Patent Application
20050119471
Rotavirus is a segmented, double-stranded RNA virus that is the major cause of severe gastroenteritis in infants and young children. Profound fluid and electrolyte loss often leads to hospitalization for life-saving rehydration therapy. Where access to medical care is limited or unavailable, volume depletion, shock and death can occur. Annually, nearly one million childhood deaths in developing countries have been ascribed to inadequately treated rotavirus gastroenteritis. In the industrialized world, more than 30% of the children admitted to hospitals with acute gastroenteritis have rotavirus infections.
The invention is drawn to isolated nucleic acid molecules comprising a gene segment from a rhesus rotavirus (RRV) or from one of three rhesus: human reassortant viruses. In one embodiment, the isolated nucleic acid molecule has a sequence selected from the group consisting of: SEQ ID NO:1-14, inclusive. In another embodiment, the isolated nucleic acid molecule encodes a protein having a sequence selected from the group consisting of: SEQ ID NO:15-28, inclusive. In yet another embodiment, the isolated nucleic acid molecule is a variant of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 10, 11, 12, or 14, such as one of the following: a nucleic acid molecule having the sequence of SEQ ID NO: 1 (gene 1) and having a nucleotide change to a G at nucleotide 2120; a nucleic acid molecule having the sequence of SEQ ID NO: 2 (gene 2) and having one or more of the following nucleotide changes: a C at nucleotide 493, and a T at nucleotide 947; a nucleic acid molecule having the sequence of SEQ ID NO:3 (gene 3) and having one or more of the following nucleotide changes: an A at nucleotide 169, a C at nucleotide 283, a C at nucleotide 448, a C at nucleotide 874, a C at nucleotide 1306, and a C at nucleotide 2388; a nucleic acid molecule having the sequence of SEQ ID NO:4 (gene 4) and having one or more of the following nucleotide changes: a C at nucleotide 119, a G at nucleotide 417, a G at nucleotide 809, a C at nucleotide 977, an A at nucleotide 1463, a C at nucleotide 1481, a C at nucleotide 1608, a C at nucleotide 1755, and an A at nucleotide 1953; a nucleic acid molecule having the sequence of SEQ ID NO:5 (gene 5) and having one or more of the following nucleotide changes: an A at nucleotide 75, a T at nucleotide 84, a C at nucleotide 347, a T at nucleotide 667, a C at nucleotide 1186, a G at nucleotide 1219, and an A at nucleotide 1204; a nucleic acid molecule having the sequence of SEQ ID NO: 6 (gene 6) and having one or more of the following nucleotide changes: a C at nucleotide 376, an A at nucleotide 756, an A at nucleotide 1008, and a G at nucleotide 1041; a nucleic acid molecule having the sequence of SEQ ID NO: 7 (gene 7) and having a nucleotide change to a G at nucleotide 387; a nucleic acid molecule having the sequence of SEQ D NO: 10 (gene 10) and having one or more of the following nucleotide changes: an A at nucleotide 92, an A at nucleotide 174, and a G at nucleotide 218; a nucleic acid molecule having the sequence of SEQ ID NO: 11 (gene 11) and having a nucleotide change to A at nucleotide 180; a nucleic acid molecule having the sequence of SEQ ID NO: 12 (DxRRV (serotype 1)) and having a nucleotide change to an A at nucleotide 556; and a nucleic acid molecule having the sequence of SEQ ID NO: 14 (ST3xRRV (serotype 4)) and having a nucleotide change to a G at nucleotide 263. Each gene variant can have one, more than one, or all of the nucleotide changes enumerated for that particular gene. Other variants of any one of nucleic acid molecules having SEQ D NO:1-14, or encoding a polypeptide of SEQ ID NO:15-28, are also included.
Human rotavirus serotypes G1-G4 are the major causes of diarrheal gastroenteritis in humans (Gentsch, et al., 1995). The serotypes are determined by epitopic differences in the outer capsid of the virus particle encoded by the VP7 gene. The ROTAMUNE™ (ROTASHIELD™) vaccine is a live virus vaccine comprised of four different rotaviruses, each containing the outer capsid protein, VP7, of one of the major serotypes G1-G4 known to cause disease in humans. The foundation of this vaccine is a virus isolated from a rhesus macaque, rhesus rotavirus (RRV). The virus is sufficiently similar to human strains to permit limited replication in human intestinal tracts and thereby elicit protective immune responses to human rotaviruses. The ROTAMUNE™ vaccine includes RRV (serotype G3, for which VP7 is 96% homologous to VP7 from human serotype 3 viruses); and three rhesus:human reassortant viruses (serotypes G1, G2 and G4). The reassortants are comprised of the rhesus virus genetic background (10 gene segments), but replace the gene segment encoding VP7 with the corresponding gene segments from the human serotype 1 (D strain), 2 (DS1 strain) or 4 (ST3 strain) viruses. Applicants have, for the first time, identified the nucleic acid sequence of all 11 gene segments of each of the four virus strains, including the 10 common gene segments and the four independent gene segments (VP7 gene), for a total of 14 gene segments.
Nucleic Acids of the Invention
Accordingly, the invention pertains to an isolated nucleic acid molecule comprising a gene segment from the rhesus rotavirus (RRV) or from one of the three rhesus: human reassortant viruses. The term, “gene segment,” as used herein, refers to a nucleotide sequence, preferably which encodes a polypeptide or protein, and preferably which contains regulatory, non-coding nucleotide sequence(s) present at the 3′ and/or 5′ end of each gene segment. In a preferred embodiment, the gene segment is selected from the group consisting of the nucleotide sequences shown in SEQ ID NO:1-14, inclusive, as described in Table 1, below.
Due to differences in electrophoretic mobility, numerical gene assignments differ among RRV and the reassortant viruses. These differences involve only genes 7, 8 and 9. For the purpose of comparison and discussion, segment 7 is designated as the segment coding for NSP3, segment 8 as the segment coding for NSP2 and segment 9 as the segment coding for outer capsid viral protein 7 (VP7).
The isolated nucleic acid molecules of the present invention can be RNA, for example, mRNA, or DNA, such as cDNA. The RNA or DNA molecules can be double-stranded or single-stranded; single stranded RNA or DNA can be either the coding, or sense, strand or the non-coding, or antisense, strand. The nucleic acid molecule can include all or a portion of the coding sequence of the gene segment and can further comprise additional non-coding sequences such as non-coding 3′ and 5′ sequences (including regulatory sequences, for example). Additionally, the nucleic acid molecule can be fused to a marker sequence, for example, a sequence that encodes a polypeptide to assist in isolation or purification of the protein. Such sequences include, but are not limited to, those which encode a glutathione-S-transferase (GST) fusion protein and those which encode a hemagglutinin A (HA) polypeptide marker from influenza.
