The present invention relates to genetically engineered bacteria that are used to generate self-adjuvanting outer membrane vesicles (OMVs) encasing protective antigens from Y. pestis, Bacillus anthracis, and Pseudomonas aeruginosa for use as vaccines.
Recent reports concerning the taxonomy of the genus Yersinia show it consists of 17 species, among which only three of 11 currently recognized species are human pathogens: Yersinia enterocolitica, Yersinia pseudotuberculosis, and Yersinia pestis.
Yersinia pestis is the etiological agent of plague, which is one of the most feared infectious disease in human history and responsible for more than 200 million deaths. Plague remains a public health concern in contemporary era, and is responsible for several thousand annual human cases worldwide. In 2015, 15 human cases of plague were reported in the US, resulting in 4 deaths and, in 2017, the island of Madagascar experienced a large outbreak of plague, where a total of 2348 cases of plague (˜70% are pneumonic form), including 202 deaths (case fatality rate: 8%), which incited regional panics. Pneumonic plague, the most dangerous form, rapidly progresses to death in 48 to 72 hours if antibiotic treatment is delayed beyond 24 hours, and also can be transmitted person-to-person via aerosol. Treatment of plague is dependent upon antibiotics which are currently effective for post-exposure mitigation of disease; however, Y. pestis strains resistant to eight antibiotics have been isolated from plague patients in Madagascar. Moreover, recent isolates from Mongolia corroborated the existence of naturally occurring, multi-drug resistant variants of Y. pestis. For longer-term protection and to counter drug-resistance Y. pestis occurring, vaccination is believed to be an efficient way (14, 15).
Recently, the main focus of plague vaccine research has been to develop subunit vaccines, in particular targeting LcrV and F1 antigens, which were found to efficiently protect rodent and cynomolgus macaque against bubonic and pneumonic plague and are well tolerated in humans. However, the subunit vaccine had insufficient and highly variable protection against pneumonic plague in African Green monkeys.
In order to improve efficacy of subunit vaccines, nanotechnology platforms have been employed to overcome the weak immunogenicity and intrinsic in vivo instability. A novel biodegradable polyanhydride nanoparticle-encapsulated with F1-LcrV vaccine could induce long-lasting mature antibody responses and protective immunity against pneumonic plague. Immunization with the bacteriophage T4 DNA nanoparticles carrying F1-LcrV elicited robust antibody and cellular immune responses and provided complete protection to mice and rats against intranasal challenge with high doses of Y. pestis CO92. Thus, Nano-antigen delivery platforms may provide a novel strategy to generate efficacious plague vaccines. However, isolation of virulent F1-negative Y. pestis strains from natural sources and the existence of LcrV polymorphisms in Yersinia may result in Y. pestis variants that escape protective immunity induced by LcrV and F1 antigens. Therefore, vaccines solely based upon LcrV and F1 antigens may be insufficient to guarantee long-term defense against plague in humans.
One critical strategy used by Y. pestis to evade host immune responses is to produce a tetra-acylated form of lipid A at 37° C. that is not recognized by Toll-like receptor 4 (TLR4) due to absence of LpxL (lauroyltransferase). Although Y. pestis is capable of synthesizing stimulatory hexa-acylated lipid A due to presence of LpxP (palmitoleoyltransferase), its activity is dependent on low temperature (26° C.). In human PBMCs, activation induced by LPS from Y. pestis grown at 26° C. and LPS from Escherichia coli was significantly inhibited by LPS from Y. pestis grown at 37° C. synthesizing tetra-acylated lipid A. The ΔlpxP32::PlpxL lpxL mutation was introduced, which deletes the lpxP gene and inserts E. coli lpxL into the chromosome of Y. pestis KIM6+ to create strain χ10015, which produces hexa-acylated lipid A at both 26° C. and 37° C. Strain χ10015(pCD1Ap), into which the pCD1Ap virulence plasmid was introduced, was highly attenuated by subcutaneous (s.c.) administration. However, mice s.c. immunized with χ10015(pCD1Ap) had significant reactogenicity due to the toxic hexa-acylated lipid A. Subsequently, strain χ10027 (ΔlpxP32::PlpxL lpxL ΔlacI23::Plpp lpxE) was constructed that heterologously expresses the lpxE gene encoding the lipid A 1-phosphatase from Francisella novicida in Y. pestis, predominantly yielding 1-dephosphorylated hexa-acylated lipid A (Monophosphoryl Lipid A, MPLA), when χ10027 was grown at both 26° C. and 37° C. MPLA isolated from strain χ10027 (ΔlpxP32::PlpxL lpxL ΔlacI23::Plpp lpxE) exhibited a significant reduced capacity to activate HEK293 cells/TLR4-MD2 and other mammalian cells in vitro, in comparison with lipid A from χ10015. MPLA is an endotoxin derivative that has been approved by US and European authorities as a vaccine adjuvant in humans and exhibits potent adjuvant activity but is 100- to 10,000-fold less toxic than native lipid A (biphosphoryl lipid A). The attenuated toxicity of MPLA is associated with reduced induction of proinflammatory cytokines such as tumor necrosis factor alpha (TNF-α), interleukin-1β (IL-1β), and gamma interferon (IFN-γ) during initial exposure. Thus, OMVs isolated from the genetically modified χ10027 strain would retain high immunostimulatory activity whilst diminishing toxicity.
Y. pseudotuberculosis is thought to be the direct evolutionary ancestor of Y. pestis. The two species diverged from one another 2,600-28,000 years ago. With the exception of two additional plasmids carried by Y. pestis (pPCP1 and pMT1), the two species share >95% genetic identity and a common virulence plasmid with a conserved colinear backbone. Blast analysis of several major Y. pestis antigens shows that LcrV shares 96% amino acid identity between the two species, additional antigens, Psn, Ail (OmpX) and YadC shown to be protective against Y. pestis challenge share 100% and >97%, respectively. Although Y. enterocolitica is a distant species to Y. pestis/Y. pseudotuberculosis in phylogenetical tree, they still share many homologous genes by entire genomic analysis. Currently, there are no effective vaccines to prevent Y. pestis infection in humans.
Bacillus anthracis, the causative agent of anthrax, is a Gram-positive, spore-forming bacilli that causes bacteremia and toxemia in its systemic form through an array of virulence factors. Human anthrax results from contact with infected animals, contaminated animal products, or after exposure to accidentally or intentionally released spores of B. anthracis. Anthrax have three types of clinical forms: cutaneous, gastrointestinal and pulmonary. Each type can progress to fatal systemic anthrax, but untreated pulmonary anthrax acquired by inhalation is the most severe form. Pulmonary anthrax has a mortality as high as 100% if no interventions in time and 45% with treatment. The development of anthrax as a biological weapon by several foreign countries has been documented. In North America, human cases of anthrax are infrequent. However, B. anthracis sent through the United States Postal Service (USPS) caused 22 cases of anthrax, including 5 deaths In 200, which poses huge public panics in US. Because spores of B. anthracis are so resistant to destruction and can be easily spread by release in the air coupled with high rates of mortality, B. anthracis is considered as an agent with potential biological terrorism threat by the United States military and also classified as a Tier-1 biothreat agent by CDC.
The current anthrax vaccines are approved for pre-exposure and post-exposure prophylaxis of disease in person at high-risk of exposure and for persons with suspected or confirmed exposure in conjunction with antibiotics, respectively. Both vaccines prepared from crude cultures of different B. anthracis strains contained protective antigen (PA) and residual amounts of anthrax toxins lethal factor (LF) and edema factor (EF) that causes certain adverse reactions and use limitations. Moreover, vaccination regimen requiring many priming and booster doses and shelf-life limitation due to the instability of the PA, are challenging widespread use of these vaccines. Alternative means have been studied to address the limitations of current anthrax vaccines via various particulate systems including polymeric nano/microparticles, nanoemulsions, and liposomes to deliver protective antigens of B. anthracis. The valuation for anthrax vaccines market was $465.5 million in 2018, and it is expected to reach $863.7 million by 2026.
Y. pestis and B. anthracis are both etiological agents for worldwide zoonotic diseases and are considered among the most feared potential bioterror agents. Their natural outbreak or malicious dissemination can cause widespread panics as recent Ebola outbreaks in West Africa, resulting in huge economic and social collapse on a global scale. Therefore, it is imperative to develop a vaccine that can elicit concerted protective immunity against both pathogens with spared doses and short-term immunization regimens. Also, stockpiling a such vaccine would be extremely valuable in protecting the general public against potential biological threats. Recently the brand name of the 6-in-1 vaccine, Infanrix Hexa, which stands for ‘Diphtheria, Tetanus, acellular Pertussis, Hib, Hepatitis B and Inactivated Polio Vaccine, was used in the UK to reduce the number of injections a child needs (http://vk.ovg.ox.ac.uk/6-in-1-vaccine), which provides a proof of concept fora two-in-one vaccine for plague and anthrax.
