Patent Application
20210076685
The instant application contains a Sequence Listing which has been submitted via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Mar. 23, 2020, is named 10035_Final_ST25.txt, and is 21,064,217 bytes in size.
Among other things, inventions disclosed herein relate to compositions and methods for improving the cultivation of plants, particularly agricultural plants. In an aspect, inventions described herein relate to beneficial bacteria and fungi that are capable of living in a plant, which may be used to impart improved agronomic traits to the plants. In another aspect, inventions described herein relate to methods of improving plant characteristics by introducing synthetic combinations of such beneficial bacteria and/or fungi to those plants. Further, inventions described herein also provide methods of treating seeds and other plant elements with synthetic combinations of beneficial bacteria and/or fungi that are capable of living within a plant, to impart improved agronomic characteristics to plants, particularly agricultural plants.
Agriculture faces numerous challenges that are making it increasingly difficult to provide food, materials, and fuels to the world's population. Population growth and changes in diet associated with rising incomes are increasing global food demand, while many key resources for agriculture are becoming increasingly scarce. By 2050, the FAO projects that total food production must increase by 70% to meet the needs of the growing population, a challenge that is exacerbated by numerous factors, including diminishing freshwater resources, increasing competition for arable land, rising energy prices, increasing input costs, and the likely need for crops to adapt to the pressures of a more extreme global climate. The need to grow nearly twice as much food in more uncertain climates is driving a critical need for new innovations.
Today, crop performance is optimized via of technologies directed towards the interplay between crop genotype (e.g., plant breeding, genetically-modified (GM) crops) and its surrounding environment (e.g., fertilizer, synthetic herbicides, pesticides). While these paradigms have assisted in doubling global food production in the past fifty years, yield growth rates have stalled in many major crops and shifts in the climate have been linked to production declines in important crops such as wheat. In addition to their long development and regulatory timelines, public fears of GM-crops and synthetic chemicals has challenged their use in many key crops and countries, resulting in a complete lack of acceptance for GM traits in wheat and the exclusion of GM crops and many synthetic chemistries from European markets. Thus, there is a significant need for innovative, effective, and publically-acceptable approaches to improving the intrinsic yield and resilience of crops to severe stresses.
The disclosures of PCT/US2014/044427, filed Jun. 26, 2014, U.S. application Ser. No. 14/316,469, filed Jun. 26, 2014, and PCT/US2014/054160, filed Sep. 4, 2014, are incorporated by reference in their entirety, including the sequence listings containing SEQ ID NOs: 1-1448.
The present invention is based on the discovery that a plant element (e.g., a whole plant, seedling, meristematic tissue, ground tissue, vascular tissue, dermal tissue, seed, leaf, root, shoot, stem, flower, fruit, stolon, bulb, tuber, corm, kelkis, shoot, bud) can be effectively augmented by associating its surface with a single endophyte strain or a plurality of endophytes in an amount that is not normally found on the plant element. Endophytes described herein can be isolated from inside the same plant or a different plant, or from inside a part or tissue of the same plant or different plant. The plant element thus associated with a single endophyte strain or a plurality of endophytes can be used to confer improved agronomic trait or traits to the seed or the plant that is grown or derived from the plant element.
In an embodiment, the invention features a method for improving an agricultural trait in an agricultural plant. In an embodiment, the method includes providing an agricultural plant, seed or tissue thereof; contacting the plant, seed or tissue thereof with a formulation comprising an endophyte that is common to at least two donor plant types that is present in the formulation in an amount effective to colonize the plant; and growing the plants under conditions that allow the endophyte to improve a trait in the plant. In some embodiments, the two donor plants are of the same family. In some embodiments, the two donor plants are of the same genus. In some embodiments, the two donor plants are of the same species. In some embodiments, the agricultural plant tissue is a seed. In a further embodiment, the population is disposed on the surface of the seed.
In an embodiment, the method for improving an agricultural trait in an agricultural plant includes providing a modern agricultural plant, seed or tissue thereof; contacting the plant, seed, or tissue thereof with a formulation comprising an endophyte derived from an ancestral plant in an amount effective to colonize the plant; and allowing the plant to grow under conditions that allow the endophyte to colonize the plant.
The invention also features a method for preparing a seed comprising an endophyte population. The method comprising applying to an exterior surface of a seed a formulation comprising an endophyte population consisting essentially of an endophyte comprising a 16S rRNA or ITS rRNA nucleic acid sequence at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455.
In some embodiments, provided herein is a method for treating seedlings. The method includes contacting foliage or the rhizosphere of a plurality of agricultural plant seedlings with a seed a formulation comprising an endophyte population consisting essentially of an endophyte comprising a 16S rRNA or ITS rRNA nucleic acid sequence at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455; and growing the contacted seedlings.
The invention also features a method for modulating a plant trait. The method includes applying to vegetation or an area adjacent the vegetation, a seed a formulation comprising an endophyte population consisting essentially of an endophyte comprising a 16S rRNA or ITS rRNA nucleic acid sequence at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455, wherein the formulation is capable of providing a benefit to the vegetation, or to a crop produced from the vegetation.
A method for modulating a plant trait also is featured. The method comprising applying a formulation to soil, the seed a formulation comprising an endophyte population consisting essentially of an endophyte comprising a 16S rRNA or ITS rRNA nucleic acid sequence at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455, wherein the formulation is capable of providing a benefit to seeds planted within the soil, or to a crop produced from plants grown in the soil.
In some embodiments, the endophyte comprises a 16S rRNA or ITS rRNA nucleic acid sequence at least 95% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455. In some embodiments, the endophyte is capable of a function or activity selected from the group consisting of auxin production, nitrogen fixation, production of an antimicrobial compound, mineral phosphate solubilization, siderophore production, cellulase production, chitinase production, xylanase production, and acetoin production. In some embodiments, the endophyte exhibits at least two of: auxin production, nitrogen fixation, production of an antimicrobial compound, mineral phosphate solubilization, siderophore production, cellulase production, chitinase production, xylanase production, and acetoin production.
In some embodiments, the endophyte is capable of metabolizing at least one substrate selected from the group consisting of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose.
In some embodiments, the endophyte is capable of metabolizing at least two substrates selected from the group consisting of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose.
In some embodiments, the endophyte is present at a concentration of at least 102 CFU or spores per seed on the surface of seeds after contacting. In some embodiments, the applying or contacting comprises spraying, immersing, coating, encapsulating, or dusting the seeds or seedlings with the formulation.
In some embodiments, the benefit or agricultural trait is selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome, relative to reference seeds or agricultural plants derived from reference seeds. In some embodiments, the benefit or agricultural trait comprises at least two benefits or agricultural traits selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome, relative to reference seeds or agricultural plants derived from reference seeds. In some embodiments, the benefit is increased tolerance to low nitrogen stress or increased nitrogen use efficiency, and the endophyte is non-diazotrophic.
In some embodiments, the formulation comprises at least one member selected from the group consisting of an agriculturally compatible carrier, a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, and a nutrient.
In some embodiments, the endophyte comprises a nucleic acid sequence that is at least 97% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455, wherein the endophyte is present in the formulation in an amount effective to colonize the mature agricultural plant. In some embodiments, the endophyte comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455, wherein the endophyte is present in the formulation in an amount effective to colonize the mature agricultural plant. In some embodiments, the endophyte comprises a nucleic acid sequence that is at least 99.5% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455, wherein the endophyte is present in the formulation in an amount effective to colonize the mature agricultural plant.
In some embodiments, the plant, seed or tissue thereof is contacted with at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, at least 1,000,000 CFU or spores, or more, of the endophyte.
In some embodiments, the formulation comprises at least two endophytes comprising a nucleic acid sequence that is at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical, or 100% identical, to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455, wherein the at least two endophytes are present in the formulation in an amount effective to colonize the mature agricultural plant. In some embodiments, the formulation comprises at least two endophytes provided in Table 1, Table 2, Table 7 and Table 8.
In some embodiments, the plant is a monocot. The monocot can be corn, wheat, barley or rice. In some embodiments, the plant is a dicot. The dicot can be a soybean, peanut, canola, cotton, Brassica Napus, cabbage, lettuce, melon, strawberry, turnip, watermelon, tomato or pepper.
In some embodiments, the endophyte is present in the formulation in an amount effective to be detectable within a target tissue of the agricultural plant selected from a fruit, seed, leaf, root or portion thereof.
In some embodiments, the endophyte is detected in an amount of at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, at least 1,000,000 CFU or spores, or more, in the target tissue.
In some embodiments, the endophyte is present in the formulation in an amount effective to increase the biomass and/or yield of the fruit or seed produced by the plant by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with the fruit or seed of a reference agricultural plant.
In some embodiments, the endophyte is present in the formulation in an amount effective to detectably increase the biomass of the plant or tissue thereof. In some embodiments, the biomass of the plant, or tissue thereof is detectably increased by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with a reference agricultural plant.
In some embodiments, the endophyte is present in the formulation in an amount effective to detectably increase the rate of germination of the seed. In some embodiments, the rate of germination of the seed is increased by at least 0.5%, at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more, when compared with a reference agricultural plant.
In some embodiments, the endophyte is present in the formulation in an amount effective to detectably induce production of auxin in the plant. In some embodiments, the production of auxin in the plant is increased by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more, when compared with a reference agricultural plant.
The invention also features an agricultural plant, or portion of tissue thereof, comprising a formulation comprising an endophyte that is common to at least two donor plant types that is disposed on an exterior surface of the plant or portion of tissue thereof, or within the plant or portion of tissue thereof, in an amount effective to colonize the plant, and in an amount effective to provide a benefit to the modern agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the endophyte comprises a nucleic acid sequence that is at least 97% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455. In some embodiments of the agricultural plant, or portion of tissue thereof, the endophyte comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455. In some embodiments of the agricultural plant, or portion of tissue thereof, the endophyte comprises a nucleic acid sequence that is at least 99.5% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455.
In some embodiments of the agricultural plant, or portion of tissue thereof, the endophyte is capable of a function or activity selected from the group consisting of auxin production, nitrogen fixation, production of an antimicrobial compound, mineral phosphate solubilization, siderophore production, cellulase production, chitinase production, xylanase production, and acetoin production.
In some embodiments of the agricultural plant, or portion of tissue thereof, the endophyte exhibits at least two of: auxin production, nitrogen fixation, production of an antimicrobial compound, mineral phosphate solubilization, siderophore production, cellulase production, chitinase production, xylanase production, and acetoin production.
In some embodiments of the agricultural plant, or portion of tissue thereof, the endophyte is capable of metabolizing at least one substrate selected from the group consisting of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose.
In some embodiments of the agricultural plant, or portion of tissue thereof, the endophyte is capable of metabolizing at least two substrates selected from the group consisting of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose.
In some embodiments of the agricultural plant, or portion of tissue thereof, the formulation is disposed on an exterior surface of the plant or portion of tissue thereof, or within the plant or portion of tissue thereof, by spraying, immersing, coating, encapsulating, or dusting the plant or portion of tissue thereof with the formulation.
In some embodiments, the agricultural plant, or portion of tissue thereof further comprises a formulation that comprises at least one member selected from the group consisting of an agriculturally compatible carrier, a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, and a nutrient.
In some embodiments of the agricultural plant, or portion of tissue thereof, the benefit is selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, increased resistance to herbivory, a detectable modulation in the level of a metabolite, a detectable modulation in the proteome, and a detectable modulation in the transcriptome, relative to a reference agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the benefit comprises at least two benefits selected from the group consisting of increased: root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, increased resistance to herbivory, a detectable modulation in the level of a metabolite, a detectable modulation in the proteome, and a detectable modulation in the transcriptome, relative to a reference agricultural plant. In some embodiments of the agricultural plant, or portion of tissue thereof, the benefit is increased tolerance to low nitrogen stress or increased nitrogen use efficiency, and the endophyte is non-diazotrophic.
In some embodiments of the agricultural plant, or portion of tissue thereof, the plant or portion of tissue thereof is contacted with at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, at least 1,000,000 CFU or spores, or more, of the endophyte. In some embodiments of the agricultural plant, or portion of tissue thereof, the plant tissue is a seed. In a further embodiment, the endophyte is disposed on the surface of the seed.
In some embodiments, the agricultural plant, or portion of tissue thereof comprises at least two endophytes comprising a nucleic acid sequence that is at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical, or 100% identical, to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455 in an amount effective to colonize the mature agricultural plant. In some embodiments of the agricultural plant, or portion of tissue thereof, the two endophytes are selected from the groups disclosed in Table 1, Table 2, Table 7 and Table 8.
In some embodiments, the agricultural plant is a monocot. In some embodiments, the portion of tissue thereof is derived from a monocot. The monocot can be corn, wheat, barley or rice.
In some embodiments, the agricultural plant is a dicot. In some embodiments, the portion of tissue thereof is derived from a dicot. The dicot can be a soybean, canola, cotton, Brassica Napus, tomato or pepper.
In some embodiments of the agricultural plant, or portion of tissue thereof, the endophyte is disposed in an amount effective to be detectable within a target tissue of the mature target tissue of the mature agricultural plant selected from a fruit, seed, leaf, root or portion thereof.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to increase the rate of germination of the seed. The rate of germination of the seed can be increased by at least 0.5%, at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more, when compared with a reference agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to be detectable within a target tissue of the mature plant. The target tissue can be the root, shoot, leaf, flower, fruit or seed.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is detected in an amount of at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, at least 1,000,000 CFU or spores, or more, in the plant or target tissue thereof.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population of is disposed in an amount effective to be detectable in the rhizosphere surrounding the plant. The population can be detected in an amount of at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, at least 1,000,000 CFU or spores, or more, in the rhizosphere surrounding the plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to detectably increase the biomass of the plant. The biomass of the plant can be detectably increased by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with a reference agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to increase the biomass of a fruit or seed of the plant. The biomass of the fruit or seed of the plant can be detectably increased by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with the fruit or seed of a reference agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to increase the height of the plant. The height of the plant can be increased by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with the height of a reference agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to increase production of auxin in the plant. The auxin production of the plant can be increased by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with the auxin production of a reference agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to increase production of acetoin in the plant. The acetoin production of the plant can be increased by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with the acetoin production of a reference agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to increase production of siderophore in the plant. The siderophore production of the plant can be increased by at least 1%, at least 2%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more, when compared with the siderophore production of a reference agricultural plant.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to increase resistance to one or more stress conditions selected from the group consisting of a drought stress, heat stress, cold stress, salt stress, and low mineral stress.
In some embodiments of the agricultural plant, or portion of tissue thereof, the population is disposed in an amount effective to effective to increase resistance to one or more biotic stress conditions selected from the group consisting of a nematode stress, insect herbivory stress, fungal pathogen stress, bacterial pathogen stress, and viral pathogen stress.
The invention also features bag comprising at least 1,000 seeds, wherein each seed comprises a formulation comprising an endophyte that is common to at least two donor plant types that is disposed on an exterior surface of the plant or portion of tissue thereof, or within the plant or portion of tissue thereof, in an amount effective to colonize the plant, and in an amount effective to provide a benefit to the modern agricultural plant, wherein each seed is contacted with at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, at least 1,000,000 CFU or spores, or more, of the endophyte, and wherein the bag further comprises a label describing the seeds and/or the population.
In an embodiment, the invention features an agricultural formulation comprising an endophyte comprising a nucleic acid sequence that is at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical, or 100% identical, to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455 that is present in an amount effective to colonize a mature agricultural plant, wherein the formulation further comprises at least one member selected from the group consisting of an agriculturally compatible carrier, a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, and a nutrient.
In some embodiments of the agricultural formulation, the agricultural plant is a monocot. The monocot can be maize, barley, rice, or wheat. In some embodiments of the agricultural formulation, the agricultural plant is a dicot. The dicot can be soybean, canola, cotton, Brassica Napus, tomato, squash, cucumber, pepper, peanut, sunflower, or sugar beet.
In some embodiments of the agricultural formulation, the population consists essentially of an endophyte comprising a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455. In some embodiments of the agricultural formulation, the population consists essentially of an endophyte comprising a nucleic acid sequence that is at least 99.5% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455.
The preparation of claim 87, comprising at least two different endophytes each comprise a nucleic acid sequence that is at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical, or 100% identical, to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455.
In some embodiments of the agricultural formulation, each of the two different endophytes comprises the nucleic acid sequence disclosed in Table 1, Table 2, Table 7, and Table 8.
In some embodiments of the agricultural formulation, at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 80%, at least 90%, or at least 95% or more, of the population is in spore form.
In some embodiments of the agricultural formulation, the endophytes were adapted to culture on growth medium.
In some embodiments of the agricultural formulation, the preparation is substantially stable at temperatures between about 0° C. and about 50° C. for at least three days. In some embodiments of the agricultural formulation, the preparation is substantially stable at temperatures between about 4° C. and about 37° C. for at least thirty days.
In some embodiments, the agricultural formulation is formulated to provide a population of plants that demonstrates a substantially homogenous growth rate when introduced into agricultural production.
The invention also features a method for making the plant comprising a formulation comprising an endophyte that is common to at least two donor plant types that is disposed on an exterior surface of the plant or portion of tissue thereof, or within the plant or portion of tissue thereof, in an amount effective to colonize the plant, and in an amount effective to provide a benefit to the modern agricultural plant. The method includes providing a modern agricultural plant, and applying to the plant a formulation comprising an endophyte comprising an endophytic microbe comprising a nucleic acid sequence that is at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical, or 100% identical, to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455 that is present in an amount effective to colonize the plant.
The invention also features a commodity plant product comprising a plant, or a portion or part thereof, comprising a formulation comprising an endophyte that is common to at least two donor plant types that is disposed on an exterior surface of the plant or portion of tissue thereof, or within the plant or portion of tissue thereof, in an amount effective to colonize the plant, and in an amount effective to provide a benefit to the modern agricultural plant. The commodity plant product can be a grain, a flour, a starch, a syrup, a meal, an oil, a film, a packaging, a nutraceutical product, a pulp, an animal feed, a fish fodder, a bulk material for industrial chemicals, a cereal product, a processed human-food product, a sugar or an alcohol and protein.
The invention also features a method of producing a commodity plant product. The method includes obtaining a plant or plant tissue from a plant, progeny or derivative thereof, the plant comprising a formulation comprising an endophyte that is common to at least two donor plant types that is disposed on an exterior surface of the plant or portion of tissue thereof, or within the plant or portion of tissue thereof, in an amount effective to colonize the plant, and in an amount effective to provide a benefit to the modern agricultural plant; and producing the commodity plant product therefrom.
The invention also features a synthetic combination comprising a purified microbial population in association with a plurality of seeds or seedlings of an agricultural plant, wherein the purified microbial population comprises a first endophyte, wherein the first endophyte comprises a 16S rRNA or ITS rRNA nucleic acid sequence at least 97% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455, and wherein the endophyte is present in the synthetic combination in an amount effective to provide a benefit to the seeds or seedlings or the plants derived from the seeds or seedlings.
In some embodiments of the synthetic combination comprising a purified microbial population, the first endophyte is capable of at least one of: production of an auxin, nitrogen fixation, production of an antimicrobial, production of a siderophore, mineral phosphate solubilization, production of a cellulase, production of a chitinase, production of a xylanase, and production of acetoin, or a combination of two or more thereof.
In some embodiments of the synthetic combination comprising a purified microbial population, the microbial population further comprises a second endophyte. In a further embodiment, the microbial population comprises a second microbial endophyte having an 16S rRNA or ITS rRNA nucleic acid sequence that is less than 95% identical to that of the first microbial endophyte.
In some embodiments of the synthetic combination comprising a purified microbial population, the microbial population further comprises a second endophyte, and wherein the first and second endophytes are independently capable of at least one of production of an auxin, nitrogen fixation, production of an antimicrobial, production of a siderophore, mineral phosphate solubilization, production of a cellulase, production of a chitinase, production of a xylanase, or production of acetoin, or a combination of two or more thereof.
In some embodiments of the synthetic combination comprising a purified microbial population, the first and second endophytes are independently capable of at least one of production of an auxin, nitrogen fixation, production of an antimicrobial, production of a siderophore, mineral phosphate solubilization, production of a cellulase, production of a chitinase, production of a xylanase, or production of acetoin, or a combination of two or more thereof.
In some embodiments of the synthetic combination comprising a purified microbial population, the microbial population further comprises a second endophyte, wherein the first and second endophytes are independently capable of metabolizing at least one substrate selected from the group consisting of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose, or a combination of two or more thereof.
The invention also features a synthetic combination comprising at least two endophytes associated with a seed, wherein at least the first endophyte is heterologous to the seed and wherein the first endophyte comprises a 16S rRNA or ITS rRNA nucleic acid sequence at least 97% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-455, wherein the endophytes are present in the formulation in an amount effective to provide a benefit to the seeds or seedlings or the plants derived from the seeds or seedlings.
In some embodiments of the synthetic combination comprising at least two endophytes, the second endophyte is a bacterial endophyte. In some embodiments of the synthetic combination comprising at least two endophytes, the second endophyte is a fungal endophyte.
In some embodiments of the synthetic combination comprising at least two endophytes, the first endophyte is a fungal endophyte. In some embodiments of the synthetic combination comprising at least two endophytes, the first endophyte is a fungal endophyte and the second endophyte is a fungal endophyte. In some embodiments of the synthetic combination comprising at least two endophytes, the first endophyte is a fungal endophyte and the second endophyte is a bacterial endophyte.
In some embodiments of the synthetic combination comprising at least two endophytes, the first and second endophytes are independently capable of metabolizing at least one substrate selected from the group consisting of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose, or a combination of two or more thereof.
In some embodiments of any of the synthetic combinations, the first endophyte is capable of metabolizing at least one substrate selected from the group of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose. In some embodiments of the synthetic combination comprising at least two endophytes associated with a seed, both of the endophytes are heterologous to the seed.
In some embodiments of any of the synthetic combinations, the synthetic combination is disposed within a packaging material selected from a bag, box, bin, envelope, carton, or container. In an embodiment of any of the synthetic combinations, the synthetic combination comprises 1000 seed weight amount of seeds, wherein the packaging material optionally comprises a desiccant, and wherein the synthetic combination optionally comprises an anti-fungal agent.
In some embodiments of any of the synthetic combinations, the first endophyte is localized on the surface of the seeds or seedlings. In some embodiments of any of the synthetic combinations, the first endophyte is obtained from a plant species other than the seeds or seedlings of the synthetic combination. In some embodiments of any of the synthetic combinations, the first endophyte is obtained from a plant cultivar different from the cultivar of the seeds or seedlings of the synthetic combination. In some embodiments of any of the synthetic combinations, the first endophyte is obtained from a plant cultivar that is the same as the cultivar of the seeds or seedlings of the synthetic combination.
In some embodiments of any of the synthetic combinations, the first endophyte is a bacterial endophyte.
In some embodiments of any of the synthetic combinations, the first endophyte is capable of at least two of auxin production, nitrogen fixation, production of an antimicrobial compound, mineral phosphate solubilization, siderophore production, cellulase production, chitinase production, xylanase production, and acetoin production.
In some embodiments of any of the synthetic combinations, the first endophyte is capable of metabolizing at least two substrates selected from the group consisting of: a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose.
In some embodiments of any of the synthetic combinations, the benefit is selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome, relative to reference seeds or agricultural plants derived from reference seeds. In some embodiments, the benefit comprises at least two benefits selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome, relative to reference seeds or agricultural plants derived from reference seeds.
In some embodiments of any of the synthetic combinations, the combination comprises seeds and the first endophyte is associated with the seeds as a coating on the surface of the seeds. In some embodiments of any of the synthetic combinations, the combination comprises seedlings and the first endophyte is contacted with the seedlings as a spray applied to one or more leaves and/or one or more roots of the seedlings. In some embodiments of any of the synthetic combinations, the synthetic combination further comprises one or more additional endophyte species.
In some embodiments of any of the synthetic combinations, the effective amount is at least 1×102 CFU or spores/per seed. In some embodiments of any of the synthetic combinations, the effective amount is at least 1×103 CFU or spores/per seed. In some embodiments of any of the synthetic combinations, the combination comprises seeds and the effective amount is from about 1×102 CFU or spores/per seed to about 1×108 CFU or spores/per seed.
In some embodiments of any of the synthetic combinations, the seed is a seed from an agricultural plant. In some embodiments of any of the synthetic combinations, the seed is a transgenic seed.
In some embodiments of any of the synthetic combinations, the first endophytes are present in an amount of at least 10 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores, at least 100,000 CFU or spores, at least 300,000 CFU or spores, or at least 1,000,000 CFU spores per seed.
In some embodiments, any of the synthetic combinations further comprise one or more of the following: a stabilizer, or a preservative, or a carrier, or a surfactant, an anticomplex agent, or any combination thereof. In some embodiments, any of the synthetic combinations further comprise one or more of the following: fungicide, nematicide, bactericide, insecticide, and herbicide.
The invention also features a plurality of any of the synthetic combinations placed in a medium that promotes plant growth, the medium selected from the group consisting of: soil, hydroponic apparatus, and artificial growth medium. The invention also features a plurality of any of the synthetic combinations, wherein the synthetic combinations are shelf-stable.
The invention also features a plant grown from any of the synthetic combinations disclosed herein, the plant exhibiting an improved phenotype of agronomic interest, selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome.
In some embodiments, the invention features a method for preparing an agricultural seed composition comprising contacting the surface of a plurality of seeds with a formulation comprising a purified microbial population that comprises at least two endophytes that are heterologous to the seed, wherein the first endophyte is capable of metabolizing at least one of a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose, wherein the endophytes are present in the formulation in an amount capable of modulating a trait of agronomic importance, as compared to isoline plants grown from seeds not contacted with the formulation.
In some embodiments, the invention features a method for preparing an agricultural seed composition, comprising contacting the surface of a plurality of seeds with a formulation comprising a purified microbial population that comprises at least two endophytes that are heterologous to the seed, wherein the first endophyte is capable of at least one function or activity selected from the group consisting of auxin production, nitrogen fixation, production of an antimicrobial compound, mineral phosphate solubilization, siderophore production, cellulase production, chitinase production, xylanase production, and acetoin production, wherein the endophytes are present in the formulation in an amount capable of modulating a trait of agronomic importance, as compared to isoline plants grown from seeds not contacted with the formulation.
In some embodiments, the invention features a method of improving a phenotype during water limited conditions of a plurality of host plants grown from a plurality of seeds, comprising treating the seeds with a formulation comprising at least two endophytes that are heterologous to the seeds, wherein the first endophyte is capable of metabolizing at least one of a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose, the phenotype improvement selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome.
In some embodiments of the methods, the first endophyte is a bacterial endophyte. In some embodiments of the methods, the first endophyte is a bacterial endophyte and the second endophyte is a bacterial endophyte. In some embodiments of the methods, the first endophyte is a bacterial endophyte and the second endophyte is a fungal endophyte. In some embodiments of the methods, the first endophyte is a fungal endophyte. In some embodiments of the methods, the first endophyte is a fungal endophyte and the second endophyte is a fungal endophyte. In some embodiments of the methods, the first endophyte is a fungal endophyte and the second endophyte is a bacterial endophyte.
In some embodiments of the methods, the first endophyte is capable of metabolizing at least two of a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose.
In some embodiments of the methods, the second endophyte is capable of metabolizing at least two of a-D-glucose, arabinose, arbutin, b-methyl-D-galactoside, b-methyl-D-glucoside, D-alanine, D-arabitol, D-aspartic acid, D-cellobiose, dextrin, D-fructose, D-galactose, D-gluconic acid, D-glucosamine, dihydroxyacetone, DL-malic acid, D-mannitol, D-mannose, D-melezitose, D-melibiose, D-raffinose, D-ribose, D-serine, D-threonine, D-trehalose, D-xylose, g-amino-N-butyric acid, g-cyclodextrin, gelatin, gentiobiose, glycogen, glycyl-L-aspartic acid, glycyl-L-glutamic acid, glycyl-L-proline, glyoxylic acid, i-erythritol, inosine, L-alanine, L-alanyl-glycine, L-arabinose, L-asparagine, L-aspartic acid, L-galactonic acid-g-lactone, L-glutamic acid, L-glutamine, L-histidine, L-proline, L-rhamnose, L-serine, L-threonine, maltitol, maltose, maltotriose, mannose, N-acetyl-D-glucosamine, oxalic acid, palatinose, pectin, proline, salicin, stachyose, sucrose, trehalose, turanose, tyramine, uridine, and xylose.
In some embodiments of the methods, the formulation comprises the purified microbial population at a concentration of at least about 1×102 CFU/ml or spores/ml in a liquid formulation or about 1×102 CFU/gm or spores/ml in a non-liquid formulation.
In some embodiments of the methods for preparing an agricultural seed composition, the trait of agronomic importance is selected from the group consisting of: increased root biomass, increased root length, increased height, increased shoot length, increased leaf number, increased water use efficiency, increased tolerance to low nitrogen stress, increased nitrogen use efficiency, increased overall biomass, increased grain yield, increased photosynthesis rate, increased tolerance to drought, increased heat tolerance, increased salt tolerance, increased resistance to nematode stress, increased resistance to a fungal pathogen, increased resistance to a bacterial pathogen, increased resistance to a viral pathogen, a detectable modulation in the level of a metabolite, a detectable modulation in the transcriptome, and a detectable modulation in the proteome.
In some embodiments of the methods, at least one of the endophytes is capable of localizing in a plant element of a plant grown from the seed, the plant element selected from the group consisting of: whole plant, seedling, meristematic tissue, ground tissue, vascular tissue, dermal tissue, seed, leaf, root, shoot, stem, flower, fruit, stolon, bulb, tuber, corm, keikis, and bud.
In some embodiments of the methods, at least one of the endophytes is capable of colonizing a plant element of a plant grown from the seed, the plant element selected from the group consisting of: whole plant, seedling, meristematic tissue, ground tissue, vascular tissue, dermal tissue, seed, leaf, root, shoot, stem, flower, fruit, stolon, bulb, tuber, corm, keikis, and bud.
In some embodiments of the methods, the formulation further comprises one or more of the following: a stabilizer, or a preservative, or a carrier, or a surfactant, or an anticomplex agent, or any combination thereof. In some embodiments of the methods, the formulation further comprises one or more of the following: fungicide, nematicide, bactericide, insecticide, and herbicide.
In some embodiments of the methods, the seed is a transgenic seed.
The invention also features a plant derived from one of the methods for preparing an agricultural seed composition, wherein the plant comprises in at least one of its plant elements the endophytes. In some embodiments, the invention also features progeny of the plant derived from one of the methods for preparing an agricultural seed composition wherein the progeny comprises in at least one of its plant elements the endophytes.
In some embodiments of any of the methods, the endophyte expresses one or more genes encoding a protein whose amino acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479, 483, 519, 532, 549, 557, 561, 562, 577, 578, 611, 626, 640, 656, 660, 666, 674, 676, 677, 678, 679, 680, 682, 683, 684, 685, 686, 688, 689, 690, 691, 692, 693, 696, 697, 698, 701, 704, 706, 710, 711, 716, 717, 718, 719, 720, 721, 722, 723, 724, 727, 728, 729, 730, 731, 732, 733, 734, 735, 737, 738, 741, 743, 744, 745, 746, 747, 748, 749, 751, 753, 756, 757, 759, 761, 762, 763, 764, 765, 766, 767, 768, 769, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 782, 783, 784, 785, 786, 788, 790, 793, 795, 796, 797, 798, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 815, 816, 817, 818, 819, 820, 822, 823, 824, 825, 826, 829, 830, 833, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 846, 848, 850, 851, 853, 854, 855, 856, 857, 858, 859, 860, 864, 865, 866, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 884, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 897, 898, 899, 901, 902, 903, 904, 905, 906, 907, 908, 910, 911, 912, 913, 914, 915, 916, 917, 918, 920, 921, 922, 923, 924, 926, 927, 928, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 968, 969, 971, 974, 976, 978, 979, 980, 984, 985, 987, 988, 989, 992, 993, 994, 995, 996, 998, 1000, 1001, 1002, 1003, 1006, 1008, 1010, 1011, 1012, 1014, 1015, 1016, 1017, 1018, 1019, 1021, 1022, 1023, 1024, 1025, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1036, 1037, 1038, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1055, 1056, 1058, 1059, 1060, 1062, 1064, 1065, 1066, 1068, 1070, 1071, 1072, 1076, 1077, 1079, 1080, 1081, 1083, 1085, 1086, 1087, 1088, 1090, 1091, 1092, 1094, 1095, 1096, 1097, 1098, 1099, 1101, 1102, 1103, 1104, 1106, 1107, 1108, 1110, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1121, 1122, 1123, 1124, 1126, 1127, 1129, 1130, 1131, 1132, 1133, 1134, 1136, 1137, 1138, 1139, 1140, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1151, 1153, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1174, 1176, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1196, 1197, 1198, 1199, 1200, 1201, 1203, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1213, 1214, 1216, 1217, 1218, 1219, 1221, 1222, 1223, 1225, 1226, 1228, 1229, 1230, 1231, 1232, 1233, 1235, 1237, 1238, 1239, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1290, 1292, 1293, 1296, 1297, 1298, 1300, 1301, 1303, 1304, 1306, 1307, 1308, 1309, 1311, 1312, 1313, 1314, 1317, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1330, 1331, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1350, 1351, 1352, 1353, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1368, 1369, 1370, 1371, 1372, 1374, 1375, 1376, 1379, 1380, 1382, 1383, 1384, 1385, 1386, 1388, 1389, 1390, 1391, 1392, 1393, 1396, 1397, 1398, 1399, 1400, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1424, 1425, 1426, 1427, 1428, 1430, 1431, 1432, 1433, 1437, 1438, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1448, 1449, 1450, 1452, 1453, 1456, 1459, 1466, 1467, 1469, 1471, 1478, 1479, 1482, 1483, 1484, 1485, 1487, 1488, 1489, 1490, 1495, 1497, 1498, 1499, 1500, 1501, 1504, 1505, 1506, 1508, 1511, 1513, 1514, 1516, 1520, 1526, 1529, 1534, 1535, 1537, 1538, 1540, 1545, 1547, 1548, 1549, 1550, 1551, 1552, 1553, 1554, 1556, 1559, 1561, 1562, 1565, 1566, 1568, 1569, 1570, 1571, 1573, 1574, 1575, 1576, 1577, 1578, 1579, 1580, 1581, 1582, 1583, 1585, 1588, 1589, 1591, 1592, 1593, 1594, 1595, 1596, 1597, 1598, 1601, 1603, 1604, 1605, 1607, 1608, 1609, 1611, 1612, 1613, 1614, 1615, 1616, 1617, 1618, 1619, 1620, 1622, 1624, 1625, 1626, 1627, 1628, 1629, 1630, 1632, 1633, 1636, 1637, 1638, 1639, 1640, 1641, 1642, 1643, 1644, 1646, 1647, 1648, 1650, 1651, 1652, 1654, 1657, 1659, 1660, 1661, 1664, 1665, 1666, 1667, 1668, 1671, 1673, 1675, 1676, 1678, 1679, 1681, 1684, 1685, 1686, 1689, 1690, 1692, 1693, 1694, 1695, 1696, 1697, 1698, 1701, 1705, 1706, 1707, 1709, 1711, 1712, 1713, 1714, 1716, 1717, 1718, 1720, 1721, 1723, 1724, 1725, 1726, 1728, 1729, 1731, 1732, 1734, 1735, 1736, 1737, 1738, 1739, 1740, 1741, 1743, 1744, 1745, 1746, 1747, 1750, 1751, 1753, 1754, 1755, 1760, 1761, 1762, 1763, 1764, 1765, 1767, 1770, 1771, 1772, 1775, 1776, 1777, 1778, 1779, 1780, 1781, 1782, 1786, 1787, 1788, 1789, 1791, 1792, 1793, 1794, 1795, 1797, 1798, 1799, 1800, 1801, 1803, 1804, 1805, 1806, 1809, 1810, 1811, 1814, 1815, 1818, 1819, 1820, 1821, 1822, 1823, 1824, 1825, 1826, 1828, 1830, 1831, 1833, 1835, 1836, 1837, 1838, 1839, 1840, 1841, 1842, 1843, 1846, 1851, 1852, 1854, 1857, 1858, 1860, 1861, 1862, 1863, 1864, 1866, 1868, 1869, 1870, 1872, 1873, 1874, 1875, 1876, 1878, 1879, 1880, 1881, 1883, 1884, 1885, 1887, 1888, 1892, 1893, 1894, 1896, 1898, 1899, 1900, 1901, 1902, 1903, 1904, 1905, 1906, 1907, 1910, 1911, 1913, 1915, 1916, 1917, 1918, 1920, 1921, 1924, 1925, 1926, 1927, 1928, 1930, 1932, 1933, 1934, 1935, 1938, 1939, 1940, 1942, 1943, 1945, 1946, 1948, 1949, 1950, 1951, 1953, 1954, 1955, 1959, 1960, 1961, 1962, 1963, 1965, 1966, 1967, 1970, 1971, 1973, 1975, 1976, 1977, 1979, 1981, 1982, 1983, 1984, 1985, 1986, 1988, 1990, 1994, 1995, 1996, 1998, 1999, 2000, 2001, 2002, 2003, 2006, 2007, 2008, 2009, 2010, 2011, 2013, 2014, 2015, 2016, 2017, 2018, 2019, 2020, 2021, 2022, 2024, 2025, 2026, 2027, 2028, 2029, 2030, 2031, 2032, 2034, 2035, 2036, 2037, 2038, 2039, 2040, 2041, 2042, 2043, 2044, 2045, 2046, 2047, 2048, 2049, 2050, 2052, 2054, 2055, 2059, 2060, 2062, 2065, 2066, 2067, 2068, 2069, 2070, 2071, 2074, 2076, 2077, 2080, 2081, 2082, 2083, 2085, 2086, 2087, 2088, 2089, 2090, 2091, 2092, 2093, 2095, 2096, 2097, 2098, 2100, 2101, 2102, 2103, 2104, 2105, 2108, 2109, 2110, 2112, 2113, 2115, 2116, 2117, 2118, 2119, 2120, 2121, 2125, 2127, 2128, 2129, 2131, 2132, 2134, 2135, 2136, 2138, 2140, 2141, 2142, 2143, 2145, 2146, 2147, 2148, 2149, 2150, 2153, 2154, 2155, 2156, 2158, 2159, 2160, 2162, 2163, 2165, 2166, 2167, 2168, 2169, 2170, 2171, 2172, 2174, 2176, 2177, 2179, 2180, 2181, 2182, 2183, 2184, 2185, 2186, 2188, 2190, 2191, 2192, 2193, 2194, 2195, 2196, 2197, 2198, 2200, 2202, 2204, 2205, 2206, 2207, 2208, 2210, 2211, 2212, 2214, 2215, 2216, 2217, 2218, 2219, 2220, 2221, 2222, 2223, 2225, 2226, 2227, 2228, 2229, 2230, 2231, 2232, 2233, 2234, 2235, 2236, 2238, 2239, 2241, 2242, 2243, 2244, 2245, 2246, 2248, 2249, 2251, 2253, 2254, 2255, 2257, 2258, 2259, 2261, 2262, 2265, 2267, 2268, 2269, and 2270.
In some embodiments of the methods, protein expression is modulated in response to the first endophyte contacting a plant element. In some embodiments, protein expression is upregulated in response to the first endophyte contacting a plant element. In some embodiments, the amino acid sequence of the upregulated protein is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 549, 640, 656, 676, 684, 690, 937, 1456, 1467, 1479, 1484, 1488, 1490, 1498, 1499, 1500, 1504, 1505, 1508, 1513, 1529, 1534, 1538, 1540, 1547, 1551, 1554, 1561, 1566, 1568, 1570, 1571, 1574, 1578, 1581, 1583, 1591, 1592, 1593, 1597, 1598, 1604, 1605, 1609, 1615, 1616, 1619, 1622, 1624, 1626, 1629, 1630, 1632, 1636, 1638, 1642, 1643, 1647, 1650, 1651, 1652, 1659, 1661, 1664, 1666, 1671, 1675, 1676, 1678, 1684, 1685, 1689, 1692, 1694, 1695, 1696, 1701, 1706, 1709, 1711, 1712, 1718, 1723, 1725, 1728, 1729, 1732, 1737, 1738, 1740, 1741, 1744, 1746, 1747, 1751, 1755, 1761, 1763, 1771, 1772, 1775, 1778, 1779, 1782, 1787, 1788, 1791, 1792, 1797, 1798, 1799, 1800, 1805, 1819, 1824, 1828, 1835, 1840, 1842, 1843, 1846, 1854, 1860, 1862, 1868, 1875, 1892, 1893, 1900, 1901, 1910, 1918, 1924, 1925, 1926, 1928, 1932, 1933, 1934, 1938, 1943, 1946, 1949, 1950, 1953, 1963, 1967, 1971, 1973, 1975, 1985, 1990, 1994, 1998, 2000, 2003, 2006, 2010, 2013, 2016, 2018, 2021, 2025, 2027, 2028, 2030, 2034, 2035, 2036, 2048, 2050, 2052, 2054, 2059, 2062, 2065, 2066, 2067, 2068, 2074, 2080, 2091, 2092, 2093, 2095, 2097, 2098, 2100, 2101, 2104, 2108, 2110, 2112, 2117, 2119, 2125, 2131, 2134, 2135, 2145, 2149, 2150, 2156, 2159, 2162, 2168, 2181, 2185, 2193, 2195, 2196, 2206, 2211, 2216, 2217, 2219, 2220, 2221, 2223, 2231, 2236, 2239, 2242, 2243, 2248, 2255, 2257, 2258, 2259, or 2262.
In some embodiments of the methods, protein expression is repressed in response to the first endophyte contacting a plant element. In some embodiments, the repressed protein amino acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 479, 483, 519, 532, 557, 626, 674, 678, 680, 683, 685, 688, 690, 696, 697, 701, 704, 706, 710, 711, 717, 720, 722, 723, 724, 728, 729, 730, 732, 733, 734, 737, 741, 744, 745, 748, 749, 751, 753, 756, 757, 761, 764, 766, 768, 769, 772, 773, 774, 778, 779, 782, 783, 784, 788, 790, 793, 795, 796, 797, 800, 802, 803, 806, 807, 808, 810, 812, 817, 818, 819, 820, 822, 825, 826, 833, 836, 837, 839, 841, 846, 848, 851, 853, 854, 855, 856, 857, 860, 864, 865, 866, 870, 872, 874, 876, 878, 879, 880, 881, 882, 884, 886, 887, 890, 891, 893, 894, 895, 898, 901, 903, 905, 907, 908, 910, 911, 912, 913, 915, 917, 918, 921, 924, 926, 927, 928, 933, 934, 935, 936, 937, 938, 940, 942, 944, 945, 946, 947, 950, 952, 954, 955, 957, 960, 961, 962, 963, 964, 968, 971, 976, 978, 979, 985, 987, 989, 992, 1000, 1001, 1002, 1003, 1006, 1008, 1012, 1014, 1018, 1019, 1021, 1022, 1024, 1025, 1028, 1031, 1032, 1034, 1037, 1038, 1040, 1042, 1043, 1046, 1047, 1050, 1051, 1056, 1059, 1064, 1065, 1068, 1070, 1072, 1077, 1079, 1083, 1086, 1087, 1091, 1094, 1095, 1098, 1102, 1103, 1104, 1110, 1111, 1112, 1113, 1114, 1116, 1117, 1118, 1121, 1126, 1130, 1132, 1133, 1134, 1136, 1139, 1143, 1146, 1147, 1151, 1155, 1156, 1158, 1159, 1160, 1162, 1163, 1165, 1168, 1170, 1172, 1174, 1176, 1180, 1182, 1183, 1186, 1188, 1192, 1193, 1194, 1196, 1197, 1198, 1209, 1214, 1217, 1218, 1219, 1221, 1222, 1223, 1225, 1226, 1230, 1237, 1242, 1244, 1249, 1251, 1253, 1256, 1260, 1261, 1262, 1264, 1270, 1272, 1274, 1276, 1279, 1280, 1283, 1284, 1285, 1286, 1288, 1290, 1292, 1298, 1300, 1303, 1307, 1309, 1311, 1312, 1313, 1320, 1321, 1324, 1325, 1328, 1330, 1331, 1333, 1336, 1337, 1339, 1340, 1344, 1346, 1352, 1353, 1355, 1357, 1358, 1359, 1360, 1361, 1363, 1364, 1365, 1370, 1375, 1376, 1379, 1380, 1383, 1384, 1386, 1390, 1391, 1392, 1393, 1396, 1399, 1400, 1402, 1405, 1408, 1411, 1412, 1418, 1420, 1422, 1427, 1428, 1431, 1433, 1438, 1439, 1440, 1442, 1444, 1445, 1449, or 1450.
In some embodiments of the methods, the protein is expressed with at least a two-fold difference, at least a three-fold difference, at least a four-fold difference, at least a five-fold difference, at least a six-fold difference, at least a seven-fold difference, at least an eight-fold difference, at least a nine-fold difference, at least a ten-fold difference or more in expression level as compared to the protein expression level of a reference microorganism. In some embodiments, the difference in expression level of the protein is positive. In some embodiments, the difference in expression level of the protein is negative.
In some embodiments of the methods, the protein is involved in at least one KEGG pathway selected from the group consisting of: endocytosis, purine metabolism, inositol phosphate metabolism, and peroxisome. In some embodiments of the methods, the protein is involved in at least one KEGG pathway selected from the group consisting of: ko00403 (indole diterpene alkaloid biosynthesis), ko00522 (biosynthesis of 12-, 14- and 16-membered macrolides), ko00550 (peptidoglycan biosynthesis), ko00601 (glycosphingolipid biosynthesis-lacto and neolacto series), ko0901 (indole alkaloid biosynthesis), ko01052 (type I polyketide structures), ko010503 (biosynthesis of siderophore group nonribosomal peptides), ko01501 (beta-Lactam resistance), and ko04071 (sphingolipid signaling pathway).
In some embodiments of any of the methods, the plant, crop, seedling, or plant grown from the seed expresses one or more genes whose nucleic acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4127, 4128, 4129, 4130, 4131, 4132, 4133, 4134, 4135, 4136, 4137, 4138, 4139, 4140, 4141, 4142, 4143, 4144, 4145, 4146, 4147, 4148, 4149, 4150, 4151, 4152, 4153, 4154, 4155, 4156, 4157, 4158, 4159, 4160, 4161, 4162, 4163, 4164, 4165, 4166, 4167, 4168, 4169, 4170, 4171, 4172, 4173, 4174, 4175, 4176, 4177, 4178, 4179, 4180, 4181, 4182, 4183, 4184, 4185, 4186, 4187, 4188, 4189, 4190, 4191, 4192, 4193, 4194, 4195, 4196, 4197, 4198, 4199, 4200, 4201, 4202, 4203, 4204, 4205, 4206, 4207, 4208, 4209, 4210, 4211, 4212, 4213, 4214, 4215, 4216, 4217, 4218, 4219, 4220, 4221, 4222, 4223, 4224, 4225, 4226, 4227, 4228, 4229, 4230, 4231, 4232, 4233, 4234, 4235, 4236, 4237, 4238, 4239, 4240, 4241, 4242, 4243, 4244, 4245, 4246, 4247, 4248, 4249, 4250, 4251, 4252, 4253, 4254, 4255, 4256, 4257, 4258, 4259, 4260, 4261, 4262, 4263, 4264, 4265, 4266, 4267, 4268, or 4269.
In some embodiments, the one or more plant genes are modulated in response to the first endophyte contacting the plant or plant element as compared to a reference microorganism contacting the plant or plant element. In some embodiments, the one or more plant genes are upregulated in response to the first endophyte contacting a plant element as compared to a reference microorganism contacting the plant or plant element. In some embodiments, the upregulated genes nucleic acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4131, 4140, 4142, 4153, 4162, 4167, 4181, 4183, 4184, 4195, 4199, 4201, 4206, 4213, 4222, 4223, 4250, 4253, or 4269.
In some embodiments, the transcription of one or more genes are repressed in response to the first endophyte contacting a plant element as compared to a reference microorganism contacting the plant or plant element. In some embodiments, the repressed genes nucleic acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4150.
In some embodiments, the one or more genes are expressed with at least a 0.5-fold difference, at least a 0.6-fold difference, at least a 0.7-fold difference, at least a 0.8-fold difference, at least a 0.9-fold difference, at least a 1.0-fold difference, at least a 1.1-fold difference, at least a 1.2-fold difference, at least a 1.3-fold difference or more in expression level as compared to the gene expression level of a reference microorganism. In some embodiments, the difference in expression level is positive. In some embodiments, the difference in expression level is negative.
In some embodiments, the one or more genes has at least one gene function selected from the group consisting of: cell wall modification, defense response, oxidation-reduction process, biological process, regulation of transcription, metabolic process, glucosinolate biosynthetic process, response to karrikin, protein phosphorylation, protein folding, response to chitin, proteolysis, response to auxin stimulus, DNA-dependent regulation of transcription, N-terminal protein myristoylation, response to oxidative stress, cellular component, leaf senescence, resistance gene-dependent defense response signaling pathway, zinc ion binding, response to cold, malate metabolic process, transport, catalytic activity, response to ozone, VQ motif, regulation of systemic acquired resistance, potassium ion transport, anaerobic respiration, multicellular organismal development, response to heat, methyltransferase activity, response to wounding, oxidation-reduction process, monooxygenase activity, oxidation-reduction process, carbohydrate metabolic process, exocytosis, nuclear-transcribed mRNA poly(A) tail shortening, sodium ion transport, glycerol metabolic process, on willebrand factor A3, response to water deprivation, response to salt stress, and chlorophyll biosynthetic process. In some embodiments, the gene has a gene ontology (GO) identifier selected from the group consisting of: GO:0003824, GO, catalytic activity; GO:0006355, GO, regulation of transcription, DNA-dependent; GO:0009870, GO, defense response signaling pathway, resistance gene-dependent; GO:0008150, GO, biological process; GO:0010200, GO, response to chitin; GO:0006508, GO, proteolysis; GO:0010193, GO, response to ozone; GO:0006979, GO, response to oxidative stress; and GO:0005975, GO, carbohydrate metabolic process.
In some embodiments, the gene function is selected from the following group: single-stranded DNA specific endodeoxyribonuclease activity, sequence-specific DNA binding transcription factor activity, NAD+ADP-ribosyltransferase activity, metalloendopeptidase activity, DNA catabolic process, cellular iron ion homeostasis, response to osmotic stress, metallopeptidase activity, zinc ion binding, response to wounding, camalexin biosynthetic process, endoribonuclease activity, producing 5′-phosphomonoesters, cellular response to heat, T/G mismatch-specific endonuclease activity, polyamine oxidase activity, flavin adenine dinucleotide binding, cellular heat acclimation, cellular response to ethylene stimulus, cellular response to nitric oxide, and reactive oxygen species metabolic process.
In some embodiments, the endophyte comprises an ITS rRNA nucleic acid sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 344.
