concern compositions including, all of the 80 percent or more conserved nucleotides of the SAM-I riboswitch depicted in
In one embodiment, the atomic coordinates of the atomic structure comprise the atomic coordinates listed in Table 1 for atoms depicted in
Yet in another embodiment, the interaction determination step can include determining a minimum interaction energy, a binding constant, a dissociation constant, or a combination thereof, for the test compound in the model of the SAM-I riboswitch.
Still in other embodiments, the interaction determination step and test compound identification can include determining the interaction of the test compound with a nucleotide of SAM-I riboswitch comprising A6, U6, G11, A45, C47, U57, G58, A86, U87, or a combination thereof Within this embodiment, the interaction determination step can include determining the interaction of the test compound with a nucleotide of SAM-I riboswitch comprising A45, G11, C44, G58 and U57, or a combination thereof In addition, the test compound that effectively interacts with one or more of the above mentioned nucleotides can be identified and expanded for use in targeting bacterial organisms disclosed herein.
Another aspect of the present invention provides, a method of regulating a gene in a cell by modulating an mRNA, said method comprising administering a SAM-I riboswitch modulating compound to the cell to modulate the SAM-I riboswitch activity of the mRNA. In certain embodiments, the gene expression is stimulated, while in other embodiments the gene expression is inhibited. Within certain embodiments where the gene expression is inhibited, the SAM-I riboswitch modulating compound forms a complex with the SAM-I riboswitch, thereby preventing the mRNA from forming an antiterminator element.
Another aspect of the present invention provides a SAM-I riboswitch in which one or more of the nucleotides listed in “Tertiary contacts” section of Table 2 is modified, e.g., replaced with another nucleotide. Alternatively, certain embodiments include a compound that associates with one or more of the contact nucleotides and modulates the activity of the SAM-1 riboswitch. In one particular embodiment, a compound capable of associating with one or more of the contact nucleotides may be capable of reducing sulfur metabolism in an organism having a SAM-I or SAM-I like riboswitch. In accordance with these embodiments, compounds of the present invention may be used to reduce infection caused by, or as a treatment for infection caused by an organism contemplated herein. In certain embodiments target organisms include bacteria. Bacteria contemplated herein include, but are not limited to, Staphylococcus spp., Bacillus spp., Listeria spp., Clostridia spp., Streptomyces spp., Thermoanaerobacteria spp. and a combination thereof.
The following drawings form part of the present specification and are included to further demonstrate certain embodiments of the present invention. The embodiments may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
As used herein, “a” or “an” may mean one or more than one of an item.
In the following sections, various exemplary compositions and methods are described in order to detail various embodiments of the invention. It will be obvious to one skilled in the art that practicing the various embodiments does not require the employment of all or even some of the specific details outlined herein, but rather that molecules, test compounds, samples, concentrations, times and other specific details may be modified through routine experimentation. In some cases, well known methods or components have not been included in the description.
Embodiments of the present invention provide for compositions and methods concerning SAM-I riboswitch and SAM-I riboswitch-like molecules.
In certain embodiments herein, the aptamer domain of the SAM-I riboswitch that controls the metFH2 operon in Thermoanerobacter tengcogensis was used as a template for construction of an RNA that could be crystallized in the presence of SAM (S-adenylsylmethionine). A series of constructs were made that encompassed all of the nucleotides that were >95% conserved across phylogeny and preserved the integrity of the four-way junction motif Out of ˜30 constructs tested, one (
Ligand recognition is effected by the first domain of the riboswitch, termed the aptamer domain while the second, the expression platform, transduces the binding event into a regulatory switch. The switch comprises an RNA element that can adopt one of two mutually exclusive secondary structures in which one signal for gene expression to be on and the other conformation turns the gene off (
Riboswitch aptamer domains are controlled by a diverse set of metabolites. Amino acid metabolism in various Bacillus species is controlled by three known riboswitches: glycine, lysine and S-adenosylmethionine (SAM). Each has a distinct aptamer domain that has evolved to specifically recognize a specific ligand. Currently, there are two distinct SAM riboswitches, one of which is dominant in gram positive bacteria, SAM-1, and one dominant in gram negative bacteria, SAM-II. The SAM-I riboswitch, which regulates methionine uptake and synthesis as well as SAM synthesis, contains a secondary structure comprised of four stem-loops surrounding a four-way junction motif. In the greater than approximately 300 SAM-I motifs that have been identified a number of nucleotides within and surrounding the junction are highly phylogenetically conserved (
Certain embodiments herein concern compositions and methods for selecting and identifying compounds that can activate, deactivate or block SAM-1 riboswitch. Activation or deactivation of a SAM-I riboswitch refers to the change in state of the riboswitch upon binding of the compound of interest, a test compound. The term trigger molecule is used herein to refer to molecules and compounds that can activate the SAM-I riboswitch.
