This invention relates generally to the detection of nucleotide sequences or other biological materials. In particular embodiments, the invention relates to the combination of single-walled carbon nanotubes and DNA for the optical detection of microRNA.
The present specification makes reference to a Sequence Listing (submitted electronically as a .txt file named “2003080-1324_SL.txt” on Apr. 7, 2017). The .txt file was generated on Mar. 29, 2017 and is 29,854 bytes in size. The entire contents of the Sequence Listing are hereby incorporated by reference.
Detection of free oligonucleotides in body fluids holds great promise as diagnostic and prognostic markers for a variety of pathologies, including cancer, metabolic disease, organ rejection, fetal health, and infectious disease. The relative accessibility of body fluids containing these oligonucleotides has fueled progress in creating “liquid biopsies” to circumvent problems inherent to traditional, invasive biopsies. Potential oligonucleotides used for liquid biopsies include cell-free tumor DNA, mRNA, and circulating microRNA (miRNA). Somewhat surprisingly, miRNA was found to differ from other RNA types in that it is stable in body fluids, despite the presence of endogenous RNases. Encouragingly, many studies to date have identified specific expression patterns of miRNA in body fluids, including in serum and urine that are indicative of disease states. The promise of using miRNA in serum or urine for minimally invasive, early detection of a variety of diseases, either alone or in conjunction with other established biomarkers, is exciting because the early detection of cancer is associated with the best prognosis.
Because miRNA detection has tremendous potential in diagnostics and prognostics, great effort has been put forth in creating novel and reliable detection schemes. The detection of miRNA is complicated by their short length, approximately 22 nucleotides, as well as by a dynamic range that can span several orders of magnitude. Additionally, relative amounts of miRNA purified from biofluids can change depending on the protocol used. The current gold standard for miRNA detection and quantification is RT-qPCR using stem loop primers, which is based on time-consuming amplification of miRNA from purified samples. Innovative assays that avoid amplification, labeling, and purification from biofluids are needed for point-of-care diagnostics. Ideally, an implantable miRNA sensor could report changes in miRNA concentration in real-time to continuously monitor the health status of a patient.
The current standard for miRNA measurement, with limits of detection ranging from attomolar (aM) to (fM), is quantitative PCR (qPCR). However, this method requires purification and amplification of miRNA that can introduce biases and variability. Commercially available techniques that do not involve amplification, such as microarrays, suffer from poorer sensitivity (picomolar (pM) to nanomolar (nM)) and high false positive rates. Detection strategies that avoid amplification, labeling, and purification from biofluids are under investigation, but in vivo detection strategies are sparse. The detection of nucleic acid biomarkers in real-time and in situ within living tissues and organisms remains an important challenge.
Nanotechnology-based solutions for miRNA detection represent a promising strategy for amplification-free and label-free detection of miRNA. In particular, individually-dispersed semiconducting single-walled carbon nanotubes (SWCNTs) exhibit ideal qualities as optical biomedical sensors. SWCNTs are fluorescent in the near-infrared, a wavelength range penetrant to tissue, raising the possibility of implantable sensors. Additionally, SWCNTs do not photobleach due to their excitonic nature of fluorescence. The emission wavelength and intensity is exquisitely sensitive to the immediate SWCNT environment, allowing changes at the surface to be transduced in an optical signal. Sensitivity to some analytes has been measured at the single-molecule level. It has been shown that single-strand DNA has an affinity for the nanotube surface and can be used as a dispersant to prepare optically active, single nanotube dispersions. Additionally, DNA-DNA hybridization between nanotube-associated DNA and free single-strand DNA in solution can mediate a solvatochromic shift in the nanotube emission.
The use of SWCNTs as optical sensors is complicated by the inability to use covalent chemistry for functionalization, as too many sp3 defects along the nanotube sidewall will quench their optical properties. Thus, non-covalent functionalization schemes are required for their application as biosensors. Using such strategies, sensors have been developed for Beta-D-glucose, DNA hybridization, divalent metal cations, assorted genotoxins, nitroaromatics, nitric oxide, pH, and the protein avidin. More recently, specific recognition of target analytes using changes in the corona phase of an adsorbed polymer has been developed. A major challenge in developing non-covalent, colloidally stable sensors for use in biological systems is imparting appropriate specificity for the target analyte while resisting non-specific interactions with other biological material.
Therefore, there remains a need for accurate and sensitive biosensing platforms.
Described herein are devices and methods for the optical detection of oligonucleotide binding events for diagnostic, point-of-care, drug screening, and theranostic applications, for example, a robust and customizable system to detect specific DNA and RNA oligonucleotides, using a carbon nanotube optical signal. This optically based detection scheme is useful, e.g., for detecting circulating oligonucleotides that have diagnostic and prognostic value for cancer, metabolic disease, organ rejection, fetal health, and infectious disease. Potential targets include cell-free tumor DNA, circulating mRNA, and circulating microRNA (miRNA). Because this platform is compatible with biofluids, the platform provides, in various embodiments, purification-free, point-of-care diagnostics. Further described are implants comprising the sensing platform in live organisms (e.g., humans, rodents etc.), and methods to detect oligonucleotides in vivo with a noninvasive method. Thus, this platform can be used as an implantable sensor for biomarkers, allowing for real-time, non-invasive monitoring in vivo. Primarily, the devices are, or comprise, a sensor comprising a single-walled carbon nanotube (SWCNT) and a polymer associated with the SWCNT, wherein the polymer comprises a first domain and a second domain, e.g., wherein the first domain has a sequence complementary to a target nucleotide sequence and wherein the second domain is a stabilizing domain.
Moreover, described herein are engineered carbon-nanotube-based sensors capable of real-time optical quantification of hybridization events of microRNA and other oligonucleotides. The mechanism of the sensors arise from competitive effects between displacement of both oligonucleotide charge groups and water from the nanotube surface, which result in a solvatochromism-like response. The sensors, which allow for detection via single-molecule sensor elements and for multiplexing by using multiple nanotube chiralities, can monitor toehold-based strand-displacement events, which reverse the sensor response and regenerate the sensor complex. It is also shown that the sensors function in whole urine and serum, and can non-invasively measure DNA and microRNA after implantation in live mice.
In certain embodiments, a distinguishing features is that the polymer on the nanotube includes both a nanotube-binding domain and a target domain that hybridizes with a target/analyte. The target domain can be complementary to a target that is DNA, miRNA, lncRNA, mRNA, and the like. In various embodiments, the sensor can be used to detect DNA, miRNA, mRNA, lnRNA, and the like, of any length, e.g., fewer than 30 nucleotides, or 30 nucleotides or longer.
In one aspect, the invention is directed to a single-walled carbon nanotube (SWCNT) sensor, comprising: a SWCNT; a polymer associated with the SWCNT (e.g., conjugated non-covalently or covalently to the SWCNT (e.g., directly or via a linker) (e.g., wrapped around the SWCNT), or otherwise associated with the SWCNT), (e.g., wherein the polymer comprises DNA, LNA, PNA, an amino-acid sequence, or a synthetic monomer), wherein the polymer comprises two or more domains ((e.g., wherein the sensor is capable of detecting species in a sample, e.g., the species having a target nucleotide sequence (e.g., microRNA) (e.g., wherein the target nucleotide sequence has fewer than 30 nucleotides, e.g., wherein the target nucleotide sequence has 30 or more nucleotides)).
In certain embodiments, the two or more domains comprise: a first domain comprising a stabilizing domain; and a second domain (e.g., or additional domains) comprising a sequence complementary to a target nucleotide sequence. In certain embodiments, the two or more domains comprise: a third domain that has a sequence complementary to a target sequence (e.g., wherein the first domain and the third domain are positioned on each end of the stability domain).
In certain embodiments, the linker comprises nucleic acid-based, hydrocarbon-based, or polymer-based (e.g., comprises polyethylene glycol (PEG)).
In certain embodiments, the polymer is single-stranded DNA. In certain embodiments, the polymer comprises a single-stranded DNA binding component containing a sequence complementary to a target nucleotide sequence.
In certain embodiments, the target nucleotide sequence has fewer than 30 nucleotides. In certain embodiments, the target nucleotide sequence has 30 or more nucleotides. In certain embodiments, the target nucleotide sequence has from about 5 nucleotides to about 30 nucleotides. In certain embodiments, the target nucleotide sequence has from about 10 nucleotides to about 25 nucleotides.
In certain embodiments, the first domain has a sequence complementary to the target nucleotide sequence. In certain embodiments, the first domain has a sequence complementary to a target miRNA sequence (or a truncated sequence of the target miRNA sequence). In certain embodiments, the target miRNA is a mammalian miRNA member selected from the group consisting of the miRNAs listed in Table 12.
In certain embodiments, the first domain has a sequence complementary to a target DNA sequence (or a truncated sequence of the target DNA sequence or to a complementary region in a longer strand with non-complementary regions). In certain embodiments, the second domain is a stabilizing domain (e.g., wherein the stabilization domain provides adequate nanotube dispersion). In certain embodiments, stabilizing means prevents/reduces agglomeration of SWCNTs and/or promotes stability of a suspension of the SWCNTs.
In certain embodiments, the second domain is an oligonucleotide sequence (e.g., a short oligonucleotide sequence) (e.g., a single-strand DNA that forms water soluble complexes with SWCNT).