An “isolated” nucleic acid molecule, as used herein, is one that is separated from nucleic acids which normally flank the gene or nucleotide sequence and/or has been completely or partially purified from other transcribed sequences (e.g., as in an RNA library). For example, an isolated nucleic acid of the invention may be substantially isolated with respect to the complex cellular milieu (e.g., the virus) in which it naturally occurs, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. In some instances, the isolated material will form part of a composition (for example, a crude extract containing other substances), buffer system or reagent mix. In other circumstances, the material may be purified to essential homogeneity, for example as determined by PAGE or column chromatography such as BPLC. Preferably, an isolated nucleic acid molecule comprises at least about 50, 80 or 90% (on a molar basis) of all macromolecular species present.
The nucleic acid molecule can be fused to other coding or regulatory sequences and still be considered isolated. Thus, recombinant nucleic acid contained in a vector is included in the definition of “isolated” as used herein. Also, isolated nucleic acid molecules include recombinant nucleic acid molecules in heterologous host cells, as well as partially or substantially purified nucleic acid molecules in solution. “Isolated” nucleic acid molecules also encompass in vivo and in vitro RNA transcripts (e.g., of cDNA) of the present invention. An isolated nucleic acid molecule or nucleotide sequence can include a nucleic acid molecule or nucleotide sequence which is synthesized chemically or by recombinant means. Therefore, recombinant nucleic acids contained in a vector are included in the definition of “isolated” as used herein. Also, isolated nucleotide sequences include recombinant nucleic acid molecules in heterologous organisms, as well as partially or substantially purified nucleic acid molecules in solution. In viva and in vitro RNA transcripts of the DNA molecules (e.g., cDNA) of the present invention are also encompassed by “isolated” nucleotide sequences. Such isolated nucleotide sequences are useful in the manufacture of the encoded protein, to raise anti-protein antibodies using DNA immunization techniques, and as an antigen to raise anti-DNA antibodies or elicit immune responses, or for detecting expression of the gene in tissue (e.g., human tissue), such as by Northern blot analysis, indicating the presence of infection.
The present invention also pertains to nucleic acid molecules which are not necessarily found in nature but which encode a protein described herein. Thus, for example, nucleic acid molecules which comprise a sequence that is different from the naturally-occurring nucleotide sequence but which, due to the degeneracy of the genetic code, encode a protein that is the same as a protein encoded by a gene segment of the present invention, are also the subject of this invention (e.g., a nucleic acid molecule that encodes a protein having as a sequence any one of SEQ ID NO:15-28, as described in Table 2, below).
The invention also encompasses variants of certain nucleotide sequences of the invention. For example, in one embodiment, the variant nucleotide sequences of the invention comprise the nucleotide differences set forth in Table 4 or Table 8, below.
That is, representative variant embodiments include: a nucleic acid molecule having the sequence of SEQ ID NO: 1 (gene 1) and having a nucleotide change to a G at nucleotide 2120; a nucleic acid molecule having the sequence of SEQ ID NO: 2 (gene 2) and having one or more of the following nucleotide changes: a C at nucleotide 493, and a T at nucleotide 947; a nucleic acid molecule having the sequence of SEQ ID NO:3 (gene 3) and having one or more of the following nucleotide changes: an A at nucleotide 169, a C at nucleotide 283, a C at nucleotide 448, a C at nucleotide 874, a C at nucleotide 1306, and a C at nucleotide 2388; a nucleic acid molecule having the sequence of SEQ ID NO:4 (gene 4) and having one or more of the following nucleotide changes: a C at nucleotide 119, a G at nucleotide 417, a G at nucleotide 809, a C at nucleotide 977, an A at nucleotide 1463, a C at nucleotide 1481, a C at nucleotide 1608, a C at nucleotide 1755, and an A at nucleotide 1953; a nucleic acid molecule having the sequence of SEQ ID NO:5 (gene 5) and having one or more of the following nucleotide changes: an A at nucleotide 75, a T at nucleotide 84, a C at nucleotide 347, a T at nucleotide 667, a C at nucleotide 1186, a G at nucleotide 1219, and an A at nucleotide 1204; a nucleic acid molecule having the sequence of SEQ ID NO: 6 (gene 6) and having one or more of the following nucleotide changes: a C at nucleotide 376, an A at nucleotide 756, an A at nucleotide 1008, and a G at nucleotide 1041; a nucleic acid molecule having the sequence of SEQ ID NO: 7 (gene 7) and having a nucleotide change to a G at nucleotide 387; a nucleic acid molecule having the sequence of SEQ ID NO:10 (gene 10) and having one or more of the following nucleotide changes: an A at nucleotide 92, an A at nucleotide 174, and a G at nucleotide 218; a nucleic acid molecule having the sequence of SEQ ID NO: 11 (gene 11) and having a nucleotide change to A at nucleotide 180; a nucleic acid molecule having the sequence of SEQ ID NO: 12 (DxRRV (serotype 1)) and having a nucleotide change to an A at nucleotide 556; and a nucleic acid molecule having the sequence of SEQ ID NO: 14 (ST3xRRV (serotype 4)) and having a nucleotide change to a G at nucleotide 263. Each gene variant can have one of the nucleotide changes, or can have more than one, or all, of the nucleotide changes enumerated for that particular gene.
Such variants can be naturally-occurring, such as in the case of allelic variation or base substitution in a clinical isolate, or non-naturally-occurring, such as those induced by various mutagens and mutagenic processes. Other intended variations can also be included in any one of the isolated nucleic acids of the invention (e.g., in any one of SEQ ID NO: 1-14 or in a nucleic acid molecule encoding a polypeptide of any one of SEQ ID NO: 15-28); such intended variations include, but are not limited to, addition, deletion and substitution of one or more nucleotides which can result in conservative or non-conservative amino acid changes, including additions and deletions. Preferably the nucleotide (and/or resultant amino acid) changes are silent or conserved; that is, they do not alter the characteristics or activity of protein encoded by the gene segment of the invention.
Other alterations of the nucleic acid molecules of the invention can include, for example, labeling, methylation, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates), charged linkages (e.g., phosphorothioates, phosphorodithioates), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids). Also included are synthetic molecules that mimic nucleic acid molecules in the ability to bind to designated sequences via hydrogen bonding and other chemical interactions. Such molecules include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.