P. aeruginosa (PA) is a Gram-negative bacterium that is widely found in the environment e.g. soil, water and other moist locations and is an opportunistic pathogen that takes advantage of an individual's compromised immune system to establish an infection. In the hospital setting, PA is one of the leading pathogens responsible for pneumonia, surgical infection, bacteremia and other life-threatening infections worldwide. This bug is most problematic to those long-term hospitalized patients in intensive care units and burn victims. U.S. CDC reports showed that PA was the most commonly isolated gram-negative pathogen in ventilator-associated pneumonia (VAP) in 2009-2010 and was the second most common pathogen overall, accounting for 11% of total cases. The VAP caused by PA contributes to a mortality rate as high as 13.5%. PA infection in burn patients can quickly develop a systemic infection with a mortality rate ranging from 38% to 70%. PA is also a leading cause of life-threatening infections in immunocompromised hosts with underlying diseases such as cancer or AIDS. In addition, cystic fibrosis (CF) patients highlighting mucus accumulation, are frequent and persistent bacterial infection causing chronic inflammation of the lungs. This abundance of microbes colonizing the respiratory tract, and particularly the lower airways, is facilitated by thick airway mucus and deficient mucociliary clearance in CF patients. Among these microbes, PA, a dominant airway pathogen, chronically infects up to 60-75% of adult CF patients, causes decline of lung function and is strongly associated with mortality increase. PA has a complex gene regulation network including hundreds of genes that can facilitate bacterium rapidly adapted to different environments, resulting in its intrinsic resistance to treatment of antibiotics. Recent studies report that the resistance rates of PA are increasing in many parts of the world. Multi-drug-resistant (MDR) and extreme drug-resistant (XDR) high-risk strains are widespread in healthcare settings, causing extreme challenges for PA treatment. To combat the spread of PA infection, vaccination against PA would be an effective means to eliminate or reduce the need of antibiotic agents that result in problems of antibiotic resistance.
Nanocarrier-based delivery systems facilitate uptake by phagocytic cells, the gut-associated lymphoid tissue, or the mucosa-associated lymphoid tissue, leading to efficient antigen recognition and presentation, thereby offering an opportunity to enhance the humoral and cellular immune responses. Outer membrane vesicles (OMVs) are nanosized lipid vesicles released by a diverse range of Gram-negative bacteria that are enriched in protein, polysaccharide, DNA/RNA and lipid microbial components, including plentiful potent immunogens. OMVs typically range between 20-200 nm, readily enabling entry into lymph vessels and uptake by antigen presenting cells. By retaining composition of the pathogen antigenic surface, OMVs elicit innate immunity as well as prime humoral and cell-mediated immune responses. A licensed OMV vaccine against Neisseria meningitides has been proven safe and protective in humans. OMVs provide an economically favorable vaccine platform as a result of inexpensive preparation and high stability. Furthermore, OMVs encase a broad spectrum of immunogens, providing the theoretical advantages of simultaneously priming immunity against many antigens and thereby reducing the likelihood of antigen circumvention. Yersinia could produce and release native OMVs under physiological conditions. Therefore, the genetically modified Yersinia strain producing an adjuvant formed lipid A (MPLA) and synthesizing multiple protective antigens from Y. pestis and B. anthracis is used to generate self-adjuvanting nanoparticles (OMVs). Immunization with the self-adjuvanting OMVs would offer premium protection against two deadly agents simultaneously.
The invention comprises certain Y. pestis mutant constructions that can produce highly immunogenic self-adjuvanting OMVs. Intramuscular immunization with OMVs from these constructions affords significant protection against three pathogenic Yersinia species, Y. pestis, Y. enterocolitica, and Y. pseudotuberculosis in mice.
Some embodiments of the invention include: (1) heterologously expresses the lpxE gene encoding the lipid A 1-phosphatase from Francisella novicida in the lpxL inserted the Y. pestis construction, predominantly yielding 1-dephosphorylated hexa-acylated lipid A (Monophosphoryl Lipid A, MLPA) to generate self-adjuvanted OMVs which deliver innate signals through TLR ligands to induce Yersinia-specific T-cell and B-cell immunity. (2) highly secret prominent protective antigens LcrV into periplasm of bacteria by Type Two Secretion System (T2SS); (3) Remove virulence factors [Yops, Pla and Ymt (murine toxin)] that are immunosuppressive or otherwise interfere with protective immune responses; and (4) disrupt tolR, yrbE, lpp or nlpI (y0695) genes in a Y. pestis construction to highly increase OMV production.
The invention provides OMVs from a genetically modified Y. pestis strain that can be used to express heterologous antigens (such as B. anthracis protective antigens), wherein the OMVs are able to encase heterologous antigens from heterologous pathogens.
The invention comprises a Y. pseudotuberculosis PB1+ strain, a progenitor of Y. pestis, that can be incorporated different mutations, such as, lpxE, tolR, yrbE, lpp, nlpI (YPTS_0515), asd or the caf operon to synthesize Y. pestis F1 antigen in a Y. pseudotuberculosis strain. The genetically modified Y. pseudotuberculosis strain (YptbS44, Table 4) can produce high amounts of immunogenic OMVs containing homologous and heterologous protective antigens of Y. pestis, B. anthracis or other pathogens.
OMVs produced by genetically modified Y. pestis or Y. pseudotuberculosis constructions provide the advantage of simultaneously priming humoral and cellular immune responses against many Yersinia homologous surface antigens, thereby greatly enhancing the likelihood of broad-based protection against plague caused by Y. pestis and Yersiniosis caused by Y. pseudotuberculosis and Y. enterocolitica.
The invention comprises the genetically modified Y. pseudotuberculosis strain that can produce high amounts of immunogenic OMVs containing heterologous protective antigens of P. aeruginosa (PcrV and HitA).
The invention comprises the genetically modified P. aeruginosa strain (can produce high amounts of immunogenic OMVs containing heterologous protective antigens of P. aeruginosa (PcrV and HitA).
The invention comprises a Y. enterocolitic strain, a close relative of Y. pestis, that can incorporate different mutations, such as, lpxE, tolR, yrbE, lpp, nlpI, asd or the caf operon to synthesize Y. pestis F1 antigen in a Y. enterocolitic strain. The genetically modified Y. enterocolitic strain can produce high amounts of immunogenic OMVs containing homologous and heterologous protective antigens of Y. pestis, B. anthracis or other pathogens.
Immunization with OMVs trapped homologous or heterologous antigens from genetically modified Y. pestis, Y. pseudotuberculosis, Y. enterocolitic or Pseudomonas aeruginosa. strains can induce significant protective immunity against pathogenic Yersinia spp., B. anthracis, Salmonella spp., P. aeruginosa, Klebsiella pneumoniae, or other pathogens. Also, OMVs can be administrated by intradermal, intranasal or oral route to induce mucosal immunity.
The present invention will be more fully understood and appreciated by reading the following Detailed Description in conjunction with the accompanying drawings, in which:
The present invention is directed to the use of an outer membrane vehicle as a new plague vaccine. More specifically, a vaccine platform according to the present invention was developed and tested using a Yersinia pestis mutant synthesizing an adjuvant form lipid A (monophosphoryl lipid A, MPLA) that largely increased biogenesis of bacterial outer membrane vesicles (OMVs). To enhance the immunogenicity of the OMVs, an Asd-based balanced-lethal host-vector system was constructed to oversynthesize the LcrV antigen of Y. pestis, raise the amounts of LcrV enclosed in OMVs by Type II secretion system, and eliminate harmful factors like plasminogen activator (Pla) and murine toxin from the OMVs. As described herein, vaccination with OMVs containing MPLA and increased amounts of LcrV with diminished toxicity afforded complete protection in mice against subcutaneous challenge and intranasal challenge and was significantly superior to that resulting from vaccination with LcrV/alhydrogel. Self-adjuvanting Y. pestis OMVs are therefore a new plague vaccine candidate and that the design of OMVs according to the present invention could serve as a robust approach for vaccine development. For instance, OMVs may be used to induce an immune response to one or more of the pathogens Y. pestis, Y. pseudotuberculosis, and Y. enterocolitica. Advantageously, OMVs can deliver heterologous antigens of other pathogens (such as B. anthracis) and may be used to prevent corresponding diseases in animals and humans.
The present invention comprises certain recombinant Y. pestis strains. Typically, the bacterium is derived from Y. pestis KIM6+. Alternatively, a bacterium of the invention may be a strain listed in Table 1.