In certain embodiments, the oligonucleotide sequence comprises a member selected from the group consisting of (GT)6 (SEQ ID NO: 2), (GT)15 (SEQ ID NO: 1), (AT)15 (SEQ ID NO: 3), (TAT)6 (SEQ ID NO: 4), (TCC)10 (SEQ ID NO: 5), (TGA)10 (SEQ ID NO: 6), (CCA)10 (SEQ ID NO: 7), (TTA)4TT (SEQ ID NO: 8), (TTA)3TTGTT (SEQ ID NO: 9), (TTA)5TT (SEQ ID NO: 10), (TAT)4 (SEQ ID NO: 11), (CGT)3C (SEQ ID NO: 12), (ATT)4 (SEQ ID NO: 13), (ATT)4AT (SEQ ID NO: 14), (TATT)2TAT (SEQ ID NO: 15), (ATTT)3 (SEQ ID NO: 16), (GTC)2GT (SEQ ID NO: 17), (CCG)4 (SEQ ID NO: 18), (GTT)3G (SEQ ID NO: 19), (TGT)4T (SEQ ID NO: 20), (TATT)3T (SEQ ID NO: 22), (TCG)10 (SEQ ID NO: 23), (GTC)3 (SEQ ID NO: 24), (TCG)2TC (SEQ ID NO: 25), (TCG)4TC (SEQ ID NO: 26), (GTC)2 (SEQ ID NO: 27), (TGTT)2TGT (SEQ ID NO: 28), (TTTA)3T (SEQ ID NO: 29), (CCG)2CC (SEQ ID NO: 30), (TCG)4TC (SEQ ID NO: 31), T3C6T3 (SEQ ID NO: 32), (GTC)2GT (SEQ ID NO: 33), CTTC2TTC (SEQ ID NO: 34), TTA(TAT)2ATT (SEQ ID NO: 35), TCT(CTC)2TCT (SEQ ID NO: 36), (ATT)4 (SEQ ID NO: 37), GC11 (SEQ ID NO: 38), (TC)3CTCCCT (SEQ ID NO: 39), CTTC3TTC (SEQ ID NO: 40), (GT)20 (SEQ ID NO: 41), CTC3TC (SEQ ID NO: 42), (TCT)2 (SEQ ID NO: 43), C5TC6 (SEQ ID NO: 44), T4C4T4 (SEQ ID NO: 45), and C5TTC5 (SEQ ID NO: 46).
In certain embodiments, the polymer comprises three or more domains. In certain embodiments, the domains have sequences complementary to one or more target nucleotide sequences. In certain embodiments, the domains have sequences complementary to one or more target miRNA sequences.
In certain embodiments, the sensor further comprises a surfactant. In certain embodiments, the sensor further comprises a surfactant, wherein the surfactant is selected from a group consisting of SDS, SDBS, SDC, SPAN-80, Brij 52, BSA, Triton X-100, Pluronic, Pyrene-PEG, TPGS, IGEPAL, and Phospholipid-PEG-NH2. In certain embodiments, the sensor further comprises SDBS.
In another aspect, the invention is directed to a method for detecting a target using a single-walled carbon nanotube (SWCNT) sensor, the method comprising: contacting a sample comprising a species having a target nucleotide sequence with the SWCNT sensor; exposing the sample to excitation electromagnetic radiation (excitation EMR) to produce an emission of electromagnetic radiation (emission EMR) by the SWCNT sensor; detecting the electromagnetic radiation emitted by the SWCNT sensor; and identifying the presence of the species having the target nucleotide sequence (e.g., a polynucleotide, oligonucleotide, radionucleotide, DNA, RNA, long non-coding RNA; microRNA, circulating microRNA, messenger RNA (mRNA), cell-free tumor DNA, or a fragment, an analogue, or a compound thereof) in the sample based at least in part on the detected emission EMR.
In certain embodiments, the method comprises detecting a wavelength shift (e.g., a blueshift or a redshift) in the emission EMR and/or an intensity shift (e.g., amplitude shift) or other changes in the spectral characteristics of the emission EMR or non-emission EMR changes, thereby identifying the presence of the species having the target nucleotide sequence in the test sample.
In certain embodiments, the other changes in the spectral characteristics of the emission EMR include ratiometric intensity changes (e.g., relative changes of one nanotube chirality intensity versus another), changes in full-width half-max (e.g., a measure of the “thickness” of the spectral peak), changes in exiciton energy transfer (a unique spectral signature from energy exchange between nanotubes in close-contact), and combinations thereof.
In certain embodiments, the non-emission EMR changes include changes in light absorbance (such as bleaching), blueshift or redshift in the excitation EMR, changes in dynamic light scattering (sample bundling), visible flocculation (aggregation) of nanotubes in sample, and combinations thereof.
In certain embodiments, the method comprises detecting an intensity shift between an emission center wavelength (e.g., a peak) of the sample and an emission center wavelength (e.g., a peak) of a reference sample, wherein the reference sample is devoid of the species having the target nucleotide sequence.
In certain embodiments, the method comprises contacting the sample comprising multiple species having target nucleotide sequences with multiple SWCNT sensors, wherein the SWCNTs have different chiralities.
In certain embodiments, the excitation EMR has a wavelength between 100 nm and 3000 nm, 200 nm and 2000 nm, between 300 and 1500 nm, or between 500 and 1000 nm. In certain embodiments, the emission EMR has a wavelength between 300 nm and 3000 nm, between 400 and 2000 nm, between 500 and 1500 nm, between 600 nm and 1400 nm, or between 700 and 1350 nm. In certain embodiments, the emission wavelength shift is between 1 nm and 100 nm, between 2 nm and 100 nm, between 3 and 50 nm, or between 4 and 20 nm.
In certain embodiments, the wavelength shift is a blue shift.
In certain embodiments, the species having the target nucleotide sequence is microRNA.
In certain embodiments, the method comprises identifying a molecule or organism having, or associated with, the target nucleotide sequences. In certain embodiments, the molecule or organism comprises a member selected from the group consisting of a peptide, a polypeptide, a protein, a biologic, a biomolecule, a biosimilar, an aptamer, a virus, a bacterium, a toxin, a cell, an antibody, and a fragment thereof.
In certain embodiments, the sample is a biological sample (e.g., in vitro, ex vivo, or in vivo, e.g., wherein the biological sample is a subject). In certain embodiments, the sample is a member selected from the group consisting of a cell culture sample, a laboratory sample, a tissue sample (e.g., muscle tissue, nervous tissue, connective tissue, and epithelial tissue), and a bodily fluid sample (e.g., Amniotic fluid, Aqueous humour and vitreous humour, Bile, Blood serum, Breast milk, Cerebrospinal fluid, Cerumen (earwax), Chyle, Chyme, Endolymph and perilymph, Exudates, Feces, Female ejaculate, Gastric acid, Gastric juice, Lymph, Menstrual fluid, Mucus (including nasal drainage and phlegm), Pericardial fluid, Peritoneal fluid, Pleural fluid, Pus, Rheum, Saliva, Sebum (skin oil), Serous fluid, Semen, Smegma, Sputum, Synovial fluid, Sweat, Tears, Urine, Vaginal secretion, Vomit., etc.).
In certain embodiments, the SWCNT sensor is the sensor.
In another aspect, the invention is directed to a kit for use in a laboratory setting, the kit comprising: at least one container (e.g., an ampule, a vial, a cartridge, a reservoir, a lyo-j ect, or a pre-filled syringe); and a single-walled carbon nanotube (SWCNT) sensor as described herein.
In another aspect, the invention is directed to a system for the detection of microRNA, comprising a single-walled carbon nanotube (SWCNT) sensor, a source of electromagnetic radiation, and an electromagnetic radiation detector.
In another aspect, the invention is directed to an implantable detection device comprising the SWCNT sensor. In certain embodiments, the device is a point-of-care medical device (e.g., a urine dipstick, a test strip, a membrane, a skin patch, a skin probe, a gastric band, a stent, a catheter, a needle, a contact lens, a prosthetic, a denture, a vaginal ring, or other implant). In certain embodiments, the device is a device for monitoring environmental conditions. In certain embodiments, the device comprises a microfluidic chamber containing a surface-immobilized SWCNT sensor, or an SWCNT sensor contained in a semi-permeable enclosure.
In another aspect, the invention is directed to a dynamic DNA nanotechnology device comprising a single-walled carbon nanotube (SWCNT) sensor. In certain embodiments, the device is a circuit, a catalytic amplifier, an autonomous molecular motor, or a reconfigurable nanostructure.
Elements of the embodiments involving one aspect of the invention (e.g., methods) can be applied in embodiments involving other aspects of the invention (e.g., devices), and vice versa.
In order for the present disclosure to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.
In this application, the use of “or” means “and/or” unless stated otherwise. As used in this application, the term “comprise” and variations of the term, such as “comprising” and “comprises,” are not intended to exclude other additives, components, integers or steps. As used in this application, the terms “about” and “approximately” are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
“Administration”: The term “administration” refers to introducing a substance into a subject. In general, any route of administration may be utilized including, for example, parenteral (e.g., intravenous), oral, topical, subcutaneous, peritoneal, intraarterial, inhalation, vaginal, rectal, nasal, introduction into the cerebrospinal fluid, or instillation into body compartments. In some embodiments, administration is oral. Additionally or alternatively, in some embodiments, administration is parenteral. In some embodiments, administration is intravenous.
“Affinity”: As is known in the art, “affinity” is a measure of the tightness with a particular ligand binds to its partner. Affinities can be measured in different ways. In some embodiments, affinity is measured by a quantitative assay. In some such embodiments, binding partner concentration may be fixed to be in excess of ligand concentration so as to mimic physiological conditions. Alternatively or additionally, in some embodiments, binding partner concentration and/or ligand concentration may be varied. In some such embodiments, affinity may be compared to a reference under comparable conditions (e.g., concentrations).
“Amphipathic” or “Amphiphilic”: The terms “amphipathic” and “amphiphilic” are interchangeably used herein, and each termrefers to a molecule containing both a hydrophilic (and/or charged) domain and a hydrophobic domain.
“Analog”: As used herein, the term “analog” refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an “analog” shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, an analog is a substance that can be generated from the reference substance, e.g., by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance. In some embodiments, an analog is or can be generated through performance of a synthetic process different from that used to generate the reference substance.
“Aptamer”: As used herein, the term “aptamer” refers to a macromolecule composed of nucleic acid (e.g., RNA, DNA) that binds tightly to a specific molecular target (e.g., an umbrella topology glycan). A particular aptamer may be described by a linear nucleotide sequence and is typically about 15-60 nucleotides in length. Without wishing to be bound by any theory, it is contemplated that the chain of nucleotides in an aptamer form intramolecular interactions that fold the molecule into a complex three-dimensional shape, and this three-dimensional shape allows the aptamer to bind tightly to the surface of its target molecule. Given the extraordinary diversity of molecular shapes that exist within the universe of all possible nucleotide sequences, aptamers may be obtained for a wide array of molecular targets, including proteins and small molecules. In addition to high specificity, aptamers typically have very high affinities for their targets (e.g., affinities in the picomolar to low nanomolar range for proteins). In many embodiments, aptamers are chemically stable and can be boiled or frozen without loss of activity. Because they are synthetic molecules, aptamers are amenable to a variety of modifications, which can optimize their function for particular applications. For example, aptamers can be modified to dramatically reduce their sensitivity to degradation by enzymes in the blood for use in in vivo applications. In addition, aptamers can be modified to alter their biodistribution or plasma residence time.