In some embodiments of any of the methods, the endophyte expresses one or more genes encoding a protein whose amino acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 477-501, 505, 514, 518, 521, 528, 530, 531, 550, 566, 567, 572, 579, 580, 581, 587, 593, 600, 602, 614, 623, 630, 635, 643, 645, 652, 657, 661, 662, 667, 670, 672, 673, 4510-4535, 4540, 4541, 4542, 4547, 4555, 4558, 4560, 4569, 4570, 4571, 4572, 4577, 4582, 4592, 4594, 4602, 4608, 4609, 4622, 4626, 4641, 4643, 4653, 4654, 4742-4766, 4734, 4739, 4740, 477, 478, 480, 482, 484, 485, 487, 489, 494, 496, 497, 501, 530, 567, 587, 602, 614, 633, 645, 649, 651, 652, 658, 665, 666, 667, 673, 874, 934, 1013, 1249, 1342, 2252, 2272, 2273, 2281, 2282, 2284, 2285, 2286, 2287, 2289, 2290, 2291, 2292, 2293, 2296, 4510, 4514, 4515, 4518, 4520, 4521, 4525, 4526, 4527, 4529, 4532, 4538, 4539, 4540, 4555, 4559, 4560, 4562, 4569, 4570, 4571, 4572, 4577, 4581, 4582, 4594, 4595, 4597, 4608, 4615, 4618, 4623, 4624, 4626, 4630, 4632, 4635, 4641, 4642, 4646, 4650, 4658, 4659, 4661, 4662, 4663, 4666, 4667, 4668, 4670, 4799, 4801, 4802, 4803, 4804, 4805, 4826, 4827, 4828, 4829, 4830, 4831, 4832, 4833, 4834, 4835, 4836, 4837, 4838, 4839, 4840, 4841, 4863, 4864, 4865, 4866, 4867, 4868, 4869, 4870, 4871, 4872, 4873, 4874, 4875, 4876, 4877, 4878, 4879, 4880, 4881, 4882, 4883, 4884, 4885, 4886, 4887, 4888, 4889, 4890, 4891, 4892, 4893, 4894, 4917, 4918, 4919, 4920, 4921, 4922, 4923, 4924, 4925, 4939, 4940, 4941, 4943, 4947, 4948, 4950, 4951, 4955, 4956, 4957, 2315, 2320, 2322, 2326, 2349, 2350, 2352, 2377, 2382, 2390, 2407, 2422, 2436, 2443, 2457, 2463, 2464, 2470, 2477, 2483, 2721, 2968, 3093, 3185, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4104, 4105, 4106, 4107, 4108, 4109, 4110, 4111, 4112, 4113, 4114, 4115, 4116, 4117, 4118, 4119, 4120, 4121, 4122, 4123, 4124, 4125, 4126, 4346, 4353, 4362, 4369, 4386, 4391, 4394, 4408, 4410, 4413, 4415, 4422, 4423, 4432, 4433, 4442, 4469, 4487, 4489, 4491, 4493, 4494, 4495, 4496, 4497, 4498, 4499, 4500, 4501, 4502, 4503, 4504, 4505, 4506, 4507, 4508, 4509, 4343, 4484, 4485, 4486, 4488, 4490, and 4492. In some embodiments of any of the methods, the endophyte expresses one or more genes involved in starch and sucrose metabolism, cell wall degradation, or protection from oxidative stress.
In some embodiments, the protein is expressed with at least a two-fold difference, at least a three-fold difference, at least a four-fold difference, at least a five-fold difference, at least a six-fold difference, at least a seven-fold difference, at least an eight-fold difference, at least a nine-fold difference, at least a ten-fold difference or more in expression level as compared to the protein expression level of a reference microorganism. In some embodiments, the difference in expression level is positive. In some embodiments, the difference in expression level is negative.
In some embodiments, the endophyte comprises an ITS rRNA nucleic acid sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 344 and 447. In some embodiments, the endophyte comprises a 16S rRNA nucleic acid sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 439 or 441.
In some embodiments of any of the methods, the endophyte expresses one or more genes encoding a protein whose amino acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479, 483, 519, 532, 549, 557, 561, 562, 577, 578, 611, 626, 640, 656, 660, 666, 674, 676, 677, 678, 679, 680, 682, 683, 684, 685, 686, 688, 689, 690, 691, 692, 693, 696, 697, 698, 701, 704, 706, 710, 711, 716, 717, 718, 719, 720, 721, 722, 723, 724, 727, 728, 729, 730, 731, 732, 733, 734, 735, 737, 738, 741, 743, 744, 745, 746, 747, 748, 749, 751, 753, 756, 757, 759, 761, 762, 763, 764, 765, 766, 767, 768, 769, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 782, 783, 784, 785, 786, 788, 790, 793, 795, 796, 797, 798, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 815, 816, 817, 818, 819, 820, 822, 823, 824, 825, 826, 829, 830, 833, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 846, 848, 850, 851, 853, 854, 855, 856, 857, 858, 859, 860, 864, 865, 866, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 884, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 897, 898, 899, 901, 902, 903, 904, 905, 906, 907, 908, 910, 911, 912, 913, 914, 915, 916, 917, 918, 920, 921, 922, 923, 924, 926, 927, 928, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 968, 969, 971, 974, 976, 978, 979, 980, 984, 985, 987, 988, 989, 992, 993, 994, 995, 996, 998, 1000, 1001, 1002, 1003, 1006, 1008, 1010, 1011, 1012, 1014, 1015, 1016, 1017, 1018, 1019, 1021, 1022, 1023, 1024, 1025, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1036, 1037, 1038, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1055, 1056, 1058, 1059, 1060, 1062, 1064, 1065, 1066, 1068, 1070, 1071, 1072, 1076, 1077, 1079, 1080, 1081, 1083, 1085, 1086, 1087, 1088, 1090, 1091, 1092, 1094, 1095, 1096, 1097, 1098, 1099, 1101, 1102, 1103, 1104, 1106, 1107, 1108, 1110, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1121, 1122, 1123, 1124, 1126, 1127, 1129, 1130, 1131, 1132, 1133, 1134, 1136, 1137, 1138, 1139, 1140, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1151, 1153, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1174, 1176, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1196, 1197, 1198, 1199, 1200, 1201, 1203, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1213, 1214, 1216, 1217, 1218, 1219, 1221, 1222, 1223, 1225, 1226, 1228, 1229, 1230, 1231, 1232, 1233, 1235, 1237, 1238, 1239, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1290, 1292, 1293, 1296, 1297, 1298, 1300, 1301, 1303, 1304, 1306, 1307, 1308, 1309, 1311, 1312, 1313, 1314, 1317, 1319, 1320, 1321, 1322, 1323, 1324, 1325, 1326, 1327, 1328, 1330, 1331, 1333, 1334, 1335, 1336, 1337, 1338, 1339, 1340, 1341, 1342, 1343, 1344, 1345, 1346, 1347, 1348, 1350, 1351, 1352, 1353, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1368, 1369, 1370, 1371, 1372, 1374, 1375, 1376, 1379, 1380, 1382, 1383, 1384, 1385, 1386, 1388, 1389, 1390, 1391, 1392, 1393, 1396, 1397, 1398, 1399, 1400, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1424, 1425, 1426, 1427, 1428, 1430, 1431, 1432, 1433, 1437, 1438, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1448, 1449, 1450, 1452, 1453, 1456, 1459, 1466, 1467, 1469, 1471, 1478, 1479, 1482, 1483, 1484, 1485, 1487, 1488, 1489, 1490, 1495, 1497, 1498, 1499, 1500, 1501, 1504, 1505, 1506, 1508, 1511, 1513, 1514, 1516, 1520, 1526, 1529, 1534, 1535, 1537, 1538, 1540, 1545, 1547, 1548, 1549, 1550, 1551, 1552, 1553, 1554, 1556, 1559, 1561, 1562, 1565, 1566, 1568, 1569, 1570, 1571, 1573, 1574, 1575, 1576, 1577, 1578, 1579, 1580, 1581, 1582, 1583, 1585, 1588, 1589, 1591, 1592, 1593, 1594, 1595, 1596, 1597, 1598, 1601, 1603, 1604, 1605, 1607, 1608, 1609, 1611, 1612, 1613, 1614, 1615, 1616, 1617, 1618, 1619, 1620, 1622, 1624, 1625, 1626, 1627, 1628, 1629, 1630, 1632, 1633, 1636, 1637, 1638, 1639, 1640, 1641, 1642, 1643, 1644, 1646, 1647, 1648, 1650, 1651, 1652, 1654, 1657, 1659, 1660, 1661, 1664, 1665, 1666, 1667, 1668, 1671, 1673, 1675, 1676, 1678, 1679, 1681, 1684, 1685, 1686, 1689, 1690, 1692, 1693, 1694, 1695, 1696, 1697, 1698, 1701, 1705, 1706, 1707, 1709, 1711, 1712, 1713, 1714, 1716, 1717, 1718, 1720, 1721, 1723, 1724, 1725, 1726, 1728, 1729, 1731, 1732, 1734, 1735, 1736, 1737, 1738, 1739, 1740, 1741, 1743, 1744, 1745, 1746, 1747, 1750, 1751, 1753, 1754, 1755, 1760, 1761, 1762, 1763, 1764, 1765, 1767, 1770, 1771, 1772, 1775, 1776, 1777, 1778, 1779, 1780, 1781, 1782, 1786, 1787, 1788, 1789, 1791, 1792, 1793, 1794, 1795, 1797, 1798, 1799, 1800, 1801, 1803, 1804, 1805, 1806, 1809, 1810, 1811, 1814, 1815, 1818, 1819, 1820, 1821, 1822, 1823, 1824, 1825, 1826, 1828, 1830, 1831, 1833, 1835, 1836, 1837, 1838, 1839, 1840, 1841, 1842, 1843, 1846, 1851, 1852, 1854, 1857, 1858, 1860, 1861, 1862, 1863, 1864, 1866, 1868, 1869, 1870, 1872, 1873, 1874, 1875, 1876, 1878, 1879, 1880, 1881, 1883, 1884, 1885, 1887, 1888, 1892, 1893, 1894, 1896, 1898, 1899, 1900, 1901, 1902, 1903, 1904, 1905, 1906, 1907, 1910, 1911, 1913, 1915, 1916, 1917, 1918, 1920, 1921, 1924, 1925, 1926, 1927, 1928, 1930, 1932, 1933, 1934, 1935, 1938, 1939, 1940, 1942, 1943, 1945, 1946, 1948, 1949, 1950, 1951, 1953, 1954, 1955, 1959, 1960, 1961, 1962, 1963, 1965, 1966, 1967, 1970, 1971, 1973, 1975, 1976, 1977, 1979, 1981, 1982, 1983, 1984, 1985, 1986, 1988, 1990, 1994, 1995, 1996, 1998, 1999, 2000, 2001, 2002, 2003, 2006, 2007, 2008, 2009, 2010, 2011, 2013, 2014, 2015, 2016, 2017, 2018, 2019, 2020, 2021, 2022, 2024, 2025, 2026, 2027, 2028, 2029, 2030, 2031, 2032, 2034, 2035, 2036, 2037, 2038, 2039, 2040, 2041, 2042, 2043, 2044, 2045, 2046, 2047, 2048, 2049, 2050, 2052, 2054, 2055, 2059, 2060, 2062, 2065, 2066, 2067, 2068, 2069, 2070, 2071, 2074, 2076, 2077, 2080, 2081, 2082, 2083, 2085, 2086, 2087, 2088, 2089, 2090, 2091, 2092, 2093, 2095, 2096, 2097, 2098, 2100, 2101, 2102, 2103, 2104, 2105, 2108, 2109, 2110, 2112, 2113, 2115, 2116, 2117, 2118, 2119, 2120, 2121, 2125, 2127, 2128, 2129, 2131, 2132, 2134, 2135, 2136, 2138, 2140, 2141, 2142, 2143, 2145, 2146, 2147, 2148, 2149, 2150, 2153, 2154, 2155, 2156, 2158, 2159, 2160, 2162, 2163, 2165, 2166, 2167, 2168, 2169, 2170, 2171, 2172, 2174, 2176, 2177, 2179, 2180, 2181, 2182, 2183, 2184, 2185, 2186, 2188, 2190, 2191, 2192, 2193, 2194, 2195, 2196, 2197, 2198, 2200, 2202, 2204, 2205, 2206, 2207, 2208, 2210, 2211, 2212, 2214, 2215, 2216, 2217, 2218, 2219, 2220, 2221, 2222, 2223, 2225, 2226, 2227, 2228, 2229, 2230, 2231, 2232, 2233, 2234, 2235, 2236, 2238, 2239, 2241, 2242, 2243, 2244, 2245, 2246, 2248, 2249, 2251, 2253, 2254, 2255, 2257, 2258, 2259, 2261, 2262, 2265, 2267, 2268, 2269, and 2270.
In some embodiments of any of the methods, expression of the protein is modulated in response to the first endophyte contacting a plant element.
In some embodiments, expression of the protein is upregulated in response to the first endophyte contacting a plant element. In some embodiments, the amino acid sequence of the upregulated protein is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 549, 640, 656, 676, 684, 690, 937, 1456, 1467, 1479, 1484, 1488, 1490, 1498, 1499, 1500, 1504, 1505, 1508, 1513, 1529, 1534, 1538, 1540, 1547, 1551, 1554, 1561, 1566, 1568, 1570, 1571, 1574, 1578, 1581, 1583, 1591, 1592, 1593, 1597, 1598, 1604, 1605, 1609, 1615, 1616, 1619, 1622, 1624, 1626, 1629, 1630, 1632, 1636, 1638, 1642, 1643, 1647, 1650, 1651, 1652, 1659, 1661, 1664, 1666, 1671, 1675, 1676, 1678, 1684, 1685, 1689, 1692, 1694, 1695, 1696, 1701, 1706, 1709, 1711, 1712, 1718, 1723, 1725, 1728, 1729, 1732, 1737, 1738, 1740, 1741, 1744, 1746, 1747, 1751, 1755, 1761, 1763, 1771, 1772, 1775, 1778, 1779, 1782, 1787, 1788, 1791, 1792, 1797, 1798, 1799, 1800, 1805, 1819, 1824, 1828, 1835, 1840, 1842, 1843, 1846, 1854, 1860, 1862, 1868, 1875, 1892, 1893, 1900, 1901, 1910, 1918, 1924, 1925, 1926, 1928, 1932, 1933, 1934, 1938, 1943, 1946, 1949, 1950, 1953, 1963, 1967, 1971, 1973, 1975, 1985, 1990, 1994, 1998, 2000, 2003, 2006, 2010, 2013, 2016, 2018, 2021, 2025, 2027, 2028, 2030, 2034, 2035, 2036, 2048, 2050, 2052, 2054, 2059, 2062, 2065, 2066, 2067, 2068, 2074, 2080, 2091, 2092, 2093, 2095, 2097, 2098, 2100, 2101, 2104, 2108, 2110, 2112, 2117, 2119, 2125, 2131, 2134, 2135, 2145, 2149, 2150, 2156, 2159, 2162, 2168, 2181, 2185, 2193, 2195, 2196, 2206, 2211, 2216, 2217, 2219, 2220, 2221, 2223, 2231, 2236, 2239, 2242, 2243, 2248, 2255, 2257, 2258, 2259, or 2262.
In some embodiments, expression of the protein is repressed in response to the first endophyte contacting a plant element. In some embodiments, the repressed protein amino acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 479, 483, 519, 532, 557, 626, 674, 678, 680, 683, 685, 688, 690, 696, 697, 701, 704, 706, 710, 711, 717, 720, 722, 723, 724, 728, 729, 730, 732, 733, 734, 737, 741, 744, 745, 748, 749, 751, 753, 756, 757, 761, 764, 766, 768, 769, 772, 773, 774, 778, 779, 782, 783, 784, 788, 790, 793, 795, 796, 797, 800, 802, 803, 806, 807, 808, 810, 812, 817, 818, 819, 820, 822, 825, 826, 833, 836, 837, 839, 841, 846, 848, 851, 853, 854, 855, 856, 857, 860, 864, 865, 866, 870, 872, 874, 876, 878, 879, 880, 881, 882, 884, 886, 887, 890, 891, 893, 894, 895, 898, 901, 903, 905, 907, 908, 910, 911, 912, 913, 915, 917, 918, 921, 924, 926, 927, 928, 933, 934, 935, 936, 937, 938, 940, 942, 944, 945, 946, 947, 950, 952, 954, 955, 957, 960, 961, 962, 963, 964, 968, 971, 976, 978, 979, 985, 987, 989, 992, 1000, 1001, 1002, 1003, 1006, 1008, 1012, 1014, 1018, 1019, 1021, 1022, 1024, 1025, 1028, 1031, 1032, 1034, 1037, 1038, 1040, 1042, 1043, 1046, 1047, 1050, 1051, 1056, 1059, 1064, 1065, 1068, 1070, 1072, 1077, 1079, 1083, 1086, 1087, 1091, 1094, 1095, 1098, 1102, 1103, 1104, 1110, 1111, 1112, 1113, 1114, 1116, 1117, 1118, 1121, 1126, 1130, 1132, 1133, 1134, 1136, 1139, 1143, 1146, 1147, 1151, 1155, 1156, 1158, 1159, 1160, 1162, 1163, 1165, 1168, 1170, 1172, 1174, 1176, 1180, 1182, 1183, 1186, 1188, 1192, 1193, 1194, 1196, 1197, 1198, 1209, 1214, 1217, 1218, 1219, 1221, 1222, 1223, 1225, 1226, 1230, 1237, 1242, 1244, 1249, 1251, 1253, 1256, 1260, 1261, 1262, 1264, 1270, 1272, 1274, 1276, 1279, 1280, 1283, 1284, 1285, 1286, 1288, 1290, 1292, 1298, 1300, 1303, 1307, 1309, 1311, 1312, 1313, 1320, 1321, 1324, 1325, 1328, 1330, 1331, 1333, 1336, 1337, 1339, 1340, 1344, 1346, 1352, 1353, 1355, 1357, 1358, 1359, 1360, 1361, 1363, 1364, 1365, 1370, 1375, 1376, 1379, 1380, 1383, 1384, 1386, 1390, 1391, 1392, 1393, 1396, 1399, 1400, 1402, 1405, 1408, 1411, 1412, 1418, 1420, 1422, 1427, 1428, 1431, 1433, 1438, 1439, 1440, 1442, 1444, 1445, 1449, or 1450.
In some embodiments, the protein is expressed with at least a two-fold difference, at least a three-fold difference, at least a four-fold difference, at least a five-fold difference, at least a six-fold difference, at least a seven-fold difference, at least an eight-fold difference, at least a nine-fold difference, at least a ten-fold difference or more in expression level as compared to the protein expression level of a reference microorganism. In some embodiments of any of the methods, the difference in expression level is positive. In some embodiments, the difference in expression level is negative.
In some embodiments, the protein is involved in at least one KEGG pathway selected from the group consisting of: endocytosis, purine metabolism, inositol phosphate metabolism, and peroxisome. In some embodiments, the protein is involved in at least one KEGG pathway selected from the group consisting of: ko00403 (indole diterpene alkaloid biosynthesis), ko00522 (biosynthesis of 12-, 14- and 16-membered macrolides), ko00550 (peptidoglycan biosynthesis), ko00601 (glycosphingolipid biosynthesis—lacto and neolacto series), ko0901 (indole alkaloid biosynthesis), ko01052 (type I polyketide structures), ko010503 (biosynthesis of siderophore group nonribosomal peptides), ko01501 (beta-Lactam resistance), and ko04071 (sphingolipid signaling pathway).
In some embodiments of any of the plants, formulations, synthetic combinations, or other compositions of the invention, the plant, crop, seedling, or plant grown from the seed expresses one or more genes whose nucleic acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4127, 4128, 4129, 4130, 4131, 4132, 4133, 4134, 4135, 4136, 4137, 4138, 4139, 4140, 4141, 4142, 4143, 4144, 4145, 4146, 4147, 4148, 4149, 4150, 4151, 4152, 4153, 4154, 4155, 4156, 4157, 4158, 4159, 4160, 4161, 4162, 4163, 4164, 4165, 4166, 4167, 4168, 4169, 4170, 4171, 4172, 4173, 4174, 4175, 4176, 4177, 4178, 4179, 4180, 4181, 4182, 4183, 4184, 4185, 4186, 4187, 4188, 4189, 4190, 4191, 4192, 4193, 4194, 4195, 4196, 4197, 4198, 4199, 4200, 4201, 4202, 4203, 4204, 4205, 4206, 4207, 4208, 4209, 4210, 4211, 4212, 4213, 4214, 4215, 4216, 4217, 4218, 4219, 4220, 4221, 4222, 4223, 4224, 4225, 4226, 4227, 4228, 4229, 4230, 4231, 4232, 4233, 4234, 4235, 4236, 4237, 4238, 4239, 4240, 4241, 4242, 4243, 4244, 4245, 4246, 4247, 4248, 4249, 4250, 4251, 4252, 4253, 4254, 4255, 4256, 4257, 4258, 4259, 4260, 4261, 4262, 4263, 4264, 4265, 4266, 4267, 4268, or 4269.
In some embodiments, the one or more plant genes are modulated in response to the first endophyte contacting the plant or plant element as compared to a reference microorganism contacting the plant or plant element.
In some embodiments, the one or more plant genes are upregulated in response to the first endophyte contacting a plant element as compared to a reference microorganism contacting the plant or plant element. In some embodiments, the upregulated gene's nucleic acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4131, 4140, 4142, 4153, 4162, 4167, 4181, 4183, 4184, 4195, 4199, 4201, 4206, 4213, 4222, 4223, 4250, 4253, or 4269.
In some embodiments, the transcription of one or more genes are repressed in response to the first endophyte contacting a plant element as compared to a reference microorganism contacting the plant or plant element. In some embodiments, the repressed genes nucleic acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 4150.
In some embodiments, the one or more genes are expressed with at least a 0.5-fold difference, at least a 0.6-fold difference, at least a 0.7-fold difference, at least a 0.8-fold difference, at least a 0.9-fold difference, at least a 1.0-fold difference, at least a 1.1-fold difference, at least a 1.2-fold difference, at least a 1.3-fold difference or more in expression level as compared to the gene expression level of a reference microorganism. In some embodiments, the difference in expression level is positive. In some embodiments, the difference in expression level is negative.
In some embodiments, the one or more genes has at least one gene function selected from the group consisting of: cell wall modification, defense response, oxidation-reduction process, biological process, regulation of transcription, metabolic process, glucosinolate biosynthetic process, response to karrikin, protein phosphorylation, protein folding, response to chitin, proteolysis, response to auxin stimulus, DNA-dependent regulation of transcription, N-terminal protein myristoylation, response to oxidative stress, cellular component, leaf senescence, resistance gene-dependent defense response signaling pathway, zinc ion binding, response to cold, malate metabolic process, transport, catalytic activity, response to ozone, VQ motif, regulation of systemic acquired resistance, potassium ion transport, anaerobic respiration, multicellular organismal development, response to heat, methyltransferase activity, response to wounding, oxidation-reduction process, monooxygenase activity, oxidation-reduction process, carbohydrate metabolic process, exocytosis, nuclear-transcribed mRNA poly(A) tail shortening, sodium ion transport, glycerol metabolic process, on willebrand factor A3, response to water deprivation, response to salt stress, and chlorophyll biosynthetic process. In some embodiments, the gene has a gene ontology (GO) identifier selected from the group consisting of: GO:0003824, GO, catalytic activity; GO:0006355, GO, regulation of transcription, DNA-dependent; GO:0009870, GO, defense response signaling pathway, resistance gene-dependent; GO:0008150, GO, biological process; GO:0010200, GO, response to chitin; GO:0006508, GO, proteolysis; GO:0010193, GO, response to ozone; GO:0006979, GO, response to oxidative stress; and GO:0005975, GO, carbohydrate metabolic process.
In some embodiments, the gene function is selected from the following group: single-stranded DNA specific endodeoxyribonuclease activity, sequence-specific DNA binding transcription factor activity, NAD+ADP-ribosyltransferase activity, metalloendopeptidase activity, DNA catabolic process, cellular iron ion homeostasis, response to osmotic stress, metallopeptidase activity, zinc ion binding, response to wounding, camalexin biosynthetic process, endoribonuclease activity, producing 5′-phosphomonoesters, cellular response to heat, T/G mismatch-specific endonuclease activity, polyamine oxidase activity, flavin adenine dinucleotide binding, cellular heat acclimation, cellular response to ethylene stimulus, cellular response to nitric oxide, and reactive oxygen species metabolic process.
In some embodiments, the endophyte comprises an ITS rRNA nucleic acid sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 344.
In some embodiments of any of the plants, formulations, synthetic combinations, or other compositions of the invention, the endophyte expresses one or more genes encoding a protein whose amino acid sequence is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 477-501, 505, 514, 518, 521, 528, 530, 531, 550, 566, 567, 572, 579, 580, 581, 587, 593, 600, 602, 614, 623, 630, 635, 643, 645, 652, 657, 661, 662, 667, 670, 672, 673, 4510-4535, 4540, 4541, 4542, 4547, 4555, 4558, 4560, 4569, 4570, 4571, 4572, 4577, 4582, 4592, 4594, 4602, 4608, 4609, 4622, 4626, 4641, 4643, 4653, 4654, 4742-4766, 4734, 4739, 4740, 477, 478, 480, 482, 484, 485, 487, 489, 494, 496, 497, 501, 530, 567, 587, 602, 614, 633, 645, 649, 651, 652, 658, 665, 666, 667, 673, 874, 934, 1013, 1249, 1342, 2252, 2272, 2273, 2281, 2282, 2284, 2285, 2286, 2287, 2289, 2290, 2291, 2292, 2293, 2296, 4510, 4514, 4515, 4518, 4520, 4521, 4525, 4526, 4527, 4529, 4532, 4538, 4539, 4540, 4555, 4559, 4560, 4562, 4569, 4570, 4571, 4572, 4577, 4581, 4582, 4594, 4595, 4597, 4608, 4615, 4618, 4623, 4624, 4626, 4630, 4632, 4635, 4641, 4642, 4646, 4650, 4658, 4659, 4661, 4662, 4663, 4666, 4667, 4668, 4670, 4799, 4801, 4802, 4803, 4804, 4805, 4826, 4827, 4828, 4829, 4830, 4831, 4832, 4833, 4834, 4835, 4836, 4837, 4838, 4839, 4840, 4841, 4863, 4864, 4865, 4866, 4867, 4868, 4869, 4870, 4871, 4872, 4873, 4874, 4875, 4876, 4877, 4878, 4879, 4880, 4881, 4882, 4883, 4884, 4885, 4886, 4887, 4888, 4889, 4890, 4891, 4892, 4893, 4894, 4917, 4918, 4919, 4920, 4921, 4922, 4923, 4924, 4925, 4939, 4940, 4941, 4943, 4947, 4948, 4950, 4951, 4955, 4956, 4957, 2315, 2320, 2322, 2326, 2349, 2350, 2352, 2377, 2382, 2390, 2407, 2422, 2436, 2443, 2457, 2463, 2464, 2470, 2477, 2483, 2721, 2968, 3093, 3185, 4096, 4097, 4098, 4099, 4100, 4101, 4102, 4103, 4104, 4105, 4106, 4107, 4108, 4109, 4110, 4111, 4112, 4113, 4114, 4115, 4116, 4117, 4118, 4119, 4120, 4121, 4122, 4123, 4124, 4125, 4126, 4346, 4353, 4362, 4369, 4386, 4391, 4394, 4408, 4410, 4413, 4415, 4422, 4423, 4432, 4433, 4442, 4469, 4487, 4489, 4491, 4493, 4494, 4495, 4496, 4497, 4498, 4499, 4500, 4501, 4502, 4503, 4504, 4505, 4506, 4507, 4508, 4509, 4343, 4484, 4485, 4486, 4488, 4490, and 4492.
In some embodiments of any of the plants, formulations, synthetic combinations, or other compositions of the invention, the endophyte expresses one or more genes involved in starch and sucrose metabolism, cell wall degradation, or protection from oxidative stress. In some embodiments, the protein is expressed with at least a two-fold difference, at least a three-fold difference, at least a four-fold difference, at least a five-fold difference, at least a six-fold difference, at least a seven-fold difference, at least an eight-fold difference, at least a nine-fold difference, at least a ten-fold difference or more in expression level as compared to the protein expression level of a reference microorganism. In some embodiments, the difference in expression level is positive.
In some embodiments, the difference in expression level is negative. In some embodiments, the endophyte comprises an ITS rRNA nucleic acid sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 344 and 447. In some embodiments, the wherein the endophyte comprises a 16S rRNA nucleic acid sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 439 or 441.
Therefore, in a first aspect, inventions described herein provide a synthetic combination of a plant element of a first plant and a preparation of an endophyte that is coated onto the surface of the plant element of the first plant such that the endophyte is present at a higher level on the surface of the plant element than is present on the surface of an uncoated reference plant element, wherein the endophyte is isolated from the inside of the plant element of a second plant. In some embodiments, a synthetic combination comprises a plant element of a first plant and a preparation of one or more endophytes. In some embodiments, the one or more endophytes are selected from the group consisting of fungi, bacteria, and combinations thereof. In some embodiments, the one or more endophytes of the synthetic combination are fungi. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more endophytes of the synthetic combination are fungi. In some embodiments, one or more endophytes of the synthetic combination are bacteria. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more endophytes of the synthetic combination are bacteria. In some embodiments, one or more endophytes of the synthetic combination comprise both fungi and bacteria. In some embodiments, one or more endophytes of the synthetic combination comprise at least one fungus and at least one bacterium. In some embodiments, one or more endophytes of the synthetic combination comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more bacteria, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more fungi, and combinations thereof.
In some embodiments, the endophyte comprises a taxon that is present in at least two species that are selected from cereal, fruit and vegetable, wild grassland and oilseed plants. In some embodiments, the endophyte comprises a nucleic acid that is at least 97% identical, for example, at least 98% identical, at least 99% identical, at least 99.5% identical, or 100% identical to the nucleic acid sequence selected from the groups provided in Table 1, Table 2, Table 7, and Table 8.
In some embodiments, the isolated endophyte is cultured, for example, prior to being coated onto the surface of the plant element. The endophyte can be cultured in a synthetic or semi-synthetic medium.
The isolated endophyte can be associated with the surface of the seed of the first plant. In some embodiments, the endophyte is not associated with the surface of the plant element of the first plant.
The present invention contemplates a synthetic combination in which the first plant and the second plant are the same species. In a particular embodiment, the first plant and the second plant are the same cultivar. The synthetic combination may also make use of an endophyte that is isolated from a plant that is a different species from the first plant.
In some embodiments, the plant element of the first plant is from a monocotyledonous plant. For example, the plant element of the first plant is from a cereal plant. The plant element of the first plant can be selected from the group consisting of maize, wheat, barley, onion, rice, or sorghum. In an alternative embodiment, the seed of the first plant is from a dicotyledonous plant. The plant element of the first plant can be selected from the group consisting of cotton, Brassica napus, tomato, pepper, cabbage, lettuce, melon, strawberry, turnip, watermelon, peanut or soybean. In a particular embodiment, the plant is not a cotton plant. In still another embodiment, the plant is not a soybean. In another embodiment, the plant is not maize. In yet another embodiment, the plant is not wheat.
In some embodiments, the plant element of the first plant can be from a genetically modified plant. In another embodiment, the plant element of the first plant can be a hybrid plant element.
The synthetic combination can comprise a plant element of the first plant that is surface-sterilized prior to combining with the endophytes.
As stated above, the endophyte used in the synthetic combination is derived from within the plant element of a second plant. In some embodiments, the second plant is a monocotyledonous plant or tissue thereof. In a particular embodiment, the second plant is a cereal plant or tissue thereof. In some embodiments, the second plant is selected from the group consisting of a maize plant, a barley plant, a wheat plant, an onion plant, a rice plant, or a sorghum plant. In some embodiments, the plant element is a seed that is a naked grain (i.e., without hulls or fruit cases). In an alternative embodiment, the second plant is a dicotyledonous plant. For example, the second plant can be selected from the group consisting of a cotton plant, a Brassica Napus plant, a tomato plant, a pepper plant, a cabbage plant, a lettuce plant, a melon plant, a strawberry plant, a turnip plant, a watermelon plant, a peanut plant or a soybean plant.
In some embodiments, the endophyte is coated on the surface of the plant element of the first plant in an amount effective to confer in the plant element or resulting plant thereof an improved agronomic trait. For example, in one embodiment, the agronomic trait is selected from the group consisting of: improved leaf biomass, improved vigor, improved fruit mass, improved grain yield, improved root mass, increased flower number, increased plant height, earlier flowering, and enhanced germination rate. Alternatively, or in addition, the agronomic trait is selected from the group consisting of: improved resistance to drought, improved water use efficiency, improved nitrogen use efficiency, improved nitrogen uptake, improved resistance to salt stress, improved resistance to heat, improved resistance to cold, improved metal tolerance, and improved nutritional content, improved uptake of micronutrients including metal ions, improved uptake of phosphorus and improved uptake of potassium. In some embodiments, the agronomic trait is selected from the group consisting of: improved nematode resistance, improved fungal pathogen resistance, improved pathogen resistance, improved herbivore resistance, improved viral pathogen resistance.
In some embodiments, the seed of the first plant is coated with at least 1 CFU or spores of the endophyte per seed, for example, at least 2 CFU or spores, at least 5 CFU or spores, at least 10 CFU or spores, at least 30 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores or more per seed.
The synthetic combination can additionally comprise a seed coating composition. The seed coating composition can comprise an agent selected from the group consisting of: a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, a nutrient, and combinations thereof. The seed coating composition can further comprise an agent selected from the group consisting of an agriculturally acceptable carrier, a tackifier, a microbial stabilizer, and combinations thereof. In some embodiments, the seed coating composition can contain a second microbial preparation, including but not limited to a rhizobial bacterial preparation.
The present invention contemplates the use of endophytes that are unmodified, as well as those that are modified. In some embodiments, the endophyte is a recombinant endophyte. In one particular embodiment, the endophyte is modified prior to coating onto the surface of the seed such that it has enhanced compatibility with an antimicrobial agent when compared with the unmodified. For example, the endophyte can be modified such that it has enhanced compatibility with an antibacterial agent. In an alternative embodiment, the endophyte has enhanced compatibility with an antifungal agent. The endophyte can be modified such that it exhibits at least 3 fold greater, for example, at least 5 fold greater, at least 10 fold greater, at least 20 fold greater, at least 30 fold greater or more resistance to an antimicrobial agent when compared with the unmodified endophyte. The endophyte can be substantially purified from any other microbial entity. In one embodiment, the antimicrobial agent is an antibacterial agent. In another embodiment, the antimicrobial agent is an antifungal agent.
In one particular embodiment, the antimicrobial agent is glyphosate. For example, the modified endophyte exhibits at least 3 fold greater, for example, at least 5 fold greater, at least 10 fold greater, at least 20 fold greater, at least 30 fold greater or more resistance to the antimicrobial agent when compared with the unmodified endophyte. In the alternative, the modified endophyte has a doubling time in growth medium containing at least 1 mM glyphosate, for example, at least 2 mM glyphosate, at least 5 mM glyphosate, at least 10 mM glyphosate, at least 15 mM glyphosate or more, that is no more than 250%, for example, no more than 200%, no more than 175%, no more than 150%, or no more than 125%, of the doubling time of the endophyte in the same growth medium containing no glyphosate. In still another embodiment, the modified endophyte has a doubling time in a plant tissue containing at least 10 ppm glyphosate, for example, at least 15 ppm glyphosate, at least 20 ppm glyphosate, at least 30 ppm glyphosate, at least 40 ppm glyphosate or more, that is no more than 250%, for example, no more than 200%, no more than 175%, no more than 150%, or no more than 125%, of the doubling time of the unmodified endophyte in a reference plant tissue containing no glyphosate.
The present invention also contemplates the use of multiple endophytes. For example, in some embodiments, the synthetic combination described above can comprise a plurality of purified endophytes, for example, 2, 3, 4 or more different types of endophytes.
In another aspect, the present invention provides for a method for improving a trait in an agricultural plant, the method comprising: Providing an agricultural plant, contacting the plant with a formulation comprising a endophytic microbial entity comprising a nucleic acid sequence that is at least 97% identical, at least 98% identical, at least 99% identical, at least 99.5% identical, or 100% identical, to the nucleic acid sequence selected from the groups provided in Table 1, Table 2, Table 7, and Table 8 that is present in the formulation in an amount effective to colonize the plant and allowing the plant to grow under conditions that allow the endophytic microbial entity to colonize the plant.
Also described herein are preparations comprising a population of isolated modified endophytes described above. Preparations described herein further comprise an agriculturally acceptable carrier, and the preparation comprises an amount of endophytes sufficient to improve an agronomic trait of the population of seeds. For example, in one embodiment, the agronomic trait is selected from the group consisting of: improved leaf biomass, improved vigor, improved fruit mass, improved grain yield, improved root mass, increased flower number, increased plant height, earlier flowering, enhanced germination rate and combinations thereof. Alternatively, or in addition, the agronomic trait is selected from the group consisting of: improved resistance to drought, improved water use efficiency, improved nitrogen use efficiency, improved nitrogen uptake, improved resistance to salt stress, improved resistance to heat, improved resistance to cold, improved metal tolerance, improved nutritional content, improved uptake of micronutrients including metal ions, improved uptake of phosphorus, improved uptake of potassium and combinations thereof. In some embodiments, the agronomic trait is selected from the group consisting of: improved nematode resistance, improved fungal pathogen resistance, improved pathogen resistance, improved herbivore resistance, improved viral pathogen resistance, and combinations thereof. In some embodiments, the preparation is substantially stable at temperatures between about 2° C. and about 45° C. for at least about thirty days.
Preparations can be conveniently formulated to provide the ideal number of endophytes onto a seed to produce synthetic combinations described above. In some embodiments, a preparation is formulated to provide at least 100 endophytes, for example, at least 300 endophyte, 1,000 endophytes, 3,000 endophytes, 10,000 endophytes or more per seed. In some embodiments, a preparation is formulated to provide a population of plants that demonstrates a substantially homogenous growth rate when introduced into agricultural production. Inventions described herein also contemplate a preparation comprising two or more different purified endophytes.
Also described herein are commodity plant products comprising a plant or part of a plant (including a seed) and further comprising the modified endophyte described above that is present in a detectable level, for example, as detected by the presence of its nucleic acid by PCR.
In another aspect of the present invention, a seed comprising synthetic combinations described herein is provided. In still another aspect, disclosed is a substantially uniform population of seeds comprising a plurality of such seeds. In one embodiment, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in the population, contains a viable endophyte or endophytes disposed on the surface of the seeds. In a particular embodiment, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in the population contains at least 10 CFU or spores, for example, at least 30 CFU or spores, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores or more, of the endophyte or endophytes coated onto the surface of the seed.
In still another aspect, the present invention discloses a substantially uniform population of plants produced by growing the population of seeds described above. In one embodiment, at least 75%, at least 80%, at least 90%, at least 95% or more of the plants comprise in one or more tissues an effective amount of the endophyte or endophytes. In another embodiment, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, at least 80%, at least 90%, at least 95% or more of the plants comprise a microbe population that is substantially similar.
In another aspect, described herein is an agricultural field, including a greenhouse comprising the population of plants described above. In on embodiment, the agricultural field comprises at least 100 plants. In another embodiment, the population occupies at least about 100 square feet of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the population comprises an effective amount of the microbe. In another embodiment, the population occupies at least about 100 square feet of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the population comprises the microbe in reproductive tissue. In still another embodiment, the population occupies at least about 100 square feet of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the population comprises at least 10 CFUs or spores, 100 CFUs or spores, 1,000 CFUs or spores, 10,000 CFUs or spores or more of the microbe. In yet another embodiment, the population occupies at least about 100 square feet of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the population comprises an exogenous microbe (i.e., the endophyte) of monoclonal origin.
In another aspect, disclosed is a method of producing a commodity plant product, comprising obtaining a plant or plant tissue from the synthetic combination described above, and producing the commodity plant product therefrom. The commodity plant product can be produced from the seed, or the plant (or a part of the plant) grown from the seed. The commodity plant product can also be produced from the progeny of such plant or plant part. The commodity plant product can be is selected from the group consisting of grain, flour, starch, seed oil, syrup, meal, flour, oil, film, packaging, nutraceutical product, an animal feed, a fish fodder, a cereal product, a processed human-food product, a sugar or an alcohol and protein.
The drawings are for illustration purposes only not for limitation.
In order for the present invention to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.
As used herein, an “agricultural seed” is a seed used to grow a plant typically used in agriculture (an “agricultural plant”). The seed may be of a monocot or dicot plant, and may be planted for the production of an agricultural product, for example grain, food, feed, fiber, fuel, etc. As used herein, an agricultural seed is a seed that is prepared for planting, for example, in farms for growing.
An “endophyte” or “endophytic entity” or “endophytic microbe” is a symbiotic organism (e.g., a microorganism, e.g., a bacterium, e.g., a fungi) capable of living within a plant or is otherwise associated therewith, and does not cause disease or harm the plant otherwise, and confers one or more beneficial properties to the host plant. In some embodiments, an endophyte is a microorganism. In some embodiments, an endophyte is a microorganism that is associated with one or more host plant tissues and is in a symbiotic, e.g., beneficial relationship with said host plant tissues. In some embodiments, an endophyte is a microorganism, e.g., a bacterial or fungal organism, that confers an increase in yield, an increase in biomass, an increase in stress resistance, an increase in fitness, or combinations thereof, in its host plant. Endophytes may occupy the intracellular or extracellular spaces of plant tissue, including the leaves, stems, flowers, fruits, seeds, roots and combinations thereof. As used herein, the term “endophytic component” refers to a composition and/or structure that is part of the endophyte.
As used herein, the term “microbe” or “microorganism” refers to any species or taxon of microorganism, including, but not limited to, archaea, bacteria, microalgae, fungi (including mold and yeast species), mycoplasmas, microspores, nanobacteria, oomycetes, and protozoa. In some embodiments, a microbe or microorganism is an endophyte. In some embodiments, a microbe is an endophyte. In some embodiments, a microbe or microorganism encompasses individual cells (e.g., unicellular microorganisms) or more than one cell (e.g., multi-cellular microorganism). A “population of microorganisms” may thus refer to a multiple cells of a single microorganism, in which the cells share common genetic derivation. As used herein, the term “neutral” microbe or “neutral” microorganism refers to a microorganism that is both non-beneficial and non-pathogenic to a host plant.
As used herein, the term “bacteria” or “bacterium” refers in general to any prokaryotic organism, and may reference an organism from either Kingdom Eubacteria (Bacteria), Kingdom Archaebacteria (Archae), or both.
As used herein, the term “fungus” or “fungi” refers in general to any organism from Kingdom Fungi.
A “spore” or a population of “spores” refers to bacteria or fungi that are generally viable, more resistant to environmental influences such as heat and bactericidal or fungicidal agents than other forms of the same bacteria or fungi, and typically capable of germination and out-growth. Bacteria and fungi that are “capable of forming spores” are those bacteria and fungi comprising the genes and other necessary abilities to produce spores under suitable environmental conditions.
“Internal Transcribed Spacer” (ITS) refers to the spacer DNA (non-coding DNA) situated between the small-subunit ribosomal RNA (rRNA) and large-subunit rRNA genes in the chromosome or the corresponding transcribed region in the polycistronic rRNA precursor transcript.
A “plurality of endophytes” means two or more types of endophyte entities, e.g., of simple bacteria or simple fungi, complex fungi, or combinations thereof. In some embodiments, the two or more types of endophyte entities are two or more strains of endophytes. In other embodiments, the two or more types of endophyte entities are two or more species of endophytes. In yet other embodiments, the two or more types of endophyte entities are two or more genera of endophytes. In yet other embodiments, the two or more types of endophyte entities are two or more families of endophytes. In yet other embodiments, the two or more types of endophyte entities are two or more orders of endophytes.
A “population” of endophytes refers to a plurality of cells of a single endophyte, in which the cells share common genetic derivation.
A “complex network” means a plurality of endophytes co-localized in an environment, such as on or within an agricultural plant. Preferably, a complex network includes two or more types of endophyte entities that synergistically interact, such synergistic endophytic populations capable of providing a benefit to the agricultural seed, seedling, or plant derived thereby.
The terms “pathogen” and “pathogenic” in reference to a bacterium or fungus includes any such organism that is capable of causing or affecting a disease, disorder or condition of a host comprising the organism.
A “spore” or a population of “spores” refers to bacteria or fungi that are generally viable, more resistant to environmental influences such as heat and bactericidal or fungicidal agents than other forms of the same bacteria or fungi, and typically capable of germination and out-growth. Bacteria and fungi that are “capable of forming spores” are those bacteria and fungi comprising the genes and other necessary abilities to produce spores under suitable environmental conditions.
As used herein, a “colony-forming unit” (“CFU”) is used as a measure of viable microorganisms in a sample. A CFU is an individual viable cell capable of forming on a solid medium a visible colony whose individual cells are derived by cell division from one parental cell.
The term “isolated” is intended to specifically reference an organism, cell, tissue, polynucleotide, or polypeptide that is removed from its original source and purified from additional components with which it was originally associated. For example, an endophyte may be considered isolated from a seed if it is removed from that seed source and purified so that it is isolated from any additional components with which it was originally associated. Similarly, an endophyte may be removed and purified from a plant or plant element so that it is isolated and no longer associated with its source plant or plant element.
As used herein, an isolated strain of a microbe is a strain that has been removed from its natural milieu. “Pure cultures” or “isolated cultures” are cultures in which the organisms present are only of one strain of a particular genus and species. This is in contrast to “mixed cultures,” which are cultures in which more than one genus and/or species of microorganism are present. As such, the term “isolated” does not necessarily reflect the extent to which the microbe has been purified. A “substantially pure culture” of the strain of microbe refers to a culture which contains substantially no other microbes than the desired strain or strains of microbe. In other words, a substantially pure culture of a strain of microbe is substantially free of other contaminants, which can include microbial contaminants. Further, as used herein, a “biologically pure” strain is intended to mean the strain separated from materials with which it is normally associated in nature. A strain associated with other strains, or with compounds or materials that it is not normally wound with in nature, is still defined as “biologically pure.” A monoculture of a particular strain is, of course, “biologically pure.” As used herein, the term “enriched culture” of an isolated microbial strain refers to a microbial culture that contains more that 50%, 60%, 70%, 80%, 90%, or 95% of the isolated strain.
A “plant element” is intended to generically reference either a whole plant or a plant component, including but not limited to plant tissues, parts, and cell types. A plant element is preferably one of the following: whole plant, seedling, meristematic tissue, ground tissue, vascular tissue, dermal tissue, seed, leaf, root, shoot, stem, flower, fruit, stolon, bulb, tuber, corm, kelkis, shoot, bud. As used herein, a “plant element” is synonymous to a “portion” of a plant, and refers to any part of the plant, and can include distinct tissues and/or organs, and may be used interchangeably with the term “tissue” throughout.
Similarly, a “plant reproductive element” is intended to generically reference any part of a plant that is able to initiate other plants via either sexual or asexual reproduction of that plant, for example but not limited to: seed, seedling, root, shoot, stolon, bulb, tuber, corm, keikis, or bud.
A “population” of plants, as used herein, refers to a plurality of plants that are of the same taxonomic category, typically of the same species, and will also typically share a common genetic derivation.
As used herein, an “agricultural seed” is a seed used to grow a plant typically used in agriculture (an “agricultural plant”). The seed may be of a monocot or dicot plant, and may be planted for the production of an agricultural product, for example feed, food, fiber, fuel, etc. As used herein, an agricultural seed is a seed that is prepared for planting, for example, in farms for growing.
“Agricultural plants”, or “plants of agronomic importance”, include plants that are cultivated by humans for food, feed, fiber, and fuel purposes. Agricultural plants include monocotyledonous species such as: maize (Zea mays), common wheat (Triticum aestivum), spelt (Triticum spelta), einkorn wheat (Triticum monococcum), emmer wheat (Triticum dicoccum), durum wheat (Triticum durum), Asian rice (Oryza sativa), African rice (Oryza glabaerreima), wild rice (Zizania aquatica, Zizania latifolia, Zizania palustris, Zizania texana), barley (Hordeum vulgare), Sorghum (Sorghum bicolor), Finger millet (Eleusine coracana), Proso millet (Panicum miliaceum), Pearl millet (Pennisetum glaucum), Foxtail millet (Setaria italica), Oat (Avena sativa), Triticale (Triticosecale), rye (Secale cereal), Russian wild rye (Psathyrostachys juncea), bamboo (Bambuseae), or sugarcane (e.g., Saccharum arundinaceum, Saccharum barberi, Saccharum bengalense, Saccharum edule, Saccharum munja, Saccharum officinarum, Saccharum procerum, Saccharum ravennae, Saccharum robustum, Saccharum sinense, or Saccharum spontaneum); as well as dicotyledonous species such as: soybean (Glycine max), canola and rapeseed cultivars (Brassica napus), cotton (genus Gossypium), alfalfa (Medicago sativa), cassava (genus Manihot), potato (Solanum tuberosum), tomato (Solanum lycopersicum), pea (Pisum sativum), chick pea (Cicer arietinum), lentil (Lens culinaris), flax (Linum usitatissimum), peanut (Arachis hypogaea) and many varieties of vegetables.
A “host plant” includes any plant, particularly a plant of agronomic importance, which an endophyte can colonize. As used herein, an endophyte is said to “colonize” a plant or plant element when it can be stably detected within the plant or plant element over a period time, such as one or more days, weeks, months or years, in other words, a colonizing entity is not transiently associated with the plant or plant element. Such host plants are preferably plants of agronomic importance.
A “non-host target” means an organism or chemical compound that is altered in some way after contacting a host plant or host fungus that comprises an endophyte, as a result of a property conferred to the host plant or host fungus by the endophyte.
As used herein, a “hybrid plant” refers generally refers to a plant that is the product of a cross between two genetically different parental plants. A hybrid plant is generated by either a natural or artificial process of hybridization whereby the entire genome of one species, variety cultivar, breeding line or individual plant is combined intra- or interspecifically into the genome of species, variety or cultivar or line, breeding line or individual plant by crossing.
An “inbred plant”, as used herein, refers to a plant or plant line that has been repeatedly crossed or inbred to achieve a high degree of genetic uniformity, and low heterozygosity, as is known in the art.
The term “isoline” is a comparative term, and references organisms that are genetically identical, but may differ in treatment. In one example, two genetically identical maize plant embryos may be separated into two different groups, one receiving a treatment (such as transformation with a heterologous polynucleotide, to create a genetically modified plant) and one control that does not receive such treatment. Any phenotypic differences between the two groups may thus be attributed solely to the treatment and not to any inherency of the plant's genetic makeup. In another example, two genetically identical seeds may be treated with a formulation that introduces an endophyte composition. Any phenotypic differences between the plants derived from those seeds may be attributed to the treatment, thus forming an isoline comparison.
Similarly, by the terms “reference plant”, “reference agricultural plant” or “reference seed”, it is meant an agricultural plant or seed of the same species, strain, or cultivar to which a treatment, formulation, composition or endophyte preparation as described herein is not administered/contacted. A reference agricultural plant or seed, therefore, is identical to the treated plant with the exception of the presence of the endophyte and can serve as a control for detecting the effects of the endophyte that is conferred to the plant.