Several Yersinia species are amenable for use in the present invention. In one embodiment, a recombinant Yersinia bacterium of the invention may be a Y. pestis bacterium. In another embodiment, a recombinant Yersinia bacterium of the invention may be a Y. pseudotuberculosis or Y. enterocolitica bacterium. The Δasd, ΔyrbE, ΔtolB, Δlpp, ΔnlpI, ΔlacZ::caf1R-caf1M-caf1A-caf1 may be introduced into Y. pseudotuberculosis or Y. enterocolitica to achieve hyper-vesiculation in bacteria and produce high amounts of OMVs. In addition, the Δyops (cure of pYV plasmid that is similar to pCD1) would be introduced into Y. pseudotuberculosis or Y. enterocolitica to eliminate potential immune suppression caused by these virulence factors and enhance protective immune response of OMVs against pathogens. In yet another embodiment, a recombinant Yersinia bacterium may be a Y. pestis or Y. pseudotuberculosis bacterium, such as YPS or YPtbS listed in Table 1 and Table 4.
The present invention encompasses a recombinant Yersinia bacterium capable of adapted an Asd+ plasmid using a balance-lethal system to over-synthesize protective antigens and generate OMVs containing these antigens. “OMVs” as used herein, Bacterial outer membrane vesicles (OMVs) are vesicles of lipids released from the outer membranes of bacteria. These vesicles may be involved in trafficking bacterial cell signaling biochemicals, which may include DNA, RNA, proteins, endotoxins and allied virulence molecules. OMVs have multiple mechanisms whereby they interact with and regulate innate immune responses to facilitate the onset of bacterial pathogenesis in the host, also OMVs can modulate adaptive immune responses to bacterial pathogens via multiple mechanisms.
A bacterium capable of vesiculation, Vesiculation is a ubiquitous secretion process of Gram-negative bacteria, where outer membrane vesicles (OMVs) are small spherical particles on the order of 30 to 300 nm composed of outer membrane (OM) and lumenal periplasmic content. In one embodiment of the invention, LpxE, a 1-dephosphase from Francisella novicida, is able to remove 1-phosphate of lipid A. The bacterium with the lpxE expression can produce monophosphate lipid A (MPLA) and significantly increase bacterial vesiculation, resulting high OMV production. In a preferred embodiment of the invention, such hyper-vesiculation can be achieved by disrupting certain genes ΔyrbE, ΔtolR, Δlpp, and ΔnlpI, that are associated with maintenance of bacterial membrane integrity.
As used herein, “antigen” refers to a biomolecule capable of eliciting an immune response in a host. In some embodiments, an antigen may be a protein, or fragment of a protein, or a nucleic acid. In an exemplary embodiment, the antigen elicits a protective immune response. As used herein, “protective” means that the immune response contributes to the lessening of any symptoms associated with infection of a host with the pathogen the antigen was derived from or designed to elicit a response against. For example, a protective antigen from a pathogen, such as Bacillus anthracis, may induce an immune response that helps to ameliorate symptoms associated with B. anthracis infection or reduce the morbidity and mortality associated with infection with the pathogen. The use of the term “protective” in this invention does not necessarily require that the host is completely protected from the effects of the pathogen.
Some examples of microorganisms useful as a source for antigen are listed below. These may include microorganisms for the control of plague caused by Yersinia pestis and other Yersinia species such as Y. pseudotuberculosis and Y. enterocolitica, for the control of gonorrhea caused by Neisseria gonorrhoea, for the control of syphilis caused by Treponema pallidum, and for the control of venereal diseases as well as eye infections caused by Chlamydia trachomatis. Species of Streptococcus from both group A and group B, such as those species that cause sore throat or heart diseases, Erysipelothrix rhusiopathiae, Neisseria meningitidis, Mycoplasma pneumoniae and other Mycoplasma-species, Hemophilus influenza, Bordetella pertussis, Mycobacterium tuberculosis, Mycobacterium leprae, other Bordetella species, Bacillus anthracis, Clostridium difficile, Clostridium perfringens, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumannii, Escherichia coli, Salmonella typhimurium, Salmonella typhi, Salmonella paratyphi, Streptococcus equi, Streptococcus pneumoniae, Brucella abortus, Pasteurella hemolytica and P. multocida, Vibrio cholera, Shigella., RNA viruses, for example from the classes, influenza viruses Papovavirus, Adenovirus, Herpesvirus, Poxvirus, Parvovirus, Reovirus, Picornavirus, Myxovirus, Paramyxovirus, Flavivirus or Retrovirus (including HIV). Antigens may also be derived from pathogenic fungi, protozoa, parasites and human cancers.
A suitable antigen derived from Yersinia and designed to induce an immune response against Yersinia may include LcrV, F1, Psn and Ail. LcrV of Yersinia is a 37-kDa multifunctional protein that has been shown to act at the level of secretion control by binding the Ysc inner-gate protein LcrG and to modulate the host immune response by altering cytokine production. LcrV also is essential for the unidirectional targeting of Yops to the cytosol of infected eukaryotic cells. A promising subunit vaccine is based on LcrV. Active immunization with purified V antigen or passive immunization with antiserum against V antigen provides protection against plague in mice. CD8+ T-cell immune responses primed to LcrV appear to confer protection against Y. pestis in mice. In one embodiment, a live attenuated Y. pseudotuberculosis used as a vector to inject the LcrV antigen from Y. pestis via T3SS elicits both antibody responses and specific T-cell responses to LcrV of Y. pestis, resulting in enhanced protective immunity against plague.
In another embodiment, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian hosts. Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. Immunity to infection has been correlated with the presence of antibody to the capsular F1 antigen, and immunization with the F1 antigen induces protection against the disease in animal models. A live attenuated Y. pseudotuberculosis strain with the caf operon inserted into its chromosome to synthesize F1 in a temperature-dependent manner, can enhance its immunogenicity.
In another embodiment, Pesticin receptor (Psn), an outer membrane protein that is chromosomally in the high pathogenicity island which is present only in highly pathogenic strains of Yersinia such as Y. enterocolitica 1B, Y. pseudotuberculosis and Y. pestis. Psn is part of an inorganic iron transport system. Psn as an antigen can stimulate protective immune response against Y. pestis infection.
In an exemplary embodiment, a bacterium of the invention may comprise one or more mutations selected from the group comprising Δasd, ΔlacZ::caf1R-caf1M-caf1Δ-caf1, ΔyrbE, ΔtolR, Δlpp, and ΔnlpI.
In another embodiment, a bacterium of the invention harboring a plasmid may comprise multiple antigens from Yersinia, such as LcrV, Psn, YopD, and Bacillus anthracis, such as PA, LF, EF, and exosporium antigen BxpB.
A recombinant bacterium of the invention may be administered to a host as a vaccine composition. As used herein, a vaccine composition may be a composition designed to elicit an immune response against Yersinia. Additionally, a vaccine composition may be a composition designed to elicit an immune response against Yersinia and against one or more additional pathogens, such as, Brucella, B. anthracis, Clostridium, Francisella, Burkholderia, Borrelia, E. coli, Salmonella, Staphylococcus, pseudomonas or Klebsiella. In an exemplary embodiment, the immune response is protective, as described above.
Vaccine compositions of the present invention may be administered to any host capable of mounting an immune response. Such hosts may include all vertebrates, for example, mammals, including domestic animals, agricultural animals, laboratory animals, humans, and rarely in cold-blood animals.
In exemplary embodiments, OMVs from the recombinant bacterium is alive when administered to a host in a vaccine composition of the invention. Suitable vaccine composition formulations and methods of administration are detailed below.
A vaccine composition comprising a recombinant bacterium of the invention may optionally comprise one or more possible additives, such as carriers, preservatives, stabilizers, adjuvants (CpG, polyI:C, c-di-GMP, or Curdlan), and other substances.
The dosages of a vaccine composition of the invention can and will vary depending on the antigen amounts in OMVs, the intended host, and immunization route, as will be appreciated by one of skill in the art. Generally, the dosage need only be sufficient to elicit a protective immune response in a majority of hosts. Routine experimentation may readily establish the required dosage. Typical initial dosages of vaccine for intramuscular injection could be about 50 to 100 μl depending upon the preparation of OMVs. Administering multiple dosages may also be used as needed to provide the desired level of protective immunity.
A vaccine of the invention may be administered via any suitable route, such as by intradermal, intramuscular, subcutaneous or intranasal administration. Additionally, other methods of administering the OMVs, such as, oral administration or other parenteral routes, are possible.
A further aspect of the invention encompasses methods of using an OMV of the invention. For instance, in one embodiment the invention provides a method for modulating a host's immune system. The method comprises administering to the host an effective amount of a composition comprising an OMV of the invention. One of skill in the art will appreciate that an effective amount of a composition is an amount that will generate the desired immune response (e.g., innate, mucosal, humoral or cellular). The monitoring of the response can be by quantitating the titers of antibodies or lymphocytes recognizing the selected antigens or by demonstrating and measuring the level of protective immunity.
In still another embodiment, an OMV of the invention may be used in a method for eliciting an immune response against Yersinia and one or more additional pathogens in an individual in need thereof. The method comprises administrating to the host an effective amount of a composition comprising an OMV as described herein.