“Associated”: As used herein, the term “associated” typically refers to two or more entities in physical proximity with one another, either directly or indirectly (e.g., via one or more additional entities that serve as a linking agent), to form a structure that is sufficiently stable so that the entities remain in physical proximity under relevant conditions, e.g., physiological conditions. In some embodiments, associated moieties are covalently linked to one another. In some embodiments, associated entities are non-covalently linked. In some embodiments, associated entities are linked to one another by specific non-covalent interactions (e.g., by interactions between interacting ligands that discriminate between their interaction partner and other entities present in the context of use, such as, for example, streptavidin/avidin interactions, antibody/antigen interactions, etc.). Alternatively or additionally, a sufficient number of weaker non-covalent interactions can provide sufficient stability for moieties to remain associated. Exemplary non-covalent interactions include, but are not limited to, electrostatic interactions, hydrogen bonding, affinity, metal coordination, physical adsorption, host-guest interactions, hydrophobic interactions, pi stacking interactions, van der Waals interactions, magnetic interactions, electrostatic interactions, dipole-dipole interactions, etc.
“Nucleic acid”: As used herein, in its broadest sense, refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and/or nucleosides); in some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a “nucleic acid” is or comprises RNA; in some embodiments, a “nucleic acid” is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid is, comprises, or consists of one or more “peptide nucleic acids”, which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and/or 5′-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is single stranded; in some embodiments, a nucleic acid is double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. In some embodiments, a nucleic acid has enzymatic activity.
“Polypeptide”: As used herein refers to any polymeric chain of amino acids. In some embodiments, a polypeptide has an amino acid sequence that occurs in nature. In some embodiments, a polypeptide has an amino acid sequence that does not occur in nature. In some embodiments, a polypeptide has an amino acid sequence that is engineered in that it is designed and/or produced through action of the hand of man. In some embodiments, a polypeptide may comprise or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, a polypeptide may comprise or consist of only natural amino acids or only non-natural amino acids. In some embodiments, a polypeptide may comprise D-amino acids, L-amino acids, or both. In some embodiments, a polypeptide may comprise only D-amino acids. In some embodiments, a polypeptide may comprise only L-amino acids. In some embodiments, a polypeptide may include one or more pendant groups or other modifications, e.g., modifying or attached to one or more amino acid side chains, at the polypeptide's N-terminus, at the polypeptide's C-terminus, or any combination thereof. In some embodiments, such pendant groups or modifications may be selected from the group consisting of acetylation, amidation, lipidation, methylation, pegylation, etc., including combinations thereof. In some embodiments, a polypeptide may be cyclic, and/or may comprise a cyclic portion. In some embodiments, a polypeptide is not cyclic and/or does not comprise any cyclic portion. In some embodiments, a polypeptide is linear. In some embodiments, a polypeptide may be or comprise a stapled polypeptide. In some embodiments, the term “polypeptide” may be appended to a name of a reference polypeptide, activity, or structure; in such instances it is used herein to refer to polypeptides that share the relevant activity or structure and thus can be considered to be members of the same class or family of polypeptides. For each such class, the present specification provides and/or those skilled in the art will be aware of exemplary polypeptides within the class whose amino acid sequences and/or functions are known; in some embodiments, such exemplary polypeptides are reference polypeptides for the polypeptide class or family. In some embodiments, a member of a polypeptide class or family shows significant sequence homology or identity with, shares a common sequence motif (e.g., a characteristic sequence element) with, and/or shares a common activity (in some embodiments at a comparable level or within a designated range) with a reference polypeptide of the class; in some embodiments with all polypeptides within the class). For example, in some embodiments, a member polypeptide shows an overall degree of sequence homology or identity with a reference polypeptide that is at least about 30-40%, and is often greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more and/or includes at least one region (e.g., a conserved region that may in some embodiments be or comprise a characteristic sequence element) that shows very high sequence identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99%. Such a conserved region usually encompasses at least 3-4 and often up to 20 or more amino acids; in some embodiments, a conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more contiguous amino acids. In some embodiments, a useful polypeptide may comprise or consist of a fragment of a parent polypeptide. In some embodiments, a useful polypeptide as may comprise or consist of a plurality of fragments, each of which is found in the same parent polypeptide in a different spatial arrangement relative to one another than is found in the polypeptide of interest (e.g., fragments that are directly linked in the parent may be spatially separated in the polypeptide of interest or vice versa, and/or fragments may be present in a different order in the polypeptide of interest than in the parent), so that the polypeptide of interest is a derivative of its parent polypeptide.
“Prevent or prevention”: As used herein when used in connection with the occurrence of a disease, disorder, and/or condition, refers to reducing the risk of developing the disease, disorder and/or condition and/or to delaying onset of one or more characteristics or symptoms of the disease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder or condition has been delayed for a predefined period of time.
“Protein”: As used herein, the term “protein” refers to a polypeptide (i.e., a string of at least two amino acids linked to one another by peptide bonds). Proteins may include moieties other than amino acids (e.g., may be glycoproteins, proteoglycans, etc.) and/or may be otherwise processed or modified. Those of ordinary skill in the art will appreciate that a “protein” can be a complete polypeptide chain as produced by a cell (with or without a signal sequence), or can be a characteristic portion thereof. Those of ordinary skill will appreciate that a protein can sometimes include more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means. Polypeptides may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term “peptide” is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, proteins are antibodies, antibody fragments, biologically active portions thereof, and/or characteristic portions thereof.
“Sample”: As used herein, the term “sample” typically refers to a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, a source of interest comprises an organism, such as an animal or human. In some embodiments, a biological sample is or comprises biological tissue or fluid. In some embodiments, a biological sample may be or comprise bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washings or lavages such as a ductal lavages or broncheoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions, and/or excretions; and/or cells therefrom, etc. In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, obtained cells are or include cells from an individual from whom the sample is obtained. In some embodiments, a sample is a “primary sample” obtained directly from a source of interest by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc. In some embodiments, as will be clear from context, the term “sample” refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane. Such a “processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc.
“Substantially”: As used herein, the term “substantially”, and grammatic equivalents, refer to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the art will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result.
“Subject”: As used herein, the term “subject” includes humans and mammals (e.g., mice, rats, pigs, cats, dogs, and horses). In many embodiments, subjects are mammals, particularly primates, especially humans. In some embodiments, subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; poultry such as chickens, ducks, geese, turkeys, and the like; and domesticated animals particularly pets such as dogs and cats. In some embodiments (e.g., particularly in research contexts) subject mammals will be, for example, rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like.
“Therapeutic agent”: As used herein, the phrase “therapeutic agent” refers to any agent that has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect, when administered to a subject.
“Treatment”: As used herein, the term “treatment” (also “treat” or “treating”) refers to any administration of a substance that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition. Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition. Alternatively or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.
Drawings are presented herein for illustration purposes, not for limitation.
Described herein are devices and methods for the detection of microRNA (miRNA) and other oligonucleotides in biofluids based on the triggered assembly of a surfactant supramolecular complex on DNA-dispersed SWCNTs. This triggered assembly results in a highly specific emission blueshift shift and an increase in quantum yield based on the resulting decrease in the effective solvent dielectric constant immediately surrounding the nanotube. In certain embodiments, it is possible to detect miRNA with a threshold of 10 pM, with a tunable dynamic range over 5 orders of magnitude (10 pM to 10 μM). Without wishing to be bound by theory, by imaging single nanotube shifting on a surface, it is possible to reduce the threshold theoretically to 10's of copies. In other embodiments, for example by using a structure-switching aptamer for ATP that releases a target oligonucleotide upon binding, it is possible to expand the platform for indirect detection of other biologically relevant analytes.
Described herein are label-free sensors that detect hybridization events of miRNA and other oligonucleotides transiently and in vivo. Included are sensors which transduce the hybridization of small DNA and RNA oligonucleotides into spectral changes of carbon nanotube photoluminescence. Without wishing to be bound by any particular theory, the mechanism of action of the sensors was determined via experiments and molecular dynamics simulations to be a competitive response to local dielectric and electrostatic factors. Accordingly, a scheme was designed where amphiphilic moieties undergo triggered assembly on the nanotube surface upon binding of target miRNA, resulting in a markedly enhanced spectral response. As provided herein, it is shown that the sensors enable multiplexed detection using different nanotube chiralities and real-time monitoring of toehold-mediated DNA-strand displacement, causing a reversal of the signal response. The sensors are highly resistant to non-specific interactions with biological molecules, allowing for direct detection in urine and serum. Further, described herein is the first in vivo optical detection of target DNA and miRNA by encasing the sensor within an implantable device through which hybridization is detected non-invasively via near-infrared fluorescence in live mice.
In certain embodiments, SWCNTs can be used for chirality specific sensing for multiplexed miRNA detection. Importantly, the triggered assembly of surfactant allows for specific and sensitive detection of oligonucleotides in the complex biological environments found in serum and urine, allowing for direct optical measurement of oligonucleotides in these biofluids without the need for purification or labeling. In certain embodiments, the nanotube sensor is encapsulated in a semi-permeable membrane. In certain specific embodiments, this encapsulated sensor can be used for the specific detection of a cancer biomarker miRNA in a live animal.
Individually-dispersed semiconducting single-walled carbon nanotubes (SWCNTs) exhibit exciting properties for use as optical biomedical sensors. Semiconducting carbon nanotubes are fluorescent in the near-infrared spectral region, a wavelength range penetrant to tissue, and they do not photobleach. Their emission wavelength and intensity are sensitive to the local environment, allowing perturbations at the nanotube surface to be transduced via modulation of their emission, with up to single-molecule sensitivity. Moreover, there are about 17 distinct nanotube (n,m) species (chiralities) with unique and resolvable emission wavelengths that can be measured, potentiating multiplexed detection schemes.
Described herein are devices and methods comprising a single-walled carbon nanotube (SWCNT) sensor. In certain embodiments, the sensor comprises a SWCNT and a nucleotide attached to the SWCNT. In certain embodiments, the sensor further comprises a surfactant.
