SEQUENCE-DETERMINED DNA FRAGMENTS AND CORRESPONDING POLYPEPTIDES ENCODED THEREBY

Abstract
The present invention provides DNA molecules that constitute fragments of the genome of a plant, and polypeptides encoded thereby. The DNA molecules are useful for specifying a gene product in cells, either as a promoter or as a protein coding sequence or as an UTR or as a 3′ termination sequence, and are also useful in controlling the behavior of a gene in the chromosome, in controlling the expression of a gene or as tools for genetic mapping, recognizing or isolating identical or related DNA fragments, or identification of a particular individual organism, or for clustering of a group of organisms with a common trait. One of ordinary skill in the art, having this data, can obtain cloned DNA fragments, synthetic DNA fragments or polypeptides constituting desired sequences by recombinant methodology known in the art or described herein.
Description
FIELD OF THE INVENTION

The present invention relates to over 100,000 isolated polynucleotides from plants that include a complete coding sequence, or a fragment thereof, that is expressed. In addition, the present invention relates to the polypeptide or protein corresponding to the coding sequence of these polynucleotides. The present invention also relates to isolated polynucleotides that represent regulatory regions of genes. The present invention also relates to isolated polynucleotides that represent untranslated regions of genes. The present invention further relates to the use of these isolated polynucleotides and polypeptides and proteins.





BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1: A Genomics Engine schematic.



FIG. 2: An illustration of how the discoveries on gene structure, function, expression and phenotypic observation can be integrated together to understand complex phenotypes is provided.



FIG. 3: Integration of Data Across Species to Link Gene Products and Phenotypes.



FIG. 4: Graph illuminates possible transcription profiles over the time course.



FIG. 5: Graph shows expression pattern of a cell wall synthesis gene, cDNAID 1595707, during fruit development.





BACKGROUND OF THE INVENTION

There are more than 300,000 species of plants. They show a wide diversity of forms, ranging from delicate liverworts, adapted for life in a damp habitat, to cacti, capable of surviving in the desert. The plant kingdom includes herbaceous plants, such as corn, whose life cycle is measured in months, to the giant redwood tree, which can live for thousands of years. This diversity reflects the adaptations of plants to survive in a wide range of habitats. This is seen most clearly in the flowering plants (phylum Angiospermophyta), which are the most numerous, with over 250,000 species. They are also the most widespread, being found from the tropics to the arctic.


The process of plant breeding involving man's intervention in natural breeding and selection is some 20,000 years old. It has produced remarkable advances in adapting existing species to serve new purposes. The world's economics was largely based on the successes of agriculture for most of these 20,000 years.


Plant breeding involves choosing parents, making crosses to allow recombination of gene (alleles) and searching for and selecting improved forms. Success depends on the genes/alleles available, the combinations required and the ability to create and find the correct combinations necessary to give the desired properties to the plant. Molecular genetics technologies are now capable of providing new genes, new alleles and the means of creating and selecting plants with the new, desired characteristics.


When the molecular and genetic basis for different plant characteristics are understood, a wide variety of polynucleotides, both endogenous polynucleotides and created variants, polypeptides, cells, and whole organisms, can be exploited to engineer old and new plant traits in a vast range of organisms including plants. These traits can range from the observable morphological characteristics, through adaptation to specific environments to biochemical composition and to molecules that the plants (organisms) exude. Such engineering can involve tailoring existing traits, such as increasing the production of taxol in yew trees, to combining traits from two different plants into a single organism, such as inserting the drought tolerance of a cactus into a corn plant. Molecular and genetic knowledge also allows the creation of new traits. For example, the production of chemicals and pharmaceuticals that are not native to particular species or the plant kingdom as a whole.


The application reports the inventions Applicants have discovered to build a foundation of scientific understanding of plant genomes to achieve these aims. These inventions include polynucleotide and polypeptide sequences, and data relating to where and when the genes are differentially expressed and phenotypic observations resulting from either aberrant gene activation or disruption. How these data are transformed into a scientific understanding of plant biology and the control of traits from a genetic perspective also is explained by the instant application. Applications of these discoveries to create new prototypes and products in the field of chemical, pharmaceutical, food, feed, and fiber production are described herein as well.


The achievements described in this application were possible because of the results from a cluster of technologies, a genomic engine, depicted below in Schematic 1, that allows information on each gene to be integrated to provide a more comprehensive understanding of gene structure and function and the deployment of genes and gene components to make new products.


I. The Discoveries of the Instant Application

Applicants have isolated and identified over one hundred thousand genes, gene components and their products and thousands of promoters. Specific genes were isolated and/or characterized from arabidopsis, soybean, maize, wheat and rice. These species were selected because of their economic value and scientific importance and were deliberately chosen to include representatives of the evolutionary divergent dicotyledonous and monocotyledonous groups of the plant kingdom. The number of genes characterized in this application represents a large proportion of all the genes in these plant species.


The techniques used initially to isolate and characterize most of the genes, namely sequencing of full-length cDNAs, were deliberately chosen to provide information on complete coding sequences and on the complete sequences of their protein products.


Gene components and products the Applicants have identified include exons, introns, promoters, coding sequences, antisense sequences, terminators and other regulatory sequences. The exons are characterized by the proteins they encode and arabidopsis promoters are characterized by their position in the genomic DNA relative to where mRNA synthesis begins and in what cells and to what extent they promote mRNA synthesis.


Further exploitation of molecular genetics technologies has helped the Applicants to understand the functions and characteristics of each gene and their role in a plant. Three powerful molecular genetics approaches were used to this end:

    • (a) Analyses of the phenotypic changes when the particular gene sequence is interrupted or activated differentially; (arabidopsis)
    • (b) Analyses of in what plant organs, to what extent, and in response to what environmental signals mRNA is synthesized from the gene; (arabidopsis and maize) and
    • (c) Analysis of the gene sequence and its relatives. (all species)


These were conducted using the genomics engine depicted in FIG. 1 that allows information on each gene to be integrated to provide a more comprehensive understanding of gene structure and function and linkage to potential products.


The species arabidopsis was used extensively in these studies for several reasons: (1) the complete genomic sequence, though poorly annotated in terms of gene recognition, was being produced and published by others and (2) genetic experiments to determine the role of the genes in planta are much quicker to complete.


The phenotypic tables, MA tables, and reference tables and sequence tables indicate the results of these analyses and thus the specific functions and characteristics that are ascribed to the genes and gene components and products.


II. Integration of Discoveries to Provide Scientific Understanding

From the discoveries made, Applicants have deduced the biochemical activities, pathways, cellular roles, and developmental and physiological processes that can be modulated using these components. These are discussed and summarized in sections based on the gene functions characteristics from the analyses and role in determining phenotypes. These sections illustrate and emphasize that each gene, gene component or product influences biochemical activities, cells or organisms in complex ways, from which there can be many phenotypic consequences.


An illustration of how the discoveries on gene structure, function, expression and phenotypic observation can be integrated together to understand complex phenotypes is provided in schematic 2. This sort of understanding enables conclusions to be made as to how the genes, gene components and product are useful for changing the properties of plants and other organisms. This example also illustrates how single gene changes in, for example, a metabolic pathway can cause gross phenotypic changes.


Furthermore, the development and properties of one part of plant can be interconnected with other parts. The dependence of shoot and leaf development on root cells is a classic example. Here, shoot growth and development require nutrients supplied from roots, so the protein complement of root cells can affect plant development, including flowers and seed production. Similarly, root development is dependent on the products of photosynthesis from leaves. Therefore, proteins in leaves can influence root developmental physiology and biochemistry.


Thus, the following sections describe both the functions and characteristics of the genes, gene components and products and also the multiplicity of biochemical activities, cellular functions, and the developmental and physiological processes influenced by them. The sections also describe examples of commercial products that can be realized from the inventions.


A. Analyses to Reveal Function and In Vivo Roles of Single Genes in One Plant Species


The genomics engine has focused on individual genes to reveal the multiple functions or characteristics that are associated to each gene, gene components and products of the instant invention in the living plant. For example, the biochemical activity of a protein is deduced based on its similarity to a protein of known function. In this case, the protein may be ascribed with, for example, an oxidase activity. Where and when this same protein is active can be uncovered from differential expression experiments, which show that the mRNA encoding the protein is differentially expressed in response to drought and in seeds but not roots. The gene disruption experiments reveal that absence of the same protein causes embryo lethality.


Thus, this protein is characterized as a seed protein and drought-responsive oxidase that is critical for embryo viability.


B. Analyses to Reveal Function and Roles of Single Genes in Different Species


The genomics engine has also been used to extrapolate knowledge from one species to many plant species. For example, proteins from different species, capable of performing identical or similar functions, preserve many features of amino acid sequence and structure during evolution. Complete protein sequences have been compared and contrasted within and between species to determine the functionally vital domains and signatures characteristic of each of the proteins that is the subject of this application. Thus, functions and characteristics of arabidopsis proteins have been extrapolated to proteins containing similar domains and signatures of corn, soybean, rice and wheat and by implication to all other (plant) species.


Schematic 3 provides an example. Two proteins with related structures, one from corn, a monocot, and one from arabidopsis, a dicot, have been concluded to be orthologs. The known characteristics of the arabidopsis protein (seed protein, drought responsive oxidase) can then be attributed to the corn protein.


C. Analyses Over Multiple Experiments to Reveal Gene Networks and Links Across Species


The genomics engine can identify networks or pathways of genes concerned with the same process and hence linked to the same phenotype(s). Genes specifying functions of the same pathway or developmental environmental responses are frequently co-regulated i.e. they are regulated by mechanisms that result in coincident increases or decreases for all gene members in the group. The Applicants have divided the genes of arabidopsis and maize into such co-regulated groups on the basis of their expression patterns and the function of each group has been deduced. This process has provided considerable insight into the function and role of thousands of the plant genes in diverse species included in this application.


D. Applications of Applicant's Discoveries


It will be appreciated while reading the sections that the different experimental molecular genetic approaches focused on different aspects of the pathway from gene and gene product through to the properties of tissues, organs and whole organisms growing in specific environments. For each endogenous gene, these pathways are delineated within the existing biology of the species. However, Applicants' inventions allow gene components or products to be mixed and matched to create new genes and placed in other cellular contexts and species, to exhibit new combinations of functions and characteristics not found in nature, or to enhance and modify existing ones. For instance, gene components can be used to achieve expression of a specific protein in a new cell type to introduce new biochemical activities, cellular attributes or developmental and physiological processes. Such cell-specific targeting can be achieved by combining polynucleotides encoding proteins with any one of a large array of promoters to facilitate synthesis of proteins in a selective set of plant cells. This emphasizes that each gene, component and protein can be used to cause multiple and different phenotypic effects depending on the biological context. The utilities are therefore not limited to the existing in vivo roles of the genes, gene components, and gene products.


While the genes, gene components and products disclosed herein can act alone, combinations are useful to modify or modulate different traits. Useful combinations include different polynucleotides and/or gene components or products that have (1) an effect in the same or similar developmental or biochemical pathways; (2) similar biological activities; (3) similar transcription profiles; or (4) similar physiological consequences.


Of particular interest are the transcription factors and key factors in regulatory transduction pathways, which are able to control entire pathways, segments of pathways or large groups of functionally related genes. Therefore, manipulation of such proteins, alone or in combination is especially useful for altering phenotypes or biochemical activities in plants. Because interactions exist between hormone, nutrition, and developmental pathways, combinations of genes and/or gene products from these pathways also are useful to produce more complex changes. In addition to using polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may exhibit different transcription profiles but which participate in common or overlapping pathways. Also, polynucleotides encoding selected enzymes can be combined in novel ways in a plant to create new metabolic pathways and hence new metabolic products.


The utilities of the various genes, gene components and products of the Application are described below in the sections entitled as follows:


I. Organ Affecting Genes, Gene Components, Products (Including Differentiation Function)

I.A. Root Genes, Gene Components And Products

    • I.A.1. Root Genes, Gene Components And Products
    • I.A.2. Root Hair Genes, Gene Components And Products


I.B. Leaf Genes, Gene Components And Products

    • I.B.1. Leaf Genes, Gene Components And Products
    • I.B.2. Trichome Genes And Gene Components
    • I.B.3. Chloroplast Genes And Gene Components


I.C. Reproduction Genes, Gene Components And Products

    • I.C.1. Reproduction Genes, Gene Components And Products
    • I.C.2. Ovule Genes, Gene Components And Products
    • I.C.3. Seed And Fruit Development Genes, Gene Components And Products


I.D. Development Genes, Gene Components And Products

    • I.D.1. Imbibition and Germination Responsive Genes, Gene Components And Products
    • I.D.2. Early Seedling Phase Genes, Gene Components And Products
    • I.D.3. Size and Stature Genes, Gene Components And Products
    • I.D.4. Shoot-Apical Meristem Genes, Gene Components And Products
    • I.D.5. Vegetative-Phase Specific Responsive Genes, Gene Components And Products


II. Hormones Responsive Genes, Gene Components And Products

II.A. Abscissic Acid Responsive Genes, Gene Components And Products


II.B. Auxin Responsive Genes, Gene Components And Products


II.C. Brassinosteroid Responsive Genes, Gene Components And Products


II.D. Cytokinin Responsive Genes, Gene Components And Products


II.E. Gibberellic Acid Responsive Genes, Gene Components And Products


III. Metabolism Affecting Genes, Gene Components And Products

III.A. Nitrogen Responsive Genes, Gene Components And Products


III.B. Circadian Rhythm Responsive Genes, Gene Components And Products


III.C. Blue Light (Phototropism) Responsive Genes, Gene Components And Products


III.D. Co2 Responsive Genes, Gene Components And Products


III.E. Mitochondria Electron Transport Genes, Gene Components And Products


III.F. Protein Degradation Genes, Gene Components And Products


III.G. Carotenogenesis Responsive Genes, Gene Components And Products


IV. Viability Genes, Gene Components And Products

IV.A. Viability Genes, Gene Components And Products


IV.B. Histone Deacetylase (Axel) Responsive Genes, Gene Components And Products


V. Stress Responsive Genes, Gene Components And Products

V.A. Cold Responsive Genes, Gene Components And Products


V.B. Heat Responsive Genes, Gene Components And Products


V.C. Drought Responsive Genes, Gene Components And Products


V.D. Wounding Responsive Genes, Gene Components And Products


V.E. Methyl Jasmonate Responsive Genes, Gene Components And Products


V.F. Reactive Oxygen Responsive Genes, Gene Components And H2O2 Products


V.G. Salicylic Acid Responsive Genes, Gene Components And Products


V.H. Nitric Oxide Responsive Genes, Gene Components And Products


V.I. Osmotic Stress Responsive Genes, Gene Components And Products


V.J. Aluminum Responsive Genes, Gene Components And Products


V.K. Cadmium Responsive Genes, Gene Components And Products


V.L. Disease Responsive Genes, Gene Components And Products


V.M. Defense Responsive Genes, Gene Components And Products


V.N. Iron Responsive Genes, Gene Components And Products


V.O. Shade Responsive Genes, Gene Components And Products


V.P. Sulfur Responsive Genes, Gene Components And Products


V.Q. Zinc Responsive Genes, Gene Components And Products


VI. Enhanced Foods
VII. Pharmaceutical Products
VIII. Precursors Of Industrial Scale Compounds
IX. Promoters As Sentinels
SUMMARY OF THE INVENTION

The present invention comprises polynucleotides, such as complete cDNA sequences and/or sequences of genomic DNA encompassing complete genes, fragments of genes, and/or regulatory elements of genes and/or regions with other functions and/or intergenic regions, hereinafter collectively referred to as Sequence-Determined DNA Fragments (SDFs) or sometimes collectively referred to as “genes or gene components”, or sometimes as “genes, gene components or products”, from different plant species, particularly corn, wheat, soybean, rice and Arabidopsis thaliana, and other plants and or mutants, variants, fragments or fusions of said SDFs and polypeptides or proteins derived therefrom. In some instances, the SDFs span the entirety of a protein-coding segment. In some instances, the entirety of an mRNA is represented. Other objects of the invention that are also represented by SDFs of the invention are control sequences, such as, but not limited to, promoters. Complements of any sequence of the invention are also considered part of the invention.


Other objects of the invention are polynucleotides comprising exon sequences, polynucleotides comprising intron sequences, polynucleotides comprising introns together with exons, intron/exon junction sequences, 5′ untranslated sequences, and 3′ untranslated sequences of the SDFs of the present invention. Polynucleotides representing the joinder of any exons described herein, in any arrangement, for example, to produce a sequence encoding any desirable amino acid sequence are within the scope of the invention.


The present invention also resides in probes useful for isolating and identifying nucleic acids that hybridize to an SDF of the invention. The probes can be of any length, but more typically are 12-2000 nucleotides in length; more typically, 15 to 200 nucleotides long; even more typically, 18 to 100 nucleotides long.


Yet another object of the invention is a method of isolating and/or identifying nucleic acids using the following steps:


(a) contacting a probe of the instant invention with a polynucleotide sample under conditions that permit hybridization and formation of a polynucleotide duplex; and


(b) detecting and/or isolating the duplex of step (a).


The conditions for hybridization can be from low to moderate to high stringency conditions. The sample can include a polynucleotide having a sequence unique in a plant genome. Probes and methods of the invention are useful, for example, without limitation, for mapping of genetic traits and/or for positional cloning of a desired fragment of genomic DNA.


Probes and methods of the invention can also be used for detecting alternatively spliced messages within a species. Probes and methods of the invention can further be used to detect or isolate related genes in other plant species using genomic DNA (gDNA) and/or cDNA libraries. In some instances, especially when longer probes and low to moderate stringency hybridization conditions are used, the probe will hybridize to a plurality of cDNA and/or gDNA sequences of a plant. This approach is useful for isolating representatives of gene families which are identifiable by possession of a common functional domain in the gene product or which have common cis-acting regulatory sequences. This approach is also useful for identifying orthologous genes from other organisms.


The present invention also resides in constructs for modulating the expression of the genes comprised of all or a fragment of an SDF. The constructs comprise all or a fragment of the expressed SDF, or of a complementary sequence. Examples of constructs include ribozymes comprising RNA encoded by an SDF or by a sequence complementary thereto, antisense constructs, constructs comprising coding regions or parts thereof, constructs comprising promoters, introns, untranslated regions, scaffold attachment regions, methylating regions, enhancing or reducing regions, DNA and chromatin conformation modifying sequences, etc. Such constructs can be constructed using viral, plasmid, bacterial artificial chromosomes (BACs), plasmid artificial chromosomes (PACs), autonomous plant plasmids, plant artificial chromosomes or other types of vectors and exist in the plant as autonomous replicating sequences or as DNA integrated into the genome. When inserted into a host cell the construct is, preferably, functionally integrated with, or operatively linked to, a heterologous polynucleotide. For instance, a coding region from an SDF might be operably linked to a promoter that is functional in a plant.


The present invention also resides in host cells, including bacterial or yeast cells or plant cells, and plants that harbor constructs such as described above. Another aspect of the invention relates to methods for modulating expression of specific genes in plants by expression of the coding sequence of the constructs, by regulation of expression of one or more endogenous genes in a plant or by suppression of expression of the polynucleotides of the invention in a plant. Methods of modulation of gene expression include without limitation (1) inserting into a host cell additional copies of a polynucleotide comprising a coding sequence; (2) modulating an endogenous promoter in a host cell; (3) inserting antisense or ribozyme constructs into a host cell and (4) inserting into a host cell a polynucleotide comprising a sequence encoding a variant, fragment, or fusion of the native polypeptides of the instant invention.


DETAILED DESCRIPTION OF THE INVENTION
I. Description of the Tables

As noted above, the Applicants have obtained and analyzed an extensive amount of information on a large number of genes by use of the Ceres Genomic Engine to determine. This information can be categorized into three basic types:


A. Sequence Information for the Inventions


B. Transcriptional Information for the Inventions


C. Phenotypic Information for the Inventions


I.A. Sequence Information


To harness the potential of the plant genome, Applicants began by elucidating a large number gene sequences, including the sequences of gene components and products, and analyzing the data. The list of sequences and associated data are presented in the Reference and Sequence Tables of the present application (sometimes referred to as the “REF” and “SEQ” Tables). The Reference and Sequence tables include:

    • cDNA sequence;
    • coding sequence;
    • 5′ & 3′ UTR;
    • transcription start sites;
    • exon and intron boundaries in genomic sequence; and
    • protein sequence.


The Reference and Sequence Tables also include computer-based, comparative analyses between the protein sequences of the invention and sequences with known function. Proteins with similar sequences typically exhibit similar biochemical activities. The Reference table notes:

    • sequences of known function that are similar to the Applicants' proteins; and
    • biochemical activity that is associated with Applicants' proteins.


Also, by analyzing the protein sequences, Applicants were able to group the protein sequences into groups, wherein all the sequences in the group contain a signature sequence. The groups are presented in the Protein Group Table. The signature sequences are reported in the Protein Group Table. More detailed analyses of the signature sequences are shown in the Protein Group Matrix Table.


To identify gene components and products, Applicants took a cDNA/coding sequence approach. That is, Applicants initiated their studies either by isolating cDNAs and determining their sequences experimentally, or by identifying the coding sequence from genomic sequence with the aid of predictive algorithms. The cDNA sequences and coding sequences also are referred to as “Maximum Length Sequences” in the Reference tables. The cDNA and coding sequences were given this designation to indicate these were the maximum length of coding sequences identified by Applicants.