A “reference environment” refers to the environment, treatment or condition of the plant in which a measurement is made. For example, production of a compound in a plant associated with an endophyte can be measured in a reference environment of drought stress, and compared with the levels of the compound in a reference agricultural plant under the same conditions of drought stress. Alternatively, the levels of a compound in plant associated with an endophyte and reference agricultural plant can be measured under identical conditions of no stress.
A “population” of plants refers to more than one plant, that are of the same taxonomic categeory, typically be of the same species, and will also typically share a common genetic derivation.
In some embodiments, the invention contemplates the use of microbes that are “exogenous” to a seed or plant. As used herein, a microbe is considered exogenous to the seed or plant if the plant element that is unmodified (e.g., a plant element that is not treated with the plurality of endophytes described herein) does not contain the microbe.
In some embodiments, a microbe can be “endogenous” to a seed or plant. As used herein, a microbe is considered “endogenous” to a plant or seed, if the endophyte or endophyte component is derived from, or is otherwise found in, a plant element of the plant specimen from which it is sourced. In embodiments in which an endogenous endophyte is applied, the endogenous microbe is applied in an amount that differs from the levels typically found in the plant.
In some embodiments, the present invention contemplates the synthetic compositions comprising the combination of a plant element, seedling, or whole plants and an endophyte population, in which the endophyte population is “heterologously disposed”.
In some aspects, “heterologously disposed” means that the plant element, seedling, or plant does not contain detectable levels of the microbe in that same plant element, seedling, or plant. For example if said plant element or seedling or plant does not naturally have the endophyte associated with it and the endophyte is applied, the endophyte would be considered to be heterologously disposed. In some aspects, “heterologously disposed” means that the endophyte is being applied to a different plant element than that with which the endophyte is naturally associated. For example, if said plant element or seedling or plant has the endophyte normally found in the root tissue but not in the leaf tissue, and the endophyte is applied to the leaf, the endophyte would be considered to be heterologously disposed. In some aspects, “heterologously disposed” means that the endophyte being applied to a different tissue or cell layer of the plant element than that in which the microbe is naturally found. For example, if endophyte is naturally found in the mesophyll layer of leaf tissue but is being applied to the epithelial layer, the endophyte would be considered to be heterologously disposed. In some aspects, “heterologously disposed” means that the endophyte being applied is at a greater concentration, number, or amount of the plant element, seedling, or plant, than that which is naturally found in said plant element, seedling, or plant. For example, an endophyte concentration that is being applied is at least 1.5 times, between 1.5 and 2 times, 2 times, between 2 and 3 times, 3 times, between 3 and 5 times, 5 times, between 5 and 7 times, 7 times, between 7 and 10 times, 10 times greater, or even greater than 10 times higher number, amount, or concentration than that which is naturally present, the endophyte would be considered to be heterologously disposed. In some aspects, “heterologously disposed” means that the endophyte is applied to a developmental stage of the plant element, seedling, or plant in which said endophyte is not naturally associated, but may be associated at other stages. For example, if an endophyte is normally found at the flowering stage of a plant and no other stage, an endophyte applied at the seedling stage may be considered to be heterologously disposed. For the avoidance of doubt, “heterologously disposed” contemplates use of microbes that are “exogenous” to a seed or plant.
In some cases, the present invention contemplates the use of microbes that are “compatible” with agricultural chemicals, including but not limited to, a fungicide, an anti-complex compound, a bactericide, a virucide, an herbicide, a nematicide, a parasiticide, a pesticide, or any other agent widely used in agricultural which has the effect of killing or otherwise interfering with optimal growth of another organism. As used herein, a microbe is “compatible” with an agricultural chemical, when the microbe is modified, such as by genetic modification, e.g., contains a transgene that confers resistance to an herbicide, or otherwise adapted to grow in, or otherwise survive, the concentration of the agricultural chemical used in agriculture. For example, a microbe disposed on the surface of plant element is compatible with the fungicide metalaxyl if it is able to survive the concentrations that are applied on the plant element surface.
“Biomass” means the total mass or weight (fresh or dry), at a given time, of a plant tissue, plant tissues, an entire plant, or population of plants, usually given as weight per unit area. The term may also refer to all the plants or species in the community (community biomass).
Some of the compositions and methods described herein involve single endophyte strains or plurality of endophytes in an amount effective to colonize a plant. As used herein, a microbe is said to “colonize” a plant or seed when it can exist in an endophytic relationship with the plant in the plant environment, for example inside the plant or a part or tissue thereof, including the seed.
The compositions and methods herein may provide for an improved “agronomic trait” or “trait of agronomic importance” to a host plant, which may include, but not be limited to, the following: altered oil content, altered protein content, altered seed carbohydrate composition, altered seed oil composition, and altered seed protein composition, chemical tolerance, cold tolerance, delayed senescence, disease resistance, drought tolerance, ear weight, growth improvement, health enhancement, heat tolerance, herbicide tolerance, herbivore resistance, improved nitrogen fixation, improved nitrogen utilization, improved root architecture, improved water use efficiency, increased biomass, increased root length, increased seed weight, increased shoot length, increased yield, increased yield under water-limited conditions, kernel mass, kernel moisture content, metal tolerance, number of ears, number of kernels per ear, number of pods, nutrition enhancement, pathogen resistance, pest resistance, photosynthetic capability improvement, salinity tolerance, stay-green, vigor improvement, increased dry weight of mature seeds, increased fresh weight of mature seeds, increased number of mature seeds per plant, increased chlorophyll content, increased number of pods per plant, increased length of pods per plant, reduced number of wilted leaves per plant, reduced number of severely wilted leaves per plant, and increased number of non-wilted leaves per plant, a detectable modulation in the level of a metabolite, a detectable modulation in the level of a transcript, and a detectable modulation in the proteome, compared to an isoline plant grown from a seed without said seed treatment formulation.
Additionally, “altered metabolic function” or “altered enzymatic function” may include, but not be limited to, the following: altered production of an auxin, altered nitrogen fixation, altered production of an antimicrobial compound, altered production of a siderophore, altered mineral phosphate solubilization, altered production of a cellulase, altered production of a chitinase, altered production of a xylanase, altered production of acetoin and altered ability to metabolize a carbon source.
An “increased yield” can refer to any increase in biomass or seed or fruit weight, seed size, seed number per plant, seed number per unit area, bushels per acre, tons per acre, kilo per hectare, or carbohydrate yield. Typically, the particular characteristic is designated when referring to increased yield, e.g., increased grain yield or increased seed size.
“Agronomic trait potential” is intended to mean a capability of a plant element for exhibiting a phenotype, preferably an improved agronomic trait, at some point during its life cycle, or conveying said phenotype to another plant element with which it is associated in the same plant. For example, a plant element may comprise an endophyte that will provide benefit to leaf tissue of a plant from which the plant element is grown; in such case, the plant element comprising such endophyte has the agronomic trait potential for a particular phenotype (for example, increased biomass in the plant) even if the seed itself does not display said phenotype.
By the term “capable of metabolizing” a particular carbon substrate, it is meant that the endophyte is able to utilize that carbon substrate as an energy source.
The term “synthetic combination” means a plurality of elements associated by human endeavor, in which said association is not found in nature. In some embodiments, “synthetic combination” is used to refer to a treatment formulation associated with a plant element. In some aspects of the present invention, “synthetic combination” refers to a purified population of endophytes in a treatment formulation comprising additional compositions with which said endophytes are not found associated in nature. The combination may be achieved, for example, by coating the surface of the seed of a plant, such as an agricultural plant, or host plant elements with an endophyte. In some embodiments of the present invention, “synthetic combination” refers to one or more plant elements in association with an isolated, purified population of endophytes in a treatment formulation comprising additional compositions with which said endophytes are not found associated in nature.
A “treatment formulation” refers to a mixture of chemicals that facilitate the stability, storage, and/or application of the endophyte composition(s). In some embodiments, an agriculturally compatible carrier can be used to formulate an agricultural formulation or other composition that includes a purified endophyte preparation. As used herein an “agriculturally compatible carrier” refers to any material, other than water, that can be added to a plant element without causing or having an adverse effect on the plant element (e.g., reducing seed germination) or the plant that grows from the plant element, or the like.
In some cases, the present invention contemplates the use of compositions that are “compatible” with agricultural chemicals, for example, a fungicide, an anti-complex compound, or any other agent widely used in agricultural which has the effect of killing or otherwise interfering with optimal growth of another organism.
Some compositions described herein contemplate the use of an agriculturally compatible carrier. As used herein an “agriculturally compatible carrier” is intended to refer to any material, other than water, which can be added to a seed or a seedling without causing/having an adverse effect on the seed, the plant that grows from the seed, seed germination, or the like.
As used herein, a nucleic acid has “homology” or is “homologous” to a second nucleic acid if the nucleic acid sequence has a similar sequence to the second nucleic acid sequence. The terms “identity”, “percent sequence identity” or “identical” in the context of nucleic acid sequences refer to the residues in the two sequences that are the same when aligned for maximum correspondence. There are a number of different algorithms known in the art that can be used to measure nucleotide sequence identity. For instance, polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wis. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. In some embodiments, sequences can be compared using Geneious (Biomatters, Ltd., Auckland, New Zealand). In other embodiments, polynucleotide sequences can be compared using the multiple sequence alignment algorithm MUSCLE. In some embodiments the nucleic acid sequence to be aligned is a complete gene. In some embodiments, the nucleic acid sequence to be aligned is a gene fragment. In some embodiments, if the nucleic acid sequence to be aligned is a gene fragment, the percent identity to a second nucleic acid sequence is considered X % identical if the two sequences are X % identical the length of the shortest sequence.
The term “substantial homology” or “substantial similarity,” when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 76%, 80%, 85%, or at least about 90%, or at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST, MUSCLE or Gap, as discussed above.
As used herein, the terms “operational taxonomic unit,” “OTU,” “taxon,” “hierarchical cluster,” and “cluster” are used interchangeably. An operational taxon unit (OTU) refers to a group of one or more organisms that comprises a node in a clustering tree. The level of a cluster is determined by its hierarchical order. In some embodiments, an OTU is a group tentatively assumed to be a valid taxon for purposes of phylogenetic analysis. In other embodiments, an OTU is any of the extant taxonomic units under study. In yet another embodiment, an OTU is given a name and a rank. For example, an OTU can represent a domain, a sub-domain, a kingdom, a sub-kingdom, a phylum, a sub-phylum, a class, a sub-class, an order, a sub-order, a family, a subfamily, a genus, a subgenus, or a species. In some embodiments, OTUs can represent one or more organisms from the kingdoms eubacteria, protista, or fungi at any level of a hierarchal order. In some embodiments, an OTU represents a prokaryotic or fungal order.
As used herein, the terms “water-limited condition”, “water stress condition” and “drought condition”, or “water-limited”, “water stress”, and “drought”, may be used interchangeably. For example, a method or composition for improving a plant's ability to grow under drought conditions means the same as the ability to grow under water-limited conditions. In such cases, the plant can be further said to display improved tolerance to drought stress.
The terms “decreased”, “fewer”, “slower” and “increased” “faster” “enhanced” “greater” as used herein refers to a decrease or increase in a characteristic of the endophyte treated seed or resulting plant compared to an untreated seed or resulting plant. For example, a decrease in a characteristic may be at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least about 60%, at least 75%, at least about 80%, at least about 90%, at least 100%, at least 200%, at least about 300%, at least about 400% or more lower than the untreated control. For example, a decrease may be between 1% and 5%, or between 5% and 10%, or between 10% and 15%, or between 15% and 20%, or between 20% and 25%, or between 25% and 30%, or between 30% and 35%, or between 35% and 40%, or between 45% and 50% lower than the untreated control or the formulation control. An increase may be at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least about 60%, at least 75%, at least about 80%, at least about 90%, at least 100%, at least 200%, at least about 300%, at least about 400% or more higher than the untreated control. For example, an increase may be between 1% and 5%, or between 5% and 10%, or between 10% and 15%, or between 15% and 20%, or between 20% and 25%, or between 25% and 30%, or between 30% and 35%, or between 35% and 40%, or between 45% and 50% higher than the untreated control or the formulation control.
Agricultural plants appear to associate with symbiotic microorganisms termed endophytes, particularly bacteria and fungi, that may have been important during evolution and may contribute to plant survival and performance. However, modern agricultural processes may have perturbed this relationship, resulting in increased crop losses, diminished stress resilience, biodiversity losses, and increasing dependence on external chemicals, fertilizers, and other unsustainable agricultural practices. There is a need for novel methods for generating plants with novel microbiome properties that can sustainably increase yield, stress resilience, and decrease fertilizer and chemical use.
The inventors have undertaken a systematic comparison of the microbial communities that reside within a wide diversity of plants. As such, the endophytic microbes useful for the invention generally relate to endophytic microbes that are present in agricultural plants.
In part, the present invention describes preparations of novel endophytes, and the creation of synthetic combinations of agricultural seeds and/or seedlings with heterologous endophytes and formulations containing the synthetic combinations, as well as the recognition that such synthetic combinations display a diversity of beneficial properties present in the agricultural plants and the associated endophyte populations newly created by the present inventors. Such beneficial properties include metabolism, transcript expression, proteome alterations, morphology, and the resilience to a variety of environmental stresses, and the combination of a plurality of such properties.
Provided are novel compositions, methods, and products related our invention's ability to overcome the limitations of the prior art in order to provide reliable increases in crop yield, biomass, germination, vigor, stress resilience, and other properties to agricultural crops.
We find that beneficial microbes can be robustly derived from plant elements, optionally cultured, administered heterologously to agricultural plant elements such as seeds, and colonize the resulting plant tissues with high efficiency to confer multiple beneficial properties.
We find that microbes can confer beneficial properties across a range of concentrations.
We find that endophytes can be heterologously disposed onto seedlings of a distinct cultivar, species, or crop type and confer benefits to those new recipients. For example, endophytes from corn cultivars are heterologously provided to wheat cultivars to confer a benefit. This is surprising given the observations of distinct microbiome preferences in distinct plant and mammalian hosts and, in particular, the likelihood that microbes derived from seeds have been co-evolved to be specialized to a particular host.
We further find that combinations of heterologously disposed endophytes confer additive advantages to plants, including multiple functional properties and resulting in seed, seedling, and plant hosts that display single or multiple improved agronomic properties.
Endophytes are microbes that grow inside a plant. Recent appreciation that endophytes can confer remarkable traits upon the host plant is the basis for the present invention. The inventors have developed a method to introduce isolated endophytes to another plant by coating the microbes onto the surface of a seed of a plant. By combining an endophyte sourced from one plant, it is possible to transfer the beneficial agronomic trait onto an agricultural plant, and therefore holds great promise for increasing agricultural productivity.
Combining a selected plant species, OTU, strain or cultivar with one or more types of endophytes thus provides mechanisms by which, alone or in parallel with plant breeding and transgenic technologies, is provided improved yield from crops and generation of products thereof. Therefore, in a first aspect, the present invention provides a synthetic combination comprising the combination of a plant element, seedling, or whole plants and a single endophyte strain or a plurality of endophytes, in which the single endophyte strain or a plurality of endophytes are “heterologously disposed.”
The present invention contemplates a synthetic combination of a plant element of a plant that is coated with an endophyte on its surface. The plant element can be any agricultural plant element, for example an agricultural seed. In one embodiment, the plant element of the first plant is from a monocotyledonous plant. For example, the plant element of the first plant is from a cereal plant. The plant element of the first plant can be selected from the group consisting of a maize plant, a wheat plant, a barley plant, an onion plant, a sorghum plant, or a rice plant. In an alternative embodiment, the plant element of the first plant is from a dicotyledonous plant. The plant element of the first plant can be selected from the group consisting of a cotton plant, a Brassica napus plant, a tomato plant, a pepper plant, a cabbage plant, a lettuce plant, a melon plant, a strawberry plant, a turnip plant, a watermelon plant, a peanut plant, or a soybean plant. In a particular embodiment, the plant is not a cotton plant. In still another embodiment, the seed of the first plant can be from a genetically modified plant. In another embodiment, the seed of the first plant can be a hybrid seed.
The synthetic combination can comprise a plant element of the first plant that is surface-sterilized prior to combining with the endophytes. Such pre-treatment prior to coating the plant element with endophytes removes the presence of other microbes that may interfere with the optimal colonization, growth and/or function of the endophyte. Surface sterilization of plant elements can be accomplished without killing the plant elements as described herein elsewhere (see, for example, the section Isolation of endophytes).
Sources of Endophytes
As described herein, endophytes can be derived from heterologous, homologous, or engineered sources, optionally cultured, administered heterologously as a single endophyte strain or a plurality of endophytes to plant elements, and, as a result of the administration, confer multiple beneficial properties. In some embodiments, endophytes are derived from plant elements or soil. In some embodiments, the plant element from which the endophyte is derived is a monocotyledonous plant. In a particular embodiment, the plant is a cereal plant or tissue thereof. In yet another embodiment, plant is selected from the group consisting of a maize plant, a barley plant, a wheat plant, a sugarcane plant, a sorghum plant, or a rice plant. In some embodiments, the plant element is a naked grain (i.e., without hulls or fruit cases). In an alternative embodiment, the plant element from which the endophyte is derived is a dicotyledonous plant. For example, a plant can be selected from the group consisting of a cotton plant, a Brassica napus plant, a tomato plant, a pepper plant, a cabbage plant, a lettuce plant, a melon plant, a strawberry plant, a turnip plant, a watermelon plant, a peanut plant, or a soybean plant.
In some embodiments, the endophytes can be obtained from a plant element of the same or different crop, and can be from the same or different cultivar or variety as the plant element to which the composition is heterologously associated. For example, endophytes from a particular corn variety can be isolated and coated onto the surface of a corn seed of the same variety. In other embodiments, the endophytes can be isolated from a related species (e.g., an endophyte isolated from Triticum monococcum (einkorn wheat) can be coated onto the surface of a T. aestivum (common wheat) plant element; or, an endophyte from Hordeum vulgare (barley) can be isolated and coated onto the plant element of another member of the Triticeae family, for example, plant elements of the rye plant, Secale cereale). In still another embodiment, the endophytes can be isolated from a plant part of a plant that is distantly related to the plant element onto which the endophyte is to be coated. For example, tomato-derived endophytes are isolated and coated onto a rice plant element. In still another embodiment, endophytes used in a composition or used to make a synthetic composition can be obtained from a plant element of a plant that is distantly related to the plant element onto which the endophyte is to be coated. For example, a tomato-derived endophyte can be isolated and coated onto a rice plant element.
In some embodiments, the present invention contemplates the use of endophytes that can confer a beneficial agronomic trait upon the seed or resulting plant onto which it is coated. In another embodiment, the seed endophytes useful for the present invention can also be isolated from seeds of plants adapted to a particular environment, including, but not limited to, an environment with water deficiency, salinity, acute and/or chronic heat stress, acute and/or chronic cold stress, nutrient deprived soils including, but not limited to, micronutrient deprived soils, macronutrient (e.g., potassium, phosphate, nitrogen) deprived soils, pathogen stress, including fungal, nematode, insect, viral, bacterial pathogen stress. In one example, the endophyte is isolated from the seed of a plant that grows in a water deficient environment.
The synthetic combination of the present invention contemplates the presence of an endophyte on the surface of the seed of the first plant. In one embodiment, the seed of the first plant is coated with at least 10 CFU or spores of the endophyte per seed, for example, at least 20 CFU or spores, at least 50 CFU or spores, at least 100 CFU or spores, at least 200 CFU or spores, at least 300 CFU or spores, at least 500 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores or more per plant element. In another embodiment, the plant element is coated with at least 10, for example, at least 20, at least 50, at least 100, at least 200, at least 300, at least 500, at least 1,000, at least 3,000, at least 10,000, at least 30,000, at least 100,000, at least 300,000, at least 1,000,000 or more of the endophyte as detected by the number of copies of a particular endophyte gene detected, for example, by quantitative PCR.
The endophyte useful for the present invention can be a fungus. In another embodiment, the endophyte can be a bacterium. In one embodiment, the endophyte is not an Agrobacterium. In another embodiment, the endophyte is not capable of nitrogen fixation (for example, from the genus Rhizobium). In still another embodiment, the endophyte is not from the genus Acetobacter. In yet another embodiment, the endophyte is not from the genus Bacillus. In a particular embodiment, the endophyte is not Bacillus mojavensis. In yet another embodiment, the endophyte is not from the genus Neotyphodium.
Historical taxonomic classification of fungi has been according to morphological presentation. Beginning in the mid-1800's, it was recognized that some fungi have a pleomorphic life cycle, and that different nomenclature designations were being used for different forms of the same fungus. In 1981, the Sydney Congress of the International Mycological Association laid out rules for the naming of fungi according to their status as anamorph, teleomorph, or holomorph. With the development of genomic sequencing, it became evident that taxonomic classification based on molecular phylogenetics did not align with morphological-based nomenclature. As a result, in 2011 the International Botanical Congress adopted a resolution approving the International Code of Nomenclature for Algae, Fungi, and Plants (Melbourne Code) (2012), with the stated outcome of designating “One Fungus=One Name”. However, systematics experts have not aligned on common nomenclature for all fungi, nor are all existing databases and information resources inclusive of updated taxonomies. As such, many fungi referenced herein may be described by their anamorph form but it is understood that based on identical genomic sequencing, any pleomorphic state of that fungus may be considered to be the same organism. For example, the genus Alternaria is the anamorph form of the teleomorph genus Lewia, ergo both would be understood to be the same organism with the same DNA sequence.
Exogenous Endophytes
In one embodiment, the endophyte is an endophytic microbe that was isolated from a different plant than the inoculated plant. For example, in one embodiment, the endophyte can be an endophyte isolated from a different plant of the same species as the inoculated plant. In some cases, the endophyte can be isolated from a species related to the inoculated plant.
The breeding of plants for agriculture, as well as cultural practices used to combat microbial pathogens, may have resulted in the loss in modern cultivars of the endophytes present in their wild ancestors or other wild plants, or such practices may have inadvertently promoted other novel or rare plant-endophyte interactions, or otherwise altered the microbial population. The former is the case in maize and its phylogenetically confirmed, direct wild ancestor, Parviglumis teosinte (Zea mays ssp. Parviglumis). Although both species have seeds that appear to contain a common core of endophytic bacterial species, the relative abundance of certain groups is higher in seeds of teosinte than modern corn. It is possible that this higher diversity and titer of endophytes in the ancestor is correlated with an equally wide range of physiological responses derived from the symbiosis that allow the plant to better adapt to the environment and tolerate stress. In order to survey plant groups for potentially useful endophytes, seeds of their wild ancestors, wild relatives, primitive landraces, modern landraces, modern breeding lines, and elite modern agronomic varieties can be screened for microbial endophytes by culture and culture independent methods as described herein. In addition, microbial endophytes can be isolated from other wild plants, such as grassland plants.
In some cases, plants are inoculated with endophytes that are exogenous to the seed of the inoculated plant. In one embodiment, the endophyte is derived from a plant of another species. For example, an endophyte that is normally found in dicots is applied to a monocot plant (e.g., inoculating corn with a soy bean-derived endophyte), or vice versa. In other cases, the endophyte to be inoculated onto a plant can be derived from a related species of the plant that is being inoculated. In one embodiment, the endophyte can be derived from a related taxon, for example, from a related species. The plant of another species can be an agricultural plant. For example, an endophyte derived from Hordeum irregulare can be used to inoculate a Hordeum vulgare L., plant. Alternatively, it can be derived from a ‘wild’ plant (i.e., a non-agricultural plant). For example, endophytes normally associated with the wild cotton Gossypium klotzschianum can be used to inoculate commercial varieties of Gossypium hirsutum plants. Endophytes normally associated with a wild turnip plant or a wild watermelon plant can be used to inoculate commercial varieties of turnip or watermelon plants, respectively. As an alternative example of deriving an endophyte from a ‘wild’ plant, endophytic bacteria isolated from the South East Asian jungle orchid, Cymbidium eburneum, can be isolated and testing for their capacity to benefit seedling development and survival of agricultural crops such as wheat, maize, soy and others. In another example, endophytes may be isolated from wild grassland plants. In other cases, the endophyte can be isolated from an ancestral species of the inoculated plant. For example, an endophyte derived from Zea diploperennis can be used to inoculate a commercial variety of modern corn, or Zea mays.
Selection of Plant Species from Desired Habitats for Isolation of Microbial Endophytes
Different environments can contain significantly different populations of endophytes. For example, geographically isolated soils from different parts of the Americas have been shown to differ in 96% of the bacterial species they contain. Soils containing different microbial populations can strongly influence the endophytic bacterial population observed inside Arabidopsis illustrating that the environment can at least partially alter a plant's associated microbial population. This suggests that plants growing and especially thriving in choice environments are colonized by different and perhaps beneficial endophytes, whose isolation and inoculation onto crop plants may aid these plants to better survive in the same choice environment or to better resist certain stresses encountered in a normal agricultural environment. For instance, at least some of the bacteria isolated from plants growing in arid environments are expected to confer drought tolerance to host plants they are transplanted onto. Additionally, novel endophtytes may be found in related crop varieties grown in the choice environment. Once a choice environment is selected, seeds of choice plants to be sampled will be identified by their healthy and/or robust growth, and will then be sampled at least 5 at a time by excavating the entire plants plus small root ball including roots and associated soil and any seeds or fruit present on the plant. These will be placed in a cool (4° C. environment) for storage and prompt transport back to the lab for extraction of endophytes and DNA using methods described herein. Identification of choice environments or ecosystems for bioprospecting of plant associated endophytes from either wild plants or crop plants growing in the choice environments or ecosystems follows protocols described herein.
In one embodiment, the endophyte-associated plant is harvested from a soil type different than the normal soil type that the crop plant is grown on, for example from a gelisol (soils with permafrost within 2 m of the surface), for example from a histosol (organic soil), for example from a spodosol (acid forest soils with a subsurface accumulation of metal-humus complexes), for example from an andisol (soils formed in volcanic ash), for example from a oxisol (intensely weathered soils of tropical and subtropical environments), for example from a vertisol (clayey soils with high shrink/swell capacity), for example from an aridisol (CaCO3-containing soils of arid environments with subsurface horizon development), for example from a ultisol (strongly leached soils with a subsurface zone of clay accumulation and <35% base saturation), for example from a mollisol (grassland soils with high base status), for example from an alfisol (moderately leached soils with a subsurface zone of clay accumulation and >35% base saturation), for example from a inceptisol (soils with weakly developed subsurface horizons), for example from a entisol (soils with little or no morphological development).
In another embodiment, the endophyte-associated plant is harvested from an ecosystem where the agricultural plant is not normally found, for example a tundra ecosystem as opposed to a temperate agricultural farm, for example from tropical and subtropical moist broadleaf forests (tropical and subtropical, humid), for example from tropical and subtropical dry broadleaf forests (tropical and subtropical, semihumid), for example from tropical and subtropical coniferous forests (tropical and subtropical, semihumid), for example from temperate broadleaf and mixed forests (temperate, humid), for example from temperate coniferous forests (temperate, humid to semihumid), from for example from boreal forests/taiga (subarctic, humid), for example from tropical and subtropical grasslands, savannas, and shrublands (tropical and subtropical, semiarid), for example from temperate grasslands, savannas, and shrublands (temperate, semiarid), for example from flooded grasslands and savannas (temperate to tropical, fresh or brackish water inundated), for example from montane grasslands and shrublands (alpine or montane climate), for example from Mediterranean forests, woodlands, and scrub or sclerophyll forests (temperate warm, semihumid to semiarid with winter rainfall), for example from mangrove forests, and for example from deserts and xeric shrublands (temperate to tropical, arid).
In another embodiment, the endophyte-associated plant is harvested from a soil with an average pH range that is different from the optimal soil pH range of the crop plant, for example the plant may be harvested from an ultra acidic soil (<3.5), from an extreme acid soil (3.5-4.4), from a very strong acid soil (4.5-5.0), from a strong acid soil (5.1-5.5), from a moderate acid soil (5.6-6.0), from an slight acid soil (6.1-6.5), from an neutral soil (6.6-7.3), from an slightly alkaline soil (7.4-7.8), from an moderately alkaline soil (7.9-8.4), from a strongly alkaline soil (8.5-9.0), or from an very strongly alkaline soil (>9.0).
In one embodiment, the endophyte-associated plant is harvested from an environment with average air temperatures lower than the normal growing temperature of the crop plant, for example 2-5° C. colder than average, for example, at least 5-10° C. colder, at least 10-15° C. colder, at least at least 15-20° C. colder, at least 20-25° C. colder, at least 25-30° C. colder, at least 30-35° C. colder, at least 35-40° C. colder, at least 40-45° C. colder, at least 45-50° C. colder, at least 50-55° C. colder or more, when compared with crop plants grown under normal conditions during an average growing season.
In one embodiment, the endophyte-associated plant is harvested from an environment with average air temperatures higher than the normal growing temperature of the crop plant, for example 2-5° C. hotter than average, for example, at least 5-10° C. hotter, at least 10-15° C. hotter, at least at least 15-20° C. hotter, at least 20-25° C. hotter, at least 25-30° C. hotter, at least 30-35° C. hotter, at least 35-40° C. hotter, at least 40-45° C. hotter, at least 45-50° C. hotter, at least 50-55° C. hotter or more, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from an environment with average rainfall lower than the optimal average rainfall received by the crop plant, for example 2-5% less rainfall than average, for example, at least 5-10% less rainfall, at least 10-15% less rainfall, at least 15-20% less rainfall, at least 20-25% less rainfall, at least 25-30% less rainfall, at least 30-35% less rainfall, at least 35-40% less rainfall, at least 40-45% less rainfall, at least 45-50% less rainfall, at least 50-55% less rainfall, at least 55-60% less rainfall, at least 60-65% less rainfall, at least 65-70% less rainfall, at least 70-75% less rainfall, at least 80-85% less rainfall, at least 85-90% less rainfall, at least 90-95% less rainfall, or less, when compared with crop plants grown under normal conditions during an average growing season.
In one embodiment, the endophyte-associated plant is harvested from an environment with average rainfall higher than the optimal average rainfall of the crop plant, for example 2-5% more rainfall than average, for example, at least 5-10% more rainfall, at least 10-15% more rainfall, at least 15-20% more rainfall, at least 20-25% more rainfall, at least 25-30% more rainfall, at least 30-35% more rainfall, at least 35-40% more rainfall, at least 40-45% more rainfall, at least 45-50% more rainfall, at least 50-55% more rainfall, at least 55-60% more rainfall, at least 60-65% more rainfall, at least 65-70% more rainfall, at least 70-75% more rainfall, at least 80-85% more rainfall, at least 85-90% more rainfall, at least 90-95% more rainfall, at least 95-100% more rainfall, or even greater than 100% more rainfall, or even greater than 200% more rainfall, or even greater than 300% more rainfall, or even greater than 400% more rainfall, or even greater than 500% more rainfall, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a soil type with different soil moisture classification than the normal soil type that the crop plant is grown on, for example from an aquic soil (soil is saturated with water and virtually free of gaseous oxygen for sufficient periods of time, such that there is evidence of poor aeration), for example from an udic soil (soil moisture is sufficiently high year-round in most years to meet plant requirement), for example from an ustic soil (soil moisture is intermediate between udic and aridic regimes; generally, plant-available moisture during the growing season, but severe periods of drought may occur), for example from an aridic soil (soil is dry for at least half of the growing season and moist for less than 90 consecutive days), for example from a xeric soil (soil moisture regime is found in Mediterranean-type climates, with cool, moist winters and warm, dry summers).
In one embodiment, the endophyte-associated plant is harvested from an environment with average rainfall lower than the optimal average rainfall of the crop plant, for example 2-95% less rainfall than average, for example, at least 5-90% less rainfall, at least 10-85% less rainfall, at least 15-80% less rainfall, at least 20-75% less rainfall, at least 25-70% less rainfall, at least 30-65% less rainfall, at least 35-60% less rainfall, at least 40-55% less rainfall, at least 45-50% less rainfall, when compared with crop plants grown under normal conditions during an average growing season.
In one embodiment, the endophyte-associated plant is harvested from an environment with average rainfall higher than the optimal average rainfall of the crop plant, for example 2-5% more rainfall than average, for example, at least 5-10% more rainfall, at least 10-15% more rainfall, at least 15-20% more rainfall, at least 20-25% more rainfall, at least 25-30% more rainfall, at least 30-35% more rainfall, at least 35-40% more rainfall, at least 40-45% more rainfall, at least 45-50% more rainfall, at least 50-55% more rainfall, at least 55-60% more rainfall, at least 60-65% more rainfall, at least 65-70% more rainfall, at least 70-75% more rainfall, at least 80-85% more rainfall, at least 85-90% more rainfall, at least 90-95% more rainfall, at least 95-100% more rainfall, or even greater than 100% more rainfall, or even greater than 200% more rainfall, or even greater than 300% more rainfall, or even greater than 400% more rainfall, or even greater than 500% more rainfall, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from an agricultural environment with a crop yield lower than the average crop yield expected from the crop plant grown under average cultivation practices on normal agricultural land, for example 2-5% lower yield than average, for example, at least 5-10% lower yield, at least 10-15% lower yield, at least 15-20% lower yield, at least 20-25% lower yield, at least 25-30% lower yield, at least 30-35% lower yield, at least 35-40% lower yield, at least 40-45% lower yield, at least 45-50% lower yield, at least 50-55% lower yield, at least 55-60% lower yield, at least 60-65% lower yield, at least 65-70% lower yield, at least 70-75% lower yield, at least 80-85% lower yield, at least 85-90% lower yield, at least 90-95% lower yield, or less, when compared with crop plants grown under normal conditions during an average growing season.
In a related embodiment, the endophyte-associated plant is harvested from an agricultural environment with a crop yield lower than the average crop yield expected from the crop plant grown under average cultivation practices on normal agricultural land, for example 2-95% lower yield than average, for example, at least 5-90% lower yield, at least 10-85% lower yield, at least 15-80% lower yield, at least 20-75% lower yield, at least 25-70% lower yield, at least 30-65% lower yield, at least 35-60% lower yield, at least 40-55% lower yield, at least 45-50% lower yield, when compared with crop plants grown under normal conditions during an average growing season.
In one embodiment, the endophyte-associated plant is harvested from an environment with average crop yield higher than the optimal average crop yield of the crop plant, for example 2-5% more yield than average, for example, at least 5-10% more yield, at least 10-15% more yield, at least 15-20% more yield, at least 20-25% more yield, at least 25-30% more yield, at least 30-35% more yield, at least 35-40% more yield, at least 40-45% more yield, at least 45-50% more yield, at least 50-55% more yield, at least 55-60% more yield, at least 60-65% more yield, at least 65-70% more yield, at least 70-75% more yield, at least 80-85% more yield, at least 85-90% more yield, at least 90-95% more yield, at least 95-100% more yield, or even greater than 100% more yield, or even greater than 200% more yield, or even greater than 300% more yield, or even greater than 400% more yield, or even greater than 500% more yield, when compared with crop plants grown under normal conditions during an average growing season.
In a related embodiment, the endophyte-associated plant is harvested from an environment with average crop yield higher than the optimal average crop yield of the crop plant, 2-500% more yield than average, 2-400% more yield than average, 2-300% more yield than average, 2-200% more yield than average, 2-95% more yield than average, for example, at least 5-90% more yield, at least 10-85% more yield, at least 15-80% more yield, at least 20-75% more yield, at least 25-70% more yield, at least 30-65% more yield, at least 35-60% more yield, at least 40-55% more yield, at least 45-50% more yield, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total nitrogen than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less nitrogen than average, for example, at least 5-10% less nitrogen, at least 10-15% less nitrogen, at least 15-20% less nitrogen, at least 20-25% less nitrogen, at least 25-30% less nitrogen, at least 30-35% less nitrogen, at least 35-40% less nitrogen, at least 40-45% less nitrogen, at least 45-50% less nitrogen, at least 50-55% less nitrogen, at least 55-60% less nitrogen, at least 60-65% less nitrogen, at least 65-70% less nitrogen, at least 70-75% less nitrogen, at least 80-85% less nitrogen, at least 85-90% less nitrogen, at least 90-95% less nitrogen, or less, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total nitrogen than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more nitrogen than average, for example, at least 5-10% more nitrogen, at least 10-15% more nitrogen, at least 15-20% more nitrogen, at least 20-25% more nitrogen, at least 25-30% more nitrogen, at least 30-35% more nitrogen, at least 35-40% more nitrogen, at least 40-45% more nitrogen, at least 45-50% more nitrogen, at least 50-55% more nitrogen, at least 55-60% more nitrogen, at least 60-65% more nitrogen, at least 65-70% more nitrogen, at least 70-75% more nitrogen, at least 80-85% more nitrogen, at least 85-90% more nitrogen, at least 90-95% more nitrogen, at least 95-100% more nitrogen, or even greater than 100% more nitrogen, or even greater than 200% more nitrogen, or even greater than 300% more nitrogen, or even greater than 400% more nitrogen, or even greater than 500% more nitrogen, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total phosphorus than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less phosphorus than average, for example, at least 5-10% less phosphorus, at least 10-15% less phosphorus, at least 15-20% less phosphorus, at least 20-25% less phosphorus, at least 25-30% less phosphorus, at least 30-35% less phosphorus, at least 35-40% less phosphorus, at least 40-45% less phosphorus, at least 45-50% less phosphorus, at least 50-55% less phosphorus, at least 55-60% less phosphorus, at least 60-65% less phosphorus, at least 65-70% less phosphorus, at least 70-75% less phosphorus, at least 80-85% less phosphorus, at least 85-90% less phosphorus, at least 90-95% less phosphorus, or less, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total phosphorus than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more phosphorus than average, for example, at least 5-10% more phosphorus, at least 10-15% more phosphorus, at least 15-20% more phosphorus, at least 20-25% more phosphorus, at least 25-30% more phosphorus, at least 30-35% more phosphorus, at least 35-40% more phosphorus, at least 40-45% more phosphorus, at least 45-50% more phosphorus, at least 50-55% more phosphorus, at least 55-60% more phosphorus, at least 60-65% more phosphorus, at least 65-70% more phosphorus, at least 70-75% more phosphorus, at least 80-85% more phosphorus, at least 85-90% more phosphorus, at least 90-95% more phosphorus, at least 95-100% more phosphorus, or even greater than 100% more phosphorus, or even greater than 200% more phosphorus, or even greater than 300% more phosphorus, or even greater than 400% more phosphorus, or even greater than 500% more phosphorus, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total potassium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less potassium than average, for example, at least 5-10% less potassium, at least 10-15% less potassium, at least 15-20% less potassium, at least 20-25% less potassium, at least 25-30% less potassium, at least 30-35% less potassium, at least 35-40% less potassium, at least 40-45% less potassium, at least 45-50% less potassium, at least 50-55% less potassium, at least 55-60% less potassium, at least 60-65% less potassium, at least 65-70% less potassium, at least 70-75% less potassium, at least 80-85% less potassium, at least 85-90% less potassium, at least 90-95% less potassium, or less, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total potassium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more potassium than average, for example, at least 5-10% more potassium, at least 10-15% more potassium, at least 15-20% more potassium, at least 20-25% more potassium, at least 25-30% more potassium, at least 30-35% more potassium, at least 35-40% more potassium, at least 40-45% more potassium, at least 45-50% more potassium, at least 50-55% more potassium, at least 55-60% more potassium, at least 60-65% more potassium, at least 65-70% more potassium, at least 70-75% more potassium, at least 80-85% more potassium, at least 85-90% more potassium, at least 90-95% more potassium, at least 95-100% more potassium, or even greater than 100% more potassium, or even greater than 200% more potassium, or even greater than 300% more potassium, or even greater than 400% more potassium, or even greater than 500% more potassium, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total sulfur than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less sulfur than average, for example, at least 5-10% less sulfur, at least 10-15% less sulfur, at least 15-20% less sulfur, at least 20-25% less sulfur, at least 25-30% less sulfur, at least 30-35% less sulfur, at least 35-40% less sulfur, at least 40-45% less sulfur, at least 45-50% less sulfur, at least 50-55% less sulfur, at least 55-60% less sulfur, at least 60-65% less sulfur, at least 65-70% less sulfur, at least 70-75% less sulfur, at least 80-85% less sulfur, at least 85-90% less sulfur, at least 90-95% less sulfur, or less, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total sulfur than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more sulfur than average, for example, at least 5-10% more sulfur, at least 10-15% more sulfur, at least 15-20% more sulfur, at least 20-25% more sulfur, at least 25-30% more sulfur, at least 30-35% more sulfur, at least 35-40% more sulfur, at least 40-45% more sulfur, at least 45-50% more sulfur, at least 50-55% more sulfur, at least 55-60% more sulfur, at least 60-65% more sulfur, at least 65-70% more sulfur, at least 70-75% more sulfur, at least 80-85% more sulfur, at least 85-90% more sulfur, at least 90-95% more sulfur, at least 95-100% more sulfur, or even greater than 100% more sulfur, or even greater than 200% more sulfur, or even greater than 300% more sulfur, or even greater than 400% more sulfur, or even greater than 500% more sulfur, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total calcium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less calcium than average, for example, at least 5-10% less calcium, at least 10-15% less calcium, at least 15-20% less calcium, at least 20-25% less calcium, at least 25-30% less calcium, at least 30-35% less calcium, at least 35-40% less calcium, at least 40-45% less calcium, at least 45-50% less calcium, at least 50-55% less calcium, at least 55-60% less calcium, at least 60-65% less calcium, at least 65-70% less calcium, at least 70-75% less calcium, at least 80-85% less calcium, at least 85-90% less calcium, at least 90-95% less calcium, or less, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains lower total magnesium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less magnesium than average, for example, at least 5-10% less magnesium, at least 10-15% less magnesium, at least 15-20% less magnesium, at least 20-25% less magnesium, at least 25-30% less magnesium, at least 30-35% less magnesium, at least 35-40% less magnesium, at least 40-45% less magnesium, at least 45-50% less magnesium, at least 50-55% less magnesium, at least 55-60% less magnesium, at least 60-65% less magnesium, at least 65-70% less magnesium, at least 70-75% less magnesium, at least 80-85% less magnesium, at least 85-90% less magnesium, at least 90-95% less magnesium, or less, when compared with crop plants grown under normal conditions during an average growing season.
In another embodiment, the endophyte-associated plant is harvested from a environment where soil contains higher total sodium chloride (salt) than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more salt than average, for example, at least 5-10% more salt, at least 10-15% more salt, at least 15-20% more salt, at least 20-25% more salt, at least 25-30% more salt, at least 30-35% more salt, at least 35-40% more salt, at least 40-45% more salt, at least 45-50% more salt, at least 50-55% more salt, at least 55-60% more salt, at least 60-65% more salt, at least 65-70% more salt, at least 70-75% more salt, at least 80-85% more salt, at least 85-90% more salt, at least 90-95% more salt, at least 95-100% more salt, or even greater than 100% more salt, or even greater than 200% more salt, or even greater than 300% more salt, or even greater than 400% more salt, or even greater than 500% more salt, when compared with crop plants grown under normal conditions during an average growing season.
Relocalization of Endophytes
In some embodiments, a single endophyte strain or a plurality of endophytes that are used to treat a plant element are capable of localizing to a different tissue of the plant, regardless of the original source of the endophyte. For example, the endophyte can be capable of localizing to any one of the tissues in the plant, including: the root, adventitious root, seminal root, root hair, shoot, leaf, flower, bud, tassel, meristem, pollen, pistil, ovaries, stamen, fruit, stolon, rhizome, nodule, tuber, trichome, guard cells, hydathode, petal, sepal, glume, rachis, vascular cambium, phloem, and xylem. In one embodiment, the endophyte is capable of localizing to the root and/or the root hair of the plant. In another embodiment, the endophyte is capable of localizing to the photosynthetic tissues, for example, leaves and shoots of the plant. In other cases, the endophyte is localized to the vascular tissues of the plant, for example, in the xylem and phloem. In still another embodiment, the endophyte is capable of localizing to the reproductive tissues (flower, pollen, pistil, ovaries, stamen, fruit) of the plant. In another embodiment, the endophyte is capable of localizing to the root, shoots, leaves and reproductive tissues of the plant. In still another embodiment, the endophyte colonizes a fruit or seed tissue of the plant. In still another embodiment, the endophyte is able to colonize the plant such that it is present in the surface of the plant (i.e., its presence is detectably present on the plant exterior, or the episphere of the plant). In still other embodiments, the endophyte is capable of localizing to substantially all, or all, tissues of the plant. In certain embodiments, the endophyte is not localized to the root of a plant. In other cases, the endophyte is not localized to the photosynthetic tissues of the plant.
Endophytes Capable of Altering the Metabolome, Epigenome, or Transcriptome of Plants
The endophytes useful for the invention can also be classified according to the changes conferred upon the plant. For example, the endophyte can alter the hormone status or levels of hormone production in the plant, which in turn can affect many physiological parameters, including flowering time, water efficiency, apical dominance and/or lateral shoot branching, increase in root hair, and alteration in fruit ripening. The endophyte may also introduce other changes to the plant, including biochemical, metabolomic, proteomic, genomic, epigenomic and/or transcriptomic profiles of endophyte-associated plants can be compared with reference agricultural plants under the same conditions.
Metabolomic differences between the plants can be detected using methods known in the art. For example, a biological sample (whole tissue, exudate, phloem sap, xylem sap, root exudate, etc.) from the endophyte-associated and reference agricultural plants can be analyzed essentially as described in Fiehn et al., (2000) Nature Biotechnol., 18, 1157-1161, or Roessner et al., (2001) Plant Cell, 13, 11-29. Such metabolomic methods can be used to detect differences in levels in hormone, nutrients, secondary metabolites, root exudates, phloem sap content, xylem sap content, heavy metal content, and the like. Such methods are also useful for detecting alterations in microbial content and status; for example, the presence and levels of bacterial/fungal signaling molecules (e.g., autoinducers and pheromones), which can indicate the status of group-based behavior of endophytes based on, for example, population of endophyte-associated and reference agricultural plants can also be performed to detect changes in expression of at least one transcript, or a set or network of genes upon endophyte association. Similarly, epigenetic changes can be detected using methylated DNA immunoprecipitation followed by high-throughput sequencing.
Combinations of Endophytes
Combinations of endophytes can be selected by any one or more of several criteria. In one embodiment, compatible endophytes are selected. As used herein, “compatibility” refers to endophyte populations that do not significantly interfere with the growth, propagation, and/or production of beneficial substances of the other. Incompatible endophyte populations can arise, for example, where one of the populations produces or secrets a compound that is toxic or deleterious to the growth of the other population(s). Incompatibility arising from production of deleterious compounds/agents can be detected using methods known in the art, and as described herein elsewhere. Similarly, the distinct populations can compete for limited resources in a way that makes co-existence difficult.
In another embodiment, combinations are selected on the basis of compounds produced by each population of endophytes. For example, the first population is capable of producing siderophores, and another population is capable of producing anti-fungal compounds. In an embodiment, the first population of endophytes or endophytic components is capable of a function selected from the group consisting of auxin production, nitrogen fixation, and production of an antimicrobial compound, siderophore production, mineral phosphate solubilization, cellulase production, chitinase production, xylanase production, and acetoin production, carbon source utilization, and combinations thereof. In another embodiment, the second population of endophytes or endophytic component is capable of a function selected from the group consisting of auxin production, nitrogen fixation, production of an antimicrobial compound, siderophore production, mineral phosphate solubilization, cellulase production, chitinase production, xylanase production, and acetoin production, and combinations thereof. In still another embodiment, the first and second populations are capable of at least one different function.
In still another embodiment, the combinations of endophytes are selected for their distinct localization in the plant after colonization. For example, the first population of endophytes or endophytic components can colonize, and in some cases preferentially colonize, the root tissue, while a second population can be selected on the basis of its preferential colonization of the aerial parts of the agricultural plant. Therefore, in an embodiment, the first population is capable of colonizing one or more of the tissues selected from the group consisting of a root, shoot, leaf, flower, and seed. In another embodiment, the second population is capable of colonizing one or more tissues selected from the group consisting of root, shoot, leaf, flower, and seed. In still another embodiment, the first and second populations are capable of colonizing a different tissue within the agricultural plant.
In some embodiments, combinations of endophytes are selected for their ability to confer a benefit to the host plant at different points in the life cycle of said host plant. In one example, one endophyte can be selected to impart improved seedling vigor, and a second endophyte can be selected to improve soil nutrient acquisition by roots of the mature plant.
In still another embodiment, combinations of endophytes are selected for their ability to confer one or more distinct fitness traits on the inoculated agricultural plant, either individually or in synergistic association with other endophytes. In another embodiment, one endophyte may induce the colonization of a second endophyte. Alternatively, two or more endophytes may induce the colonization of a third endophyte. For example, the first population of endophytes or endophytic components is selected on the basis that it confers significant increase in biomass, while the second population promotes increased drought tolerance on the inoculated agricultural plant. Therefore, in one embodiment, the first population is capable of conferring at least one trait selected from the group consisting of thermal tolerance, herbicide tolerance, drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, male sterility, cold tolerance, salt tolerance, increased yield, enhanced nutrient use efficiency, increased nitrogen use efficiency, increased fermentable carbohydrate content, reduced lignin content, increased antioxidant content, enhanced water use efficiency, increased vigor, increased germination efficiency, earlier or increased flowering, increased biomass, altered root-to-shoot biomass ratio, enhanced soil water retention, or a combination thereof. In another embodiment, the second population is capable of conferring a trait selected from the group consisting of thermal tolerance, herbicide tolerance, drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, male sterility, cold tolerance, salt tolerance, increased yield, enhanced nutrient use efficiency, increased nitrogen use efficiency, increased fermentable carbohydrate content, reduced lignin content, increased antioxidant content, enhanced water use efficiency, increased vigor, increased germination efficiency, earlier or increased flowering, increased biomass, altered root-to-shoot biomass ratio, and enhanced soil water retention. In still another embodiment, each of the first and second population is capable of conferring a different trait selected from the group consisting of thermal tolerance, herbicide tolerance, drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, male sterility, cold tolerance, salt tolerance, increased yield, enhanced nutrient use efficiency, increased nitrogen use efficiency, increased fermentable carbohydrate content, reduced lignin content, increased antioxidant content, enhanced water use efficiency, increased vigor, increased germination efficiency, earlier or increased flowering, increased biomass, altered root-to-shoot biomass ratio, and enhanced soil water retention.
The combinations of endophytes can also be selected based on combinations of the above criteria. For example, the first population of endophytes can be selected on the basis of the compound it produces (e.g., its ability to fix nitrogen, thus providing a potential nitrogen source to the plant), while the second population can be selected on the basis of its ability to confer increased resistance of the plant to a pathogen (e.g., a fungal pathogen).
In some embodiments of the present invention, it is contemplated that combinations of endophytes can provide an increased benefit to the host plant, as compared to that conferred by a single endophyte, by virtue of additive effects. For example, one endophyte strain that induces a benefit in the host plant may induce such benefit equally well in a plant that is also colonized with a different endophyte strain that also induces the same benefit in the host plant. The host plant thus exhibits the same total benefit from the combination of different endophyte strains as the additive benefit to individual plants colonized with each individual endophyte of the combination. In one example, a plant is colonized with two different endophyte strains: one provides a 1× increase in biomass when associated with the plant, and the other provides a 2× increase in biomass when associated with a different plant. When both endophyte strains are associated with the same plant, that plant would experience a 3× (additive of 1×+2× single effects) increase in auxin biomass. Additive effects are a surprising embodiment of the present invention, as non-compatibility of endophytes may result in a cancelation of the beneficial effects of both endophytes.