Described herein are devices and methods comprising single-walled carbon nanotubes (SWCNTs). SWCNTs are rolled sheets of graphene with nanometer-sized diameters. SWCNTs are defined by their chirality. The sheets that make up the SWCNTs are rolled at specific and discrete, i.e., “chiral” angles. This rolling angle in combination with the nanotube radius determines the nanotube's properties. SWCNTs of different chiralities have different electronical properties. These electronic properties are correlated with respective differences in optical properties. Thus, individually-dispersed semiconducting SWCNTs exhibit ideal qualities as optical biomedical sensors.
Semiconducting SWCNTs are fluorescent in the near-infrared (NIR, 900-1600 nm) due to their electronic band-gap between valence and conduction band. The semiconducting forms of SWNTs, when dispersed by surfactants in aqueous solution, can display distinctive near-infrared (IR) photoluminescence arising from their electronic band gap. IR is a wavelength range penetrant to tissue, and thus potentially suitable for implantable sensors or other devices. The band-gap energy is sensitive to the local dielectric environment around the SWNT, and this property can be exploited in chemical sensing. Among the molecules that can bind to the surface of SWNTs is DNA, which adsorbs as a double-stranded (ds) complex. Certain DNA oligonucleotides will transition from the native, right-handed B form to the left-handed Z form as cations adsorb onto and screen the negatively charged backbone. Additionally, SWCNTs do not photobleach due to their excitonic nature of fluorescence. DNA-DNA hybridization between nanotube-associated DNA and free single-strand DNA in solution can mediate a solvatochromic shift in the nanotube emission.
In certain embodiments, the sensor as described herein comprises a polymer capable of being non-covalently or covalently conjugated to the SWCNT. In certain embodiments, the polymer is DNA, RNA, an artificial nucleic acid including peptide nucleic acid (PNA), Morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), an amino-acid sequence, or a synthetic monomer
In certain embodiments, the sensor as described herein comprises a nucleotide attached to the SWCNT. In certain embodiments, the nucleotide can have fewer than 100,000, fewer than 50,000, fewer than 25,000, fewer than 10,000, fewer than 5,000, fewer than 1,000, fewer than 500, fewer than 250, fewer than 100, fewer than 75, fewer than 50, fewer than 30, fewer than 25, fewer than 20, 15, 12, 10, 8, 6 or 4 nucleotides.
In certain embodiments, the nucleotide can have a random sequence. In certain embodiments, the nucleotide can have an ordered sequence. In certain embodiments, the ordered sequence can be a predetermined sequence. In certain embodiments, the ordered sequence can be a repeating sequence. In certain embodiments, the repeat sequence can include fewer than 500, fewer than 400, fewer than 300, fewer than 200, fewer than 100, fewer than 50, fewer than 30, fewer than 25, fewer than 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 or 2 nucleotides. In certain embodiments, the polynucleotide can be poly(AT), poly(GT), poly(CT), poly(AG), poly(CG), or poly(AC). In certain embodiments, the polynucleotide can have a content. In certain embodiments, the content can be a percentage of a unique nucleotide present in the sequence.
In certain embodiments, the nucleotide sequence is a single-stranded DNA molecule. In certain embodiments, the single-stranded DNA (ssDNA) has a sequence complementary to a target nucleotide sequence. In certain embodiments, the ssDNA has a sequence complementary to sequence to miRNA. In certain embodiments, the miRNA is an endogenous piece of RNA with a 21-23 nucleotide sequence. In certain embodiments, the miRNA is mir19, mir21, mir39, mir96, mir126, mir152, mir182, mir183, mir494, or mir509. In certain embodiments, the miRNA is a nucleotide described in Appendix B.
In certain embodiments, the nucleotide has a first domain and a second domain. In certain embodiments, the first domain has a sequence complementary to a target nucleotide sequence as described below. In certain embodiments, the first domain has a sequence complementary to a target miRNA.
In certain embodiments, the second domain is a stabilizing domain, e.g., wherein stabilizing means prevents/reduces agglomeration of SWCNTs and/or promotes stability of a suspension of the SWCNTs. In certain embodiments, the second nucleotide sequence is a short oligonucleotide sequence, e.g., (GT)6 (SEQ ID NO: 2), (GT)15 (SEQ ID NO: 1), (AT)15 (SEQ ID NO: 3), (TAT)6 (SEQ ID NO: 4), (TCC)10 (SEQ ID NO: 5), (TGA)10 (SEQ ID NO: 6), (CCA)10 (SEQ ID NO: 7), (TTA)4TT (SEQ ID NO: 8), (TTA)3TTGTT (SEQ ID NO: 9), (TTA)5TT (SEQ ID NO: 10), (TAT)4 (SEQ ID NO: 11), (CGT)3C (SEQ ID NO: 12), (ATT)4 (SEQ ID NO: 13), (ATT)4AT (SEQ ID NO: 14), (TATT)2TAT (SEQ ID NO: 15), (ATTT)3 (SEQ ID NO: 16), (GTC)2GT (SEQ ID NO: 17), (CCG)4 (SEQ ID NO: 18), (GTT)3G (SEQ ID NO: 19), (TGT)4T (SEQ ID NO: 20), (TATT)3T (SEQ ID NO: 22), (TCG)10 (SEQ ID NO: 23), (GTC)3 (SEQ ID NO: 24), (TCG)2TC (SEQ ID NO: 25), (TCG)4TC (SEQ ID NO: 26), (GTC)2 (SEQ ID NO: 27), (TGTT)2TGT (SEQ ID NO: 28), (TTTA)3T (SEQ ID NO: 29), (CCG)2CC (SEQ ID NO: 30), (TCG)4TC (SEQ ID NO: 31), T3C6T3 (SEQ ID NO: 32), (GTC)2GT (SEQ ID NO: 33), CTTC2TTC (SEQ ID NO: 34), TTA(TAT)2ATT (SEQ ID NO: 35), TCT(CTC)2TCT (SEQ ID NO: 36), (ATT)4 (SEQ ID NO: 37), GC11 (SEQ ID NO: 38), (TC)3CTCCCT (SEQ ID NO: 39), CTTC3TTC (SEQ ID NO: 40), (GT)20 (SEQ ID NO: 41), CTC3TC (SEQ ID NO: 42), (TCT)2 (SEQ ID NO: 43), C5TC6 (SEQ ID NO: 44), T4C4T4 (SEQ ID NO: 45), C5TTC5 (SEQ ID NO: 46), and/or other single-strand DNA that form water soluble complexes with SWCNT.
In certain embodiments, the nucleotide has two, three, four, five, six, seven, eight, or more domains. In certain embodiments, the domains have sequences complementary to one or more target nucleotide sequences.
In certain embodiments, the methods and devices described herein comprise one or more colloidal stabilization agents. A colloidal stabilization agent is any substance that hinders or prevents aggregation and sedimentation of liquid suspended particles. In certain embodiments, the colloidal stabilization agent is a surfactant. Surfactants are compounds that lower the surface tension (or interfacial tension) between two liquids or between a liquid and a solid. In certain embodiments, the surfactant is a detergent. In certain embodiments, the surfactant is an anionic surfactant, a carboxylate, a cationic surfactant, a zwitterionic surfactant, or a non-ionic surfactant. In certain embodiments, the methods and devices described herein comprise one or more of SDS, SDBS, SDC, SPAN-80, Brij 52, BSA, Triton X-100, Pluronic, Pyrene-PEG, TPGS, IGEPAL, and Phospholipid-PEG-NH2.
Target conditions and diseases that can be diagnosed, treated and/or prevented using the devices and methods described herein include all cancers, metabolic disease, fetal health condition, kidney disease, organ rejection, hereditary diseases, nervous disease, obesity, and infectious disease. In certain embodiments, the condition or disease is at least in part characterized by a substance, i.e., an analyte.
In certain embodiments, the analytes that can be detected or otherwise manipulated using the devices and methods described herein include nucleotide sequences, e.g., polynucleotides, oligonucleotides, radionucleotides, DNA, RNA, long non-coding RNA, microRNA (miRNA), circulating microRNA, messenger RNA (mRNA), circulating messenger RNA, cell-free tumor DNA, or fragments, analogues, or compounds thereof. Analytes that can be detected or otherwise manipulated using the devices and methods described herein include any molecule or organism having or being associated with the target nucleotide sequences, including peptides, polypeptides, proteins, biologics, biomolecules, biosimilars, aptamers, viruses, bacteria, toxins, cells, antibodies, or fragments thereof.
In certain embodiments, the analyte is a nucleotide with the sequence mir19, mir21, mir39, mir96, mir126, mir152, mir182, mir183, mir494, or mir509, or a nucleotide described in Table 12.
In certain embodiments, the device is a sensing platform. In certain embodiment, the device is a sensor. In certain embodiments, the device is in contact with a biofluid or bodily fluid sample. In certain embodiments, the bodily fluid sample is e.g., Amniotic fluid, Aqueous humour and vitreous humour, Bile, Blood serum, Breast milk, Cerebrospinal fluid, Cerumen (earwax), Chyle, Chyme, Endolymph and perilymph, Exudates, Feces, Female ejaculate, Gastric acid, Gastric juice, Lymph, Menstrual fluid, Mucus (including nasal drainage and phlegm), Pericardial fluid, Peritoneal fluid, Pleural fluid, Pus, Rheum, Saliva, Sebum (skin oil), Serous fluid, Semen, Smegma, Sputum, Synovial fluid, Sweat, Tears, Urine, Vaginal secretion, Vomit., etc. In certain embodiments, the bodily fluid in contact with the device is not treated or purified prior to contact with the device.
In certain embodiments, the device is a sensor, or comprises a sensor, as described herein, wherein the device is placed outside of an organism to be treated or diagnosed. In certain embodiments, the device is a point-of-care diagnostic device, a wearable device, or a piece of laboratory equipment. In certain embodiments, the device can be positioned on the surface of the organism, such as the arm, and, e.g., worn like a wristwatch. In certain embodiments, the device is implantable into the organism. In certain embodiments, the devices is a point-of-care medical device, e.g., a (urine) dipstick, a test strip, a membrane, a skin patch, a skin probe, a gastric band, a stent, a catheter, a needle, a contact lens, a prosthetic, a denture, a vaginal ring, or other implant. In certain embodiments, the device comprises a solid support, a membrane, a gel, or a microfluidic component. In certain embodiments, the device comprises a microfluidic chamber containing a sensor. In certain embodiments, the device comprises a sensor contained in a semi-permeable enclosure.