Deactivation of a riboswitch refers to the change in state of the riboswitch when the trigger molecule is not bound. A riboswitch can be deactivated by binding of compounds other than the trigger molecule and in ways other than removal of the trigger molecule. Blocking of a riboswitch refers to a condition or state of the riboswitch where the presence of the trigger molecule does not activate the riboswitch.
In certain particular embodiments, methods of identifying a compound that interact with a SAM-I riboswitch include modeling the atomic structure of the SAM-I riboswitch with a test compound and determining if the test compound interacts with the SAM-I riboswitch. In accordance with these embodiments, the atomic contacts of the SAM-I riboswitch and test compound can be determined by means known in the art. Further, analogs of a compound known to interact with a SAM-I riboswitch can be generated by analyzing the atomic contacts for example the contacts that interact with ligand binding, then optimizing the atomic structure of the analog to maximize interaction. In certain embodiments, these methods can be used in a high throughput screen.
Other embodiments concern methods for identifying compounds that block a riboswitch. For example, an assay can be performed for assessing the induction or inhibition of SAM-I riboswitch in the presence of a test compound.
Some embodiments herein concern compositions and methods for identifying a test compound for significantly reducing the activity or inactivating a SAM-I riboswitch by binding the test compound to at least a portion of the atomic structure represented in
In other embodiments, a test compound that activates a SAM-I riboswitch can be identified. For example, test compounds that activate a riboswitch can be identified by bringing into contact a test compound and a SAM-I riboswitch including at least a portion of the SAM-I riboswitch of
The SAM-I riboswitch is known to regulate multiple operons in a number of bacteria. Example bacteria contemplated herein include, but are not limited to, Staphylococcus spp., Bacillus spp., Listeria spp., Clostridia spp., Streptomyces spp., Thermoanaerobacteria spp. and a combination thereof.
Organization of Riboswitch RNAs
Structural probing studies demonstrate that bacterial riboswitch elements are composed of two domains: a natural aptamer that serves as the ligand-binding domain, and an ‘expression platform’ that interfaces with RNA elements that are involved in gene expression. Structural probing investigations suggest that the aptamer domain of most riboswitches adopts a particular secondary- and tertiary-structure fold when examined independently, that is essentially identical to the aptamer structure when examined in the context of the entire 5′ leader RNA. This implies that, in many cases, the aptamer domain is a modular unit that folds independently of the expression platform.
The ligand-bound or unbound status of the aptamer domain is interpreted through the expression platform, which is responsible for exerting an influence upon gene expression. The aptamer domains are highly conserved amongst various organisms, whereas the expression platform varies in sequence, structure, and in the mechanism by which expression of the appended open reading frame is controlled.
Aptamer domains for riboswitch RNAs typically range from ˜70 to 170 nt in length. Some aptamer domains, when isolated from the appended expression platform, exhibit improved affinity for the target ligand over that of the intact riboswitch. (˜10 to 100-fold). Presumably, there is an energetic cost in sampling the multiple distinct RNA conformations required by a fully intact riboswitch RNA, which is reflected by a loss in ligand affinity. Since the aptamer domain must serve as a molecular switch, this might also add to the functional demands on natural aptamers that might help rationalize their more sophisticated structures.
Riboswitch Regulation
Bacteria primarily use two methods for termination of transcription. Certain genes incorporate a termination signal that is dependent upon the Rho protein, while others make use of Rho-independent terminators (intrinsic terminators) to destabilize the transcription elongation complex. The latter RNA elements are composed of a GC-rich stem-loop followed by a stretch of 6-9 uridyl residues. Intrinsic terminators are widespread throughout bacterial genomes, and are typically located at the 3′-termini of genes or operons. Interestingly, an increasing number of examples are being observed for intrinsic terminators located within 5′-UTRs.
In certain examples, RNA polymerase responds to a termination signal within the 5′-UTR in a regulated fashion. Under certain conditions, the RNA polymerase complex is directed by external signals either to perceive or to ignore the termination signal. Although transcription initiation might occur without regulation, control over mRNA synthesis (and of gene expression) is ultimately dictated by regulation of the intrinsic terminator. Presumably, one of at least two mutually exclusive mRNA conformations results in the formation or disruption of the RNA structure that signals transcription termination. A trans-acting factor, which in some instances an RNA is generally required for receiving a particular intracellular signal and subsequently stabilizing one of the RNA conformations. Riboswitches offer a direct link between RNA structure modulation and the metabolite signals that are interpreted by the genetic control machinery.
Certain mRNAs involved in thiamine biosynthesis bind to thiamine (vitamin B1) or its bioactive pyrophosphate derivative (TPP) without the participation of protein factors. The mRNA-effector complex adopts a distinct structure that sequesters the ribosome-binding site and leads to a reduction in gene expression. This metabolite-sensing mRNA system provides an example of a genetic “riboswitch” (referred to herein as a riboswitch) whose origin might predate the evolutionary emergence of proteins. It has been discovered that the mRNA leader sequence of the btuB gene of Escherichia coli can bind coenzyme B12 selectively, and that this binding event brings about a structural change in the RNA that is important for genetic control. It was also discovered that mRNAs that encode thiamine biosynthetic proteins also employ a riboswitch mechanism.