In a related aspect, the nucleic acid molecules of the invention are used as probes or primers in assays. “Probes” are oligonucleotides that hybridize in a base-specific manner to a complementary strand of nucleic acid molecules. Such probes include polypeptide nucleic acids, as described in Nielsen et al., Science, 254, 1497-1500 (1991). Typically, a probe comprises a region of nucleotide sequence that hybridizes under highly stringent conditions to at least about 15, typically about 20-25, and more typically about 40, 50 or 75, consecutive nucleotides of a nucleic acid molecule comprising a nucleotide sequence selected from SEQ ID NO: 1-14, and the complement of SEQ ID NO: 1-14. More typically, the probe further comprises a label, e.g., radioisotope, fluorescent compound, enzyme, or enzyme co-factor.
As used herein, the term “primer” refers to a single-stranded oligonucleotide which acts as a point of initiation of template-directed DNA synthesis using well-known methods (e.g., PCR, LCR) including, but not limited to those described herein. The appropriate length of the primer depends on the particular use, but typically ranges from about 15 to 30 nucleotides.
The nucleic acid molecules of the invention such as those described above can be identified and isolated using standard molecular biology techniques and the sequence information provided in SEQ ID NO: 1-14. For example, nucleic acid molecules can be amplified and isolated by the polymerase chain reaction using synthetic oligonucleotide primers designed based on one or more of the sequences provided in SEQ ID NO: 1-14 and/or the complement of SEQ ID NO: 1-14. See generally PCR Technology: Principles and Applicationsfor DNA Amplification (ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (Eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res., 19:4967 (1991); Eckert et al., PCR Methods and Applications, 1:17 (1991); PCR (eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. No. 4,683,202. The nucleic acid molecules can be amplified using cDNA, RNA, or mRNA as a template, cloned into an appropriate vector and characterized by DNA sequence analysis.
Other suitable amplification methods include the ligase chain reaction (LCR) (see Wu and Wallace, Genomics, 4:560 (1989), Landegren et al., Science, 241:1077 (1988), transcription amplification Kwoh et al., Proc. Natl. Acad. Sci. USA, 86:1173 (1989)), and self-sustained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87:1874 (1990)) and nucleic acid based sequence amplification (NASBA). The latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce both single stranded RNA (ssRNA) and double stranded DNA (dsDNA) as the amplification products in a ratio of about 30 or 100 to 1, respectively.
Antisense nucleic acid molecules of the invention can be designed using the nucleotide sequences of SEQ ID NO: 1-14 and/or the complement of SEQ ID NO: 1-14, or a portion of the nucleotide sequence of SEQ ID NO: 1-14 and/or the complements thereof, and constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid molecule (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Alternatively, the antisense nucleic acid molecule can be produced biologically using an expression vector into which a nucleic acid molecule has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid molecule will be of an antisense orientation to a target nucleic acid of interest).
Another aspect of the invention pertains to nucleic acid constructs containing a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1-14 and the complement of SEQ ID NO: 1-14 (or a portion thereof). The constructs comprise a vector (e.g., an expression vector) into which a sequence of the invention has been inserted in a sense or antisense orientation. As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a “plasmid”, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses, negative strand RNA virus vectors, VEE vectors) that serve equivalent functions.
Preferred recombinant expression vectors of the invention comprise a nucleic acid molecule of the invention in a form suitable for expression of the nucleic acid molecule in a host cell. This means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term “regulatory sequence” is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed and the level of expression of protein desired. The expression vectors of the invention can be introduced into host cells to thereby produce proteins, including fusion proteins, encoded by nucleic acid molecules as described herein.
The recombinant expression vectors of the invention can be designed for expression of a protein described herein, in prokaryotic or eukaryotic cells, e.g., bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, supra. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms “host cell” and “recombinant host cell” are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell but are still included within the scope of the term as used herein.
A host cell can be any prokaryotic or eukaryotic cell. For example, a nucleic acid molecule of the invention can be expressed in bacterial cells (e.g. E. coli), insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.
Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” are intended to refer to a variety of art-recognized techniques for introducing a foreign nucleic acid molecule (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAB-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (supra), and other laboratory manuals.
For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid molecules encoding a selectable marker can be introduced into a host cell on the same vector as the nucleic acid molecule of the invention or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid molecule can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) a protein described herein. Accordingly, the invention further provides methods for producing a protein using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of the invention (into which a recombinant expression vector encoding a protein described herein has been introduced) in a suitable medium such that the protein is produced. In another embodiment, the method further comprises isolating the protein from the medium or the host cell.
The invention will be further described by the following non-limiting examples. The teachings of all publications cited herein are incorporated herein by reference in their entirety.
Materials and Methods
Viral Stocks
A rotavirus seed bank system was developed for the ROTAMUNE™ vaccine consisting of a Master Virus Seed (MVS) Bank, a Primary Virus Seed (PVS) Bank and a Manufacturer's Working Virus Seed (MWVS) Bank. The nucleotide sequence of all 11 gene segments of each of the four strains comprising the commercial virus seed (MWVS-5, 6, 7 and 8) were identified and the sequence identity (genetic equivalence) between the commercial virus seeds and the clinical virus seeds (MWVS-1, 2, 3, and 4) were demonstrated.
A subset of Manufacturer's Working Virus Seed (MWVS), representing clinical lots (MWVS 1-4) and commercial lots (MWVS 5-8), was used. The strains used in this study are:
RNA Isolation
Genomic RNAs from the aliquots of each MWVS were extracted using Trizol-LS™ reagent (Life Technologies, Grand Island, N.Y.). RNA was resuspended in RNase-free water and used for all genomic amplifications.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Amplification
RT-PCR amplifications spanning individual fall length RNA gene segments of the rotavirus genome were performed by using the GeneAmp XL RNA PCR Kit (Perkin-Elmer) and primer pairs specific to each individual rotavirus gene segment. Common RRV primers were used for all segments of the three reassortants, except for gene 9 where primers specific to gene 9 of the rhesus or of the different human rotavirus sequences (RRV, HRV-D, HRV-DS1 and GRV-ST3) were used. Primers are shown in Table 3A.
Primers named . . . 01 are (+) sense and primers named . . . 02 are (−) sense.
*Primers 301A, 302A, 501A, and 502A reflect the actual termini sequence as determined.
**Primer 901 was used to amplify all four serotypes, while primer 902 was designed specifically for each.
RT-PCR amplification steps were as follows:
RNA (100-500 ng per reaction) was mixed with water and 5× SL RT buffer in a Gene-amp tube. The mixture was denatured at 96° C. for 5-6 minutes in a pre-heated thermal cycler, and then placed on ice immediately for 3 minutes to quick cool. Samples were pulse-spun in microfuge to remove any condensation on caps, and the remaining ingredients were added. A drop of mineral oil was added to each tube, and samples were placed in pre-heated thermal cycler at 40° C. The RT thermal cycle was 40° C. for 60 minutes, followed by 45° C. for 60 minutes and then 4° C., soak. If several different fragments from the same RNA template were amplified, the entire reaction was scaled up in one tube, eliminating only the primer from the mix. One μl of the RT (+sense) primer was added to each reaction tube, and then 19 μl of the scaled-up RT mix were added.