In some embodiments of the present invention, it is contemplated that a combination of endophytes can provide an increased benefit to the host plant, as compared to that conferred by a single endophyte, by virtue of synergistic effects. For example, one endophyte strain that induces a benefit in the host plant may induce such benefit beyond additive effects in a plant that is also colonized with a different endophyte strain that also induces that benefit in the host plant. The host plant thus exhibits the greater total benefit from the combination of different endophyte strains than could be seen from the additive benefit of individual plants colonized with each individual endophyte of the combination. In one example, a plant is colonized with two different endophyte strains: one provides a 1x increase in biomass when associated with a plant, and the other provides a 2× increase in biomass when associated with a different plant. When both endophyte strains are associated with the same plant, that plant would experience a 5× (greater than an additive of 1×+2× single effects) increase in biomass. Synergistic effects are a surprising embodiment of the present invention.
Inoculation with Multiple Endophytes
In another embodiment, the present invention contemplates methods of coating a plant element, e.g., a seed of a plant, with a plurality of endophytes, as well as synthetic compositions comprising a plurality of endophytes on and/or in the plant element. The methods according to this embodiment can be performed in a manner similar to those described herein for single endophyte coating. In one example, multiple endophytes can be prepared in a single preparation that is coated onto the plant element, e.g., a seed. The endophytes can be from a common origin (i.e., a same plant). Alternatively, the endophytes can be from different plants.
Where multiple endophytes are coated onto a plant element, each endophyte can be a bacterium. In the alternative, each endophyte can be a fungus. In still another embodiment, a plurality of bacterial and fungal endophytes can be coated onto the surface of a plant element.
Where a plurality of endophytes are coated onto the plant element, any or all of the endophytes may be capable of conferring a beneficial trait onto the host plant. In some cases, all of the endophytes are capable of conferring a beneficial trait onto the host plant. The trait conferred by each of the endophytes may be the same (e.g., both improve the host plant's tolerance to a particular biotic stress), or may be distinct (e.g., one improves the host plant's tolerance to drought, while another improves phosphate utilization). In other cases the conferred trait may be the result of interactions between the endophytes.
In one embodiment, an agricultural plant is contacted with a formulation comprising at least two endophytic microbial entities. Specific examples of pairs of endophytic microbial entities that can be applied to an agricultural plant include, for example, a pair of endophytic microbes containing nucleic acid sequences that are each at least 97% identical to the nucleic acid sequence selected from the groups provided in Table 1, Table 2, Table 7 and Table 8.
Isolation of Endophytes
According to the present invention, endophytes are isolated from a plant element, e.g., a seed of a plant. Because endophytes are capable of living and/or residing within the plant, or portion of the plant (including the seed), the endophytic nature of a microbe can distinguished from surface associated microbes by its resistance to surface sterilization techniques. Therefore, in one embodiment, endophytes are isolated from plant elements after the surface of the plant element is sterilized by contacting with non-specific antimicrobial agents such as sodium hypochlorite, hydrogen peroxide, copper oxychloride, copper hydroxide, copper sulfate, chlorothalonil, cuprous oxide, streptomycin, copper ammonium carbonate, copper diammonia diacetate complex, copper octanoate, oxytetracycline, fosetyl-AL or chloropicrin, in an aqueous solution and also optionally including detergents such as SDS, triton X-100, tween 20, can be used. In addition, dried seeds can be soaked in organic solvents such as ethanol, for example 50%-90% ethanol. Antibacterial or antifungal agents (e.g., captan, maneb, thiram, fludioxonil, etc.), particularly those that do not penetrate into the plant element, can also be used. In general, plant elements are soaked in an aqueous solution or commercial formulation containing one or more of these compounds for 30 seconds to 12 hours in a plastic container. After surface sterilization, the plant element is removed from the antibacterial formulation and washed 3-5 times with sterile distilled water. In an alternative embodiment where the plant element is a seed, the seed coat can be removed under sterile conditions, and the microbes inside the seed isolated and characterized.
Once surface-residing microbes are removed, the surviving microbes present in the plant element are generally considered endophytes. Such endophytes can be a bacterium or fungus, and can be isolated by homogenizing the surface sterilized seeds, and placing the homogenate under conditions allowing growth of the microbe. Therefore, the loss of microbe viability upon surface sterilization indicates that the microbes are almost exclusively located on the seed surface. In contrast, resistance of the microbe population to such plant element sterilization methods indicates an internal localization of the microbes. Alternatively, the presence of microbial DNA after surface sterilization with agents that cross-link or otherwise destroy DNA can be detected using sensitive detection methods such as PCR to establish the presence of the microbe within the plant element.
Growth of Endophytes
Viability of the microbe can be tested after plant element surface sterilization, or after removal of the seed coat, by homogenizing the plant element and placing the homogenate under conditions that promote growth of the microbe. In the alternative, the presence of microbes can be detected visually or microscopically if the microbes can form a colony that is visible by such inspection. Reagents are also available for the detection of microbes: the stain aniline blue can be used for detecting hyphae, other assays are known in the art.
Endophytes may require special conditions to allow for growth in isolation. A number of different growth media can be used to grow the endophytes. Additional details of endophyte growth are described within the examples sections.
Functional Attributes of Endophytes
In some cases, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, may produce one or more compounds and/or have one or more activities, e.g., one or more of the following: production of a metabolite, production of a phytohormone such as auxin, production of acetoin, production of an antimicrobial compound, production of a siderophore, production of a cellulase, production of a pectinase, production of a chitinase, production of a xylanase, nitrogen fixation, or mineral phosphate solubilization. For example, an endophyte can produce a phytohormone selected from the group consisting of an auxin, a cytokinin, a gibberellin, ethylene, a brassinosteroid, and abscisic acid. In some embodiments, the endophyte produces auxin (e.g., indole-3-acetic acid (IAA)). Production of auxin can be assayed as described herein. Many of the microbes described herein are capable of producing the plant hormone auxin indole-3-acetic acid (IAA) when grown in culture. Auxin plays a key role in altering the physiology of the plant, including the extent of root growth. Therefore, in other embodiments, endophytes are disposed on the surface or within a tissue of the plant element in an amount effective to detectably increase production of auxin in the agricultural plant when compared with a reference agricultural plant. In some embodiments, the increased auxin production can be detected in a tissue type selected from the group consisting of the root, shoot, leaves, and flowers.
In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, can produce a compound with antimicrobial properties. For example, the compound can have antibacterial properties, as determined by the growth assays provided herein. In some embodiments, the compound with antibacterial properties shows bacteriostatic or bactericidal activity against E. coli and/or Bacillus sp. In other embodiments, the endophyte produces a compound with antifungal properties, for example, fungicidal or fungistatic activity against S. cerevisiae and/or Rhizoctonia.
In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, is capable of nitrogen fixation, and is thus capable of producing ammonium from atmospheric nitrogen. The ability of endophytes to fix nitrogen can be confirmed by testing for growth of the fungus in nitrogen-free growth media, for example, LGI media, as described herein.
In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, can produce a compound that increases the solubility of mineral phosphate in the medium, i.e., mineral phosphate solubilization, for example, using growth assays known in the art. In some embodiments, the endophytes produce a compound that allows the bacterium to grow in growth media comprising Ca3HPO4 as the sole phosphate source.
In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, can produce a siderophore. Siderophores are small high-affinity iron chelating agents secreted by microorganisms that increase the bioavailability of iron. Siderophore production by the endophytes can be detected, for example, using methods known in the art.
In some embodiments, a single endophyte strain, a plurality of endophytes, or each individual type of endophytes of that plurality, can produce a hydrolytic enzyme. For example, in some embodiments, an endophytes can produce a hydrolytic enzyme selected from the group consisting of a cellulase, a pectinase, a chitinase and a xylanase. Hydrolytic enzymes can be detected using the methods known in the art.
Selection of Endophytes Conferring Beneficial Traits
The present invention contemplates inoculation of plants with microbes. As described earlier, the microbes can be derived from many different plants species, from different parts of the plants, and from plants isolated across different environments. Once a microbe is isolated, it can be tested for its ability to confer a beneficial trait. Numerous tests can be performed both in vitro and in vivo to assess what benefits, if any, are conferred upon the plant. In one embodiment, a microbe is tested in vitro for an activity selected from the group consisting of: liberation of complexed phosphates, liberation of complexed iron (e.g., through secretion of siderophores), production of phytohormones, production of antibacterial compounds, production of antifungal compounds, production of insecticidal compounds, production of nematicidal compounds, production and/or secretion of ACC deaminase, production and/or secretion of acetoin, production and/or secretion of pectinase, production and/or secretion of cellulase, and production and/or secretion of RNAse. Exemplary in vitro methods for the above can be found in the Examples sections below.
It is noted that the initial test for the activities listed above can also be performed using a mixture of microbes, for example, a community of microbes isolated from a single plant. A positive activity readout using such mixture can be followed with the isolation of individual microbes within that population and repeating the in vitro tests for the activities to isolate the microbe responsible for the particular activity. Once validated using a single microbe isolate, then the plant can be inoculated with a microbe, and the test performed in vivo, either in growth chamber or greenhouse conditions, and comparing with a control plant that was not inoculated with the microbe.
Endophyte Preparations
Also described herein is a preparation comprising one or more isolated modified endophytes described above. The preparation further comprises an agriculturally acceptable carrier, and the preparation comprises an amount of endophytes sufficient to improve an agronomic trait of the population of seeds. In one embodiment, the isolated endophyte is cultured, for example, on semi-synthetic or synthetic growth medium. In one embodiment, the endophyte is provided as a powder, for example, a lyophilized powder. In another embodiment, the endophyte is applied in suspension at a suitable concentration. The preparation of microbes can be an aqueous solution, an oil-in-water emulsion or water-in-oil emulsion containing a minimum concentration of a microbe. Microbes are present as live cells, viable cells, spores, or mycelia. Typically, the concentration is at least 104 CFU/ml or spores/ml, for example at least 3×104 CFU/mL or spores/ml, at least 105 CFU/mL or spores/ml, at least 3×105 CFU/mL or spores/ml, at least 106 CFU/mL or spores/ml, at least 3×106 CFU/mL or spores/ml, at least 107 CFU/ml or spores/ml, at least 3×107 CFU/mL or spores/ml, at least 108 CFU/mL or spores/ml, 109 CFU/mL or spores/ml, or more. In one embodiment, the preparation is a solution containing a microbe at a concentration between about 105 CFU/mL or spores/ml and about 109 CFU/mL or spores/ml. In another embodiment, the preparation contains a microbe at a concentration between about 106 CFU/mL or spores/ml and about 108 CFU/mL or spores/ml.
The synthetic preparation can also contain any number of other components. In one embodiment, the synthetic preparation may contain growth media or constituents required for the growth and propagation of the microbe. In one embodiment, the growth medium is selected from the group provided in the table below.
The synthetic preparation can be of a defined pH range. In one embodiment, the pH of the preparation can be between pH 5.5-6.0, pH 5.75-6.25, pH 6.0-6.5, pH 6.25-6.75, pH 6.5-7.0, pH 6.75-7.25, and pH 7.0-7.5. The pH of the medium can be adjusted using any biologically compatible buffering agent.
The synthetic preparation can also comprise a carrier, such as diatomaceous earth, clay, or chitin, which act to complex with chemical agents, such as control agents.
The synthetic preparation can also comprise an adherent. Such agents are useful for combining the microbes of the invention with carriers that can contain other compounds (e.g., control agents that are not biologic), to yield a coating composition. Such compositions help create coatings around the plant or seed to maintain contact between the microbe and other agents with the plant or plant part. In one embodiment, adherents are selected from the group consisting of: alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate, cephalins, Gum Arabic, Xanthan Gum, Mineral Oil, Polyethylene Glycol (PEG), Polyvinyl pyrrolidone (PVP), Arabino-galactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti, and polyoxyethylene-polyoxybutylene block copolymers. Other examples of adherent compositions that can be used in the synthetic preparation include those described in EP 0818135, CA 1229497, WO 2013090628, EP 0192342, WO 2008103422 and CA 1041788, each of which is incorporated by reference in its entirety.
The synthetic preparation can also contain one or more reagents that promote internalization of the microbe into the plant, and can include any one of the following classes of compounds: a surfactant, an abrasive, an osmoticum, and a plant signaling molecule.
The preparation can also contain a surfactant. Non-limiting examples of surfactants include nitrogen-surfactant blends such as Prefer 28 (Cenex), Surf-N(US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-It II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo-silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Amic (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis) and Century (Precision). In one embodiment, the surfactant is present at a concentration of between 0.01% v/v to 10% v/v. In another embodiment, the surfactant is present at a concentration of between 0.1% v/v to 1% v/v.
The synthetic preparation of a defined osmolality can also be used. In one embodiment, the synthetic preparation has an osmolality of less than about 100 mOsm, for example less than about 75 mOsm, less than about 50 mOsm, or less than about 25 mOsm. In another embodiment, the synthetic preparation has an osmolality of at least 250 mOsm, for example at least 300 mOsm, at least 400 mOsm, at least 500 mOsm, at least 600 mOsm, at least 700 mOsm, at least 800 mOsm, 900 mOsm or greater. The osmolality of the preparation can be adjusted by addition of an osmoticum: the osmoticum can be any commonly used osmoticum, and can selected from the group consisting of: mannitol, sorbitol, NaCl, KCl, CaCl2, MgSO4, sucrose, or any combination thereof.
The endophyte can be obtained from growth in culture, for example, using semi-synthetic or synthetic growth medium. In addition, the microbe can be cultured on solid media, for example on petri dishes, scraped off and suspended into the preparation. Microbes at different growth phases can be used. For example, microbes at lag phase, early-log phase, mid-log phase, late-log phase, stationary phase, early death phase, or death phase can be used.
For certain microbes that exist as mycelia or mycelia-like structures, pre-treatment of the microbes with enzymes (including, but not limited to, driselase, gluculase, cellulase, beta-glucanase, lysozyme, zymolyase) can be used to generate protoplasts in order to provide a suspension of microbes. After generation of protoplasts, the microbes can be allowed to partially regenerate the cell walls by leaving the protoplasts in a growth medium or solution with relatively high osmolarity for a short time (typically less than about 12 hours at room temperature) to prevent bursting of protoplasts.
Detection and Quantitation of Endophytes and Other Microbes
The presence of the endophyte or other microbes can be detected and its localization in or on the host plant (including the seed) can be determined using a number of different methodologies. The presence of the microbe in the embryo or endosperm, as well as its localization with respect to the plant cells, can be determined using methods known in the art, including immunofluorescence microscopy using microbe specific antibodies, or fluorescence in situ hybridization. The presence and quantity of other microbes can be established by the FISH, immunofluorescence and PCR methods using probes that are specific for the microbe. Alternatively, degenerate probes recognizing conserved sequences from many bacteria and/or fungi can be employed to amplify a region, after which the identity of the microbes present in the tested tissue/cell can be determined by sequencing.
Therefore, in one embodiment, where the endophyte is coated onto the surface of a plant element of a first plant such that the endophyte is present at a higher level on the surface of the plant element than is present on the surface of an uncoated reference plant element, the level of the endophyte present on the surface of the uncoated reference plant element is determined by culturing microbes that are present on the surface of the plant element. In another embodiment, the level of the endophyte present on the surface of the uncoated reference plant element is determined by PCR.
Uniformity of Seeds and Plants
In another aspect, the seeds according to the present invention provide a substantially uniform population of seeds with a uniform endophyte composition. The uniform population of seeds can be of a predefined weight. For example, a substantially uniform population of seeds containing at least 100 g seeds, for example at least 1 kg seeds, at least 5 kg seeds, at least 10 kg seeds, can be provided by the method according to the present invention that contains—as a whole product—more than 1%, for example more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, especially more than 50%, of the endophytic microorganism, i.e., the strain that is coated onto the surface of the seeds. According to a preferred embodiment, the present invention provides a marketable seed product containing at least 100 g seeds, for example, at least 1 kg seeds, for example at least 5 kg seeds, at least 10 kg seeds, wherein—as a whole product-more than 50%, for example, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, more than 99%, or 100% of the seeds contain the microbe, i.e., the inoculant strain. Each of the seeds can also contain a uniform number of microbes (for example, viable endophytes): for example, at least 50% of the seeds, for example at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or more of the seeds in the population can contain at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, at least 10,000 CFU or spores, at least 30,000 CFU or spores or more, of the endophytic microorganism. In some embodiments, at least 50% of the seeds, for example at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or more of the seeds in the population contains a single endophyte or a plurality of endophytes at a concentration between about 100 CFU or spores and about 30,000 CFU or spores, between about 100 CFU or spores and about 300 CFU or spores, between about 100 CFU or spores and about 1,000 CFU or spores, between about 100 CFU or spores and about 3,000 CFU or spores, between about 100 CFU or spores and about 10,00 CFU or spores, between about 100 CFU or spores and about 30,000 CFU or spores, between about 300 CFU or spores and about 1,000 CFU or spores, between about 300 CFU or spores and about 3,000 CFU or spores, between about 300 CFU or spores and about 10,00 CFU or spores, between about 300 CFU or spores and about 30,000 CFU or spores, between about 1,000 CFU or spores and about 3,000 CFU or spores, between about 1,000 CFU or spores and about 10,00 CFU or spores, between about 1,000 CFU or spores and about 30,00 CFU or spores, between about 3,000 CFU or spores and about 10,000 CFU or spores, between about 3,000 CFU or spores and about 30,00 CFU or spores, or between about 10,000 CFU or spores and about 30,000 CFU or spores. The endophyte can also be quantitated using other means, for example, using quantitative PCR, to detect the total number of endophyte present on each seed.
The uniformity of the microbes within the seed population can be measured in several different ways. In one embodiment, a substantial portion of the population of seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population, contains a viable endophyte on its surface. In another embodiment, a substantial portion of the population of seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population contain on its surface a threshold number of viable microbe that is at least 1 CFU or spore per seed, at least 10 CFU or spores per seed, for example, at least 100 CFU or spores, at least 300 CFU or spores, at least 1,000 CFU or spores, at least 3,000 CFU or spores, or more, of the microbe per seed. In some embodiments, a substantial portion of the population of seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population contain on its surface a threshold number of viable microbe that is between 1 CFU or spore per seed and about 3,000 CFU or spores per seed, between 1 CFU or spore per seed and about 10 CFU or spores per seed, between 1 CFU or spore per seed and about 100 CFU or spores per seed, between 1 CFU or spore per seed and about 300 CFU or spores per seed, between 1 CFU or spore per seed and about 1,000 CFU or spores per seed, between 1 CFU or spore per seed and about 3,000 CFU or spores per seed, between about 10 CFU or spore per seed and about 100 CFU or spores per seed, between about 10 CFU or spore per seed and about 300 CFU or spores per seed, between about 10 CFU or spore per seed and about 1,000 CFU or spores per seed, between about 10 CFU or spore per seed and about 3,000 CFU or spores per seed, between about 100 CFU or spore per seed and about 300 CFU or spores per seed, between about 100 CFU or spore per seed and about 1,000 CFU or spores per seed, between about 100 CFU or spore per seed and about 3,000 CFU or spores per seed, between about 300 CFU or spore per seed and about 1,000 CFU or spores per seed, between about 300 CFU or spore per seed and about 3,000 CFU or spores per seed, or between about 1,000 CFU or spore per seed and about 3,000 CFU or spores per seed.
In still another aspect, the present invention discloses a substantially uniform population of plants produced by growing the population of seeds described above. In one embodiment, at least 75%, at least 80%, at least 90%, at least 95% or more of the plants comprise in one or more tissues an effective amount of the endophyte or endophytes. In another embodiment, at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the plants comprise a microbe population that is substantially similar.
In some cases, a substantial portion of the population of plants or seeds, for example, at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds in a population, is coated with an endophyte that is able to perform one of the following functions, including: to stimulate plant growth, grow on nitrogen-free media, solubilize phosphate, sequester iron, secrete RNAse, antagonize pathogens, catabolize the precursor of ethylene, produce auxin and acetoin/butanediol. In some cases, a substantial portion of the population of seeds, for example, at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds in a population, exhibits at least one of the endophyte community attributes listed in herein (e.g., total CFUs, presence of a taxa, absence of a taxa, spatial distribution, intercellular colonization, functional properties of endophytes, presence of monoclonal strain, presence of conserved subset of microbial plasmid repertoire, microbe isolated from habitat that is distinct from the location of seed production, etc.).
Increased uniformity of microbes in plants or seeds can also be detected by measuring the presence of non-genomic nucleic acids present in the microbes. For examples, where the microbe that is inoculated into the plant is known to harbor a plasmid or episome, the presence of the plasmid or episome can be detected in individual plants or seeds by using conventional methods of nucleic acid detection. Therefore, in one embodiment, a substantial portion of the population of seeds, for example at least example at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds in a population, has a detectable presence of the microbial plasmid or episome.
Increased uniformity of the microbes' epigenetic status can also be used to detect increased uniformity of a population of seeds or plants derived from such seeds. For example, where a microbe that has been inoculated by a plant is also present in the plant (for example, in a different tissue or portion of the plant), or where the introduced microbe is sufficiently similar to a microbe that is present in some of the plants (or portion of the plant, including seeds), it is still possible to distinguish between the inoculated microbe and the native microbe, for example, by distinguishing between the two microbe types on the basis of their epigenetic status. Therefore, in one embodiment, the epigenetic status is detected in microbes across individual seeds or the plants that grow from such seeds.
It is also known that certain viruses are associated with endophytic fungi (such as the Curvularia thermal tolerance virus (CThTV) described in Marquez, L. M., et al., (2007). Science 315: 513-515). Therefore, the presence and quantity of a virus can be used to measure uniformity of seeds or plants containing the endophyte. For example, where the inoculated microbe is known to be associated with a virus, the presence of that virus can be used as a surrogate indicator of uniformity. Therefore, in one embodiment, a substantial portion of the seeds, for example at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds, contain the virus. In other embodiments, where one or more of the endogenous microbes contain associated viruses which are not found in, and not compatible with the inoculated microbe, the loss (i.e., absence) of the virus can be used to measure uniformity of the seed population. As such, in another embodiment, a substantial portion of the seeds, for example at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the seeds, do not contain the virus. In other cases, the genetic sequence of the virus can be used to measure the genetic similarity of the virus within a population. In one embodiment, a substantial proportion of the seeds, for example, at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the seeds contain the same virus, for example, as determined by sequence analysis.
Such uniformity in microbial composition is unique and is extremely advantageous for high-tech and/or industrial agriculture. It allows significant standardization with respect to qualitative endophyte load of seed products. Suitable volumes or weights are those that are currently used for plant seeds (e.g., the at least 100 g, at least 1, 5 or 10 kg; but also 25 or more, 40 or more, 50 kg or more, even 100 kg or more, 500 kg or more, 1 ton or more, etc.). Suitable containers or packages are those traditionally used in plant seed commercialization: however, also other containers with more sophisticated storage capabilities (e.g., with microbiologically tight wrappings or with gas- or water-proof containments) can be used. The amount of endophytes (qualitatively and quantitatively) contained in the seeds or in the marketable seed product as a whole can be determined by standard techniques in microbiology readily available to any person skilled in the art of plant endophyte analysis.
In some cases, a sub-population of agricultural seeds can be further selected on the basis of increased uniformity, for example, on the basis of uniformity of microbial population. For example, individual seeds of pools collected from individual cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields can be tested for uniformity of microbial density, and only those pools meeting specifications (e.g., at least 80% of tested seeds have minimum density, as determined by quantitative methods described elsewhere) are combined to provide the agricultural seed sub-population.
The methods described herein can also comprise a validating step. The validating step can entail, for example, growing some seeds collected from the inoculated plants into mature agricultural plants, and testing those individual plants for uniformity. Such validating step can be performed on individual seeds collected from cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields, and tested as described above to identify pools meeting the required specifications.
Agricultural Field
In another aspect, described herein is an agricultural field, including a greenhouse, comprising the population of plants described above. In one embodiment, the agricultural field comprises at least 100 plants. In another embodiment, the population occupies at least about 100 square feet of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the population comprises an effective amount of the microbe. In another embodiment, the population occupies at least about 100 square feet of space, wherein at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the population comprises the microbe in reproductive tissue. In still another embodiment, the population occupies at least about 100 square feet of space, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the population comprises at least 10 CFUs or spores, 100 CFUs or spores, 1,000 CFUs or spores, 10,000 CFUs or spores or more of the microbe. In still another embodiment, the population occupies at least about 100 square feet of space, wherein at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the population comprises between about 10 CFU or spores and about 10,000 CFU or spores, between about 10 CFU or spores and about 100 CFU or spores, between about 10 CFU or spores and about 1,000 CFU or spores, between about 100 CFU or spores and about 1,000 CFU or spores, between about 100 CFU or spores and about 10,00 CFU or spores, or between about 1,000 CFU or spores and about 10,000 CFU or spores. In yet another embodiment, the population occupies at least about 100 square feet of space, wherein at least 1%, between 1% and 10%, for example, at least 10%, between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, at least 95% or more of the population comprises a exogenous microbe (i.e., the endophyte) of monoclonal origin.
Plants can be grown individually from the seeds coated with the endophytes to propagate the desired microbes in indoor or outdoor settings. An advantage of the present invention is that it allows multiple plants harboring endophytes to be grown under agricultural methods as a means of providing improved uniformity of microbe-derived benefits to farmers.
Therefore, in another aspect, provided herein are indoor arrangements of populations (e.g., greenhouse) of plants generated from the methods of the present invention. Such arrangements can include at least a defined number of plants of the present invention, such as at least 1, at least 2, at least 3, between 3 and 5, at least 5, between 5 and 10, at least 10, between 10 and 15, at least 15, between 15 and 20, at least 20, between 20 and 30, at least 30, between 30 and 50, at least 50, between 50 and 100, at least 100, between 100 and 200, at least 200, between 200 and 500, at least 500, between 500 and 1000, at least 1000, between 1000 and 5000, at least 5000, between 5000 and 10000, at least 10000 or more plants.
Also provided herein are agricultural fields that contain population of plants generated from the seeds of the present invention. Agricultural fields can occupy as little as 100 square feet or less, or can occupy hundreds or thousands of acres. Area of field containing a population of microbe-associated plants can be measured in square feet, such as at least 100, 500, 1000, 5000, 10,000, 50,000 or greater than 50,000 square feet, or can be measured in acres, such as least 1, at least 2, at least 3, between 3 and 5, at least 5, between 5 and 10, at least 10, between 10 and 15, at least 15, between 15 and 20, at least 20, between 20 and 30, at least 30, between 30 and 50, at least 50, between 50 and 100, at least 100, between 100 and 200, at least 200, between 200 and 500, at least 500, between 500 and 1000, at least 1000, between 1000 and 5000, at least 5000, between 5000 and 10000, at least 10000, between 10000 and 50000, at least 50000 or greater acres. The field can also be measured in hectares, for example at least 1, at least 2, at least 3, between 3 and 5, at least 5, between 5 and 10, at least 10, between 10 and 15, at least 15, between 15 and 20, at least 20, between 20 and 30, at least 30, between 30 and 50, at least 50, between 50 and 100, at least 100, between 100 and 200, at least 200, between 200 and 500, at least 500, between 500 and 1000, at least 1000, between 1000 and 5000, at least 5000, between 5000 and 10000, at least 10000 or more hectares. Additionally, a field containing a population of microbe-associated plants can be characterized by the number of plants in the population, generally a field is at least two, such as at least 3, between 3 and 5, at least 5, between 5 and 10, at least 10, between 10 and 15, at least 15, between 15 and 20, at least 20, between 20 and 30, at least 30, between 30 and 50, at least 50, between 50 and 100, at least 100, between 100 and 200, at least 200, between 200 and 500, at least 500, between 500 and 1000, at least 1000, between 1000 and 5000, at least 5000, between 5000 and 10000, at least 10000, between 10000 and 25000, at least 250000, between 25000 and 50000, at least 500000, between 50000 and 75000, at least 750000, between 75000 and 100000, at least 1000000 or more plants. A field is generally a contiguous area but may be separated by geographical features such as roads, waterways, buildings, fences, and the like known to those skilled in the art. Because the microbe-associated plants described herein benefit from an increased level of uniformity of germination and other characteristics, it is desirable to maximize the percentage of plants containing microbes. For example, at least 10% (e.g., between 10% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 90%, at least 90%, between 90% and 95%, between 95% and 99%, at least 99% or more) of the plants contain the microbes.
Endophytes Compatible with Agrichemicals
In certain embodiments, the endophyte is selected on the basis of its compatibility with commonly used agrichemicals. As mentioned earlier, plants, particularly agricultural plants, can be treated with a vast array of agrichemicals, including fungicides, biocides (anti-bacterial agents), herbicides, insecticides, nematicides, rodenticides, fertilizers, and other agents.
In some cases, it can be important for the endophyte to be compatible with agrichemicals, particularly those with fungicidal or antibacterial properties, in order to persist in the plant although, as mentioned earlier, there are many such fungicidal or antibacterial agents that do not penetrate the plant, at least at a concentration sufficient to interfere with the endophyte. Therefore, where a systemic fungicide or antibacterial agent is used in the plant, compatibility of the endophyte to be inoculated with such agents will be an important criterion.
In one embodiment, natural isolates of endophytes that are compatible with agrichemicals can be used to inoculate the plants according to the methods described herein. For example, fungal endophytes which are compatible with agriculturally employed fungicides can be isolated by plating a culture of the endophytes on a petri dish containing an effective concentration of the fungicide, and isolating colonies of the endophyte that are compatible with the fungicide. In another embodiment, an endophyte that is compatible with a fungicide is used for the methods described herein. Fungicide compatible endophytes can also be isolated by selection on liquid medium. The culture of endophytes can be plated on petri dishes without any forms of mutagenesis; alternatively, the endophytes can be mutagenized using any means known in the art. For example, microbial cultures can be exposed to UV light, gamma-irradiation, or chemical mutagens such as ethylmethanesulfonate (EMS) prior to selection on fungicide containing media. Finally, where the mechanism of action of a particular fungicide is known, the target gene can be specifically mutated (either by gene deletion, gene replacement, site-directed mutagenesis, etc.) to generate an endophyte that is resilient against that particular fungicide. It is noted that the above-described methods can be used to isolate fungi that are compatible with both fungistatic and fungicidal compounds.
It will also be appreciated by one skilled in the art that a plant may be exposed to multiple types of fungicides or antibacterial compounds, either simultaneously or in succession, for example at different stages of plant growth. Where the target plant is likely to be exposed to multiple fungicidal and/or antibacterial agents, an endophyte that is compatible with many or all of these agrichemicals can be used to inoculate the plant. An endophyte that is compatible with several fungicidal agents can be isolated, for example, by serial selection. An endophyte that is compatible with the first fungicidal agent is isolated as described above (with or without prior mutagenesis). A culture of the resulting endophyte can then be selected for the ability to grow on liquid or solid media containing the second antifungal compound (again, with or without prior mutagenesis). Colonies isolated from the second selection are then tested to confirm its compatibility to both antifungal compounds.
Likewise, bacterial endophytes that are compatible to biocides (including herbicides such as glyphosate or antibacterial compounds, whether bacteriostatic or bactericidal) that are agriculturally employed can be isolated using methods similar to those described for isolating fungicide compatible endophytes. In one embodiment, mutagenesis of the microbial population can be performed prior to selection with an antibacterial agent. In another embodiment, selection is performed on the microbial population without prior mutagenesis. In still another embodiment, serial selection is performed on an endophyte: the endophyte is first selected for compatibility to a first antibacterial agent. The isolated compatible endophyte is then cultured and selected for compatibility to the second antibacterial agent. Any colony thus isolated is tested for compatibility to each, or both antibacterial agents to confirm compatibility with these two agents.
Resistance, or compatibility with an antimicrobial agent can be determined by a number of means known in the art, including the comparison of the minimal inhibitory concentration (MIC) of the unmodified and modified endophyte. Therefore, in one embodiment, the present invention discloses an isolated modified endophyte derived from an endophyte isolated from within a plant or tissue thereof, wherein the endophyte is modified such that it exhibits at least 3 fold greater, for example, at least 5 fold greater, at least 10 fold greater, at least 20 fold greater, at least 30 fold greater or more MIC to an antimicrobial agent when compared with the unmodified endophyte.
In one particular aspect, disclosed herein are bacterial endophytes with enhanced resistance to the herbicide glyphosate. In one embodiment, the bacterial endophyte has a doubling time in growth medium containing at least 1 mM glyphosate, for example, at least 2 mM glyphosate, at least 5 mM glyphosate, at least 10 mM glyphosate, at least 15 mM glyphosate or more, that is no more than 250%, for example, no more than 200%, no more than 175%, no more than 150%, or no more than 125%, of the doubling time of the endophyte in the same growth medium containing no glyphosate. In one particular embodiment, the bacterial endophyte has a doubling time in growth medium containing 5 mM glyphosate that is no more than 150% the doubling time of the endophyte in the same growth medium containing no glyphosate.
In another embodiment, the bacterial endophyte has a doubling time in a plant tissue containing at least 10 ppm glyphosate, for example, at least 15 ppm glyphosate, at least 20 ppm glyphosate, at least 30 ppm glyphosate, at least 40 ppm glyphosate or more, that is no more than 250%, for example, no more than 200%, no more than 175%, no more than 150%, or no more than 125%, of the doubling time of the endophyte in a reference plant tissue containing no glyphosate. In one particular embodiment, the bacterial endophyte has a doubling time in a plant tissue containing 40 ppm glyphosate that is no more than 150% the doubling time of the endophyte in a reference plant tissue containing no glyphosate.
The selection process described above can be repeated to identify isolates of the endophyte that are compatible with a multitude of antifungal or antibacterial agents.
Candidate isolates can be tested to ensure that the selection for agrichemical compatibility did not result in loss of a desired microbial bioactivity. Isolates of the endophyte that are compatible with commonly employed fungicides can be selected as described above. The resulting compatible endophyte can be compared with the parental endophyte on plants in its ability to promote germination.
The agrichemical compatible endophytes generated as described above can be detected in samples. For example, where a transgene was introduced to render the endophyte resistant to the agrichemical(s), the transgene can be used as a target gene for amplification and detection by PCR. In addition, where point mutations or deletions to a portion of a specific gene or a number of genes results in compatibility with the agrichemical(s), the unique point mutations can likewise be detected by PCR or other means known in the art. Such methods allow the detection of the microbe even if it is no longer viable. Thus, commodity plant products produced using the agrichemical compatible microbes described herein can readily be identified by employing these and related methods of nucleic acid detection.
Improved Traits Conferred by the Endophyte
The present invention contemplates the establishment of a microbial symbiont in a plant. In one embodiment, the microbial association results in a detectable change to the seed or plant. The detectable change can be an improvement in a number of agronomic traits (e.g., improved general health, increased response to biotic or abiotic stresses, or enhanced properties of the plant or a plant part, including fruits and grains). Alternatively, the detectable change can be a physiological or biological change that can be measured by methods known in the art. The detectable changes are described in more detail in the sections below. As used herein, an endophyte is considered to have conferred an improved agricultural trait whether or not the improved trait arose from the plant, the endophyte, or the concerted action between the plant and endophyte. Therefore, for example, whether a beneficial hormone or chemical is produced by the plant or endophyte, for purposes of the present invention, the endophyte will be considered to have conferred an improved agronomic trait upon the host plant.
In some embodiments, plant-endophyte combinations confer an agronomic benefit in agricultural plants. In some embodiments, the agronomic trait is selected from the group consisting of altered oil content, altered protein content, altered seed carbohydrate composition, altered seed oil composition, and altered seed protein composition, chemical tolerance, cold tolerance, delayed senescence, disease resistance, drought tolerance, ear weight, growth improvement, health enhancement, heat tolerance, herbicide tolerance, herbivore resistance, improved nitrogen fixation, improved nitrogen utilization, improved root architecture, improved water use efficiency, increased biomass, increased root length, increased seed weight, increased shoot length, increased yield, increased yield under water-limited conditions, kernel mass, kernel moisture content, metal tolerance, number of ears, number of kernels per ear, number of pods, nutrition enhancement, pathogen resistance, pest resistance, photosynthetic capability improvement, salinity tolerance, stay-green, vigor improvement, increased dry weight of mature seeds, increased fresh weight of mature seeds, increased number of mature seeds per plant, increased chlorophyll content, increased number of pods per plant, increased length of pods per plant, reduced number of wilted leaves per plant, reduced number of severely wilted leaves per plant, and increased number of non-wilted leaves per plant, a detectable modulation in the level of a metabolite, a detectable modulation in the level of a transcript, and a detectable modulation in the proteome relative to a reference plant. In other embodiments, at least two agronomic traits are improved in the agricultural plant.
For example, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, at least 100%, between 100% and 150%, at least 150%, between 150% and 200%, at least 200%, between 200% and 300%, or at least 300% or more, when compared with uninoculated plants grown under the same conditions.
In some aspects, provided herein, are methods for producing a seed of a plant with a heritably altered trait. The trait of the plant can be altered without known genetic modification of the plant genome, and comprises the following steps. First, a preparation of an isolated endophyte that is exogenous to the seed of the plant is provided, and optionally processed to produce a microbial preparation. The microbial preparation is then contacted with the plant. The plants are then allowed to go to seed, and the seeds, which contain the endophytes on and/or in the seed are collected. The endophytes contained within the seed are viably incorporated into the seed.
The method of the present invention can facilitate crop productivity by enhancing germination, seedling vigor and biomass in comparison with a non-treated control. Moreover, the introduction of the beneficial microorganisms to within the seed instead of by, e.g., seed coating, makes the endophytes less susceptible to environmental perturbation and more compatible with chemical seed coatings (e.g., pesticides and herbicides). Using endophyte colonized seeds, the plant growth and biomass increases are statistically similar to those obtained using conventional inoculation methods e.g., exogenous seed soaking and soil inoculation (that are more laborious and less practicable in certain circumstances).
Also described herein are plants, and fields of plants, that are associated with beneficial endophytes, such that the overall fitness, productivity or health of the plant or a portion thereof, is maintained, increased and/or improved over a period of time. Improvement in overall plant health can be assessed using numerous physiological parameters including, but not limited to, height, overall biomass, root and/or shoot biomass, seed germination, seedling survival, photosynthetic efficiency, transpiration rate, seed/fruit number or mass, plant grain or fruit yield, leaf chlorophyll content, photosynthetic rate, root length, or any combination thereof. Improved plant health, or improved field health, can also be demonstrated through improved resistance or response to a given stress, either biotic or abiotic stress, or a combination of one or more abiotic stresses, as provided herein.
Disclosed herein are endophyte-associated plants with increased resistance to an abiotic stress. Exemplary abiotic stresses include, but are not limited to: drought, salt, high metal content, low nutrients, cold stress, and heat stress.
When soil water is depleted or if water is not available during periods of drought, crop yields are restricted. Plant water deficit develops if transpiration from leaves exceeds the supply of water from the roots. The available water supply is related to the amount of water held in the soil and the ability of the plant to reach that water with its root system. Transpiration of water from leaves is linked to the fixation of carbon dioxide by photosynthesis through the stomata. The two processes are positively correlated so that high carbon dioxide influx through photosynthesis is closely linked to water loss by transpiration. As water transpires from the leaf, leaf water potential is reduced and the stomata tend to close in a hydraulic process limiting the amount of photosynthesis. Since crop yield is dependent on the fixation of carbon dioxide in photosynthesis, water uptake and transpiration are contributing factors to crop yield. Plants which are able to use less water to fix the same amount of carbon dioxide or which are able to function normally at a lower water potential have the potential to conduct more photosynthesis and thereby to produce more biomass and economic yield in many agricultural systems.
In some cases, a plant resulting from seeds or other plant elements treated with a single endophyte strain or a plurality of endophytes can exhibit a physiological change, such as a compensation of the stress-induced reduction in photosynthetic activity (expressed, for example, as ΔFv/Fm) after exposure to heat shock or drought conditions as compared to a corresponding control, genetically identical plant that does not contain the endophytes grown in the same conditions. In some cases, the endophyte-associated plant as disclosed herein can exhibit an increased change in photosynthetic activity ΔFv(ΔFv/Fm) after heat-shock or drought stress treatment, for example 1, 2, 3, 4, 5, 6, 7 days or more after the heat-shock or drought stress treatment, or until photosynthesis ceases, as compared with corresponding control plant of similar developmental stage but not comprising the endophytes. For example, a plant having a plurality of the endophytes able to confer heat and/or drought-tolerance can exhibit a ΔFv/Fm of from about 0.1 to about 0.8 after exposure to heat-shock or drought stress or a ΔFv/Fm range of from about 0.03 to about 0.8 under one day, or 1, 2, 3, 4, 5, 6, 7, or over 7 days post heat-shock or drought stress treatment, or until photosynthesis ceases. In some embodiments, stress-induced reductions in photosynthetic activity can be compensated by at least about 0.25% (for example, at least about 0.5%, between 0.5% and 1%, at least about 1%, between 1% and 2%, at least about 2%, between 2% and 3%, at least about 3%, between 3% and 5%, at least about 5%, between 5% and 10%, at least about 8%, at least about 10%, between 10% and 15%, at least about 15%, between 15% and 20%, at least about 20%, between 20$ and 25%, at least about 25%, between 25% and 30%, at least about 30%, between 30% and 40%, at least about 40%, between 40% and 50%, at least about 50%, between 50% and 60%, at least about 60%, between 60% and 75%, at least about 75%, between 75% and 80%, at least about 80%, between 80% and 85%, at least about 85%, between 85% and 90%, at least about 90%, between 90% and 95%, at least about 95%, between 95% and 99%, at least about 99%, between 99% and 100%, or at least 100%) as compared to the photosynthetic activity decrease in a corresponding reference agricultural plant following heat shock conditions. Significance of the difference between endophyte-associated and reference agricultural plants can be established upon demonstrating statistical significance, for example at p<0.05 with an appropriate parametric or non-parametric statistic, e.g., Chi-square test, Student's t-test, Mann-Whitney test, or F-test based on the assumption or known facts that the endophyte-associated plant and reference agricultural plant have identical or near identical genomes (isoline comparison).
In selecting traits for improving crops, a decrease in water use, without a change in growth would have particular merit in an irrigated agricultural system where the water input costs were high. An increase in growth without a corresponding jump in water use would have applicability to all agricultural systems. In many agricultural systems where water supply is not limiting, an increase in growth, even if it came at the expense of an increase in water use also increases yield. Water use efficiency (WUE) is a parameter often correlated with drought tolerance, and is the CO2 assimilation rate per water transpired by the plant. An increased water use efficiency of the plant relates in some cases to an increased fruit/kernel size or number. Therefore, in some embodiments, the plants described herein exhibit an increased water use efficiency when compared with a reference agricultural plant grown under the same conditions. For example, the plants grown from the plant elements comprising the plurality of endophytes can have at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100% higher WUE than a reference agricultural plant grown under the same conditions. Such an increase in WUE can occur under conditions without water deficit, or under conditions of water deficit, for example, when the soil water content is less than or equal to 60% of water saturated soil, for example, less than or equal to 50%, less than or equal to 40%, less than or equal to 30%, less than or equal to 20%, less than or equal to 10% of water saturated soil on a weight basis. In a related embodiment, the plant comprising the plurality of endophytes can have at least 10% higher relative water content (RWC), for example, at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100% higher RWC than a reference agricultural plant grown under the same conditions.
In some embodiments, the plants comprise a single endophyte strain or a plurality of endophytes able to increase heat and/or drought-tolerance in sufficient quantity, such that increased growth or improved recovery from wilting under conditions of heat or drought stress is observed. For example, a plurality of endophyte populations described herein can be present in sufficient quantity in a plant, resulting in increased growth as compared to a plant that does not contain endophytes, when grown under drought conditions or heat shock conditions, or following such conditions. Increased heat and/or drought tolerance can be assessed with physiological parameters including, but not limited to, increased height, overall biomass, root and/or shoot biomass, seed germination, seedling survival, photosynthetic efficiency, transpiration rate, seed/fruit number or mass, plant grain or fruit yield, leaf chlorophyll content, photosynthetic rate, root length, wilt recovery, turgor pressure, or any combination thereof, as compared to a reference agricultural plant grown under similar conditions. For example, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
In various embodiments, a single endophyte strain or plurality of endophytes introduced into altered seed microbiota can confer in the resulting plant thermal tolerance, herbicide tolerance, drought resistance, insect resistance, fungus resistance, virus resistance, bacteria resistance, male sterility, cold tolerance, salt tolerance, increased yield, enhanced nutrient use efficiency, increased nitrogen use efficiency, increased protein content, increased fermentable carbohydrate content, reduced lignin content, increased antioxidant content, enhanced water use efficiency, increased vigor, increased germination efficiency, earlier or increased flowering, increased biomass, altered root-to-shoot biomass ratio, enhanced soil water retention, or a combination thereof. A difference between the endophyte-associated plant and a reference agricultural plant can also be measured using other methods known in the art.
In other embodiments, a single endophyte strain or plurality of endophytes able to confer increased tolerance to salinity stress can be introduced into plants. The resulting plants comprising endophytes can exhibit increased resistance to salt stress, whether measured in terms of survival under saline conditions, or overall growth during, or following salt stress. The physiological parameters of plant health recited above, including height, overall biomass, root and/or shoot biomass, seed germination, seedling survival, photosynthetic efficiency, transpiration rate, seed/fruit number or mass, plant grain or fruit yield, leaf chlorophyll content, photosynthetic rate, root length, or any combination thereof, can be used to measure growth, and compared with the growth rate of reference agricultural plants (e.g., isogenic plants without the endophytes) grown under identical conditions. For example, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
In other instances, endophyte-associated plants and reference agricultural plants can be grown in soil or growth media containing different concentration of sodium to establish the inhibitory concentration of sodium (expressed, for example, as the concentration in which growth of the plant is inhibited by 50% when compared with plants grown under no sodium stress). Therefore, in another embodiment, a plant resulting from seeds containing an endophyte able to confer salt tolerance described herein exhibits an increase in the inhibitory sodium concentration by at least 10 mM, for example at least 15 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM or more, when compared with the reference agricultural plants.
Plants are sessile organisms and therefore must contend with the environment in which they are placed. While plants have adapted many mechanisms to deal with chemicals and substances that may be deleterious to their health, heavy metals represent a class of toxins which are highly relevant for plant growth and agriculture. Plants use a number of mechanisms to cope with toxic levels of heavy metals (for example, nickel, cadmium, lead, mercury, arsenic, or aluminum) in the soil, including excretion and internal sequestration. For agricultural purposes, it is important to have plants that are able to tolerate otherwise hostile conditions, for example soils containing elevated levels of toxic heavy metals. Endophytes that are able to confer increased heavy metal tolerance may do so by enhancing sequestration of the metal in certain compartments. Use of such endophytes in a plant would allow the development of novel plant-endophyte combinations for purposes of environmental remediation (also known as phytoremediation). Therefore, in one embodiment, the plant containing the endophyte able to confer increased metal tolerance exhibits a difference in a physiological parameter that is at least about 5% greater, for example at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 75%, at least about 80%, at least about 80%, at least about 90%, or at least 100%, at least about 200%, at least about 300%, at least about 400% or greater than a reference agricultural plant grown under the same heavy metal concentration in the soil.
Alternatively, the inhibitory concentration of the heavy metal can be determined for the endophyte-associated plant and compared with a reference agricultural plant under the same conditions. Therefore, in one embodiment, the plants resulting from seeds containing an endophyte able to confer heavy metal tolerance described herein exhibit an increase in the inhibitory sodium concentration by at least 0.1 mM, for example at least 0.3 mM, at least 0.5 mM, at least 1 mM, at least 2 mM, at least 5 mM, at least 10 mM, at least 15 mM, at least 20 mM, at least 30 mM, at least 50 mM or more, when compared with the reference agricultural plants.
Finally, plants inoculated with endophytes that are able to confer increased metal tolerance exhibits an increase in overall metal accumulation by at least 10%, for example at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, at least 150%, at least 200%, at least 300% or more, when compared with uninoculated plants grown under the same conditions.
A single endophyte strain or a plurality of endophytes described herein may also confer to the plant an increased ability to grow in nutrient limiting conditions, for example by solubilizing or otherwise making available to the plants macronutrients or micronutrients that are complexed, insoluble, or otherwise in an unavailable form. In some embodiments, a plant is inoculated with a plurality of endophytes that confer increased ability to liberate and/or otherwise provide to the plant with nutrients selected from the group consisting of phosphate, nitrogen, potassium, iron, manganese, calcium, molybdenum, vitamins, or other micronutrients. Such a plant can exhibit increased growth in soil comprising limiting amounts of such nutrients when compared with reference agricultural plant. Differences between the endophyte-associated plant and reference agricultural plant can be measured by comparing the biomass of the two plant types grown under limiting conditions, or by measuring the physical parameters described above. Therefore, in some embodiments, the plant comprising endophytes shows increased tolerance to nutrient limiting conditions as compared to a reference agricultural plant grown under the same nutrient limited concentration in the soil, as measured for example by increased biomass or seed yield of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions. In other embodiments, the plant containing the plurality of endophytes is able to grown under nutrient stress conditions while exhibiting no difference in the physiological parameter compared to a plant that is grown without nutrient stress. In some embodiments, such a plant will exhibit no difference in the physiological parameter when grown with 2-5% less nitrogen than average cultivation practices on normal agricultural land, for example, at least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, or between 75% and 100%, less nitrogen, when compared with crop plants grown under normal conditions during an average growing season. In some embodiments, the microbe capable of providing nitrogen-stress tolerance to a plant is diazotrophic. In other embodiments, the microbe capable of providing nitrogen-stress tolerance to a plant is non-diazotrophic.
In some cases, endophytes can confer to the plant the ability to tolerate cold stress. Many known methods exist for the measurement of a plant's tolerance to cold stress (as reviewed, for example, in Thomashow (2001) Plant Physiol. 125: 89-93, and Gilmour et al. (2000) Plant Physiol. 124: 1854-1865, both of which are incorporated herein by reference in their entirety). As used herein, cold stress refers to both the stress induced by chilling (0° C.-15° C.) and freezing (<0° C.). Some cultivars of agricultural plants can be particularly sensitive to cold stress, but cold tolerance traits may be multigenic, making the breeding process difficult. Endophytes able to confer cold tolerance would potentially reduce the damage suffered by farmers on an annual basis. Improved response to cold stress can be measured by survival of plants, the amount of necrosis of parts of the plant, or a change in crop yield loss, as well as the physiological parameters used in other examples. Therefore, in one embodiment, the plant containing the endophyte able to confer increased cold tolerance exhibits a difference in a physiological parameter that is at least about 5% greater, for example at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 75%, at least about 80%, at least about 80%, at least about 90%, or at least 100%, at least about 200%, at least about 300%, at least about 400% or greater than a reference agricultural plant grown under the same conditions of cold stress.