Although certain specific natural riboswitches such as SAM-I riboswitch was one of the first examples of mRNA elements that control genetic expression by metabolite binding, it is suspected that this genetic control strategy may be widespread in biology. If these metabolites were being biosynthesized and used before the advent of proteins, then certain riboswitches might be modern examples of the most ancient form of genetic control. A search of genomic sequence databases has revealed that sequences corresponding to the TPP aptamer exist in organisms from bacteria, archaea and eukarya-largely without major alteration. Although new metabolite-binding mRNAs are likely to emerge as evolution progresses, it is possible that the known riboswitches are molecular fossils from the RNA world.
In certain embodiments, it is contemplated that a SAM-I Reporter system can be used to assess whether a test compound activates or inactivates the SAM-I riboswitch. In certain particular embodiments, an in vitro selection protocol can be designed for example to assess whether a test compound activates or deactivates the SAM-I riboswitch. In one particular embodiment, binding of the ligand can be monitored by a mobility-shift assay, known in the art, to discern free and bound RNA, providing a basis for selection of binding-competent RNAs. Ligand binding to the RNA can cause a conformational and/or secondary structural change in the RNA that can result in a change in its migration in a native polyacrylamide gel.
In certain embodiments, a detectable tag can be incorporated into the SAM-I riboswitch. In accordance with these embodiments, a test compound can be placed in contact with the SAM-I riboswitch and the interaction of the test compound and the SAM-I riboswitch assessed by measuring the presence or absence of a detectable tag. In certain particular examples, a detectable tag may be undetectable in the presence of a test compound thereby quenching the signal. This mechanism can be adapted to existing SAM-I riboswitches, as this method can take advantage of assessing a ligand-mediated interaction of the SAM-I riboswitch. In certain particular embodiments, a detectable tag can be placed within the ligand interaction region. In more particular embodiments, a detectable tag can be placed on any one of ligand binding nucleic acids, including but not limited to, A6, U6, G11, A45, C47, U57, G58, A86, U87, or a combination thereof of
In other embodiments, control compounds can be used to assess interaction of the test compound compared to a known compound that interacts with a SAM-I riboswitch. To use riboswitches to report ligand binding by analyzing for a detectable tag, the appropriate construct can be determined empirically. The optimum length and composition of a test compound and its binding site on the riboswitch can be assessed systematically to result in the highest ligand binding region interaction possible. The validity of the assay can be determined by comparing apparent relative binding affinities of different SAM-I analogs, SAM-I antibodies or other SAM-I binding agents to a particular test compound (determined by the presence or level of detectable signal generation of the tag) to the binding constants determined by standard in-line probing.
In other embodiments, interaction of a test compound with at least a portion of the atomic structures depicted in
In one example method, the structure depicted in
It is contemplated herein that test compounds capable of associating with the atomic structures depicted in
Kits
In still further embodiments, kits for methods and compositions described herein are contemplated. In one embodiment, the kits have a point-of care application, for example, the kits may have portability for use at a site of suspected bacterial outbreak. In another embodiment, a kit for treatment of a subject having a bacterial-induced infection is contemplated. In accordance with this embodiment, the kit may be used to reduce the bacterial infection of a subject.
The kits may include a container means. Any of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which the testing agent, may be preferably and/or suitably aliquoted. Kits herein may also include a means for comparing the results such as a suitable control sample such as a positive and/or negative control.
Nucleic Acids
In various embodiments, isolated nucleic acids may be used as test compounds for binding the atomic structure depicted in
A “nucleic acid” includes single-stranded and double-stranded molecules, as well as DNA, RNA, chemically modified nucleic acids and nucleic acid analogs. It is contemplated that a nucleic acid may be of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about 625, about 650, about 675, about 700, about 725, about 750, about 775, about 800, about 825, about 850, about 875, about 900, about 925, about 950, about 975, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1750, about 2000 or greater nucleotide residues in length, up to a full length protein encoding or regulatory genetic element.
Construction of Nucleic Acids
Isolated nucleic acids may be made by any method known in the art, for example using standard recombinant methods, synthetic techniques, or combinations thereof. In some embodiments, the nucleic acids may be cloned, amplified, or otherwise constructed.
The nucleic acids may conveniently comprise sequences in addition to a portion of a SAM-I riboswitch. For example, a multi-cloning site comprising one or more endonuclease restriction sites may be added. A nucleic acid may be attached to a vector, adapter, or linker for cloning of a nucleic acid. Additional sequences may be added to such cloning and sequences to optimize their function, to aid in isolation of the nucleic acid, or to improve the introduction of the nucleic acid into a cell. Use of cloning vectors, expression vectors, adapters, and linkers is well known in the art.