In a further embodiment, an OMV described herein may be used in a method for ameliorating one or more symptoms of bubonic plague, pneumonic plague, yersiniosis, or anthrax in a host in need thereof. The method comprises administering an effective amount of a composition comprising an OMV as described herein.
Materials and Methods
Bacterial strains, plasmids, culture conditions, and molecular operations. All bacterial strains and plasmids used in this study are listed in Table 1 and Table 2 below. All bacterial cultures and molecular procedures as in the Supplementary Information below.
E. coli
X6212
E. coli
X7213
Y. pestis
χ10015
χ10027
OMV isolation. OMVs were isolated from Y. pestis strains as previously described with minor modifications. Briefly, the strains were grown at 28° C. in heart Infusion broth (Difco) for 14 h and then incubated at 37° C. for 4 h. The bacterial cultures were supplemented with EDTA (pH 8.0) at 100 mM and kept on ice for 1 h. Then, the bacterial cells were pelleted by centrifugation at 10,000×g at 4° C. for 20 min. The culture supernatant was filtered using a 0.45 μm pore membrane (Millipore) to remove the residual bacterial cells and concentrated with a 100 kDa filter using a Vivaflow 200 system (Sartorius). The OMVs were harvested by ultracentrifugation (120,000×g) for 2 h at 4° C. The vesicle pellet was washed and resuspended in 0.1× sterilized PBS (pH 7.4), and the ultracentrifugation step was repeated. The final vesicle pellet was resuspended in 0.1× sterilized PBS, filtered with a 0.22 μm pore membrane (Millipore) and stored at −80° C. for subsequent experiments. The bacteria and OMV were viewed by Transmission electron microscopy (SI Appendix).
OMV analysis. A Bradford assay was performed as described previously for quantifying the total protein abundance associated with OMVs. The relative lipid contents of the OMVs were determined via a FM4-64 fluorescence dye binding assay measured by a SpectraMax® iD3 Multi-Mode Microplate Reader (Molecular Devices). The values of the protein amounts and lipid contents were normalized according to the total bacterial number (×1011 CFU). The major outer membrane proteins present in the OMV preparations were detected by immunoblotting. Proteomic analysis of OMVs (SI Appendix).
Animal experiments. All animal studies were conducted in accordance with the NIH “Guide for the Care and Use of the laboratory Animals” and approved by the Institutional Animal Care and Use Committee at Albany Medical College (IACUC protocol #18-02004). Six-week-old male and female Swiss Webster mice were purchased from Charles River Laboratories (Wilmington, Mass.) and acclimated for one week after arrival. The groups of mice were intramuscularly (i.m.) immunized with 400 μg OMVs in 100 μl PBS buffer, 100 μl of a mixture containing 10 μg LcrV/alhydrogel, as a positive control, or 100 μl PBS/alhydrogel, as a negative control. Booster vaccinations were then administered 3 weeks after the initial vaccination. Blood was collected via submandibular veins every 2 weeks to harvest sera for antibody analysis. At 42 days after the initial vaccination, animals were challenged s.c. with Y. pestis KIM6+(pCD1Ap) in 100 μl PBS to mimic bubonic plague. For mimicking pneumonic plague, animals were anesthetized with a 1:5 xylazine/ketamine mixture and were challenged i.n. with virulent Y. pestis in 40 μl PBS. The LD50 values of Y. pestis KIM6+(pCD1Ap) administered by s.c. and i.n. challenge in mice were 10 CFU and 100 CFU, respectively. All infected animals were observed over a 15-day period. For the determination of the bacterial burden, the animals were euthanized with an overdose of sodium pentobarbital. Lungs, livers and spleens were removed at the indicated times and homogenized in ice-cold PBS (pH 7.4) using a bullet blender (Bullet Blender Blue; N.Y., USA) at power 7 for 2 min. Serial dilutions of each organ homogenate were plated on HIB agar, and each count was confirmed with duplicate plates with a minimum of 2 dilutions to determine the titers of bacteria per gram of tissue. The experiments were performed twice, and the data were combined for analysis.
Measurement of antibody responses and cytokines. An enzyme-linked immunosorbent assay (ELISA) was used to assay antibody titers against LcrV, F1 or Y. pestis whole cell lysates (YPL) in serum as described in our previous report. A mouse multiplex cytokine assay kit (Bio-Plex) was used to detect the cytokines and chemokines in the BALF and sera collected from the mice according to the manufacturer's instructions.
Analysis of cellular immune responses. Lungs and spleens were obtained aseptically from euthanized animals and dissociated with 70 μm strainers to obtain single cells. The RBC-lysed individual cell populations (2×106) were seeded in 12-well cell culture plates and stimulated in vitro for 72 h with 20 μg/ml rLcrV. Four hours before the collection of the cells, the culture media in each well was supplemented with brefeldin-A and a monensin cocktail (1:1 ratio) to block Golgi-mediated cytokine secretion. For the flow cytometric analysis of the T-cell populations and their corresponding cytokines, the induced cells were harvested and resuspended in FACS staining buffer containing CD16/32 antibodies (1:200) for 10 min on ice. The T-cell-specific markers were stained using anti-mouse antibodies as in Table 3 according to the manufacturer's protocol. The samples were acquired on BD flow cytometers (LSRII) and were analyzed using FlowJo v.10.
Cells from the BALF and lungs of mice were resuspended in 30 μL of FACS straining solution containing Fc block (CD16/32) at a 1:100 dilution and incubated at room temperature for 15 min to block macrophage Fc receptors. The cell suspensions were then pelleted at 650×g for five min at 4° C. The cells were resuspended and incubated for 30 min at 4° C. with the following fluorescently labeled antibodies (SI Appendix, Table 3) in flow cytometry buffer (1% BSA in PBS) for the staining of cell surface markers. The stained cells were analyzed based on fluorescence staining patterns to identify the alveolar macrophages (Siglec-F+F4/80+CD11bmid/low+CD11chigh+Ly6G−), monocytes (CD11bhigh+CD11clow+Ly−6G−) and neutrophils (CD45+ Ly−6G+).
Statistical analysis. Each experiment included a significant number (minimum of 3) of biological replicates, with 2-3 replicates performed in a synchronized fashion to establish reproducibility. The statistical analyses of the data among the groups were performed with one-way ANOVA/univariate or two-way ANOVA with Tukey post hoc tests. The log-rank (Mantel-Cox) test was used for the survival analysis. All data were analyzed using GraphPad PRISM 8.0 software. The data are represented as the mean±standard deviation; ns, no significance, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.
Results
Lipid A 1-dephosphorylation of Y. pestis affects bacterial morphology and increases OMV biogenesis. Previously, Y. pestis KIM6+ isogenic mutants: χ10015 (ΔlpxP:: PlpxLlpxL) and χ10027 (ΔlpxP:: PlpxL lpxL ΔlacZ:: Plpp lpxE) (Table 1), produced conventional hexa-acylated lipid A and 1-dephosphorylated hexa-acylated lipid A at 28° C. and 37° C., respectively. χ10027 was more susceptible to polymyxin B than KIM6+ and χ10015, suggesting that lipid A 1-dephosphorylation might influence bacterial membrane stability and morphology. Thus, transmission electron microscopy was employed to visualize all three strains when they were cultured in heart infusion broth (HIB) at 28° C. for 14 h and then incubated at 37° C. for 4 h. The morphologies of KIM6+ and χ10015 were observed as a mixture of coccus and bacillus shapes (
To determine the effect of lipid A remodeling on Y. pestis OMV biogenesis, it was initially confirmed that OMV biogenesis occurred in each Y. pestis strain cultured at 28° C. for 14 h and then incubated at 37° C. for 4 h. The results showed that KIM6+, ×10015 and χ10027 all produced OMVs, but the sizes of the OMVs from χ10027 were much smaller than those from Y. pestis KIM6+ and χ10015 (
A balanced-lethal system for oversynthesizing LcrV antigen in Y. pestis. The three above-described strains harboring the virulence plasmid pCD1 are Select agents and must be studied in a Biosafety Level 3 (BSL3) lab. Growing large cultures of these bacteria in BSL3 for OMV isolation is inconvenient and prohibited. A suite of virulence effectors, Yops (YopE, YopJ, YopH, YopM and YopT), that are encoded on the virulence plasmid pCD1 (˜70 kb) suppress innate immunity to favor Y. pestis infection upon translocation into host mammalian cells by the T3SS. As a vaccine, OMVs derived from pCD1+ Y. pestis that package Yops may result in potential immune suppression. To avoid these concerns, pCD1-deficient Y. pestis strains were used to produce OMVs in a BSL2 lab. However, OMVs from pCD1-deficient Y. pestis lack the indispensable protective antigen LcrV, which is encoded on the pCD1 plasmid. To overcome this deficiency, a balanced lethal system was constructed to introduce an asd mutation into each Y. pestis strain to generate YPS1, YPS2 and YPS3, respectively (Table 1), which can adopt an Asd+ plasmid for the oversynthesis of LcrV.