Due to this cDNA/coding sequence focus of the present application, the Reference and Sequence Tables were organized around cDNA and coding sequences. Each of these Maximum Length Sequences was assigned a unique identifier: Ceres Sequence ID NO, which is reported in the Tables.


All data that relate to these Maximum Length Sequences are grouped together, including 5′ & 3′ UTRs; transcription start sites; exon and intron boundaries in genomic sequence; protein sequence, etc.


Below, a more detailed explanation of the organization of the Reference and Sequence Tables and how the data in the tables were generated is provided.


a. cDNA


Applicants have ascertained the sequences of mRNAs from different organisms by reverse transcription of mRNA to DNA, which was cloned and then sequenced. These complementary DNA or cDNA sequences also are referred to as Maximum Length Sequences in the Reference Tables, which contain details on each of the sequences in the Sequence Tables.


Each sequence was assigned a Pat. Appln. Sequence ID NO: and an internal Ceres Sequence ID NO: as reported in the Reference Table, the section labeled “(Ac) cDNA Sequence.” An example is shown below:

    • Max Len. Seq.:
    • (Ac) cDNA Sequence
      • Pat. Appln. Sequence ID NO: 174538
      • Ceres Sequence ID NO: 5673127


Both numbers are included in the Sequence Table to aid in tracking of information, as shown below:











<210>
174538 (Pat. Appin. Sequence ID NO:)



<211>
1846


<212>
DNA (genomic)


<213>

Arabidopsis thaliana






<220>



<221>
misc_feature


<222>
(1)..(1846)


<223>
Ceres Seq. ID no. 5673127





<220>



<221>
misc_feature


<222>
( )..( )


<223>
n is a, c, t, g, unknown, or other


<400>
174538












acaagaacaa caaaacagag gaagaagaag aagaagatga agcttctggc tctgtttcca
60



tttctagcga tcgtgatcca actcagctgt ... etc.







The Sequence and Reference Tables are divided into sections by organism: Arabidopsis thaliana, Brassica napus, Glycine max, Zea mays, Triticum aestivum; and Oryza sativa.


b. Coding Sequence


The coding sequence portion of the cDNA was identified by using computer-based algorithms and comparative biology. The sequence of each coding sequence of the cDNA is reported in the “PolyP Sequence” section of the Reference Tables, which are also divided into sections by organism. An example shown below for the peptides that relate to the cDNA sequence above


PolyP Sequence

Pat. Appln. Sequence ID NO 174539


Ceres Sequence ID NO 5673128


Loc. Sequence ID NO 174538: @1 nt.


Loc. Sig. P. Sequence ID NO 174539: @37 aa.


The polypeptide sequence can be found in the Sequence Tables by either the Pat. Appln. Sequence ID NO or by the Ceres Sequence ID NO: as shown below:











<210>
174539 (Pat. Appin. Sequence ID NO)



<211>
443


<212>
PRT


<213>

Arabidopsis thaliana






<220>



<221>
peptide


<222>
(1)..(443)


<223>
Ceres Seq. ID no. 5673128





<220>



<221>
misc_feature


<222>
( )..( )


<223>
xaa is any aa, unknown or other


<400>
174539











Thr Arg Thr Thr Lys Gln Arg Lys Lys Lys Lys Lys Met Lys Leu Leu



1         5        10             15





Ala Leu Phe Pro Phe Leu Ala Be_ etc.


                25






The PolyP section also indicates where the coding region begins in the Maximum Length Sequence. More than one coding region may be indicated for a single polypeptide due to multiple potential translation start codons. Coding sequences were identified also by analyzing genomic sequence by predictive algorithms, without the actual cloning of a cDNA molecule from a mRNA. By default, the cDNA sequence was considered the same as the coding sequence, when Maximum Length Sequence was spliced together from a genomic annotation.


c. 5′ and 3′ UTR


The 5′ UTR can be identified as any sequence 5′ of the initiating codon of the coding sequence in the cDNA sequence. Similarly, the 3′ UTR is any sequence 3′ of the terminating codon of the coding sequence.


d. Transcription Start Sites


Applicants cloned a number of cDNAs that encompassed the same coding sequence but comprised 5′ UTRs of different lengths. These different lengths revealed the multiple transcription start sites of the gene that corresponded to the cDNA. These multiple transcription start sites are reported in the “Sequence # w. TSS” section” of the Reference Tables.


e. Exons & Introns


Alignment of the cDNA sequences and coding portions to genomic sequence permitted Applicants to pinpoint the exon/intron boundaries. These boundaries are identified in the Reference Table under the “Pub gDNA” section. That section reports the gi number of the public BAC sequence that contains the introns and exons of interest. An example is shown below:


Max Len. Seq.:


Pub gDNA:

    • gi No: 1000000005
    • Gen. seq. in cDNA:
      • 115777 . . . 115448 by Method #1
      • 115105 . . . 114911 by Method #1
      • 114822 . . . 114700 by Method #1
      • 114588 . . . 114386 by Method #1
      • 114295 . . . 113851 by Method #1
      • 115777 . . . 115448 by Method #2
      • 115105 . . . 114911 by Method #2
      • 114822 . . . 114700 by Method #2
      • 114588 . . . 114386 by Method #2
      • 114295 . . . 113851 by Method #2
      • 115813 . . . 115448 by Method #3
      • 115105 . . . 114911 by Method #3
      • 114822 . . . 114700 by Method #3
      • 114588 . . . 114386 by Method #3
      • 114295 . . . 113337 by Method #3


(Ac) cDNA Sequence


All the gi numbers were assigned by Genbank to track the public genomic sequences except:


gi 1000000001


gi 1000000002


gi 1000000003


gi 1000000004; and


gi 1000000005.


These gi numbers were assigned by Applicants to the five Arabidopsis chromosome sequences that were published by the Institute of Genome Research (TIGR). Gi 1000000001 corresponds to chromosome 1, Gi 1000000002 to chromosome 2, etc.


The method of annotation is indicated as well as any similar public annotations.


f. Promoters & Terminators


Promoter sequences are 5′ of the translational start site in a gene; more typically, 5′ of the transcriptional start site or sites. Terminator sequences are 3′ of the translational terminator codon; more typically, 3′ of the end of the 3′ UTR.


For even more specifics of the Reference and Sequence Tables, see the section below titled “Brief Description of the Tables.”


I.B. Transcriptional (Differential Expression) Information-Introduction to Differential Expression Data & Analyses


A major way that a cell controls its response to internal or external stimuli is by regulating the rate of transcription of specific genes. For example, the differentiation of cells during organogenensis into forms characteristic of the organ is associated with the selective activation and repression of large numbers of genes. Thus, specific organs, tissues and cells are functionally distinct due to the different populations of mRNAs and protein products they possess. Internal signals program the selective activation and repression programs. For example, internally synthesized hormones produce such signals. The level of hormone can be raised by increasing the level of transcription of genes encoding proteins concerned with hormone synthesis.


To measure how a cell reacts to internal and/or external stimuli, individual mRNA levels can be measured and used as an indicator for the extent of transcription of the gene. Cells can be exposed to a stimulus, and mRNA can be isolated and assayed at different time points after stimulation. The mRNA from the stimulated cells can be compared to control cells that were not stimulated. The mRNA levels of particular Maximum Length Sequences that are higher in the stimulated cell versus the control indicate a stimulus-specific response of the cell. The same is true of mRNA levels that are lower in stimulated cells versus the control condition.


Similar studies can be performed with cells taken from an organism with a defined mutation in their genome as compared with cells without the mutation. Altered mRNA levels in the mutated cells indicate how the mutation causes transcriptional changes. These transcriptional changes are associated with the phenotype that the mutated cells exhibit that is different from the phenotype exhibited by the control cells.


Applicants have utilized microarray techniques to measure the levels of mRNAs in cells from mutant plants, stimulated plants, and/or selected from specific organs. The differential expression of various genes in the samples versus controls are listed in the MA_diff Tables. Applicants have analyzed the differential data to identify genes whose mRNA transcription levels are positively correlated. From these analyses, Applicants were able to group different genes together whose transcription patterns are correlated. The results of the analyses are reported in the MA_clust Tables.


a. Experimental Detail


A microarray is a small solid support, usually the size of a microscope slide, onto which a number of polynucleotides have been spotted onto or synthesized in distinct positions on the slide (also referred to as a chip). Typically, the polynucleotides are spotted in a grid formation. The polynucleotides can either be Maximum Length Sequences or shorter synthetic oligonucleotides, whose sequence is complementary to specific Maximum Length Sequence entities. A typical chip format is as follows:
















Oligo #1
Oligo #2
Oligo #3


Oligo #4
Oligo #5
Oligo #6


Oligo #7
Oligo #8
Oligo #9









For Applicants' experiments, samples were hybridized to the chips using the “two-color” microarray procedure. A fluorescent dye was used to label cDNA reverse-transcribed from mRNA isolated from cells that had been stimulated, mutated, or collected from a specific organ or developmental stage. A second fluorescent dye of another color was used to label cDNA prepared from control cells.


The two differentially-labeled cDNAs were mixed together. Microarray chips were incubated with this mixture. For Applicants' experiments the two dyes that are used are Cy3, which fluoresces in the red color range, and Cy5, which fluoresces in the green/blue color range. Thus, if:


cDNA#1 binds to Oligo #1;


cDNA#1 from the sample is labeled red;


cDNA#1 from the control is labeled green, and


cDNA#1 is in both the sample and control, then cDNA#1 from both the sample and control will bind to Oligo#1 on the chip. If the sample has 10 times more cDNA#1 than the control, then 10 times more of the cDNA#1 would be hybridized to Oligo#1. Thus, the spot on the chip with Oligo#1 spot would look red.
















Oligo #1
Oligo #2
Oligo #3


Oligo #4
Oligo #5
Oligo #6


Oligo #7
Oligo #8
Oligo #9










If the situation were reversed, the spot would appear green. If the sample has approximately the same amount of cDNA#1 as the control, then the Oligo#1 spot on the chip would look yellow. These color differentials are measured quantitatively and used to deduce the relative concentration of mRNAs from individual genes in particular samples.


b. MA_Diff Data Table


To generate data, Applicants labeled and hybridized the sample and control mRNA in duplicate experiments. One chip was exposed to a mixture of cDNAs from both a sample and control, where the sample cDNA was labeled with Cy3, and the control was labeled with Cy5 dye. For the second labeling and chip hybridization experiments, the fluorescent labels were reversed; that is, the Cy5 dye for the sample, and the Cy3 dye for the control.


Whether Cy5 or Cy3 was used to label the sample, the fluorescence produced by the sample was divided by the fluorescence of the control. A cDNA was determined to be differentially expressed in response to the stimulus in question if a statistically-significantly ration difference in the sample versus the control was measured by both chip hybridization experiments.


The MA_diff tables show which cDNA were significantly up-regulated as designated by a “+” and which were significantly down-regulated as designated by a “−” for each pair of chips using the same sample and control.


I.C. Phenotypic Information


One means of determining the phenotypic effect of a gene is either to insert extra active copies of the gene or coding sequence, or to disrupt an existing copy of the gene in a cell or organism and measure the effects of the genetic change on one or more phenotypic characters or traits. “Knock-in” is used herein to refer to insertion of additional active copies of a gene or coding sequence. “Knock-out” refers to a plant where an endogenous gene(s) is disrupted. Applicants have used both methods of addition or disruption to determine the phenotypic effects of gene or gene components or products, and have thereby discovered the function of the genes and their utilities.


1. Knock-in Results


The coding sequence of a desired protein can be functionally linked to a heterologous promoter to facilitate expression. Here, Applicants have operably linked a number of coding sequences to either one of the promoters listed below:















Specific Promoter
Plant Line


GFP Pattern
activity
Descriptor







Root epidermis/mostly toward the lower
Specific to the root basal
Root basal


region of root (more intense than CS9094)
region.



Root-endodermis/cortex (initials sharp);
Specific to the root
Root/Petiole/Flowers


shoot-mesophyll of one leaf, sharp guard cell
endodermis-cortex



marking. New leaf petioles near tip of
region, leaf petiole, and



primary inflorescence; floral stems; in
flowers.



flowers at base of sepal, anther stems, and




pistil




Broad root exp. (some dermal, some cortical,
Specific to root and stem.
Root/Stem1


some vascular); shoot apex. Faintly in




petiole; stem




High expression in stem, excluded from 1st
Specific to stem and root.
Root/Stem2


true leaves/High in root. Faint expression in




stem




Shoot meristem/whole root region; little bit
Specific to roots, shoot
Root/Stem/Leaves/


on cotyledons. Base of leaves(axillary
meristem, base of leaves
Flowers


meristem?); base of sepals; inflorescence
and flowers.



meristem; small amount in unfertilized pistil.




root tip vascular initials; vascular system
Specific to vascular
Vascular/Ovule/Young


throughout plant; Bud petal vasculature and
systems.
Seed/Embryo


pistil septum; Flower petal vascualture;




Flower pistil septum; Pre fertilization ovules;




Post fertilization ovule at chalazal end;




Developing seed (young, maturing siliques);




Seed coat and young embryos. GFP not




observed in mature embryos.




Flower, sepal/vascular tissue of root, stem,
Specific to flowers, seed
Flowers/Seed/


and cotyledons. Stems of new flowers;
and vasculature.
Vasculature/Embryo


vasculature or petals, anthers, sepals, and




pistil/silique; Vasculature throughtout




seedling: root, hypocotyl, petioles, stem,




cotyledons, first true leaves; Rosette




vasculature; Cauline leaf vasculature; Bud




pedicel vasculature; Flower vasculature:




(sepals, petals, filaments, pistil); Bud




vasculature (sepal, petal, filament, pistil);




Funiculus in both flower and bud; Some




possible seed coat expression; Silique




funiculus; Very faint fluorescence in mature




embryo (auto fluorescence perhaps);




Root expression-primarily in cortex (upper
Specific to root.
Roots2


refion of the root). No shoot expression




Root expression-less intense in whole root
Specific to root and shoot
Root/SAM


of young seedling. Shoot apical meristem;
apical meristem.



organ primordia in SAM region.




Root epidermis/tip; shoot epidermis/vascular;
Specific to seed and to
Seed/Epidermis/


leaf epidermis; expression in developing
epidermal layers of roots,
Ovary/Fruit


seed/ovule-mature embryo; Primary and
shoots and leaves.



lateral root cortex; Very strong in root cap;




Base of flower bud and epidermis of carpels;




Base of flower, epidermis of filaments,




epidermis of carpels; Trichomes; Weak




(hardly detectable) gfp expression in




vasculature throughout seedling; Strong




expression in trichomes; POST-fertilization




SEED only; GFP strength increases as




silique matures; Weak at suspensor end of




the embryo; GFP observed in seed coat; Root




and post fertilization seed specific gfp




expression; Expression in seed coat.




Young root dermis; dermal/cortical?/vascular
Specific to roots, shoots,
Roots/Shoots/Ovule


in older root; general (epidermal?) shoot
and ovules.



expression; ovules. some in sepals;




vasculature of stem




Vascular tissue of root; Meristem tissues:
Specific to root structural
Vasculature/Meristem


axillary meristems, floral meristems, base of
leaf vascular region and



flowers/sepals; Weak expression in
to floral buds and axillary



hypocotyl, petiole and cotyledon
meristem



vasculature..









The chimeric constructs were transformed into Arabidopsis thaliana. The resulting transformed lines were screened to determine what phenotypes were changed due to introduced transgene. The phenotype changes, relative to the control, are reported in the Knock-in tables.


2. Knock-Out Results


Knock-out plants in Arabidopsis thaliana were created by inserting a polynucleotide tag into the genome. The location of the tag was identified using primers to the tag sequence and isolation of the plant genomic sequence that flanks the tag using a variation of the polymerase chain reaction. The plants were generated using the procedure described in Feldmann et al., (1987) Molec. Gen. Genet. 208: 1-9; Feldmann (1991) Plant Journal, 1:71-83 and Forsthoefel et al., (1992) Aust. J. Plant Physiol. 19:353-366. On average, the population of plants that was screened had ˜1.5 to 2 tags. Generally, the number of tags ranged from 1 to greater than 5.


The polynucleotide tags were classified as either incorporated within a gene, or between two genes. The data in the Knock-out Table indicates which plants have a tag(s) causing a disruption in a gene, or a disruption between genes.


a. Disruption in a Gene


For the sake of this analysis, the tag was considered to be causing a disruption in a gene when the tag was located:


1) less than 501 upstream of the transcriptional start site;


2) less than 701 upstream of the translational initiation codon;


3) between the translational initiation and termination codons of the gene,


4) less than 301 downstream of the translational stop codon; or


5) less than 151 downstream of a transcriptional termination site.


By this definition, a tag can be inserted in two genes. For example, if two genes have only 700 nucleotides between the translational termination codon of one gene and the translational initiation codon of the other gene, the tag can be inserted into the terminator of one gene and the promoter of the other gene according to the definition above.


Genomic annotations by the method OCKHAM-OCDNA identify the transcriptional start and stop site of a gene.


b. Disruption Between Genes


When a tag causes a disruption between two genes, either or both genes can be affected. Typically, a tag can affect a gene if it disrupts the genome at a location 3000 nt downstream to the start codon of a gene. More typically, insertions found 1000-2000 nt upstream (5′), or 750-1000 nt downstream (3′) could be expected to disrupt expression.


c. More than One Insert


A plant can have multiple tags. If a mutant phenotype is observed, then it can be attributed to any one or all of the tags.


I.D. Brief Description of the Individual Tables


1. Reference and Sequence Tables

The sequences of exemplary SDFs and polypeptides corresponding to the coding sequences of the instant invention are described in the Reference and Sequence Tables (sometimes referred to as the REF and SEQ Tables. The Reference Table refers to a number of “Maximum Length Sequences” or “MLS.” Each MLS corresponds to the longest cDNA obtained, either by cloning or by the prediction from genomic sequence. The sequence of the MLS is the cDNA sequence as described in the Av subsection of the Reference Table.


The Reference Table includes the following information relating to each MLS:


I. cDNA Sequence

    • A. 5′ UTR
    • B. Coding Sequence
    • C. 3′ UTR


II. Genomic Sequence

    • A. Exons
    • B. Introns
    • C. Promoters


III. Link of cDNA Sequences to Clone IDs


IV. Multiple Transcription Start Sites


V. Polypeptide Sequences

    • A. Signal Peptide
    • B. Domains
    • C. Related Polypeptides


VI. Related Polynucleotide Sequences


I. cDNA Sequence


The Reference Table indicates which sequence in the Sequence Table represents the sequence of each MLS. The MLS sequence can comprise 5′ and 3′ UTR as well as coding sequences. In addition, specific cDNA clone numbers also are included in the Reference Table when the MLS sequence relates to a specific cDNA clone.


A. 5′ UTR


The location of the 5′ UTR can be determined by comparing the most 5′ MLS sequence with the corresponding genomic sequence as indicated in the Reference Table. The sequence that matches, beginning at any of the transcriptional start sites and ending at the last nucleotide before any of the translational start sites corresponds to the 5′ UTR.


B. Coding Region


The coding region is the sequence in any open reading frame found in the MLS. Coding regions of interest are indicated in the PolyP SEQ subsection of the Reference Table.


C. 3′ UTR


The location of the 3′ UTR can be determined by comparing the most 3′ MLS sequence with the corresponding genomic sequence as indicated in the Reference Table. The sequence that matches, beginning at the translational stop site and ending at the last nucleotide of the MLS corresponds to the 3′ UTR.


II. Genomic Sequence


Further, the Reference Table indicates the specific “gi” number of the genomic sequence if the sequence resides in a public databank. For each genomic sequence, Reference tables indicate which regions are included in the MLS. These regions can include the 5′ and 3′ UTRs as well as the coding sequence of the MLS. See, for example, the scheme below:


The Reference Table reports the first and last base of each region that are included in an MLS sequence. An example is shown below:


gi No. 47000:


37102 . . . 37497


37593 . . . 37925


The numbers indicate that the MLS contains the following sequences from two regions of gi No. 47000; a first region including bases 37102-37497, and a second region including bases 37593-37925.


A. Exon Sequences


The location of the exons can be determined by comparing the sequence of the regions from the genomic sequences with the corresponding MLS sequence as indicated by the Reference Table.


i. Initial Exon


To determine the location of the initial exon, information from the


(1) polypeptide sequence section;


(2) cDNA polynucleotide section; and


(3) the genomic sequence section


of the Reference Table is used. First, the polypeptide section will indicate where the translational start site is located in the MLS sequence. The MLS sequence can be matched to the genomic sequence that corresponds to the MLS. Based on the match between the MLS and corresponding genomic sequences, the location of the translational start site can be determined in one of the regions of the genomic sequence. The location of this translational start site is the start of the first exon.


Generally, the last base of the exon of the corresponding genomic region, in which the translational start site was located, will represent the end of the initial exon. In some cases, the initial exon will end with a stop codon, when the initial exon is the only exon.