Recombinant Methods for Constructing Nucleic Acids
Isolated nucleic acids may be obtained from bacterial or other sources using any number of cloning methodologies known in the art. In some embodiments, oligonucleotide probes which selectively hybridize, under stringent conditions, to the nucleic acids of a bacterial organism. Methods for construction of nucleic acid libraries are known and any such known methods may be used.
Nucleic Acid Screening and Isolation
Bacterial RNA or cDNA may be screened for the presence of an identified genetic element of interest using a probe based upon one or more sequences. Various degrees of stringency of hybridization may be employed in the assay. As the conditions for hybridization become more stringent, there must be a greater degree of complementarity between the probe and the target for duplex formation to occur. The degree of stringency may be controlled by temperature, ionic strength, pH and/or the presence of a partially denaturing solvent such as formamide. For example, the stringency of hybridization is conveniently varied by changing the concentration of formamide within the range up to and about 50%. The degree of complementarity (sequence identity) required for detectable binding will vary in accordance with the stringency of the hybridization medium and/or wash medium. In certain embodiments, the degree of complementarity can optimally be about 100 percent; but in other embodiments, sequence variations in the RNA may result in <100% complementarity, <90% complimentarily probes, <80% complimentarily probes, <70% complimentarily probes or lower depending upon the conditions. In certain examples, primers may be compensated for by reducing the stringency of the hybridization and/or wash medium.
High stringency conditions for nucleic acid hybridization are well known in the art. For example, conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50° C. to about 70° C. Other exemplary conditions are disclosed in the following Examples. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleotide content of the target sequence(s), the charge composition of the nucleic acid(s), and by the presence or concentration of formamide, tetramethylammonium chloride or other solvent(s) in a hybridization mixture. Nucleic acids may be completely complementary to a target sequence or may exhibit one or more mismatches.
Nucleic Acid Amplification
Nucleic acids of interest may also be amplified using a variety of known amplification techniques. For instance, polymerase chain reaction (PCR) technology may be used to amplify target sequences directly from bacterial RNA or cDNA. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences, to make nucleic acids to use as probes for detecting the presence of a target nucleic acid in samples, for nucleic acid sequencing, or for other purposes.
Synthetic Methods for Constructing Nucleic Acids
Isolated nucleic acids may be prepared by direct chemical synthesis by methods such as the phosphotriester method, or using an automated synthesizer. Chemical synthesis generally produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence or by polymerization with a DNA polymerase using the single strand as a template. While chemical synthesis of DNA is best employed for sequences of about 100 bases or less, longer sequences may be obtained by the ligation of shorter sequences.
Covalent Modification of Nucleic Acids
A variety of cross-linking agents, alkylating agents and radical generating species may be used to bind, label, detect, and/or cleave nucleic acids. In addition, covalent crosslinking to a target nucleotide using an alkylating agent complementary to the single-stranded target nucleotide sequence can be used. A photoactivated crosslinking to single-stranded oligonucleotides mediated by psoralen can be used. Use of N4,N4-ethanocytosine as an alkylating agent to crosslink to single-stranded oligonucleotides has also been disclosed. Various compounds to bind, detect, label, and/or cleave nucleic acids are known in the art.
Nucleic Acid Labeling
In various embodiments, tag nucleic acids may be labeled with one or more detectable labels to facilitate identification of a target nucleic acid sequence bound to a capture probe on the surface of a microchip. A number of different labels may be used, such as fluorophores, chromophores, radio-isotopes, enzymatic tags, antibodies, chemiluminescent, electroluminescent, affinity labels, etc. One of skill in the art will recognize that these and other label moieties not mentioned herein can be used. Examples of enzymatic tags include urease, alkaline phosphatase or peroxidase. Colorimetric indicator substrates can be employed with such enzymes to provide a detection means visible to the human eye or spectrophotometrically. A well-known example of a chemiluminescent label is the luciferin/luciferase combination.
In preferred embodiments, the label may be a fluorescent, phosphorescent or chemiluminescent label. Exemplary photodetectable labels may be selected from the group consisting of Alexa 350, Alexa 430, AMCA, aminoacridine, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4′,5′-dichloro-2′,7′-dimethoxy fluorescein, 5-carboxy-2′,4′,5′,7′-tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxyrhodamine, 6-carboxytetramethyl amino, Cascade Blue, Cy2, Cy3, Cy5,6-FAM, dansyl chloride, Fluorescein, HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-1,3-diazole), Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresyl fast violet, cresyl blue violet, brilliant cresyl blue, para-aminobenzoic acid, erythrosine, phthalocyanines, azomethines, cyanines, xanthines, succinylfluoresceins, rare earth metal cryptates, europium trisbipyridine diamine, a europium cryptate or chelate, diamine, dicyanins, La Jolla blue dye, allopycocyanin, allococyanin B, phycocyanin C, phycocyanin R, thiamine, phycoerythrocyanin, phycoerythrin R, REG, Rhodamine Green, rhodamine isothiocyanate, Rhodamine Red, ROX, TAMRA, TET, TRIT (tetramethyl rhodamine isothiol), Tetramethylrhodamine, and Texas Red. These and other labels are available from commercial sources, such as Molecular Probes (Eugene, Oreg.).