In certain embodiments, the organism to be treated or diagnosed is a mammal, a human, a dog, a rodent, or a farm animal. In certain embodiments, the device is used in to detect oligonucleotides in vivo with a noninvasive method. In certain embodiments, the method is a real-time, non-invasive monitoring in vivo.
In certain embodiments, the device is a sensor, or comprises a sensor, as described herein, and is exposed excitation electromagnetic radiation (excitation EMR) to produce an emission of electromagnetic radiation (emission EMR) by the SWCNT sensor. In certain embodiments, the excitation EMR is ultraviolet light, infrared light, or near-infrared light (NIR). In certain embodiments, the excitation EMR is visible light. In certain embodiments, the excitation EMR has a wavelength between 100 nm and 3000 nm, 200 nm and 2000 nm, between 300 and 1500 nm, or between 500 and 1000 nm.
In certain embodiments, the emission EMR is ultraviolet light, infrared light, or near-infrared light (NIR). In certain embodiments, the emission EMR is visible light. In certain embodiments, the emission EMR has a wavelength between 300 nm and 3000 nm, between 400 and 2000 nm, between 500 and 1500 nm, between 600 nm and 1400 nm, or between 700 and 1350 nm.
In certain embodiments, the methods described herein can be used for diagnostic or therapeutic purposes to diagnose, prevent, or treat any condition or disease characterized by or associated with an analyte as described herein. In certain embodiments, the method comprises contacting a test sample comprising a species having a target nucleotide sequence with the SWCNT sensor; exposing the test sample to excitation electromagnetic radiation (excitation EMR) to produce an emission of electromagnetic radiation (emission EMR) by the SWCNT sensor; detecting the electromagnetic radiation emitted by the SWCNT sensor; and identifying the presence of the species having the target nucleotide sequence (e.g., a polynucleotide, oligonucleotide, radionucleotide, DNA, RNA, microRNA, circulating microRNA, messenger RNA (mRNA), cell-free tumor DNA, or a fragment, an analogue, or a compound thereof) in the test sample based at least in part on the detected emission EMR. Sources of excitation EMR can be any such source known in the art, e.g., a laser, a light emitting diode, or a lamp. Detectors of emission EMR can be any such detector known in the art, e.g., a fluorometer. In certain embodiments, the method comprises detecting a wavelength shift (e.g., a blue or red shift) in the emission EMR and/or an intensity shift (e.g., amplitude shift), or other changes in the spectral characteristics of in the emission EMR, thereby identifying the presence of the species having the target nucleotide sequence in the test sample.
In certain embodiments, a photoluminescence plot (PL plot), as previously described in Bachilo, S. M. et al. Science 298, 2361-6 (2002) can be generated from the emission EMR data. Without wishing to be bound by theory, from the complete PL plots, the peaks can be fit using Gaussian lineshapes to identify the peak center, which then can be used to calculate the magnitude of emission and excitation wavelength shifts relative to a control. In certain embodiments, the method comprises detecting an intensity shift between an emission center wavelength (e.g., a peak) of the test sample and an emission center wavelength (e.g., a peak) of a reference sample, wherein the reference sample is devoid of the species having the target nucleotide sequence. In certain embodiments, the emission wavelength shift is between 1 nm and 100 nm, between 2 nm and 100 nm, between 3 and 50 nm, or between 4 and 20 nm. In certain embodiments, the wavelength shift is a color shift, e.g., a redshift or a blueshift. In certain embodiments, the wavelength shift is a blueshift.
In certain embodiments, the methods comprise the use of a structure-switching aptamer. Without wishing to be bound by theory, in certain embodiments, ATP causes the aptamer to release a target oligonucleotide upon binding. The released target oligonucleotide is detected using the sensors and methods described herein.
In certain embodiments, the device is a sensor, or comprises a sensor, as described herein, and is a device for a non-medical application. In certain embodiments, the device is a device for monitoring environmental conditions. In certain embodiments, the device comprises a solid support, a membrane, a gel, or a microfluidic component, or a combination thereof. In certain embodiments, the device comprises a microfluidic chamber containing a sensor. In certain embodiments, the device comprises a sensor contained in a semi-permeable enclosure.
Dynamic DNA nanotechnology using strand-displacement reactions has recently emerged as an attractive engineering system for various devices, including reconfigurable nanostructures, based on the specificity and versatility of DNA oligonucleotides. Strand displacement reactions can occur through the use of “toeholds,” single-strand overhangs on duplexed DNA that facilitate binding of an invader strand to displace the shorter bound strand. In certain embodiments, the methods and devices described herein relate to Dynamic DNA nanotechnology. In certain embodiments, the device is a component of a nucleic acid system with designed dynamic functionalities related to its overall structures, such as computation and mechanical motion. DNA base pairing allows for the construction of DNA nanostructures and nanodevices through the programmed hybridization of complementary strands. Structures include (logic) circuits, catalytic amplifiers, autonomous molecular motors and reconfigurable nanostructures. Without wishing to be bound by theory, in certain embodiments, the devices described herein can be used in DNA strand-displacement reactions, in which two strands with partial or full complementarity hybridize, displacing in the process one or more pre-hybridized strands, causing dynamic behavior in the system of interest.
In this example, the basic design of the sensor/sensing platform uses a DNA oligonucleotide to both disperse and stabilize the SWCNTs as well as to provide specificity to target oligonucleotides. The DNA oligonucleotide has a modular design containing two domains; a domain to impart colloidal stability, and a contiguous domain complementary to a target oligonucleotide. A screen of a certain number of sequences found to stably disperse SWCNTs showed that (GT)15 (SEQ ID NO: 1) provides the best stability and resistance to non-specific oligonucleotide interactions (
Sequences of miRNA used herein are provided in Table 1.
ACA-3′
The optical response of the GT15mir19 sensor was tested using both a DNA-based and RNA-based analyte miR-19 sequence, as well as a length-matched, randomly generated, non-complementary control (R23). After incubation with miR-19 or R23, eleven different nanotube chiralities were measured via two-dimensional excitation/emission photoluminescence spectroscopy (“PL plots”,
To verify that hybridization to the GT15mir19 sensor occurred upon introduction of the target, a hairpin oligonucleotide was designed which would make binding of the target more apparent by atomic force microscopy (AFM). The oligonucleotide was composed of the miR-19 or R23 sequence, a short spacer, and a 52-nucleotide hairpin region (
Because the mechanism of nanotube spectral changes induced by oligonucleotide hybridization is poorly understood, a set of experiments was designed to better determine the structural changes of the sensor induced by hybridization. It was first investigated whether the hybridized duplex remained near the nanotube surface after the binding of target miRNA. An assay was developed using an organic fluorophore conjugated to the miRNA capture sequence under the premise that the fluorophore intensity would increase upon hybridization if the fluorophore desorbed from the nanotube surface, as organic fluorophores are known to quench upon interaction with the nanotube surface via an energy transfer mechanism. Nanotubes with the sequence GT6mir19 were suspended, (shortened due to synthesis constraints) containing the Cy5 dye conjugated to the 3′ end of the miR-19-binding domain (scheme in
Upon addition of miR-19 to the modified complex, it was found that Cy5 fluorescence increased over time, while the R23 sequence caused no change in Cy5 fluorescence (
Using all-atom molecular dynamics simulations, it was assessed whether the GT15mir19 sequence could remain stable on the nanotube upon partial hybridization. The pre-hybridized sequence was placed in the vicinity of the (9,4) nanotube with explicit water and counterions, and a simulation was run for 250 ns (as provided herein). The single-stranded portion of the oligomer bound to the nanotube and the hybridized construct remained stable on the nanotube surface for the remainder of the simulation (
The simulations allowed the quantification of nucleobase adsorption to the nanotube surface. The radial distance of the nucleobases was measured from the nanotube surface and their stacking angles relative to the nanotube surface (
The thermodynamic concerns regarding the stability of the hybridized duplex were assessed in the presence of the nanotube. Molecular dynamics simulations of hybridized miR-19, without the (GT)15 (SEQ ID NO: 1) nanotube binding domain, in the presence of the nanotube were run using several different initial conditions (
The molecular dynamics simulations were also analyzed to gain a quantitative determination of the carbon nanotube spectral response upon hybridization. Comparing the water density as a function of distance at the end of the two simulations, it was found that a slight increase in the water concentration near the nanotube in the hybridized structure (
Table 2 shows surfactant and polymer suspended nanotubes spectral properties. Note that numbers in parentheses indicate the molecular weight of polyethylene glycol; these surfactants share polyethlene glycol as a component. Accordingly, the numbers in parentheses are included for comparison.