In the case when sequences representing the MLS are in the positive strand of the corresponding genomic sequence, the last base will be a larger number than the first base. When the sequences representing the MLS are in the negative strand of the corresponding genomic sequence, then the last base will be a smaller number than the first base.


ii. Internal Exons


Except for the regions that comprise the 5′ and 3′ UTRs, initial exon, and terminal exon, the remaining genomic regions that match the MLS sequence are the internal exons. Specifically, the bases defining the boundaries of the remaining regions also define the intron/exon junctions of the internal exons.


iii. Terminal Exon


As with the initial exon, the location of the terminal exon is determined with information from the


(1) polypeptide sequence section;


(2) cDNA polynucleotide section; and


(3) the genomic sequence section


of the Reference Table. The polypeptide section will indicate where the stop codon is located in the MLS sequence. The MLS sequence can be matched to the corresponding genomic sequence. Based on the match between MLS and corresponding genomic sequences, the location of the stop codon can be determined in one of the regions of the genomic sequence. The location of this stop codon is the end of the terminal exon. Generally, the first base of the exon of the corresponding genomic region that matches the cDNA sequence, in which the stop codon was located, will represent the beginning of the terminal exon. In some cases, the translational start site will represent the start of the terminal exon, which will be the only exon.


In the case when the MLS sequences are in the positive strand of the corresponding genomic sequence, the last base will be a larger number than the first base. When the MLS sequences are in the negative strand of the corresponding genomic sequence, then the last base will be a smaller number than the first base.


B. Intron Sequences


In addition, the introns corresponding to the MLS are defined by identifying the genomic sequence located between the regions where the genomic sequence comprises exons. Thus, introns are defined as starting one base downstream of a genomic region comprising an exon, and end one base upstream from a genomic region comprising an exon.


C. Promoter Sequences


As indicated below, promoter sequences corresponding to the MLS are defined as sequences upstream of the first exon; more usually, as sequences upstream of the first of multiple transcription start sites; even more usually as sequences about 2,000 nucleotides upstream of the first of multiple transcription start sites.


III. Link of cDNA Sequences to Clone IDs


As noted above, the Reference Table identifies the cDNA clone(s) that relate to each MLS. The MLS sequence can be longer than the sequences included in the cDNA clones. In such a case, the Reference Table indicates the region of the MLS that is included in the clone. If either the 5′ or 3′ termini of the cDNA clone sequence is the same as the MLS sequence, no mention will be made.


IV. Multiple Transcription Start Sites


Initiation of transcription can occur at a number of sites of the gene. The Reference Table indicates the possible multiple transcription sites for each gene. In the Reference Table, the location of the transcription start sites can be either a positive or negative number.


The positions indicated by positive numbers refer to the transcription start sites as located in the MLS sequence. The negative numbers indicate the transcription start site within the genomic sequence that corresponds to the MLS.


To determine the location of the transcription start sites with the negative numbers, the MLS sequence is aligned with the corresponding genomic sequence. In the instances when a public genomic sequence is referenced, the relevant corresponding genomic sequence can be found by direct reference to the nucleotide sequence indicated by the “gi” number shown in the public genomic DNA section of the Reference Table. When the position is a negative number, the transcription start site is located in the corresponding genomic sequence upstream of the base that matches the beginning of the MLS sequence in the alignment. The negative number is relative to the first base of the MLS sequence which matches the genomic sequence corresponding to the relevant “gi” number.


In the instances when no public genomic DNA is referenced, the relevant nucleotide sequence for alignment is the nucleotide sequence associated with the amino acid sequence designated by “gi” number of the later PolyP SEQ subsection.


V. Polypeptide Sequences


The PolyP SEQ subsection lists SEQ ID NOs and Ceres SEQ ID NO for polypeptide sequences corresponding to the coding sequence of the MLS sequence and the location of the translational start site with the coding sequence of the MLS sequence.


The MLS sequence can have multiple translational start sites and can be capable of producing more than one polypeptide sequence.


A. Signal Peptide


The Reference tables also indicate in subsection (B) the cleavage site of the putative signal peptide of the polypeptide corresponding to the coding sequence of the MLS sequence. Typically, signal peptide coding sequences comprise a sequence encoding the first residue of the polypeptide to the cleavage site residue.


B. Domains


Subsection (C) provides information regarding identified domains (where present) within the polypeptide and (where present) a name for the polypeptide domain.


C. Related Polypeptides


Subsection (Dp) provides (where present) information concerning amino acid sequences that are found to be related and have some percentage of sequence identity to the polypeptide sequences of the Reference and Sequence Tables. These related sequences are identified by a “gi” number.


VI. Related Polynucleotide Sequences


Subsection (Dn) provides polynucleotide sequences (where present) that are related to and have some percentage of sequence identity to the MLS or corresponding genomic sequence.













Abbreviation
Description







Max Len. Seq.
Maximum Length Sequence


rel to
Related to


Clone Ids
Clone ID numbers


Pub gDNA
Public Genomic DNA


gi No.
gi number


Gen. Seq. in Cdna
Genomic Sequence in cDNA



(Each region for a single gene prediction



is listed on a separate line.



In the case of multiple gene predictions,



the group of regions relating to a single



prediction are separated by a blank line)


(Ac) cDNA SEQ
cDNA sequence


Pat. Appln. SEQ ID NO
Patent Application SEQ ID NO:


Ceres SEQ ID NO: 1673877
Ceres SEQ ID NO:


SEQ # w. TSS
Location within the cDNA sequence,



SEQ ID NO:, of Transcription Start Sites



which are listed below


Clone ID #: # -> #
Clone ID comprises bases # to # of the



cDNA Sequence


PolyP SEQ
Polypeptide Sequence


Pat. Appln. SEQ ID NO:
Patent Application SEQ ID NO:


Ceres SEQ ID NO
Ceres SEQ ID NO:


Loc. SEQ ID NO: @ nt.
Location of translational start site in



cDNA of SEQ ID NO: at nucleotide



number


(C) Pred. PP Nom. & Annot.
Nomination and Annotation of Domains



within Predicted Polypeptide(s)


(Title)
Name of Domain


Loc. SEQ ID NO #: # -> # aa.
Location of the domain within the



polypeptide of SEQ ID NO: from #



to # amino acid residues.


(Dp) Rel. AA SEQ
Related Amino Acid Sequences


Align. NO
Alignment number


gi No
Gi number


Desp.
Description


% Idnt.
Percent identity


Align. Len.
Alignment Length


Loc. SEQ ID NO: # -> # aa
Location within SEQ ID NO: from #



to # amino acid residue.









2. Protein Group Table

This table indicates groups of proteins that share a signature sequence (also referred to as a consensus sequence). The Protein group also referred to as the Ortholog group is named by the peptide ID with which all members were compared. Each group contains sequences that were included at the 10−50, 10−30, and 10−10 p-value cutoffs. For each group, the peptide ID and at which cutoff the peptide was included into the group. The same peptide ID may be included in the group three times as peptide ID 50, peptide ID 30 and peptide ID 10. The data indicates that peptide ID was included in the group when the threshold was either 10−50, 10−30, or 10−10. All the peptide IDs that are followed by “50” were included in the protein group when the e-value cutoff was 10−50. All the peptide IDs that are followed by either “30” or “50” were included in the protein group when the threshold e-value was 10−30. All the peptide IDs that are followed by “10”, “30” or “50” were included in the protein group when 10−10 was used as the e-value cutoff. At the end of each protein group is a list of the consensus sequence that proteins share at the 10−50, 10−30, or 10−10. The consensus sequence contains both lower-case and upper-case letters. The upper-case letters represent the standard one-letter amino acid abbreviations. The lower case letters represent classes of amino acids:

    • “t” refers to tiny amino acids, which are specifically alanine, glycine, serine and threonine.
    • “p” refers to polar amino acids, which are specifically, asparagine and glutamine
    • “n” refers to negatively charged amino acids, which are specifically, aspartic acid and glutamic acid
    • “+” refers to positively charged residues, which are specifically, lysine, arginine, and histidine
    • “r” refers to aromatic residues, which are specifically, phenylalanine, tyrosine, and tryptophan,
    • “a” refers to aliphatic residues, which are specifically, isoleucine, valine, leucine, and methonine


3. Protein Group Matrix Table

In addition to each consensus sequence, Applicants have generated a scoring matrix to provide further description of the consensus sequence. The first row of each matrix indicates the residue position in the consensus sequence. The matrix reports number of occurrences of all the amino acids that were found in the group members for every residue position of the signature sequence. The matrix also indicates for each residue position, how many different organisms were found to have a polypeptide in the group that included a residue at the relevant position. The last line of the matrix indicates all the amino acids that were found at each position of the consensus.


4. MA_DIFF TABLE

The MA_diff Table presents the results of the differential expression experiments for the mRNAs, as reported by their corresponding cDNA ID number, that were differentially transcribed under a particular set of conditions as compared to a control sample. The cDNA ID numbers correspond to those utilized in the Reference and Sequence Tables. Increases in mRNA abundance levels in experimental plants versus the controls are denoted with the plus sign (+). Likewise, reductions in mRNA abundance levels in the experimental plants are denoted with the minus (−) sign.


The Table is organized according to each set of experimental conditions, which are denoted by the term “Expt ID:” followed by a particular number. The table below links each Expt ID with a short description of the experiment and the parameters.


For each experiment ID a method of the normalization is specified. “Method: 2” represents normalization by median the goal of the method is to adjust the ratios by a factor so that the median of the ratio distribution is 1. Method 3 is the normalization procedure conducted by Aglilent Technologies, Inc. Palo Alto, Calif., USA.


The MA_diff Table also specifies the specific parameters and the experiment number (e.g. 107871) used in compiling the data. The experiment numbers are referenced in the appropriate utility/functions sections herein. The background threshold was set to “BKG_Threshold=X” to reduce the effect of the background on the signal.


Finally, the Table includes reference to an “Organism_ID” number. This number refers to the cDNA spotted on the chip were similar to Arabidopsis thaliana (3769) sequences or whether the oligo used for the chips were similar to Zea mays (311987) sequences.


5. MA_diff (Experiment) Table


The following Table summarizes the experimental procedures utilized for the differential expression experiments, each experiment being identified by a unique “Expt ID” number.


