Solid Supports
Solid supports are solid-state substrates or supports with which molecules (such as trigger molecules, e.g., SAM) and riboswitches (or other components used in, or produced by, the disclosed methods) can be associated. Riboswitches and other molecules can be associated with solid supports directly or indirectly. For example, analytes (e.g., trigger molecules, test compounds) can be bound to the surface of a solid support or associated with capture agents (e.g., compounds or molecules that bind an analyte) immobilized on solid supports. As another example, riboswitches can be bound to the surface of a solid support or associated with probes immobilized on solid supports. An array is a solid support to which multiple riboswitches, probes or other molecules have been associated in an array, grid, or other organized pattern.
In some embodiments, a solid-state substrate may be used. Solid supports contemplated of use can include any solid material with which components can be associated, directly or indirectly. These material include but are not limited to acrylamide, agarose, cellulose, nitrocellulose, glass, gold, polystyrene, polyethylene vinyl acetate, polypropylene, polymethacrylate, polyethylene, polyethylene oxide, polysilicates, polycarbonates, teflon, fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic acid, polylactic acid, polyorthoesters, functionalized silane, polypropylfumerate, collagen, glycosaminoglycans, and polyamino acids. Solid-state substrates can have any useful form including thin film, membrane, bottles, dishes, fibers, woven fibers, shaped polymers, particles, beads, microparticles, or a combination. Solid-state substrates and solid supports can be porous or non-porous. A chip is a rectangular or square small piece of material. Preferred forms for solid-state substrates are thin films, beads, or chips. A useful form for a solid-state substrate is a microtiter dish. In some embodiments, a multi-well glass slide can be employed.
In certain embodiments, an array can include a plurality of riboswitches, trigger molecules, other molecules, compounds or probes immobilized at identified or predefined locations on the solid support. Each predefined location on the solid support generally has one type of component (that is, all the components at that location are the same). Alternatively, multiple types of components can be immobilized in the same predefined location on a solid support. Each location will have multiple copies of the given components. The spatial separation of different components on the solid support allows separate detection and identification.
Although useful, it is not required that the solid support be a single unit or structure. A set of riboswitches, trigger molecules, other molecules, compounds and/or probes can be distributed over any number of solid supports. For example, in some embodiments, each component can be immobilized in a separate reaction tube or container, or on separate beads or microparticles.
Methods for immobilization of oligonucleotides to solid-state substrates are well established. Oligonucleotides, including address probes and detection probes, can be coupled to substrates using established coupling methods. For example, suitable attachment methods are described by Pease et al., Proc. Natl. Acad. Sci. USA 91(11):5022-5026 (1994), and Khrapko et al., Mol Biol (Mosk) (USSR) 25:718-730 (1991). A method for immobilization of 3′-amine oligonucleotides on casein-coated slides is described by Stimpson et al., Proc. Natl. Acad. Sci. USA 92:6379-6383 (1995). A useful method of attaching oligonucleotides to solid-state substrates is described by Guo et al., Nucleic Acids Res. 22:5456-5465 (1994).
Each of the components (for example, riboswitches, trigger molecules, or other molecules) immobilized on the solid support can be located in a different predefined region of the solid support. The different locations can be different reaction chambers. Each of the different predefined regions can be physically separated from each other of the different regions. The distance between the different predefined regions of the solid support can be either fixed or variable. For example, in an array, each of the components can be arranged at fixed distances from each other, while components associated with beads will not be in a fixed spatial relationship. In particular, the use of multiple solid support units (for example, multiple beads) will result in variable distances. In accordance with these examples, components can be associated or immobilized on a solid support at any density. Components can be immobilized to the solid support at a density exceeding 400 different components per cubic centimeter. Arrays of components can have any number of components depending on the circumstances.
Pharmaceutical Compositions
In certain embodiments, compositions of identified test compounds may be generated for use in a subject having a bacterial infection in order to reduce or eliminate the infection in the subject. In accordance with these embodiments, the compositions can be administered in a subject in a biologically compatible form suitable for pharmaceutical administration in vivo. By “biologically compatible form suitable for administration in vivo” is meant a form of the active agent (e.g., pharmaceutical chemical, protein, gene, antibody etc of the embodiments) to be administered in which any toxic effects are outweighed by the therapeutic effects of the active agent. Administration of a therapeutically active amount of the therapeutic compositions is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example, a therapeutically effective amount of an antibody or nucleic acid molecule reactive with at least a portion of SAM-I riboswitch depicted in
In one embodiment, the compound (e.g., pharmaceutical chemical, nucleic acid molecule, gene, protein, antibody etc of the embodiments) may be administered in a convenient manner such as by injection such as subcutaneous, intravenous, by oral administration, inhalation, transdermal application, intravaginal application, topical application, intranasal or rectal administration. Depending on the route of administration, the active compound may be coated in a material to protect the compound from the degradation by enzymes, acids and other natural conditions that may inactivate the compound. In a preferred embodiment, the compound may be orally administered. In another preferred embodiment, the compound may be inhaled in order to make the compound bioavailable to the lung.