The reagents were mixed for each sample; 80 μl PCR mix were added to the 20 μl RT reaction under the oil, and mixed by pipetting up and down several times. The samples were placed in pre-heated thermal cycler (hot-start) at 94° C. and cycled as follows: 94° C. denaturation for 3 minutes, followed by 40 cycles of denaturation at 94° C. for 1 minute, primer annealing at 40° C. for 30 seconds, and extension at 70° C. for five minutes. A final extension step was run at 70° C. for 10 minutes, followed by a soak cycle at 4° C.
Ten μl of reaction were run on agarose gel. Products were purified using Promega's Wizard PCR preps DNA purification system (Madison Wis.) either directly or using gel purification from low-melting agarose.
RNA Ligation RT-PCR to Determine Consensus Nucleotide Sequence of the Gene Termini
The nucleotide sequence of the absolute 3′ and 5′ termini of the eleven RNA gene segments of the rotavirus vaccine stains was determined using an RNA ligation reverse transcription-PCR protocol modified from Sidhu et al. (Virology 193:66-72, 1993) for use on double-stranded RNA. Genomic RNA was extracted using Trizol-LS™ reagent (Life Technologies) and 2-3 μg was treated with Tobacco Acid Pyrophosphatase (TAP) at 37° C. for 1 hour in a 40 μl volume according to the manufacturer's directions (Epicentre Technologies). This step was used to remove the CAP structure on the 5′ end of the plus strand of the genomic RNA segments, and leave behind a 5′ monophosphate that was used for RNA ligation. The TAP-treated RNA was extracted with phenyl/chloroform/isoamyl alcohol (25:24:1) and ethanol-precipitated. The RNA pellet was air-dried and resuspended in 13.7 μl of RNase-free water. The double-stranded RNA was then denatured at 96° C. for 4 minutes and quick-chilled on ice for 2 minutes. The reagents required for RNA ligation in at 20 μl volume were then added. The final ligation reaction conditions were 1× RNA ligase buffer (New England Biolabs), 10% DMSO (Sigma D-2650), 20 U Promega RNasin, and 36 U NEB T4 RNA ligase. Ligation was performed at 16° C. overnight (approximately 16 hours). The ligated RNA was phenyl extracted and ethanol precipitated as described above, and the RNA pellet was resuspended in 15 μl of water. One μl of ligated RNA was seeded into each of 11 RT-PCR reactions containing rotavirus gene-specific primers (shown in Table 3B) designed to amplify across the ligated RNA junction.
Odd numbered primers are negative sense; Even numbered primers are positive sense.
Primers ending with 03, 04 or 07, 08 (genes 7 and 10) are used for reverse transcription and first round PCR.
Primers ending with 01, 02 or 05, 06 (genes 7 and 10) are used for second round (nested) PCR and sequencing.
Primers ending with 01 and 103T, 1103T, 705T contain 9 nucleotides at the 5′ end that include a HindIII site.
Primers ending with 02 and 104T, 1104T, 706T contain 9 nucleotides at the 5′ end that include a BamHI site.
The RT step and the first round of PCR was done using the Perkin-Elmer GeneAmp Thermostable rTth Reverse Transcriptase RNA PCR Kit (catalog #N8O8-0069) as per the manufacturer's specifications with modification.
RT mix for one reaction (multiply μl volumes by number of reactions needed)
*prepared by mixing equal volumes of each 10 mM dNTP stock (dATP, dGTP, dCTP, dTTP).
Fifteen μl of RT mix were combined with 2 μl of upstream and 2 μl of downstream first round PCR primers (each are 20 pmoles/μl) and 1 μl of ligated RNA in a 0.5 ml thin-walled GeneAmp tube and overlaid with 2 drops of Sigma mineral oil. Since both plus and minus RNA strands of the genome have been ligated, each of the first round PCR primers could be used for cDNA synthesis during reverse transcription. For each different primer pair used, a negative control was set up that contained 1 μl of water in place of the ligated RNA. The 0.5 ml reaction tubes were loaded in the PE thermal cycler 480 at 4° C. and the cycler was quickly ramped to 80° C. and then ramped back to 45° C. RT was performed at 45° C. for 30 minutes, followed by 50° C. for 30 minutes. Following RT, 80 μl of first-round PCR mix was added to each RT reaction over the oil and the tubes were pulse spun in a microcentrifuge.
First Round PCR Mix for one reaction (multiply μl volumes by the number of reactions needed):
Thermal cycling profile was as follows: 94° C. for 2 minutes; 40 cycles of 94° C. for 1 minute, 45° C. for 1 minute, 72° C. for 1 minute; 72° C., for 10 minutes; and 4° C., soak. Following each first round PCR, a second round (nested) PCR amplification was performed using Perkin-Elmer reagents and AmpliTaq Gold™ DNA polymerase (catalog #N808-0241).
Second Round (nested) PCR mix for one reaction (multiply μl volumes by the number of reactions needed)
The second round PCR mix (92 μl) was combined with 2 μl of upstream and 2 μl of downstream second round PCR primers (each are 20 pmoles/μl) and 4 μl of the first round PCR reaction (including negative controls). The reactions were overlaid with 2 drops of Sigma mineral oil and pulse spun. The thermal cycling profile was the same as for the first round PCR except the initial step at 94° C. for 2 minutes was extended to 12 minutes to activate the AmpliTaq Gold™ DNAP.
Second round PCR products (10 μl) were analyzed by agarose gel electrophoresis with ethidium bromide. The ligation PCR products were gel-purified using the Promega Wizard™ PCR preps DNA purification system. A consensus sequence for the PCR amplified products was determined. If necessary to resolve nucleotide sequence ambiguities, the PCR products were cloned using pGEM-T Easy Vector System I (Promega, Madison, Wis.) and multiple clones were sequenced.
DNA Sequencing
A consensus sequence for the PCR amplified products was generated by using, the Applied Biosystems-PRISM fluorescent dye terminator cycle sequencing kit with AmpliTaq DNA Polymerase-FS, and the Applied Biosystems 377 DNA sequencer (ABI-Perkin-Elmer). Over 100 primers spaced approximately 200 nucleotides apart on each strand were used for sequencing both strands of the PCR products. When needed, gel purified PCR products were cloned by using pGEM-T Easy Vector System I (Promega, Madison, W.Va.). Positive clones were selected by T7/SP6 primer-specific PCR screening and the amplified PCR products of the positive clones were directly sequenced as described above. Sequences were analyzed by using MacVector gene analysis program (Oxford Molecular, Oxford, UK).