In other embodiments, a single endophyte strain or plurality of endophytes protects the plant from a biotic stress, for example, insect infestation, nematode infestation, complex infection, fungal infection, oomycete infection, protozoal infection, viral infection, and herbivore grazing, or a combination thereof. For example, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
There are an abundance of insect pest species that can infect or infest a wide variety of plants. Pest infestation can lead to significant damage. Insect pests that infest plant species are particularly problematic in agriculture as they can cause serious damage to crops and significantly reduce plant yields. A wide variety of different types of plant are susceptible to pest infestation including commercial crops such as cotton, soybean, wheat, barley, and corn.
In some embodiments, endophytes described herein confer upon the host plant the ability to repel insect herbivores. In other cases, the endophytes may produce, or induce the production in the plant of, compounds which are insecticidal or insect repellant. The insect may be any one of the common pathogenic insects affecting plants, particularly agricultural plants. Examples include, but are not limited to: Leptinotarsa spp. (e.g., L. decemlineata (Colorado potato beetle), L. juncta (false potato beetle), or L. texana (Texan false potato beetle)); Nilaparvata spp. (e.g., N. lugens (brown planthopper)); Laode/phax spp. (e.g., L. striatellus (small brown planthopper)); Nephotettix spp. (e.g., N. virescens or N. cincticeps (green leafhopper), or N. nigropictus (rice leafhopper)); Sogatella spp. (e.g., S. furcifera (white-backed planthopper)); Chilo spp. (e.g., C. suppressalis (rice striped stem borer), C. auricilius (gold-fringed stem borer), or C. polychrysus (dark-headed stem borer)); Sesamia spp. (e.g., S. inferens (pink rice borer)); Tryporyza spp. (e.g., T. innotata (white rice borer), or T. incertulas (yellow rice borer)); Anthonomus spp. (e.g., A. grandis (boll weevil)); Phaedon spp. (e.g., P. cochleariae (mustard leaf beetle)); Epilachna spp. (e.g., E. varivetis (Mexican bean beetle)); Tribolium spp. (e.g., T. castaneum (red floor beetle)); Diabrotica spp. (e.g., D. virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm), D. virgifera zeae (Mexican corn rootworm); Ostrinia spp. (e.g., O. nubilalis (European corn borer)); Anaphothrips spp. (e.g., A. obscrurus (grass thrips)); Pectinophora spp. (e.g., P. gossypiella (pink bollworm)); Heliothis spp. (e.g., H. virescens (tobacco budworm)); Trialeurodes spp. (e.g., T. abutiloneus (banded-winged whitefly) T. vaporariorum (greenhouse whitefly)); Bemisia spp. (e.g., B. argentifolii (silverleaf whitefly)); Aphis spp. (e.g., A. gossypii (cotton aphid)); Lygus spp. (e.g., L. lineolaris (tarnished plant bug) or L. hesperus (western tarnished plant bug)); Euschistus spp. (e.g., E. conspersus (consperse stink bug)); Chlorochroa spp. (e.g., C. sayi (Say stinkbug)); Nezara spp. (e.g., N. viridula (southern green stinkbug)); Thrips spp. (e.g., T. tabaci (onion thrips)); Frankliniella spp. (e.g., F. fusca (tobacco thrips), or F. occidentalis (western flower thrips)); Acheta spp. (e.g., A. domesticus (house cricket)); Myzus spp. (e.g., M. persicae (green peach aphid)); Macrosiphum spp. (e.g., M. euphorbiae (potato aphid)); Blissus spp. (e.g., B. leucopterus (chinch bug)); Acrosternum spp. (e.g., A. hilare (green stink bug)); Chilotraea spp. (e.g., C. polychrysa (rice stalk borer)); Lissorhoptrus spp. (e.g., L. oryzophilus (rice water weevil)); Rhopalosiphum spp. (e.g., R. maidis (corn leaf aphid)); Anuraphis spp. (e.g., A. maidiradicis (corn root aphid)), and combinations thereof.
The endophyte-associated plant can be tested for its ability to resist, or otherwise repel, pathogenic insects by measuring, for example, insect load, overall plant biomass, biomass of the fruit or grain, percentage of intact leaves, or other physiological parameters described herein, and comparing with a reference agricultural plant. In some embodiments, the endophyte-associated plant exhibits increased biomass as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, endophyte-associated plants). In other embodiments, the endophyte-associated plant exhibits increased fruit or grain yield as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, endophyte-associated plants). In any of the above, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
Nematodes are microscopic roundworms that feed on the roots, fluids, leaves and stems of more than 2,000 row crops, vegetables, fruits, and ornamental plants, causing an estimated $100 billion crop loss worldwide and accounting for 13% of global crop losses due to disease. A variety of parasitic nematode species infect crop plants, including root-knot nematodes (RKN), cyst- and lesion-forming nematodes. Root-knot nematodes, which are characterized by causing root gall formation at feeding sites, have a relatively broad host range and are therefore parasitic on a large number of crop species. The cyst- and lesion-forming nematode species have a more limited host range, but still cause considerable losses in susceptible crops.
Signs of nematode damage include stunting and yellowing of leaves, and wilting of the plants during hot periods. Nematode infestation, however, can cause significant yield losses without any obvious above-ground disease symptoms. The primary causes of yield reduction are due to underground root damage. Roots infected by SCN are dwarfed or stunted. Nematode infestation also can decrease the number of nitrogen-fixing nodules on the roots, and may make the roots more susceptible to attacks by other soil-borne plant nematodes.
In some embodiments, the endophyte-associated plant has an increased resistance to a nematode when compared with a reference agricultural plant. As before with insect herbivores, biomass of the plant or a portion of the plant, or any of the other physiological parameters mentioned elsewhere, can be compared with the reference agricultural plant grown under the same conditions. Particularly useful measurements include overall plant biomass, biomass and/or size of the fruit or grain, and root biomass. In some embodiments, the endophyte-associated plant exhibits increased biomass as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, under conditions of nematode challenge). In other embodiments, the endophyte-associated plant exhibits increased root biomass as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, under conditions of nematode challenge). In still another embodiment, the endophyte-associated plant exhibits increased fruit or grain yield as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, under conditions of nematode challenge). In any of the above, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
Fungal diseases are responsible for yearly losses of over $10 Billion on agricultural crops in the US, represent 42% of global crop losses due to disease, and are caused by a large variety of biologically diverse pathogens. Different strategies have traditionally been used to control them. Resistance traits have been bred into agriculturally important varieties, thus providing various levels of resistance against either a narrow range of pathogen isolates or races, or against a broader range. However, this involves the long and labor intensive process of introducing desirable traits into commercial lines by genetic crosses and, due to the risk of pests evolving to overcome natural plant resistance, a constant effort to breed new resistance traits into commercial lines is required. Alternatively, fungal diseases have been controlled by the application of chemical fungicides. This strategy usually results in efficient control, but is also associated with the possible development of resistant pathogens and can be associated with a negative impact on the environment. Moreover, in certain crops, such as barley and wheat, the control of fungal pathogens by chemical fungicides is difficult or impractical.
The present invention contemplates the use a single endophyte strain or of a plurality of endophytes that is able to confer resistance to fungal pathogens to the host plant. Increased resistance to fungal inoculation can be measured, for example, using any of the physiological parameters presented above, by comparing with reference agricultural plants. In some embodiments, the endophyte-associated plant exhibits increased biomass and/or less pronounced disease symptoms as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, infected with the fungal pathogen). In still another embodiment, the endophyte-associated plant exhibits increased fruit or grain yield as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, infected with the fungal pathogen). In other embodiments, the endophyte-associated plant exhibits decreased hyphal growth as compared to a reference agricultural plant grown under the same conditions (e.g., grown side-by-side, or adjacent to, the endophyte-associated plants, infected with the fungal pathogen). In any of the above, the endophyte may provide an improved benefit or tolerance to a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
Plant viruses are estimated to account for 18% of global crop losses due to disease. There are numerous examples of viral pathogens affecting agricultural productivity. Examples include the American wheat striate mosaic virus (AWSMV) (wheat striate mosaic), Barley stripe mosaic virus (BSMV), Barley yellow dwarf virus (BYDV), Brome mosaic virus (BMV), Cereal chlorotic mottle virus (CCMV), Corn chlorotic vein banding virus (CCVBV), Brazilian maize mosaic virus, Corn lethal necrosis Virus complex from Maize chlorotic mottle virus, (MCMV), Maize dwarf mosaic virus (MDMV), A or B Wheat streak mosaic virus (WSMV), Cucumber mosaic virus (CMV), Cynodon chlorotic streak virus (CCSV), Johnsongrass mosaic virus (JGMV), Maize bushy stunt Mycoplasma-like organism (MLO) associated virus, Maize chlorotic dwarf Maize chlorotic dwarf virus (MCDV), Maize chlorotic mottle virus (MCMV), Maize dwarf mosaic virus (MDMV), strains A, D, E and F, Maize leaf fleck virus (MLFV), Maize line virus (MLV), Maize mosaic (corn leaf stripe, Maize mosaic virus (MMV), enanismo rayado), Maize mottle and chlorotic stunt virus, Maize pellucid ringspot virus (MPRV), Maize raya gruesa virus (MRGV), Maize rayado fino (fine striping) virus (MRFV), Maize red stripe virus (MRSV), Maize ring mottle virus (MRMV), Maize rio cuarto virus (MRCV), Maize rough dwarf virus (MRDV), Cereal tillering disease virus, Maize sterile stunt virus, barley yellow striate virus, Maize streak virus (MSV), Maize stripe virus, Maize chloroticstripe virus, maize hoja blanca virus, Maize stunting virus; Maize tassel abortion virus (MTAV), Maize vein enation virus (MVEV), Maize wallaby ear virus (MWEV), Maize white leaf virus, Maize white line mosaic virus (MWLMV), Millet red leaf virus (MRLV), Northern cereal mosaic virus (NCMV), Oat pseudorosette virus, (zakuklivanie), Oat sterile dwarf virus (OSDV), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), Sorghum mosaic virus (SrMV), Sugarcane mosaic virus (SCMV) strains H, 1 and M, Sugarcane Fiji disease virus (FDV), Sugarcane mosaic virus (SCMV) strains A, B, D, E, SC, BC, Sabi and MB (formerly MDMV-B), and Wheat spot mosaic virus (WSMV). In one embodiment, the endophyte-associated plant provides protection against viral pathogens such that there is at least 5% greater biomass, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% or more biomass, than the reference agricultural plant grown under the same conditions. In still another embodiment, the endophyte-associated plant exhibits at least 5% greater fruit or grain yield, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% or more fruit or grain yield when challenged with a virus, as compared to a reference agricultural plant grown under the same conditions. In yet another embodiment, the endophyte-associated plant exhibits at least 5% lower viral titer, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% lower viral titer when challenged with a virus, as compared to a reference agricultural plant grown under the same conditions.
Likewise, bacterial pathogens are a significant problem negatively affecting agricultural productivity and accounting for 27% of global crop losses due to plant disease. In one embodiment, the endophyte-associated plant described herein provides protection against bacterial pathogens such that there is at least 5% greater biomass, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% or more biomass, than the reference agricultural plant grown under the same conditions. In still another embodiment, the endophyte-associated plant exhibits at least 5% greater fruit or grain yield, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% or more fruit or grain yield when challenged with a bacterial pathogen, than the reference agricultural plant grown under the same conditions. In yet another embodiment, the endophyte-associated plant exhibits at least 5% lower bacterial count, for example, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 75%, at least 100% lower bacterial count when challenged with a bacteria, as compared to a reference agricultural plant grown under the same conditions.
Yield and Biomass Improvement
In other embodiments, the improved trait can be an increase in overall biomass of the plant or a part of the plant, including its fruit or seed. In some embodiments, a single endophyte strain or a plurality of endophytes is disposed on the surface or within a tissue of the plant element in an amount effective to increase the biomass of the plant, or a part or tissue of the plant grown from the plant element. The increased biomass is useful in the production of commodity products derived from the plant. Such commodity products include an animal feed, a fish fodder, a cereal product, a processed human-food product, a sugar or an alcohol. Such products may be a fermentation product or a fermentable product, one such exemplary product is a biofuel. The increase in biomass can occur in a part of the plant (e.g., the root tissue, shoots, leaves, etc.), or can be an increase in overall biomass. Increased biomass production, such an increase meaning at at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions. Such increase in overall biomass can be under relatively stress-free conditions. In other cases, the increase in biomass can be in plants grown under any number of abiotic or biotic stresses, including drought stress, salt stress, heat stress, cold stress, low nutrient stress, nematode stress, insect herbivory stress, fungal pathogen stress, bacterial pathogen stress, and viral pathogen stress. In some embodiments, a plurality of endophytes is disposed in an amount effective to increase root biomass by at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions, when compared with a reference agricultural plant.
In other cases, a plurality of endophytes is disposed on the plant element in an amount effective to increase the average biomass of the fruit or cob from the resulting plant at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, or at least 100%, when compared with uninoculated plants grown under the same conditions.
Increase in Plant Growth Hormones
Many of the microbes described herein are capable of producing the plant hormone auxin indole-3-acetic acid (IAA) when grown in culture. Auxin may play a key role in altering the physiology of the plant, including the extent of root growth. Therefore, in other embodiments, a single endophyte strain or a plurality of endophytes is disposed on the surface or within a tissue of the plant element in an amount effective to detectably induce production of auxin in the agricultural plant. For example, the increase in auxin production can be at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, at least 100%, or more, when compared with a reference agricultural plant. In some embodiments, the increased auxin production can be detected in a tissue type selected from the group consisting of the root, shoot, leaves, and flowers.
Improvement of other traits. In other embodiments, a single endophyte strain or a plurality of endophytes can confer other beneficial traits to the plant. Improved traits can include an improved nutritional content of the plant or plant element used for human consumption. In some embodiments, the endophyte-associated plant is able to produce a detectable change in the content of at least one nutrient. Examples of such nutrients include amino acid, protein, oil (including any one of Oleic acid, Linoleic acid, Alpha-linoleic acid, Saturated fatty acids, Palmitic acid, Stearic acid and Trans fats), carbohydrate (including sugars such as sucrose, glucose and fructose, starch, or dietary fiber), Vitamin A, Thiamine (vit. B1), Riboflavin (vit. B2), Niacin (vit. B3), Pantothenic acid (B5), Vitamin B6, Folate (vit. B9), Choline, Vitamin C, Vitamin E, Vitamin K, Calcium, Iron, Magnesium, Manganese, Phosphorus, Potassium, Sodium, Zinc. In some embodiments, the endophyte-associated plant or part thereof contains at least one increased nutrient when compared with reference agricultural plants.
In other cases, the improved trait can include reduced content of a harmful or undesirable substance when compared with reference agricultural plants. Such compounds include those which are harmful when ingested in large quantities or are bitter tasting (for example, oxalic acid, amygdalin, certain alkaloids such as solanine, caffeine, nicotine, quinine and morphine, tannins, cyanide). As such, in some embodiments, the endophyte-associated plant or part thereof contains less of the undesirable substance when compared with reference agricultural plant. In a related embodiment, the improved trait can include improved taste of the plant or a part of the plant, including the fruit or seed. In a related embodiment, the improved trait can include reduction of undesirable compounds produced by other endophytes in plants, such as degradation of Fusarium-produced deoxynivalenol (also known as vomitoxin and a virulence factor involved in Fusarium head blight of maize and wheat) in a part of the plant, including the fruit or seed.
The endophyte-associated plant can also have an altered hormone status or altered levels of hormone production when compared with a reference agricultural plant. An alteration in hormonal status may affect many physiological parameters, including flowering time, water efficiency, apical dominance and/or lateral shoot branching, increase in root hair, and alteration in fruit ripening.
The association between the endophytes and the plant can also be detected using other methods known in the art. For example, the biochemical, genomic, epigenomic, transcriptomic, metabolomics, and/or proteomic profiles of endophyte-associated plants can be compared with reference agricultural plants under the same conditions.
Transcriptome analysis of endophyte-associated and reference agricultural plants can also be performed to detect changes in expression of at least one transcript, or a set or network of genes upon endophyte association. Similarly, epigenetic changes can be detected using methylated DNA immunoprecipitation followed by high-throughput sequencing.
Metabolomic or proteomic differences between the plants can be detected using methods known in the art. The metabolites, proteins, or other compounds described herein can be detected using any suitable method including, but not limited to gel electrophoresis, liquid and gas phase chromatography, either alone or coupled to mass spectrometry, NMR, immunoassays (enzyme-linked immunosorbent assays (ELISA)), chemical assays, spectroscopy and the like. In some embodiments, commercial systems for chromatography and NMR analysis are utilized. Such metabolomic methods can be used to detect differences in levels in hormone, nutrients, secondary metabolites, root exudates, phloem sap content, xylem sap content, heavy metal content, and the like. Such methods are also useful for detecting alterations in endophyte content and status; for example, the presence and levels of signaling molecules (e.g., autoinducers and pheromones), which can indicate the status of group-based behavior of endophytes based on, for example, population density. In some embodiments, a biological sample (whole tissue, exudate, phloem sap, xylem sap, root exudate, etc.) from endophyte-associated and reference agricultural plants can be analyzed essentially as known in the art.
In some embodiments, metabolites in plants can be modulated by making synthetic combinations of plants with pluralities of endophytes. For example, a plurality of endophytes can cause a detectable modulation (e.g., an increase or decrease) in the level of various metabolites, e.g., indole-3-carboxylic acid, trans-zeatin, abscisic acid, phaseic acid, indole-3-acetic acid, indole-3-butyric acid, indole-3-acrylic acid, jasmonic acid, jasmonic acid methyl ester, dihydrophaseic acid, gibberellin A3, salicylic acid, upon colonization of a plant.
In some embodiments, a single endophyte strain or a plurality of endophytes modulates the level of the metabolite directly (e.g., the microbes produces the metabolite, resulting in an overall increase in the level of the metabolite found in the plant). In other cases, the agricultural plant, as a result of the association with the plurality of endophytes, exhibits a modulated level of the metabolite (e.g., the plant reduces the expression of a biosynthetic enzyme responsible for production of the metabolite as a result of the microbe inoculation). In still other cases, the modulation in the level of the metabolite is a consequence of the activity of both the microbe and the plant (e.g., the plant produces increased amounts of the metabolite when compared with a reference agricultural plant, and the endophyte also produces the metabolite). Therefore, as used herein, a modulation in the level of a metabolite can be an alteration in the metabolite level through the actions of the microbe and/or the inoculated plant.
The levels of a metabolite can be measured in an agricultural plant, and compared with the levels of the metabolite in a reference agricultural plant, and grown under the same conditions as the inoculated plant. The uninoculated plant that is used as a reference agricultural plant is a plant that has not been applied with a formulation with the plurality of endophytes (e.g., a formulation comprising a plurality of populations of purified endophytes). The uninoculated plant used as the reference agricultural plant is generally the same species and cultivar as, and is isogenic to, the inoculated plant.
The metabolite whose levels are modulated (e.g., increased or decreased) in the endophyte-associated plant may serve as a primary nutrient (i.e., it provides nutrition for the humans and/or animals who consume the plant, plant tissue, or the commodity plant product derived therefrom, including, but not limited to, a sugar, a starch, a carbohydrate, a protein, an oil, a fatty acid, or a vitamin). The metabolite can be a compound that is important for plant growth, development or homeostasis (for example, a phytohormone such as an auxin, cytokinin, gibberellin, a brassinosteroid, ethylene, or abscisic acid, a signaling molecule, or an antioxidant). In other embodiments, the metabolite can have other functions. For example, in some embodiments, a metabolite can have bacteriostatic, bactericidal, fungistatic, fungicidal or antiviral properties. In other embodiments, the metabolite can have insect-repelling, insecticidal, nematode-repelling, or nematicidal properties. In still other embodiments, the metabolite can serve a role in protecting the plant from stresses, may help improve plant vigor or the general health of the plant. In yet another embodiment, the metabolite can be a useful compound for industrial production. For example, the metabolite may itself be a useful compound that is extracted for industrial use, or serve as an intermediate for the synthesis of other compounds used in industry. In a particular embodiment, the level of the metabolite is increased within the agricultural plant or a portion thereof such that it is present at a concentration of at least 0.1 ug/g dry weight, for example, at least 0.3 ug/g dry weight, between 0.3 ug/g and 1.0 ug/g dry weight, at least 1.0 ug/g dry weight, between 1.0 ug/g and 3.0 ug/g dry weight, at least 3.0 ug/g dry weight, between 3.0 ug/g and 10 ug/g dry weight, at least 10 ug/g dry weight, between 10 ug/g and 30 ug/g dry weight, at least 30 ug/g dry weight, between 30 ug/g and 100 ug/g dry weight, at least 100 ug/g dry weight, between 100 ug/g and 300 ug/g dry weight, at least 300 ug/g dry weight, between 300 ug/g and 1 mg/g dry weight, or more than 1 mg/g dry weight, of the plant or portion thereof.
Likewise, the modulation can be a decrease in the level of a metabolite. The reduction can be in a metabolite affecting the taste of a plant or a commodity plant product derived from a plant (for example, a bitter tasting compound), or in a metabolite which makes a plant or the resulting commodity plant product otherwise less valuable (for example, reduction of oxalate content in certain plants, or compounds which are deleterious to human and/or animal health). The metabolite whose level is to be reduced can be a compound that affects quality of a commodity plant product (e.g., reduction of lignin levels).
Commodity Plant Product
The present invention provides a commodity plant product, as well as methods for producing a commodity plant product, that is derived from a plant of the present invention. As used herein, a “commodity plant product” refers to any composition or product that is comprised of material derived from a plant, seed, plant cell, or plant part of the present invention. Commodity plant products may be sold to consumers and can be viable or nonviable. Nonviable commodity products include but are not limited to nonviable seeds and grains; processed seeds, seed parts, and plant parts; dehydrated plant tissue, frozen plant tissue, and processed plant tissue; seeds and plant parts processed for animal feed for terrestrial and/or aquatic animal consumption, oil, meal, flour, flakes, bran, fiber, paper, tea, coffee, silage, crushed of whole grain, and any other food for human or animal consumption; and biomasses and fuel products; and raw material in industry. Industrial uses of oils derived from the agricultural plants described herein include ingredients for paints, plastics, fibers, detergents, cosmetics, lubricants, and biodiesel fuel. Soybean oil may be split, inter-esterified, sulfurized, epoxidized, polymerized, ethoxylated, or cleaved. Designing and producing soybean oil derivatives with improved functionality and improved oliochemistry is a rapidly growing field. The typical mixture of triglycerides is usually split and separated into pure fatty acids, which are then combined with petroleum-derived alcohols or acids, nitrogen, sulfonates, chlorine, or with fatty alcohols derived from fats and oils to produce the desired type of oil or fat. Commodity plant products also include industrial compounds, such as a wide variety of resins used in the formulation of adhesives, films, plastics, paints, coatings and foams.
In some cases, commodity plant products derived from the plants, or using the methods of the present invention can be identified readily. In some cases, for example, the presence of viable endophytes can be detected using the methods described herein elsewhere. In other cases, particularly where there are no viable endophytes, the commodity plant product may still contain at least a detectable amount of the specific and unique DNA corresponding to the microbes described herein. Any standard method of detection for polynucleotide molecules may be used, including methods of detection disclosed herein.
The present invention contemplates a synthetic combination of a plant element that is associated with a single endophyte strain or a plurality of endophytes to confer an improved trait of agronomic importance to the host plant, or an improved agronomic trait potential to a plant element associated with the endophytes, that upon and after germination will confer said benefit to the resultant host plant.
In some embodiments, the plant element is associated with a single endophyte strain or a plurality of endophytes on its surface. Such association is contemplated to be via a mechanism selected from the group consisting of: spraying, immersion, coating, encapsulating, dusting, dripping, aerosolizing, seed treatment, root wash, seedling soak, foliar application, soil inocula, in-furrow application, sidedress application, soil pre-treatment, wound inoculation, drip tape irrigation, vector-mediation via a pollinator, injection, osmopriming, hydroponics, aquaponics, and aeroponics.
In some embodiments, the plant element is a leaf, and the synthetic combination is formulated for application as a foliar treatment.
In some embodiments, the plant element is a seed, and the synthetic combination is formulated for application as a seed coating.
In some embodiments, the plant element is a root, and the synthetic combination is formulated for application as a root treatment.
In certain embodiments, the plant element becomes associated with a plurality of endophytes through delayed exposure. For example, the soil in which a plant element is to be introduced is first treated with a composition comprising a plurality of endophytes. In another example, the area around the plant or plant element is exposed to a formulation comprising a plurality of endophytes, and the plant element becomes subsequently associated with the endophytes due to movement of soil, air, water, insects, mammals, human intervention, or other methods.
The plant element can be obtained from any agricultural plant. In some embodiments, the plant element of the first plant is from a monocotyledonous plant. For example, the plant element of the first plant is from a cereal plant. The plant element of the first plant can be selected from the group consisting of a maize seed, a wheat seed, a barley seed, a rice seed, a sugarcane seed, a maize root, a wheat root, a barley root, a sugarcane root, a rice root, a maize leaf, a wheat leaf, a barley leaf, a sugarcane leaf, or a rice leaf. In an alternative embodiment, the plant element of the first plant is from a dicotyledonous plant. The plant element of the first plant can be selected from the group consisting of a cotton seed, a tomato seed, a canola seed, a pepper seed, a soybean seed, a cotton root, a tomato root, a canola root, a pepper root, a soybean root, a cotton leaf, a tomato leaf, a canola leaf, a pepper leaf, or a soybean leaf. In still another embodiment, the plant element of the first plant can be from a genetically modified plant. In other embodiments, the plant element of the first plant can be a hybrid plant element.
The synthetic combination can comprise a plant element of the first plant which is surface-sterilized prior to combining with a plurality of endophytes. Such pre-treatment prior to coating the seed with endophytes removes the presence of other microbes which may interfere with the optimal colonization, growth and/or function of the endophytes. Surface sterilization of seeds can be accomplished without killing the seeds as described herein.
A single endophyte strain or a plurality of endophytes is intended to be useful in the improvement of agricultural plants, and as such, may be formulated with other compositions as part of an agriculturally compatible carrier. It is contemplated that such carriers can include, but not be limited to: seed treatment, root treatment, foliar treatment, soil treatment. The carrier composition with a plurality of endophytes, may be prepared for agricultural application as a liquid, a solid, or a gas formulation. Application to the plant may be achieved, for example, as a powder for surface deposition onto plant leaves, as a spray to the whole plant or selected plant element, as part of a drip to the soil or the roots, or as a coating onto the seed prior to planting. Such examples are meant to be illustrative and not limiting to the scope of the invention.
In some embodiments, the present invention contemplates plant elements comprising a single endophyte strain or a plurality of endophytes, and further comprising a formulation. The formulation useful for these embodiments generally comprises at least one member selected from the group consisting of an agriculturally compatible carrier, a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, and a nutrient.
In some cases, a single endophyte strain or a plurality of endophytes is mixed with an agriculturally compatible carrier. The carrier can be a solid carrier or liquid carrier. The carrier may be any one or more of a number of carriers that confer a variety of properties, such as increased stability, wettability, or dispersability. Wetting agents such as natural or synthetic surfactants, which can be nonionic or ionic surfactants, or a combination thereof can be included in a composition of the invention. Water-in-oil emulsions can also be used to formulate a composition that includes a plurality of endophytes. Suitable formulations that may be prepared include wettable powders, granules, gels, agar strips or pellets, thickeners, and the like, microencapsulated particles, and the like, liquids such as aqueous flowables, aqueous suspensions, water-in-oil emulsions, etc. The formulation may include grain or legume products, for example, ground grain or beans, broth or flour derived from grain or beans, starch, sugar, or oil.
In some embodiments, the agricultural carrier may be soil or plant growth medium. Other agricultural carriers that may be used include fertilizers, plant-based oils, humectants, or combinations thereof. Alternatively, the agricultural carrier may be a solid, such as diatomaceous earth, loam, silica, alginate, clay, bentonite, vermiculite, seed cases, other plant and animal products, or combinations, including granules, pellets, or suspensions. Mixtures of any of the aforementioned ingredients are also contemplated as carriers, such as but not limited to, pesta (flour and kaolin clay), agar or flour-based pellets in loam, sand, or clay, etc. Formulations may include food sources for the cultured organisms, such as barley, rice, or other biological materials such as seed, leaf, root, plant elements, sugar cane bagasse, hulls or stalks from grain processing, ground plant material or wood from building site refuse, sawdust or small fibers from recycling of paper, fabric, or wood. Other suitable formulations will be known to those skilled in the art.
In some embodiments, the formulation can comprise a tackifier or adherent. Such agents are useful for combining the microbial population of the invention with carriers that can contain other compounds (e.g., control agents that are not biologic), to yield a coating composition. Such compositions help create coatings around the plant or plant element to maintain contact between the microbe and other agents with the plant or plant part. In some embodiments, adherents are selected from the group consisting of: alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate, cephalins, Gum Arabic, Xanthan Gum, carragennan, PGA, other biopolymers, Mineral Oil, Polyethylene Glycol (PEG), Polyvinyl pyrrolidone (PVP), Arabino-galactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti, and polyoxyethylene-polyoxybutylene block copolymers. Other examples of adherent compositions that can be used in the synthetic preparation include those described in EP 0818135, CA 1229497, WO 2013090628, EP 0192342, WO 2008103422 and CA 1041788, each of which is incorporated herein by reference in its entirety.
It is also contemplated that the formulation may further comprise an anti-caking agent.
The formulation can also contain a surfactant, wetting agent, emulsifier, stabilizer, or anti-foaming agent. Non-limiting examples of surfactants include nitrogen-surfactant blends such as Prefer 28 (Cenex), Surf-N(US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-It II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo-silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Amic (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis) and Century (Precision), polysorbate 20, polysorbate 80, Tween 20, Tween 80, Scattics, Alktest TW20, Canarcel, Peogabsorb 80, Triton X-100, Conco NI, Dowfax 9N, Igebapl CO, Makon, Neutronyx 600, Nonipol NO, Plytergent B, Renex 600, Solar NO, Sterox, Serfonic N, T-DET-N, Tergitol NP, Triton N, IGEPAL CA-630, Nonident P-40, and Pluronic. In some embodiments, the surfactant is present at a concentration of between 0.01% v/v to 10% v/v. In other embodiments, the surfactant is present at a concentration of between 0.1% v/v to 1% v/v. An example of an anti-foaming agent is Antifoam-C.
In certain cases, the formulation includes a microbial stabilizer. Such an agent can include a desiccant. As used herein, a “desiccant” can include any compound or mixture of compounds that can be classified as a desiccant regardless of whether the compound or compounds are used in such concentrations that they in fact have a desiccating effect on the liquid inoculant. Such desiccants are ideally compatible with the endophytes used, and should promote the ability of the microbial population to survive application on the plant elements and to survive desiccation. Examples of suitable desiccants include one or more of trehalose, sucrose, glycerol, and Methylene glycol. Other suitable desiccants include, but are not limited to, non-reducing sugars and sugar alcohols (e.g., mannitol or sorbitol). The amount of desiccant introduced into the formulation can range from about 5% to about 50% by weight/volume, for example, between about 10% to about 40%, between about 15% and about 35%, or between about 20% and about 30%.
In some cases, it is advantageous for the formulation to contain agents such as a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, a bactericide, a virucide, and a nutrient. Such agents are ideally compatible with the agricultural plant element or seedling onto which the formulation is applied (e.g., it should not be deleterious to the growth or health of the plant). Furthermore, the agent is ideally one which does not cause safety concerns for human, animal or industrial use (e.g., no safety issues, or the compound is sufficiently labile that the commodity plant product derived from the plant contains negligible amounts of the compound).
In the liquid form, for example, solutions or suspensions, a plurality of endophytes can be mixed or suspended in aqueous solutions. Suitable liquid diluents or carriers include aqueous solutions, petroleum distillates, or other liquid carriers.
Solid compositions can be prepared by dispersing a plurality of endophytes of the invention in and on an appropriately divided solid carrier, such as peat, wheat, bran, vermiculite, clay, talc, bentonite, diatomaceous earth, fuller's earth, pasteurized soil, and the like. When such formulations are used as wettable powders, biologically compatible dispersing agents such as non-ionic, anionic, amphoteric, or cationic dispersing and emulsifying agents can be used.
The solid carriers used upon formulation include, for example, mineral carriers such as kaolin clay, pyrophyllite, bentonite, montmorillonite, diatomaceous earth, acid white soil, vermiculite, and pearlite, and inorganic salts such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, ammonium chloride, and calcium carbonate. Also, organic fine powders such as wheat flour, wheat bran, and rice bran may be used. The liquid carriers include vegetable oils such as soybean oil and cottonseed oil, glycerol, ethylene glycol, polyethylene glycol, propylene glycol, polypropylene glycol, etc.
In some embodiments, the formulation is ideally suited for coating of a plurality of endophytes onto plant elements. The plurality of endophytes is capable of conferring many agronomic benefits to the host plants. The ability to confer such benefits by coating the plurality of endophytes on the surface of plant elements has many potential advantages, particularly when used in a commercial (agricultural) scale.
A single endophyte strain or a plurality of endophytes can be combined with one or more of the agents described above to yield a formulation suitable for combining with an agricultural plant element or seedling. The plurality of endophytes can be obtained from growth in culture, for example, using a synthetic growth medium. In addition, the microbe can be cultured on solid media, for example on petri dishes, scraped off and suspended into the preparation. Microbes at different growth phases can be used. For example, microbes at lag phase, early-log phase, mid-log phase, late-log phase, stationary phase, early death phase, or death phase can be used. Endophytic spores may be used for the present invention, for example but not limited to: arthospores, sporangispores, conidia, chlamadospores, pycnidiospores, endospores, zoospores.
The formulations comprising a plurality of endophytes of the present invention typically contains between about 0.1 to 95% by weight, for example, between about 1% and 90%, between about 3% and 75%, between about 5% and 60%, between about 10% and 50% in wet weight of a plurality of endophytes. In some embodiments, the formulation contains at least about 10{circumflex over ( )}2 per ml of formulation, at least about 10{circumflex over ( )}3 per ml of formulation, for example, at least about 10{circumflex over ( )}4, at least about 10{circumflex over ( )}5, at least about 10{circumflex over ( )}6, at least about 10{circumflex over ( )}7 CFU or spores, at least about 10{circumflex over ( )}8 CFU or spores per ml of formulation. In some embodiments, the formulation be applied to the plant element at about 10{circumflex over ( )}2 CFU/seed, between 10{circumflex over ( )}2 and 10{circumflex over ( )}3 CFU, at least about 10{circumflex over ( )}3 CFU, between 10{circumflex over ( )}3 and 10{circumflex over ( )}4 CFU, at least about 10{circumflex over ( )}4 CFU, between 10{circumflex over ( )}4 and 10{circumflex over ( )}5 CFU, at least about 10{circumflex over ( )}5 CFU, between 10{circumflex over ( )}5 and 10{circumflex over ( )}6 CFU, at least about 10{circumflex over ( )}6 CFU, between 10{circumflex over ( )}6 and 10{circumflex over ( )}7 CFU, at least about 10{circumflex over ( )}7 CFU, between 10{circumflex over ( )}7 and 10{circumflex over ( )}8 CFU, or even greater than 10{circumflex over ( )}8 CFU per seed.
The compositions provided herein are preferably stable. The endophyte may be shelf-stable, where at least 0.01%, of the CFU or spores are viable after storage in desiccated form (i.e., moisture content of 30% or less) for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or greater than 10 weeks at 4° C. or at room temperature. Optionally, a shelf-stable formulation is in a dry formulation, a powder formulation, or a lyophilized formulation. In some embodiments, the formulation is formulated to provide stability for the population of endophytes. In one embodiment, the formulation is substantially stable at temperatures between about −20° C. and about 50° C. for at least about 1, 2, 3, 4, 5, or 6 days, or 1, 2, 3 or 4 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, or one or more years. In another embodiment, the formulation is substantially stable at temperatures between about 4° C. and about 37° C. for at least about 5, 10, 15, 20, 25, 30 or greater than 30 days.
As described above, in certain embodiments, the present invention contemplates the use of a single endophyte strain or a plurality of endophytes heterologously disposed on the plant, for example, the plant element. In certain cases, the agricultural plant may contain bacteria that are substantially similar to, or even genetically indistinguishable from, the bacteria that are being applied to the plant. It is noted that, in many cases, the bacteria that are being applied is substantially different from the bacteria already present in several significant ways. First, the bacteria that are being applied to the agricultural plant have been adapted to culture, or adapted to be able to grow on growth media in isolation from the plant. Second, in many cases, the bacteria that are being applied are derived from a clonal origin, rather than from a heterologous origin and, as such, can be distinguished from the bacteria that are already present in the agricultural plant by the clonal similarity. For example, where a microbe that has been inoculated by a plant is also present in the plant (for example, in a different tissue or portion of the plant), or where the introduced microbe is sufficiently similar to a microbe that is present in some of the plants (or portion of the plant, including plant elements), it is still possible to distinguish between the inoculated microbe and the native microbe by distinguishing between the two microbe types on the basis of their epigenetic status (e.g., the bacteria that are applied, as well as their progeny, would be expected to have a much more uniform and similar pattern of cytosine methylation of its genome, with respect to the extent and/or location of methylation).
It is, of course, also possible to provide a coating with additional microorganisms (either the same or different as the endophyte that was inoculated). Therefore, according to another embodiment of the present invention, the obtained plant seed containing microorganisms is therefore subjected to a further seed impregnation step.
Once coated with the endophyte formulation, the seeds can be mixed and allowed to dry before germination occurs.
Endophytes Compatible with Agrichemicals
In certain embodiments, the single endophyte strain or the plurality of endophytes is selected on the basis of its compatibility with commonly used agrichemicals. As mentioned earlier, plants, particularly agricultural plants, can be treated with a vast array of agrichemicals, including fungicides, biocides (anti-complex agents), herbicides, insecticides, nematicides, rodenticides, fertilizers, and other agents.
In some cases, it can be important for the single endophyte strain or the plurality of endophytes to be compatible with agrichemicals, particularly those with anticomplex properties, in order to persist in the plant although, as mentioned earlier, there are many such anticomplex agents that do not penetrate the plant, at least at a concentration sufficient to interfere with the endophytes. Therefore, where a systemic anticomplex agent is used in the plant, compatibility of the endophytes to be inoculated with such agents will be an important criterion.
Fungicides
In some embodiments, the control agent is a fungicide. As used herein, a fungicide is any compound or agent (whether chemical or biological) that can either inhibit the growth of a fungus or kill a fungus. In that sense, a “fungicide”, as used herein, encompasses compounds that may be fungistatic or fungicidal. As used herein, the fungicide can be a protectant, or agents that are effective predominantly on the seed surface, providing protection against seed surface-borne pathogens and providing some level of control of soil-borne pathogens. Non-limiting examples of protectant fungicides include captan, maneb, thiram, or fludioxonil.
The fungicide can be a systemic fungicide, which can be absorbed into the emerging seedling and inhibit or kill the fungus inside host plant tissues. Systemic fungicides used for seed treatment include, but are not limited to the following: azoxystrobin, carboxin, mefenoxam, metalaxyl, thiabendazole, trifloxystrobin, and various triazole fungicides, including difenoconazole, ipconazole, tebuconazole, and triticonazole. Mefenoxam and metalaxyl are primarily used to target the water mold fungi Pythium and Phytophthora. Some fungicides are preferred over others, depending on the plant species, either because of subtle differences in sensitivity of the pathogenic fungal species, or because of the differences in the fungicide distribution or sensitivity of the plants. In some embodiments, the endophyte is compatible with at least one of the fungicides selected from the group consisting of: 2-(thiocyanatomethylthio)-benzothiazole, 2-phenylphenol, 8-hydroxyquinoline sulfate, ametoctradin, amisulbrom, antimycin, Ampelomyces quisqualis, azaconazole, azoxystrobin, Bacillus subtilis, benalaxyl, benomyl, benthiavalicarb-isopropyl, benzylaminobenzene-sulfonate (BABS) salt, bicarbonates, biphenyl, bismerthiazol, bitertanol, bixafen, blasticidin-S, borax, Bordeaux mixture, boscalid, bromuconazole, bupirimate, calcium polysulfide, captafol, captan, carbendazim, carboxin, carpropamid, carvone, chloroneb, chlorothalonil, chlozolinate, Coniothyrium minitans, copper hydroxide, copper octanoate, copper oxychloride, copper sulfate, copper sulfate (tribasic), cuprous oxide, cyazofamid, cyflufenamid, cymoxanil, cyproconazole, cyprodinil, dazomet, debacarb, diammonium ethylenebis-(dithiocarbamate), dichlofluanid, dichlorophen, diclocymet, diclomezine, dichloran, diethofencarb, difenoconazole, difenzoquat ion, diflumetorim, dimethomorph, dimoxystrobin, diniconazole, diniconazole-M, dinobuton, dinocap, diphenylamine, dithianon, dodemorph, dodemorph acetate, dodine, dodine free base, edifenphos, enestrobin, epoxiconazole, ethaboxam, ethoxyquin, etridiazole, famoxadone, fenamidone, fenarimol, fenbuconazole, fenfuram, fenhexamid, fenoxanil, fenpiclonil, fenpropidin, fenpropimorph, fentin, fentin acetate, fentin hydroxide, ferbam, ferimzone, fluazinam, fludioxonil, flumorph, fluopicolide, fluopyram, fluoroimide, fluoxastrobin, fluquinconazole, flusilazole, flusulfamide, flutianil, flutolanil, flutriafol, fluxapyroxad, folpet, formaldehyde, fosetyl, fosetyl-aluminium, fuberidazole, furalaxyl, furametpyr, guazatine, guazatine acetates, GY-81, hexachlorobenzene, hexaconazole, hymexazol, imazalil, imazalil sulfate, imibenconazole, iminoctadine, iminoctadine triacetate, iminoctadine tris(albesilate), ipconazole, iprobenfos, iprodione, iprovalicarb, isoprothiolane, isopyrazam, isotianil, kasugamycin, kasugamycin hydrochloride hydrate, kresoxim-methyl, mancopper, mancozeb, mandipropamid, maneb, mepanipyrim, mepronil, mercuric chloride, mercuric oxide, mercurous chloride, metalaxyl, mefenoxam, metalaxyl-M, metam, metam-ammonium, metam-potassium, metam-sodium, metconazole, methasulfocarb, methyl iodide, methyl isothiocyanate, metiram, metominostrobin, metrafenone, mildiomycin, myclobutanil, nabam, nitrothal-isopropyl, nuarimol, octhilinone, ofurace, oleic acid (fatty acids), orysastrobin, oxadixyl, oxine-copper, oxpoconazole fumarate, oxycarboxin, pefurazoate, penconazole, pencycuron, penflufen, pentachlorophenol, pentachlorophenyl laurate, penthiopyrad, phenylmercury acetate, phosphonic acid, phthalide, picoxystrobin, polyoxin B, polyoxins, polyoxorim, potassium bicarbonate, potassium hydroxyquinoline sulfate, probenazole, prochloraz, procymidone, propamocarb, propamocarb hydrochloride, propiconazole, propineb, proquinazid, prothioconazole, pyraclostrobin, pyrametostrobin, pyraoxystrobin, pyrazophos, pyribencarb, pyributicarb, pyrifenox, pyrimethanil, pyroquilon, quinoclamine, quinoxyfen, quintozene, Reynoutria sachalinensis extract, sedaxane, silthiofam, simeconazole, sodium 2-phenylphenoxide, sodium bicarbonate, sodium pentachlorophenoxide, spiroxamine, sulfur, SYP-Z071, SYP-Z048, tar oils, tebuconazole, tebufloquin, tecnazene, tetraconazole, thiabendazole, thifluzamide, thiophanate-methyl, thiram, tiadinil, tolclofos-methyl, tolylfluanid, triadimefon, triadimenol, triazoxide, tricyclazole, tridemorph, trifloxystrobin, triflumizole, triforine, triticonazole, validamycin, valifenalate, valiphenal, vinclozolin, zineb, ziram, zoxamide, Candida oleophila, Fusarium oxysporum, Gliocladium spp., Phlebiopsis gigantea, Streptomyces griseoviridis, Trichoderma spp., (RS)—N-(3,5-dichlorophenyl)-2-(methoxymethyl)-succinimide, 1,2-dichloropropane, 1,3-dichloro-1,1,3,3-tetrafluoroacetone hydrate, 1-chloro-2,4-dinitronaphthalene, 1-chloro-2-nitropropane, 2-(2-heptadecyl-2-imidazolin-1-yl)ethanol, 2,3-dihydro-5-phenyl-1,4-dithi-ine 1,1,4,4-tetraoxide, 2-methoxyethylmercury acetate, 2-methoxyethylmercury chloride, 2-methoxyethylmercury silicate, 3-(4-chlorophenyl)-5-methylrhodanine, 4-(2-nitroprop-1-enyl)phenyl thiocyanateme, ampropylfos, anilazine, azithiram, barium polysulfide, Bayer 32394, benodanil, benquinox, bentaluron, benzamacril; benzamacril-isobutyl, benzamorf, binapacryl, bis(methylmercury) sulfate, bis(tributyltin) oxide, buthiobate, cadmium calcium copper zinc chromate sulfate, carbamorph, CECA, chlobenthiazone, chloraniformethan, chlorfenazole, chlorquinox, climbazole, cyclafuramid, cypendazole, cyprofuram, decafentin, dichlone, dichlozoline, diclobutrazol, dimethirimol, dinocton, dinosulfon, dinoterbon, dipyrithione, ditalimfos, dodicin, drazoxolon, EBP, ESBP, etaconazole, etem, ethirim, fenaminosulf, fenapanil, fenitropan, 5-fluorocytosine and profungicides thereof, fluotrimazole, furcarbanil, furconazole, furconazole-cis, furmecyclox, furophanate, glyodine, griseofulvin, halacrinate, Hercules 3944, hexylthiofos, ICIA0858, isopamphos, isovaledione, mebenil, mecarbinzid, metazoxolon, methfuroxam, methylmercury dicyandiamide, metsulfovax, milneb, mucochloric anhydride, myclozolin, N-3,5-dichlorophenyl-succinimide, N-3-nitrophenylitaconimide, natamycin, N-ethylmercurio-4-toluenesulfonanilide, nickel bis(dimethyldithiocarbamate), OCH, phenylmercury dimethyldithiocarbamate, phenylmercury nitrate, phosdiphen, picolinamide UK-2A and derivatives thereof, prothiocarb; prothiocarb hydrochloride, pyracarbolid, pyridinitril, pyroxychlor, pyroxyfur, quinacetol; quinacetol sulfate, quinazamid, quinconazole, rabenzazole, salicylanilide, S SF-109, sultropen, tecoram, thiadifluor, thicyofen, thiochlorfenphim, thiophanate, thioquinox, tioxymid, triamiphos, triarimol, triazbutil, trichlamide, urbacid, XRD-563, and zarilamide, IK-1140. In still another embodiment, an endophyte that is compatible with an antibacterial compound is used for the methods described herein. For example, the endophyte is compatible with at least one of the antibiotics selected from the group consisting of: Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Tobramycin, Paromomycin, Spectinomycin, Geldanamycin, Herbimycin, Rifaximin, streptomycin, Loracarbef, Ertapenem, Doripenem, Imipenem/Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cefalotin or Cefalothin, Cefalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefepime, Ceftaroline fosamil, Ceftobiprole, Teicoplanin, Vancomycin, Telavancin, Clindamycin, Lincomycin, Daptomycin, Azithromycin, Clarithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Telithromycin, Spiramycin, Aztreonam, Furazolidone, Nitrofurantoin, Linezolid, Posizolid, Radezolid, Torezolid, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Methicillin, Nafcillin, Oxacillin, Penicillin G, Penicillin V, Piperacillin, Penicillin G, Temocillin, Ticarcillin, Amoxicillin/clavulanate, Ampicillin/sulbactam, Piperacillin/tazobactam, Ticarcillin/clavulanate, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Nalidixic acid, Norfloxacin, Ofloxacin, Trovafloxacin, Grepafloxacin, Sparfloxacin, Temafloxacin, Mafenide, Sulfacetamide, Sulfadiazine, Silver sulfadiazine, Sulfadimethoxine, Sulfamethizole, Sulfamethoxazole, Sulfanilimide (archaic), Sulfasalazine, Sulfisoxazole, Trimethoprim-Sulfamethoxazole (Co-trimoxazole) (TMP-SMX), Sulfonamidochrysoidine (archaic), Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline, Clofazimine, Dapsone, Capreomycin, Cycloserine, Ethambutol, Ethionamide, Isoniazid, Pyrazinamide, Rifampicin (Rifampin in US), Rifabutin, Rifapentine, Streptomycin, Arsphenamine, Chloramphenicol, Fosfomycin, Fusidic acid, Metronidazole, Mupirocin, Platensimycin, Quinupristin/Dalfopristin, Thiamphenicol, Tigecycline, Tinidazole, and Trimethoprim.
A fungicide can be a biological control agent, such as a bacterium or fungus. Such organisms may be parasitic to the pathogenic fungi, or secrete toxins or other substances which can kill or otherwise prevent the growth of fungi. Any type of fungicide, particularly ones that are commonly used on plants, can be used as a control agent in a seed composition.
Antibacterial Agents
In some cases, the seed coating composition comprises a control agent which has antibacterial properties. In some embodiments, the control agent with antibacterial properties is selected from the compounds described herein elsewhere. In other embodiments, the compound is Streptomycin, oxytetracycline, oxolinic acid, or gentamicin.
Plant Growth Regulators
The seed coat composition can further comprise a plant growth regulator. In some embodiments, the plant growth regulator is selected from the group consisting of: Abscisic acid, amidochlor, ancymidol, 6-benzylaminopurine, brassinolide, butralin, chlormequat (chlormequat chloride), choline chloride, cyclanilide, daminozide, dikegulac, dimethipin, 2,6-dimethylpuridine, ethephon, flumetralin, flurprimidol, fluthiacet, forchlorfenuron, gibberellic acid, inabenfide, indole-3-acetic acid, maleic hydrazide, mefluidide, mepiquat (mepiquat chloride), naphthaleneacetic acid, N-6-benzyladenine, paclobutrazol, prohexadione (prohexadione-calcium), prohydrojasmon, thidiazuron, triapenthenol, tributyl phosphorotrithioate, 2,3,5-tri-iodobenzoic acid, trinexapac-ethyl and uniconazole. Other examples of antibacterial compounds which can be used as part of a seed coating composition include those based on dichlorophene and benzylalcohol hemi formal (Proxel® from ICI or Acticide® RS from Thor Chemie and Kathon® MK from Rohm & Haas) and isothiazolinone derivatives such as alkylisothiazolinones and benzisothiazolinones (Acticide® MBS from Thor Chemie). Other plant growth regulators that can be incorporated seed coating compositions are described in US 2012/0108431, which is incorporated by reference in its entirety.