A compound may be administered to a subject in an appropriate carrier or diluent, co-administered with enzyme inhibitors or in an appropriate carrier such as liposomes. The term “pharmaceutically acceptable carrier” as used herein is intended to include diluents such as saline and aqueous buffer solutions. To administer a compound that stimulates or inhibits a SAM-I riboswitch by other than parenteral administration, it may be necessary to coat the compound with, or co-administer the compound with, a material to prevent its inactivation. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEP) and trasylol. Liposomes include water-in-oil-in-water emulsions as well as conventional liposomes. The active agent may also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases, the composition must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The pharmaceutically acceptable carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of microorganisms can be achieved by various antibacterial and antifungal agents (i.e., parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like). In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. A compound such as aluminum monostearate and gelatin can be included to prolong absorption of the injectable compositions.
Sterile injectable solutions can be prepared by incorporating active compound (e.g., a chemical that modulates the SAM-I riboswitch) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a dispersion medium and other required ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient (i.e., a chemical agent, antibody etc.) plus any additional desired ingredient from a previously sterile-filtered solution thereof
When the active agent is suitably protected, as described above, the composition may be orally administered (or otherwise indicated), for example, with an inert diluent or an assimilable edible carrier. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms are dictated by and directly dependent on (a) the unique characteristics of the active agent and the particular therapeutic effect to be achieved, and (b) the limitations inherent an active agent for the therapeutic treatment of individuals.
The following examples are included to illustrate various embodiments. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered to function well in the practice of the claimed methods, compositions and apparatus. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes may be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
RNA preparation. A 94 nucleotide construct consisting of the sequence for the SAM riboswitch from the metF-metH2 operon of T. tencongensis was constructed by PCR using overlapping DNA oligonucleotides (e.g., Integrated DNA Technologies). The resulting fragment contained sites for the restriction enzymes EcoRI and NgoMIV and was ligated into plasmid vector pRAV12, which is designed for either native or denaturing purification of RNA. The cloned sequence was verified by sequencing. Transcription template was prepared by PCR using primers directed against the T7 promoter (SEQ ID NO:1: 5′, GCGCGCGAATTCTAATAC GACTCACTATAG, 3′) and the HδV ribozyme in the vector
The global architecture of the SAM-I riboswitch aptamer domain is established through two coaxial stacks of helices. The first comprises the P1/P4 stack (
The global tertiary architecture of the riboswitch is believed to be established through a series of interactions between L2, J3/4 and J4/1 (See
S-adenosylmethionine is specifically recognized by the riboswitch within a pocket created between the P1 and P3 helices (
Many riboswitches and aptamers recognize ligands with negatively charged groups including ATP thiamine pyrophosphate, flavin mononucleotide, as well as SAM. Negative charge is expected to be difficult for the polyanionic RNA to recognize; aptamers selected to bind SAM indeed bind the adenine and ribose moiety well, but do not recognize the methionine functional group. In this structure, it is clear the negatively charged functional group is recognized by the Watson-Crick face of a guanine residue (G11). This is very analogous to an acetate ion binding in the purine riboswitch, as well as binding of non-bridging phosphate oxygens in the backbone of the GAAA tetraloop, SRP RNA, and the ribosomal RNA. It is likely that a very general mode for anion recognition, particularly carboxy and phosphate groups, is through the N1 and N2 groups of unpaired guanine residues.
The other half of the binding pocket for SAM is created by the minor groove of the P1 helix, adjacent to the universally conserved A6-U88 and U7-A87 base pairs. The ribose sugar of SAM bridges the P1 and P3 helices via interactions between SAM-2′-OH and O4′ of C47 in P3, SAM-3′-OH and O4′ of U7, and SAM-O4′ and O2′ of U88. The sulfur atom is situated approximately 4 A from the O2 carbonyl oxygens of U7 and U88 (data not shown). This positioning likely serves as the basis for a 100-fold preference for SAM over SAH. In SAM, the positively charged sulfur would be positioned to make favorable electrostatic interactions with the carbonyls of the minor groove of P1. This electrostatic interaction is consistent with observations that the identity of the charged moiety at this position is not important, but the presence of a formal positive charge or high partial positive charge is sensed. While in the electron density maps we did not observe a region of clear electron density around the sulfur atom that would correspond to the methyl group of SAM, its position can be readily inferred as the sulfur is biologically always found in the S configuration. The model of SAM places the methyl group facing towards a solvent cavity within the interior of the folded RNA. This is consistent with the biochemical observations that have suggested that the methyl group is not directly recognized by the RNA.