As the simulations showed an increase in available nanotube surface area upon hybridization, it was hypothesized that additional small amphipathic molecules might assemble on this newly exposed nanotube surface to enhance the optical response. Low concentrations of several candidate surfactants (Table 3) were tested to determine whether they changed the optical response of the GT15mir19 sensor (
The study found that a low concentration (0.2% wt/vol, or 5.7 mM) of sodium dodecylbenzenesulfonate (SDBS), a mild surfactant known to associate with nanotubes, resulted in an increase in the degree of hybridization-dependent blue-shifting and intensity enhancement by an order of magnitude (
To further assess the specificity of the sensor response, an ensemble of randomly generated oligonucleotides was introduced. A random library of 23 nt oligonucleotides, with a diversity of approximately 423 different sequences, was introduced to the GT15mir19 sensor, resulting in no response (
Functionality of the sensor was tested using both a DNA-based and an RNA-based target miR-19 sequence, as well as a length-matched random DNA and RNA sequence control (R23). After incubation with miR-19 or R23, eleven different nanotubes were sampled by measuring fluorescence intensity as a function of excitation wavelength and emission wavelength in a photoluminescence plot (PL plot). From the complete PL plots (
To verify that the sensor was only interacting with the complementary oligonucleotide, the height-profile changes were measured with AFM after incubation with the target sequence or with the random sequence control. To exacerbate a change in height after binding, hairpins were designed with a 20 nucleotide long stem and 12 nucleotide loop that contained the single strand miR-19 or miR-23 sequence at the end of the stem. After overnight incubation and washing, the sample was adsorbed to mica and measured with AFM. In both samples, the helical wrapping pattern of GT15mir19 was visible, as reported previously for single-stranded DNA (see Gigliotti, B., Nano Lett. 6, 159-64 (2006)). A comparison of the average heights between the sample that had received miR-19-hairpin versus the R23-hairpin showed that the miR-19-hairpin increased the average height by about 0.6 nm, consistent with the miR-19-hairpin being bound to the surface (
Without wishing to be bound by theory, mechanistically, the change in nanotube optical response may be due to the hybridized duplex remaining on the nanotube surface after complementary base-pairing, or due to the newly formed duplex partially dissociating from the surface. To test this, SWCNTs were suspended with GT6mir19 containing the fluorophore Cy5 conjugated to the end of the miR-19-binding domain. GT6 (SEQ ID NO: 2) was chosen as the dispersing domain due to length restraints for oligonucleotide functionalization with fluorophores. While less effective at providing resistance to R23 binding at high concentrations, GT6mir19 still specifically blueshifted upon hybridization with target oligonucleotide (
It was hypothesized that the observed blueshifting could be enhanced by adding a small amount of amphipathic molecules to interact with and assemble upon the newly exposed carbon nanotube surface. After screening several amphipathic molecules, sodium dodecylbenzenesulfonate (SDBS), a surfactant known to associate with SWCNTs, was found to greatly enhance the magnitude of blueshifting and intensity enhancement.
Optical transition energies for DNA-wrapped SWCNTs are red-shifted by 10-20 meV compared to nanotubes suspended entirely in surfactants like SDS or SDBS (See Haggenmueller, R. et al. Langmuir 24, 5070-8 (2008); Fantini, C. et al. Chem. Phys. Lett. 473, 96-101 (2009)). This is due to incomplete coverage of the nanotube surface by DNA, which allows for greater accessibility of water and a resulting larger dielectric in the immediate vicinity of the nanotube (See Miyauchi, Y. et al. Chem. Phys. Lett. 442, 394-399 (2007). Additionally, SDBS suspended nanotube have been shown to produce a higher quantum yield than DNA-suspended nanotubes (See Fantini et al.). Without wishing to be bound by theory, the blueshifted shoulder-feature that SDBS produced on the spectra of DNA-wrapped nanotubes in the photoluminescence plots (
To test the stability of GT15mir19 with SDBS, PL plots after a 1:2 serial dilution from 4% to 0.004% SDBS (128 mM to 0.0625 mM) were measured. Increasing SDBS showed only minor changes in the baseline emission of GT15mir19, except at high concentrations for some large-diameter chiralities (above about 2%). GT15mir19, for most chiralities, was remarkably stable over 4 orders of magnitudes of SDBS in the absence of target miR (
The hybridization-triggered supramolecular assembly and resulting enhancement in blueshifting and quantum yield now provided a rationally designed platform for the detection of target RNA or DNA oligonucleotide. This was further characterized in terms of specificity. Because only one random sequence control was used, i.e., R23, random permutations of oligonucleotides each 23 bases long were generated to verify that the sensing platform could recognize the miR-19 target in the context of many random sequences. In the presence of 1 μM of the many random sequences, there was no significant change in wavelength for the measured chiralities (
Given the variety of potential miRNA biomarkers, it was sought to assess the modularly of the sensor. The miRNA capture sequence was substituted with several sequences specific to 9 different serum or urine miRNA biomarkers, as well as a sequence not found in humans (C. elegans miR-39) used for standardization in clinical applications (Table 4). Each GT15mirX sensor was treated with SDBS and interrogated with its respective miRNA target sequence, resulting in a wavelength shift which was comparable to that of the original miR-19 sensor, with slight sequence-to-sequence variations (
Table 4 shows name, disease relevance, and biofluid of miCRNAs tested in
To determine if the SDBS-GT15mirX sensor could discriminate among similar sequences, three related sequences from the miR-200 family were selected. The miR-200 family plays an essential role in the epithelial-to-mesenchymal transition (EMT) in cancer. Focusing on the wavelength response of the (9,4) nanotube chirality, a high degree of discrimination between the three sequences after one hour of incubation was observed (
To determine the limit and range of detection, a dose-response curve of the sensor was constructed over several orders of magnitude of miR-19 concentrations. At a minimal sensor concentration of 0.02 mg/L, the limit of detection of miRNA was between 10 and 100 pM (500 attomoles to 5 femtomoles) (
Table 5 shows SWCNT concentration, limit of detection, binding sites, and saturating range of values shown in
The kinetics of both DNA and miRNA detection were assessed via transient measurements. The kinetics of eleven different nanotube chiralities were measured by excitation/emission spectroscopy (
To test if the composition of the miRNA capture sequence influenced sensor kinetics, the response rates for the sensor was compared using 8 different miRNA capture sequences (
To better determine how the length and thermodynamics of hybridization relate to the optical response of the nanotube, several experiments were conducted using modified analyte oligonucleotides. The G15mir19 sensor was interrogated using analyte sequences between 10 and 23 nucleotides long which were complementary to either the 3′ terminal end of the miRNA capture sequence, or the middle of the sequence, as depicted in
To assess its broad applicability for the detection of different nucleic acid types, it was determined whether the sensor could detect oligonucleotides longer than miRNA sequences. First, it was determined how the GT15mir19 sensor would respond to a long oligonucleotide designed to contain a complementary sequence flanked by non-complementary sequences (
Sensors based on the GT15 (SEQ ID NO: 1) nanotube binding domain and a general capture sequence can be extended to detect longer nucleic acid sequences, but the orientation of the oligonucleotide is critical for eliciting a desired spectral response.
To determine the limit and range of detection, a dose-response over several orders of magnitude was constructed (
The kinetics of blueshifting were rapid, with changes evident within 5 minutes of miR-19 DNA addition (
Both molecular dynamics and ab initio calculations of nucleic acid interaction strengths with carbon nanotubes predict binding strengths in the order of G>A>T>C (See Johnson, R. R., et al. Small 6, 31-4 (2010)). To test if the base composition of the target recognition sequence initially bound to the nanotube played a role in the kinetics of blueshifting, the fitted rates for 8 different miR sequences whose recognition sequences had varying amounts of each base were compared. For the two chiralities measured, (9,4) and (8,6), a statistically significant correlation with the percent of guanine in the recognition sequence and the rate of blueshifting was found (
To better determine how the length and thermodynamics of hybridization relates to blueshifting of the nanotubes, truncated target sequences ranging from 10 to 15 nucleotides that can bind either from the 3′ end or the 5′ portion in the middle of the recognition sequence were used (depicted in
Table 6 shows truncated target sequences used for experiments depicted in
CAGTTTTGCATAGATTTGCACA
It was tested if GT15mir19 could detect a long sequence of ssDNA by addressing a smaller sequence in the middle. Using R23-mir19-R23, a 69 bp oligonucleotide with 23 complementary bases in the middle, it was found that even in the presence of SDBS, hybridization resulted in a small red-shift (
Without wishing to be bound by theory, the solution-phase dose-response data suggested that the limit of detection for miR-19 RNA is determined by ratio of nanotube binding sites to target RNA (
The sensor function on the single-nanotube level was assessed via spectral imaging. The sensor was deposited on a lysine-coated glass surface with sodium dodecyl sulfate (SDS). Hyperspectral microscopy was used to spectroscopically image the (9,4) nanotube (
The blue-shifting of single nanotubes was apparent upon interrogating the sensor with miR-19 RNA, but not upon introducing R23 RNA (
Ideally, each chirality of SWCNT could act as a specific sensor for a given miR, with potentially 11-12 SWCNTs that can be easily measured in a PL plot for multiplexed detection of 11-12 miR species. Multiplexed detection of several miRs is advantageous due to increased specificity and sensitivity when using multiple miRs as a biomarker for disease conditions. For an implantable sensor, this would be an especially valuable feature. Using two nanotube preparations differentially enriched for different chiralities, multiplexed detection of two miR sequences was demonstrated.
The potential for the multiplexed detection of several miRNA sequences via the use of different nanotube chiralities was assessed. Two nanotube preparations enriched for different nanotube chiralities were suspended with binding sequences for either miR-19 or miR-509. A preparation enriched in large diameter species, (Nano-C APT-200) was suspended by the GT15mir19 sequence, and a CoMoCAT preparation enriched in small diameter species was suspended using the GT15mir509 sequence. Excitation/emission plots found that the GT15mir19 sensor, encapsulating the APT-200 nanotubes, effectively lacked the (6,5) species (
As purity of production methods improves, more chiralities can be used for greater multiplexing.
It was then assessed whether the platform could be extended to other analytes of interest by linking target recognition with DNA release from a structure-switching aptamer. As a model, a structure-switching aptamer that recognizes ATP was chosen, due to its role in extracellular communication and as a marker of bacterial growth. Because the aptamer was designed so that ATP binding releases a 12 bp reporter strand of DNA, the miR recognition sequence was substituted for a reporter recognition sequence (GT15cReporter,
Dynamic DNA nanotechnology using strand-displacement reactions has recently emerged as an attractive engineering system for various devices, including reconfigurable nanostructures, based on the specificity and versatility of DNA oligonucleotides.
It was determined whether the spectral response of the sensor could be reversed via toehold-mediated strand displacement. Strand displacement reactions occur through the use of “toeholds,” single-strand overhangs on duplexed DNA that facilitate binding of a complementary strand, which is thermodynamically favored due to complete complementarity, and is thus able to displace the shorter bound strand.