Nematicides
Preferred nematode-antagonistic biocontrol agents include ARF18; Arthrobotrys spp.; Chaetomium spp.; Cylindrocarpon spp.; Exophilia spp.; Fusarium spp.; Gliocladium spp.; Hirsutella spp.; Lecanicillium spp.; Monacrosporium spp.; Myrothecium spp.; Neocosmospora spp.; Paecilomyces spp.; Pochonia spp.; Stagonospora spp.; vesicular-arbuscular mycorrhizal fungi, Burkholderia spp.; Pasteuria spp., Brevibacillus spp.; Pseudomonas spp.; and Rhizobacteria. Particularly preferred nematode-antagonistic biocontrol agents include ARF18, Arthrobotrys oligospora, Arthrobotrys dactyloides, Chaetomium globosum, Cylindrocarpon heteronema, Exophilia jeanselmei, Exophilia pisciphila, Fusarium aspergilus, Fusarium solani, Gliocladium catenulatum, Gliocladium roseum, Gliocladium vixens, Hirsutella rhossiliensis, Hirsutella minnesotensis, Lecanicillium lecanii, Monacrosporium drechsleri, Monacrosporium gephyropagum, Myrotehcium verrucaria, Neocosmospora vasinfecta, Paecilomyces lilacinus, Pochonia chlamydosporia, Stagonospora heteroderae, Stagonospora phaseoli, vesicular-arbuscular mycorrhizal fungi, Burkholderia cepacia, Pasteuria penetrans, Pasteuria thornei, Pasteuria nishizawae, Pasteuria ramosa, Pasteuria usage, Brevibacillus laterosporus strain G4, Pseudomonas fluorescens and Rhizobacteria.
Nutrients
In other embodiments, the seed coating composition can comprise a nutrient. The nutrient can be selected from the group consisting of a nitrogen fertilizer including, but not limited to Urea, Ammonium nitrate, Ammonium sulfate, Non-pressure nitrogen solutions, Aqua ammonia, Anhydrous ammonia, Ammonium thiosulfate, Sulfur-coated urea, Urea-formaldehydes, IBDU, Polymer-coated urea, Calcium nitrate, Ureaform, and Methylene urea, phosphorous fertilizers such as Diammonium phosphate, Monoammonium phosphate, Ammonium polyphosphate, Concentrated superphosphate and Triple superphosphate, and potassium fertilizers such as Potassium chloride, Potassium sulfate, Potassium-magnesium sulfate, Potassium nitrate. Such compositions can exist as free salts or ions within the seed coat composition. Alternatively, nutrients/fertilizers can be complexed or chelated to provide sustained release over time.
Rodenticides
Rodents such as mice and rats cause considerable economical damage by eating and soiling planted or stored seeds. Moreover, mice and rats transmit a large number of infectious diseases such as plague, typhoid, leptospirosis, trichinosis and salmonellosis. Anticoagulants such as coumarin and indandione derivatives play an important role in the control of rodents. These active ingredients are simple to handle, relatively harmless to humans and have the advantage that, as the result of the delayed onset of the activity, the animals being controlled identify no connection with the bait that they have ingested, therefore do not avoid it. This is an important aspect in particular in social animals such as rats, where individuals act as tasters. In some embodiments, the seed coating composition comprises a rodenticide selected from the group of substances consisting of 2-isovalerylindan-1,3-dione, 4-(quinoxalin-2-ylamino)benzenesulfonamide, alpha-chlorohydrin, aluminum phosphide, antu, arsenous oxide, barium carbonate, bisthiosemi, brodifacoum, bromadiolone, bromethalin, calcium cyanide, chloralose, chlorophacinone, cholecalciferol, coumachlor, coumafuryl, coumatetralyl, crimidine, difenacoum, difethialone, diphacinone, ergocalciferol, flocoumafen, fluoroacetamide, flupropadine, flupropadine hydrochloride, hydrogen cyanide, iodomethane, lindane, magnesium phosphide, methyl bromide, norbormide, phosacetim, phosphine, phosphorus, pindone, potassium arsenite, pyrinuron, scilliroside, sodium arsenite, sodium cyanide, sodium fluoroacetate, strychnine, thallium sulfate, warfarin and zinc phosphide.
Compatibility
In some embodiments, a single endophyte strain or a plurality of endophytes that are compatible with agrichemicals can be used to inoculate the plants according to the methods described herein. In each case below, each single endophyte strain or each type of endophyte used in a plurality of endophytes can be tested for compatibility on their own or as the plurality. Endophytes that are compatible with agriculturally employed anticomplex agents can be isolated by plating a culture of endophytes on a petri dish comprising an effective concentration of the anticomplex agent, and isolating colonies of endophytes that are compatible with the anticomplex agent. In other embodiments, a plurality of endophytes that are compatible with an anticomplex agent are used for the methods described herein.
In some embodiments, the endophytes of the present invention display tolerance to an agrichemical selected from the group consisting of: Aeris®, Avicta® DuoCot 202, Cruiser®, Syntenta CCB® (A), Clariva®, Albaugh, Dynasty®, Apron®, Maxim®, Gaucho®, Provoke® ST, Syngenta CCB®, Trilex®, WG Purple, WG Silver, Azoxystrobin, Carboxin, Difenoconazole, Fludioxonil, fluxapyroxad, Ipconazole, Mefenoxam, Metalaxyl, Myclobutanil, Penflufen, pyraclostrobin, Sedaxane, TCMTB, Tebuconazole, Thiram, Triadimenol (Baytan®), Trifloxystrobin, Triticonazole, Tolclofos-methyl, PCNB, Abamectin, Chlorpyrifos, Clothianidin, Imidacloprid, Thiamethoxam, and Thiodicarb.
Bactericide-compatible endophytes can also be isolated by selection on liquid medium. The culture of endophytes can be plated on petri dishes without any forms of mutagenesis; alternatively, endophytes can be mutagenized using any means known in the art. For example, endophyte cultures can be exposed to UV light, gamma-irradiation, or chemical mutagens such as ethylmethanesulfonate (EMS), ethidium bromide (EtBr) dichlovos (DDVP, methyl methane sulphonale (MMS), triethylphosphate (TEP), trimethylphosphate (TMP), nitrous acid, or DNA base analogs, prior to selection on fungicide comprising media. Finally, where the mechanism of action of a particular bactericide is known, the target gene can be specifically mutated (either by gene deletion, gene replacement, site-directed mutagenesis, etc.) to generate a plurality of endophytes that are resilient against that particular chemical. It is noted that the above-described methods can be used to isolate endophytes that are compatible with both bacteriostatic and bactericidal compounds.
It will also be appreciated by one skilled in the art that a plant may be exposed to multiple types of anticomplex compounds, either simultaneously or in succession, for example at different stages of plant growth. Where the target plant is likely to be exposed to multiple anticomplex agents, a plurality of endophytes that are compatible with many or all of these agrichemicals can be used to inoculate the plant. Endophytes that are compatible with several agents can be isolated, for example, by serial selection. Endophytes that are compatible with the first agent can be isolated as described above (with or without prior mutagenesis). A culture of the resulting endophytes can then be selected for the ability to grow on liquid or solid media comprising the second agent (again, with or without prior mutagenesis). Colonies isolated from the second selection are then tested to confirm its compatibility to both agents.
Likewise, endophytes that are compatible to biocides (including herbicides such as glyphosate or anticomplex compounds, whether bacteriostatic or bactericidal) that are agriculturally employed can be isolated using methods similar to those described for isolating compatible endophytes. In some embodiments, mutagenesis of the endophytes can be performed prior to selection with an anticomplex agent. In other embodiments, selection is performed on the endophytes without prior mutagenesis. In still another embodiment, serial selection is performed on endophytes: the endophytes are first selected for compatibility to a first anticomplex agent. The isolated compatible endophytes are then cultured and selected for compatibility to the second anticomplex agent. Any colony thus isolated is tested for compatibility to each, or both anticomplex agents to confirm compatibility with these two agents.
Compatibility with an antimicrobial agent can be determined by a number of means known in the art, including the comparison of the minimal inhibitory concentration (MIC) of the unmodified and modified endophytes. Therefore, in some embodiments, the present invention discloses modified endophytes, wherein the endophytes are modified such that they exhibits at least 3 fold greater, for example, at least 5 fold greater, between 5 and 10 fold greater, at least 10 fold greater, between 10 and 20 fold greater, at least 20 fold greater, between 20 and 30 fold greater, at least 30 fold greater or more MIC to an antimicrobial agent when compared with the unmodified endophytes.
In some embodiments, disclosed herein are endophytes with enhanced compatibility to the herbicide glyphosate. In some embodiments, the endophytes have a doubling time in growth medium comprising least 1 mM glyphosate, for example, between 1 mM and 2 mM glyphosate, at least 2 mM glyphosate, between 2 mM and 5 mM glyphosate, at least 5 mM glyphosate, between 5 mM and 10 mM glyphosate, at least 10 mM glyphosate, between 10 mM and 15 mM glyphosate, at least 15 mM glyphosate or more, that is no more than 250%, between 250% and 100%, for example, no more than 200%, between 200% and 175%, no more than 175%, between 175% and 150%, no more than 150%, between 150% and 125%, or no more than 125%, of the doubling time of the endophytes in the same growth medium comprising no glyphosate. In some embodiments, the endophytes have a doubling time in growth medium comprising 5 mM glyphosate that is no more than 150% the doubling time of the endophytes in the same growth medium comprising no glyphosate.
In other embodiments, the endophytes have a doubling time in a plant tissue comprising at least 10 ppm glyphosate, for example, between 10 and 15 ppm, at least 15 ppm glyphosate, between 15 and 10 ppm, at least 20 ppm glyphosate, between 20 and 30 ppm, at least 30 ppm glyphosate, between 30 and 40 ppm, at least 40 ppm glyphosate or more, that is no more than 250%, between 250% and 200%, for example, no more than 200%, between 200% and 175%, no more than 175%, between 175% and 150%, no more than 150%, between 150% and 125%, of the doubling time of the endophytes in a reference plant tissue comprising no glyphosate. In some embodiments, the endophytes have a doubling time in a plant tissue comprising 40 ppm glyphosate that is no more than 150% the doubling time of the endophytes in a reference plant tissue comprising no glyphosate.
The selection process described above can be repeated to identify isolates of endophytes that are compatible with a multitude of agents.
Candidate isolates can be tested to ensure that the selection for agrichemical compatibility did not result in loss of a desired bioactivity. Isolates of endophytes that are compatible with commonly employed agents can be selected as described above. The resulting compatible endophytes can be compared with the parental endophytes on plants in its ability to promote germination.
The agrichemical compatible endophytes generated as described above can be detected in samples. For example, where a transgene was introduced to render the endophytes compatible with the agrichemical(s), the transgene can be used as a target gene for amplification and detection by PCR. In addition, where point mutations or deletions to a portion of a specific gene or a number of genes results in compatibility with the agrichemical(s), the unique point mutations can likewise be detected by PCR or other means known in the art. Such methods allow the detection of the endophytes even if they is no longer viable. Thus, commodity plant products produced using the agrichemical compatible endophytes described herein can readily be identified by employing these and related methods of nucleic acid detection.
The synthetic combinations of the present invention may be confined within an object selected from the group consisting of: bottle, jar, ampule, package, vessel, bag, box, bin, envelope, carton, container, silo, shipping container, truck bed, and case. In a particular embodiment, the population of plant elements is packaged in a bag or container suitable for commercial sale. For example, a bag contains a unit weight or count of the plant elements comprising a plurality of endophytes as described herein, and further comprises a label. In one embodiment, the bag or container contains at least 100 plant elements, between 100 and 1,000 plant elements, 1,000 plant elements, between 1,000 and 5,000 plant elements, for example, at least 5,000 plant elements, between 5,000 and 10,000 plant elements, at least 10,000 plant elements, between 10,000 and 20,000 plant elements, at least 20,000 plant elements, between 20,000 and 30,000 plant elements, at least 30,000 plant elements, between 30,000 and 50,000 plant elements, at least 50,000 plant elements, between 50,000 and 70,000 plant elements, at least 70,000 plant elements, between 70,000 and 80,000 plant elements, at least 80,000 plant elements, between 80,000 and 90,000, at least 90,000 plant elements or more. In another embodiment, the bag or container can comprise a discrete weight of plant elements, for example, at least 1 lb, between 1 and 2 lbs, at least 2 lbs, between 2 and 5 lbs, at least 5 lbs, between 5 and 10 lbs, at least 10 lbs, between 10 and 30 lbs, at least 30 lbs, between 30 and 50 lbs, at least 50 lbs, between 50 and 70 lmbs, at least 70 lbs or more. The label can contain additional information, for example, the information selected from the group consisting of: net weight, lot number, geographic origin of the plant elements, test date, germination rate, inert matter content, and the amount of noxious weeds, if any. Suitable containers or packages include those traditionally used in plant element commercialization. The invention also contemplates other containers with more sophisticated storage capabilities (e.g., with microbiologically tight wrappings or with gas- or water-proof containments).
In some cases, a sub-population of plant elements comprising a plurality of endophytes is further selected on the basis of increased uniformity, for example, on the basis of uniformity of microbial population. For example, individual plant elements of pools collected from individual cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields can be tested for uniformity of microbial density, and only those pools meeting specifications (e.g., at least 80% of tested plant elements have minimum density, as determined by quantitative methods described elsewhere) are combined to provide the agricultural plant element sub-population.
The methods described herein can also comprise a validating step. The validating step can entail, for example, growing some plant elements collected from the inoculated plants into mature agricultural plants, and testing those individual plants for uniformity. Such validating step can be performed on individual plant elements collected from cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields, and tested as described above to identify pools meeting the required specifications.
In some embodiments, methods described herein include planting a synthetic composition described herein. Suitable planters include an air seeder and/or fertilizer apparatus used in agricultural operations to apply particulate materials including one or more of the following, seed, fertilizer and/or inoculants, into soil during the planting operation. Seeder/fertilizer devices can include a tool bar having ground-engaging openers thereon, behind which is towed a wheeled cart that includes one or more containment tanks or bins and associated metering means to respectively contain and meter therefrom particulate materials.
In certain embodiments, a composition described herein may be in the form of a liquid, a slurry, a solid, or a powder (wettable powder or dry powder). In another embodiment, a composition may be in the form of a seed coating. Compositions in liquid, slurry, or powder (e.g., wettable powder) form may be suitable for coating plant elements. When used to coat plant elements, the composition may be applied to the plant elements and allowed to dry. In embodiments wherein the composition is a powder (e.g., a wettable powder), a liquid, such as water, may need to be added to the powder before application to a seed.
In still another embodiment, the methods can include introducing into the soil an inoculum of one or more of the endophyte populations described herein. Such methods can include introducing into the soil one or more of the compositions described herein. The inoculum(s) or compositions may be introduced into the soil according to methods known to those skilled in the art. Non-limiting examples include in-furrow introduction, spraying, coating seeds, foliar introduction, etc. In a particular embodiment, the introducing step comprises in-furrow introduction of the inoculum or compositions described herein.
In one embodiment, plant elements may be treated with composition(s) described herein in several ways but preferably via spraying or dripping. Spray and drip treatment may be conducted by formulating compositions described herein and spraying or dripping the composition(s) onto a seed(s) via a continuous treating system (which is calibrated to apply treatment at a predefined rate in proportion to the continuous flow of seed), such as a drum-type of treater. Batch systems, in which a predetermined batch size of seed and composition(s) as described herein are delivered into a mixer, may also be employed.
In another embodiment, the treatment entails coating plant elements. One such process involves coating the inside wall of a round container with the composition(s) described herein, adding plant elements, then rotating the container to cause the plant elements to contact the wall and the composition(s), a process known in the art as “container coating”. Plant elements can be coated by combinations of coating methods. Soaking typically entails using liquid forms of the compositions described. For example, plant elements can be soaked for about 1 minute to about 24 hours (e.g., for at least 1 min, between 1 and 5 min, 5 min, between 5 and 10 min, 10 min, between 10 and 20 min, 20 min, between 20 and 40 min, 40 min, between 40 and 80 min, 80 min, between 80 min and 3 hrs, 3 hrs, between 3 hrs and 6 hrs, 6 hr, between 6 hrs and 12 hrs, 12 hr, between 12 hrs and 24 hrs, or at least 24 hrs).
Throughout the specification, the word “comprise,” or variations such as “comprises” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
Although the present invention has been described in detail with reference to examples below, it is understood that various modifications can be made without departing from the spirit of the invention. For instance, while the particular examples below may illustrate the methods and embodiments described herein using a specific plant, the principles in these examples may be applied to any agricultural crop. Therefore, it will be appreciated that the scope of this invention is encompassed by the embodiments of the inventions recited herein and the specification rather than the specific examples that are exemplified below.
Example Description
Microbial taxa found in agriculturally relevant communities were identified using high-throughput marker gene sequencing across several crops and numerous varieties of seeds.
Experimental Description
To identify core (i.e. ubiquitous) microbial taxa across seeds, we used high-throughput sequencing of marker genes for bacteria, archaea, and fungi.
Cereals
2 inbred, 10 landrace, 4 teosinte corn seeds, and 4 modern and 4 wild wheat seeds were obtained. Accessions were categorized into landrace, wild, and inbred varieties based on their assessment of improvement status. In order to extract microbial DNA, the seeds were first sterilized in one of four different manners. Some of the seeds were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water. Others were first soaked in sterile, DNA-free water for 48 hours to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water. Others were rinsed in deionized water, immersed in 95% ethanol for 5 seconds, 0.5% NaOCl for 2 minutes, 70% ethanol for 2 minutes, and then washed three times in deionized water for 1 minute each.
Grasslands
To identify microbial taxa from seeds of wild grassland plants, we used high-throughput sequencing of marker genes for bacteria, archaea, and fungi. Seeds from the following wild grassland species were obtained: Big bluestem, Side oats grama, Bicknell's sedge, Short beak sedge, Canada wild rye, Virginia wild rye, June grass, Leafy satin grass, Switch grass, Little bluestem, Prairie cord grass, Prairie dropseed, Nodding wild onion, Meadow/Canada anemone, Common milkweed, Butterfly weed, Whorled milkweed, New England aster, False boneset, Tall coreopsis, Shooting star, Pale purple coneflower, Rattlesnake master, Tall boneset, Purple joe pye weed, Biennial gaure, Prairie smoke, False sunflower, Rough blazing star, Wild bergamot, Horse mint, Common evening primrose, Wild quinine, Beardtongue, Yellow coneflower, Black-eyed Susan, Sweet black-eyed susan, Compass plant, Prairie dock, Stiff goldenrod, Showy goldenrod, Hairy aster, Hoary vervain, Culver's root, Golden alexanders, Dogtooth daisy, Wild blue iris, Pointed broom sedge, Dark green bulrush, and Blue vervain. In order to extract microbial DNA, the seeds were first soaked in sterile, DNA-free water for 48 h to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water.
Fruits and Vegetables
Seeds from 22 different varieties of cabbage were obtained, including broccoli, cauliflower, and collards. In addition, seeds from 8 different varieties of lettuce, 9 varieties of melon (including cantaloupe and honeydew), 7 varieties of onions (including cippolini, shallots, and vidalia), 4 varieties of tomatoes, one variety of toria, 4 varities of turnip, 7 varieties of watermelon, and one variety of yellow sarcon were obtained. For strawberries, the seeds or runner plant tissue of 9 varieties were obtained. For sterilization, the seeds were first soaked in sterile, DNA-free water for 48 h to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water. Strawberry tissue was surface sterilized using 95% ethanol, then rinsed in water.
Oilseed
Seeds from 1 wild and 3 modern cultivars of Brassica Napus were also obtained. In order to extract microbial DNA, the seeds were first soaked in sterile, DNA-free water for 48 h to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes, then rinsed in water.
The seeds or tissues from all of the plants described above were then ground using a mortar and pestle treated with 95% ethanol and RNAse Away (Life Technologies, Inc., Grand Island, N.Y.) to remove contaminant DNA. DNA was extracted from the ground seeds using the PowerPlant Pro DNA extraction kit (Mo Bio Laboratories, Inc., Carlsbad, Calif.) according to the manufacturer's instructions. The surface wash off from certain sterilization treatments of cereal seeds was also collected and DNA was extracted as above.
Marker genes were amplified and sequenced from the extracted DNA. For the bacterial and archaeal analyses, the V4 hypervariable region of the 16S rRNA gene was targeted (primers 515f/806r), and for fungi, the first internal transcribed spacer (ITS1) region of the rRNA operon (primers ITS1f/ITS2r) was targeted. The two marker genes were PCR amplified separately using 35 cycles, and error-correcting 12-bp barcoded primers specific to each sample were used to faciliate combining of samples. To reduce the amplification of chloroplast and mitochondrial DNA, PNA clamps specific to the rRNA genes in these organelles were used. PCR reactions to amplify 16S rRNA genes followed the protocol of Lundberg et al 2013, and those to amplify ITS regions followed the protocol of Fierer et al. 2012. PCR products were quantified using the PicoGreen assay (Life Technologies, Inc., Grand Island, N.Y.), pooled in equimolar concentrations, and cleaned using the UltraClean kit (Mo Bio Laboratories, Inc., Carlsbad, Calif.). Cleaned DNA pools were sequenced on an Illumina MiSeq instrument at the University of Colorado Next Generation Sequencing Facility.
OTU Assignment
For both 16S rRNA and ITS1 sequences, the raw sequence data were reassigned to distinct samples using a custom Python script, and quality filtering and OTU (i.e. operational taxonomic unit) clustering was conducted using the UPARSE pipeline (Edgar 2013). Briefly, a de novo sequence database with representative sequences for each OTU was created using a 97% similarity threshold, and raw reads were mapped to this database to calculate sequence counts per OTU per sample. Prior to creating the database, sequences were quality filtered using an expected error frequency threshold of 0.5 errors per sequence. In addition, sequences were dereplicated and singletons were removed prior to creating the database. OTUs were provided taxonomic classifications using the RDP classifier (Wang et al. 2007) trained with the Greengenes (McDonald et al. 2012) and UNITE (Abarenkov et al. 2010) databases for 16S rRNA and ITS sequences, respectively. To account for differences in the variable number of sequences per sample, each sample was rarefied to 1000 16S rRNA and 1000 ITS sequences per sample. OTUs classified as chloroplasts or mitochondria were discarded prior to rarefaction.
Overall differences in bacterial community composition between the control and inoculated plants were evaluated using non-metric multidimensional scaling based on Bray-Curtis dissimilarities in order to visualize pairwise differences between sample communities. Permutational analysis of variance (PERMANOVA) was used to statistically test the significance of these differences. Analyses were conducted using the vegan package in R (R Core Team 2013). To determine the OTUs contributing to overall differences among crop types, mean relative abundances were calculated for each OTU within each crop type. Only OTUs with a mean relative abundance of 0.1% in either group were included in this analysis.
Results
Across seeds from all plants analyzed herein, a total of 144 bacterial and 145 fungal OTUs were detected and evaluated (Table 3 and Table 4) following stringent sequence quality filtering approach. Among all OTUs, 28 bacterial OTUs and 20 fungal OTUs were found to be core taxa within seeds across plants (Table 1 and Table 2).
Streptomyces
Corynebacterium
Corynebacterium
Sanguibacter
Rathayibacter
caricis
Microbispora
rosea
Rhodococcus
fascians
Kineococcus
Mycoplana
Agrobacterium
Mesorhizobium
Devosia
Sphingomoius
Sphingomonas
wittichii
Novosphingobium
Rhodobacter
Novosphingobium
Sphingomonas
Sphingomonas
Sphingomonas
Methylobacterium
adhaesivum
Azospirillum
Methylobacterium
adhaesivum
Sphingomonas
wittichii
Sphingomonas
Methylobacterium
Agrobacterium
Methylobacterium
adhaesivum
Methylobacterium
Sphingomonas
Sphingomonas
Sphingomonas
Paenibacillus
Leuconostoc
Bacillus
badius
Paenibacillus
Sporosarcina
ginsengi
Bacillus
cereus
Paenibacillus
Paenibacillus
Planomicrobium
Leuconostoc
Carnobacterium
Lactococcus
Bacillus
Enterococcus
Staphylococcus
Paenibacillus
amylolyticus
Exiguobacterium
Bacillus
racemilacticus
Geobacillus
Bacillus
endophyticus
Paenibacillus
Saccharibacillus
kuerlensis
Bacillus
flexus
Sporosarcina
ginsengi
Comamonas
Limnohabitans
Janthinobacterium
Pigmentipbaga
Janthinobacterium
lividum
Polaromonas
Janthinobacterium
Ralstonia
Janthinobacterium
Clostridium
butyricum
Clostridium
intestinale
Thermoanaerobacterium
saccharolyticum
Caldicellulosiruptor
saccharolyticus
Carboxydocella
Hymenobacter
Hymenobacter
Hymenobacter
Hymenobacter
Hymenobacter
Hymenobacter
Chryseobacterium
Chryseobacterium
Chryseobacterium
Chryseobacterium
Chryseobacterium
Yersinia
Enterobacter
hormaechei
Pseudomonas
fragi
Acinetobacter
lwoffii
Stenotrophomonas
maltophilia
Stenotrophomonas
Pseudomonas
veronii
Stenotrophomonas
Pseudomonas
Pseudomonas
Xanthomonas
Serratia
marcescens
Xanthomonas
axonopodis
Halomonas
Pseudomonas
viridiflava
Pseudomonas
Escherichia
coli
Enterobacter
Pantoca
agglomerans
Asteroleplasma
Pedobacter
Pedobacter
Pedobacter
Pedobacter
cryoconitis
Pedobacter
Waitea
circinata var
circinata
Thanatephorus
cucumeris
Alternaria
Cladosporium
Davidiella
tassiana
Lewia
infectoria
Epicoccum
nigrum
Ulocladium
Cladosporium
Phoma
Cladosporium
Phaeosphaeriaceae
Ampelomyces
quisqualis
Dendryphiella
arenaria
Septoria
phalaridis
Aureobasidium
Phaeosphaeriaceae
Phoma
Cladosporium
Alternaria
brassicicola
Phaeosphaeriaceae
Ampelomyces
quisqualis
Leptospora
rubella
Phoma
rhei
Epicoccum
Lewia
infectoria
Parastagonospora
caricis
Cladosporium
Phaeosphaeria
Dothideomycetes
Alternaria
Cladosporium
sphaerospermum
Alternaria
Lewia
infectoria
Phoma
macrostoma
Phoma
Phoma
macrostoma
Phaeosphaeriaceae
Lewia
infectoria
Cochliobolus
Pseudeurotium
Cercospora
nicotianae
Mycosphaerella
punctiformis
Phoma
Cladosporium
Aureobasidium
pullulans
Phoma
Phoma
Phoma
paspali
Phaeosphaeriaceae
Phaeosphaeria
Penicillium
Penicillium
citrinum
Aspergillus
niger
Penicillium
bialowiezense
Eurotium
Penicillium
Penicillium
spinulosum
Emericella
nidulans
Penicillium
bialowiezense
Penicillium
Aspergillus
flavus
Penicillium
Talaromyces
Emericella
nidulans
Rhizopus
oryzae
Erysiphe
cruciferarum
Botrytis
Sporobolomyces
oryzicola
Sporobolomyces
roseus
Sporobolomyces
Sporobolomyces
ruberrimus
Sporobolomyces
roseus
Sporidiobolales
Rhodosporidium
diobovatum
Sporobolomyces
symmetricus
Pichia
fermentans
Hanseniaspora
uvarum
Hanseniaspora
thailandica
Fusarium
Monographella
Fusarium
culmorum
Acremonium
Gibberella
intricans
Gibberella
intricans
Gibberella
baccata
Acremonium
Fusarium
petroliphilum
Gibellulopsis
Monographella
cucumerina
Fusarium
sporotrichioides
Phomopsis
Lasiosphaeriaceae
Chaetomium
globosum
Colletotrichum
acutatum
Acremonium
dichromosporum
Fusarium
sporotrichioides
Monographella
Lectera
longa
Gibberella
intricans
Engyodontium
album
Fusarium
poae
Cryptococcus
Cryptococcus
Cryptococcus
victoriae
Tremellales
Cryptococcus
victoriae
Hannaella
Cryptococcus
wieringae
Cryptococcus
laurentii
Cryptococcus
oeirensis
Cryptococcus
Cryptococcus
oeirensis
Udeniomyces
puniceus
Udeniomyces
pyricola
Bullera
Bullera
unica
Dioszegia
fristingensis
Cystofilobasidium
infirmominiatum
Cryptococcus
oeirensis
Tremellomycetes sp
Hannaella
luteola
Cryptococcus
albidus
Cryptococcus
victoriae
Tremellomycetes sp
Tremellomycetes sp
Cryptococcus
albidus
Hannaella
Wallemia
sebi
Wallemia
muriae
Wallemia
sebi
Wallemia
muriae
Methylobacterium
Sphingomonas
Sphingomonas
Paenibacillus
amylolyticus
Exiguobacterium
Geobacillus
Bacillus
endophyticus
Paenibacillus
Saccharibacillus
kuerlensis
Bacillus
nexus
Janthinobacterium
Janthinobacterium
Pseudomonas
Serratia
marcescens
Xanthomonas
axonopodis
Halomonas
Pseudomonas
Escherichia
coli
Enterobacter
Pantoea
agglomerans
Alternaria
Cladosporium
Davidiella
tassiana
Lewia
infectoria
Alternaria
Alternaria
Penicillium
Sporobolomyces
oryzicola
Sporobolomyces
roseus
Sporobolomyces
Sporobolomyces
roseus
Fusarium
Gibberella
intricans
Gibberella
intricans
Cryptococcus
Cryptococcus
Cryptococcus
victoriae
Cryptococcus
victoriae
In order to better understand the role played by core seed-derived endophytic microbes in improving the vigor, general health and stress resilience of agricultural plants, we initiated a systematic screen to isolate and characterize endophytic microbes from seeds and tissues of commercially significant agricultural plants.
Seeds from diverse types of cereals, fruits, vegetables, grasses, oilseed, and other seeds were acquired and screened for cultivatable microbes, as described below. Culturable microbes (i.e., SYM strains) belonging to the same OTUs as the core OTUs described in Table 1 and Table 2 were isolated and identified.
Isolation of Bacteria and Fungi from the Interior of Seeds
Isolation of fungi and bacteria (including endophytes) from the interior of surface-sterilized seeds was performed using techniques known in the art. Surface sterilized seeds were ground, diluted in liquid media, and the suspension used to inoculate solid media plates. These were incubated under different conditions at room temperature.
Experiment Description
Approximately fifty surface-sterilized seeds were transferred aseptically to a sterile blender and ground. The ground seeds were resuspended in 50 mL of sterile R2A broth, and incubated for 4h at room temperature. Ten 1 mL aliquots of the seed homogenates were collected and centrifuged, their supernatants discarded and the pellets gently resuspended in 1 mL of sterile 0.05 phosphate buffer; 0.5 mL of 50% glycerol is added to each of five tubes. These were stored at −80 C for further characterization. The remaining aliquots were diluted down twice in hundred-fold dilutions to 10-4. 100 microliters of the 1, 10-2, and 10-4 dilutions were used to inoculate three Petri dishes containing the following media in order to isolate of bacteria and/or fungi:
Tryptic Soy agar
R2A agar
Potato dextrose agar
Sabouraud Agar
Other Media Depending on Target Microorganism
The plates were divided into three sets comprising each media type and incubated in different environments. The first set was incubated aerobically, the second under anaerobic conditions, and the third under microaerophilic conditions and all were inspected daily for up to 5 days. 1-2 individual colonies per morphotype were isolated and streaked for purity onto fresh plates of the same media/environment from which the microorganism was isolated. Plates were incubated at room temperature for 2-5 days. After an isolate grew it was streaked once more onto a fresh plate of the same media to ensure purity and incubated under the same environmental conditions.
From the second streaked plate, isolates were stored in Tryptic soy broth+15% glycerol at −80° C. for further characterization, by first scraping 2-3 colonies (about 10 μL) from the plate into a cryogenic tube containing 1.5 mL of the above-mentioned media and gently resuspending the cells. Alternatively, isolates were propagated in specialized media as recommended for the particular taxon of microorganism. The microbes obtained represent those that live in the seeds of the plant accession.
Isolation of Bacteria and Fungi from Plant Interior Tissues
Isolation of fungi and bacteria (including endophytes) from surface-sterilized plant tissues was performed using techniques known in the art. Surface sterilized plant tissues were ground, diluted in liquid media, and then this suspension was used to inoculate solid media plates. These were incubated under different environmental conditions at room temperature.
Experiment Description
Approximately fifty grams of surface-sterilized plant tissue were transferred aseptically to a sterile blender and ground. The ground tissue was resuspended in 50 mL of sterile R2A broth, and incubated for 4h at room temperature. Ten 1 mL aliquots of the plant tissue homogenates were collected and centrifuged, their supernatants discarded and the pellets gently resuspended in 1 mL of sterile 0.05 phosphate buffer. 0.5 mL of 50% Glycerol was added to each of five tubes. These were stored at −80° C. for possible further characterization. The remaining aliquots were diluted down twice in hundred-fold dilutions to 10-4. One hundred microliters of the 1, 10-2, and 10-4 dilutions were used to inoculate three Petri dishes containing the following media in order to isolate of bacteria and/or fungi:
Tryptic Soy agar
R2A agar
Potato dextrose agar
Sabouraud Agar
Other Media Depending on Target Microorganism
Plates were divided into three sets comprising each media type and incubated in different environments. The first set was incubated aerobically, the second under anaerobic conditions, and the third under microaerophilic conditions and all were inspected daily for up to 5 days. 1-2 individual colonies per morphotype were isolated and streaked for purity onto fresh plates of the same media/environment from which the microorganism was isolated. Plates were incubated at room temperature for 2-5 days. After an isolate grew it was streaked once more onto a fresh plate of the same media to ensure purity and incubated under the same environmental conditions.
From the second streaked plate, isolates were stored in Tryptic soy broth+15% glycerol at −80° C. for further characterization, by first scraping 2-3 colonies (about 10 μL) from the plate into a cryogenic tube containing 1.5 mL of the above-mentioned media and gently resuspending the cells. Alternatively, isolates were propagated in specialized media as recommended for the particular taxon of microorganism.
Isolation of Bacteria and Fungi from Plant or Seed Surfaces
To collect phyllosphere, rhizosphere, or spermosphere material for culturing of microbes, unwashed shoot, roots or seeds were shaken free/cleaned of any attached soil and stuffed into sterile 50 mL Falcon tubes. To these, 10 mL of sterile 0.1 M sodium phosphate buffer was added and shaken, followed by 5 minutes of sonication to dislodge microbes from plant surfaces, with the resulting cloudy or muddy wash collected in a separate 15 mL Falcon tube. 100 μL of this microbe filled wash was directly spread onto agar plates or nutrient broth for culturing and enrichment, or it was further diluted with sterile 0.1 M sodium phosphate buffer by 10×, 100×, 1,000×, 10,000× and even 100,000×, before microbial culturing on agar plates or nutrient broth. Glycerol stock preparations of the plant surface wash solution were made at this point by mixing 1 mL of the soil wash solution and 0.5 mL of sterile, 80% glycerol, flash freezing the preparation in a cryotube dipped in liquid nitrogen, and storing at −80° C. Nutrient broth inoculated with a mixture of plant surface bacteria forms a stable, mixed community of microbes which was used in plant inoculation experiments described herein, subcultured in subsequent broth incubations, or spread on agar plates and separated into individual colonies which were tested via methods described herein.
Characterization of Fungal and Bacterial Isolates
Characterization of fungi and bacteria isolated from surface-sterilized or non-sterilized plant or seed tissues was performed using techniques known in the art. These techniques take advantage of differential staining of microorganisms, morphological characteristics of cells, spores, or colonies, biochemical reactions that provide differential characterization, and DNA amplification and sequencing of diagnostic regions of genes, among other methods.
Experimental Description
Isolates of bacteria and/or fungi isolated as described herein (including endophytic bacteria and fungi) were categorized into three types: bacterial isolates, fungal isolates, and unknown isolates (since yeast colonies can resemble bacterial colonies in some cases) based on colony morphology, formation of visible mycelia, and/or formation of spores. To determine if an unknown isolate was bacterial or fungal, microscopic analysis of the isolates was performed. Some of the analyses known to the art to differentiate microorganisms include, but are not limited to: the 10% KOH test, positive staining with Lactophenol cotton blue, Gram staining, and growth on media with selective agents. The distinguishing features observed by these tests are relative cell size (yeast size is much larger than bacterial size), formation of hyphae and spores (filamentous bacteria form smaller hyphae than fungi, and do not form structures containing spores), or growth under selection agents (most bacteria can grow in the presence of antifungal compounds like nystatin, while most fungi cannot; likewise, most fungi are unaffected by the presence of broad-spectrum antibiotics like chloramphenicol and spectinomycin).
To identify the isolates, DNA sequence analysis of conserved genomic regions like the ribosomal DNA loci was performed. To obtain DNA to perform PCR amplifications, some cellular growth from solid media (approximately 5-10 μL) was resuspended in 30 μL of sterile Tris/EDTA buffer (pH 8.0). Samples were heated to 98° C. for 10 minutes followed by cooling down to 4° C. for 1 minute in a thermocycler. This cycle was repeated twice. Samples were then centrifuged at ˜13,000 RCF for 1-5 minutes and used as DNA template for PCR reactions. Below is a series of exemplary primer combinations used to identify isolates to a genus level.
GTGCCAGCMGCCGCGGTAA-
3′)(SEQ ID NO: 453)
AGAGTTTGATCCTGGCTCAG-
3′)(SEQ ID NO: 455)
TCCGTAGGTGAACCTGCGG-
3′)(SEQ ID NO: 457)
TACCTGGTTGATQCTGCCAGT-
3′)(SEQ ID NO: 459)
CTTGGTCATTTAGAGGAAGTA
A-3′)(SEQ ID NO: 461)
GGAAGTAAAAGTCGTAACAA
GG-3′)(SEQ ID NO: 463)
mycorrhizae) genome
CCCTAYGGGGYGCASCAG-3′)
AGRRTTYGATYMTGGYTYAG-
3′)(SEQ ID NO: 471)
AACMGGATTAGATACCCKG-
3′)(SEQ ID NO: 473)
To decrease background noise due to the non-specific binding of primers to DNA, the thermocycler was programmed for a touchdown-PCR, which increased specificity of the reaction at higher temperatures and increased the efficiency towards the end by lowering the annealing temperature. Exemplary conditions for performing Touchdown PCR are shown in Table 6.
PCR reactions were purified to remove primers, dNTPs, and other components by methods known in the art, for example by the use of commercially available PCR clean-up kits.
The resulting sequences were aligned as query sequences with the publicly available databases GenBank nucleotide, RDP, UNITE and PlutoF. RDP was specifically compiled and used for bacterial 16s classification. UNITE and PlutoF were specifically compiled and used for identification of fungi. In all the cases, the strains were identified to species level if their sequences were more than 95% similar to any identified accession from all databases analyzed. When the similarity percentage was between 90-97%, the strain was classified at genus, family, order, class, subdivision or phylum level depending on the information displayed in databases used. Isolates with lower similarity values (from 30-90%) were classified as “unknown” or “uncultured” depending on the information displayed after BLAST analysis. To compliment the molecular identification, fungal taxa were confirmed by inducing sporulation on PDA or V8 agar plates and using reported morphological criteria for identification of fruiting bodies structure and shape. Bacterial taxa were confirmed by using reported morphological criteria in specialized differential media for the particular taxon, or by biochemical differentiation tests, as described by the Bergey's Manual of Systematic Microbiology (Whitman, William B., et al., eds. Bergey's Manual® of systematic bacteriology. Vols. 1-5. Springer, 2012).
Culture-Independent Characterization of Fungal and Bacterial Communities in Seeds or Plants
To understand the diversity of culturable and unculturable microbial (e.g., bacterial and fungal) taxa that reside inside of seeds or plants of agriculturally-relevant cultivars, landraces, and ancestral wild varieties, microbial DNA was extracted from surface sterilized seed or plant parts, as described herein, followed by amplification of conserved genomic regions, for example the ribosomal DNA loci. Amplified DNA represented a “snapshot” of the full microbial community inside seeds or plants.
Experimental Description
To obtain microbial DNA from seeds, plants or plant parts, the seeds, plants or plant parts were surface sterilized under aseptic conditions as described herein. Microbial DNA from seeds, plants, or plant parts was extracted using methods known in the art, for example using commercially available Seed-DNA or plant DNA extraction kits, or the following method.
A sample of each kind of seed or plant tissue is placed in a cold-resistant container and 10-50 mL of liquid nitrogen is applied. The seeds or plant tissues are then macerated to a powder.
Genomic DNA is extracted from each seed or plant tissue preparation, following a chloroform:isoamyl alcohol 24:1 protocol (Sambrook et al. 1989).
Fungal-specific primers were used to amplify the ITS (Internal Transcribed Spacer) region of nuclear ribosomal DNA. Bacterial specific primers were used to amplify region of the 16s rDNA gene of the bacterial genome. Sequences obtained through NGS platforms were analyzed against databases, such as the ones mentioned herein.
Exemplary primer pairs used for this analysis are listed in Table 5.
As an alternative to next generation sequencing, Terminal Restricition Fragment Length Polymorphism, (TRFLP) can be performed. Group specific, fluorescently labeled primers are used to amplify diagnostic regions of genes in the microbial population. This fluorescently labeled PCR product is cut by a restriction enzyme chosen for heterogeneous distribution in the PCR product population. The enzyme cut mixture of fluorescently labeled and unlabeled DNA fragments is then submitted for sequence analysis on a Sanger sequence platform such as the Applied Biosystems 3730 DNA Analyzer.
Determination of the Plant Pathogenic Potential of Microbial Isolates
Since a microbe that confers positive traits to one cultivar might be a pathogenic agent in a different plant species, a general assay was used to determine the pathogenic potential of microbial isolates. Surface and interior-sterilized seeds are germinated in water agar, and once the plant develops its first set of leaves, are inoculated with the isolate. Alternatively, the plants are inoculated as seeds. For inoculation the microbial isolate is grown on solid media, and inoculated into a plant or onto a seed via any of the methods described herein. Plants are allowed to grow under ideal conditions for 2-3 weeks and any pathogenic effect of the introduced microbe is evaluated against uninoculated control plants.
Identification of Culturable Microbial Isolates that Correspond to Core OTUs
To accurately characterize the isolated microbial endophytes, colonies were submitted for marker gene sequencing, and the sequences were analyzed to provide taxonomic classifications. Among the cultured microbes (SYM strains), those with at least 97% 16S or ITS sequence similarity to OTUs of Table 1 and Table 2 were identified. Exemplary isolated microbes that correspond to core OTUs are listed in Table 7 (bacteria) and Table 8 (fungi).
This example describes the ability of synthetic compositions comprising plant seeds and a single endophyte strain or a plurality of endophyte strains described herein, to confer one or more benefits to a host plant. Among other things, this Example describe the ability of endophytes (e.g., bacterial and fungal endophytes described herein) to confer beneficial traits on a variety of host plants, including but not limited to, dicots (e.g., soy, peanut) and monocots (e.g., corn, soy, wheat, cotton, sorghum), and combinations thereof. Endophyte-inoculated seeds (e.g., seeds described herein) were tested under water-limited conditions (e.g., drought stress) in seed germination assays and seedling root vigor assays to test whether one or more endophytes confer an increase in tolerance to these stresses. These growth tests were performed using growth assays (e.g., germination assays and seedling root vigor assays) on sterile filter papers. Seeds were treated either with a single bacterial or fungal strain, or with a combination of two bacterial or two fungal strains. In some embodiments, seeds were treated with a combination of at least one bacterial and at least one fungal strain.
Experimental Description
Growth & Scale-Up of Bacteria for Inoculation
Each bacterial endophyte was streaked out onto 20% Tryptic Soy Agar, forming a lawn on regular Petri dishes (9 cm in diameter). Once the bacteria grew to high density, which happened after one or two days depending on the bacterial growth rate, a plate per bacterial strain was scraped with the aid of a sterile loop (filling the entire hole of the loop and producing a droplet of bacterial biomass of about 20 mg). The bacteria collected in this way were transferred into 1 ml of sterile 50 mM Phosphate Buffer Saline (PBS) in a microcentrifuge tube and fully resuspended by vortexing for ˜20 sec at maximum speed. This method achieves highly concentrated (˜0.5-1 optical density, corresponding to about 108 CFU/mL) and viable bacteria pre-adapted to live coating a surface.
Growth & Scale-Up of Fungi for Inoculation
Fungal isolates were grown from a frozen stock on Petri dishes containing potato dextrose agar and the plates were incubated at room temperature for about a week. After mycelia and spore development, four agar plugs (1 cm in diameter) were used to inoculate erlenmeyers containing 150 ml of potato dextrose broth. Liquid cultures were grown at room temperature and agitation on an orbital shaker at 115 rpm for 4 days. Then, the cultures were transferred to 50 ml sterile test tubes with conical bottoms. Mycelium mats were disrupted by pulse sonication at 75% setting and 3 pulses of 20 seconds each, using a Fisher Scientific sonicator (Model FB120) with a manual probe (CL-18). The sonicated cultures were used in the same manner as the bacterial suspensions for seed inoculation.
Surface Sterilization of Seeds
Un-treated seeds (e.g., soy seeds or wheat seeds) were sterilized overnight with chlorine gas as follows: 200 g of seeds were weighed and placed in a 250 mL glass bottle. The opened bottle and its cap were placed in a dessicator jar in a fume hood. A beaker containing 100 mL of commercial bleach (8.25% sodium hypochlorite) was placed in the dessicator jar. Immediately prior to sealing the jar, 3 mL of concentrated hydrochloric acid (34-37.5%) were carefully added to the bleach. The sterilization was left to proceed for 17-24h. After sterilization, the bottle was closed with its sterilized cap, and reopened in a sterile flow hood. The opened bottle was left in the sterile hood for a couple hours to air out the seeds and remove chlorine gas leftover. The bottle was then closed and the seeds stored at room temperature in the dark until use.
Preparation of Synthetic Compositions Comprising Plant Seeds and Endophytes
The following procedure was used to coat seeds with a plurality of fungal endophyte inocula for planting in greenhouse and field trials. First, 3% Sodium alginate (SA) was prepared and autoclaved in the following manner. Erlenmeyer flasks were filled with the appropriate amount of deionized water and warmed to about 50 degrees C. on a heat plate with agitation using a stirring bar. SA powder was poured slowly into the water until it all dissolved. The solution was autoclaved (121° C. @15 PSI for 30 minutes). Talcum powder was autoclaved in dry cycle (121° C. @15 PSI for 30 minutes) and aliquoted in Ziploc bags or 50 ml falcon tubes at a ratio of 15 g per kg of seed to be treated for formulation controls and 10 g per kg of seed for actual treatments.
The next day, seeds were treated with either powdered or liquid formulations.
For powdered formulations, 10 g per kg of seed was allocated to the seeds to be treated, according to the following procedure. Seeds were placed in large plastic container. 16.6 ml of 2% SA per Kg of seeds to be treated were poured on the seeds. The container was covered and shaken slowly in orbital motion for about 20 seconds to disperse the SA. Endophyte powder was mixed with an equal amount of talcum powder. The mix of endophytes and talc was added on top of the seeds, trying to disperse it evenly. The container was covered and seeds are shaken slowly in orbital motion for about 20 seconds. 13.3 ml of Flo-rite per kg of seed to be treated was poured on the seeds. Seeds were shaken again, slowly and in orbital motion.
For liquid formulations, 8.5 mL per seed was allocated to the seeds to be treated, according to the following procedure. Seeds were placed in large plastic container. 8.3 ml of 2% SA per kg of seed and the same amount of bacterial culture (8.3 ml per kg of seed) was poured on the seeds. The container was covered and shaken slowly in orbital motion for about 20 seconds to disperse the SA. 15 g of talcum powder per kg of seed was added, trying to disperse it evenly. The container was covered and seeds were shaken slowly in orbital motion for about 20 seconds. 13.3 ml of Flo-rite per kg of seed to be treated are poured on the seeds. Seeds were shaken again, slowly and in orbital motion. For soy seeds, 10 μL of sodium alginate and inoculum were applied for every one gram of seeds. For wheat seeds, the amount of SA and bacterial suspension or fungal inoculum was adjusted to 15 ml/kg to account for the larger surface to volume ratio of these small seeds.
Testing for Germination Enhancement Under Drought Stress
Polyethylene glycol (PEG) is an inert, water-binding polymer with a non-ionic and virtually impermeable long chain that accurately mimics drought stress under dry-soil conditions. The higher the concentration of PEG, the lower the water potential achieved, thus inducing higher water stress in a watery medium. To determine germination enhancement in seeds, the interiors of which are colonized by microbial strains, the effect of osmotic potential on germination is tested at a range of water potential representative of drought conditions following Perez-Fernandez et al. [J. Environ. Biol. 27: 669-685 (2006)]. The range of water potentials simulates those that are known to cause drought stress in a range of cultivars and wild plants, (˜0.05 MPa to −5 MPa). The appropriate concentration of polyethylene glycol (6000) required to achieve a particular water potential was determined following Michel and Kaufmann (Plant Physiol., 51: 914-916 (1973)) and further modifications by Hardegree and Emmerich (Plant Physiol., 92, 462-466 (1990)). The final equation used to determine amounts of PEG is: Ψ=0.130 [PEG]2 T−13.7 [PEG] 2; where the osmotic potential (Ψ) is a function of temperature (T).
Soy Seedling Germination Assay in Drought Conditions
For each SYM tested in the germination assay, ten (10) SYM-coated soy seeds were placed on a 150 mm Petri plate that contained a single heavy germination paper (SD5-¼ 76# heavy weight seed germination paper, Anchor Paper Co., St. Paul, Minn.). To each petri plate, 10 mL 8% polyethylene glycol (PEG 6000) was added for germination screening assays in drought conditions. Plates were covered and incubated at in the dark at 22° Celcius and 60% relative humidity for four days for bacterial SYM strains) or five days for fungal SYM strains. All experiments were done in triplicate under sterile conditions. Seedlings were scored based on germination percentage relative to formulation only and non-treated seedling controls at the end of the incubation period. Exemplary soy germination results under drought conditions are shown in Table A.
Soy Seedling Root Vigor Assay in Drought Conditions
For each SYM tested in the root vigor assay, ten (10) soy seeds were placed equidistant to each other on moistened heavy weight germination paper sandwiches. Each layer of the germination paper was pre-soaked in 25 mL of sterile distilled water. The germination paper sandwich was rolled, taped using surgical tape, placed in glass bottles and incubated at 22° Celcius with 60% relative humidity in dark for four (4) days to allow seed germination. On day five (5), bottle lids were removed and seed samples were placed in a growth chamber set to 25° Celcius, 70% RH, 250-300 microEinsten light for 12 hours and 18° Celcius, 60% RH dark 12 hours for five (5) days. Placement of bottles were randomized daily to reduce any positional effect throughout the incubation period. At the end of the experiment, each soy seedling was measured for total root length and compared relative to formulation only and non-treated seedling controls. Exemplary soy root vigor results under drought conditions are shown in Table B.
Wheat Seedling Germination Assay in Drought Conditions
For each SYM tested, 25 uL of sonicated, 7-day old fungal culture or 3-day old bacteria culture was added into 15 mL of semi-solid solution [12.5% polyethylene glycol (PEG 6000) and 0.3% of agar] pre-aliquoted in a 90 mm deep well petri dish. After adding the SYM biomass, the petri dishes were horizontally shaken for even distribution of SYM biomass. Fifteen (15) surface-steriled wheat seeds were placed onto each petri dish. Plates were covered and incubated in the dark at 24° Celcius and 60% relative humidity for three days in a Conviron chamber. All experiments were done in triplicate under sterile conditions. Seedlings were scored by counting the number of germinated seedlings per dish and the performance of each SYM normalized as germination percentage relative to formulation only and non-treated seedling controls at the end of the incubation period. Exemplary wheat germination results under drought conditions are shown in Table C.