Two Asd+ plasmids were constructed: pSMV12 (V), containing the native lcrV gene of Y. pestis and pSMV13 (Bla-V), containing the N-terminal β-lactamase signal sequence (bla ss) fused with Y. pestis lcrV to facilitate LcrV secretion into the periplasm by the Type II secretion system (T2SS) (
Elimination of potential virulence factors from Y. pestis OMVs. Y. pestis harbors two additional plasmids, pPCP1 (9.6 kb), encoding the plasminogen activator (Pla), and pMT1 (102 kb), encoding murine toxin (Ymt) and the protective antigen F1. Pla is necessary for Y. pestis dissemination and the inhibition of immune cell recruitment and induces fibrinolysis. Murine toxin, which is encoded by ymt, is highly toxic in mice and rats but is less toxic in larger animals. Pla and Ymt are clearly present in Y. pestis OMVs (
The stimulation and cytotoxicity of OMVs from YPS7(Bla-V), YPS8(Bla-V) or YPS9(Bla-V) cultured with different cell lines was compared in vitro and found that OMVs from YPS9(Bla-V) could activate the TLR4-mediated NF-κB signaling pathway but showed less stimulatory activity than OMVs from the other two strains (
Immunization with self-adjuvanting OMVs afforded complete protection against Y. pestis challenge. Groups of mice (n=10) were intramuscularly immunized with OMVs purified from YPS9(Bla-V), LcrV/alhydrogel or PBS/alhydrogel (sham) and boosted at 21 days after the prime immunization (
On day 42 after the initial vaccination, the mice were challenged by the subcutaneous (s.c.) or intranasal (i.n.) route to mimic bubonic or pneumonic plague, respectively. All OMV-immunized mice survived s.c. challenge with 8×105 CFU (8×104 LD50) of Y. pestis KIM6+(pCD1Ap), while 80% of the LcrV-immunized mice survived the same challenge (
Vaccination with self-adjuvanting OMVs elicited Th1/Th2-balanced immune responses. In mice, IgG1 is associated with a Th2-like response, while a Th1 response is associated with the production of IgG2a, IgG2b, and IgG3 antibodies. Therefore, the IgG subtypes produced in response to each antigen were analyzed to distinguish between Th1/Th2 immune responses in immunized mice. The anti-LcrV IgG1 titers were high and showed similar profiles as the anti-LcrV total IgG titers in both LcrV- and OMV-immunized mice (
Vaccination with self-adjuvanting OMVs induced potent cellular immune responses. After 72 h of in vitro induction with LcrV or PBS, lung lymphocytes from OMV-immunized mice showed substantial increases in both the CD4 and CD8 T cell populations (
Similarly, splenocytes from both OMV- and LcrV-immunized mice also showed increased production of CD4+ and CD8+ T cells in comparison to those from sham mice after in vitro stimulation with LcrV (
In vivo responses after Y. pestis pulmonary challenge. Furthermore, bacterial burdens were specifically monitored in different tissues, variations of different cells in lung and bronchoalveolar lavage fluid (BALF), and cytokine production in BALF on day 2 after pulmonary Y. pestis challenge to determine the correlation between animal survival and host responses. On day 2 postinfection, the sham mice were found to have strikingly increased Y. pestis titers (mean 7.8 log 10 CFU/g tissue) in lung and moderate bacterial titers in liver (mean 3.8 log 10 CFU/g tissue) and spleen (mean 2.0 log 10 CFU/g tissue). In the LcrV-immunized mice, the bacterial titers reached moderate levels (mean 3.6 log 10 CFU/g tissue) in the lungs, but the bacteria could not disseminate into the liver and spleen (
Upon the comparison of immunized mice with or without infection, significant increases in CD4+CD44+ cells were observed in the lungs of LcrV- or OMV-immunized mice after infection (
Discussion
Generally, the removal of phosphate groups decreases the overall negative charge of a bacterium, thus reducing the electrostatic interactions of the phosphates in lipid A with cationic antimicrobial peptides and decreasing the susceptibility to polymyxin B, which is a cationic antimicrobial peptide that binds negatively charged phosphate groups in lipid A units in LPS on the bacterial membrane and inserts its hydrophobic tail into the outer membranes of bacteria, causing membrane damage and bacteria killing. The removal of 1-phosphate from the conventional biphosphorylated lipid A in E. coli and Salmonella decreased their susceptibility to polymyxin B, but the opposite was observed in Y. pestis. The possible reasons for this are as follows: 1) Y. pestis masked the phosphate groups with 4-amino-4-deoxy-1-arabinose (1-Ara4N) to reduce the negative charge at its surface using different regulatory strategies that those used by Salmonella; 2) Y. pestis naturally lacks O-antigen because bacteria with the full O-antigen are more resistant to polymyxin B than O-antigen isogenic mutants; 3) lipid A 1-dephosphorylation in Y. pestis may cause cation displacement in the outer membrane (OM), resulting in a reduction in OM integrity and an increase in OM permeability and thereby changing Y. pestis morphology by increasing the OM curvature (
Vaccination with OMVs derived from a wild-type Y. pestis strain containing very low amounts of LcrV provided very limited protection against plague (unpublished data). An Asd+-based balanced lethal Salmonella system was adopted with the Y. pestis system that was successful in overcoming this limitation by oversynthesizing LcrV (
In addition to the production of high titers of IgGs against LcrV, YPL and F1 antigen (
Previous studies showed that recombinant, bacterially derived OMVs induced a more balanced Th1/Th2 response. Both LcrV and OMV vaccination elicited the production of significant levels of IgG against LcrV and YPL in mice (
The disease progression of primary pneumonic plague in several animal models is biphasic and consists of a preinflammatory and a pro-inflammatory phase. The early ‘preinflammatory’ phase of the disease (initial 36 h post infection) is characterized by rapid Y. pestis replication in the lungs of mice but an absence of measurable host immune responses or obvious disease symptoms. In contrast, the proinflammatory phase (48 h post infection) is characterized by continuous increases in bacterial titers and dramatic increases in the levels of cytokines (IL-1α IL-1β, IL-6, IFN-γ and IL-17) and chemokines (KC, G-CSF, MIP-1α) accompanied by massive neutrophil influx in the lungs and alveolar spaces, resulting in acute lethal pneumonia. The data showed that the responses in the sham group mice on day 2 post infection (
In Y. pestis pulmonary infection, the massive recruitment of mature and immature neutrophils in response to an increasing bacterial burden leads to highly necrotic, lethal pneumonia. This phenomenon occurred in sham mice on day 2 post infection and was characterized by dramatic increases in neutrophils in the BALF and lung (
The studies showed that protective immunity elicited by self-adjuvanting OMVs derived from engineered Y. pestis was greater than that elicited by LcrV/alhydrogel, suggesting that OMVs could be utilized as antigen carriers for delivering antigens and adjuvants as part of a promising and effective next generation plague vaccine.
Supplemental Information
Bacterial Culture Conditions
All E. coli strains were grown routinely at 37° C. in LB broth or LB Agar (Difco). E. coli strain, χ7213, was used to construct suicide vectors and conjugate with Y. pestis for generating mutations. Y. pestis grown in heart infusion broth (HIB) and Tryptose blood agar (TBA) plates was described previously. Strain construction was performed using Y. pestis KIM6+ derivatives that lack the 70 kb pCD1 plasmid and exempt from Select Agent status and can be handled at BSL-2. Ampicillin at 100 μg/ml or chloramphenicol at 25 μg/ml was supplemented to media, when necessary. Fully virulent strain Y. pestis KIM6+ (pCD1Ap) was used for animal challenge under BSL-3/ABSL3 containment.
Molecular and Genetic Procedures
Plasmids and primers used in this study were listed in supplemental Table 1 and Table 2, respectively. The lcrV gene was amplified by a lcrV-1/lcrV-3 primer set from genome of Y. pestis KIM6+(pCD1Ap) and cloned into NcoI and HindIII sites of pYA3342 to generate pSMV12. The lcrV gene was amplified by a lcrV-2/lcrV-3 primer set from genome of Y. pestis KIM6+(pCD1Ap) and cloned into EcoRI and HindIII sites of pYA3493 to generate pSMV13. The Δasd flanking region of Y. pestis KIM6+ was assembled by overlapping PCR using Asd-1/Asd-2 and Asd-3/Asd-4 primer sets and cloned into a suicide vector pRE112 to generate pSMV25. To cure pPCP1 plasmid, the replication origin was amplified by the pPCP1-F/pPCP1-R primer set and cloned into pYA4373 to generate pSMV26. All the plasmids were confirmed by PCR screening and DNA sequencing. The procedures for the sacB-based sucrose counter-selectable suicide vectors used to construct unmarked deletion and/or insertion mutations in Y. pestis were described in a previous report. Successful gene mutations were confirmed by PCR screening.