Accordingly, the miRNA capture sequence of the GT15mir19 sensor was truncated to leave a 6 nucleotide overhang after hybridization with the target strand to test whether the addition of a removing strand (RS) to bind the toehold and displace the target would reverse the spectral shift, according to the scheme depicted in
Because SWCNTs are extremely sensitive to their immediate environment, they are prone to non-specific interactions in complex biological environments. When GT15mir19 was tested in a solution of 10% fetal bovine serum (FBS), there was a 2 nm redshift across all conditions, and target DNA could not be detected (
An application for the sensor/sensing platform is an implantable sensor for real-time monitoring of microRNA biomarkers. To demonstrate the utility of this platform for in vivo sensing, SDBS-pretreated GT15mir19 nanotubes were loaded into an implantable semipermeable membrane with a molecular weight cut off (500 kDa) small enough to keep the nanotubes inside, but to also allow sampling of small oligonucleotides in the environment (
Detection of miRNA in Biofluids
The ability of the GT15mir19 sensor to detect miRNA binding events in common biofluids—urine and serum—due to their clinical value was assessed as sources of microRNA biomarkers. The GT15mir19 sensor and SDBS were introduced concomitantly to whole urine from 5 healthy donors before interrogating with miR-19 RNA. The wavelength shifting response was clearly detectable against controls down to 1 nM of miRNA, and intensity enhancement gave a similar sensitivity, between 1 and 10 nM (
When target miR-19 RNA was introduced to the sensor, it was found that only a small response at the highest tested concentration (
Detection of miRNA Detection In Vivo
The present Example provides the ability of the system to detect miRNA in vivo via a minimally-invasive implantable device. The SDBS-treated GT15mir19 sensor was loaded into a semipermeable membrane capillary with a MWCO of 500 kDa (
The likelihood that the enhanced signal response provided by SDBS would continue after device implantation was also assessed. Thus, the semi-permeable capillary was filled with SDBS-pretreated GT15mir19 sensor and was placed in buffer dialysate for 6 hours. The buffer was changed and the sensor response was assessed with miR-19 every 2 hours (
The sensor response was tested in vivo after surgically implanting the membrane into the peritoneal cavity of NU/J (nude) mice. The membrane was placed medially over the intestines and sutured to the parietal peritoneum to immobilize the device. It was first tested whether DNA could be detected intraperitoneally by injecting 1 nanomole of miR-19 DNA, R23, or the vehicle control. The mice exhibited no obvious adverse effects or changes in behavior following the implantation or injection. After 90 min, the mice were anesthetized using isofluorane. A fiber optic-based probe system was developed to excite an 0.8 cm2 area with a 730 nm CW laser (
The implantable device was tested in vitro by immersing the filled capillary into buffer containing RNA, finding that the threshold of detection was below 10 pmol (
Two schemes shown in
For case A, one ssDNA is already adsorbed on the nanotube surface and its complementary partner ssDNA is introduced in the solution like the experimental setup as provided herein. The change in free energy upon hybridization is approximately −135 kcal/mol (at (300 K, 1 bar), which clearly indicates that hybridization is preferred over adsorption).
Similarly for case B, where both strands are initially adsorbed on the nanotube surface, the change in free energy upon hybridization is approximately +9 kcal/mol. This indicates that when both strands are initially adsorbed (
Several classes of amphipathic molecules were introduced to the GT15mir19 sensor to assess their potential to modulate the optical response to hybridization. Selected molecules included ionic surfactants, non-ionic triblock copolymers, non-ionic surfactants, PEG-functionalized lipid, and BSA due to their variety of steric and electrostatic properties (Table 3). After treatment for 4 hours with each amphipathic molecule, but before addition of target oligonucleotide, emission spectra were measured to assess the effect of each molecule in the absence of target miRNA. The impact on center wavelength and intensity are shown for the (7,5) nanotube, which was similar to the responses of other chiralities (
For each set of surfactant-treated nanotubes, complementary and non-complementary target oligonucleotides were introduced and incubated for 4 hours. Each amphipathic molecule was tested at a final concentration of 0.2% wt/vol with 2 mg/L of GT15mir19. Endpoint data showed that SDBS and IGEPAL provided the greatest enhancement of target miRNA-induced blue-shifting, followed by SDS, Brij52, and lipid-PEG to a smaller extent (
Optical transition energies for DNA-wrapped nanotubes are red-shifted by 10-20 meV (14-22 nm, depending on chirality) and quenched as compared to nanotubes suspended entirely with small molecule anionic surfactants like SDS or SDBS. A proposed mechanism has attributed this finding to incomplete coverage of the nanotube surface by DNA, which allows for greater accessibility of water, resulting in an increased polarity of the local solvent environment (higher local dielectric constant) in the immediate vicinity of the nanotube. However, a blue-shifted shoulder in the spectrum of the GTmir19 sensor was observed in the absence of the complementary miR-19 strand upon introduction of SDBS (
From spectroscopic studies of the GT15mir19 sensor response, a blue shift in nanotube excitation wavelengths was observed, suggesting that the binding of miR-19 RNA and DNA affects the ground state absorption energies in addition to the excited state.
The molecular weight of the sensor was estimated using the lower limit of the nanotube diameters to be 0.8 nm, wherein there are 20 carbons around the nanotube circumference. Thus, 80 carbon atoms are present for every 0.283 nm in nanotube length. Taking the average length of the nanotube, as measured via AFM, to be 166 nm, the resulting molecular weight of the nanotube is 564 kDa. The molecular weight of the GT15mir19 DNA sequence is 16.5 kDa. From AFM measurements, it was estimated that 5-10 copies of DNA per 100 nm, and thus 8.3 to 16.6 copies per 166 nm, adding 137 kDa to 275 kDa to the total complex. Thus, for an average length GT15mir19 sensor with diameter near the lower limit, the molecular weight would be between 701 kDa and 839 kDa.
Herein, label-free, amplification-free optical sensors were engineered for the quantitative detection of oligonucleotide hybridization events in vitro and non-invasively in vivo. The sensor mechanism, resulting from competitive effects of the displacement of both electrostatic charge and water from the carbon nanotube surface, has implications for the improvement of carbon nanotube-based optical and electronic sensors. A better determination of the effects of length, mismatches in sequence, and orientation of longer oligonucleotides on the optical response of the carbon nanotube was gained. The GT15mirX sensor enabled detection via single-molecule sensor elements and multiplexing using multiple nanotube chiralities. The monitoring of toehold-based strand displacement events portends use in nucleic acid-based logic circuits and also allowed the reversal of the sensor response and regeneration of the sensor complex, which may potentially be exploited for continuous use.
In vitro applications such as point-of-care diagnostics may provide the most immediate route to clinical use. It was found that the sensor can directly detect oligonucleotides in heterogeneous biofluids such as urine and serum with minimal pre-treatment, potentially circumventing biases and variability related to typical pre-analytical steps required for RT-qPCR. Regarding sensor parameters pertinent to clinical measurements, microRNA content in 12 body fluids were surveyed, providing useful quantitative information to estimate the physiological range of microRNA. The limit of detection of the provided sensor in bulk solution is in the picomolar range (e.g., greater than the picomolar range), although the threshold of detection and dynamic range depends on several factors, including binding site coverage. The ability to measure single-nanotube responses representing 1-60 copies of microRNA binding was also demonstrated, suggesting that sensitivities down to 10's of copies of microRNA can be obtained.
An implantable optical sensor device for the non-invasive detection of biomarkers such as miRNA may potentially be used in conjunction with wearable devices to facilitate the optical readout and data recording. The described sensor implants quantified miRNA down to 100 pmol in vivo. Further, miRNA is often found associated with the small protein Ago2, which makes it physiologically stable. Functionally, Ago2 binds to microRNA in a conformation to favor hybridization with target sequences, especially over an 8 nucleotide section called the seed sequence, but steric hindrance or charge interactions of the protein with miRNA could slow access to the protein-bound sections of the strand.
Table 7 shows GT15mirX sequences used herein.
CATAGATTTGCACA (SEQ ID NO: 47)
CTCACGGTACGA (SEQ ID NO: 63)
TACCATTGCCAAA (SEQ ID NO: 64)
GTCATGCACTGA (SEQ ID NO: 65)
CTGTCTGCAGTA (SEQ ID NO: 66)
GTGCTAGTGCCAAA (SEQ ID NO: 67)
TACCAGTGCCATA (SEQ ID NO: 68)
CGTGTATGTTTCA (SEQ ID NO: 69)
TTACACCCGGTGA (SEQ ID NO: 70)
GTCTGATAAGCTA (SEQ ID NO: 71)
CCAGACAGTGTTA (SEQ ID NO: 72)
CCAGACAGTATTA (SEQ ID NO: 73)
CCAGGCAGTATTA (SEQ ID NO: 74)
CATAGATT (SEQ ID NO: 75)
Table 8 shows analyte/target sequences used herein.
Table 9 shows truncated miR analyte sequences designed to hybridize to the middle of miRNA capture sequence.
TGCATAGATTTGCACA-3′ (SEQ ID NO: 47)
Table 10 shows truncated miR analyte sequences designed to hybridize to the 5′ end of miRNA capture sequence.
TGCATAGATTTGCACA-3′ (SEQ ID NO: 47)
Table 11 shows elongated analyte sequences used herein.
AAACTGATCGGTCAGTGGGTCATTGCTAGT
AAACTGA
TGTGCAAATCTATGCAAAACTGATCGGTCAGTGGGTCA
Carbon nanotubes produced by the HiPco process (Unidym, Sunnyvale, Calif.), CoMoCAT process (SG65i grade, Sigma-Aldrich, St. Louis, Mo., US), or a combustion process (APT-200, Nano-C, Westwood, Mass.) were mixed with DNA oligonucleotides (IDT DNA, Coralville, Iowa) at a 2:1 mass ratio in 1 mL of saline-sodium citrate (SSC) buffer and ultrasonicated for 30 minutes at 40% amplitude (Sonics & Materials, Inc.). The complete list of DNA sequences used for suspension can be found in Supplementary Methods. Following ultrasonication, the dispersions were ultracentrifuged (Sorvall Discovery 90SE) for 30 minutes at 280,000×g. The top 80% of the supernatant was collected. Absorbance spectra were acquired using a UV/Vis/nIR spectrophotometer (Jasco V-670, Tokyo, Japan). The concentration was calculated using the extinction coefficient Abs910=0.02554 L mg−1 cm−1. To remove free DNA, 100 kDa Amicon centrifuge filters (Millipore) were used. The DNA-nanotube complexes were re-suspended in saline-sodium citrate buffer (G Biosciences, St. Louis, Mo.).