Wheat Seedling Root Vigor Assay in Drought Conditions
For each SYM tested, twelve (12) SYM-coated wheat seeds were placed onto a 125 mm filter paper pre-wet with 5 mL of 12.5% polyethylene glycol (PEG 6000). The seeds were arranged in a circular formation and with embryo facing toward the center of the filter paper. Plates were covered and incubated in the dark at 24° Celcius and 60% relative humidity for three days in a Conviron chamber. All experiments were done in triplicate under sterile conditions. At the end of the incubation period, images were taken for each plate and root length were measured (in pixel) on the images using ImageJ and the pixel was finally converted into cm based on an internal standard. The performance of each SYM was normalized as root length percentage relative to formulation only and non-treated seedling controls. Exemplary wheat root vigor results under drought conditions are shown in Table D.
Discussion
Plant vigor and improved stress resilience are important components of providing fitness to a plant in an agricultural setting. These were measured in germination assays and seedling root vigor assays to test the improvement on plant phenotype as conferred by microbial inoculation. The collection of seed-derived endophytes produced a measurable response in soy and wheat when inoculated as compared to non-inoculated controls, as shown in Table A, Table B, Table C and Table D. For example, most of the strains tested were found to produce a favorable phenotype in any of the measured multiple parameters such as germination efficiency, root length, or shoot length, suggesting that the strains play an intimate role modulating and improving plant vigor and conferring stress resilience to the host plant. The stress responses in the strain collection can be seen by the ability of a subgroup to confer a beneficial response under different conditions such as water stress. These can be applicable to products for arid and marginal lands. In a large proportion of cases for the tested strains, the beneficial effect was measurable in several crops. In one aspect of the invention, it is understood that beneficial strains described herein are capable of colonizing multiple varieties and plant species.
This Example describes the ability of synthetic compositions comprising plant seeds and a single endophyte strain or a plurality of endophyte strains described herein, to confer beneficial traits to a host plant. Among other things, this Example describe the ability of endophytes (e.g., bacterial and fungal endophytes described herein) to confer beneficial traits on a variety of host plants, including but not limited to, dicots (e.g., soy, peanuts) and monocots (e.g., corn, soy, wheat, cotton, sorghum), and combinations thereof. Endophyte-inoculated seeds (e.g., seeds described herein) are tested under normal conditions, biotic stress, heat stress, cold stress, high salt stress, soil with high metal content, and combinations thereof, in seed germination assays and seedling root vigor assays to test whether one or more endophytes confer an increase in tolerance to one or more stresses. Growth tests are performed using growth assays (e.g., germination assays and seedling root vigor assays) on sterile filter papers. In some embodiments, seeds are treated either with a single bacterial or fungal strain, or with a combination of two bacterial or two fungal strains. In some embodiments, seeds are treated with two or more bacterial or fungal strains. In some embodiments, seeds are treated with a combination of at least one bacterial and at least one fungal strain.
Growth and scale-up of bacteria and fungi for inoculation, surface sterilization of seeds, and seed coating are performed as described herein.
Testing for Germination Enhancement in Normal Conditions
Standard Germination Tests are used to assess the ability of the endophyte to enhance the seeds' germination and early growth. Briefly, 400 seeds (e.g., seeds described herein) are coated with one or more endophytes described herein, and are placed in between wet brown paper towels (8 replicates with 50 seeds each). An equal number of seeds are treated with formulation only. Paper towels are placed on top of 1×2 feet plastic trays and maintained in a growth chamber set at 25° C. and 70% humidity for 7 days. Seedlings are scored based on germination percentage relative to formulation only and non-treated seedling controls
Testing for Germination Enhancement Under Biotic Stress
A modification of the method developed by Hodgson [Am. Potato. J. 38: 259-264 (1961)] is used to test germination enhancement in microbe-colonized seeds under biotic stress. Biotic stress is understood as a concentration of inocula in the form of cell (bacteria) or spore suspensions (fungus) of a known pathogen for a particular crop (e.g., Pantoea stewartii or Fusarium graminearum for Zea mays L.). Briefly, for each level of biotic stress, 400 seeds (e.g., seeds described herein), the interiors of which are colonized by microbial strains, and 400 seed controls (lacking the microbial strains), are placed in between brown paper towels: 8 replicates with 50 seeds each for each treatment (microbe-colonized and control). Each one of the replicates is placed inside a large petri dish (150 mm in diameter). The towels are then soaked with 10 mL of pathogen cell or spore suspension at a concentration of 104 to 108 cells/spores per mL. Each level corresponds with an order of magnitude increment in concentration (thus, 5 levels). The petri dishes are maintained in a growth chamber set at 25° C. and 70% humidity for 7 days. The proportion of seeds that germinate successfully is compared between the seeds coming from microbe-colonized plants with those coming from controls for each level of biotic stress.
Testing for Germination Enhancement in Heat Conditions
Standard Germination Tests are used to determine if a microbe colonizing the interior of a seed protects maize against heat stress during germination. Briefly, 400 seeds (e.g, seeds described herein), the interiors of which are colonized by microbial strains are placed in between wet brown paper towels (8 replicates with 50 seeds each). An equal number of seeds obtained from control plants that lack the microbe is treated in the same way. The paper towels are placed on top of 1×2 ft plastic trays and maintained in a growth chamber set at 16:8 hour light:dark cycle, 70% humidity, and at least 120 g/m2/s light intensity for 7 days. A range of high temperatures (from 35° C. to 45° C., with increments of 2 degrees per assay) is tested to assess the germination of microbe-colonized seeds at each temperature. The proportion of seeds that germinate successfully is compared between the seeds coming from microbe-colonized plants and those coming from controls.
Testing for Germination Enhancement in Cold Conditions
Standard Germination Tests are used to determine if a microbe colonizing the interior of a seed protects maize against cold stress during germination. Briefly, 400 seeds (e.g., seeds described herein), the interiors of which are colonized by microbial strains are placed in between wet brown paper towels (8 replicates with 50 seeds each). An equal number of seeds obtained from control plants that lack the microbe is treated in the same way. The paper towels are placed on top of 1×2 ft plastic trays and maintained in a growth chamber set at 16:8 hour light:dark cycle, 70% humidity, and at least 120 g/m2/s light intensity for 7 days. A range of low temperatures (from 0° C. to 10° C., with increments of 2 degrees per assay) is tested to assess the germination of microbe-colonized seeds at each temperature. The proportion of seeds that germinate successfully is compared between the seeds coming from microbe-colonized plants and those coming from controls.
Testing for Germination Enhancement in High Salt Concentrations
Germination experiments are conducted in 90 mm diameter petri dishes. Replicates consist of a Petri dish, watered with 10 mL of the appropriate solution and 20 seeds floating in the solution. 400 seeds (e.g., seeds described herein), the interiors of which are colonized by microbial strains, and 400 seed controls (lacking the microbial strains) are tested in this way (40 petri dishes total). To prevent large variations in salt concentration due to evaporation, dishes are sealed with parafilm and the saline solutions are renewed weekly by pouring out the existing saline solution in the petri dish and adding the same amount of fresh solution. A range of saline solutions (100-500 mM NaCl) is tested for to assess the germination of microbe-colonized seeds at varying salt levels. Petri dishes are maintained in a growth chamber set at 25° C., 16:8 hour light:dark cycle, 70% humidity, and at least 120 μE/m2/s light intensity. The proportion of seeds that germinates successfully after two weeks is compared between the seeds coming from inoculated plants and those coming from controls.
Testing for Germination Enhancement in Soils with High Metal Content
Standard Germination Tests are used to determine if a microbe colonizing the interior of a seed protects maize against stress due to high soil metal content during germination. Briefly, 400 seeds (e.g., seeds described herein), the interiors of which are colonized by microbial strains, are placed in between wet brown paper towels (8 replicates with 50 seeds each). An equal number of seeds obtained from control plants that lack the microbe (microbe-free) is treated in the same way. The paper towels are placed on top of 1×2 ft plastic trays with holes to allow water drainage. The paper towels are covered with an inch of sterile sand. For each metal to be tested, the sand needs to be treated appropriately to ensure the release and bioavailability of the metal. For example, in the case of aluminum, the sand is watered with pH 4.0+˜1 g/Kg soil Al+3 (−621 uM). The trays are maintained in a growth chamber set at 25° C. and 70% humidity for 7 days. The proportion of seeds that germinates successfully is compared between the seeds coming from microbe-colonized plants and those coming from controls.
Testing for Growth Promotion in Growth Chamber in Normal Conditions
Soil is made from a mixture of 60% Sunshine Mix #5 (Sun Gro; Bellevue, Wash., USA) and 40% vermiculite. To determine if a particular microbe colonizing the interior of seeds is capable of promoting plant growth under normal conditions, 24 pots are prepared in two 12-pot no-hole flat trays with 28 grams of dry soil in each pot, and 2 L of filtered water is added to each tray. The water is allowed to soak into the soil and the soil surface is misted before seeding. For each seed-microbe combination, 12 pots are seeded with 3-5 seeds colonized by the microbe and 12 pots are seeded with 3-5 seeds lacking the microbe (microbe-free plants). The seeded pots are covered with a humidity dome and kept in the dark for 3 days, after which the pots are transferred to a growth chamber set at 25° C., 16:8 hour light:dark cycle, 70% humidity, and at least 120 μE/m2/s light intensity. The humidity domes are removed on day 5, or when cotyledons are fully expanded. After removal of the domes, each pot is irrigated to saturation with 0.5× Hoagland's solution, then allowing the excess solution to drain. Seedlings are then thinned to 1 per pot. In the following days, the pots are irrigated to saturation with filtered water, allowing the excess water to drain after about 30 minutes of soaking, and the weight of each 12-pot flat tray is recorded weekly. Canopy area is measured at weekly intervals. Terminal plant height, average leaf area and average leaf length are measured at the end of the flowering stage. The plants are allowed to dry and seed weight is measured. Significance of difference in growth between microbe-colonized plants and controls lacking the microbe is assessed with the appropriate statistical test depending on the distribution of the data at p<0.05.
Testing for Growth Promotion in Growth Chamber Under Biotic Stress
Soil is made from a mixture of 60% Sunshine Mix #5 (Sun Gro; Bellevue, Wash., USA) and 40% vermiculite. To determine if a particular microbe colonizing the interior of seeds is capable of promoting plant growth in the presence of biotic stress, 24 pots are prepared in two 12-pot no-hole flat trays with 28 grams of dry soil in each pot, and 2 L of filtered water is added to each tray. The water is allowed to soak into the soil before planting. For each seed-microbe combination test, 12 pots are seeded with 3-5 seeds colonized by the microbe and 12 pots are seeded with 3-5 seeds lacking the microbe (microbe-free plants). The seeded pots are covered with a humidity dome and kept in the dark for 3 days, after which the pots are transferred to a growth chamber set at 25° C., 16:8 hour light:dark cycle, 70% humidity, and at least 120 μF/m2/s light intensity. The humidity domes are removed on day 5, or when cotyledons are fully expanded. After removal of the domes, each pot is irrigated to saturation with 0.5× Hoagland's solution, allowing the excess solution to drain. Seedlings are then thinned to 1 per pot. In the following days, the pots are irrigated to saturation with filtered water, allowing the excess water to drain after about 30 minutes of soaking.
Several methods of inoculation are used depending on the lifestyle of the pathogen. For leaf pathogens (e.g., Pseudomonas syringeae or Colletotrichum graminicola), a suspension of cells for bacteria (108 cell/mL) or spores for fungi (107 spores/mL) is applied with an applicator on the adaxial surface of each of the youngest fully expanded leaves. Alternatively for fungal pathogens that do not form conidia easily, two agar plugs containing mycelium (˜4 mm in diameter) are attached to the adaxial surface of each of the youngest leaves on each side of the central vein. For vascular pathogens (e.g., Pantoea stewartii or Fusarium moniliforme), the suspension of cells or spores is directly introduced into the vasculature (5-10 μL) through a minor injury inflected with a sterile blade. Alternatively, the seedlings can be grown hydroponically in the cell/spore or mycelium suspension. To test the resilience of the plant-microbe combination against insect stresses, such as thrips or aphids, plants are transferred to a specially-designated growth chamber containing the insects. Soil-borne insect or nematode pathogens are mixed into or applied topically to the potting soil. In all cases, care is taken to contain the fungal, insect, nematode or other pathogen and prevent release outside of the immediate testing area.
The weight of each 12-pot flat tray is recorded weekly. Canopy area is measured at weekly intervals. Terminal plant height, average leaf area and average leaf length are measured at the cease of flowering. The plants are allowed to dry and seed weight is measured. Significance of difference in growth between microbe-colonized plants and controls lacking the microbe is assessed with the appropriate statistical test depending on the distribution of the data at p<0.05.
Auxin Production Assay
Auxin is an important plant hormone, which can promote cell enlargement and inhibit branch development (meristem activity) in above ground plant tissues, while below ground it has the opposite effect, promoting root branching and growth. Interestingly, plant auxin is manufactured above ground and transported to the roots. It thus follows that plant, and especially root inhabiting microbes which produce significant amounts of auxin, will be able to promote root branching and development even under conditions where the plant reduces its own production of auxin. Such conditions can exist for example when soil is flooded and roots encounter an anoxic environment.
Indole containing IAA is able to generate a pinkish chromophore under acidic conditions in the presence of ferric chloride. For auxin measurement, 1 μl of overnight-grown cultures of endophytic bacterial strains were inoculated into 750 μl of R2A broth supplemented with L-TRP (5 mM) in 2-mL 96 well culture plates. The plates were sealed with a breathable membrane and incubated at 23° C. with constant shaking at 200 rpm for 4 days. To measure auxin production by fungal strains, 3 μl of 5-day old liquid fungal cultures were inoculated into 1 ml R2A broth supplemented with L-TRP (5 mM) in 24-well culture plates. The plates were sealed with breathable tape and incubated at 23° C. with constant shaking at 130 rpm for 4 days. After 4 days, 100 μL of each culture was transferred to a 96 well plate. 25 μL of Salkowski reagent (1 mL of FeCl3 0.5 M solution to 50 mL of 35% HClO4) was added into each well and the plates were incubated in the dark for 30 minutes before taking picture and measuring 540 nm absorption using the SpectraMax M5 plate reader (Molecular Devices). Dark pink halos around colonies are visualized in the membrane by background illumination using a light table.
Endophytes were screened for their ability to produce auxins as possible root growth promoting agents. Four replicates were performed for each strain assayed. Exemplary auxin production results for endophytes belonging to core OTUs are presented below in Table E, Table F, and Table G.
Acetoin and Diacetyl Production Assay
For acetoin measurements, microbial strains were cultured as described above in R2A broth supplemented with 5% glucose. After 4 days, 100 μL of each culture was transferred to a 96 well plate and mixed with 25 μL Barritt's Reagents A and B and 525 nm absorption was measured. Barritt's Reagents A and B were prepared by mixing 5 g/L creatine mixed 3:1 (v/v) with freshly prepared alpha-naphthol (75 g/L in 2.5 M sodium hydroxide). After 15 minutes, plates are scored for red or pink colouration against a copper coloured negative control. Four replicates were performed for each strain assayed. Exemplary acetoin production results for endophytes belonging to core OTUs are presented below in Table E, Table F, and Table G.
Siderophore Production Assay
To ensure no contaminating iron is carried over from previous experiments, all glassware is deferrated with 6 M HCl and water prior to media preparation. For siderophore measurements, microbial strains were cultured as described above in R2A broth. After 3 days of incubation at 25° C., plates are overlaid with 0-CAS overlay. Again using the cleaned glassware, 1 liter of 0-CAS overlay is made by mixing 60.5 mg of Chrome azurol S (CAS), 72.9 mg of hexadecyltrimethyl ammonium bromide (HDTMA), 30.24 g of finely crushed Piperazine-1,4-bis-2-ethanesulfonic acid (PIPES) with 10 mL of 1 mM FeCl3.6H2O in 10 mM HCl solvent. The PIPES had to be finely powdered and mixed gently with stirring (not shaking) to avoid producing bubbles, until a dark blue colour is achieved. Melted 1% agarose is then added to pre-warmed O-CAS just prior pouring the overlay in a proportion of 1:3 (v/v). After 15 minutes, colour change is scored by looking for purple halos (catechol type siderophores) or orange colonies (hydroxamate siderophores). Four replicates were performed for each strain assayed.
In many environments, iron is a limiting nutrient for growth. A coping mechanism which many microbes have developed is to produce and secrete iron chelating compounds called siderophores which often only that particular species or strain has the means to re-uptake and interact with to release the bound iron, making it available for metabolism. A fringe effect of siderophore production and secretion is that a siderophore secreting microbes can remove all the bio-available iron in its environment, making it difficult for a competing species to invade and grow in that micro-environment.
Siderophore production by microbes on a plant surface or inside a plant may both show that a microbe is equipped to grow in a nutrient limited environment, and perhaps protect the plant environment from invasion by other, perhaps undesirable microbes. Exemplary siderophore production results for endophytes belonging to core OTUs are presented below in Table E, Table F, and Table G.
Escherichia sp.
Escherichia sp.
Burkholderia sp.
Enterobacter sp.
Agrobacterium sp.
Brevundimonas sp.
Leptosphaerulina sp
Bacillus sp.
Acinetobacter sp.
Acremonium sp.
Penicillium sp.
Acremonium sp.
Exiguobacterium sp.
Stenotrophomonas sp.
Methylobacterium sp.
Sphingomonas sp.
Stenotrophomonas sp.
Luteibacter sp.
Agrobacterium sp.
Curtobacterium sp.
Pantoea sp.
Fusarium sp.
Aspergillus sp.
Alternaria sp.
Phoma sp.
Rhizopus sp.
Phoma sp.
Cladosporium sp.
Phoma sp.
Alternaria sp.
Fusarium sp.
Fusarium sp.
Penicillium sp.
Assay for Growth on Nitrogen Free LGI Media
All glassware is cleaned with 6 M HCl before media preparation. A new 96 deep-well plate (2 mL well volume) is filled with 250 ul/well of sterile LGI broth [per L, 50 g Sucrose, 0.01 g FeCl3-6H2O, 0.8 g K3PO4, 0.2 g MgSO4-7H2O, 0.002 g Na2MoO4-2H2O, pH 7.5]. Microbes are inoculated into the 96 wells simultaneously with a flame-sterilized 96 pin replicator. The plate is sealed with a breathable membrane, incubated at 28° C. without shaking for 3 days, and OD600 readings taken with a 96 well plate reader.
A nitrogen fixing plant associated bacterium is able theoretically to add to the host's nitrogen metabolism, and the most famous beneficial plant associated bacteria, rhizobia, are able to do this within specially adapted organs leguminous plant grows for them to be able to do this. In some embodiments, seed associated microbes described herein are able to fix nitrogen in association with developing seedling, regardless of whether they colonize the plant's surfaces or interior, and thereby add to the plant's nitrogen nutrition.
ACC Deaminase Activity Assay
Microbes are assayed for growth with ACC as their sole source of nitrogen. Prior to media preparation all glassware is cleaned with 6 M HCl. A 2 M filter sterilized solution of ACC (#1373A, Research Organics, USA) is prepared in water. 1 μl/mL of this is added to autoclaved LGI broth (see above), and 1 mL aliquots are placed in a new 96 well plate. The plate is sealed with a breathable membrane, incubated at 25° C. with gentle shaking for 5 days, and OD600 readings taken. Only wells that are significantly more turbid than their corresponding nitrogen free LGI wells are considered to display ACC deaminase activity.
Plant stress reactions are strongly impacted by the plant's own production and overproduction of the gaseous hormone ethylene. Ethylene is metabolized from its precursor 1-aminocyclopropane-1-carboxylate (ACC) which can be diverted from ethylene metabolism by microbial and plant enzymes having ACC deaminase activity. As the name implies, ACC deaminase removes molecular nitrogen from the ethylene precursor, removing it as a substrate for production of the plant stress hormone and providing for the microbe a source of valuable nitrogen nutrition.
Mineral Phosphate Solubilization Assay
Microbes are plated on tricalcium phosphate media. This is prepared as follows: 10 g/L glucose, 0.373 g/L NH4NO3, 0.41 g/L MgSO4, 0.295 g/L NaCl, 0.003 FeCl3, 0.7 g/L Ca3HPO4 and 20 g/L Agar, pH 6, then autoclaved and poured into 150 mm plates. After 3 days of growth at 25° C. in darkness, clear halos are measured around colonies able to solubilize the tricalcium phosphate.
RNAse Activity Assay
1.5 g of torula yeast RNA (#R6625, Sigma) is dissolved in 1 mL of 0.1 M Na2HPO4 at pH 8, filter sterilized and added to 250 mL of autoclaved R2A agar media which is poured into 150 mm plates. The bacteria from a glycerol stock plate are inoculated using a flame-sterilized 96 pin replicator, and incubated at 25° C. for 3 days. On day three, plates are flooded with 70% perchloric acid (#311421, Sigma) for 15 minutes and scored for clear halo production around colonies.
Pectinase Activity Assay
Adapting a previous protocol 0.2% (w/v) of citrus pectin (#76280, Sigma) and 0.1% triton X-100 are added to R2A media, autoclaved and poured into 150 mm plates. Bacteria are inoculated using a 96 pin plate replicator. After 3 days of culturing in the darkness at 25° C., pectinase activity is visualized by flooding the plate with Gram's iodine. Positive colonies are surrounded by clear halos.
Cellulase Activity Assay
Adapting a previous protocol, 0.2% carboxymethylcellulose (CMC) sodium salt (#C5678, Sigma) and 0.1% triton X-100 are added to R2A media, autoclaved and poured into 150 mm plates. Bacteria are inoculated using a 96 pin plate replicator. After 3 days of culturing in the darkness at 25° C., cellulose activity is visualized by flooding the plate with Gram's iodine. Positive colonies are surrounded by clear halos.
Antibiosis Assay
Bacteria or fungi are inoculated using a 96 pin plate replicator onto 150 mm Petri dishes containing R2A agar, then grown for 3 days at 25° C. At this time, colonies of either E. coli DH5a (gram negative tester), Bacillus subtillus ssp. Subtilis (gram positive tester), or yeast strain AH109 (fungal tester) are resuspended in 1 mL of 50 mM Na2HPO4 buffer to an OD600 of 0.2, and 30 μl of this is mixed with 30 mL of warm LB agar. This is quickly poured completely over a microbe array plate, allowed to solidify and incubated at 37° C. for 16 hours. Antibiosis is scored by looking for clear halos around microbial colonies.
BIOLOG Characterization of Endophyte Substrate Metabolism
In addition to the auxin, acetoin, and siderophore assays described above, endophytes described herein were characterized for their ability to metabolize a variety of carbon substrates. Liquid cultures of microbe were first sonicated to achieve homogeneity. 1 mL culture of each strain was harvested by centrifugation for 10 minutes at 4500 RPM and subsequently washed three times with sterile distilled water to remove any traces of residual media. Microbial samples were resuspended in sterile distilled water to a final OD590 of 0.2. Measurements of absorbance were taken using a SpectraMax M microplate reader (Molecular Devices, Sunnyvale, Calif.).
Sole carbon substrate assays were done using BIOLOG Phenotype MicroArray (PM) 1 and 2A MicroPlates (Hayward, Calif.). An aliquot of each bacterial cell culture (2.32 mL) were inoculated into 20 mL sterile IF-0a GN/GP Base inoculating fluid (IF-0), 0.24 mL 100× Dye F obtained from BIOLOG, and brought to a final volume of 24 mL with sterile distilled water. Negative control PM1 and PM2A assays were also made similarly minus bacterial cells to detect abiotic reactions. An aliquot of fungal culture (0.05 mL) of each strain were inoculated into 23.95 mL FF-IF medium obtained from BIOLOG. Microbial cell suspensions were stirred in order to achieve uniformity. One hundred microliters of the microbial cell suspension was added per well using a multichannel pipettor to the 96-well BIOLOG PM1 and PM2A MicroPlates that each contained 95 carbon sources and one water-only (negative control) well.
MicroPlates were sealed in paper surgical tape (Dynarex, Orangeburg, N.Y.) to prevent plate edge effects, and incubated stationary at 24° C. in an enclosed container for 70 hours. Absorbance at 590 nm was measured for all MicroPlates at the end of the incubation period to determine carbon substrate utilization for each strain and normalized relative to the negative control (water only) well of each plate (Garland and Mills, 1991; Barua et al., 2010; Siemens et al., 2012; Blumenstein et al., 2015). The bacterial assays were also calibrated against the negative control (no cells) PM1 and PM2A MicroPlates data to correct for any biases introduced by media on the colorimetric analysis (Borglin et al., 2012). Corrected absorbance values that were negative were considered as zero for subsequent analysis (Garland and Mills, 1991; Blumenstein et al., 2015) and a threshold value of 0.1 and above was used to indicate the ability of a particular microbial strain to use a given carbon substrate (Barua et al., 2010; Blumenstein et al., 2015). Additionally, bacterial MicroPlates were visually examined for the irreversible formation of violet color in wells indicating the reduction of the tetrazolium redox dye to formazan that result from cell respiration (Garland and Mills, 1991). Fungal PM tests were measured as growth assays and visual observation of mycelial growth in each well was made. Exemplary BIOLOG substrate utilization by endophytes described herein are presented in Table H, Table I, Table J, Table K, Table L, Table M, Table N, Table O, Table P, Table Q, Table R, Table S, Table T, and Table U.
Twelve SYM strains of culturable bacteria belonging to OTUs present in landrace and wild corn and wheat seeds that are present in lower levels in modern corn and wheat seeds were tested for sole carbon substrate utilization using BIOLOG PM1 and PM2A MicroPlates. The most utilized substrates by these strains are L-alanine, L-galactonic-acid-γ-lactone, maltose, maltotriose, D-cellobiose, gentiobiose, and D-glucosamine. The least utilized substrates by these strains are L-asparagine, L-glutamine, D-aspartic acid, tricarballylic acid, L-serine, L-fucose, 1,2-propanediol, D-threonine, L-threonine, succinic acid, fumaric acid, bromo succinic acid, D-L-a-glycerol phosphate, a-keto-butyric acid, a-hydroxy butyric acid, acetoacetic acid, glucuronamide, glycolic acid, mono methyl succinate, glyoxylic acid, phenylethyl-amine, and L-malic acid.
The substrates most utilized by a large number of the culturable bacteria belonging to core OTUs are mucic acid, L-arabinose, L-galactonic-acid-γ-lactone, N-acetyl-D-glucosamine, maltose, maltotriose, and D-cellobiose. These core bacteria did not utilize sedoheptulosan, oxalic acid, 2-hydroxy benzoic acid, quinic acid, mannan, L-methionine, N-acetyl-D-glucosaminitol, sorbic acid, 2,3-butanone, succinic acid, phenylethyl-amine, and 3-hydroxy 2-butanone as sole carbon sources. Results for the culturable fungi belonging to core OTUs indicate that D-sorbitol, L-arabinose, N-acetyl-D-glucosamine, glycerol, tween 40, tween 80, D-gluconic acid, L-proline, a-D-glucose, D-trehalose, maltose, lactulose, D-mannose, D-mannitol, sucrose, D-cellobiose, L-glutamic acid, L-ornithine, and L-pyroglutamic acid are carbon substrates that are utilized by a large number of the endophyte strains examined here. The carbon substrate that seemed to be not utilized by fungi in these assays is 2-deoxy-D-ribose. All other substrates could be utilized as a sole carbon nutrient by at least one fungal SYM strain.
Characterization of Culturable Microbes: Substrate Use
Additional BIOLOG analyses were performed. For additional biolog analyses, microbes were cultivated in three biological replicates for each strain. Each bacterium was initially streaked on Reasoner's 2A (R2A) agar, distinct CFUs selected and cultured in 6 mL R2A broth for 4 days. Fungal strains were streaked on potato dextrose (PD) agar and individual plugs containing spores and mycelial tissues were used to initiate growth in 6 mL PD broth for 6 days. All strains were grown with agitation at room temperature. One mL liquid cultures of each sample were harvested by centrifugation for 15 minutes at 4500 RPM and subsequently washed at least four times with sterile distilled water to remove any traces of residual media. Additionally, fungal cultures were first sonicated to achieve homogeneity after the growth period. Microbes were resuspended in 500 μL sterile distilled water and measurements of absorbance were taken using a SpectraMax M microplate reader (Molecular Devices, Sunnyvale, Calif.).
Sole carbon substrate assays were done using BIOLOG Phenotype MicroArray (PM) 1 and 2A MicroPlates (Hayward, Calif.). An aliquot of each bacterial cell culture corresponding to a final absorbance of 0.2 were inoculated into 20 mL sterile IF-0a GN/GP Base inoculating fluid (IF-0), 0.24 mL 100× Dye B obtained from BIOLOG, and brought to a final volume of 24 mL with sterile distilled water in 50 mL Falcon tubes. Negative control PM1 and PM2A assays were done similarly for each dye minus bacterial cells to detect abiotic reactions. Fungal culture of each strain with a final absorbance of 0.2 (˜63% turbidity) was brought to a final volume of 24 mL with the FF-IF medium (BIOLOG). Microbial cell suspensions in tubes were gently shaken to achieve uniformity. One hundred microliters of the microbial cell suspension was added per well using a multichannel pipettor to the 96-well BIOLOG PM1 and PM2A MicroPlates that each contained 95 carbon sources and one water-only (negative control) well. All steps were performed under sterile conditions using biosafety cabinets.
MicroPlates were sealed in paper surgical tape (Dynarex, Orangeburg, N.Y.) to minimize plate edge effects, and incubated stationary at 24° C. in an enclosed container for a minimum of 72 hours. Absorbance at 590 nm was measured for all MicroPlates at least every 24 hours or at a defined interval (72 hours post-assay) to determine carbon substrate utilization for each strain. Measurements were normalized relative to the negative control (water only) well of each plate (Garland and Mills, 1991; Barua et al., 2010; Siemens et al., 2012; Blumenstein et al., 2015). Bacterial MicroPlates were also visually examined for the irreversible formation of violet color in wells indicating the reduction of the tetrazolium redox dye to formazan that result from cell respiration (Garland and Mills, 1991), and assessed against the negative control (no cells) PM1 and PM2A MicroPlates to detect any abiotic color changes potentially introduced by the medium and/or dyes (Borglin et al., 2012). Normalized absorbance values that were negative were considered as zero for subsequent analysis (Garland and Mills, 1991; Blumenstein et al., 2015) and a threshold value of 0.1 and above was used to indicate the ability of a particular microbial strain to use a given carbon substrate (Barua et al., 2010; Blumenstein et al., 2015). Fungal PM tests were measured as growth assays and visual observation of mycelial growth in each well was made.
Seventeen (17) bacterial SYM strains and sixteen (16) fungal SYM strains were tested in biological triplicate for sole carbon substrate utilization using BIOLOG PM1 and PM2A MicroPlates. The most utilized substrates overall by these strains are a-D-Glucose, Arbutin, b-Methyl-D-Galactoside, b-Methyl-D-Glucoside, D-Arabitol, D-Cellobiose, Dextrin, D-Fructose, D-Galactose, D-Gluconic acid, D-Glucosamine, Dihydroxyacetone, DL-Malic acid, D-Mannitol, D-Mannose, D-Melezitose, D-Melibiose, D-Raffinose, D-Ribose, D-Trehalose, D-Xylose, g-Amino-N-Butyric acid, g-Cyclodextrin, Gelatin, Gentiobiose, Glycogen, i-Erythritol, L-Alanine, L-Arabinose, L-Galactonic acid-g-Lactone, L-Histidine, L-Proline, L-Rhamnose, Maltitol, Maltose, Maltotriose, N-Acetyl-D-Glucosamine, Palatinose, Pectin, Salicin, Stachyose, Sucrose, and Turanose. Overall, these strains did not utilize 2,3-Butanediol, 2,3-Butanedione, b-Methyl-D-Glucuronic acid, b-Methyl-D-Xyloside, Capric acid, D,L-Carnitine, Glucuronamide, Itaconic acid, L-Methionine, N-Acetyl-D-Glucosaminitol, N-Acetyl-Neuraminic acid, Phenylethylamine, or sec-Butylamine as sole carbon sources.
The most utilized substrates by these seventeen bacterial endophytes are 2-Deoxy-D-Ribose, a-D-Glucose, a-Methyl-D-Galactoside, Arbutin, b-Methyl-D-Galactoside, b-Methyl-D-Glucoside, D-Arabitol, D-Cellobiose, Dextrin, D-Fructose, D-Galactose, D-Galacturonic acid, D-Gluconic acid, D-Glucosamine, Dihydroxyacetone, DL-Malic acid, D-Mannitol, D-Mannose, D-Melibiose, D-Raffinose, D-Ribose, D-Trehalose, D-Xylose, Gelatin, Gentiobiose, L-Arabinose, L-Aspartic acid, L-Galactonic acid-g-Lactone, L-Glutamic acid, L-Glutamine, L-Histidine, L-Ornithine, L-Proline, Maltose, Maltotriose, N-Acetyl-D-Glucosamine, Pyruvic acid, Salicin, Sucrose, and Turanose. These bacterial endophytes did not utilize 1,2-Propanediol, 2,3-Butanediol, 2,3-Butanedione, 2-Aminoethanol, 2-Hydroxybenzoic acid, 3-Hydroxy-2-butanone, 3-Methylglucose, 4-Hydroxybenzoic acid, Acetamide, Acetoacetic acid, a-Hydroxybutyric acid, a-Hydroxyglutaric acid-g-Lactone, a-Ketobutyric acid, a-Keto-Valeric acid, a-Methyl-D-Glucoside, a-Methyl-D-Mannoside, b-D-Allose, b-Methyl-D-Glucuronic acid, b-Methyl-D-Xyloside, Capric acid, Caproic acid, Citraconic acid, Citramalic acid, D,L-Carnitine, D,L-Octopamine, d-Amino Valeric acid, D-Aspartic acid, D-Melezitose, D-Serine, D-Tagatose, D-Tartaric acid, D-Threonine, g-Cyclodextrin, g-Hydroxybutyric acid, Glucuronamide, Glycine, Glycolic acid, Glyoxylic acid, Hydroxy-L-Proline, i-Erythritol, Inulin, Itaconic acid, L-Arabitol, L-Fucose, L-Glucose, L-Homoserine, L-Methionine, L-Sorbose, L-Threonine, L-Valine, m-Tartaric acid, N-Acetyl-D-Glucosaminitol, N-Acetyl-D-Mannosamine, N-Acetyl-Neuraminic acid, Oxalic acid, Phenylethylamine, Sebacic acid, sec-Butylamine, Sedoheptulosan, Stachyose, Tricarballylic acid, Tyramine, or Xylitol as sole carbon sources.
The most utilized substrates by these sixteen fungal endophytes are a-D-Glucose, a-Methyl-D-Glucoside, Amygdalin, Arbutin, b-Methyl-D-Galactoside, b-Methyl-D-Glucoside, D-Arabitol, D-Cellobiose, Dextrin, D-Fructose, D-Galactose, D-Mannitol, D-Mannose, D-Melezitose, D-Melibiose, D-Raffinose, D-Trehalose, D-Xylose, g-Amino-N-Butyric acid, g-Cyclodextrin, Gentiobiose, Glycogen, i-Erythritol, L-Alanine, L-Arabinose, L-Arginine, L-Ornithine, L-Rhamnose, Maltitol, Maltose, Maltotriose, N-Acetyl-D-Glucosamine, Palatinose, Pectin, Putrescine, Quinic acid, Salicin, Stachyose, Sucrose, and Turanose. These fungal endophytes did not utilize 2,3-Butanediol, 2,3-Butanedione, 2-Deoxy-D-Ribose, b-Methyl-D-Glucuronic acid, b-Methyl-D-Xyloside, Capric acid, D,L-Carnitine, D-Galactonic acid-g-Lactone, D-Glucose-1-Phosphate, Glucuronamide, Itaconic acid, L-Methionine, N-Acetyl-D-Galactosamine, N-Acetyl-D-Glucosaminitol, N-Acetyl-L-Glutamic acid, N-Acetyl-Neuraminic acid, Phenylethylamine, or sec-Butylamine as sole carbon sources.
This Example describes the ability of synthetic compositions comprising plant seeds a single endophyte strain or a plurality of endophyte strains described herein, to confer beneficial traits to a host plant. Among other things, this Example describe the ability of endophytes (e.g., endophytes described herein) to confer beneficial traits on a variety of host plants by modulating the transcriptome of the host plant. In some embodiments, host plants include, but are not limited to, dicots (e.g., soy, peanuts) and monocots (e.g., plants described herein, e.g., corn, soy, wheat, cotton, sorghum), and combinations thereof.
Among other things, this Example describes surprising and unexpected modulations in the transcriptome of a host plant in response to synthetic compositions comprising plant seeds and a beneficial fungal endophyte strain, compared to a neutral fungal strain of the same genus.
Plant Seedling
Untreated soy seeds were surface sterilized using chlorine fumes. Briefly, Erlenmyer flasks containing seeds and a bottle with 100 mL of fresh bleach solution were placed in a desiccation jar located in a fume hood. Immediately prior to closing the lid of the desiccation jar, 3 mL hydrochloric acid was carefully pipetted into the bleach. Sterilization was done for 17 hours, and upon completion the flasks with seeds were removed, sealed in sterile foil, and opened in a sterile biosafety cabinet or laminar flow hood for subsequent work.
Soy Seedling Assay
Seeds were first coated with 3% sodium alginate, and gently shaken to obtain homogenous coverage. SYM strain fungal inoculum grown as described previously was added to the sodium alginate coated seeds and gently mixed. For every one gram of seeds, 10 μL of sodium alginate and inoculum were applied. Formulation only soybean seeds were coated with 3% sodium alginate and fresh PDB.
Ten seeds were placed on a 150 mm Petri plate that contained a single heavy germination paper (SD5-¼ 76# heavy weight seed germination paper, Anchor Paper Co., St. Paul, Minn.) added with 10 mL 8% polyethylene glycol (PEG 6000). Plates were incubated at 22° Celsius in dark and 60% relative humidity for five days. Seedlings were harvested at the end of the incubation period and stored in −80° C. until total RNA isolation using standard extraction method using TriReagent (Sigma-Aldrich, St. Louis, Mo., USA) and purification with RNeasy Mini Kit (Qiagen, Hilden, Germany). All experiments (beneficial, neural, formulation) were done in triplicate under sterile conditions resulting in a total of nine samples.
Soy RNA-SEQ
Initial quality control was performed using Agilent Bioanalyzer and Tapestation.
polyA cDNA Preparation
For each of the 9 soybean RNAs, polyA cDNA was prepared using a Clontech cDNA synthesis kit. Briefly, after initial QC passed, 500 ng of total RNA was used to generate 1-2 ug of cDNA using Clontech SMARTer PCR cDNA kit (Clontech Laboratories, Inc., Mountain View, Calif. USA, catalog #634925). Manufacturer's instructions were strictly followed to perform polyA cDNA construction; 14 PCR cycles were performed.
Fragmentation
Briefly, cDNA was fragmented using Bioruptor (Diagenode, Inc., Denville, N.J. USA). Fragmented cDNAs were tested for size distribution and concentration using an Agilent Bioanalyzer 2100 or Tapestation 2200 and Nanodrop.
DNA Library Construction
For each the 9 soybean samples, Illumina libraries were made from qualified fragmented cDNA using Beckman Coulter SPRlworks HT Reagent Kit (Beckman Coulter, Inc. Indianapolis, Ind. USA, catalog #B06938) on the Biomek FXp liquid handler.
Beckman Biomek FXp (Biomek 6000, Beckman Coulter) fully automatic workstation and a Beckman HT library kit were used to generate fragment libraries. The instructions were strictly followed to perform library construction. Briefly, after fragmentation the ends were repaired and ‘A’ bases were added to the 3′ end of the fragments. Adapters were then ligated to both ends. The adaptor-ligated templates were further purified using Agencourt AMPure SPRI beads. The adaptor-ligated library was amplified by ligation-mediated PCR which consisted of 10 cycles of amplification, and the PCR product was purified using Agencourt AMPure SPRI beads again. After the library construction procedure was completed, QC was performed using a Nanodrop and Agilent Bioanalyzer to ensure the library quality and quantity.
RNA Sequencing
Sequencing was performed on an Illumina HiSeq 2500, using Rapid run v2.0 chemistry which generated paired-end reads of 106 nucleotides (nt.) according to Illumina manufacturer's instructions. The initial data analysis was started directly on the HiSeq 2500 System during the run. The HiSeq Control Software 2.2.58 in combination with RTA 1.18.64 (real time analysis) performed the initial image analysis and base calling. In addition, bcl2fastq1.8.4 generated and reported run statistics. Data was analyzed using FASTQC (Babraham Institute, Cambridge, UK) comprising the sequence information which was used for all subsequent bioinformatics analyses. Sequences were de-multiplexed according to the 6 bp index code with 1 mismatch allowed.
Analysis
Differential analysis of the soy transcriptome in the presence of neutral vs beneficial fungi was performed using standard RNA-seq analysis methods. Briefly, mapped reads overlapping with exon features were counted and aggregated by gene. These gene-level counts were analyzed with the DESeq2 R package, available through the Bioconductor software repository. All possible comparisons of the three groups (control, neutral, beneficial) were performed, and the false discovery rate method was used to adjust p-values for multiple testing. High- and low-confidence differential gene lists were created using false discovery rate thresholds of 0.1 and 0.05, and log 2 fold-change thresholds of 1 and 2, respectively. Set differences were extracted, e.g., genes differentially expressed in beneficial vs control but not in neutral vs control. Gene Ontology (GO) enrichment analysis was performed for all differential gene lists.
Genes that are modulated in soybean in response to treatment with a beneficial endophyte include those involved in a variety of plant processes, such as plant defense (including responses to chitin and wounding), stress responses (including salt stress, water deprivation, cold, ozone, heat, osmotic), defense against oxidative stress (oxidation-reduction process, monooxygenase activity, oxidation-reduction process, ion binding, nitric oxide). For example, expression of genes involved in the following processes were modulated: cell wall modification, defense response, oxidation-reduction process, biological process, regulation of transcription, metabolic process, glucosinolate biosynthetic process, response to karrikin, protein phosphorylation, protein folding, response to chitin, proteolysis, response to auxin stimulus, DNA-dependent regulation of transcription, N-terminal protein myristoylation, response to oxidative stress, cellular component, leaf senescence, resistance gene-dependent defense response signaling pathway, zinc ion binding, response to cold, malate metabolic process, transport, catalytic activity, response to ozone, VQ motif, regulation of systemic acquired resistance, potassium ion transport, anaerobic respiration, multicellular organismal development, response to heat, methyltransferase activity, response to wounding, oxidation-reduction process, monooxygenase activity, oxidation-reduction process, carbohydrate metabolic process, exocytosis, nuclear-transcribed mRNA poly(A) tail shortening, sodium ion transport, glycerol metabolic process, response to water deprivation, response to salt stress, and chlorophyll biosynthetic process.
This Example describes the ability of synthetic compositions comprising plant seeds and a single endophyte strain or a plurality of endophyte strains described herein, to confer beneficial traits to a host plant. Among other things, this Example provides exemplary characterization of modulations in a beneficial endophyte's transcriptome in response to host plant interactions, as compared to transcriptome changes in the transcriptome of a neutral (e.g., non-beneficial and non-pathogenic) microbe of the same genus.
RNA sequencing was used to explore differences in mRNA expression of genes common to the two strains of Acremonium zeae.
Among other things, this Example describe the ability of host plants (e.g., host plants described herein, e.g., dicots, e.g., soy, peanuts, and monocots, e.g., corn, soy, wheat, cotton, sorghum) to differentially modulate the transcriptome of a beneficial endophyte as compared to the transcriptome of a neutral microbe of the same genus. This Example describes surprising and unexpected modulations in the transcriptome of a beneficial endophyte in response to whole plant homogenate, compared to a neutral fungal strain of the same genus.
In particular, this Example describes an exemplary transcriptomic comparison between the functional capacity of a beneficial fungal endophyte genome and the genome of a neutral fungal microbe of the same genus. Briefly, each set of microbial predicted genes was annotated with pathway and orthologous group information from the KEGG database. Pathways and ortholog groups appearing in one genome but not the other were extracted and manually explored for biological relevance to the phenotype differences.
Fungal Biomass
Beneficial (SYM00577) and neutral (SYM00300) fungal strains of Acremonium zeae were initially streaked onto PD agar and incubated at room temperature until colony formation. Distinct plugs consisting of spores and mycelia were used to inoculate 125 mL PD broth and cultured for 5 days at room temperature with agitation (200 RPM). Each strain was grown in three biological replicates in duplicates totaling 12 flasks.
On day 5 of culture, 1 mL of total plant homogenate obtained from 6 day old soybean seedlings extracted with 50 mM Phosphate-buffered saline (PBS) at a ratio of 2 mL buffer/gram plant mass was added to the fungi. The plant homogenate solution was prepared in three replicates, and each replicate was applied to the corresponding beneficial and neutral fungal cultures. One mL of PBS solution was applied to each fungal biological replicate as the negative control.
Fungal biomass was harvested 24 hours after the addition of either the plant homogenate or PBS only solutions by centrifuging at 4500 RPM for 20 minutes in 50 mL Falcon tubes to allow culture separation prior to the removal of supernatant. Fungal tissues were stored immediately in −80° C. until total RNA isolation using standard extraction method using TriReagent (Sigma-Aldrich, St. Louis, Mo., USA) and purification with RNeasy Mini Kit (Qiagen, Hilden, Germany).
Fungal RNA-SEQ
Initial quality control was performed using Agilent Bioanalyzer and Tapestation.
rRNA Depletion
1 μg of total RNA was subjected to rRNA depletion using the RiboZero Yeast kit (Epicentre Biotechnologies, Illumina.com, catalog #MRZY1306). Manufacturer's instructions were strictly followed to perform rRNA depletion.
Stranded cDNA Preparation
After rRNA depletion, depletedRNA was used to generate 1-2 ug of cDNA using: Illumina TruSeq Stranded Total RNA LT kit (Illumina.com, catalog #RS-122-2201). Manufacturer's instructions were strictly followed to perform cDNA construction; and library construction.
RNA Sequencing
Sequencing was performed on an Illumina HiSeq 2500, using Rapid run v2.0 chemistry which generated paired-end reads of 106 nucleotides according to Illumina manufacturer's instructions. The initial data analysis was started directly on the HiSeq 2500 System during the run. The HiSeq Control Software 2.2.58 in combination with RTA 1.18.64 (real time analysis) performed the initial image analysis and base calling. In addition, bcl2fastq1.8.4 generated and reported run statistics. Data was analyzed using FASTQC (Babraham Institute, Cambridge, UK) comprising the sequence information which was used for all subsequent bioinformatics analyses. Sequences were de-multiplexed according to the 6 bp index code with 1 mismatch allowed.
Analysis
Expression levels for each gene were quantified as transcripts per million (TPM) using Cufflinks. The Blast Best Reciprocal Hits (BRH) method was used to define orthologous groups for similar gene pairs across species. Expression was mapped directly to BRH groups to create an expression matrix and the limma method was used to uncover genes (1) differentially expressed with vs without plant homogenate within each species, (2) differentially expressed across species within each plant homogenate condition, and (3) responding differently to plant homogenate in the different species. The false discovery rate method was used to adjust p-values for multiple testing. In each case, significance was defined as adjusted p-value less than 0.05 and absolute log 2 fold change greater than 2.
Functional and Comparative Genomics
Prior to applying differential expression analysis, the functional capabilities of a beneficial and neutral Acremonium zeae, i.e., SYM00577 (beneficial) and SYM00300 (neutral), were contrasted at the gene function (GO) and pathway level. A shared goal of both the genome comparison and the transcriptome analyses was the construction of orthologous groups. In the case of comparative genomics, annotations of these orthologs provided an overview of shared capabilities, while for RNA-seq they provided anchors for comparison of expression data, i.e. rows in the expression matrix.
Differential KEGG Orthology Groups
The unique and shared orthology group (OG) terms were counted for SYM00577 and SYM00300. Most KO terms were shared by both strains, with 62 terms found in SYM00300 only, and 207 terms found in SYM00577 only, with 2,676 KO terms overlapping between both strains. This process was repeated for KEGG Pathways, and the total and shared number of pathways was again similar, with 324 of the pathways shared between strains. Unique pathways in SYM00577 that were not present in SYM00300, include, but are not limited to, indole diterpene alkaloid biosynthesis, biosynthesis of 12-, 14- and 16-membered macrolides, peptidoglycan biosynthesis, glycosphingolipid biosynthesis—lacto and neolacto series, indole alkaloid biosynthesis, type I polyketide structures, biosynthesis of siderophore group nonribosomal peptides, beta-Lactam resistance, sphingolipid signaling pathway, Vibrio cholera pathogenic cycle, central carbon metabolism in cancer, choline metabolism in cancer, and nicotinate and nicotinamide metabolism. Exemplary KEGG Pathway differences for SYM00577 are illustrated below in Table 600.
In the above example, the Sphingolipid signaling pathway included 46 genes. To determine whether all of the genes (i.e., orthologous groups) in the pathway were unique to only SYM00577, a query was performed to determine which of the Sphingolipid pathway genes in SYM00577 do not share any KEGG OG terms with SYM00300 genes.
Interestingly, even though the Sphingolipid Signaling Pathway annotation is attached to 46 genes in SYM00577 but no genes in SYM00300, only one orthologous group from that pathway (sphingomyelin phosphodiesterase, annotating 4 genes) is not present in SYM300.
Unique pathways in SYM00300 that were not present in SYM00577, include, but are not limited to, beta-Lactam resistance, DDT degradation, Flavone and flavonol biosynthesis, and ECM-receptor interaction. Exemplary KEGG Pathway differences for SYM00300 are illustrated below in Table 700.
Blast Best Reciprocal Hits (BBRH)
The NCBI Blast+software was installed and used to build blast databases from each set of amino acid sequences, then each transcriptome was blasted against the database created from the other. Best Reciprocal Hits (BRH) were calculated by filtering for high percent identity, gathering the best hits, and joining the targets from one output with the queries from the other. The result was a query-target-reciprocal trio, which was filtered for trios where the query was the same as its reciprocal. The e-value and bitscores from the two blast outputs were averaged (since they are asymmetric) for the BRH pairs, and an ortholog group identifier was created.
Calculation of in-Paralogs
In-paralogs are paralogs that are the result of speciation first, then duplication of the genes later. In-paralogs are more likely to retain the same function as the ortholog than out-paralogs, which represent duplication, followed by speciation. Considering the high proportion of SYM00300 genes that have BRH orthologs, along with the realization that SYM00577 has nearly twice as many transcripts, we considered the possibility of a major genome duplication event somewhere in the phylogenetic history of SYM00577, and extended the orthologous groups to include in-paralogs.
An important step after BRH is, for each orthologous pair, to include same-species genes more similar to each member of the pair than the cross-species ortholog similarity. This was accomplished using all-versus-all Blast within the same species, to expand our orthologous groups.