Example
Experiment







No.
short name
genome
EXPT_ID
Value
PARAMETER
UNITS







3ii
3642-1
Arabidopsis
108512
3746-1
Plant Line
Hours


3n
Arab_0.001%_MeJA_1
Arabidopsis
108568
Aerial
Tissue
Tissue






0.001%_MeJA
Treatment
Compound






1
Timepoint
Hours


3n
Arab_0.001%_MeJA_1
Arabidopsis
108569
Aerial
Tissue
Tissue






6
Timepoint
Hours






0.001%_MeJA
Treatment
Compound


3j
Arab_0.1uM_Epi-Brass_1
Arabidopsis
108580
Aerial
Tissue
Tissue






1
Timepoint
Hours






0.1uM Brassino_Steroid
Treatment
Compound


3j
Arab_0.1uM_Epi-Brass_1
Arabidopsis
108581
Aerial
Tissue
Tissue






6
Timepoint
Hours






0.1uM_Brassino_ Steroid
Treatment
Compound


3g
Arab_100uM_ABA_1
Arabidopsis
108560
Aerial
Tissue
Tissue






1
Timepoint
Hours






100uM_ABA
Treatment
Compound


3g
Arab_100uM_ABA_1
Arabidopsis
108561
Aerial
Tissue
Tissue






100uM_ABA
Treatment
Compound






6
Timepoint
Hours


3I
Arab_100uM_ABA _1
Arabidopsis
108566
Aerial
Tissue
Tissue






1
Timepoint
Hours






100uM_BA
Treatment
Compound


3I
Arab_100uM_BA_1
Arabidopsis
108567
Aerial
Tissue
Tissue






100uM_BA
Treatment
Compound






6
Timepoint
Hours


3k
Arab_100uM_GA3_1
Arabidopsis
108562
Aerial
Tissue
Tissue






1
Timepoint
Hours






100uM GA3
Treatment
Compound


3k
Arab_100uM_GA3_1
Arabidopsis
108563
Aerial
Tissue
Tissue






100uM GA3
Treatment
Compound






6
Timepoint
Hours


3h
Arab_100uM_NAA_1
Arabidopsis
108564
Aerial
Tissue
Tissue






1
Timepoint
Hours






100um_NAA
Treatment
Compound


3h
Arab_100uM_NAA_1
Arabidopsis
108565
Aerial
Tissue
Tissue






100um_NAA
Treatment
Compound






6
Timepoint
Hours


3r
Arab_20%_PEG_1
Arabidopsis
108570
Aerial
Tissue
Tissue






1
Timepoint
Hours






20% PEG
Treatment
Compound


3r
Arab_20%_PEG_1
Arabidopsis
108571
Aerial
Tissue
Tissue






20% PEG
Treatment
Compound






6
Timepoint
Hours


3o
Arab_2mM_SA_1
Arabidopsis
108586
Aerial
Tissue
Tissue






2mM_SA
Treatment
Compound






1
Timepoint
Hours


3o
Arab_2mM_SA_1
Arabidopsis
108587
Aerial
Tissue
Tissue






6
Timepoint
Hours






2mM_SA
Treatment
Compound


3u
Arab_5mM_H2O2_1
Arabidopsis
108582
Aerial
Tissue
Tissue






1
Timepoint
Hours






5mM_H2O2
Treatment
Compound


3u
Arab_5mM_H2O2_1
Arabidopsis
108583
Aerial
Tissue
Tissue






5mM_H2O2
Treatment
Compound






6
Timepoint
Hours


3v
Arab_5mM_NaNP_1
Arabidopsis
108584
Aerial
Tissue
Tissue






1
Timepoint
Hours






5mM_NaNP
Treatment
Compound


3v
Arab_5mM_NaNP_1
Arabidopsis
108585
Aerial
Tissue
Tissue






5mM_NaNP
Treatment
Compound






6
Timepoint
Hours


3t
Arab_Cold_1
Arabidopsis
108578
Aerial
Tissue
Tissue






Cold
Treatment
Compound






1
Timepoint
Hours


3t
Arab_Cold_1
Arabidopsis
108579
Aerial
Tissue
Tissue






6
Timepoint
Hours






Cold
Treatment
Compound


3g
Arab_Drought_1
Arabidopsis
108572
Aerial
Tissue
Tissue






1
Timepoint
Hours






Drought
Treatment
Compound


3g
Arab_Drought_1
Arabidopsis
108573
Aerial
Tissue
Tissue






Drought
Treatment
Compound






6
Timepoint
Hours


3s
Arab_Heat_1
Arabidopsis
108576
Aerial
Tissue
Tissue






1
Timepoint
Hours






Heat (42 deg C.)
Treatment
Compound


3s
Arab_Heat_1
Arabidopsis
108577
Aerial
Tissue
Tissue






Heat (42 deg C.)
Treatment
Compound






6
Timepoint
Hours


3aa (ovule)
Arab_Lerpi_ovule_1
Arabidopsis
108595
Ler_pi
Plant Line
Hours






Ovule
Tissue
Tissue


3b
Arab _Lerrhl_root_1
Arabidopsis
108594
Ler_rhl
Plant Line
Hours






Root
Tissue
Tissue


3l
Arab_NO3_H-to-L_1
Arabidopsis
108592
Aerial
Tissue
Tissue






Low Nitrogen
Treatment
Compound






12
Timepoint
Hours


3l
Arab_NO3_H-to-L_1
Arabidopsis
108593
Aerial
Tissue
Tissue






24
Timepoint
Hours






Low Nitrogen
Treatment
Compound


3l
Arab_NO3_L-to-H_1
Arabidopsis
108588
Aerial
Tissue
Tissue






2
Timepoint
Hours






Nitrogen
Treatment
Compound


3l
Arab_NO3_L-to-H_1
Arabidopsis
108589
Aerial
Tissue
Tissue






Nitrogen
Treatment
Compound






6
Timepoint
Hours


3l
Arab_NO3_L-to-H_1
Arabidopsis
108590
Aerial
Tissue
Tissue






9
Timepoint
Hours






Nitrogen
Treatment
Compound


3l
Arab_NO3_L-to-H_1
Arabidopsis
108591
Aerial
Tissue
Tissue






Nitrogen
Treatment
Compound






12
Timepoint
Hours


3p
Arab_Wounding_1
Arabidopsis
108574
Aerial
Tissue
Tissue






1
Timepoint
Hours






Wounding
Treatment
Compound


3p
Arab_Wounding_1
Arabidopsis
108575
Aerial
Tissue
Tissue






Wounding
Treatment
Compound






6
Timepoint
Hours


3o
Columbia/CS37
Arabidopsis
108475
Columbia
species
Hours



26 flower SA


SA
Treatment
Compound






5 weeks
Timepoint
Hours


3o
Columbia/CS37
Arabidopsis
108476
CS3726
species
Hours



26 flower SA


5 weeks
Timepoint
Hours






SA
Treatment
Compound


3p
Corn_0.001Percent_MeJA

Zea Mays

108555
Aerial
Tissue
Tissue






24
Timepoint
Hours






0.001%_MeJA
Treatment
Compound


3j
Corn_0.1uM_Brassino_Steroid

Zea Mays

108557
24
Timepoint
Hours






Aerial
Tissue
Tissue






0.1uM_Brassino_Steroid
Treatment
Compound


3g
Corn_100uM_ABA

Zea Mays

108513
Aerial
Tissue
Tissue






ABA
Treatment
Compound






6
Timepoint
Hours


3g
Corn_100uM_ABA

Zea Mays

108597
Aerial
Tissue
Tissue






24
Timepoint
Hours






100uM_ABA
Treatment
Compound


3i
Corn_100uM_BA

Zea Mays

108517
Aerial
Tissue
Tissue






6
Timepoint
Hours






BA
Treatment
Compound


3k
Corn_100uM_GA3

Zea Mays

108519
Aerial
Tissue
Tissue






100uM Giberillic Acid
Treatment
Compound






1
Timepoint
Hours


3k
Corn_100uM_GA3

Zea Mays

108520
Aerial
Tissue
Tissue






6
Timepoint
Hours






100uM Giberillic Acid
Treatment
Compound


3k
Corn_100uM_GA3

Zea Mays

108521
Aerial
Tissue
Tissue






100uM Giberillic Acid
Treatment
Compound






12
Timepoint
Hours


3h
Corn_100uM_NAA

Zea Mays

108516
Aerial
Tissue
Tissue






NAA
Treatment
Compound






6
Timepoint
Hours


3h
Corn_100uM_NAA

Zea Mays

108554
Aerial
Tissue
Tissue






24
Timepoint
Hours






NAA
Treatment
Compound


3hh
Corn_1400-6/S-17

Zea Mays

108598
Shoot apices
Tissue
Tissue


3r
Corn_150mM_NaCl

Zea Mays

108541
Aerial
Tissue
Tissue






1
Timepoint
Hours






150mM_NaCl
Treatment
Compound


3r
Corn_150mM_NaCl

Zea Mays

108542
Aerial
Tissue
Tissue






150mM_NaCl
Treatment
Compound






6
Timepoint
Hours


3r
Corn_150mM_NaCl

Zea Mays

108553
Aerial
Tissue
Tissue






24
Timepoint
Hours






150mM_NaCl
Treatment
Compound


3r
Corn_20%_PEG

Zea Mays

108539
Aerial
Tissue
Tissue






1
Timepoint
Hours






20%PEG
Treatment
Compound


3r
Corn_20%_PEG

Zea Mays

108540
Aerial
Tissue
Tissue






20%PEG
Treatment
Compound






6
Timepoint
Hours


3o
Corn_2mM_SA

Zea Mays

108515
Aerial
Tissue
Tissue






SA
Treatment
Compound






12
Timepoint
Hours


3o
Corn_2mM_SA
Zea Mays
108552
Aerial
Tissue
Tissue






SA
Treatment
Compound






24
Timepoint
Hours


3u
Corn_5mM_H2O2

Zea Mays

108537
Aerial
Tissue
Tissue






H2O2
Treatment
Compound






1
Timepoint
Hours


3u
Corn_5mM_H2O2

Zea Mays

108538
Aerial
Tissue
Tissue






6
Timepoint
Hours






H2O2
Treatment
Compound


3u
Corn_5mM_H2O2

Zea Mays

108558
Aerial
Tissue
Tissue






24
Timepoint
Hours






H2O2
Treatment
Compound


3v
Corn_5mM_NO

Zea Mays

108526
Aerial
Tissue
Tissue






NO
Treatment
Compound






1
Timepoint
Hours


3v
Corn_5mM_H2O2

Zea Mays

108527
Aerial
Tissue
Tissue






6
Timepoint
Hours






NO
Treatment
Compound


3v
Corn_5mM_H2O2

Zea Mays

108559
Aerial
Tissue
Tissue






12
Timepoint
Hours






NO
Treatment
Compound


3t
Corn_Cold

Zea Mays

108533
Aerial
Tissue
Tissue






1
Timepoint
Hours






Cold
Treatment
Compound


3t
Corn_Cold

Zea Mays

108534
Aerial
Tissue
Tissue






Cold
Treatment
Compound






6
Timepoint
Hours


3q
Corn_Drought

Zea Mays

108502
Drought
Treatment
Compound






1
Timepoint
Hours


3q
Corn_Drought

Zea Mays

108503
Drought
Treatment
Compound






6
Timepoint
Hours


3q
Corn_Drought

Zea Mays

108504
Drought
Treatment
Compound






12
Timepoint
Hours


3q
Corn_Drought

Zea Mays

108556
Drought
Treatment
Compound






24
Timepoint
Hours


3s
Corn_Heat

Zea Mays

108522
Aerial
Tissue
Tissue






1
Timepoint
Hours






Heat (42 deg C.)
Treatment
Compound


3s
Corn_Heat

Zea Mays

108523
Aerial
Tissue
Tissue






6
Timepoint
Hours






Heat (42 deg C.)
Treatment
Compound


3gg
Corn_ImbibedSeeds

Zea Mays

108518
Imbibed
Treatment
Compound






4
Age
days old






Roots
Tissue
Tissue


3gg
Corn_ImbibedSeeds

Zea Mays

108528
Imbibed
Treatment
Compound






Aerial
Tissue
Tissue






5
Age
days old


3gg
Corn_ImbibedSeeds

Zea Mays

108529
Imbibed
Treatment
Compound






5
Age
days old






Root
Tissue
Tissue


3gg
Corn_ImbibedSeeds

Zea Mays

108530
Imbibed
Treatment
Compound






Aerial
Tissue
Tissue






6
Age
days old


3gg
Corn_ImbibedSeeds

Zea Mays

108531
Imbibed
Treatment
Compound






6
Age
days old






root
Tissue
Tissue


3gg
Corn_ImbibedSeeds

Zea Mays

108545
Imbibed
Treatment
Compound






Aerial
Tissue
Tissue






3
Age
days old


3gg
Corn_ImbibedSeeds

Zea Mays

108546
Imbibed
Treatment
Compound






3
Age
days old






Root
Tissue
Tissue


3gg
Corn_ImbibedSeeds

Zea Mays

108547
Imbibed
Treatment
Compound






Aerial
Tissue
Tissue






4
Age
days old


3gg
Corn_Imbibed_Embryo_Endosperm

Zea Mays

108543
2
Age
days old






Imbibed
Treatment
Compound






Embryo
Tissue
Tissue


3gg
Corn_Imbibed_Embryo_Endosperm

Zea Mays

108544
2
Age
days old






Endosperm
Tissue
Tissue






Imbibed
Treatment
Compound


3ee
Corn_Meristem

Zea Mays

108535
Root Meristem
Tissue
Tissue






192
Timepoint
Hours


3ee
Corn_Meristem

Zea Mays

108536
Shoot Meristem
Tissue
Tissue






192
Timepoint
Hours


3n
Corn_Nitrogen_H_to_L

Zea Mays

108532
Roots
Tissue
Tissue






Low Nitrogen
Treatment
Compound






16
Timepoint
Hours


3n
Corn_Nitrogen_H_to_L

Zea Mays

108548
Root
Tissue
Tissue






Low Nitrogen
Treatment
Compound






4
Timepoint
Hours


3m
Corn_Nitrogen_L_to_H

Zea Mays

108549
Aerial
Tissue
Tissue






0.166
Timepoint
Hours






Nitrogen
Treatment
Compound


3m
Corn_Nitrogen_L_to_H

Zea Mays

108550
Aerial
Tissue
Tissue






Nitrogen
Treatment
Compound






1.5
Timepoint
Hours


3m
Corn_Nitrogen_L_to_H

Zea Mays

108551
Aerial
Tissue
Tissue






3
Timepoint
Hours






Nitrogen
Treatment
Compound


3ff
Corn_RT1

Zea Mays

108599
Unknown
Plant Line
Hours






Root
Tissue
Tissue


3p
Corn_Wounding

Zea Mays

108524
Aerial
Tissue
Tissue






Wounding
Treatment
Compound






1
Timepoint
Hours


3p
Corn_Wounding

Zea Mays

108525
Aerial
Tissue
Tissue






6
Timepoint
Hours






Wounding
Treatment
Compound


3g
Drought_Flowers
Arabidopsis
108473
Flowers
Tissue
Tissue






7 d
Timepoint
Hours






Drought
Treatment
Compound


3g
Drought_Flowers
Arabidopsis
108474
Flowers
Tissue
Tissue






Drought
Treatment
Compound






8 d (1d-post_re-
Timepoint
Hours






watering)




3k
GA Treated
Arabidopsis
108484
1
Timepoint
Hours






1
Timepoint
Hours


3k
GA Treated
Arabidopsis
108485
6
Timepoint
Hours






6
Timepoint
Hours


3k
GA Treated
Arabidopsis
108486
12
Timepoint
Hours






12
Timepoint
Hours


3e
Germinating Seeds
Arabidopsis
108461
Day 1
Timepoint
Hours


3e
Germinating Seeds
Arabidopsis
108462
Day 2
Timepoint
Hours


3e
Germinating Seeds
Arabidopsis
108463
Day 3
Timepoint
Hours


3e
Germinating Seeds
Arabidopsis
108464
Day 4
Timepoint
Hours


3bb
Herbicide V3.1
Arabidopsis
108465
Round up
Treatment
Compound






12
Timepoint
Hours


3bb
Herbicide V3.1
Arabidopsis
108466
Trimec
Treatment
Compound






12
Timepoint
Hours


3bb
Herbicide V3.1
Arabidopsis
108467
Finale
Treatment
Compound






12
Timepoint
Hours


3bb
Herbicide V3.1
Arabidopsis
108468
Glean
Treatment
Compound






12
Timepoint
Hours


3bb
Herbicide_v2
Arabidopsis
107871
Finale
Treatment
Compound






4
Timepoint
Hours


3bb
Herbicide_v2
Arabidopsis
107876
Finale
Treatment
Compound






12
Timepoint
Hours


3bb
Herbicide_v2
Arabidopsis
107881
Glean
Treatment
Compound






4
Timepoint
Hours


3bb
Herbicide_v2
Arabidopsis
107886
Trimec
Treatment
Compound






4
Timepoint
Hours


3bb
Herbicide_v2
Arabidopsis
107891
Trimec
Treatment
Compound






12
Timepoint
Hours


3bb
Herbicide_v2
Arabidopsis
107896
Round-up
Treatment
Compound






4
Timepoint
Hours


3d
Trichome
Arabidopsis
108452
Hairy
Tissue
Tissue



Inflorescences expt


Influorescence #1




3o
SA treatment_1 hour
Arabidopsis
108471
Columbia
Species
Hours






1
Timepoint
Hours






SA
Treatment
Compound


3o
SA treatment_1 hour
Arabidopsis
108472
CS3726
Species
Hours






1
Timepoint
Hours






SA
Treatment
Compound


3o
SA treatment_4 hour
Arabidopsis
108469
columbia
Species
Hours






4
Timepoint
Hours






SA
Treatment
Compound


3o
SA treatment_4 hour
Arabidopsis
108470
CS3726
Species
Hours






SA
Treatment
Compound






4
Timepoint
Hours


3o
SA treatment_AJ
Arabidopsis
107953
50
Probe
% of







Amount
Standard








Amount






SA
Treatment
Compound






24
Timepoint
Hours






Clontech
Probe Type
Probe








method


3o
SA treatment_AJ
Arabidopsis
107960
50
Probe
% of







Amount
Standard








Amount






SA
Treatment
Compound






24
Timepoint
Hours






Operon
Probe Type
Probe








method


3o
SA_treatment 24 hour
Arabidopsis
108443
SA
Treatment
Compound






24
Timepoint
Hours


3o
SA_treatment 6 hour
Arabidopsis
108440
SA treatment 6 hour
Treatment
Compound






CS3726
species
Hours


3o
SA_treatment 6 hour
Arabidopsis
108441
SA treatment 6 hour
Treatment
Compound






Columbia
species
Hours














3l
Nitrogen High transition to Low
Arabidopsis
108454
10
min
Timepoint
Hours


3l
Nitrogen High transition to Low
Arabidopsis
108455
1
hr
Timepoint
Hours













3j
BR_Shoot Apices Expt
Arabidopsis
108478
dwf4-1
Plant Line
Hours


3j
BR_Shoot Apices Expt
Arabidopsis
108479
AOD4-4
Plant Line
Hours


3j
BR_Shoot Apices Expt
Arabidopsis
108480
Ws-2
Plant Line
Hours






BL
Treatment
Compound


3j
BR_Shoot Apices Expt
Arabidopsis
108481
Ws-2
Plant Line
Hours






BRZ
Treatment
Compound


3jj
Tissue Specific Expression
Arabidopsis
108429
green flower
Tissue
Tissue






operon
Probe
Probe







Type
method






50
Probe
% of







Amount
Standard








Amount


3jj
Tissue Specific Expression
Arabidopsis
108430
white flower
Tissue
Tissue






50
Probe
% of







Amount
Standard








Amount






operon
Probe
Probe







Type
method


3jj
Tissue Specific Expression
Arabidopsis
108431
flowers (bud)
Tissue
Tissue






operon
Probe
Probe







Type
method






50
Probe
% of







Amount
Standard








Amount


3c
Tissue Specific Expression
Arabidopsis
108436
5-10 mm siliques
Tissue
Tissue






33
Probe
% of







Amount
Standard








Amount






operon
Probe
Probe







Type
method


3c
Tissue Specific Expression
Arabidopsis
108437
<5mm siliques
Tissue
Tissue






operon
Probe
Probe







Type
method






33
Probe
% of







Amount
Standard








Amount


3c
Tissue Specific Expression
Arabidopsis
108438
5wk siliques
Tissue
Tissue






33
Probe
% of







Amount
Standard








Amount






operon
Probe
Probe







Type
method


3a
Tissue Specific Expression
Arabidopsis
108439
Roots (2wk)
Tissue
Tissue






operon
Probe
Probe







Type
method






33
Probe
% of







Amount
Standard








Amount


3c
Tissue Specific Expression
Arabidopsis
108497
3 week Rossette leaves
Tissue
Tissue






100
Probe
% of







Amount
Standard








Amount






operon
Probe
Probe







Type
method


3c
Tissue Specific Expression
Arabidopsis
108498
3-week stems
Tissue
Tissue






operon
Probe
Probe







Type
method






100
Probe
% of







Amount
Standard








Amount


3dd
U.A.E. Knockout
Arabidopsis
108451
13B12
Plant Line
Hours


3q
Ws Arabidopsis Drought 2 days
Arabidopsis
108477
stems and leaves
Tissue
Tissue


















2
days
Timepoint
Hours


3q
Ws Arabidopsis Drought 4 days
Arabidopsis
108482
4
days
Timepoint
Hours


3q
Ws Arabidopsis Drought 6 days
Arabidopsis
108483
6
days
Timepoint
Hours













3cc
ap2-floral buds
Arabidopsis
108501
ap2 (Ler.)
Plant Line
Hours






floral buds
Tissue
Tissue


3m
nitrogen-seed set
Arabidopsis
108487
0.5
Timepoint
Hours


3m
nitrogen-seed set
Arabidopsis
108488
2
Timepoint
Hours


3m
nitrogen-seed set
Arabidopsis
108489
4
Timepoint
Hours


3b
rhl mutant2
Arabidopsis
108433
mutant
Tissue
Tissue


3ee
root tips
Arabidopsis
108434
root tips
Tissue
Tissue


3f
stm mutants
Arabidopsis
108435
stem
Tissue
Tissue



Aluminum

SMD 7304,








SMD 7305






Axel

SMD 6654,








SMD 6655






Cadium

SMD 7427,








SMD 7428






Cauliflower

SMD 5329,








SMD 5330






Chloroplast

SMD 8093,








SMD 8094






Circadian

SMD 2344,








SMD 2359,








SMD 2361,








SMD 2362,








SMD 2363,








SMD 2364,








SMD 2365,








SMD 2366,








SMD 2367,








SMD 2368,








SMD 3242






CO2

SMD 7561,








SMD 7562,








SMD 7261,








SMD 7263,








SMD 3710,








SMD 4649,








SMD 4650






Disease

SMD 7342,








SMD 7343






reactive oxygen

SMD 7523






Iron

SMD 7114,








SMD 7115,








SMD 7125






defense

SMD 8031,








SMD 8032






Mitchondria-Electron Transport

SMD 8061,








SMD 8063






NAA

SMD 3743,








SMD 3749,








SMD 6338,








SMD 6339






Nitrogen

SMD 3787,








SMD 3789






Phototropism

SMD 4188,








SMD 6617,








SMD 6619






Shade

SMD 8130,








SMD 7230






Sqn

SMD 7133,








SMD 7137






Sulfur

SMD 8034,








SMD 8035






Wounding

SMD 3714,








SMD 3715






Zinc

SMD 7310,








SMD 7311












6. MA Clusters Table

Microarray data was clustered using one of two methods: “complete linkage” or “nearest neighbor” analysis. These clustering methods are described in more detail elsewhere herein. The results of the clustering analysis are presented in the MA_clust table. The table is organized as follows:


“METHOD” refers to a method number which clustering method used. “CL_METHOD_TYPE=TRUE” refers to complete linkage method. “NN_METHOD_TYPE=TRUE” refers to the nearest neighbor method. “FULL_NN_METHOD_TYPE=TRUE” refers to the nearest neighbor method, where no size limitation was placed on the cluster.


“PARAMETERS” refers to the parameters utilized for the analysis. The nature of these is also described in more detail elsewhere herein.


“ORGANISM” refers to the cDNA spotted on the chip were similar to Arabidopsis thaliana (3769) sequences or whether the oligo used for the chips were similar to Zea mays (311987) sequences.


Each cluster or group of cDNA is identified by a “Group #”, following which are the individual cDNA_Ids that are a member of that Group 7. Knock-in Table


The Knock-In Table presents the results of knock-in experiments wherein plants are grown from tissues transformed with a marker gene-containing insert and phenotypes are ascertained from the transformed plants. Each section of the Table relating to information on a new transformant begins with a heading “Knock-in phenotype in gene (cDNA_id):” followed by a number which represents the Ceres internal code for a proprietary cDNA sequence. The described transformant was prepared by procedures described herein, wherein the identified Ceres proprietary cDNA_id (corresponding to the cDNA_id in the Reference and Sequence Tables) was interrupted by the marker gene-containing insert. The following information is presented for each section.

    • Parent plants used in cross—presents the id numbers of the parent plants which were crossed to produce the F1 generation plant for which a phenotype is described. The parent plant with the promoter is described by a plant line descriptor.
    • Clone ID—presents the clone number of the Ceres proprietary clone which was the source of the cDNA_id.
    • Phenotype ID—represents an internal identification code.
    • Unique FI plant ID—represents the internal code for the F1 plant for which a phenotype is described.
    • Assay—presents the type of growth analyzed (e.g. soil gross morphology), followed by the assay name which corresponds to the type/location of the tissue that was observed, the name of the assay conducted for which the result provided the identified phenotype.
    • Phenotype—describes the phenotype noted for the F1 generation transformant.
    • Notes—may provide additional information on the described phenotype for the transformant.


Each knock-in representing a transformant with an interruption in the identified cDNA_id may be correlated with more than one identified phenotype.


8. Knock-Out Table

The Knock-Out Table presents the results of knock-out experiments wherein plants are grown from tissues transformed with a marker gene-containing insert wherein phenotypes are ascertained from the transformed plants. Each section of the Table relating to information on a new transformant begins with a heading “tail id:” representing an internal code. The following information is presented for each section.

    • br—provides another internal code for the experiment.
    • Phenotype_id—provides an identification number for the particular phenotype identified for the transformant.
    • assay—identifies the assay procedure utilized in the experiment to identify a phenotype for the transformant.
    • phenotype—represents an internal identification code.
    • ratio—represents a segregation ratio.
    • notes—lists any notes relevant to the identified phenotype.
    • Knock-out in-genes—Identifies the genes in which the tag has inserted
      • 6) the less than 501 upstream of the transcriptional start site;
      • 7) less than 701 upstream of the translational initiation codon;
      • 8) between the translational initiation and termination codons of the gene,
      • 9) less than 301 downstream of the translational stop codon; or
      • 10) less than 151 downstream of a transcriptional termination site or a gene.
    • In this table the gene is identified by its cDNA ID number, the Ceres SEQ ID that is indicated in the (Ac) portion of the Reference tables. For each cDNA_id, the following information is provided:
      • the cDNA_id number.
      • in parenthesis, the cluster number of which the identified cDNA is a member.
      • the “gDNA_Insert pos” representing the position of the insert in the corresponding gDNA sequence
      • the gi number refers to the TIGR chromosome sequences for Arabidopsis.
    • Knock-out out of-genes: Identifies the Ceres cDNA proprietary sequences (noted by cDNA_id which are the same as those identified in the Reference and Sequence Tables) which are closest in position to the insert, both upstream and downstream from the insert. For each cDNA_id, the following information is provided:
      • In the first parentheses, R indicates that the gene is to the right of the tag, L indicates that the gene is to right of the tag as the sequences is read left to right
      • the cDNA_id number
      • in next parentheses, the cluster number of which the identified cDNA is a member.
      • the distance (in number of nucleotides) of the insert is upstream of the start of the gene annotation as described in the Reference Tables or downstream at the end the gene annotation.
      • the “gDNA_Insert pos” representing the position of the insert in the corresponding gDNA sequence
      • the gi number refers to the TIGR chromosome sequences for Arabidopsis.


9. Protein Domain Table

The Protein Domain table provides details concerning the protein domains noted in the Reference Table. The majority of the protein domain descriptions given in the Protein Domain Table are obtained from Prosite, (http//www.expasy.ch/prosite/), and Pfam, (http//pfam.wustl.edu/browse.shtml). Each description in The Table begins with the pfam and Prosite identifying numbers, the full name of the domain, and a detailed description, including biological and in vivo implications/functions for the domain, references which further describe such implications/functions, and references that describe tests/assays to measure the implications/functions.


10. Single Gene Functions & Utilities Table

The Single Gene Functions & Utilities Table describes particular utilities/functions of interest for individual genes. The Table identifies the cDNA_ID of interest, correlates to that cDNA the relevant phenotype, protein domain and microarray/differential expression data. The final column of the Table identifies the utilities/functions of particular interest for the identified cDNA.


11. Cluster Functions & Utilities Table

The Cluster Functions & Utilities Table describes particular utilities/functions of interest for identified clusters of genes. The Table provides the following information:


Record #—an internal identifier.


Group—identifies the group of clusters of interest, wherein each group is identified with the same utilities/functions as set forth in the right-hand most column.


CDNA—identifies the cDNA of interest with the noted utility/function.


CDNA_Cluster—identifies the cDNA Cluster ID of interest.


Gi No—refers to the public genomic sequence that matches to the cDNA


NR Hit—refers to the most relevant protein domain for the cDNA of interest.


Pfam and Pfam Desc—provide the protein domain name.


Notes/Annotations—provides some notes relevant to the data/information analysis.


Utilities/Functions—this rightmost column identifies utilities/functions of particular interest for the group of cDNAs and clusters.


12. cDNA_Clusters Table


The cDNA_Clusters Table correlates the Ceres cDNA_ID nos. (in numerical order) with the relevant cDNA cluster which contains each cDNA_ID.


13. Stanford_Old_New_cDNA_Map Table


During the course of the experiments reported herein, some of the cDNA sequences were assigned new Ceres internal cDNA_id numbers. The cDNA_map Table provides a list of the original “old” cDNA_ids and correlates those id numbers with any new cDNA_id which may have been assigned. Thus, any “old” and “new” cDNA ids which are on the same line in the Table are, in fact, the same sequence.


14. gb Only Peptides Table

In the Protein Group table, a number of proteins encoded by Genbank predictions are included. These proteins were referenced with a peptide ID number. The peptide ID number is linked to the amino acid sequence of the Genbank prediction in this table.


15. Stanford_Old_New_cDNA Table


During the course of the experiments reported herein, some of the cDNA sequences utilized in the Stanford Microarray differential expression analysis experiments were assigned new Ceres internal cDNA_id numbers. The Stanford_old_new_cDNA Table provides a list of the original “old” cDNA_ids and correlates those id numbers with any new cDNA_id which may have been assigned. Thus, any “old” and “new” cDNA ids which are on the same line in the Table are, in fact, the same sequence.


16. Enhanced Amino Table

This table lists the peptide IDs of polypeptides with enhanced amino acid content. The table list the peptide ID following with the single letter code of the amino acid that is enhanced. The table also includes a frequency that the amino acid occurred. The frequency was calculated by dividing the total number of the desired amino acid indicated in the column by the number of residues in the peptide. For example, if amino acid A, occurred 50 times in a polypeptide that is 100 amino acid long, the frequency would be 50 divided by 100 or 0.5.


17. Stanford_Old_New_cDNA_Map Table


During the course of the experiments reported herein, some of the cDNA sequences were assigned new Ceres internal cDNA_id numbers. The docket_80090_101_cDNA_map provides a list of the original “old” cDNA_ids in the Reference and Sequence tables and correlates those id numbers with any new cDNA_id which may have been assigned and utilized in the remaining tables. Thus, any “old” and “new” cDNA ids which are on the same line in the Table are, in fact, the same sequence.


II. How the Inventions Reveal how Genes, Gene Components and Products Function

The different experimental molecular genetic approaches focused on different aspects of genes, gene components, and gene products of the inventions. The variety of the data demonstrates the multiple functions and characteristics of single genes, gene components, and products. The data also explain the pathways and networks in which individual genes and products participate and interact. As a result, the circumstances or conditions are now known when these genes and networks are active. These new understandings of biology are relevant for many plant species. The following section describes the process by which Applicants analyzed the inventions generated by the Ceres Genomic Engine:


II.A. Experimental Results Reveal Many Facets of a Single Gene


The experimental results are used to dissect the function of individual components and products of the genes. For example, the biochemical activity of the encoded protein could be surmised from sequence analyses, and promoter specificity could be identified through transcriptional analyses. Generally, the data presented herein can be used to functionally annotate either the protein sequence and/or the regulatory sequence that control transcription and translation.