Bacterial Subcellular Fractionation Analysis
Y. pestis strains were grown in HIB broth at 28° C. for 14 h and then incubated at 37° C. for 4 h The bacterial cells were collected by centrifugation (10,000×g) for 10 minutes. Periplasmic and cytoplasmic fractions were prepared by a lysozyme-osmotic shock method. Equal volumes of periplasmic, cytoplasmic, and supernatant fractions and total lysate samples was analyzed using Western blotting.
Transmission electron microscopy (TEM). Bacterial cultures were absorbed onto freshly glow-discharged Formvar/carbon-coated copper grids for 10 min. The grids were washed in ddH2O and stained with 1% aqueous uranyl acetate (Ted Pella, Inc., CA) for 1 min. The excess liquid was gently wicked off, and the grids were allowed to air dry. The samples were viewed with a JEOL 1200EX transmission electron microscope (JEOL Peabody, Mass.) equipped with an AMT 8-megapixel digital camera (Advanced Microscopy Techniques, Woburn, Mass.). The OMVs were analyzed by TEM as described in previous reports.
Stimulation and Cytotoxicity Assay in Cell Lines
To determine stimulatory activity of OMVs via TLR4, HEK-Blue™ hTLR4 and HEK-Blue™ Null1-v cells (InvivoGen, CA, USA) were maintained at 37° C. with 5% CO2 in DMEM (Gibco BRL, Grand Island, N.Y., USA) containing 10% FBS supplemented with 100 μg/ml penicillin, 100 μg/ml streptomycin and 100 μg/ml Normocin. Cells were seeded at a density of 5×104 cells per well in 96-well tissue culture plates (Costar, Washington, D.C.) and were stimulated with 20 μl OMVs isolated from different strains (final concentration 10 μg/ml or 25 μg/ml) for 8 h. HEK-Blue™ Null1-v cell and PBS as negative controls. Relative NF-κB activity was determined by measuring the embryonic alkaline phosphatase (SEAP) activity that accumulated the culture media according to the manufacturer's instructions.
Murine macrophage RAW264.7 cells were maintained at 37° C. with 5% CO2 in DMEM (Gibco BRL, Grand Island, N.Y., USA) containing 10% FBS supplemented with 100 μg/ml penicillin and streptomycin. Cells were seeded at a density of 5×104 cells per well in 96-well tissue culture plates (Costar, Washington, D.C.) and cultured for 12h, and then were stimulated with OMVs isolated from different strains (final concentration 10 μg/ml or 25 μg/ml). 20 ng/ml of LPS as a positive control. After 24 h, the supernatants from each well were collected for measuring TNF-α secretion using Mouse TNF alpha ELISA Ready-SET-Go! kit (Thermo scientific) and lactate dehydrogenase (LDH) release using a Multitox-Fluor Multiplex Cytotoxicity Assay kit (Promega, Madison, USA) following the manufacturer's instructions. Statistical significance among groups were analyzed by two-way multivariant ANOVA with a Tukey post hoc test. ns, no significance, *, P<0.05; **, P<0.01; ***, P<0.001, ****, P<0.0001.
Y. psedotuberculosis strains and plasmids used in this study
Y. pseudotuberculosis
Y. pseudotuberculosis PB1+, serotype O:1B
Construction of an Asd+ Plasmid Containing Genes Encoding Protective Antigens from Both Y. pestis and B. anthracis.
Delivering antigens by T2SS into the periplasm space of bacteria could increase the antigens in lumen of OMVs, significantly increasing antibody responses and protective immunity. As mentioned above, protective antigen (PA) of anthrax toxin encoded by pagA is the primary component of human anthrax vaccine. So, the same strategy was applied to construct an Asd+ plasmid to synthesize and secrete PA of B. anthracis in the heterologous Yptb strain. The pagA gene fragment removing the N-terminal signal sequence is codon-optimized to favor for expression in Y. pseudotuberculosis. In addition, the codon-optimized pagA gene (PAop gene) has mutations to eliminate proteolytic cleavage sites, such as a furin site by replacing RKKR167 with SNKE167 and a chymotrypsin site via deletion of FF314 and a substitution at position 308 (E308D), which enhances the stability of the PA protein in the mammalian host. So, the PAop gene fused with N-terminal β-lactamase signal sequence (bla ss) is cloned downstream from Plpp promoter of an Asd+ plasmid (pSMV59) to facilitate PA secretion into the bacterial periplasmic space, resulting in high amounts of PA encased in OMVs. So, pSMV59 was introduced into YPS9 to determine PA synthesis in whole cell lysate and OMV fractions, result showed that OMVs from YPS9 (pSMV59) encased high amounts of PA antigen (
Based on results shown in
An Y. pseudotuberculosis (Yptb) mutant strain was constructed which robustly produces self-adjuvating and highly immunogenic OMVs to deliver protective antigens from different pathogens. Yptb PB1+ (serotype O:1b) is the closest ancestor of Y. pestis, But Yptb is much less virulent than Y. pestis, can be operated in BSL2 lab, and typically causes enteric diseases in humans and animals. With the exception of two additional plasmids carried by Y. pestis (pPCP1 and pMT1), the two species share >95% genetic identity and a common virulence plasmid (pCD1/pYV) with a conserved colinear backbone. Yptb grows much faster than Y. pestis at both 28° C. and 37° C. in HIB media, produces higher amounts of OMVs than Y. pestis in the same culture volumes and is much easier to be genetically manipulated than Y. pestis. Therefore, the Yptb PB1+ strain as an alternative to generate high immunogenic and minimal reactogenic OMVs should be an ideal option to achieve similar OMVs but greatly reduce labor-intensive process. To do so, an Yptb mutant strain was constructed, YPtbS41 (Table 4) that produces MPLA, an adjuvant form Lipid A, cures the virulence plasmid pYV to remove all possible immunomodulation factors (Yops) and incorporates the caf1 operon into chromosome to synthesis F1 antigen as an initial strain.
Increasing Production of OMVs.
It is well established that defects in a range of proteins involved in maintaining the structural integrity of the membrane result in increased vesiculation. In E. coli, the five proteins of the Tol-Pal system is comprised of three inner membrane proteins (TolA, TolQ, and TolR) and a periplasmic protein (TolB), which interact with an outer membrane protein, peptidoglycan-associated lipoprotein (Pal). Disruption of tolR in E. coli and Salmonella did not significantly compromise the cell envelope and growth, but resulted in high levels of OMVs formation. Also individual disruption of vacJ and yrbE resulted in excessive OMV production in Haemophilus influenza, Vibrio cholera or E. coli. NlpI, a lipoprotein, participates in the balance of peptidoglycan breakdown and synthesis. E. coli ΔnlpI exhibits hypervesiculation and an increased OMVs production compared to the otherwise isogenic parental strain, without evident leakage of cytoplasmic proteins. Actinobacillus pleuropneumoniae ΔnlpI has similar occurrences. Homologous genes of tolR, vacJ, yrbE and nlpI in Y. pseudotuberculosis strain are YPTS_1234 (83% amino acid identity), YPTS_2737 (75% amino acid identity), YPTS_3704 (83% amino acid identity), and YPTS_0515 (87% amino acid identity) respectively. Therefore, tolR, vacJ, yrbE and nlpI were deleted from wild-type Yptb PB1+ individually and compare OMVs production of each mutant strain with Yptb PB1+. Results have shown that only the tolR mutant largely increases OMVs production, while the vacJ, yrbE or nlpI mutant dose not heighten OMVs production in comparison with Yptb PB1+ (
Construction of a Recombinant Yptb Strain Heterologously Expressing the Gene Cluster for β-(1-3)-Glucan Synthesis.
More and more evidences indicate that plague vaccines aiming to induce mixed Th1 and Th17 cellular responses would provide more powerful and comprehensive protection. Curdlan acts as an adjuvant for the activation of Th1 and, in particular, Th17 immunity. Curdlan is a high-molecular-weight water insoluble β-(1-3)-D-glucan (glucose homo-polymer) without any substituents that has been approved as a food additive by the U. S. FDA. Curdlan is produced by an Agrobacterium sp. (formerly known as Rhizobium lupini) and some other bacteria. Four genes are involved in curdlan biosynthesis (crdA, crdS, crdC and crdR). The curdlan synthase (CrdS), is the key enzyme of curdlan biosynthesis. The UDP-glucose is also a critical block for the curdlan synthesis. So far, there are no any reports about exact UDP-glucose synthesis in Yptb. Protein blast shows that Yptb has a galUF operon governing UDP-glucose synthesis. Therefore, introducing the curdlan synthesis operon (crdASCR) into a certain site of chromosome in YPtbS39 (Table 4) that would synthesize β-(1-3)-glucan will be explored. In addition, studies have shown that production of curdlan is activated by the second messenger c-di-GMP binding to glucan synthase, CrdS. So, the mutant strain combining elevation of c-di-GMP and curdlan synthesis operon would increase curdlan synthesis.