Results
Eleven full length gene segments were amplified for each virus strain using high fidelity RNA-PCR amplification reactions as described above. Both strands of the amplified products were sequenced directly by using RRV-specific primers, except for gene segment 9, for which strain specific primers were used. The sequences for each of the eleven RRV (MWVS-7) genes are SEQ ID NO:1-11, respectively as shown in Table 1 above. Gene segment 9 sequences for the three reassortants are SEQ ID NO:12 (DxRRV (MWVS-5)), SEQ ID NO:13 (DS1xRRV (MWVS-6)), and SEQ ID NO:14 (ST3 x RRV (MWVS-8)). The putative protein sequences for each of these are SEQ ID NO:15-28, respectively, as shown in Table 2 above.
Table 4 lists nucleotide differences identified between the parent RRV (MWVS-7) strain and the three reassortant viruses DxRRV (MWVS-5), DS1 x RRV MWVS-6), and ST3 x RRV (MWVS-8). These nucleotide differences were common to both clinical (MWVS 14) and commercial (MWVS 5-8) seeds.
— Identical to RRV.
†Position 174 is an ‘A’ in RRV (MWVS-1 and MWVS-7).
Materials and Methods
Viral Stocky
Viral stocks were from the Wyeth Laboratories, Inc., in Marietta, Pa., USA, rotavirus seed bank system. The strains used in this study are:
Working virus seeds for commercial vaccine production:
Working virus seeds for clinical vaccine production:
All clinical isolates were plaque purified three times, except for isolates 37 and 38 (purified twice).
RNA Isolation
Total RNA was extracted from clinical samples, aliquots of virus seed or aliquots of vaccine virus using Trizol-LS™ reagent (Life Technologies, Grand Island, N.Y.). RNA was resuspended in nuclease-free water and used for all RT/PCR amplifications.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Amplification
Clonal analysis was carried out to determine the following: 1) the micro-heterogeneity in MWVS-1, 2, 3 and 4 at the 7 nucleotide positions (position 2388 in gene 3, positions 1674 and 1953 in gene 4, positions 75, 667 and 1204 in gene 5, and position 556 in gene 9) which were found to differ from consensus sequence in more than one clinical isolate; 2) the micro-heterogeneity in the four seed strains (MWVS-1, 2, 3 and 4) at position 174 in gene 10, found to contain abase mixture in serotypes G1 and G4 by consensus sequencing; and 3) the micro-heterogeneity in genes 3 and 10 at nucleotide positions 2388 and 174, respectively, in the commercial vaccine lots and their seeds (MWVS-5, 6, 7 and 8).
A portion of each gene spanning the nucleotide position(s) of interest was amplified by RT-PCR using the GeneAmp XL RNA PCR Kit (Perkin-Elmer) and primer pairs listed in Table 5.
Primers common to all four serotypes were used for RT-PCR amplification of fragments from all genes except gene 9 where primers specific to gene 9 of human rotavirus serotype G1 (HRV-D) were used. RT-PCR amplification was carried out as follows:
RNA (100-500 ng per reaction) was mixed with water and 5× SL RT buffer in a Gene-amp tube. The mixture was denatured at 96° C. for 4 minutes in a pre-heated thermal cycler, and then placed on ice immediately for 3 minutes to quick cool. Samples were pulse-spun in microfuge to remove any condensation on caps, and the remaining ingredients were added. A drop of mineral oil was added to each tube, and samples were placed in pre-heated thermal cycler at 40° C. The RT thermal cycle was 40° C. for 60 minutes, followed by 45° C. for 60 minutes and then 4° C., soak. If several different fragments from the same RNA template were amplified, the entire reaction was scaled up in one tube, eliminating only the primer from the mix. One μl of the RT (+sense) primer was added to each reaction tube, and then 19 μof the scaled-up RT mix were added.
The reagents were mixed for each sample; 80 μl PCR mix were added to the 20 μl RT reaction under the oil, and mixed by pipetting up and down several times. The samples were placed in pre-heated thermal cycler (hot-start) at 94° C. and cycled as follows: 94° C. denaturation for 3 minutes, followed by 40 cycles of denaturation at 94° C. for 1 minute, primer annealing at 40° C. for 30 seconds, and extension at 70° C. for two minutes. A final extension step was run at 70° C. for 10 minutes, followed by a soak cycle at 4° C.
Ten μl of reaction were run on 1% agarose gel. Products were purified using Promega's Wizard PCR preps DNA purification system (Madison Wis.) either directly or using gel purification from low-melting agarose.
Cloning of RT-PCR Products
The RT-PCR products from genes 3, 4, 5, 9 and 10 of MWVS-1, 2, 3 and 4 were cloned into the appropriate restriction endonuclease sites of either pGEM-3Zf(+)™, pGEM-5Zf(+)™, or pGEM T-Easy™ (T/A cloning) plasmid vectors using standard cloning methods.
Screening for Positive Clones
Approximately 40-100 colonies from each plasmid construct were screened for the presence of cloned RRV sequences by PCR using primers specific to the SP6 and T7 promoter sequences (SP6:5′TATTTAGGTGACACTATAG3′) (SEQ ID NO.:122) (T7:5′TAATACGACTCACTATAGGG3′) (SEQ ID NO.:123) flanking the cloning sites of each vector as follows: a single colony was transferred to 10 μl of water in a 0.5 ml Gene-Amps tube using a sterile inoculating needle, and overlaid with a drop of mineral oil. The tubes were placed in a pre-heated thermal cycler at 96° C. for 10 minutes to lyse bacterial cells, and cooled to 4° C. for 3-4 minutes. Then, 40 μl PCR mix was added to each tube underneath the oil and pipetted several times to mix the sample.
PCR Mix (50 Reactions):
The mixture was placed in a pre-heated thermal cycler (hot-start) at 94° C. and cycled as follows: initial 94° C. denaturation for 3 minutes, followed by 40 cycles of denaturation at 94° C. for 1 minute, primer annealing at 42° C. for 1 minute, and extension at 72° C. for 2 minutes, terminating with a soak file at 4° C. Each PCR product (10 μl) was run on a 1% agarose gel to confirm the presence of an insert of the appropriate size.
Sequence Determination of Positive Clones
PCR products from 25-30 positive clones were directly purified from the PCR reaction using the PCR Preps Kit (Promega) and eluted in 25 μl nuclease-free water. Three μl of the purified product were then sequenced using Taq Cycle Sequencing terminator mix, FS (ABI) and primers specific for the SP6 and 17 promoters which flank the MCS of each plasmid vector.