Fluorescence emission spectra from aqueous nanotube solutions were acquired using a home-built apparatus consisting of a tunable white light laser source, inverted microscope, and InGaAs nIR detector. The SuperK EXTREME supercontinuum white light laser source (NKT Photonics) was used with a VARIA variable bandpass filter accessory capable of tuning the output 500-825 nm with a bandwidth of 20 nm. The light path was shaped and fed into the back of an inverted IX-71 microscope (Olympus) where it passed through a 20× nIR objective (Olympus) and illuminated a 50-100 μL nanotube sample in a 96-well plate (Corning). The emission from the nanotube sample was collected through the 20× objective and passed through a dichroic mirror (875 nm cutoff, Semrock). The light was f/# matched to the spectrometer using several lenses and injected into an Isoplane spectrograph (Princeton Instruments) with a slit width of 410 μm which dispersed the emission using a 86 g/mm grating with 950 nm blaze wavelength. The spectral range was 930-1369 nm with a resolution of ˜0.7 nm. The light was collected by a PIoNIR InGaAs 640×512 pixel array (Princeton Instruments). A HL-3-CAL-EXT halogen calibration light source (Ocean Optics) was used to correct for wavelength-dependent features in the emission intensity arising from the spectrometer, detector, and other optics. A Hg/Ne pencil style calibration lamp (Newport) was used to calibrate the spectrometer wavelength. Background subtraction was conducted using a well in a 96-well plate filled with DI H2O. Following acquisition, the data was processed with custom code written in Matlab which applied the aforementioned spectral corrections, background subtraction, and was used to fit the data with Lorentzian functions.
The GT15mir19 sensor was incubated overnight at 20 mg/L with 10 μM of the miR-19-hairpin or 10 μM of the R23-hairpin in saline sodium citrate diluted 20× in 20 mM HEPES+5 mM MgCl2. The sample was plated on a freshly cleaved mica substrate (SPI) for 4 minutes before washing with 10 mL of dH2O and blowing dry with argon gas. An Asylum Research MFP-3D-Bio instrument was used with an Olympus AC240TS AFM probe in AC mode. Data was captured at 2.93 nm/pixel XY resolution and 15.63 pm Z resolution. For AFM under aqueous conditions, 20 mg/L of the GT15mir19 sensor was incubated with 10 μM of the miR-19-hairpin, R23-hairpin, or buffer overnight. All three conditions were spin-filtered 3× with 100 kDa Amicon centrifuge filters, and resuspended with 5 mM NiCl2, 20 mM HEPES pH 6.7 buffer. The samples were plated onto freshly cleaved mica for 2 minutes before gently washing with the same buffer. Samples were imaged in a droplet of the buffer using an Asylum Research Cypher ES+BlueDrive AFM with an Olympus AC55 probe and imaged using BlueDrive excitation at the ambient temperature of 31° C. within the AFM enclosure. All three samples were imaged with the same probe, consecutively, with the same scan settings, starting with the miR-19-hairpin sample, followed by the R23-hairpin control and the buffer control.
Hybridization experiments were conducted with 2 mg/L of the GT15mir19 sensor in saline-sodium citrate buffer at room temperature. Target DNA or RNA was introduced to reach a final concentration of 1 μM. Samples were incubated for 4 hours, unless otherwise noted. Free energy of hybridization was predicted using OligoAnalyzer 3.1 (IDT). Kinetics experiments were measured every 10 minutes using custom LabView code. Hybridization experiments with sodium dodecylbenzenesulfonate (SDBS) were conducted using a final concentration 0.2% wt/v. SDBS was added to the GT15mir19 sensor and allowed to equilibrate overnight at room temperature before target oligonucleotides were added. Toehold-mediated strand displacement experiments were performed with 1 μM of target miR-19 DNA, and 10 of the removing strand, composed of an ssDNA oligonucleotide with the complementary sequence to miR-19. Hybridization experiments in urine were conducted in samples from 5 healthy volunteers and stored on ice until the experiment. Concentrated GT15mir19 was added to each sample to final concentration of 0.2 mg/L and SDBS to final concentration of 0.2%. Concentrated DNA and RNA target were added to the indicated concentrations and incubated at room temperature overnight. Serum experiments used fetal bovine serum (Life Sciences) with GT15mir19 added to final concentration 0.2 mg/L and SDBS at 0.2%. Where indicated, proteinase K (New England Biolabs) was added to a final concentration of 0.5 mg/mL. Spectra were acquired after overnight incubation at room temperature.
Single-nanotube measurements were performed by incubating SDS-treated GT15mir19 sensor (0.2% SDS in SSC buffer) on a poly-D-lysine coated glass bottom plate (Mattek, Ashland, Mass.) for 10 minutes before gently washing with 0.2% SDS in SSC buffer. A final volume of 1 mL SDS-buffer was left in the plate during hyperspectral imaging measurements of the surface-bound nanotubes. A small volume (1 uL) of 1 mM solutions of miR-19 RNA or R23 RNA were then mixed with the buffer. Hyperspectral imaging measurements were repeated after 15 minutes and 50 minutes. Single nanotube emission spectra were collected via a custom near-infrared hyperspectral microscope. Data was processed with ImageJ software. Peaks were fit to Voigt functions using custom Matlab code to obtain center wavelength values.
Molecular dynamics (MD) simulations were conducted using the (9,4) nanotube chirality in explicit water. The DNA molecule for GT15mir19 (without complementary strand) was generated as an unstructured single stranded DNA and placed near the (9,4) nanotube, followed by a sufficiently long equilibration MD simulation enhanced with a replica-exchange based method to let the entire strand adsorb on (9,4) nanotube surface. Analysis of an additional 250 ns long MD simulation is presented herein. The DNA molecule for GT15mir19 hybridized with the complementary strand was created in a partially double stranded form. miR-19 was generated in the double stranded form using NAB program of AmberTools and was appropriately bonded via phosphodiester bond to the ss(GT)15 segment (SEQ ID NO: 1) of the GT15mir19 DNA. The ss(GT)15 (SEQ ID NO: 1) nanotube binding portion of the first strand was adsorbed to the nanotube. The entire DNA and nanotube construct was solvated in a 10.65×10.65×14.7179 nm water-box containing approximately 55,000 water molecules and 74 sodium counter-ions, placed randomly, to balance the negative charges from phosphates on the DNA. The total system was approximately 170,000 atoms. The nanotube extended to the edges of the water box and was kept frozen in place during the entire equilibration and simulation time. The nanotube atoms were modeled as sp2 hybridized carbon. All structures were visualized in VMD60.
The Gromacs 4.6.7 simulation package was used with the Charmm36/TIP3P nucleic acid/water model. Long-range electrostatics were calculated using the particle mesh Ewald method with a 0.9 nm real space cutoff. For van der Waals interactions, a cutoff value of 1.2 nm was used. The energy minimized simulation box was then subjected to 100 ps equilibration in an NVT (T=300 K) ensemble where the number of water molecules were fine-tuned to make average pressure approximately equivalent to atmospheric pressure. Further equilibration runs were performed for 100-200 ns in NVT (T=300 K) ensemble. Systems were propagated with stochastic Langevin dynamics with a time step of 2 fs. The trajectories were saved every 10 ps, yielding a total of 25,000 snapshots for production analysis. Homemade python scripts calling MDAnalysis module were used for all other analysis presented.
The GT15mir19 sequence was used to suspend nanotubes as described earlier. After each of 4 centrifugation filter steps using the Amicon centrifuge filter (100 kDa MWCO), the concentration of the filtered DNA was measured using Abs260 on a NanoDrop spectrophotometer (ThermoScientific, Waltham, Mass.). The pellet from centrifugation was also filtered to measure free DNA. The final mass of DNA from the combined values was calculated from the concentration and subtracted from the initial value. From three suspensions, it was found that 3.5 (+/−1.8) mg of DNA suspended 1 mg of nanotube.
All animal experiments were approved by the Institutional Animal Care and Use Committee at Memorial Sloan Kettering Cancer Center. KrosFlo Implant Membranes (500 kD MWCO) were obtained from Spectrum Labs (Rancho Dominguez, Calif.). The membrane was cut to about 1 cm in length and filled with approximately 15 μL of 2 mg/L GT15mir19-nanotubes. Each end was heat sealed. A total of 36 NU/J (nude) mice (Jackson Labs) were anesthetized with 2% isoflurane and implanted with the membrane. Nine mice were divided into three cohorts of three mice to receive miR-19 DNA, R23 DNA, or buffer vehicle via an intraperitoneal injection of 1 nanomole in 1 mL sodium saline citrate buffer. An identical experiment was performed with miR-19 RNA, R23 RNA, or buffer vehicle at 1 nanomole, 500 picomole, 100 picomole, or 50 picomole in 1 mL sodium saline citrate buffer. The mice were removed from anesthesia and allowed to regain consciousness. After 90 or 120 minutes, mice were anesthetized and measured using a custom-built reflectance probe-based spectroscopy system. The system consisted of a continuous wave 1 watt 730 nm diode laser (Frankfurt). The laser light was injected into a bifurcated fiber optic reflection probe bundle. The sample leg of the bundle included one 200 μm, 0.22 NA fiber optic cable for sample excitation located in the center of six 200 μm, 0.22 NA fiber optic cables for collection of the emitted light. Emission below 1050 nm was filtered using longpass filters, and the light was focused into the slit of a Czerny-Turner spectrograph with 303 mm focal length (Shamrock 303i, Andor). The slit width of the spectrograph was set at 410 μm. The light was dispersed using a 85 g/mm grating with 1350 nm blaze wavelength and collected with an iDus InGaAs camera (Andor). Spectra were fit to Voigt functions using custom Matlab code.
Table 12 shows a list of mammalian miRNAs that can be used with the sensor described herein.
This application claims the benefit of U.S. Application Ser. No. 62/320,126 filed on Apr. 8, 2016, the disclosure of which is hereby incorporated by reference in its entirety. Applicant also notes it is concurrently filing a potentially related patent application entitled, “SWCNT-DNA-ANTIBODY CONJUGATES, RELATED COMPOSITIONS, AND SYSTEMS, METHODS AND DEVICES FOR THEIR USE”, which claims the benefit of U.S. Application Ser. No. 62/334,412 filed on May 10, 2016.
This invention was made with government support under grant numbers HD075698 and CA008748 awarded by National Institutes of Health. The government has certain rights in this invention.
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/US17/26592 | 4/7/2017 | WO | 00 |
Number | Date | Country | |
---|---|---|---|
62320126 | Apr 2016 | US |