The PcrV forms a ring structure at the tip of the needle of Type three secretion system (T3SS) in PA and is essential for translocation of the effectors and bacterial pathogenicity. PcrV is a conserved protein among different serotypes of PA isolates and a promising antigen candidate. Immunization with recombinant PcrV or adaptive transfer of anti-PcrV antibodies offered significant protection against lethal PA infections. In addition, iron is an indispensable nutrient for replication of almost all bacteria. Several iron acquisition systems are used by PA to obtain iron from mammalian hosts during infection and play an important role in bacterial virulence. The hitA (PA4687), hitB (PA4688), and others in PA are involved in iron transportation and associated with bacterial virulence. A study showed immunization with ferric iron-binding periplasmic protein HitA afforded protection against PA infection in mice. Therefore, immunization with OMVs delivering heterologous PcrV and HitA antigens as a bivalent vaccine might potentiate protective immunity against PA infection.
Here, an Asd (Aspartate-semialdehyde dehydrogenase)-based balanced-lethal recombinant Yersinia pseudotuberculosis system tailored with an Asd+ plasmid was used to over-synthesize the heterologous PcrV-HitAT fusion antigen (referred to PH), as well as produce high amounts of OMVs encasing the PH antigen. Intramuscular (i.m.) immunization with the rOMV-PH stimulated robust B and T-cell responses and offered great protection against lethal subcutaneous (s.c.) or intranasal (i.n.) challenge with PA103 strain.
Materials And Methods
Bacterial strains, plasmids, culture conditions, and molecular operations. All bacterial strains and plasmids used in this study were listed in the Table 1. All bacterial cultures and molecular and genetic procedures used in this study were described in the Supplementary information (SI).
OMV isolation and analysis. Isolation of OMVs from Y. pseudotuberculosis strains was similar as described previously. A brief procedure was described in SI. The OMVs were analyzed by Transmission electron microscopy (TEM), a Bradford assay was performed for quantifying the total protein abundance associated with OMVs as described previously. The heterologous antigen present in the OMV preparations were detected by immunoblotting.
Animal experiments. Animal protocols were in accordance with the NIH “Guide for the Care and Use of the laboratory Animals” and were approved by the Institutional Animal Care and Use Committee at Albany Medical College (IACUC protocol #20-02001). Six-week-old male and female BALB/c mice were purchased from Taconic (Germantown, N.Y.) and acclimated for one week after arrival. Mice were primed by intramuscular (i.m.) vaccination, then boosted at 3 weeks after the initial vaccination. Blood samples were collected via submandibular veins at 2-week intervals to harvest sera for antibody analysis. On 42 days after the initial vaccination, animals were challenged subcutaneously (s.c.) with a lethal dose of PA103 strain in 100 μl PBS to mimic surgical infection. For mimicking acute pneumonic infection, animals were anesthetized with a 1:5 xylazine/ketamine mixture and were challenged intranasally (i.n.) with a lethal dose of PA103 in 40 μl PBS. All infected animals were observed over a 15-day period. The actual numbers of bacterial CFUs were determined by plating serial dilutions of the inoculum on LB agar plates.
For the determination of the bacterial burden, infected animals were euthanized with an overdose of sodium pentobarbital. Lungs, livers, spleens and blood were taken at the indicated times and homogenized in ice-cold PBS (pH 7.4) using a bullet blender at power 7 for 2 min. Serial dilutions of each organ homogenate were plated on LB agar plates, and each count was confirmed with duplicate plates with different dilutions to determine the titers of bacteria per gram of tissue. A mouse multiplex cytokine assay kit (Bio-Plex, Bio-rad) was used to detect cytokines and chemokines in the serum and bronchoalveolar lavage fluid (BALF) collected from the mice according to the manufacturer's instructions.
Antibody responses and opsonophagocytic killing assay. Antibody titers were measured using an enzyme-linked immunosorbent assay (ELISA) described in SI. The opsonophagocytic killing assay were performed as described previously. Briefly, HL-60 cells (ATCC, CCL-240) were differentiated into granulocyte-like cells in the Iscove's Modified Dulbecco's Medium (IMDM) (ATCC) containing 100 mM N′,N-dimethylformamide (Sigma) for 5 days. Sera samples from immunized mice containing opsonic antibodies were heat-inactivated (56° C., 30 min) and serially diluted with opsonization buffer (mixture of 80 ml of sterile water, 10 ml of 10× Hank's balanced solution, 10 ml of 1% gelatin, and 5.3 ml of fetal bovine serum). Each well in a 96-well plate contains: 40 μl of 4×105 HL60 cells, 103 CFUs of PA103 in 10 μl of opsonophagocytic buffer, 20 μl of serum, and 10 μl of 1% infant rabbit serum as a complement source (Sigma). Blank wells with the same system in absence of mouse serum were used as negative controls. After 2 h incubation, 10 μl of each sample was plated on LB agar medium. Each sample was performed in triplicate. The opsonophagocytic killing ability was defined as a reduction in CFUs compared with the CFUs in the sera from unimmunized mice.
Analysis of cellular immune responses. Lungs and spleens were obtained aseptically from euthanized animals and lungs were minced and digested with 400 μg/ml of Liberase and 30 μg/ml of DNase (Sigma) at 37° C. for 30 min. Then, tissues were dissociated with 70 μm strainers to obtain single cells. The RBC-lysed individual cell populations (2×106) were seeded in 12-well cell culture plates and stimulated in vitro for 72 h with 20 μg/ml PH. Four hours before the collection of the cells, Cells in each well were supplemented with brefeldin-A and a monensin cocktail (1:1 ratio) to block Golgi-mediated cytokine secretion. For the flow cytometric analysis of the T-cell populations and their corresponding cytokines, the induced cells were harvested and resuspended in FACS staining buffer containing CD16/32 antibodies (1:200) for 10 min on ice. The T-cell-specific markers were stained using anti-mouse CD3 (FITC), CD4 (PE) and CD8 (APC) antibodies (BioLegend, CA), followed by intracellular cytokine (IFN-γ, PerCP Cy5.5; TNF-α, BV510; IL17A, APC-Cy7) staining using BioLegend Perm-fix solution and buffer according to the manufacturer's protocol. The entire staining process was performed on ice with 30 min incubation at each step. The events were acquired on BD flow cytometers (FACSymphony A3) and analyzed using FlowJo v.10.
Statistical analysis. The statistical analyses of the data among the groups were performed with one-way ANOVA/univariate or two-way ANOVA with Tukey post hoc tests. The log-rank (Mantel-Cox) test was used for the survival analysis. All data were analyzed using GraphPad PRISM 8.0 software. The data were represented as the mean±standard deviation (SD); ns, no significance, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.