Sequence Confirmation of Clinical Virus Isolates
RNA was extracted from 400 μL of each clinical virus isolate as previously described. For each virus, a fragment containing the nucleotide position(s) of interest was amplified from 200-600 ng of RNA using the GeneAmp XL RNA PCR Kit (Perkin-Elmer) and primer pairs shown in Table 6. Consensus sequence of the resulting RT/PCR product, including the nucleotide of interest, was determined using Taq cycle sequencing and the ABI 377 DNA sequencer with primers denoted in Table 6.
Results
Analysis of Micro-Heterogeneity in Clinical Virus Seeds (MWVS-1, 2, 3 and 4)
Sequence analysis of genes 3, 4, 5, 9 and 10 of the 19 clinical viral isolates obtained from the stools of ROTAMUNE™ recipients had heterogeneity at 24 nucleotide positions when compared to consensus sequence of the clinical seeds (MWVS-1, 2, 3 and 4). One of these sites, nucleotide position 174 of gene 10, contains a base mixture in the serotype G1 and G4 viruses. In addition, 7 of the 24 nucleotide base substitutions identified in the clinical virus isolates (i.e., position 2388 in gene 3; positions 1674 and 1953 in gene 4; positions 75, 667 and 1204 in gene 5; and position 556 in gene 9) were observed in more than one virus sample. To establish the precise level of microheterogeneity present at nucleotide position 174 of gene 10, as well as to determine whether the seven nucleotide base substitutions found in more than one clinical virus isolate were the result of sequence micro-heterogeneity in the clinical virus seeds, clonal analysis was carried out on each of the four seeds at these eight nucleotide positions.
The clonal analysis revealed micro-heterogeneity at position 2388 in gene 3 of the G2 clinical seed (MWVS-2), and at position 174 in gene 10 of the G1, G21 and G4 virus seeds (MWVS-3, 2 and 4, respectively). Twenty-six percent of the viral genomes in the G2 clinical seed were found to contain minor species C at position 2388 of gene 3, while the remaining 74% of the genomes contained T at this position. As predicted by consensus sequence, heterogeneity (i.e., G>A) was observed for position 174 of gene 10 in the G1 (MVS-3) and G4 (MWVS-4) clinical seeds, where the minor species A was found in 12% and 7% of the genomes, respectively. In contrast, the genomes of the RRV parental strain contained solely A at this position. The analysis also revealed a minor population of 5% G at the same position in the G2 virus seed (MWVS-2) which was not detected by consensus sequencing.
The remainder of the nucleotide substitutions which occur in more than one of the clinical isolates (i.e., positions 1674 and 1953 of gene 4; positions 75, 667 and 1204 of gene 5; and position 556 of gene 9) apparently do not result from measurable sequence micro-heterogeneity within the virus seeds, since mixtures of bases were not found at these positions by clonal analysis. Table 7 summarizes the micro-heterogeneity found in the clinical virus seeds (MWVS-1, 2, 3 and 4) at the variable nucleotide positions. The micro-heterogeneity at these positions may exist at levels below the detection limits, or the substitutions observed in the clinical isolates may represent adaption within the human gastrointestinal tract.
Sequence Confirmation of Clinical Virus Isolates
The sequence of the clinical virus isolates at each of the 24 nucleotide positions where the sequence had been found to diverge from consensus was re-examined. Table 8 lists the 24 nucleotide positions of heterogeneity.
Analysis of the Genetic Stability of RRV at Positions 2388 and 174 in Genes 3 and 10, Respectively
Consensus sequencing of the commercial seeds (MWVS-5, 6, 7 and 8) revealed heterogeneity at positions 2388 and 174 in genes 3 and 10, respectively. To compare the precise levels of micro-heterogeneity in the clinical and commercial virus seeds at these positions, as well as to analyze the genetic stability of these nucleotide positions during vaccine manufacture, clonal analysis of these positions was carried out in the commercial virus seeds and several vaccine lots generated from them.
The data showed that a similar level of micro-heterogeneity existed in the commercial MWVS-5, 6, 7 and 8) and clinical (MWVS-1, 2, 3 and 4) vaccine seeds at positions 2388 and 174 in genes 3 and 10, respectively. By clonal analysis, 15% of the minor species (C) was observed at nucleotide position 2388 in the G2 commercial virus seed (MWVS-2), compared to 26% C in the G2 clinical virus seed (MWVS-2), as
Serotype 3=MWVS-1=RRV; Serotype 4=MWVS4=ST3xRRV
*Mixed base depicted in MWVS-3 and MWVS-4 by consensus sequencing (see Table 4).
2388
2388
1953
1953
1674
1674
75
75
1204
1204
667
667
556
ATA (GTA)
556
ATA (GTA)
ACA (GCA)
1Underlined nucleotide is different in the clinical isolate when compared to the Manufacture's Working Virus Seed (MWVS). Triplet in parentheses is the consensus sequence of MWVS.
2Amino acid (aa) in parentheses is present in the relevant MWVS.
3Initial clonal sequence analysis had indicated heterogeneity at the positions listed as “No change”. Consensus sequence analysis of these isolates revealed sequence identity with the corresponding MWVS.
Boldface type indicates that the nucleotide change was identified in more than one clinical isolate.
shown in Table 9. Analysis of the micro-heterogeneity present in the commercial seeds at nucleotide position 174 in gene 10 revealed 25% and 23% of the minor species (A) in the G1 and G4 viruses, respectively, as shown in Table 10; these were similar to the levels observed in the clinical virus seed bank (12% and 7% respectively). As observed in the clinical seeds, the RRV G3 commercial seed strain (MWVS-7) contained solely A at nucleotide position 174. The G2 strain of the commercial seed bank (MWVS-6), however, did not retain the same minor population observed in the G2 clinical strain (5% G), but instead, resembled the G3 RRV strain at this position, harboring 100% A at this site by clonal analysis.
Determination of the heterogeneity at nucleotides 2388 and 174 of genes 3 and 10, respectively, in several vaccine lots produced from the commercial manufacturer's working virus seed allowed the monitoring of the genetic stability of these positions after passage in vitro. Four vaccine lots of each serotype, generated from the commercial virus seeds (MWVS-5, 6, 7 and 8) were analyzed by clonal analysis. Four G2 vaccine lots (I973029, I983008, I983037 and I973030) were analyzed for heterogeneity at nucleotide position 2388 in gene 3, and in each case, the level of the minor variant (4%, 8%, 8% and 16% C) was found to be similar to the 15% observed in the G2 commercial seed (MWVS-6) (Table 9). For nucleotide 174 in gene 10, each of the four G1 and G4 vaccine lots contained the minor species (A) at a level similar to that seen in its corresponding commercial seed. The four G1 vaccine lots (I973020, I973017, I983026 and I983003) contained 22%, 6%, 33% and 4% A, respectively, at nucleotide position 174 compared to the 25% A observed in the G1 commercial (MWVS-5) seed. Likewise, the G4 vaccine lots (I973034, I973004, I973030 and I983030) retained 9%, 14%, 19% and 23% A, respectively, at this position, similar to the 23% A found in the G4 (MWVS-8) seed (Table 10). These data indicate that conditions used in the vaccine manufacturing process preserve the identity of the four RRV vaccine strains as reflected in their genomic nucleotide sequence.