II.A.1. Functions of Coding Sequences Revealed by the Ceres Genomic Engine


II.A.1.a. Sequence Similarity to Proteins of Known Function can be Used to Associate Biochemical Activities and Molecular Interaction to the Proteins of the Invention


The protein sequences of the invention were analyzed to determine if they shared any sequence characteristics with proteins of known activity. Proteins can be grouped together based on sequence similarity, either localized or throughout the length of the proteins. Typically, such groups of proteins exhibit common biochemical activities or interact with similar molecules.


II.A.1.a.1. Presence of Amino Acid Motifs Indicates Biological Function


Localized protein sequence similarity, also referred to as amino acid motifs, have been attributed to enzyme or protein functions. A library of motifs, important for function, have been documented in PROSITE, a public database available at http://www.expasy.ch/prosite/. This library includes descriptions of the motifs and their functions. The zinc finger motif is one such entry in PROSITE, which reports that the zinc finger domain of DNA-binding proteins is typically defined by a 25-30 amino acid motif containing specific cysteine or histidine residues that are involved in the tetrahedral coordination of a zinc ion. Any protein comprising a sequence similar to the zinc finger amino acid motif will have similar functional activity (specific binding of DNA).


Protein sequences of the invention have been compared to a library of amino acid motifs in the pFAM database, which is linked to the PROSITE database. If any of Applicants' protein sequences exhibit similarity to these amino acid motifs or domains, the Reference Table notes the name and location of the motif in the “Pred. PP Nom. & Annot” section of the Reference tables. A description of any biochemical activities that are associated to these domains, and therefore associated with Applicants' proteins, is included in the Protein Domain table.


For example, polypeptide, CERES Sequence ID NO: 1545823 is associated with zinc finger motif as follows in the Reference Table:


(C) Pred. PP Nom. & Annot.

    • Zinc finger, C3HC4 type (RING finger)
    • Loc. Sequence ID NO 133059: 58->106 aa.


II.A.1.a.2. Related Amino Acid Sequences Share Similar Biological Functions


It is apparent, when studying protein sequence families, that some regions have been better conserved than others during evolution. These regions are generally important for the function of a protein and/or for the maintenance of its three-dimensional structure.


The Reference Table reports in section “(Dp) Rel. AA Sequence” when a protein shares amino acid similarity with a protein of known activity. The section reports the gi number of the protein of known activity, a brief description of the activity, and the location where it shares sequence similarity to Applicants' polypeptide sequence.


Using this analysis, biochemical activity of the known protein is associated with Applicants' proteins. An example for the polypeptide described above is as follows:


(Dp) Rel. AA Sequence

    • Align. NO 524716
    • gi No 2502079
    • Desp.: (AF022391) immediate early protein; ICP0 [Feline herpesvirus 1]
    • % Idnt.: 33.7
    • Align. Len.: 87
    • Loc. Sequence ID NO 133059: 52->137 aa.


II.A.1.b. Differential Expression Results Explain in which Cellular Responses the Proteins of the Invention are Involved


Differential expression results show when the coding sequence is transcribed, and therefore when the activity of the protein is deployed by the cell. Similar coding sequences can have very different physiological consequences because the sequences are expressed at different times or places, rather than because of any differences in protein activity. Therefore, modified levels (increased or decreased) of expression as compared to a control provide an indication of the function of a corresponding gene, gene components, and gene products.


These experiments can determine which are genes “over-expressed” under a given stimulus. Such over-expressed genes give rise to higher transcript levels in a plant or cell that is stimulated as compared to the transcript levels of the same genes in a control organism or cell. Similarly, differential expression experiments can reveal “under-expressed” genes.


To increase the cellular response to a stimulus, additional copies of the coding sequences of a gene that is over-expressed are inserted into a cell. Increasing transcript levels of an over-expressed gene can either heighten or prolong the particular cellular response. A similar enhancement can occur when transcription of an under-expressed gene is inhibited. In contrast, the cellular response will be shortened or less severe when the over-expressed genes are inhibited or when expression of the under-expressed genes are increased.


In addition to analyzing the levels of transcription, the data were also analyzed to gain insight into the changes in transcription over time. That is, while the plants in the experiments were reacting to either an external or internal stimulus, a differential experiment takes a snapshot of the transcription levels in the cells at one specific time. However, a number of snap-shots can be taken at different time points during an external stimulus regime, or at different stages of development during an internal stimulus. These results show how the plant changes transcription levels over time, and therefore protein levels in response to specific stimuli to produce phenotypic changes. These results show that a protein can be implicated in a single, but more likely, in a number of cellular responses.


II.A.1.b.1. The Transcript Levels of a Protein Over Time in Response to a Stimuli are Revealed by Transcriptional Analyses Over Many Experiments


Applicants produced data from plants at different times after a specific stimulus. These results show whether the expression level of a gene spikes at a key moment during the cellular response, or whether the transcript level remains constant. Thus, coding sequences not only can be determined to be over- or under-expressed, but also can be classified by the initial timing and duration of differential expression. This understanding of timing can be used to increase or decrease any desired cellular response.


Generally, Applicants have assayed plants at 2 to 4 different time points after exposing the plants to the desired stimuli. From these experiments, “early” and “late” responders were identified. These labels are applied to either the regulatory sequences driving transcription of the gene as well as to the protein encoded by the gene.


The following example illustrates how the genes, gene components and products were classified as either early or late responders following a specific. The mRNAs from plants exposed to drought conditions were isolated 1 hour and 6 hours after exposure to drought conditions. These mRNAs were tested utilizing microarray techniques.


Data acquired from this type of time course experiment are useful to understand how one may increase or decrease the speed of the cellular response. Inserting into a cell extra copies of the coding sequence of early responders in order to over-express the specific gene can trigger a faster cellular response. Alternatively, coding sequences of late responders that are over-expressed can be placed under the control of promoters of early responders as another means to increase the cellular response.


Inserting anti-sense or sense mRNA suppression constructs of the early responders that are over-expressed can retard action of the late responders, thereby delaying the desired cellular response. In another embodiment, extra copies of the promoters of both early and late responders can be added to inhibit expression of both types of over-expressed genes.


The experiments described herein can be grouped together to determine the time course of the transcript levels of different coding sequences in response to different stimuli. Examples of different groups are as follows (the examples include the IDs for both corn and Arabidopsis experiments):

    • NAA (EXPT IDs 108564, 108565, 108516, 108554)
    • BA (EXPT IDs 108566, 108567, 108517)
    • GA (EXPT IDs 108562, 108563, 108519, 108520, 108521, 108484, 108485, 108486)
    • BR (EXPT IDs 108580, 108581, 108557, 108478, 108479, 108480, 108481)
    • ABA (EXPT IDs 108560, 108561, 108513, 108597)
    • Drought (EXPT IDs 108572, 108573, 108502, 108503, 108504, 108556, 108482, 108483, 108473, 108474, 108477)
    • Cold (EXPT IDs 108578, 108579, 108533, 108534)
    • Heat (EXPT IDs 108576, 108577, 108522, 108523)
    • Osmotic stress (EXPT IDs108570, 108571, 108541, 108542, 108553, 108539, 108540)
    • Reactive Oxygen (EXPT IDs 108582, 108583, 108537, 108538, 108558)
    • NO (EXPT IDs 108584, 108585, 108526, 108527, 108559)
    • Wounding (EXPT IDs 108574, 108575, 108524, 108525)
    • SA (EXPT IDs 108586, 108587, 108515, 108552, 108471, 108472, 108469, 108470, 107953, 107960, 108443, 108440, 108441, 108475, 108476)
    • MeJA (EXPT IDs 108568, 108569)
    • Finale (EXPT IDs 108467, 107871, 107876)
    • Trimec (EXPT IDs 108466, 107886, 107891)
    • Round-up (EXPT IDs 108465, 107896)
    • Glean (EXPT IDs 108468, 107881)


II.A.1.b.2. The Transcript Levels of a Protein Over Different Developmental Stages can be Identified by Transcriptional Analyses Over Many Experiments


Differential expression data were produced for different development stages of various organs and tissues. Measurement of transcript levels can divulge whether specific genes give rise to spikes of transcription at specific times during development, or whether transcription levels remain constant. This understanding can be used to increase speed of development, or to arrest development at a specific stage.


Like the time-course experiments, the developmental stage data can classify genes as being transcribed at early or late stages of development. Generally, Applicants assayed different organs or tissues at 2-4 different stages.


Inhibiting under-expressed genes at either early or late stages can trigger faster development times. The overall development time also can be increased by this means to allow organs and tissue to grow to a larger size or to allow more organs or tissues to be produced. Alternatively, coding sequences of late stage genes that are under-expressed can be placed under the control of promoters of early stage genes to increase heighten development.


Inserting extra copies of the coding sequence early stage genes that are under-expressed can retard action of the late-stage genes and delay the desired development.


Fruit development of Arabidopsis is one example that can be studied. Siliques of varying sizes, which are representative of different stages, were assayed by microarray techniques. Specifically, mRNA was isolated from siliques between 0-5 mm, between 5-10 mm and >10 mm in length.


The developmental course shows that the gene encoding a cell wall synthesis protein is up-regulated when the fruit is 0-5 mm but returns to normal levels at 5-10 mm and >10 mm. Increase of cell wall synthesis can lead to larger cells and/or greater number of cells. This type of increase can boost fruit yield. The coding sequence of the cell wall synthesis protein under the control of a strong early stage promoter would increase fruit size or number.


A pectinesterase gene was also differentially expressed during fruit development, cDNA ID 1396123. Pectinesterase catalyzes the hydrolysis of pectin into pectate and methanol. This biochemical activity plays an important role in cell wall metabolism during fruit ripening. To shorten the time for fruit ripening, extra copies of this gene with its endogenous promoter can be inserted into a desired plant. With its native promoter, the extra copies of the gene will be expressed at the normal time, to promote extra pectinesterase at the optimal stage of fruit development thereby shortening ripening time.


A number of Applicant's experiments can be grouped together to study changes of transcript levels over a number development stages. Below are examples of groups of experiments:

    • Root, Root Tip, and rhl mutant (EXPT IDs 108594, 108433, 108599, 108434, 108439)
    • Flowers Drought Exposed Flowers, SA Treated Flowers (EXPT IDs 108473, 108474, 108429, 108430, 108431, 108475, 108476, 108501)
    • BR Shoot Apices, Leaves, Stm (EXPT IDs 108478, 108479, 108480, 108481, 108598, 108535, 108536, 108435)
    • Leaf and Stm (EXPT IDs 108477, 108512, 108497, 108498, 108598108478, 108479, 108480, 108481, 108598, 108535, 108536, 108435)
    • Imbibded & Germinating Seeds 1, 2, 3, And 4 Days (EXPT IDs 108461, 108462, 108463, 108464, 108528, 108529, 108530, 108531, 108545, 108546, 108547, 108518, 108529, 108543, 108544)
    • Tissue Specific Expression (3 week rosette leaves, Tissue Specific Expression (3 week stems), Tissue Specific Expression (2 week roots) (EXPT IDs 108497, 108498, 108439)
    • Tissue Specific Expression (3 week rosette leaves), Germinating Seeds (EXPT IDs 108497, 108461)
    • Tissue Specific Expression (3 week rosette leaves, stm mutants, BR_Shoot Apices Expt, root tips, Tissue Specific Expression (2 week roots) (EXPT IDs 108497, 108435, 108480, 108434, 108439)
    • BR_Shoot Apices Expt, root tips, Tissue Specific Expression (flower buds) (EXPT IDs 108480, 108434, 108431)
    • Arab_Ler-pi_ovule_1, ap2-floral buds, Tissue Specific Expression (flower buds), Tissue Specific Expression (<5 mm siliques) (EXPT IDs 108595, 108501, 108431, 108437)
    • Tissue Specific Expression (2 week roots), rhl mutant2, BR_Shoot Apices Expt, Trichome Inflorescences (EXPT IDs 108439, 108433, 108480, 108452)


II.A.1.b.3. Proteins that are Common in a Number of Similar Responses can be Identified by Transcriptional Analyses Over a Number of Experiments


The differential expression experiments also reveal the genes, and therefore the coding sequence, that are common to a number of cellular responses. By identifying the genes that are differentially expressed in a number of similar responses, the genes at the nexus of a range of responses are discovered. For example, genes that are differentially expressed in all the stress responses are at the hub of many of the stress response pathways.


These types of nexus genes, proteins, and pathways are differentially expressed in many or majority of the responses or developmental conditions of interest. Typically, a nexus gene, protein, or pathway is differentially expressed in generally the same direction in many or majority of all the desired experiments. By doing so, the nexus gene can be responsible for triggering the same or similar set of pathways or networks for various cellular responses. This type of gene is useful in modulating pleiotropic effects or triggering or inhibiting a general class of responses.


When nexus genes are differentially expressed in a set of responses, but in different directions, these data indicate that a nexus gene is responsible for creating the specificity in a response by triggering the same pathway but to a different degree. Placing such nexus genes under a constitutive promoter to express the proteins at a more constant level can remove the fluctuations. For example, a plant that is better drought adapted, but not cold adapted can be modified to be tolerant to both conditions by placing under the control of a constitutive promoter a nexus gene that is up-regulated in drought but down regulated in cold.


Applicants' experiments can be grouped together to identify such nexus genes. Examples of these groups are as follows:

    • Herbicide Response
      • Trimec, Finale, Glean, Round-up (EXPT IDs 108467, 107871, 107876, 108468, 107881, 108465, 107896, 108466, 107886, 107891)
    • Stress Response
      • Drought, Cold, Heat, Osmotic Stress (EXPT IDs 108578, 108579, 108533, 108534, 108572, 108573, 108502, 108503, 108504, 108556, 108482, 108483, 108473, 108474, 108477, 108576, 108577, 108522, 108523, 108570, 108571, 108541, 108542, 108553, 108539, 108540)
      • Drought, Cold, Heat, PEG, Trimec, Finale, Glean, Round-up (EXPT IDs 108578, 108579, 108533, 108534, 108572, 108573, 108502, 108503, 108504, 108556, 108482, 108483, 108473, 108474, 108477, 108576, 108577, 108522, 108523, 108570, 108571, 108541, 108542, 108553, 108539, 108540)
      • Wounding, SA, MeJA, Reactive Oxygen, NO (EXPT IDs 108568, 108569, 108555, 108584, 108585, 108526, 108527, 108559, 108582, 108583, 108537, 108538, 108558, 108586, 108587, 108515, 108552, 108471, 108472, 108469, 108470, 107953, 107960, 108443, 108440, 108441, 108475, 108476, 108574, 108575, 108524, 108525)
    • Hormone Responses
      • NAA, BA, BR, GA, TRIMEC (EXPT IDs 108566, 108567, 108517, 108580, 108581, 108557, 108478, 108479, 108480, 108481, 108562, 108563, 108519, 108520, 108521, 108484, 108485, 108486, 108564, 108565, 108516, 108554, 108466, 107886, 107891)
      • NAA, Trimec (EXPT IDs 108566, 108567, 108517, 108580, 108581, 108557, 108478, 108479, 108480, 108481, 108562, 108563, 108519, 108520, 108521, 108484, 108485, 108486, 108564, 108565, 108516, 108554, 108466, 107886, 107891)


II.A.1.b.4. Proteins that are Common to Disparate Responses can be Identified by Transcriptional Analyses Over a Number of Experiments


Phenotypes and traits result from complex interactions between cellular pathways and networks. Which pathways are linked by expression of common genes to specify particular traits can be discerned by identifying the genes that show differential expression of seemingly disparate responses or developmental stages. For example, hormone fluxes in a plant can direct cell patterning and organ development. Genes that are differentially expressed both in the hormone experiments and organ development experiments would be of particular interest to control plant development.


Examples Of Such Pathway Interactions Include:

    • (i) The Interaction Between Stress Tolerance Pathways And Metabolism Pathways;
    • (ii) Interaction Between Hormone Responses And Developmental Changes In The Plant;
    • (iii) Interactions Between Nutrient Uptake And Developmental Changes;
    • (iv) Mediation Of Stress Response By Hormone Responses; And
    • (v) Interactions Between Stress Response And Development.


      Applicant's experiments can be grouped together to identify proteins that participate in interacting pathways or networks. Specific groups of experiments include, for example:
    • (i) Stress & Metabolism
      • Germinating Seeds (Day 1), Arab_0.1 uM_Epi-Brass_1, Arab_NO3_H-to-L_1, Arab_100 uM_GA3_1 (EXPT IDs 108461, 108580, 108592, 108562)
    • (ii) Hormones & Development
      • NAA, BA & Root Tips (EXPT IDs 108566, 108567, 108517, 108564, 108565, 108516, 108554, 108434, 108466, 107886, 107891)
      • NAA, Roots & Root Tips (EXPT IDs 108564, 108565, 108516, 108554, 108599, 108434, 108439, 108466, 107886, 107891)
      • NAA, BA, Roots And/Or Root Tips (EXPT IDs 108564, 108565, 108516, 108554, 108599, 108434, 108439, 108466, 107886, 107891, 108566, 108567, 108517)
      • NAA, BA And Leaf (EXPT IDs 108566, 108567, 108517, 108518, 108529, 108512, 108497, 108498, 108598, 108564, 108565, 108516, 108554, 108466, 107886, 107891)
      • NAA, BA, Leaves, Roots And/Or Root Tips (EXPT IDs 108566, 108567, 108517, 108518, 108529, 108512, 108497, 108498, 108598, 108564, 108565, 108516, 108554, 108466, 107886, 107891, 108599, 108434, 108439)
      • ABA & Siliques (Of Any Size) (EXPT IDs 108560, 108561, 108513, 108597, 108436, 108437, 108438)
      • GA, Imbibed & Germinating Seeds, ABA & Siliques (Of Any Size) (EXPT IDs 108560, 108561, 108513, 108597, 108562, 108563, 108519, 108520, 108521, 108484, 108485, 108486, 108461, 108462, 108463, 108464, 108528, 108529, 108530, 108531, 108545, 108546, 108547, 108518, 108529, 108543, 108544, 108436, 108437, 108438)
      • Tissue Specific Expression (3 week rosette leaves), Arab_0.1 uM_Epi-Brass_1, Arab_100 uM_GA3_1, Germinating Seeds (Day 1), (EXPT IDs 108461, 108497, 108580, 108562, 108461)
    • (iii) Nutrient Uptake And Development
      • Any Or All Nitrogen Experiments With Siliques (Of Any Size) (EXPT IDs 108592, 108593, 108588, 108589, 108590, 108591, 108532, 108548, 108549, 108550, 108551, 108454, 108455, 108487, 108488, 108489, 108436, 108437, 108438)
      • Any Or All Nitrogen Experiments With Roots Or Root Tips (EXPT IDs 108518, 108529, 108592, 108593, 108588, 108589, 108590, 108591, 108532, 108548, 108549, 108550, 108551, 108454, 108455, 108487, 108488, 108489, 108594, 108433, 108599, 108434, 108439)
    • (iv) Stress & Hormones
      • ABA, Drought (EXPT IDs 108560, 108561, 108513, 108597, 108572, 108573, 108502, 108503, 108504, 108556, 108482, 108483, 108473, 108474, 108477)
      • ABA, Drought, Cold, Heat, & Wounding (EXPT IDs 108560, 108561, 108513, 108597, 108578, 108579, 108533, 108534, 108572, 108573, 108502, 108503, 108504, 108556, 108482, 108483, 108473, 108474, 108477, 108576, 108577, 108522, 108523, 108574, 108575, 108524, 108525)
      • Tissue Specific Expression (3 week rosette leaves), Arab_100 uM_ABA_1, Ws Arabidopsis Drought 2 days, Ws Arabidopsis Drought 4 days (EXPT IDs 108497, 108560, 108477, 108482)
    • (v) Stress & Hormones Stress & Hormones
      • Nitrogen High transition to Low, Arab_NO3_H-to-L_1, Tissue Specific Expression (<5 mm siliques), Tissue Specific Expression (5-10 mm siliques) (EXPT IDs 108455, 108592, 108437, 108436)


II.A.1.c. Observations of Phenotypic Changes Show What Physiological Consequences Applicants' Proteins can Produce


Another direct means of determining the physiological consequences of a protein is to make aberrant decreases or increases of its expression level in a cell. To this end, Applicants have produced plants where specific genes have been disrupted, or produced plants that include an extra expressed copy of the gene. The plants were then planted under various conditions to determine if any visible physiological changes are caused. These changes then are attributed to the changes in protein levels.


II.A.2. Differential Expression Results Explain which External or Internal Stimuli Trigger the Regulatory Sequences


Transcriptional studies can reveal the time and place that genes are expressed. Typically, regulatory sequences, such as promoters, introns, UTRs, etc., control when and in which cells transcription occurs. Differential studies can explain the temporal- and location-specific regulatory sequences that control transcription.


Using the experiments that are provided herein, one skilled in the art can choose a promoter or any other regulatory sequence that is capable of facilitating the desired pattern of transcription. For example, if a promoter is needed to give rise to increased levels of transcription in response to Auxin, but little expression in response to cytokinin, then the promoters of cDNAs that were up-regulated in the Auxin experiments, but down-regulated the cytokinin experiments would be of interest.