The binding site for SAM can be created through the docking of the minor groove faces of the P1 and P3 helices. While SAM has a fairly loose association with the P1 helix, as suggested by the long hydrogen-bonding distances between SAM and functional groups of P1, the backbone of P1 makes intimate contacts with the minor groove of P3. These interactions involve a mixture of hydrogen bonding and van der Waals contacts between the backbone ribose/phosphate atoms of U88-A90 in helix P1 and C47, C48, G56, U57 and G58 of helix P3 (
Additional objects, advantages, and novel features of this invention will become apparent to those skilled in the art upon examination of the following examples thereof, which are not intended to be limiting.
Methods and Materials.
RNA preparation. In one exemplary method, a 94 nucleotide construct consisting of the sequence for the SAM riboswitch from the metF-metH2 operon of T. tencongensis was constructed by PCR using overlapping DNA oligonucleotides (Integrated DNA Technologies). The resulting fragment contained site for the restriction enzymes EcoRI and NgoMIV and was ligated into plasmid vector pRAV12, which is designed for either native or denaturing purification of RNA. The cloned sequence was verified by sequencing. Transcription template was prepared by PCR using primers directed against the T7 promoter (SEQ ID NO:1 5′, GCGCGCGAATTCTAATACGACTCACTATAG) and the HδV ribozyme in the vector. Because the HδV sequence in the vector is mutated to be active only in the presence of imidazole, the primer used contained the single-base correction required for wild-type activity. RNA was transcribed in a 12.5 mL reaction containing 30 mM Tris-HCl (pH 8.0), 10 mM DTT, 0.1% Triton X-100, 0.1 mM spermidine-HCl, 4 mM each NTP, 24 mM MgCl2, 0.25 mg/mL T7 RNA polymerase, 1 mL of 0.5 μM template, and 0.32 unit/mL inorganic pyrophosphatase to suppress formation of insoluble magnesium pyrophosphate. The transcription reaction was allowed to proceed for two hours at 37° C., supplemented with an addition 20 mM MgCl2 and incubated at 60° C. for 15 minutes to enhance cleavage of the HδV ribozyme at the 3′ end of the riboswitch construct. RNA was then ethanol precipitated at −20° C. overnight, purified by denaturing PAGE (12% polyacrylamide, 1× TBE, 8 M urea). The band of interest was visualized by UV shadowing, excised, and electroeluted overnight in 1× TBE to extract RNA from the gel. The eluted fraction was exchanged three times into 10 mM Na-MES at pH 6.0 using a 10,000 MWCO centrifugal filter, then refolded by heating to 95° C. for three minutes followed by snap cooling. The refolded RNA was exchanged once into 10 mM Na-MES pH 6.0, 2 mM MgCl2. The final yield was ˜500 μL of RNA at a concentration of 400 μM as judged by absorbance at 260 nm and the calculated extinction coefficient. RNA was stored at −20° C.
Crystallization. In another example, SAM was added to RNA stock right before the RNA was set-up for crystallization by directly pipetting a predetermined amount of 100 mM SAM stock into the RNA solution. Final concentration of SAM in the RNA was approximately 5 mM. Bound RNA was crystallized by the hanging drop vapor diffusion method. RNA was mixed 1:1 with a solution consisting of 8 mM iridium hexammine, 100 mM KCl, 5 mM MgCl2, 10% MPD, 0 mM Na-cacodylate pH 7.0, and 6 mM spermine HCl. The drop was seeded with seed-stock grown in 27 mM spermine, 34 mM Na-cacodylate, 17 mM BaCl2, 8.5% MPD, and 34 mM KCl. Crystals grew in a diamond morphology to their maximum size (˜0.3 mm on the edge) in 48 hours at 30° C. and were cryoprotected by soaking the crystals for at least 5 minutes in 50 mL of a solution consisting of the motherliquor plus 15% ethylene glycol. Crystals were then flash-frozen in liquid nitrogen. Data was collected on beamline 8.2.1 at the Advanced Light Source in Berkeley, Calif. using an inverse beam experiment at two wavelengths. Data was indexed, integrated, and scaled using D*TREK. The crystals belong to the P43212 space group (a=62.90 Å, b=62.90 Å, c=158.97 Å, α=β=γ=90°) and have one molecule per asymmetric unit. All the data used in this example phasing and refining came from one crystal (see
Preparation of iridium hexaammine.