Manufacturer's Working Virus Seeds = MWVS-5, 6, 7 and 8 for Serotypes 1, 2, 3 and 4, respectively.
*Vaccine Concentrates and Harvests:
Serotype 1 - Lot # I973020, I973017, I983026 and I983003, respectively.
Serotype 2 - Lot # I973030, I973029, I983008 and I983037, respectively.
Serotype 3 - Lot # I973026, I983021 and I983032, respectively.
Serotype 4 - Lot # I973034, I973004, I973040 and I983030, respectively.
Superscripts denote the number of clones sequenced for each virus lot.
A sensitive and direct method to monitor the levels of micro-heterogeneity at nucleotide 2388 of gene 3, Mutant Analysis by PCR and Restriction Enzyme Cleavage (MAPREC), was developed.
Materials
The following materials were used: Life Technologies (Gibco-BRL) SuperScript™ Preamplification for First Strand cDNA Synthesis kit; RNase-free water; RRV Serotype 2 total RNA; Gene 3 nucleotide 2388 100% T DNA control template (1/30 dilution of stock); Gene 3 nucleotide 2388 100% C DNA control template (1/30 dilution of stock); Perkin Elmer Thermal Cycler PE 480; primer RRV-G3-EcoRI (20 pmole/μl); primer RRV-302A-flourescein (20 pmole/μl); Perkin-Elmer Taq DNA polymerase; mineral oil (Sigma), molecular biology grade 5; Perkin-Elmer 0.5 ml Gene-Amp reaction tubes; Pharmacia G40 AutoSeq spin columns; restriction endonuclease Eco RI (10 U/μl) (Roche Molecular Biochemicals); glycerol; bromophenyl blue; xylene cyanol; Bio-Rad 40% acrylamide:bis-acrylamide (38:2) liquid; distilled water; 10× TBE (Gibco-BRL); TEMED; ammonium persulfate; two 20×20 cm vertical polyacrylamide gel electrophoresis apparatus with 0.75 mm, 20-well combs and 0.75 mm spacers; flat head gel loading pipet tips; Molecular Dynamics Flourimager 595.
Reverse Transcription
For each sample, 500-1000 ng RNA and water were added to a 0.5 ml microfuge tube for a final volume of 11 μl. It was preferable to use 1000 ng RNA per reaction if the RNA is concentrated enough; however, 500 ng per reaction was usually sufficient to generate product. The RNA and water mixture was heated in a pre-heated thermal cycler at 96° C. for 4 minutes, and then immediately placed on ice for 2-3 minutes. During that time, the RT mix was made as follows:
After cooling, the chilled RNA and water mixture was briefly centrifuged to spin down any condensation on the tube cap. Then 8 μl RT mix (above) was added to each tube of RNA and water mixture, and mixed by pipeting up and down several times. A drop of mineral oil was overlaid in the reaction tube, and the tube was then incubated in a pre-heated thermal cycler at 50° C. for 5 minutes. Subsequently, 1 μl Superscript II Reverse Transcriptase 200 U/μl (kit) was added to each reaction tube underneath the oil layer. The reverse transcription process was allowed to proceed at 50° C., for 60 minutes, followed by 70° C. for 15 minutes to inactivate the RT; the mixture was then soaked at 4° C. One μl RNase H (Superscript II kit) was added to each reaction underneath the oil, and the reaction was incubated in a thermal cycler at 37° C. for 20 minutes. The first-strand cDNA resulting from this procedure could either be transferred to 4° C. and used directly in the PCR reaction, or stored at −20° C.
PCR Step
It should be noted that in addition to the vaccine samples, each assay must be accompanied by two DNA control reactions containing either 100% T or 100% C DNA templates, to validate each assay.
PCR mix was prepared as follows:
The PCR mix was aliquoted to a fresh 0.5 ml tube for each sample. Three μl of the first strand cDNA (from the RT reaction), 3 μl of 1/30 dilution of 100% T DNA, or 3 μl of 1/40 dilution of 100% C DNA were added to each PCR reaction as a template, and the reaction was then overlaid with a drop of mineral oil. The reaction was placed in a pre-heated thermal cycler, and cycled for 94° C. for 1 minutes (1 cycle), followed by 94° C. for 30 seconds and 60° C. for 3 minutes (40 cycles), and then a 4° C. soak.
Since the PCR products being generated are fluorescent, their exposure to light should be minimized by placing a piece of aluminum foil over the thermal cycler cover during cycling. Storage of the PCR products should always be in light tight containers.
Purification and Digestion of PCR Products
A Pharmacia G40 spin column was prepared for use in the purification of each PCR product. Each column was vortexed for 2-3 seconds to thoroughly resuspend the Sephadex beads; the screw cap was loosened one-half turn; the bottom of the column was snapped off and discarded, and then the screw cap was removed and discarded as well. Each column was placed in an empty 1.5 ml Eppendorf tube and spun in an Eppendorf microfuge at 3200 rpm (approximately 200×g) for 1 minute. Columns were then used immediately to avoid drying of the resin. The PCR reaction described above was removed from each tube, being careful to transfer as little oil as possible. The G-50 spin column was removed from its tube, and the entire 50 μl PCR reaction was slowly loaded onto the center of the angled resin in the column. The loaded column was then placed into a fresh, labeled 1.5 ml Eppendorf microfuge tube. The tubes were spun at 3200 rpm for 1 minute to collect the effluent containing the purified PCR product, and column was discarded. This purification step allows subsequent digestion of the PCR product with EcoRI to take place in a proper restriction enzyme buffer, as digestion with EcoRI in other buffers results in non-specific digestion of PCR products. Eight μL of each purified PCR reaction was removed to a new 0.5 ml Gene-amp tube, and 1 μl of Restriction Buffer H (Roche Mol. Biochemicals) provided with the EcoRI enzyme was added. One μl of EcoRI restriction enzyme (10 U/μl) was added to each sample and pipetted up and down several times to thoroughly mix reaction contents. The reaction tubes were then placed in a thermal cycler at 37° C. for 3-4 hours. The reactions were spun down by pulsing in microfuge to spin down any condensation on the tube cap, and 2 μl of 6× loading dye (40% glycerol, 0.05% Bromophenyl Blue, 0.05% Xylene Cyanol) were added to each digested sample, and then the samples were stored at 4° C. in light tight containers until loaded onto the gel.