Time Course Experiments—Time Sensitive


Evaluation of time-course data as described above is also useful to identify time-specific promoters. Promoters or regulatory sequences, like the coding sequences, can be classified as early or late responding according to the microarray data. Promoters that facilitate expression of early or late genes are useful to direct expression of heterologous coding sequences to modulate the cellular response. In the drought data, promoters from “early” responding genes can be selected to activate expression of any desired coding sequence. Thus, a coding sequence for a salt-tolerance protein that is not typically expressed early in response to drought could be linked to an “early” responding promoter to increase salt tolerance within one hour after exposure to drought conditions.


Developmental Experiments—Time Sensitive


Another class of time-sensitive promoters and other regulatory sequence can be identified from the experiments examining different developmental stages. These regulatory sequences can drive transcription of heterologous sequence at particular times during development. For example, expression of stress-responsive genes during fruit development can protect any gain in fruit yield.


Common to Many Pathways—Cause General Effects


Promoters and other regulatory sequence associated with cDNAs that are differentially expressed in a number of similar responses can be used to cause general effects. These types of regulatory sequences can be used to inhibit or increase expression of a desired coding sequence in a number circumstances. For example, protein that is capable of acting as an insecticide can be placed under the control a general “stress” promoter to increase expression, not only when the plant is wounded, but under other stress attack.


II.B. Experimental Results Also Reveal Pathways or Networks of Genes


II.B.1. Genes Whose Transcription are Well Coordinated Generally Act Together to Produce Proteins that Participate in the Same Pathway or Network


Patrick Brown, one of the pioneers of microarray chip technology, demonstrated that differential expression experiments can identify groups of genes that encode proteins that participate the same pathway or network. The work focused on phosphate accumulation and metabolism genes in yeast and was published in the paper Ogawa et al., Mol Biol Cell (2000) December; 11(12):4309-21. The authors identified by microarray analysis 22 genes whose transcription was regulated by phosphate concentration. Promoter analysis of these genes showed that 21 of them contained a sequence in their promoters that is recognized by a transcriptional activator that is regulated by phosphate. Further, phenotypic studies were completed by mutational analysis of many of these 22 genes in yeast. The mutants were shown to be either severely deficient in accumulation of inorganic polyphosphate (polyP) and P(i), or associated with normal catabolism of polyP in the yeast vacuole. This publication proves that genes with correlated transcriptional profiles do indeed participate in the same pathway or network.


II.B.1.a. Calculating the Correlation Coefficient Between Pairs of Genes Based on the Differential Expression Data


The differential expression data obtained over many experiments reveal the global pattern of transcription of a gene. Transcription patterns, also referred to as profiles, of two different genes can be compared. From this comparison, a correlation coefficient can be calculated as a measure of the strength of the relationship between the two profiles.


Transcription profiles can be compared by plotting as a point, the differential expression of gene1 on the x-axis and gene 2 on the y-axis on one experiment. If all the pairs lie on a regression line the relationship and correlation between the two genes are strong. The correlation coefficient can be calculated using a number of methods. In the present case, the Spearman method was utilized.


The correlation coefficient can vary from −1 to 1. The coefficient indicates the strength of the relationship between two mRNA transcripts of any set of data that is examined. A zero coefficient indicates that no correlation exists between the transcription profiles of two genes in the samples examined.


Biologically, a high correlation coefficient indicates that a gene(s) triggers the activation or repression of the correlated genes, or have related functional roles. Thus, illumination of the activity of one gene can indicate the activities of the genes with highly correlated transcription profiles. This implication is true whether the activity is a biochemical activity, molecular interaction, cellular response, or physiological consequence.


II.B.1.b. The Complete Linkage Analyses of Differential Identity Genes with Similar Pattern of Transcription


The complete linkage analysis can build groups (or “clusters”) of genes whose transcription patterns are highly correlated or co-regulated.


Because genes with related functions are frequently expressed in similar patterns, utilities or roles can be ascribed for genes (without observation of transformed plants) based on their temporal association with other genes of known function (a “guilt-by-association” analysis). Ogawa et al. has used correlated mRNA transcription profiles to identify the function of proteins of unknown function.


The complete linkage analysis utilizes the correlation coefficients that are calculated for each pair of genes tested in the microarray experiments. A cluster is first seeded with any arbitrary transcript tested on the chip. The seed transcript, for this illustration, is designated mRNA#0. Next, a minimum threshold is chosen for all acceptable correlation coefficients. In this case, the threshold used was 0.75. A list of potential cluster members is compiled by choosing mRNA transcripts that have a correlation coefficient with mRNA#0 that is greater than the threshold. No limit is placed on the number of mRNAs that can be added to a cluster so long as the correlation coefficient meets the threshold limit criterion.


For this example, assume that four mRNAs were added to the cluster, mRNA_1 to mRNA_4. Once the potential cluster members are identified, the cDNA IDs of each member is added to the potential list in order its correlation coefficient to mRNA#1, the largest correlation coefficient first. For this example, let's suppose four mRNAs 1-4 are potential members, they would be ordered as follows:
















Correlation Coefficient



MRNA#
with mRNA#0


















MRNA#1
0.9



MRNA#2
0.8



MRNA#3
0.78



MRNA#4
0.75









A potential member is accepted into the group, if its correlation coefficients with all other potential members are all greater than the threshold. Thus, for mRNA#1 to remain in the group the correlation coefficient between mRNA#1 and mRNA#2 must be greater than 0.75; and mRNA#1 and #3>0.75; and mRNA#1 and mRNA#4>0.75. Potential cluster members are removed only after reviewing the correlation coefficients in a specific order where mRNAs are reviewed in the order that they appear on the list.


Consequently, review of the correlation coefficients does not begin with any random pair, such as mRNA#3 and mRNA#4. The review begins between mRNA#1 and mRNA#2, which are the top two on the list.


If correlation coefficient between mRNA#1 and mRNA#2 is less than the threshold, then mRNA#2 is removed from the cluster. mRNA#2 is removed because its correlation coefficient with mRNA#0 is 0.8 which is less than 0.9, the correlation coefficient of mRNA#1 and mRNA#0.


This illustrates the rule that if the correlation coefficient is less than the threshold, then only one of the pair not accepted as a cluster member, specifically, the one with the lower coefficient to the seed mRNA#0.


This process of iterative reviewing of correlation coefficients between potential members continues until all pairs are reviewed. In this case, the coefficient between mRNA#1 and mRNA#3 would be reviewed because these are the two highest ones on the list besides mRNA#1 and #2. The next pair to be reviewed would be mRNA#1 and #4, etc.


Applicants have analyzed the data using several sets of parameters for the complete linkage analysis as shown in the table below:
















Correlation





Coefficient
Max number of



Method
Threshold
members in a cluster
Organism


















CL_METHOD_
0.9
MAX_SIZE = 15
Arabidopsis


TYPE = TRUE





CL_METHOD_
0.75
MAX_SIZE = 30000
Arabidopsis


TYPE = TRUE





CL_METHOD_
0.70
MAX_SIZE = 30000
Arabidopsis


TYPE = TRUE





CL_METHOD_
0.9
MAX_SIZE = 15
Zea


TYPE = TRUE





CL_METHOD_
0.75
MAX_SIZE = 30000
Zea


TYPE = TRUE





CL_METHOD_
0.70
MAX_SIZE = 30000
Zea


TYPE = TRUE





CL_METHOD_
0.9
MAX_SIZE = 15
Arabidopsis


TYPE = TRUE





CL_METHOD_
0.75
MAX_SIZE = 30000
Arabidopsis


TYPE = TRUE





CL_METHOD_
0.70
MAX_SIZE = 30000
Arabidopsis


TYPE = TRUE





CL_METHOD_
0.9
MAX_SIZE = 15
Zea


TYPE = TRUE





CL_METHOD_
0.75
MAX_SIZE = 30000
Zea


TYPE = TRUE





CL_METHOD_
0.70
MAX_SIZE = 30000
Zea


TYPE = TRUE









The results of these cluster analyses are reported in the MA_clust table.


II.B.1.c. The Nearest Neighbor Analyses of Differential Group Genes with Correlated but Dissimilar Transcription Profiles


The nearest neighbor analysis differs from the complete linkage algorithm by not requiring all members to meet the correlation threshold with each other. Thus, a member of a nearest neighbor cluster need only be closely correlated to one other member of the cluster. It is not even required that all members be closely correlated to the seed mRNA transcript.


In a complete linkage cluster all the transcription profile of all members are correlated to a greater or lesser extent. In contrast, a cluster deduced by the nearest neighbor analysis may include members with differing transcription profiles. However, nearest neighbor brings to light clusters of interacting genes. In the nearest neighbor analysis, the seed mRNA may not have a very high correlation coefficient with the last mRNA added to the cluster.


The nearest neighbor analysis, like the complete linkage analysis, is initiated by seeding each cluster with a mRNA_0. The cluster size is determined by setting a threshold coefficient and setting a limit on the number of members that can be added to the cluster.


The cluster is expanded in an iterative fashion determining which mRNA has the highest correlation coefficient with mRNA_0. The additional member is labeled mRNA_1. Next, a list of potential candidates is generated by finding the mRNA that has the highest correlation to mRNA_0 (besides mRNA_1) and finding the mRNA that has the highest coefficient with mRNA_1. Whichever of the candidates has the highest correlation coefficient is added to the cluster. Then, a list of three potential candidates is generated similarly.


Addition of members continues until either (1) all the correlation coefficients of potential members is lower than the threshold or (2) number of members in the cluster meets the size limitation.


Applicants have analyzed the data using several sets of parameters for the nearest neighbor analysis as shown in the table below:
















Correlation
Max number of




Coefficient
members in a


Method
Threshold
cluster
Organism


















NN_METHOD_TYPE = TRUE
0.5
MAX_HITS = 15

Arabidopsis



FULL_NN_METHOD_TYPE =
0.8
NONE

Arabidopsis



TRUE


FULL_NN_METHOD_TYPE =
0.6
NONE

Arabidopsis



TRUE


NN_METHOD_TYPE = TRUE
0.5
MAX_HITS = 15

Zea



FULL_NN_METHOD_TYPE =
0.8
NONE

Zea



TRUE


FULL_NN_METHOD_TYPE =
0.6
NONE

Zea



TRUE


NN_METHOD_TYPE = TRUE
0.5
MAX_HITS = 15

Arabidopsis



FULL_NN_METHOD_TYPE =
0.8
NONE

Arabidopsis



TRUE


FULL_NN_METHOD_TYPE =
0.6
NONE

Arabidopsis



TRUE


NN_METHOD_TYPE = TRUE
0.5
MAX_HITS = 15

Zea



FULL_NN_METHOD_TYPE =
0.8
NONE

Zea



TRUE


FULL_NN_METHOD_TYPE =
0.6
NONE

Zea



TRUE









The results of these cluster analyses are reported in the MA_clust table.


II.C. Experimental Results Reveal the Functions and Characteristics of Genes, Pathways and Networks


II.C.1. Linking Biochemical or Metabolic Activities of One Protein in a Cluster to the Other Proteins in the Same Microarray Cluster


As shown in the Ogawa et al., Mol Biol Cell (2000), genes whose transcription profiles cluster together as being strongly correlated typically take part in the same pathway or network. Thus, the activity of one gene in the cluster can be associated to the other genes in the cluster with highly correlated transcription profiles. This association is true whether the activity is a biochemical activity, molecular interaction, cellular response or physiological consequence.


One example of this is cluster 420 of the report (shown below). In this cluster, a protein encoded by cDNA ID 1025791 did not match to any pFAM domain. However, through the microarray data, the gene that encodes that protein had a transcription profile that was correlated with other genes that encode ribosomal proteins. Thus, the activity of the ribosomal genes can be associated with the protein with no pFAM match. All the proteins in the same cluster would be associated with mRNA translation and protein synthesis.




















420
1025791
803433
4585878
(AC005850)








Unknown








protein








[Arabidopsis




420
4608965
671877
8567795
(AC013428)
Ribosomal_S17e
Ribosomal






40S

S17






ribosomal








protein S17,








pu




420
5663116
818554
7486478
hypothetical
DapB
Dihydro-






protein

dipicolinate






F6E13.17-

reductase






Arabidop









II.C.2 Using Differential Expression Data to Determine when the Genes and Pathways are Active


The differential expression data can be used to associate the cellular response that results when the clusters of genes are transcribed. For the complete linkage clusters, the genes in the cluster will produce similar transcription profiles. The experiments where the genes in the cluster are differentially expressed as compared to the control define the cellular responses that all the genes of the cluster are capable of modulating.


For example, for the cluster shown above, the mRNA levels for the genes were significantly different in the nitrogen response experiments. Thus, the data shows that this cluster of genes is associated with protein synthesis in response to nutrient uptake.


II.C.3. Using Phenotype Data to Determine when Genes and Pathways are Active


The phenotypic data can be used to demonstrate the physiological consequences of that result when a cluster of genes is active. Whether the clusters were generated by the complete linkage or the nearest neighbor analyses, if a single gene in the cluster has been implicated in phenotypic changes, then any one or combination of the other genes in the cluster can also modulate the same or similar phenotypic changes.


Utilities of Particular Interest


The following sections describe utilities/functions for the genes, gene components and products of the invention. The sequences of the invention, as discussed above, can be recognized as a particular type of gene (e.g. root gene, leaf gene, etc.) by means of particular terms utilized in the Knock-in and Knock-out Tables and by the results of the differential expression experiments. Combined analysis of those data also identify genes with utilities/functions of particular interest. The Single Gene Functions and Utilities Table correlates that data and specific genes with those utilities/functions of particular interest.


Utilities of Particular Interest for Clustered Sequences


As discussed further herein, the genes, gene components and products of the invention have been clustered together into groups. This enables one to understand the function/utility of one member of the cluster based upon knowledge about one or more other members of the cluster. In addition, this enables an understanding of some utilities/functions of a cluster that would be of particular interest. The Cluster Functions and Utilities Table lists some of the clusters of the invention and notes the functions/utilities that are of particular interest for each of the clusters. Of course, these functions/utilities are of particular interest for each member of each particular cluster.


II.D. Experimental Results Provide an Understanding of Genes, Pathways and Networks in Many Plant Species


By analyzing the constant and variable properties of groups of similar sequences, it is possible to derive a structural and functional signature for a protein family, which distinguishes its members from all other proteins. This approach has allowed the Applicants to assign proteins into functional groups and identify orthologous proteins both within and between species. A pertinent analogy to be considered is the use of fingerprints by the police for identification purposes. A fingerprint is generally sufficient to identify a given individual. Similarly, a protein signature can be used to assign a newly sequenced protein to a specific family of proteins and thus to formulate hypotheses about its function.


Proteins can be grouped together because they share a single motif or many motifs. Typically, proteins that share a series of motifs share greater functional equivalence. Usually, signature sequences comprise more than one motif in a particular order from N-terminus to C-terminus.


A list of these groups can be found in the Protein Group Table. The sequences were grouped together using the iterative protein sequence local alignment software, PSI-BLAST. This software begins by aligning a number sequences where the probability that the alignment occurred by chance is set by a threshold e-value. In the Applicants' case, the threshold e-value was set at 10−50, 10−30, and 10−10. The algorithm generates a consensus sequence from the sequences that were aligned together. The consensus sequence was then used to find sequences that matched to it with a probability that was less than the set threshold. The algorithm performs the iterative tasks of aligning and generating a consensus sequence any number of times. Generally, Applicants performed one iteration for the 10−10 e-value threshold, two iterations for the 10−3° threshold, and three iterations for the 10−50 threshold.


Each group can contain sequences from one of more organisms. The groups included both Ceres polypeptides and public polypeptide sequences. The Ceres polypeptides are identified by their Ceres Sequence ID NO as listed in the Reference Table.


Each group contains sequences that were included at the 10−50, 10−30, and 10−10 e-value cutoffs. For each group, the peptide ID and at which cutoff the peptide was included into the group. The same peptide ID may be included in the group three times as peptide ID 50, peptide ID 30 and peptide ID 10. The data indicates that peptide ID was included in the group when the threshold was either 10−50, 10−3°, or 10−10. All the peptide IDs that are followed by “50” were included in the protein group when the e-value cutoff was 10−50. All the peptide IDs that are followed by either “30” or “50” were included in the protein group when the threshold e-value was 10−30. All the peptide IDs that are followed by “10”, “30” or “50” were included in the protein group when 10−10 was used as the e-value cutoff.


II.D.1. Conserved Sequences Between Proteins of Different Species Give Rise to a Signature Sequence


The signature sequence for each group of proteins, also referred to as the consensus sequence. The signature sequence comprises the amino acids that are conserved throughout all the proteins in a particular protein group. The data are shown in the Protein Group table.


Not all the polypeptides in a group are the same length. Thus, some members of the group may not contain the entire signature sequence. However, throughout the length of any member protein, its sequence will match the signature sequence.


The consensus sequence contains both lower-case and upper-case letters. The upper-case letters represent the standard one-letter amino acid abbreviations. The lower case letters represent classes of amino acids:

    • “t” refers to tiny amino acids, which are specifically alanine, glycine, serine and threonine.
    • “p” refers to polar amino acids, which are specifically, asparagine and glutamine
    • “n” refers to negatively charged amino acids, which are specifically, aspartic acid and glutamic acid
    • “+” refers to positively charged residues, which are specifically, lysine, arginine, and histidine
    • “r” refers to aromatic residues, which are specifically, phenylalanine, tyrosine, and tryptophan,
    • “a” refers to aliphatic residues, which are specifically, isoleucine, valine, leucine, and methonine


In addition to each consensus sequence, Applicants have generated a scoring matrix to provide further description of the consensus sequence. The matrix reports the identitiy and number of occurences of all the amino acids that were found in the group members for every residue position of the signature sequence. The matrix also indicates for each residue position, how many different organisms were found to have a polypeptide in the group that included a residue at the relevant position. These results are reported in the Protein Group Matrix table.


Functional equivalents share similar (1) structural characteristics; (2) biochemical activities and molecular interactions; (3) cellular responses or activities; or (4) phenotypic effects.


II.D.2. Linking Signature Sequences to Conservation of Structural Characteristics


Proteins with related functions show similar three-dimensional structures but may not show extensive amino acid sequence similarity. Typically, proteins need only share a single motif or low similarity in multiple domains to exhibit similar structural features, such as alpha helix, beta sheet, charge residues, stretches of hydrophobicity, etc. Conserved structural features have been implicated in ligand binding by receptor proteins, binding to a class of substrates, polynucleotide binding, or protein-protein interactions.


Based on the signature sequences and the Matrix Tables described herein, a number of motifs can be discerned. Motifs are identified as regions in the signature sequence which are constant in a majority of the members of the group. Example motifs can be found among Applicant's data which are shared in the range of 75% to 95% of group members


Typically, a region of the consensus sequence is constant if, at each position of the region, the preferred amino acid is chosen from a single class of amino acids; even more typically, the preferred amino acid is a single amino acid. The region can contain a number of positions where an amino acid can be chosen. However, these variable positions are usually less than 15% of the total number of residues in the region; more usually, less than 10%; even more usually, less than 5%.


Generally, a domain is considered to be well defined if the consensus sequence is constructed from sequences from at least 2 organisms; more preferably, at least 3 organisms; even more preferably four organisms or greater.


Primary domains are best identified from the data presented for the 10−10 probability criteria. Using this parameter, the largest number of proteins is associated into a group. Consequently, the signature sequence exhibits the greatest amount of variability. The conserved regions, the domains or motifs of the signature contrast against the variable regions. These variable regions become obvious when sequences from more proteins are compared.


Signature sequences revealed in the 10−30 and 10−50 e-value classes show more conservation in the domains, and can even display a degree of conservation in what is considered the variable regions in the 10−10 analyses. These more extensively-conserved domains can reflect higher similarity in function—completely orthologous functions. Proteins that share a number of conserved domains, in the same relative order from N terminus to C terminus, are even more likely to be completely orthologous. Nevertheless, because of the natural divergence that occurs in non-conserved regions during evolution and species differentiation, orthologs can be proteins with only the domains conserved and therefore be present in the 10−30 and 10−10 p value classes of the Ortholog Table.


II.D.3. Linking Signature Sequences to Conservation of Biochemical Activities and Molecular Interactions


Proteins that possess the same defined domains or motifs are likely to carry out the same biochemical activity or interact with a similar class of target molecule, e.g., DNA, RNA, proteins, etc. Thus, the pFAM domains listed in the Reference Tables are routinely used as predictors of these properties. Substrates and products for the specific reactions can vary from protein to protein. Where the substrates, ligands, or other molecules bound are identical the affinities may differ between the proteins. Typically, the affinities exhibited by different functional equivalents varies no more than 50%; more typically, no more than 25%; even more typically, no more than 10%; or even less.


Proteins with very similar biochemical activities or molecular interactions will share similar structural properties, such as substrate grooves, as well as sequence similarity in more than one motif. Usually, the proteins will share at least two motifs of the signature sequence; more usually, three motifs; even more usually four motifs or greater. Typically, the proteins exhibit 70% sequence identity in the shared motifs; more typically, 80% sequence identity; even more typically, 90% sequence identity or greater. These proteins also often share sequence similarity in the variable regions between the constant motif regions. Further, the shared motifs will be in the same order from amino- to carboxyl-termini. The length of the variable regions between the motifs in these proteins, generally, is similar. Specifically, the number of residues between the shared motifs in these proteins varies by less than 25%; more usually, does not vary by less than 20%; even more usually, less than 15%; even more usually less than 10% or even less.