Another approach to building ortholog groups was to apply a threshold to the same-species hits for each member of the ortholog pairs. To find the best threshold, we explored the distribution of scores in these BRH/same-species tables described above, normalizing by the ortholog score.
RNA-SEQ Cross-Species Comparison
RNA-seq cufflinks FPKM values were generated for two species of fungus (Acremonium zeae), with three biological replicates each. An expression matrix was built using orthologouos groups, to explore the structure of the data, characterize data quality, and to elucidate pathway-level expression differences between SYM00577 and SYM00300.
This Example describes the ability of synthetic compositions comprising plant seeds and a single endophyte strain or a plurality of endophyte strains described herein, to confer beneficial traits to a host plant. Among other things, this Example provides exemplary characterization of modulations in a beneficial endophyte's secretome, as compared to the secretome of a neutral microbe of the same genus.
Mass spectrometry was used to explore differences in secreted proteins between beneficial endophytes and neutral microbes. Four genera were selected for the secreted proteomic analysis (two fungal and two bacterial): Acremonium, Phoma, Stenotrophomonas, and Agrobacterium. For each genus, a beneficial endophyte and neutral microbe were selected: SYM00577 (SEQ ID NO: 344) and SYM00300 (SEQ ID NO: 449); SYM15774 (SEQ ID NO: 447) and SYM01331 (SEQ ID NO: 450); SYM00906 (SEQ ID NO: 439) and SYM00865 (SEQ ID NO: 451); and SYM01004 (SEQ ID NO: 441) and SYM00091 (SEQ ID NO: 427).
Microbes were cultivated in three biological replicates for each strain. Briefly, each bacterium was initially streaked on Reasoner's 2A (R2A) agar, distinct CFUs selected and cultured in 10 mL R2A broth for 4 days. Fungal strains were streaked on potato dextrose (PD) agar and individual plugs containing spores and mycelial tissues were used to initiate growth in 10 mL PD broth for 6 days. All strains were grown with agitation at room temperature. Microbial culture filtrate was harvested by centrifuging at 4500 RPM for 20 minutes in 15 mL Falcon tubes to allow culture separation and removal of the supernatant. Five mL of culture supernatant were used for secreted proteomics analysis. All steps were performed in sterile conditions. Culture filtrates were kept in dry ice after harvest at all times to preserve protein stability. Media only samples consisting of PDB and R2A were tested independently to ensure the absence of intact proteins that could potentially interfere with the secreted microbial peptides.
Prior to mass spectrometry, samples were concentrated on a Pall 3 kD MWCO MicroSep Spin Column (VWR Cat #89132-006) and quantified at 1:10 dilution by Qubit fluorometry (Life Technologies). 12 μg of each sample was separated ˜1.5 cm on a 10% Bis-Tris Novex mini-gel (Invitrogen) using the MES buffer system. The gel was stained with coomassie and each lane was excised into ten equally sized segments.
Gel pieces were processed using a robot (ProGest, DigiLab) with the following protocol:
Washed with 25 mM ammonium bicarbonate followed by acetonitrile.
Reduced with 10 mM dithiothreitol at 60° C. followed by alkylation with 50 mM iodoacetamide at RT.
Digested with trypsin (Promega) at 37° C. for 4h.
Quenched with formic acid and the supernatant was analyzed directly without further processing.
Mass Spectrometry
The digests were analyzed by nano LC/MS/MS with a Waters NanoAcquity HPLC system interfaced to a ThermoFisher Q Exactive. Peptides were loaded on a trapping column and eluted over a 75 μm analytical column at 350 nL/min; both columns were packed with Proteo Jupiter resin (Phenomenex). A 30 min gradient was employed (5h total). The mass spectrometer was operated in data-dependent mode, with MS and MS/MS performed in the Orbitrap at 70,000 FWHM and 17,500 FWHM resolution, respectively. The fifteen most abundant ions were selected for MS/MS.
Data were searched using a local copy of Mascot with the following parameters: Fixed modification: Carbamidomethyl (C); Variable modifications: Oxidation (M), Acetyl (Protein N-term), Pyro-Glu (N-term Q), Deamidation (NQ); Mass values: Monoisotopic; Peptide Mass Tolerance: 10 ppm; Fragment Mass Tolerance: 0.02 Da; Max Missed Cleavages: 2.
Mascot DAT files were parsed into the Scaffold software for validation, filtering and to create a non-redundant list per sample. Data were filtered 1% protein and peptide level false discovery rate (FDR) and requiring at least two unique peptides per protein.
Differential Secreted Protein Expression and Functional Enrichment Analysis
Data Acquisition and Processing
Protein sequence data, KEGG annotations and corresponding protein mass spectrometry spectral count data were provided to a vendor. Data were provided for beneficial (A) and non-beneficial (B) species pairs from two fungal and two bacterial genera. All data were converted into file formats and a local database suitable for subsequent processing, analysis and parallelization.
Protein Ortholog Identification
Pairs/groups of orthologous proteins were identified using a modified version of the OrthoMCL pipeline. Orthologs were identified as reciprocal best BLASTP hits, and then clusters of orthologous proteins were defined using the modified OrthoMCL pipeline. This process was done independently for the within genera and the between genera analyses. BLASTP was run in parallel on the Georgia Tech PACE HPC environment.
Protein Functional Annotation
KEGG annotations for individual proteins were provided to the vendor based on the whole genome sequence annotations. The program BLAST2GO was used to annotate proteins with gene ontology (GO) terms based on sequence similarity to previously annotated proteins.
Protein Expression Quantification and Normalization
Individual protein expression levels were taken as the number of observed spectra (i.e. the spectra count) corresponding to each protein. Protein spectra counts were retrieved across three replicates for each species. Missing counts for any given ortholog or replicate were assigned values of 0. Individual protein expression levels (spectra counts) were then normalized by the total number of observed spectra for each replicate. This process was done independently for the three replicates corresponding to each member of the A-B pair of every species. Fold-change (FC) values for orthologous pairs/groups were computed as log 2 A/B spectra counts for the purpose of functional enrichment analysis
Protein Differential Expression Analysis
Differential protein expression analysis was done for a) pairs of orthologous proteins from the within genera analysis and b) groups of orthologous proteins from the between genera analysis. Differential expression was quantified by comparing the within group normalized spectra count variation to the between group normalized spectra count variation using the Students ttest. A Benjamini-Hochberg False Discover Rate threshold of 0.2 was used to identify differentially abundant orthologous proteins.
Pathway and Functional Enrichment Analysis
Enrichment analysis was done in parallel using both KEGG and GO annotations with the hypergeometric test and via Gene Set Enrichment Analysis (GSEA). For the hypergeometric test, for any given functional annotation category (i.e. KEGG pathway or GO term), the number of proteins up-regulated in the beneficial member of the orthologous pair (species A) was compared to the total number of proteins up-regulated in the complete set of orthologs. For GSEA analysis, orthologous protein pairs/groups were ranked by FC values and the distribution of FC values was evaluated for a shift using the clusterprofiler R package.
SYM00577 Secreted Proteomic Analysis
SYM00577 Versus SYM00300
cholerae infection
Helicobacter
pylori
Salmonella infection,
A total of 892 proteins were detected across all Acremonium samples with two or more unique peptides at the false discovery rates indicated above.
SYM15774 Secreted Proteomic Analysis
SYM15774 Versus SYM01331
A total of 697 proteins were detected across all Phoma samples with two or more unique peptides at the false discovery rates indicated above.
SYM01004 Secreted Proteomic Analysis
Salmonella infection usually presents as a self-
legionella species. Two distinct clinical and
Salmonella infection: Salmonella
legionella species. Two distinct clinical
Legionella species: Legionnaires' disease is the
Salmonella infection usually presents as a
legionella species. Two distinct clinical
Legionella species: Legionnaires' disease is the
Legionella pneumophila and other legionella
Legionella species: Legionnaires' disease is the
SYM01004 Versus SYM00091
A total of 1390 proteins were detected across all Agrobacterium samples with two or more unique peptides at the false discovery rates indicated above.
KEGG Pathway Enrichment of Beneficial Fungi Versus Neutral Fungi
indicates data missing or illegible when filed
Gene Ontology Enrichment of Beneficial Fungi Versus Neutral Fungi
These data suggest that numerous biological processes are different in beneficial endophytes, for example as compared to neutral endophytes. Some of these processes include cell wall degradation, starch and sucrose metabolism, and protection from oxidative stress.
One mechanism of entry of endophytes into intact plant tissue is by enzymatic processes involving degradation of cell walls. Beneficial endophytes used in this example show increased levels of secreted proteins that may be involved in such degradation, for example those that fall within the following gene ontology annotations: GO:0005618 (cell wall), GO:0000272 (polysaccharide catabolic process), GO:0045490 (pectin catabolic process), GO:0030248 (cellulose binding), GO:0004650 (polygalacturonase activity), GO:0008810 (cellulase activity), GO:0071555 (cell wall organization), GO:0004185 (serine-type carboxypeptidase activity), GO:0016798 (hydrolase activity, acting on glycosyl bonds), and GO:0030246 (carbohydrate binding). Certain of the proteins that fall within these gene ontology annotations may also be involved in starch and sucrose metabolism.
Beneficial endophytes of the invention secreted proteins that may provide a benefit to the plant, such as proteins involved in protection against oxidative stress (GO:0016614 (oxidoreductase activity, acting on CH—OH group of donors); GO:0006979 (response to oxidative stress); GO:0005507 (copper ion binding), and GO:0004601 (peroxidase activity)).
Setup and Watering Conditions
A sandy loam growth substrate is mixed in the greenhouse and consisting of 60% loam and 40% mortar sand (Northeast Nursery, Peabody, Mass.). Prior to mixing, loam is sifted through a ⅜″ square steel mesh screen to remove larger particles and debris. Half of the appropriate fertilizers and soil treatments to be applied during the season is added to the soil mixture prior to sowing. The remaining components are provided dissolved in irrigation water at the onset of the reproductive stages of development. Substrate surface area per pot is calculated based on pot diameter in order to approximate the “acreage” of individual pots. An equivalent volume of fertilized soil is then gently added to each pot in order to minimize compaction of the soil. The substrate is saturated with water 3-4 hours before sowing.
Commercially available seeds (e.g., seeds described herein) are coated with microbial treatments using the formulation used for field trials and described herein. Treatments included microbial coatings and two controls (non-treated and formulation). Three seeds are sown evenly spaced at the points of a triangle. Soil is then overlaid atop the seeds and an additional 200 mL water was added to moisten the overlaying substrate.
Midseason Measurements and Harvest
Emergence percentage is observed. Further, at various times through the growing season, plants are assessed for onset of and recovery from stress symptoms, for example but not limited to: leaf senescence, anthesis-silking interval, leaf chlorophyll content, grain weight, and total yield.
To compare treated plants to controls, a fully Bayesian robust t-test is performed. Briefly, R (R Core Team, 2015) was used with the BEST package (Kruschke and Meredith, 2015) and JAGS (Plummer, 2003) to perform a Markov Chain Monte Carlo estimation of the posterior distribution the likely differences between the two experimental groups. A 95% highest density interval (HDI) is overlayed onto this distribution to aid in the interpretation of whether the two biological groups truly differ.
Tissue Collection and Processing for Transcriptomics, Hormone, and Metabolomics Analysis
In order to assess the effects of endophyte treatment on plant growth at the transcriptomic, phytohormone, and metabolomic levels, plants are harvested. Three pots from each treatment are selected. Once separated, the tissues (roots, stems, leaves, other plant elements as appropriate) from the three pots of each treatment are pooled. For collection, first all loosely attached substrate is removed from the roots by gently tapping and shaking the roots. Any adherent substrate is removed by submerging the roots in water and manually dislodging attached soil and debris. The roots are then blotted dry before being cut from the aerial tissue, followed by separating petioles and leaves from the stem. As tissues are removed from the plant they are immediately bagged and frozen in liquid nitrogen. All harvested tissues are kept in liquid nitrogen or stored at −80° C. until further processing.
To prepare for analyses, the tissues are ground with liquid nitrogen using a pre-chilled mortar and pestle. Approximately 100-200 micrograms of each ground sample pool is transferred to a chilled 1.5 mL microtube for RNA extraction and subsequent transcriptome, phytohormone and metabolite analysis. For proteomic analysis, 3 g of each ground sample pool is used. The remaining ground tissue is then transferred to a chilled 50 mL conical tube and stored in liquid nitrogen or at −80° C. until shipment for further analyses.
The protocols described in this section allow confirmation of successful colonization of plants by endophytes, for example by direct recovery of viable colonies from various tissues of the inoculated plant.
Recovery of Viable Colonies from Seeds
Seeds are surface-sterilized by exposing them to chlorine gas overnight, using the methods described elsewhere. Sterile seeds are then inoculated with submerged in 0.5 OD overnight cultures (Tryptic Soy Broth, TSB) of bacteria and allowed to briefly air dry. The seeds are then placed in tubes filled partially with a sterile sand-vermiculite mixture [(1:1 wt:wt)] and covered with 1 inch of the mixture, watered with sterile water, sealed and incubated in a greenhouse for 7 days. After incubation, various tissues of the plants are harvested and used as donors to isolate bacteria by placing tissue section in a homogenizer (TSB 20%) and mechanical mixing. The slurry is then serially diluted in 10-fold steps to 10-3 and dilutions 1 through 10-3 are plated on TSA 20% plates (1.3% agar). Plates are incubated overnight and pictures are taken of the resulting plates as well as colony counts for CFU. Bacteria are identified visually by colony morphotype and molecular methods described herein. Representative colony morphotypes are also used in colony PCR and sequencing for isolate identification via ribosomal gene sequence analysis as described herein. These trials are repeated twice per experiment, with 5 biological samples per treatment.
Culture-Independent Methods to Confirm Colonization of the Plant or Seeds by Bacteria or Fungi
One way to detect the presence of endophytes on or within plants or seeds is to use quantitative PCR (qPCR). Internal colonization by the endophyte can be demonstrated by using surface-sterilized plant tissue (including seed) to extract total DNA, and isolate-specific fluorescent MGB probes and amplification primers are used in a qPCR reaction. An increase in the product targeted by the reporter probe at each PCR cycle therefore causes a proportional increase in fluorescence due to the breakdown of the probe and release of the reporter. Fluorescence is measured by a quantitative PCR instrument and compared to a standard curve to estimate the number of fungal or bacterial cells within the plant.
Experimental Description
The design of both species-specific amplification primers, and isolate-specific fluorescent probes are well known in the art. Plant tissues (seeds, stems, leaves, flowers, etc.) are pre-rinsed and surface sterilized using the methods described herein.
Total DNA is extracted using methods known in the art, for example using commercially available Plant-DNA extraction kits, or the following method.
1. Tissue is placed in a cold-resistant container and 10-50 mL of liquid nitrogen is applied. Tissues are then macerated to a powder.
2. Genomic DNA is extracted from each tissue preparation, following a chloroform:isoamyl alcohol 24:1 protocol (Sambrook et al., 1989).
Quantitative PCR is performed essentially as described by Gao et al. (2010) with primers and probe(s) specific to the desired isolate using a quantitative PCR instrument, and a standard curve is constructed by using serial dilutions of cloned PCR products corresponding to the specie-specific PCR amplicon produced by the amplification primers. Data are analyzed using instructions from the quantitative PCR instrument's manufacturer software.
As an alternative to qPCR, Terminal Restriction Fragment Length Polymorphism, (TRFLP) can be performed, essentially as described in Johnston-Monje and Raizada (2011). Group specific, fluorescently labelled primers are used to amplify a subset of the microbial population, especially bacteria, especially fungi, especially archaea, especially viruses. This fluorescently labelled PCR product is cut by a restriction enzyme chosen for heterogeneous distribution in the PCR product population. The enzyme cut mixture of fluorescently labelled and unlabeled DNA fragments is then submitted for sequence analysis on a Sanger sequence platform such as the Applied Biosystems 3730 DNA Analyzer.
Immunological Methods to Detect Microbes in Seeds and Vegetative Tissues
A polyclonal antibody is raised against specific bacteria X or fungus Y strains via standard methods. A polyclonal antibody is also raised against specific GUS and GFP proteins via standard methods. Enzyme-linked immunosorbent assay (ELISA) and immunogold labeling is also conducted via standard methods, briefly outlined below.
Immunofluorescence microscopy procedures involve the use of semi-thin sections of plant element or adult plant tissues transferred to glass objective slides and incubated with blocking buffer (20 mM Tris (hydroxymethyl)-aminomethane hydrochloride (TBS) plus 2% bovine serum albumin, pH 7.4) for 30 min at room temperature. Sections are first coated for 30 min with a solution of primary antibodies and then with a solution of secondary antibodies (goat anti-rabbit antibodies) coupled with fluorescein isothiocyanate (FITC) for 30 min at room temperature. Samples are then kept in the dark to eliminate breakdown of the light-sensitive FITC. After two 5-min washings with sterile potassium phosphate buffer (PB) (pH 7.0) and one with double-distilled water, sections are sealed with mounting buffer (100 mL 0.1 M sodium phosphate buffer (pH 7.6) plus 50 mL double-distilled glycerine) and observed under a light microscope equipped with ultraviolet light and a FITC Texas-red filter.
Ultrathin (50- to 70-nm) sections for TEM microscopy are collected on pioloform-coated nickel grids and are labeled with 15-nm gold-labeled goat anti-rabbit antibody. After being washed, the slides are incubated for 1 h in a 1:50 dilution of 5-nm gold-labeled goat anti-rabbit antibody in IGL buffer. The gold labeling is then visualized for light microscopy using a BioCell silver enhancement kit. Toluidine blue (0.01%) is used to lightly counterstain the gold-labeled sections. In parallel with the sections used for immunogold silver enhancement, serial sections are collected on uncoated slides and stained with 1% toluidine blue. The sections for light microscopy are viewed under an optical microscope, and the ultrathin sections are viewed by TEM.
Methods
For hormone analysis, 100±10 mg tissue is measured into microtubes (chilled with liquid nitrogen), and sent on dry ice to a vendor. Plant hormone analysis is performed per Christiansen et al. (2014) with slight modification. Briefly, hormones are extracted from 100±10 mg of frozen tissue and tissue weights are recorded for quantification. A mixture containing 10 microliters of 2.5 microMolar internal standards and 500 microliters of extraction buffer [1-propanol/H2O/concentrated HCl (2:1:0.002, vol/vol/vol) is added to each sample and vortexed until thawed. Samples are agitated for 30 min at 4° C., then 500 microliters of dichloromethane (CH2Cl2) is added. Samples are agitated again for 30 min at 4° C., and then centrifuged at 13,000×g for 5 min. in darkness. The lower organic layer is removed into a glass vial and the solvent is evaporated by drying samples for 30-40 min under a N2 stream. Samples are re-solubilized in 150 microliters of MeOH, shaken for 1 min and centrifuged at 14,000×g for 2 min. A supernatant of 90 microliters is transferred into the autosampler vial and hormones are analyzed by ultraperformance liquid chromatography, coupled to mass spectrometry (UPLC-MS/MS). Ascentis Express C-18 Column (3 cm×2.1 mm, 2.7 cm) is connected to an API 3200 using electrospray ionization-tandem mass spectrometry (MS/MS) with scheduled multiple reaction monitoring (SMRM). The injection volume is 5 microliters and has a 300 microliters/min mobile phase consisting of Solution A (0.05% acetic acid in water) and Solution B (0.05% acetic acid in acetonitrile) with a gradient consisting of (time-% B): 0.3-1%, 2-45%, 5-100%, 8-100%, 9-1%, 11-stop. Quantitation is carried out with Analyst software (AB Sciex), using the internal standards as a reference for extraction recovery. Leaf, root, and/or other tissue is saved in −62° C. and saved for subsequent gene expression analysis.
Mass spectra of plant hormones are obtained. Fold changes between control and treated samples are calculated by dividing the mass spectrum value from the treated sample by the value from the control sample.
Modulation of hormones related to growth as well as related to resistance to abiotic and biotic stresses are found in plants treated with endophytes as compared to isoline plants lacking such treatment.
Methods
For metabolite analysis, 150±10 mg of each sample is transferred into 1.5 mL microtubes (chilled in liquid nitrogen) and sent on dry ice to the Proteomics and Metabolomics Facility at Colorado State University. Metabolomics data acquisition is performed per the following methods provided by Dr. Corey Broeckling at CSU. To prepare the samples for analysis, phytohormones are extracted from ground plant material using a biphasic protocol. One mL of a methyl tert-butyl ether (MTBE): methanol:water mixture (6:3:1) is added to each sample then shaken for 1 hour. Next, 250 microliters cold water and a mix of internal standards are added to each sample to promote phase separation. Samples are shaken again for 5 minutes. Samples are then centrifuged at 2,095×g at 4° C. for 15 minutes. The organic top phase is removed for hormone analysis, dried under an inert nitrogen environment, then re-suspended in 400 microliters of 50% acetonitrile. Extracts are then directly analyzed by LC-MS.
For GC-MS, the polar (lower phase) extract is dried using a speedvac, resuspended in 50 microliters of pyridine containing 50 mg/mL of methoxyamine hydrochloride, incubated at 60° C. for 45 min, sonicated for 10 min, and incubated for an additional 45 min at 60° C. Next, 25 microliters of N-methyl-N-trimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane (MSTFA+1% TMCS, Thermo Scientific) is added and samples re incubated at 60° C. for 30 min, centrifuged at 3000×g for 5 min, cooled to room temperature, and 80 microliters of the supernatant is transferred to a 150 microliters glass insert in a GC-MS autosampler vial. Metabolites are detected using a Trace GC Ultra coupled to a Thermo ISQ mass spectrometer (Thermo Scientific). Samples are injected in a 1:10 split ratio twice in discrete randomized blocks. Separation occurs using a 30 m TG-5MS column (Thermo Scientific, 0.25 mm i.d., 0.25 micrometer film thickness) with a 1.2 mL/min helium gas flow rate, and the program consists of 80° C. for 30 sec, a ramp of 15° C. per min to 330° C., and an 8 min hold. Masses between 50-650 m/z re scanned at 5 scans/sec after electron impact ionization. The ionization source is cleaned and retuned and the injection liner replaced between injection replicates. Analysis for plant hormones is performed by UPLC-MS/MS as follows.
Metabolites are detected and mass spectra annotated by comparing to libraries of known spectra including an in-house database at CSU (LC-MS only), the National Institute of Standards and Technology databases, Massbank MS database, and the Golm Metabolite Database. Initial annotation is automated, followed by manual validation of annotations. Following annotation, compounds are identified. After removal of technical artifacts (e.g. siloxane), and ambiguous or vague annotations (e.g. carbohydrate or saccharide), identified compounds remain for analysis. These compounds are assessed for fold change over control plants. Metabolites are grouped by pathways (e.g. carbohydrate metabolism or alkaloid biosynthesis) and the KEGG database and literature are manually referenced to identify pertinent shifts in metabolic patterns in plants treated with microbes. Any compound without an appreciable shift compared to that observed in control plants is removed from further analysis.
Modulation of metabolites related to growth as well as related to resistance to abiotic and biotic stresses are found in plants treated with endophytes as compared to isoline plants lacking such treatment.
Method
Whole plants or plant elements, such as seeds, roots, or leaves, from any of the crops useful in the invention are treated with endophytes as described in Examples 3, 4, or 8. They are then sown in a variety in different growing regions for efficacy testing. Trials consist of ten replicate plots for each treatment and control respectively arranged in a spatially balanced randomized complete block design (Van Es et al. 2007). In addition to measuring total yield, metrics such as seedling emergence, normalized difference vegetation index (NDVI) and time to flowering are assessed. Endophytes are applied alone as a seed treatment, as well as in combination with other endophytes.
Results
Crop plants that have been treated with the endophyte(s) of the present invention demonstrate improvements in one or more agronomically-important characteristic, for example but not limited to: disease resistance, drought tolerance, heat tolerance, cold tolerance, salinity tolerance, metal tolerance, herbicide tolerance, chemical tolerance, improved water use efficiency, improved nitrogen utilization, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, increased yield, increased yield under water-limited conditions, health enhancement, vigor improvement, growth improvement, photosynthetic capability improvement, nutrition enhancement, altered protein content, altered oil content, increased biomass, increased shoot length, increased root length, improved root architecture, improved plant standability, increased plant element weight, altered plant element carbohydrate composition, altered plant element oil composition, number of pods, delayed senescence, stay-green, and altered plant element protein composition.
The application of pesticides against fungal pathogens of agriculturally-relevant plants is a common practice in agriculture to ensure higher yields. One method of pesticide delivery is to cover the seeds with a coating with pesticides. Although pesticides are meant to deter the growth and propagation of pathogenic microorganisms, they may also affect endophyte populations residing inside of the seed. For this purpose, conferring compatibility mechanisms to endophytic fungi providing beneficial properties which are sensitive to these compounds is desirable for the maintenance of endophytes in the seeds.
Compatibility with pesticides can be intrinsic (naturally pesticide compatible fungi, for example) or acquired (due to mutations in the genetic material of the microorganism, or to the introduction of exogenous DNA by natural DNA transfer).
Fungicides used as protectants are effective only on the seed surface, providing protection against seed surface-borne pathogens and providing some level of control of soil-borne pathogens. These products generally have a relatively short residual. Protectant fungicides such as captan, maneb, thiram, or fludioxonil help control many types of soil-borne pathogens, except root rotting organisms. Systemic fungicides are absorbed into the emerging seedling and inhibit or kill susceptible fungi inside host plant tissues. Systemic fungicides used for seed treatment include the following: azoxystrobin, carboxin, mefenoxam, metalaxyl, thiabendazole, trifloxystrobin, and various triazole fungicides, including difenoconazole, ipconazole, tebuconazole, and triticonazole. Mefenoxam and metalaxyl are primarily used to target the oomycetes such as species of Pythium and Phytophthora.
Strobilurin analogues, such as azoxystrobin, inhibit mitochondrial respiration by blocking electron transfer at the cytochrome bcl complex. Phenylamides, including metalaxyl, interfere with RNA synthesis in target fungi. Oxathiin systemic fungicides like carboxin inhibits the incorporation of phenylalanine into protein and of uracil into RNA. Azole fungicides BAS 480F, flusilazole, and tebuconazole are inhibitors of sterol 14a-demethylase, and block sterol biosynthesis.
I. Determination of Intrinsic Resilience Against Agrochemicals of Bacteria Cultured from Seeds
To test the intrinsic resilience pesticides of bacteria isolated as described herein, minimum inhibitory concentration (MIC) assays are performed on all isolated bacteria of interest, as described in Wiegand, Irith, Kai Hilpert, and Robert E W Hancock. Nature protocols 3.2 (2008): 163-175, which is incorporated herein by reference in its entirety. Briefly, known concentrations of bacterial cells or spores are used to inoculate plates containing solid media with different concentrations of the pesticide, or to inoculate liquid media containing different concentrations of the pesticide (in a 96-well plate). The pesticides are used at the concentration recommended by the manufacturer for seed coating, and two-fold dilutions down to 0.000125 (12 two-fold dilutions). Growth is assessed after incubation for a defined period of time (16-20 h) and compared to cultures grown in the same manner without any pesticides as control. The MIC value is determined as described in Wiegand, Irith, Kai Hilpert, and Robert E W Hancock. Nature protocols 3.2 (2008): 163-175.
II. Determination of Intrinsic Resilience Against Agrochemicals of Fungi Cultured from Seeds
To test the intrinsic resilience against pesticides of the fungi isolated as described in this application, minimum inhibitory concentration (MIC) assays are performed on all isolated fungi of interest, as described in Mohiddin, F. A., and M. R. Khan. African Journal of Agricultural Research 8.43 (2013): 5331-5334 (incorporated herein by reference in its entirety), with the following changes: Briefly, double strength potato dextrose agar is prepared containing different concentrations of each pesticide. The pesticides are applied at the concentration recommended by the manufacturer, and also in two fold dilutions to 0.000125× (12 two-fold dilutions). Thereafter, the plates are seeded centrally with a 3 mm disc of 4 days old culture of each fungus that had been centrifuged and rinsed twice in sterile phosphate buffer. PDA plates without a fungicide but inoculated with the fungi serve as a control. The inoculated plates are incubated at 25±2° C. for 5 days. The radial growth of the colony in each treatment is measured and the percent inhibition of growth is calculated as described by Mohiddin, F. A., and M. R. Khan. African Journal of Agricultural Research 8.43 (2013): 5331-5334 (incorporated herein by reference in its entirety). Fungal isolates are classified as resilience against the particular pesticide if their maximum tolerance concentration (MTC) is 2x or above the concentration of pesticides recommended to be used in seed coatings.
III. Generating Fungal Species with Compatibility with Commercial Pesticides Coated onto Seeds
When a fungal strain of interest that provides a beneficial property to its plant host is found to be sensitive to a commercially-relevant pesticide, pesticide-compatible variants of the strains need to be generated for use in this application. Generation of compatibility to multiple pesticides or cocktails of pesticides is accomplished by sequentially selecting compatible variants to each individual pesticide and then confirming compatibility with a combination of the pesticides. After each round of selection, fungi are tested for their ability to form symbiotic relationships with the plants and to confirm that they provide a beneficial property on the plant as did the parental strain, with or without application of the pesticide product as described herein.
Generation and isolation of pesticide-compatible strains derived from endophytic strains isolated from seeds and shown to provide beneficiary traits to plants is performed as described by Shapiro-Ilan, David I., et al. Journal of invertebrate pathology 81.2 (2002): 86-93 (incorporated herein by reference in its entirety), with some changes. Briefly, spores of the isolated fungi are collected and solutions containing between 1×103 spores are used to inoculate potato dextrose agar (PDA) plates containing 2, 5, and 10 times the MTC of the particular strain. Plates are incubated for 1-5 days and a single colony from the highest concentration of pesticide which allows growth is inoculated onto a fresh plate with the same pesticide concentration 7 consecutive times. After compatibility has been established, the strain is inoculated onto PDA plates 3 consecutive times and then inoculated onto a PDA plate containing the pesticide to confirm that the compatibility trait is permanent.
Alternatively, if this method fails to provide a compatible strain, a spore suspension is treated with ethyl methanesulfonate to generate random mutants, similarly as described by Leonard, Cory A., Stacy D. Brown, and J. Russell Hayman. International journal of microbiology 2013 (2013), Article ID 901697 (incorporated herein by reference in its entirety) and spores from this culture are used in the experiment detailed above.
To develop fungal endophytes compatible with multiple pesticides or cocktails of pesticides, spores of a strain compatible with one or more pesticides are used to select for variants to a new pesticide as described above. Strains developed this way are tested for retention of the pesticide-compatibility traits by inoculating these strains onto PDA plates containing each single pesticide or combinations of pesticides.
IV. Generating Bacterial Species with Compatibility to Commercial Pesticides Coated onto Seeds
When a bacterial strain of interest is found to be sensitive to a commercially-relevant pesticide, generation of pesticide-compatible variants of the strains can be generated for use in this application. Generation of compatible with multiple pesticides or cocktails of pesticides is accomplished by first sequentially selecting variants compatible with incrementally higher concentrations of each individual pesticide (as described by Thomas, Louise, et al. Journal of Hospital Infection 46.4 (2000): 297-303, which is incorporated herein by reference in its entirety). To develop bacterial endophytes compatible with multiple pesticides or cocktails of pesticides, bacterial cells of a strain compatible with one or more pesticides is used to select for variants to a new pesticide as described above. Strains developed this way are tested for retention of the pesticide-compatible traits by inoculating these strains onto PDA plates containing each single pesticide or combinations of pesticides.
After each round of selection, bacteria are tested for their ability to live within plants and for their ability to provide the same beneficial property to the plant as did the parental strain, with or without application of the pesticide product to the plants as described herein.
V. Generation of Pesticide-Compatible Bacteria by Insertion of a Resistance Plasmid
Many bacterial plasmids that confer compatible pesticides have been described in the literature (Don, R. H., and J. M. Pemberton. Journal of Bacteriology 145.2 (1981): 681-686; and Fisher, P. R., J. Appleton, and J. M. Pemberton. Journal of bacteriology 135.3 (1978): 798-804, each of which is incorporated herein by reference in its entirety)
For cases in which obtaining naturally occurring compatible bacteria is not feasible, use of these plasmids is a possible way to develop endophytic strains compatible with multiple pesticides.
For example, a Pseudomonas fluorescens strain that provides anti-nematode properties to plants but is sensitive to the pesticides 2,4-dichlorophenoxyacetic acid and 4-chloro-2-methylphenoxyacetic can be transformed with the plasmid pJP2 (isolated from Alcaligenes eutrophus) which provides transmissible compatible with these compounds, as described by Don and Pemberton, 1981. Briefly, plasmids are transferred by conjugation to Pseudomonas, using the method described in Haas, Dieter, and Bruce W. Holloway. Molecular and General Genetics 144.3 (1976): 243-251 (incorporated herein by reference in its entirety).
After the generation of bacteria carrying pesticide-compatibility conferring plasmids, these endophytes are tested for their ability to live inside plant tissues and for their ability to provide the same beneficial property to the plant as it did for the parental strain, with or without application of the pesticide product to the plants as described herein.
VI. Growth and Scale-Up of Bacteria for Inoculation on Solid Media
The bacterial isolates are grown by loop-inoculation of a single colony into R2A broth (supplemented with appropriate antibiotics) in 100 mL flasks. The bacterial culture is incubated at 30±2 OC for 2 days at 180 rpm in a shaking incubator (or under varying temperatures and shaking speeds as appropriate). This liquid suspension is then used to inoculate heat sterilized vermiculite powder that is premixed with sterile R2A broth (without antibiotics), resulting in a soil like mixture of particles and liquid. This microbial powder is then incubated for an additional couple of days at 30±2 OC with daily handshaking to aerate the moist powder and allow bacterial growth. Microbially inoculated vermiculite powder is now ready for spreading on to soil or onto plant parts. Alternatively, the R2A broth is used to inoculate Petri dishes containing R2A or another appropriate nutrient agar where lawns of bacteria are grown under standard conditions and the solid colonies scraped off, resuspended in liquid and applied to plants as desired.
VII. Growth & Scale-Up of Fungi for Inoculation on Solid Media
Once a fungal isolate has been characterized, conditions are optimized for growth in the lab and scaled-up to provide sufficient material for assays. For example, the medium used to isolate the fungus is supplemented with nutrients, vitamins, co-factors, plant-extracts, and other supplements that can decrease the time required to grow the fungal isolate or increase the yield of mycelia and/or spores the fungal isolate produces. These supplements can be found in the literature or through screening of different known media additives that promote the growth of all fungi or of the particular fungal taxa.
To scale up the growth of fungal isolates, isolates are grown from a frozen stock on several Petri dishes containing media that promotes the growth of the particular fungal isolate and the plates are incubated under optimal environmental conditions (temperature, atmosphere, light). After mycelia and spore development, the fungal culture is scraped and resuspended in 0.05M Phosphate buffer (pH 7.2, 10 mL/plate). Disposable polystyrene Bioassay dishes (500 cm2, Thermo Scientific Nunc UX-01929-00) are prepared with 225 mL of autoclaved media with any required supplements added to the media, and allowed to solidify. Plates are stored at room temperature for 2-5 days prior to inoculation to confirm sterility. 5 mL of the fungal suspension is spread over the surface of the agar in the Bioassay plate in a biosafety cabinet, plates are allowed to dry for 1h, and they are then incubated for 2-5 days, or until mycelia and/or spores have developed.
A liquid fungal suspension is then created via the following. Fungal growth on the surface of the agar in the Bioassay plates are then scraped and resuspended in 0.05M Phosphate buffer (pH 7.2). OD600 readings are taken using a spectrometer and correlated to previously established OD600/CFU counts to estimate fungal population densities, and the volume adjusted with additional sodium phosphate buffer to result in 100 mL aliquots of fungi at a density of approximately 106-1011 spores/mL. This suspension may or may not be filtered to remove mycelia and can be used to create a liquid microbial formulation as described herein to apply the fungal isolate onto a plant, plant part, or seed.
VIII. Growth & Scale-Up of Bacteria for Inoculation in Liquid Media
Bacterial strains are grown by loop-inoculation of one single colony into R2A broth (amended with the appropriate antibiotics) in 100 mL flasks. The bacterial culture is incubated at 28±2 OC for 1 day at 180 rpm in a shaking incubator (or under varying temperatures and shaking speeds as appropriate). The bacteria are pelleted by centrifugation and resuspended in sterile 0.1 M sodium phosphate. OD600 readings are taken using a spectrometer and correlated to previously established OD600/CFU counts to estimate bacterial population densities, and the volume adjusted with additional sodium phosphate buffer to result in 100 mL aliquots of bacteria at a density of 1×108 cells/mL. To help break surface tension, aid bacterial entry into plants and provide microbes for some energy for growth, 10 μL of Silwet L-77 surfactant and 1 g of sucrose is added to each 100 mL aliquot (resulting in 0.01% v/v and 1% v/v concentrations, respectively) in a similar way as in the protocol for Agrobacterium-mediated genetic transformation of Arabidopsis thaliana seed [Clough, S., Bent, A. (1999) The Plant Journal 16(6): 735-743].
IX. Growth & Scale-Up of Fungi for Inoculation in Liquid Media
Once a fungal isolate has been characterized, conditions are optimized for growth in the lab and scaled-up to provide enough material for assays. For example, the medium used to isolate the fungi is supplemented with nutrients, vitamins, co-factors, plant-extracts, and/or other supplements that can decrease the time required to grow the fungal isolate and/or increase the yield of mycelia and/or spores the fungal isolate produces. These supplements can be found in the literature or through screening of different known media additives that promote the growth of all fungi or of the particular fungal taxa.
To scale up the growth of fungal isolates, isolates are grown from a frozen stock on Petri dishes containing media that promotes the growth of the particular fungal isolate and the plates are incubated under optimal environmental conditions (temperature, atmosphere, light). After mycelia and spore development, the fungal culture is scraped and resuspended in 0.05M Phosphate buffer (pH 7.2, 10 mL/plate). 1 liter of liquid media selected to grow the fungal culture is prepared in 2 L glass flasks and autoclaved and any required supplements added to the media. These are stored at room temperature for 2-5 days prior to inoculation to confirm sterility. 1 mL of the fungal suspension is added aseptically to the media flask, which is then incubated for 2-5 days, or until growth in the liquid media has reached saturation. Spore counts are determined using hemacytometer and correlated to previously established OD600/CFU counts to estimate fungal population densities, and the volume adjusted with additional sodium phosphate buffer to result in 100 mL aliquots of fungi at a density of approximately 106-1011 spores/mL. This suspension may or may not be filtered to remove mycelia and can be used to create a liquid microbial formulation as described herein to apply the fungal isolate onto a plant, plant part, or seed.
X. Creation of Liquid Microbial Formulations or Preparations for the Application of Microbes to Plants
Bacterial or fungal cells are cultured in liquid nutrient broth medium to between 102-1012 CFU/mL. The cells are separated from the medium and suspended in another liquid medium if desired. The microbial formulation may contain one or more bacterial or fungal strains. The resulting formulation contains living cells, lyophilized cells, or spores of the bacterial or fungal strains. The formulation may also contain water, nutrients, polymers and binding agents, surfactants or polysaccharides such as gums, carboxymethylcellulose and polyalcohol derivatives. Suitable carriers and adjuvants can be solid or liquid and include natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackifiers, thickeners, binders or fertilizers. Compositions can take the form of aqueous solutions, oil-in-water emulsions, or water-in-oil emulsions. Small amounts of insoluble material can optionally be present, for example in suspension in the medium, but it is generally preferred to minimize the presence of such insoluble material.
XI. Inoculation of Plants by Coating Microbes Directly onto Seed
Seed is treated by coating it with a liquid microbial formulation (prepared as described herein) comprising microbial cells and other formulation components, directly onto the seed surface at the rate of 102-108 microbial CFU per seed. Seeds are soaked in liquid microbial formulation for 1, 2, 3, 5, 10, 12, 18 or 24 hours or 2, 3, or 5 days. After soaking in microbial formulation, seeds are planted in growing containers or in an outdoor field. Seeds may also be coated with liquid microbial formulation by using an auger or a commercial batch treater. One or more microbial formulations or other seed treatments are applied concurrently or in sequence. Treatment is applied to the seeds using a variety of conventional treatment techniques and machines, such as fluidized bed techniques, augers, the roller mill method, rotostatic seed treaters, and drum coaters. Other methods, such as spouted beds may also be useful. The seeds are pre-sized before coating. Optionally the microbial formulation is combined with an amount of insecticide, herbicide, fungicide, bactericide, or plant growth regulator, or plant micro- or macro-nutrient prior to or during the coating process. After coating, the seeds are typically dried and then transferred to a sizing machine for grading before planting. Following inoculation, colonization of the plants or seeds produced therefrom is confirmed via any of the various methods described herein. Growth promotion or stress resilience benefits to the plant are tested via any of the plant growth testing methods described herein.
XII. Inoculation of Plants with a Combination of Two or More Microbes
Seeds can be coated with bacterial or fungal endophytes. This method describes the coating of seeds with two or more bacterial or fungal strains. The concept presented here involves simultaneous seed coating of two microbes (e.g., both a gram negative endophytic bacterium Burkholderia phytofirmans and a gram positive endophytic bacterium Bacillus mojavensis). Optionally, both microbes are genetically transformed by stable chromosomal integration as follows. Bacillus mojavensis are transformed with a construct with a constitutive promoter driving expression of a synthetic operon of GFPuv and spectinomycin resistance genes, while Burkholderia phytofirmans are transformed with a construct with a constitutive promoter driving expression of the lac operon with an appended spectinomycin resistance gene. Seeds are coated with a prepared liquid formulation of the two microbes the various methods described herein. Various concentrations of each endophyte in the formulation is applied, from 102 CFU/seed to about 108 CFU/seed. Following inoculation, colonization of the plants or seeds produced therefrom may be confirmed via any of the various methods described herein. Growth promotion or stress resilience benefits to the plant are tested via any of the plant growth testing methods described herein.
XIII. Culturing to Confirm Colonization of Plant by Bacteria
The presence in the seeds or plants of GFPuv or gusA-labeled endophytes can be detected by colony counts from mashed seed material and germinated seedling tissue using R2A plates amended with 5-Bromo-4-chloro-3-indolyl β-D-glucuronide (X-glcA, 50 μg/mL), IPTG (50 μg/mL) and the antibiotic spectinomycin (100 μg/mL). Alternatively, bacterial or fungal endophytes not having received transgenes can also be detected by isolating microbes from plant, plant tissue or seed homogenates (optionally surface-sterilized) on antibiotic free media and identified visually by colony morphotype and molecular methods described herein. Representative colony morphotypes are also used in colony PCR and sequencing for isolate identification via ribosomal gene sequence analysis as described herein. These trials are repeated twice per experiment, with 5 biological samples per treatment.
XIV. Culture-Independent Methods to Confirm Colonization of the Plant or Seeds by Bacteria or Fungi
One way to detect the presence of endophytes on or within plants or seeds is to use quantitative PCR (qPCR). Internal colonization by the endophyte can be demonstrated by using surface-sterilized plant tissue (including seed) to extract total DNA, and isolate-specific fluorescent MGB probes and amplification primers are used in a qPCR reaction. An increase in the product targeted by the reporter probe at each PCR cycle therefore causes a proportional increase in fluorescence due to the breakdown of the probe and release of the reporter. Fluorescence is measured by a quantitative PCR instrument and compared to a standard curve to estimate the number of fungal or bacterial cells within the plant.
XV. Experimental Description
The design of both species-specific amplification primers, and isolate-specific fluorescent probes are well known in the art. Plant tissues (seeds, stems, leaves, flowers, etc.) are pre-rinsed and surface sterilized using the methods described herein.
Total DNA is extracted using methods known in the art, for example using commercially available Plant-DNA extraction kits, or the following method.
Tissue is placed in a cold-resistant container and 10-50 mL of liquid nitrogen is applied. Tissues are then macerated to a powder.
Genomic DNA is extracted from each tissue preparation, following a chloroform:isoamyl alcohol 24:1 protocol (Sambrook, Joseph, Edward F. Fritsch, and Thomas Maniatis. Molecular cloning. Vol. 2. New York: Cold spring harbor laboratory press, 1989.).
Quantitative PCR is performed essentially as described by Gao, Zhan, et al. Journal of clinical microbiology 48.10 (2010): 3575-3581 with primers and probe(s) specific to the desired isolate using a quantitative PCR instrument, and a standard curve is constructed by using serial dilutions of cloned PCR products corresponding to the specie-specific PCR amplicon produced by the amplification primers. Data are analyzed using instructions from the quantitative PCR instrument's manufacturer software.
As an alternative to qPCR, Terminal Restriction Fragment Length Polymorphism, (TRFLP) can be performed, essentially as described in Johnston-Monje D, Raizada MN (2011) PLoS ONE 6(6): e20396. Group specific, fluorescently labelled primers are used to amplify a subset of the microbial population, especially bacteria, especially fungi, especially archaea, especially viruses. This fluorescently labelled PCR product is cut by a restriction enzyme chosen for heterogeneous distribution in the PCR product population. The enzyme cut mixture of fluorescently labelled and unlabeled DNA fragments is then submitted for sequence analysis on a Sanger sequence platform such as the Applied Biosystems 3730 DNA Analyzer.
XVI. Immunological Methods to Detect Microbes in Seeds and Vegetative Tissues
A polyclonal antibody is raised against specific bacteria X or fungus Y strains via standard methods. A polyclonal antibody is also raised against specific GUS and GFP proteins via standard methods. Enzyme-linked immunosorbent assay (ELISA) and immunogold labeling is also conducted via standard methods, briefly outlined below.
Immunofluorescence microscopy procedures involve the use of semi-thin sections of seed or seedling or adult plant tissues transferred to glass objective slides and incubated with blocking buffer (20 mM Tris (hydroxymethyl)-aminomethane hydrochloride (TBS) plus 2% bovine serum albumin, pH 7.4) for 30 min at room temperature. Sections are first coated for 30 min with a solution of primary antibodies and then with a solution of secondary antibodies (goat anti-rabbit antibodies) coupled with fluorescein isothiocyanate (FITC) for 30 min at room temperature. Samples are then kept in the dark to eliminate breakdown of the light-sensitive FITC. After two 5-min washings with sterile potassium phosphate buffer (PB) (pH 7.0) and one with double-distilled water, sections are sealed with mounting buffer (100 mL 0.1 M sodium phosphate buffer (pH 7.6) plus 50 mL double-distilled glycerine) and observed under a light microscope equipped with ultraviolet light and a FITC Texas-red filter.
Ultra-thin (50- to 70-nm) sections for TEM microscopy are collected on pioloform-coated nickel grids and are labeled with 15-nm gold-labeled goat anti-rabbit antibody. After being washed, the slides are incubated for 1 h in a 1:50 dilution of 5-nm gold-labeled goat anti-rabbit antibody in IGL buffer. The gold labeling is then visualized for light microscopy using a BioCell silver enhancement kit. Toluidine blue (0.01%) is used to lightly counterstain the gold-labeled sections. In parallel with the sections used for immunogold silver enhancement, serial sections are collected on uncoated slides and stained with 1% toluidine blue. The sections for light microscopy are viewed under an optical microscope, and the ultrathin sections are viewed by TEM.
XVII. Characterization of Uniformity of Endophytes in a Population of Seeds
To test for the homogeneity of endophytes either on the surface or colonizing the interior tissues in a population of seeds, seeds are tested for the presence of the microbes by culture-dependent and/or -independent methods. Seeds are obtained, surface sterilized and pulverized, and the seed homogenate is divided and used to inoculate culture media or to extract DNA and perform quantitative PCR. The homogeneity of colonization in a population of seeds is assessed through detection of specific microbial strains via these methods and comparison of the culture-dependent and culture-independent results across the population of seeds. Homogeneity of colonization for a strain of interest is rated based on the total number of seeds in a population that contain a detectable level of the strain, on the uniformity across the population of the number of cells or CFU of the strain present in the seed, or based on the absence or presence of other microbial strains in the seed.
XVIII. Experimental Description
Surface sterilized seeds are obtained as described herein. For culture-dependent methods of microbial-presence confirmation, bacterial and fungi are obtained from seeds essentially as described herein with the following modification. Seed homogenate is used to inoculate media containing selective and/or differential additives that will allow to identification of a particular microbe.
For qPCR, total DNA of each seed is extracted using methods known in the art, as described herein.
XIX. Characterization of Homogeneity of Colonization in Population of Plants
To test for the homogeneity of microorganisms (including endophytes) colonizing the interior in a population of plants, tissues from each plant are tested for the presence of the microbes by culture-dependent and/or -independent methods. Tissues are obtained, surface sterilized and pulverized, and the tissue material is divided and used to inoculate culture media or to extract DNA and perform quantitative PCR. The homogeneity of colonization in a population of plants is assessed through detection of specific microbial strains via these methods and comparison of the culture-dependent and culture-independent results across the population of plants or their tissues. Homogeneity of colonization for a strain of interest is rated based on the total number of plants in a population that contain a detectable level of the strain, on the uniformity across the population of the number of cells or CFU of the strain present in the plant tissue, or based on the absence or presence of other microbial strains in the plant.
XX. Experimental Description
Surface sterilized plant tissues are obtained as described herein. For culture-dependent methods of microbial-presence confirmation, bacterial and fungi are obtained from plant tissues essentially as described herein with the following modification. Plant tissue homogenate is used to inoculate media containing selective and/or differential additives that will allow identification of a particular microbe.
For qPCR, total DNA of each plant tissue is extracted using methods known in the art, as described herein.
Other embodiments will be apparent to those skilled in the art from consideration of the specification and practice of the embodiments. Consider the specification and examples as exemplary only, with a true scope and spirit being indicated by the following claims.
| Number | Date | Country | Kind |
|---|---|---|---|
| PCT/US2015/038187 | Jun 2015 | US | national |
This application is a continuation of U.S. application Ser. No. 15/540,961, filed Jun. 29, 2018, allowed, which is the National Stage of International Application No. PCT/US2015/068206, filed Dec. 30, 2015, which claims the benefit of and priority to International Application No. PCT/US2015/038187, filed Jun. 26, 2015, U.S. Provisional Application No. 62/156,021, filed May 1, 2015, U.S. Provisional Application No. 62/156,028, filed May 1, 201 S, U.S. Provisional Application No. 62/098,296, filed Dec. 30, 2014, U.S. Provisional Application No. 62/098,298, filed Dec. 30, 2014, U.S. Provisional Application No. 62/098,299, filed Dec. 30, 2014, U.S. Provisional Application No. 62/098,302, filed Dec. 30, 2014, and U.S. Provisional Application No. 62/098,304, filed Dec. 30, 2014, each of which is incorporated by reference it its entirety.
| Number | Date | Country | |
|---|---|---|---|
| 62098296 | Dec 2014 | US | |
| 62098299 | Dec 2014 | US | |
| 62098304 | Dec 2014 | US | |
| 62098302 | Dec 2014 | US | |
| 62098298 | Dec 2014 | US | |
| 62156028 | May 2015 | US | |
| 62156021 | May 2015 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 15540961 | Jun 2017 | US |
| Child | 16827551 | US |