Polyacrylamide Gel Electrophoresis of Digested PCR Products
During the final hour of the digestion step (above), polyacrylamide gels were prepared for analyses of the digested PCR products. Gel plates were washed with Alconox detergent, followed by a final rinse with ethanol, and allowed to air dry. The plates were assembled, and a 6% non-denaturing polyacrylamide gel mixture was prepared as follows:
(This gel recipe was sufficient to pour two 20×20 cm gels; each gel accommodated nine samples.)
For polymerization, 50 μl TEMED and 500 μl freshly prepared 10% ammonium persulfate were added to the gel mixture, swirling gently to mix reagents. The gel was immediately poured, the comb inserted, and clamps placed on the wells. Polymerization was allowed to occur for approximately one hour, after which the comb was removed and the wells rinsed with 1× TBE. The bottom buffer chamber was filled with 1× TBE. An entire 12 μl of each sample was loaded onto the gel, and the gel was run at 200-220 volts until the xylene cyanol was approximately 2 cm from the bottom of the gel (approximately 3 hours).
Quantitation of Undigested and Digested Band Density by Flourimaging
The gels were transferred to an overhead transparency, and then to a glass sample plate on the Flourimager. The gel was scanned on the Flourimager with the following settings: voltage (PMI)=600; filter 1=530 dF30 agarose; wavelength 488 nm. Once the gel was scanned, the image could be modified and quantitated using ImageQuant2 software. The percent C at nucleotide 2388 was then calculated:
a) Corrected volume of undigested product (CU)=undigested band volume−background volume.
b) Corrected volume of digested product (CD)=digested band volume−background volume.
c) Percent 2388 “C”=[CD/(CD+CU)]×100.
To ensure validity of each individual determination, all of the following conditions were met: 1) the value of % 2388 C in the 100% C DNA control sample must have been≧905; 2) the value of % 2388 C in the 100% T DNA control sample must have been less than 1.5%; and 3) the total bands of fluorescence (indicated by the volume) present in the undigested and digested bands must have been≧500,000.
Results
RNA was extracted as described above from each of 15 serotype G2 commercial vaccine lots, and for each vaccine lot, 5 individual determinations of the level of variant “C” at nucleotide position 2388 were carried out. The RNA from each virus sample was used to synthesize first strand cDNA (reverse transcription) in two independent experiments carried out on separate days. Three independent determinations of % C at nucleotide position 2388 were made using cDNA derived from the first reverse transcription reaction as PCR template, while the remaining two independent determinations were carried out using cDNA derived from the second reverse transcription reaction. For each sample, the Mean and Standard Deviation of the five determinations was calculated.
Following the protocols described above, a short region of gene 3 of RRV serotype G2 virus, encompassing nucleotide position 2388, was amplified by RT/PCR using the Superscript Pre-amplification System for First Strand cDNA synthesis (Life Technologies, Rockville, Md.). One of the primers used for amplification was homologous to the sequence immediately upstream of nucleotide 2388 and was designed to create an Eco RI restriction enzyme site if a cytosine residue was present at position 2388 (RRV-G3-EcoRI primer, GTTAGTGGAGTTCTAGCGACATATTTTAAAATGTAGAAT (SEQ ID NO: 186), corresponding to plus sense nucleotides 2347-2386). The second primer (RRV-302A-5′Flourescein, GGTCACATCATGACTAGTGTG (SEQ ID NO: 187), corresponding to negative sense nucleotides 2571-2591) was labeled with Flourescein (at the 5′ end), enabling the resulting PCR product to be visualized and quantitated using polyacrylamide gel electrophoresis and flourimaging techniques.
Following amplification, the PCR product was purified and digested. PCR products derived from genomes containing cytidine (C) at nucleotide position 2388 were digested, resulting in 34 and 207 bp digested fragments; of these two fragments, only the 207 bp fragment retains the flourescein tag and was detected by PAGE). Those genomes containing thymidine (T) at nucleotide position 2388 did not generate an EcoRI site, and thus yielded a 244 bp uncleaved product. The products were separated on a 6% polyacrylamide gel, and the relative densities of bands representing the undigested and digested products were quantitated using the Flourimager 595 (Molecular Dynamics), and a measurement of background fluorescence was taken. The percentage of viral genomes in the sample containing “C” at nucleotide 2388 was then calculated.
Base mixtures at nucleotide position 2388 in gene 3 and nucleotide position 174 in gene 10 were consistently detected in vaccine virus at the master working virus seed (MWVS) and vaccine monopool bulk concentrate stages. Thus, measurement of the inherent heterogeneity at these positions in the vaccine virus lots can be used as the foundation for a product consistency assay. The MAPREC analysis was used to determine the base composition at nucleotide 2388. The low level of variation observed in the fifteen G2 commercial vaccine lots at this nucleotide position demonstrates, not only the stability of the subpopulation containing C at nucleotide, but also the consistency of the vaccine manufacturing process. The average percentage of C at nucleotide position 2388 ranged from 2/75% to 6.68%, resulting in a variation of no more than 3.92% when any of the fifteen vaccine lots were compared (Table 11). The first three MAPREC determinations, revealed slightly higher levels of the minor species (C) compared to the remaining twelve G2 vaccine lots. However, three additional determinations carried out from a new RT reaction yielded levels of C consistent with those observed in the other twelve lots. Reanalyzing the data to exclude the first three MAPREC determinations, the range of variation observed for the fifteen vaccine lots was significantly reduced (i.e., a low of 2.76% and a high of 4.90%, equivalent to a variation of just 2.14%). In each case, excluding the three aberrant determinations, the standard deviation observed across five MAPREC determinations of the percentage C at nucleotide position 2388 of gene 3 in the commercial vaccine lots fell well below 1%, with over 50% of the samples resulting in standard deviations less than 0.5%. Taking into account that the variation observed was nearly 4 times greater by clonal analyses
*A second digestion sample taken from the PCR rxn generated in trial 5. (A digestion duplicate)
{circumflex over ( )}Trials 5 and 6 were PCR rxns. seeded from the same RT rxn. and carried out on the same day.
than was found using MAPREC (8% vs 2.14%, respectively), the levels of the minor species (C) in the G2 vaccine pools as measured by either method are comparable (average of 4% for MAPREC vs 8% for clonal analysis). These data indicate that MAPREC analyses of base composition at nucleotide 2388 in gene 3 of RRV were both accurate and reproducible.
While this invention has been particularly shown and described with reference to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.
This application claims the benefit of U.S. Application No. 60/359,960, filed Feb. 27, 2002. The entire teachings of the above application are incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US03/05172 | 2/19/2003 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 60359960 | Feb 2002 | US |