Results
OMVs displaying the heterologous PcrV-HitAT fusion antigen of P. aeruginosa. A hypervesiculating and Δasd Y. pseudotuberculosis mutant strain, YptbS44 [Table 1 and Supplementary information (SI)] producing adjuvant monophosphoryl lipid A (MPLA) was used here. YptbS44 adapted an Asd+ plasmid, pSMV81 (Table 1,
Immunization with OMVs enclosing PH antigen afforded significant protection against P. aeruginosa infection. Prior to challenge study, it was determined that LD50s (50% of lethal dose) of WT PA103 in BALB/c mice by s.c. and i.n. administration were 7.1×106 colony-forming unit (CFU) and 2×105 CFU, respectively. The LD50s of PA103 were similar to previous report. Groups of mice (n=10-15, nearly equal males and females) were immunized intramuscularly with 100 μl PBS containing 50 μg of OMVs from YptbS44(pSMV81) designated as rOMV-PH, 50 μg of OMVs from YptbS44(pYA3493) designated as rOMV-N, PH (10 μg)/alhydrogel or PBS/alhydrogel, then boosted at 21 days after the prime immunization (
rOMV-PH vaccination elicited strong antibody responses with significant opsonophagocytic killing capability. Serum antibody responses showed that both PH- and rOMV-PH prime immunization generated similarly high anti-PH IgG titers in mice at week 2 post vaccination, and both boost immunization substantially increased anti-PH IgG titers at week 4 post vaccination (
Opsonophagocytic killing (OPK) assay has been used to evaluate correlation of functional antibody levels in serum samples with protection. Thus, whether the PH-specific antibodies were protective was measured using OPK assay. Results showed that only undiluted anti-sera from rOMV-PH-immunized mice exhibited significant OPK activity compared with those from PBS-, PH- or rOMV-N-immunized mice. While, all diluted anti-sera (1:10 or 1:100) from three immunized groups displayed no OPK activity (
Vaccination with rOMV-PH induced potent cellular immune responses. Following, T-cell responses were evaluated in the lung and spleen after immunization. Lung cells from rOMV-immunized mice showed increased number of CD4+ and CD8+ T cells in comparison to those from PBS- or PH-immunized mice after in vitro stimulation with PH (
In similar fashion, splenic CD4+ T cells from rOMV-PH-immunized mice significantly increased after in vitro stimulation with the PH antigen in comparison to cells from PBS- or PH-immunized mice. There was no significant increase in splenic CD4+ T cells from PH-immunized mice compared to cells from PBS-immunized mice (
The rOMV-PH vaccination effectively controlled bacteria and host inflammation. Further, in vivo responses of immunized mice challenged with a sub-lethal dose of PA103 were evaluated. Mice were challenged with 5×106 CFU PA103 by s.c. administration and monitored bacterial burdens in different tissues and cytokine/chemokine production in serum on 36 h post infection. Results showed that striking increases of PA titers in lungs (mean 5.5 log 10 CFU/g tissue) and livers (mean 6.2 log 10 CFU/g tissue), and moderate bacterial titers in spleens (mean 4.8 log 10 CFU/g tissue) and blood (mean 3.8 log 10 CFU/g tissue) in the PBS-immunized mice. Bacterial titers within all four organs in PH-immunized mice substantially decreased in comparison to PBS-immunized mice, but still retained significantly higher in lungs and spleens than those in rOMV-PH-immunized mice. No bacteria disseminated to those organs in rOMV-PH-immunized mice (
Similarly, groups of immunized mice were evaluated by i.n. challenge with 5×105 CFU PA103. On 36 h post pulmonary infection, PBS-immunized mice were found to have strikingly increased bacterial titers in lungs (mean 7.0 log 10 CFU/g tissue), and rapidly disseminated to livers (mean 6.0 log 10 CFU/g tissue), spleens (mean 5.8 log 10 CFU/g tissue) and blood (mean 4.8 log 10 CFU/g tissue). In comparison to the PBS immunization, the PH- or OMV-PH immunization substantially decreased bacterial burdens within lungs, livers and spleens of mice. However, the OMV-PH immunization had more efficiency to clear bacteria from mouse blood than the PH-immunization (
Discussion
The increasing prevalence of multidrug-resistant P. aeruginosa (PA) infections in healthcare settings justifies the urgent need for an effective vaccine against this organism. Barriers to PA vaccine development include the presence of phenotypically diverse PA strains, the diverse virulence mechanisms, and lack of reliable animal models to mimic CF patients. A number of PA vaccine candidates are being tested in clinical trials, but so far no licensed vaccines are available for human use. Among them, a PA subunit vaccine (IC43) composed of OprI and a fragment of the outer membrane protein OprF was evaluated in a phase III clinical trial (NCT01563263). Immunization with 100 μg of IC43 was well tolerated in a large group of mechanically ventilated patients as well as achieved high immunogenicity, but did not present significant clinical benefit over placebo in terms of overall mortality. Human clinical trials showed that anti-PcrV antibody or its fragment could reduce inflammation and damage of the airway of CF patients, but directly using PcrV antigen as a vaccine component seemed to never be evaluated in human clinical trials probably due to protein purity or other unmentioned issues. In addition, Holder et al reported that immunization with PcrV alone did not provide long-term protection to burned mice infected with the highly toxigenic strain 1071. Moreover, purified antigens as subunit vaccines administered alone have limited immunogenicity and vaccination with subunit vaccines prefers to generate humoral response. Many studies reach consistent points that an excellent PA vaccine should stimulate antibodies combined with both Th1- and Th17-type CD4+ T cell responses to provide effective protection against pulmonary and systemic PA infection. Currently, this dilemma for subunit vaccines is being addressed with different improved vaccine carriers. Among them, using self-adjuvanting OMVs as a carrier not only circumvents the requirements of antigen-purification for traditional subunit vaccines, but also stimulates potent specific humoral and cellular responses to the delivered antigens.
Our studies showed that i.m. immunization with rOMV-PH afforded complete protection against s.c. challenge and 73% protection against i.n. challenge with the virulent PA103 strain (
Generally, antigen-specific antibodies induced by a vaccine candidate are able to correlate with protection and assist killing of host target cells infected by bacteria. However, our results showed that immunization with the PH/alhydrogel generated comparable high titers of PH-specific antibody in mice to the rOMV-PH immunization (
Based upon antibody analysis (
P. aeruginosa strains and plasmids used in this study
E. coli
χ6212
P. aeruginosa
P. aeruginosa PA103
E. coli-Pseudomonas shuttle vector; Apr Cbr
gaattcgaacaggaagaactgctg
ggatccggtggcggcggtagcg
aagcttttaatggtgatgatgatg
a Underlining indicates restriction endonuclease recognition sequences.
Trimming P. aeruginosa to mitigate toxicity of outer membrane vesicles. A multitude of virulence factors produced by PA are involving in acute and chronic infections. Studies have illustrated that OMVs from WT PA can package numerous virulence factors, such as virulence effectors of the type III secretion system (T3SS) and toxins, and deliver them into host cells, impairing immune response and cytotoxicity. The toxins (ExoU, ExoT or ExoS) secreted by T3SS facilitated PA to breach in the epithelial barrier by antagonizing wound healing during colonization and promoting cell injury causing pneumonia. Also, several toxic effectors (Exotoxin A, LasA and LasB) of Type II secretion system (T2SS) contribute to bacterial pathogenicity. In addition, high levels of antibodies against alginate or elastases are induced upon PA infection, but these antibodies have poor opsonic activities, especially in CF individuals, fail to clear the infection effectively, and even exacerbate lung infection. Siderophores (pyochelin and pyoverdine), rhamnolipids, LPS, and alkaline phosphatases also facilitate PA infection. To mitigate toxicity caused by those factors, 14 genes (
Increasing PcrV-HitAT fusion antigen enclosed by P. aeruginosa OMVs. Studies showed that active and passive immunization with the PcrV antigen or its protective antibody decreased lung inflammation and injury in a murine infection model and a burn mouse model. The components in PA iron acquisition systems, such as PA4359, PA4514, HitA (PA4687), and HitB (PA4688) are involved in iron transportation and associated with bacterial virulence, rendering them as potential vaccine candidates. Immunization with the ferric iron-binding periplasmic protein HitA provided protection for mice against systemic PA infection. PcrV and HitA antigen among different serotypes of PA has 98˜100% identity, respectively. However, OMVs directly isolated from PA-m14 strain contained low amounts of PcrV and HitA, which may limit OMV immunogenicity. In order to increase protective antigens enclosed in OMVs, PcrV (E28-I294, removing signal peptide) was fused with truncated HitA (D28-N355) from PA103 strain together designated as PcrV-HitAT (68 kDa, referred to PH) for the proof of concept. Therefore, the pSMV83 plasmid (Table 5 and
Immunization with recombinant PA OMVs induces protection against P. aeruginosa infection. Groups of mice (n=10, 5 males and 5 females) were intramuscularly (i.m.) immunized with 50 μg OMVs purified from PA-m14(pSMV83) (referred to OMV-PH) in 100 μl PBS, in which contains ˜10 μg PcrV-HitAT, and boosted at 21 days after prime immunization (
Mice with OMV-PH immunization rapidly halt P. aeruginosa infection. On day 2 post infection, PBS-immunized mice had substantially higher PA titers (mean 7.2 log10 CFU/g tissue) in lungs, spleens (mean 5.7 log10 CFU/g tissue), livers (mean 5.6 log10 CFU/g tissue) and bloods (mean 5.2 log10 CFU/g tissue) than PH-, OMV-NA or OMV-PH immunized mice. In the PH-immunized mice, bacteria reached moderate levels in livers (mean 1.2 log10 CFU/g tissue) and blood (mean 2.5 log10 CFU/g tissue), but no bacteria were detected in spleens (
Mice with OMV-PH immunization rapidly halt P. aeruginosa infection. At 48 h after s.c. challenge with PA103, significant high bacteria titers were detected in livers (mean 4.2 log10 CFU/g tissue) and blood (mean 4.6 log10 CFU/g tissue) of PBS-immunized mice, moderate bacterial titers were observed in spleens (mean 2.7 log10 CFU/g tissue) and lungs (mean 2.8 log10 CFU/g tissue) of PBS-immunized mice. PH immunization could significantly reduce bacterial titers in livers, spleens, lungs, and blood, but not completely clear PA from livers, spleens, and blood at 48 h post infection. No bacteria were detected in OMV-NA or OMV-PH-immunized groups in all of tissues at 48 h post infection (
This application is a continuation of U.S. Non-Provisional application Ser. No. 17/117,417, filed on Dec. 10, 2020, and which claimed priority to U.S. Provisional App. No. 62/947,585 filed on Dec. 13, 2019.
This invention was made with government support under R21 AI139703 awarded by the National Institutes of Health. The government has certain rights in the invention.
Number | Date | Country | |
---|---|---|---|
62947585 | Dec 2019 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 17117417 | Dec 2020 | US |
Child | 17482527 | US |