II.D.4. Linking Signature Sequences to Conservation of Cellular Responses or Activities


Proteins that exhibit similar cellular response or activities will possess the structural and conserved domain/motifs as described in the Biochemical Activities and Molecular Interactions above.


Proteins can play a larger role in cellular response than just their biochemical activities or molecular interactions suggest. A protein can initiate gene transcription, which is specific to the drought response of a cell. Other cellular responses and activities include: stress responses, hormonal responses, growth and differential of a cell, cell to cell interactions, etc.


The cellular role or activities of protein can be deduced by transcriptional analyses or phenotypic analyses as well as by determining the biochemical activities and molecular interactions of the protein. For example, transcriptional analyses can indicate that transcription of gene A is greatly increased during flower development. Such data would implicate protein A encoded by gene A, in the process of flower development. Proteins that shared sequence similarity in more than one motif would also act as functional equivalents for protein A during flower development.


II.D.5. Linking Signature Sequences to Conservation of Phenotypic Effects


Typically, proteins that are grouped together under the most stringent parameters, e-value≤10−50, are likely orthologs and therefore, when present in the same or equivalent cells can cause similar phenotypic consequences. These proteins have very high sequence similarity. Typically, if one of the members of a group is an Arabidopsis protein, then the corn ortholog can rescue an Arabidopsis mutant plant that does not produce the Arabidopsis protein. The mutant plant would be rescued as the parental “wild-type” phenotype by expression of a coding sequence of the corn protein of the same orthologous group when present in the appropriate cell types of the plant.


Preferably, these functional equivalents have sequence motif identity throughout much of the length of the protein. However, proteins that share very high similarity between a number, usually more than two; even more usually, more than three motifs can act as functional equivalents to produce similar phenotypic effects.


A gene can have coding sequence similarity, i.e., is a homologous. The coding sequence can be sufficient to act as a functional equivalent, although the gene as a whole is not an ortholog. For example, two similar dwf4 coding sequences were found in the Arabidopsis genome. However, this pair of coding sequences had different promoters and hence different roles in Plantae. But when one of the pair was placed under the control of its mates' promoter, the phenotypic effects were similar to the effects produced by its mate coding sequence. Therefore, the coding sequence, but not the genes are orthologous.


III. Description of the Genes, Gene Components and Products, Together with their Use and Application

As described herein, the results of Applicant's experiments provide an understanding of the function and phenotypic implications of the genes, gene components and products of the present invention. Bioinformatic analysis provides such information. The sections of the present application containing the bioinformatic analysis, together with the Sequence and Reference Tables, teach those skilled in the art how to use the genes, gene components and products of the present invention to provide plants with novel characteristics. Similarly, differential expression analysis provides additional such information and the sections of the present application on that analysis; together with the MA_Diff Tables and MA_Cluster Tables, describe the functions of the genes, gene components and products of the present invention which are understood from the results of the differential expression experiments. The same is true with respect to the phenotype data, wherein the results of the Knock-in and Knock-out experiments and the sections of the present application on those experiments provide the skilled artisan with further description of the functions of the genes, gene components and products of the present invention.


As a result, one reading each of these sections of the present application as an independent report will understand the function of the genes, gene components and products of the present invention. But those sections and descriptions can also be read in combination, in an integrated manner, to gain further insight into the functions and uses for the genes, gene components and products of the present invention. Such an integrated analysis does not require extending beyond the teachings of the present application, but rather combining and integrating the teachings depending upon the particular purpose of the reader.


Some sections of the present application describe the function of genes, gene components and products of the present invention with reference to the type of plant tissue (e.g. root genes, leaf genes, etc.), while other sections describe the function of the genes, gene components and products with respect to responses under certain conditions (e.g. Auxin-responsive genes, heat-responsive genes, etc.). Thus, if one desires to utilize a gene understood from the application to be a particular tissue-type of gene, then the condition-specific responsiveness of that gene can be understood from the differential expression tables, and very specific characteristics of actions of that gene in a transformed plant will be understood by recognizing the overlap or intersection of the gene functions as understood from the two different types of information. Thus, for example, if one desires to transform a plant with a root gene for enhancing root growth and performance, one can know the useful root genes from the results reported in the knock-in and knock-out tables. A review of the differential expression data may then show that a specific root gene is also over-expressed in response to heat and osmotic stress. The function of that gene is then described in (1) the section of the present application that discusses root genes, (2) the section of the present application that discusses heat-responsive genes, and (3) the section of the application that discusses osmotic stress-responsive genes. The function(s) which are commonly described in those three sections will then be particularly characteristic of a plant transformed with that gene. This type of integrated analysis of data can be viewed from the following schematic that summarizes, for one particular gene, the function of that gene as understood from the phenotype and differential expression experiments.














Gene function known
Gene function known
Gene function known


from phenotype
from first differential
from second differential


experiments
expression experiment
expression experiment







Function A
Function A
Function A


Function B



Function C
Function C



Function D




Function E


Function F
Function F
Function F


Function G
Function G




Function H


Function I

Function I



Function J









In the above example, one skilled in the art will understand that a plant transformed with this particular gene will particularly exhibit functions A and F because those are the functions which are understood in common from the three different experiments.


Similar analyses can be conducted on various genes of the present invention, by which one skilled in the art can effectively modulate plant functions depending upon the particular use or conditions envisioned for the plant.


III.A. Organ-Affecting Genes, Gene Components, Products (Including Differentiation and Function)


III.A.1. Root Genes, Gene Components and Products


The economic values of roots arise not only from harvested adventitious roots or tubers, but also from the ability of roots to funnel nutrients to support growth of all plants and increase their vegetative material, seeds, fruits, etc. Roots have four main functions. First, they anchor the plant in the soil. Second, they facilitate and regulate the molecular signals and molecular traffic between the plant, soil, and soil fauna. Third, the root provides a plant with nutrients gained from the soil or growth medium. Fourth, they condition local soil chemical and physical properties.


III.A.1. A. Identification of Root Genes


Root genes identified herein are defined as genes, gene components and products capable of modulating one or more processes in or functions of the root as described below. They are active or potentially active to a greater extent in roots than in most other organs of the plant. These genes and gene products can regulate many plant traits from yield to stress tolerance. That single genes usually affect the development and function of roots and whole plants is a consequence of biological cellular complexity and the role roots play in supporting the growth of whole plants. Examples of such root genes and gene products are shown in the Reference and Sequence Reference and Sequence Tables and sequences encoding polypeptides of the Protein Group and Protein Group Matrix tables or fragments thereof, the Knock-In and Knock-Out Tables, and the MA-diff Tables. The function of many of the protein products gained from comparisons with proteins of known functions, are also given in the REF Tables.


Root Genes Identified By Phenotypic Observations


Root genes are active or potentially active to a greater extent in roots than in some other organs/tissue of the plant. Some of the root genes herein were discovered and characterized from a much larger set of genes in experiments designed to find genes that cause phenotypic changes in root morphology. Such morphological changes include primary and lateral root number, size and length, as well as phenotypic changes of other parts of that plant associated with changes in root morphology.


In these experiments, root genes were identified by either (1) ectopic expression of a cDNA in a plant or (2) mutagenesis of the plant genome. The plants were then cultivated under standardized conditions and any phenotypic differences recorded between the modified plants as compared with the parent plant. The gene(s) causing the changes were deduced from the cDNA inserted or disrupted gene. Phenotypic differences were observed in:

    • Primary Roots And Root System
      • Size, Including Length And Girth
      • Number
      • Branching
      • Root Waving/Curling Characteristics
      • Gravitropism Changes
      • Agravitropic
    • Lateral Roots
      • Size, Including Length And Girth
      • Number
      • Branching


Results from screening for these phenotypic changes are reported in the Knock-in and Knock-out Tables. Therefore, any sequence reported in those Tables with one of the above-noted observations is considered a “root gene”. A “root gene” is also a sequence which, in the Ortholog Tables or in the MA-clust Tables, is grouped/clustered together with at least one sequence that is identified as such by means of the Knock-in and Knock-out Tables.


Root Genes Identified By Differential Expression


Root genes were also identified by measuring the relative levels of mRNA products in the root versus the aerial portion of a plant. Specifically, mRNA was isolated from roots and root tips of Arabidopsis plants and compared to mRNA isolated from the aerial portion of the plants utilizing microarray procedures. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108594, 108433, 108599, 108434, 108439). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Roots genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Roots Genes Identified by Cluster Analyses of Differential Expression


Roots Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Roots genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108594, 108433, 108599, 108434, 108439 of the MA_diff table(s).


Roots Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Roots genes. A group in the MA_clust is considered a Roots pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Roots Genes Identified by Amino Acid Sequence Similarity


Roots genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Roots genes. Groups of Roots genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Roots pathway or network is a group of proteins that also exhibits Roots functions/utilities.


Examples of phenotypes, biochemical activities, and transcription profiles that can be modulated by these genes and gene products are described above and below.


III.A.1.b. Use of Root Genes to Modulate Phenotypes


The root genes of the instant invention are capable of modulating one or more processes of root structure and/or function including (1) development; (2) interaction with the soil and soil contents; and (3) transport in the plant.


Root genes and gene products can be used to alter or modulate one or more of the following phenotypes.


1.) Development


Roots arise from meristem cells that are protected by a root cap during root elongation, but as the root grows out, the cap cells abscise and the remaining cells differentiate to the tip. Depending on the plant species, some surface cells of roots can develop into root hairs. Some roots persist for the life of the plant; others gradually shorten as the ends slowly die back; some may cease to function due to external influences. The root genes and gene products of this invention are useful to modulate any one or all of these growth and development processes generally, as in root density and root growth; including rate, timing, direction and size.


Root genes and gene products are useful to modulate either the growth and development or other processes in one or more of the following types of roots, including primary, lateral, and adventitious.


Root genes and gene products are useful to modulate cellular changes in cell size, cell division, rate direction and/or number, cell elongation, cell differentiation, lignified cell walls, epidermal cells, such as trichoblasts, and root apical meristem cells (growth and initiation).


Parts of roots (i.e. root architecture) can be modulated by these genes root and gene products to affect root architecture in, for example, the epidermis cortex (including the epidermis, hypodermis, endodermis, casparian strips, suberized secondary walls, parenchyma, and aerenchyma), stele (including vaculature, xylem, phloem, and pericycle), vasculature, xylem, phloem, root cap, root apical meristem, elongating region, and symmetry.


The polynucleotides and polypeptides of this invention can be used to control the responses to internal plant and root programs as well as to environmental stimuli in the seminal system, nodal system, hormone systems (including Auxin and cytokinin), root cap abscission, root senescence, gravitropism, coordination of root growth and development with that of other organs (including leaves, flowers, seeds, fruits, stems, and changes in soil environment (including water, minerals, ph, and microfauna and flora).


2.) Interaction with Soil and Soil Contents


Roots are sites of intense chemical and biological activities and as a result can strongly modify the soil they contact. Roots coat themselves with surfactants and mucilage to facilitate these activities. Specifically, roots are responsible for nutrient uptake by mobilizing and assimilating water, organic and inorganic compounds, ions and attracting and interacting with beneficial microfauna and flora. Roots also help to mitigate the effects of toxic chemicals, pathogens and stress. Examples of root properties and activities that the genes and gene products of this invention are useful to modulate are root surfactants and mucilage (including mucilage composition, secretion rate and time, surfactant); nutrient uptake of water, nitrate and other sources of nitrogen, phosphate, potassium, and micronutrients (e.g. iron, copper, etc.); microbes and nematodes associations (such as bacteria including nitrogen-fixing bacteria, mycorrhizae, and nodule-forming and other nematodes); oxygen (including transpiration); detoxification of iron, aluminum, cadium, mercury, salt, and other heavy metals and toxins); pathogen interactions/control (including chemical repellents (includes glucosinolates (GSL), which release pathogen-controlling isothiocyanates); and changes in soil properties, (such as Ph, mineral depletion, and rhizosheath).


3) Transport of Materials in Plants


Uptake of nutrients by roots produces a “source-sink” effect in a plant. The greater the source of nutrients, the larger “sinks,” such as stems, leaves, flowers, seeds, fruits, etc. can grow. Thus, root genes and gene products are useful to modulate the vigor and yield of the plant overall as well as distinct cells, organs, or tissues. The root genes and gene products are, therefore, useful to modulate vigor (including plant nutrition, growth rate (such as whole plant, including height, flowering time, etc.), seedling, coleoptile elongation, young leaves, stems, flowers, seeds, fruit, and yield (including biomass (such as fresh and dry weight during any time in plant life, including maturation and senescence), root/tuber yield (such as number, size, weight, harvest index, content and composition, (i.e. amino acid, jasmonate, oil, protein and starch), number of flowers, seed yield, number, size, weight, harvest index, content and composition (e.g. amino acid, jasmonate, oil, protein and starch), and fruit yield (such as number, size, weight, harvest index, post harvest quality, content and composition, (e.g. amino acid, jasmonate, oil, protein and starch).


Additional Uses of Plants with Modified Roots


Plants with roots modified in one or more of the properties described above are used to provide:

    • A. Higher vigor and yield of plants and harvested products due to pathogen resistance from conditioning the soil with plant-derived chemicals and/or more tolerance to stresses such as drought, flooding and anoxia.
    • B. Better Animal (Including Human) Nutrition
    • C. Improved Dietary Mineral Nutrition
    • D. Better Plant Survival
      • (a) Decreased Lodging
      • (b) More Efficient Transport
      • (c) More Efficient Physiology
      • (d) More Efficient Metabolism
    • E. Better Resistance To Plant Density Effects
    • F. Increased Yield Of Valuable Molecules
    • G. More Efficient Root Nodulation
    • H. Better Access To Rhizobia Spray Application, For Anaerobic Soils
    • I. Easier Crop Harvesting And Ground Tillage
    • J. Decreased Soil Erosion


To regulate any of the phenotype(s) above, activities of one or more of the root genes or gene products is modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Dolan et al. (1993, Development 119: 71-84), Dolan et al. (1997, Development 124: 1789-98), Crawford and Glass (1998, Trends Plant Science 3: 389-95), Wang et al. (1998, PNAS USA 95: 15134-39), Gaxiola et al. (1998, PNAS USA 95: 4046-50), Apse et al. (1999, Science 285: 1256-58), Fisher and Long (1992, Nature 357: 655-60), Schneider et al. (1998, Genes Devel 12: 2013-21) and Hirsch (1999, Curr Opin Plant Biol. 2: 320-326).


III.A.1.c. Use of Root Genes to Modulate Biochemical Activities


The activities of one or more of the root genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Association Of Root
Cell-Cell Recognition
Gage et al. (1996) J Bacteriol


Morphology With Nitrogen
Cell Wall Degradation
178: 7159-66


Fixing Bacteria


Primary Root, Lateral
Cell Division/Elongation
Schneider et al. (1998) Genes


Root, And Root Hair
Cell Differentiation
Devel 12: 2013-21


Initiation
Cell Expansion
Casimiro et al. (2001). Plant


Spacing
Auxin Mediated Response
Cell 13: 843-852.


Elongation
Pathways
Rogg et al. (2001). Plant


Branching

Cell 13: 465-480.




Gaedeke et al. (2001).




EMBO J. 20: 1875-1887.




Neuteboom et al. (1999).




Plant Mol. Biol. 39: 273-287.




Schindelman et al. (2001).




Genes and Dev. 15: 1115-1127.




Rashotte et al. (2001) Plant




Cell 13: 1683-1697.




Zhang et al. (2000). J Exp




Bot 51: 51-59.




Zhang et al. (1998) Science




279: 407-409.


Metabolism
Organic Molecule Export
Moody et al. (1988)




Phytochemistry 27: 2857-61.



Ion Export
Uozumi et al. (2000) Plant




Physiol 122: 1249-59




Frachisse et al. (2000) Plant J




21: 361-71



Nutrient Uptake
Frachisse et al. (2000) Plant J




21: 361-71




Uozumio et al. (2000) Plant




Physiol 122: 1249-59




Williamson et al. (2001).




Plant Physiol. 126: 875-882.




Zhang et al. (2000). J Exp




Bot 51: 51-59.




Zhang et al. (1998). Science




279: 407-409.




Coruzzi et al. (2001). Plant




Physiol. 125: 61-64.


Root Gravitropism And
Reactive Oxygen Species
Joo et al. (2001) Plant


Waving
(ROS) Such As Superoxide
Physiol. 126: 1055-60.



Anions And H2O2
Vitha et al. (2000). Plant



Production
Physiol. 122: 453-461.



Auxin Transport Pathways
Tasaka et al. (2001) Int Rev



Flavonoid Inhibition Of
Cytol 206: 135-54.



Auxin Transport Function
Brown et al. (2001) Plant



Changes In Root Cap Ph
Physiol 126: 524-35.



Starch Synthesis And
Fasano et al. (2001) Plant



Storage
Cell 13: 907-22.



Cell Differentiation
MacCleery et al. (1999).



Cell Elongation
Plant Physiol 120: 183-92




Blancaflor et al. (1998).




Plant Physiol 116: 213-22




Schneider et al. (1998) Genes




Devel 12: 2013-21









Other biological activities that can be modulated by the root genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


III.A.1.d. Use of Root Genes to Modulate Transcription Levels of Plant Genes


Many genes are “up regulated” or “down regulated” because they belong to networks or cascades of genes. Thus some root genes are capable of regulating many other gene activities via these networks and hence complex phenotypes. Examples of transcription profiles of root genes are described in the Table below with associated biological activities. “Up-regulated” profiles are those where the concentrations of the mRNA in total mRNA are higher in roots as compared to aerial parts of a plant; and vice-versa for “down-regulated” profiles.


















EXAMPLES OF


TRANSCRIPT

PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
TYPE OF GENES
CONSEQUENCES
ACTIVITY







Up Regulated
Genes Expressed In
Primary Root,
Transporters


Transcripts
Root Development
Lateral Root, and/or
Metabolic Enzymes



Responders To
Root Hair Growth
Change In Cell



Micro-Organismal
and Differentiation
Membrane Structure



Symbionts And
Microorganism
And Potential



Parasites
Perception
Kinases,



Genes involved in
Entrapment Of
Phosphatases, G-



polar Auxin transport
Microorganismal
Proteins



Genes involved in
Symbionts
Transcription



starch deposition in
Nutrient Uptake
Activators



the roots
Synthesis Of
Change In



Genes involved in
Metabolites And/Or
Chromatin Structure



production of reactive
Proteins
And/Or Localized



oxygen species
Modulation Of
DNA Topology



Genes involved in
Transduction
Cell Wall Proteins



flavonoid synthesis
Pathways
Ca++ Fluctuation




Specific Gene
Reactive Oxygen




Transcription
Species (ROS)




Initiation
production




Nutrient Uptake




Enhancement




Gravitropic growth




of roots




Associations with




rhizobia are




stimulated


Down-Regulated
Genes Repressed In
Negative
Transcription


Transcripts
Root Development
Regulation Of
Factors



Responders To
Primary Root,
Kinases,



Micro-Organismal
Lateral Root, and/or
Phosphatases, G-



Symbionts And
Root Hair
Proteins



Parasites
Production
Change In



Genes With
Released
Chromatin Structure



Discontinued
Changes In
And/Or DNA



Expression Or
Pathways And
Topology



UnsTable mRNA In
Processes
Stability Of Factors



Presence Of Root
Operating In Cells
For Protein



And/Or Micro-
Changes In
Synthesis And



Organismal
Metabolism
Degradation



Symbionts
Inhibition of root
Metabolic Enzymes




gravitropism









Changes in the function or development of roots are the result of modulation of the activities of one or more of these many root genes and gene products. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield, especially when plants are growing in the presence of soil borne biotic or abiotic stresses or when they are growing in barren conditions or in soils depleted of certain minerals.


Root genes, gene components and gene products can act alone or in combination as described in the introduction. Of particular interest are combinations of these genes and gene products with those that modulate stress tolerance and/or metabolism. Stress tolerance and metabolism genes and gene products are described in more detail in the sections below.


Use of Promoters of Root Genes


Promoters of root genes, as described in the Reference tables, for example, can be used to modulate transcription that is induced by root development or any of the root biological processes or activities above. For example, when a selected polynucleotide sequence is operably linked to a promoter of a root gene, then the selected sequence is transcribed in the same or similar temporal, development or environmentally-specific patterns as the root gene from which the promoter was taken. The root promoters can also be used to activate antisense copies of any coding sequence to achieve down regulation of its protein product in roots. They can also be used to activate sense copies of mRNAs by RNA interference or sense suppression in roots.


III.A.2. Root Hair Genes, Gene Components and Products


Root hairs are specialized outgrowths of single epidermal cells termed trichoblasts. In many and perhaps all species of plants, the trichoblasts are regularly arranged around the perimeter of the root. In Arabidopsis, for example, trichoblasts tend to alternate with non-hair cells or atrichoblasts. This spatial patterning of the root epidermis is under genetic control, and a variety of mutants have been isolated in which this spacing is altered or in which root hairs are completely absent.


III.A.2.a. Identification of Root Hair Genes


Root hair genes identified herein are defined as genes, gene components and products capable of modulating one or more processes in or the function of root hairs as described below. Root hairs are capable of controlling or influencing many plant traits, also as shown below. Examples of such root hair development genes and gene products are shown in the Reference and Sequence Tables. The protein products of many of these genes are also identified in these Tables.