The iridium hexaammine was prepared according to methods outlined in the literature. Two grams iridium chloride (IrCl3) (Aldrich) and 35 mL ammonium hydroxide were added to a heavy-walled ACE pressure tube (Aldrich). The tube was then sealed and incubated in a 150° C. silicone oil bath for four days. The reaction was then allowed to completely cool and incubated on slushy ice. The clear, light brown solution was then filtered and evaporated to dryness under vacuum. While evaporating, the solution was heated to 50° C. using a waterbath. The resulting solid was then resuspended in 5 mL of water and transferred to a 50 mL conical tube. Two mL of concentrated HCl was then added to the solution. Precipitate was spun down in a centrifuge and the light yellow supernatant was discarded. Pellet was washed three times with 10 mL of a 2:1 (v/v) water:conc. HCl solution by vigorous vortexing followed by centrifugation. Supernatant was discarded after each wash. Pellet was then washed three times in absolute ethanol, air-dried and resuspended in ˜3 mL ddH2O. Solution was centrifuged one more time to remove insoluble material. The resulting supernatant should show a clear absorbance maxima at 251 nm and concentration can be calculated using the extinction coefficient 92 M−1cm−1 at 251 nm. Typical yield is 50%. Supernatant was then aliquoted into fresh Eppendorf tubes and stored at −20° C.
Phasing and structure determination. Phases were determined by multi-wavelength anomalous diffraction (MAD) using data that extended to 2.8 Å. The peak and inflection wavelength datasets were merged and scaled in CNS and Patterson maps were then calculated for both space groups P41212 and P43212. From the maps it was determined that there were four possible iridium sites within the unit cell, although most if not all had less than full occupancy. A CNS heavy-atom search for four possible sites was then carried out in both space groups, and both space groups yielded 94 possible solutions. The best of these were used to calculate predicted Patterson maps, which showed peaks that correlated very well with those seen in the original maps in all four Harker sections. The best solution sites were used to calculate phases in CNS. The resulting density map for P41212 was uninterpretable, whereas the map for P43212 clearly showed features that were macromolecular, such as RNA helix backbones and base-stacking. The phasing solution found by CNS had a figure of merit of 0.6332 which was further improved to 0.8846 following a round of density modification with the solvent level set to 0.46. The phasing power at the peak wavelength was 3.3 with a Rcullis of 0.39 (acentric).
Using methods known in the art, the model was built in O and refined in CNS in iterative rounds. The RNA nucleotides were placed in the first round, the iridium hexaammines were placed in the second round, and then in the third round two magnesium ions were placed based on their position in the density with respect to the sugar-phosphate backbone of the RNA. Once the ions were in place the SAM was built. Structure, parameter, and topology files for iridium hexaammine and SAM were downloaded from HIC-Up (Hetero-compound Information Centre-Uppsala); the parameters for Mg2+ ions were already loaded into CNS. The compact conformation of the SAM molecule was chosen to fit the density seen in the binding pocket, and in order to get the model molecule to fit the density the energy parameters in the SAM parameter file downloaded from HIC-Up had to be changed. This was followed by one round of water-picking carried out by CNS. Waters were chosen based on peak size in an anomalous difference map. The minimum was set to 2.5σ with the additional parameters that the B-factor could be no greater than 200, and the peak must be within hydrogen bonding distance of the oxygens and nitrogens in the RNA. Each round of model-building was followed by a simulated annealing run and B-factor refinement using CNS. Rfree was monitored in each round to ensure that it was dropping. Sugar puckers were restrained in most cases to C3′ endo, except for residues A9, A14, A33, A51, U63, and G74 which were restrained to C2′ endo. Some of the figures were prepared using Ribbons 3.0 and Pymol.
* Data collected on one crystal.
*Highest resolution shell is shown in parenthesis.
*Nucleotide numbering consistent with that used in the RNA crystallized.
‡Conservation based upon alignment of ˜100 SAM-I sequences (Rfam database, http://www.sanger.ac.uk/Software/Rfam/)
The foregoing discussion of the invention has been presented for purposes of illustration and description. The foregoing is not intended to limit the invention to the form or forms disclosed herein. Although the description of the invention has included description of one or more embodiments and certain variations and modifications, other variations and modifications are within the scope of the invention, e.g., as may be within the skill and knowledge of those in the art, after understanding the present disclosure. It is intended to obtain rights which include alternative embodiments to the extent permitted, including alternate, interchangeable and/or equivalent structures, functions, ranges or steps to those claimed, whether or not such alternate, interchangeable and/or equivalent structures, functions, ranges or steps are disclosed herein, and without intending to publicly dedicate any patentable subject matter.
This application claims benefit under 35 U.S.C. §119(e) of provisional U.S. Application No. 60/774,489, filed Feb. 17, 2006 and is hereby incorporated herein by reference in its entirety for all purposes.
The U.S. Government has a paid-up license in this invention and the right in limited circumstances to require the patent owner to license others on reasonable terms as provided for by the terms of Grant No. R-01 GM073850-01 awarded by the National Institutes of Health.
| Number | Date | Country | |
|---|---|---|---|
| 60774489 | Feb 2006 | US |