Root Hair Genes Identified by Differential Expression


These genes were discovered and characterized from a much larger set of genes by experiments designed to find genes whose mRNA products are associated specifically with root hairs. These experiments made use of the arabidopsis mutant “root hairless” (rhl), which does not develop root hairs. By comparing gene expression profiles of rhl roots with those of wild type roots grown in identical conditions, genes specifically expressed in root hairs were revealed. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108594, 108433). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Root Hairs genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Root Hairs Genes Identified by Cluster Analyses of Differential Expression


Root Hairs Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Root Hairs genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108594, 108433 the MA_diff table(s).


Root Hairs Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Root Hairs genes. A group in the MA_clust is considered a Root Hairs pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Root Hairs Genes Identified by Amino Acid Sequence Similarity


Root Hairs genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Root Hairs genes. Groups of Root Hairs genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Root Hairs pathway or network is a group of proteins that also exhibits Root Hairs functions/utilities.


Examples of phenotypes, biochemical activities, and transcript profiles that can be modulated by these genes and gene products are described above and below.


III.A.2.b. Use of Root Hair Development Genes to Modulate Phenotypes


The root hair development genes of the instant invention are useful to modulate one or more processes of root hair structure and/or function including (1) development; (2) interaction with the soil and soil contents; (3) uptake and transport in the plant; and (4) interaction with microorganisms.


1.) Development


The surface cells of roots can develop into single epidermal cells termed trichoblasts or root hairs. Some of the root hairs will persist for the life of the plant; others will gradually die back; some may cease to function due to external influences. The genes and gene products of this invention are useful to modulate any one or all of these growth and development process generally, as in root hair density or root hair growth; including rate, timing, direction, and size, for example. Processes that are regulated by these genes and gene products include cell properties such as cell size, cell division, rate and direction and number, cell elongation, cell differentiation, lignified cell walls, epidermal cells (including trichoblasts) and root apical meristem cells (growth and initiation); and root hair architecture such as leaf cells under the trichome, cells forming the base of the trichome, trichome cells, and root hair responses.


The genes and gene products of this invention are useful to modulate one or more of the growth and development processes in response to internal plant programs or environmental stimuli in, for example, the seminal system, nodal system, hormone responses, Auxin, root cap abscission, root senescence, gravitropism, coordination of root growth and development with that of other organs (including leaves, flowers, seeds, fruits, and stems), and changes in soil environment (including water, minerals, Ph, and microfauna and flora).


2.) Interaction with Soil and Soil Contents


Root hairs are sites of intense chemical and biological activity and as a result can strongly modify the soil they contact. Roots hairs can be coated with surfactants and mucilage to facilitate these activities. Specifically, roots hairs are responsible for nutrient uptake by mobilizing and assimilating water, reluctant ions, organic and inorganic compounds and chemicals. In addition, they attract and interact with beneficial microfauna and flora. Root hairs also help to mitigate the effects of toxic ions, pathogens and stress. Examples of root hair properties and activities that the genes and gene products of the invention are useful to modulate include root hair surfactant and mucilage (including composition and secretion rate and time); nutrient uptake (including water, nitrate and other sources of nitrogen, phosphate, potassium, and micronutrients (e.g. iron, copper, etc.); microbe and nematode associations (such as bacteria including nitrogen-fixing bacteria, mycorrhizae, nodule-forming and other nematodes, and nitrogen fixation); oxygen transpiration; detoxification effects of iron, aluminum, cadium, mercury, salt, and other soil constituents; pathogens (including chemical repellents) glucosinolates (GSL1), which release pathogen-controlling isothiocyanates; and changes in soil (such as Ph, mineral excess and depletion), and rhizosheath.


3.) Transport of Materials in Plants


Uptake of the nutrients by the root and root hairs contributes a source-sink effect in a plant. The greater source of nutrients, the more sinks, such as stems, leaves, flowers, seeds, fruits, etc. can draw sustenance to grow. Thus, root hair development genes and gene products are useful to modulate the vigor and yield of the plant overall as well as of distinct cells, organs, or tissues of a plant. The genes and gene products, therefore, can modulate Vigor, including plant nutrition, growth rate (such as whole plant, including height, flowering time, etc., seedling, coleoptile elongation, young leaves, stems, flowers, seeds and fruit) and yield, including biomass (fresh and dry weight during any time in plant life, including maturation and senescence), number of flowers, number of seeds, seed yield, number, size, weight and harvest index (content and composition, e.g. amino acid, jasmonate, oil, protein and starch) and fruit yield (number, size, weight, harvest index, and post harvest quality).


Additional Uses of Plants with Modified Root Hairs


Plants with root hairs modified in one or more of the properties described above are used to provide:

    • A. Higher vigor and yield of plant and harvested products due to pathogen resistance from conditioning the soil with plant-derived chemicals and/or more tolerance to stresses such as drought, flooding and anoxia
    • B. Better Animal (Including Human) Nutrition
    • C. Improved Dietary Mineral Nutrition
    • D. Increased Plant Survival By Decreasing Lodging
    • E. Better Plant Survival By:
      • (a) Decreased Lodging
      • (b) More Efficient Transport
      • (c) More Efficient Physiology
      • (d) More Efficient Metabolism
    • F. Increased Yield Of Valuable Molecules


Root Hair Modulation


To regulate any of the phenotype(s) above, activities of one or more of the root hair genes or gene products is modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels are altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Dolan et al. (1993, Development 119: 71-84), Dolan et al. (1997, Development 124: 1789-98), Crawford and Glass (1998, Trends Plant Science 3: 389-95), Wang et al. (1998, PNAS USA 95: 15134-39), Gaxiola et al. (1998, PNAS USA 95: 4046-50), Apse et al. (1999, Science 285: 1256-58), Fisher and Long (1992, Nature 357: 655-60), Schneider et al. (1998, Genes Devel 12: 2013-21) and Hirsch (1999, Curr Opin Plant Biol. 2: 320-326).


III.A.2.c. Use of Root Hair Development Genes to Modulate Biochemical Activities


The activities of one or more of the root hair development genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the table below:















Biochemical Or Metabolic



Process
Activities And/Or Pathways
Citations Including Assays







Association
Functions Associated
Gage et al. (1996) J


Of Root Hair
With Root Hair Curling
Bacteriol 178: 7159-66


With Nitrogen
And Signal Transduction


Fixing Bacteria


Root Hair

Schneider et al. (1998)


Spacing

Genes Devel 12: 2013-21


Initiation


Elongation


Metabolism
Organic Molecule Export
Moody et al. (1988)




Phytochemistry 27:




2857-61



Ion Export
Uozumi et al. (2000) Plant




Physiol 122: 1249-59




Frachisse et al. (2000) Plant




J 21: 361-71


Nutrient
Nutrient Uptake
Frachisse et al. (2000) Plant


Uptake

J 21: 361-71




Uozumio et al. (2000) Plant




Physiol 122: 1249-59









Other biological activities that can be modulated by the root hair genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


III.A.2.d. Use of Root Hair Genes, Gene Components and Product to Modulate Transcription Levels


Many genes are “up regulated” or “down regulated” in root hairs or associated with root hair formation because genes are regulated in networks. Thus some root hairs genes are useful to regulate the activities of many other genes, directly or indirectly to influence complex phenotypes. Examples of transcription profiles of root genes are described in the Table below with associated biological activities. “Up regulated” profiles are those where the mRNA levels are higher when the rhl gene is inhibited as compared to when rhl gene is not inhibited; and vice-versa for “down-regulated” profiles.















Transcript

Physiological
Examples Of


Levels
Type Of Genes
Consequences
Biochemical Activity







Down Regulated
Genes Expressed In
Root Hair Formation
Transporters


Transcripts
Root Hair
Microorganism
Metabolic Enzymes



Development
Perception
Change In Cell



Responders To
Entrapment Of
Membrane Structure



Micro-Organismal
Microorganismal
And Potential



Symbionts And
Symbionts
Kinases,



Parasites
Nutrient Uptake
Phosphatases, G-




Synthesis Of
Proteins




Metabolites And/Or
Transcription




Proteins
Activators




Modulation Of
Change In Chromatin




Transduction
Structure And/Or




Pathways
Localized DNA




Specific Gene
Topology




Transcription
Cell Wall Proteins




Initiation




Nutrient Uptake




Enhancement


Up-Regulated
Genes Repressed In
Negative Regulation
Transcription Factors


Transcripts
Roots Making
Of Hair Production
Kinases,



Hairs
Released
Phosphatases, G-



Responders To
Changes In
Proteins



Micro-Organismal
Pathways And
Change In Chromatin



Symbionts And
Processes Operating
Structure And/Or



Parasites
In Cells
DNA Topology



Genes With
Changes In
Stability Of Factors



Discontinued
Metabolism
For Protein Synthesis



Expression Or

And Degradation



UnsTable mRNAIn

Metabolic Enzymes



Presence Of Root

Cell Wall Proteins



Hairs And/Or



Micro-Organismal



Symbionts









Changes in the patterning or development of root hairs are the result of modulation of the activities of one or more of these many root hair genes and gene products. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield, especially when plants are growing in the presence of biotic or abiotic stresses or when they are growing in barren conditions or in soils depleted of certain minerals.


Root hair genes and gene products can act alone or in combination as described in the introduction. Of particular interest are combination of these genes and gene products with those that modulate stress tolerance and/or metabolism. Stress tolerance and metabolism genes and gene products are described in more detail in the sections below.


Use of Promoters of Root Hair Genes

Promoters of root hair development genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by root hair development or any of the following phenotypes or biological activities above. For example, any desired sequence can be transcribed in similar temporal, tissue, or environmentally-specific patterns as the root hair genes when the desired sequence is operably linked to a promoter of a root hair responsive gene.


III.A.3. Leaf Genes, Gene Components and Products


Leaves are responsible for producing most of the fixed carbon in a plant and are critical to plant productivity and survival. Great variability in leaf shapes and sizes is observed in nature. Leaves also exhibit varying degrees of complexity, ranging from simple to multi-compound. Leaf genes as defined here, not only modulate morphology, but also influence the shoot apical meristem, thereby affecting leaf arrangement on the shoot, internodes, nodes, axillary buds, photosynthetic capacity, carbon fixation, photorespiration and starch synthesis. Leaf genes elucidated here can be used to modify a number of traits of economic interest from leaf shape to plant yield, including stress tolerance, and to modify the efficiency of synthesis and accumulation of specific metabolites and macromolecules.


III.A.3.a. Identification of Leaf Gene, Gene Components and Products Leaf genes identified herein are defined as genes, active or potentially active to greater extent in leaves than in some other organs of the plant or as genes that affect leaf properties. These genes and gene components are useful for modulating one or more processes in or functions of leaves, as described below, to improve plant traits ranging from yield to stress tolerance. Examples of such leaf genes and gene products are shown in the Reference and Sequence Tables and sequences encoding polypeptides of the Protein Group and Protein Group Matrix tables or fragments thereof, Knock-In, Knock-Out and MA_diff Tables. The biochemical functions of the protein products of many of these genes determined from comparisons with known proteins are also given in the Reference tables.


Leaf Genes Identified by Phenotypic Observations


Some leaf genes were discovered and characterized from a much larger set of genes by experiments designed to find genes that cause phenotypic changes in leaf, petiole, internode, and cotyledon morphology.


In these experiments, leaf genes were identified by either (1) ectopic expression of a cDNA in a plant or (2) mutagenesis of the plant genome. The plants were then cultivated and one or more of the following leaf phenotypes, which varied from the parental “wild-type”, were observed:

    • A. Changes In Seedling Stage Cotyledons
      • Cup Shaped
      • Curled
      • Horizontally Oblong
      • Long Petioles
      • Short Petioles
      • Silver
      • Tricot
      • Wilted
    • B. Changes In Rosette And Flowering Stage Leaf Shapes
      • Cordate
      • Cup-Shaped
      • Curled
      • Fused
      • Lanceolate
      • Lobed
      • Long Petioles
      • Short Petioles
      • Oval
      • Ovate
      • Serrate
      • Trident
      • Undulate
      • Vertically Oblong
    • C. Changes In Cauline, Flowering Leaf Shape
      • Misshapen
      • Other
    • D. Changes In Leaf Pigment
      • Albino
      • Dark Green Pigment
      • High Anthocyanin
      • Interveinal Chlorosis
      • Yellow Pigment
    • E. Changes In Leaf Size
    • F. Changes In Seedling Stage Hypocotyl
      • Long
      • Short
    • G. Changes In Leaf Number
    • H. Changes In Wax Deposition
      • Glossy Rosette And Flowering Stage Leaves
      • Altered Wax Deposition On The Bolt


Leaf Genes Identified by Differential Expression


Also, leaf genes were identified in experiments in which the concentration of mRNA products in the leaf, or stem, or Knock-out mutant 3642-1 were compared with to a control. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108477, 108512, 108497, 108498, 108598). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Leaf genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Leaf Genes Identified by Cluster Analyses of Differential Expression


Leaf Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Leaf genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108477, 108512, 108497, 108498, 108598 of the MA_diff table(s).


Leaf Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Leaf genes. A group in the MA_clust is considered a Leaf pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Leaf Genes Identified by Amino Acid Sequence Similarity


Leaf genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Leaf genes. Groups of Leaf genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Leaf pathway or network is a group of proteins that also exhibits Leaf functions/utilities.


It is assumed that (i) the genes preferentially expressed in leaves are concerned with specifying leaf structures and the synthesis of all the constituent molecules and (ii) that the genes repressed in leaves specify products that are not required in leaves or that could inhibit normal leaf development and function.


Examples of phenotypes, biochemical activities, and transcription profiles that are modulated by using selected members of these genes and gene products, singly or in combination, are described below.


III.A.3.b. Use of Leaf Genes, Genes Components and Products to Modulate Phenotypes


Leaves are critical for the performance and industrial utility of plants. There is extensive evidence that the number, size, shape, position, timing of synthesis, timing of senescence and chemical constitution are very important for agriculture, horticulture and uses of plants as chemical factories for making valuable molecules. Many improvements already demonstrated over past decades have involved genetic modifications to leaves. Therefore, the leaf genes and gene components of this invention offer considerable opportunities for further improving plants for industrial purposes. When the leaf genes and/or gene components are mutated or regulated differently, they are capable of modulating one or more of the processes determining leaf structure and/or function including (1) development; (2) interaction with the environment and (3) photosynthesis and metabolism.


1.) Development


The leaf genes, gene components and products of the instant invention are useful to modulate one or more processes of the stages of leaf morphogenesis including: stage 1-organogenesis that gives rise to the leaf primordium; stage 2-delimiting basic morphological domains; and stage 3-a coordinated processes of cell division, expansion, and differentiation. Leaf genes include those genes that terminate as well as initiate leaf development. Modulating any or all of the processes leads to beneficial effects either at specific locations or throughout the plant, such as in the cotyledons, major leaves, cauline leaves, or petioles.


Leaf genes, gene components and gene products are useful to modulate changes in leaf cell size, cell division (rate and direction), cell elongation, cell differentiation, stomata size, number, spacing and activity, trichome size and number, xylem and phloem cell numbers, cell wall composition, and all cell types. The leaf genese are also useful to modulate to change overall leaf architecture, including veination (such as improvements in photosynthetic efficiency, stress tolerance efficiency of solute and nutrient movement to and from the leaf are accomplished by increases or decreases in vein placement and number of cells in the vein); shape, either elongated versus rounded or symmetry, around either (e.g. abaxial-adaxial (dorsiventral) axis, apical-basal (proximodistal) axis, and margin-blade-midrib (lateral) axis; and branching (improved plant performance to biotic and abiotic stress in heavy density planting is achieved by increases or decreases in leaf branch position or leaf branch length).


Shoot apical meristem cells differentiate to become leaf primordia that eventually develop into leaves. The genes, gene components and gene products of this invention are useful to modulate any one or all of these growth and development processes, by affecting timing and rate or planes of cell divisions for example, in response to the internal plant stimuli and/or programs such as embryogenesis; germination; hormones like Auxin leaf senescence; phototropism; coordination of leaf growth and development with that of other organs (such as roots, flowers, seeds, fruits, and stems; and stress-related programs.


2.) Interaction with the Environment


Leaves are the main sites of photosynthesis and have various adaptations for that purpose. Flat laminae provide a large surface for absorbing sunlight; leaves are rich in chloroplasts and mitochondria; stomata in the lower surface of the laminae allow gases to pass into and out of the leaves including water; and an extensive network of veins brings water and minerals into the leaves and transports the sugar products produced by photosynthesis to the rest of the plant. examples of leaf properties or activities that are modulated by leaf genes, gene components and their products to facilitate interactions between a plant and the environment including pigment accumulation; wax accumulation on the surface of leaves (e.g. improved protection of young leaves from water borne pathogen attack such as downey mildew with increased wax production); oxygen gain/loss control; carbon dioxide gain/loss control; water gain/loss control; nutrient transport; light harvesting; chloroplast biogenesis; circadian rhythm control; light/dark adaptation; defense systems against biotic and abiotic stresses; metabolite accumulation; and secondary metabolite production in leaf mesophyl, epidermis and trichomes (such as increases in antifeeding secondary metabolites such as strictosiden reduce herbivory and decreases in secondary metabolites improve plants as forage by reducing allergens or undigestible compounds). 3.) Photosynthesis And Metabolism


Many of the uses for plants depend on the success of leaves as the powerhouses for plant growth, their ability to withstand stresses and their chemical composition. Leaves are organs with many different cell types and structures. Most genes of a plant are active in leaves and therefore leaves have very diverse of pathways and physiological processes. Pathways and processes that are modulated by leaf genes, gene components and products include photosynthesis, sugar metabolism, starch synthesis, starch degradation, nitrate and ammonia metabolism, amino acid biosynthesis, transport, protein biosynthesis, dna replication, repair, lipid biosynthesis and breakdown, protein biosynthesis, storage and breakdown, nucleotide transport and metabolism, cell envelope biogenesis, membrane formation, mitochondrial and chloroplast biogenesis, transcription and RNA metabolism, vitamin biosynthesis, steroid and terpenoid biosynthesis, devise secondary metabolite synthesis, co-enzyme metabolism, flavonoid biosynthesis and degradation, synthesis of waxes, glyoxylate metabolism, and hormone perception and response pathways.


Uses of Plants that are Modified as Described Above


Altering leaf genes or gene products in a plant modifies one or more plant traits, to make the plants more useful for specific purposes in agriculture, horticulture and for the production of valuable molecules. The modified plant traits include A higher yield of leaves and their molecular constituents (due to different number, size, weight, harvest index, composition including and amounts and types of carbohydrates, proteins, oils, waxes, etc.; photosynthetic efficiency (e.g. reduced photorespiration), absorption of water and nutrients to enhance yields, including under stresses such as high light, herbicides, and heat, pathways to accumulate new valuable molecules); more optimal leaf shape and architecture—enhancing photosynthesis and enhancing appeal in ornamental species (including size, number, pigment, and aroma; a better overall plant architecture—enhancing photosynthesis and enhancing appeal in ornamental species petals, sepals, stamens, and carpels; better shade avoidance for maximizing photosynthesis by, for example, altering leaf placement, to improve light capture and photosynthetic efficiency, thereby increasing yields; Reduced negative effects of high planting density, by altering leaf placement to be more vertical instead of parallel to the ground, for instance; More resistance to the deleterious effects of wind and mechanical damage; Better stress tolerance (including without limitation drought resistance, by decreasing water loss, and pathogen resistance, including, for instance, insect resistance through internal insecticide levels and optimizing the leaf shape to prevent runoff of insecticides); and better overall yield and vigor.


Plant yield of biomass and of constituent molecules and plant vigor are modulated to create benefits by genetically changing the growth rate of the whole plant, (including height, flowering time, etc.), seedling, coleoptile elongation, young leaves flowers, seeds, and/or fruit, or by changing the biomass, including fresh and dry weight during any time in plant life, (including maturation and senescence), number of flowers, seed yield including for example, number, size, weight, harvest index, content and composition (e.g. amino acid, jasmonate, oil, protein and starch0, and fruit yield (such as number, size, weight, harvest index, content and composition, e.g. amino acid, jasmonate, oil, protein and starch).


To change any of the phenotype(s) in I, II, or III above, activities of one or more of the leaf genes or gene products are modulated in an organism and the consequence evaluated by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels are altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (Methods. Mol. Biol. 82:259-266 (1998)) with leaf gene constructs and/or screened for variants as in Winkler et al., Plant Physiol. 118: 743-50 (1998) and visually inspected for the desired phenotype and metabolically and/or functionally assayed for altered levels of relevant molecules.


III.A.3.c. Use of Leaf Genes, Gene Components and Products to Modulate Biochemical Activities


Leaves are complex organs and their structure, function and properties result from the integration of many processes and biochemical activities. Some of these are known from the published literature and some can be deduced from the genes and their products described in this application. Leaf genes, and gene components are used singly or in combination to modify these processes and biochemical activities and hence modify the phenotypic and trait characteristics described above. Examples of the processes and metabolic activities are given in the Table below. The resulting changes are measured according to the citations included in the Table.















BIOCHEMICAL OR
CITATIONS



METABOLIC ACTIVITIES
INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Metabolism - anabolic
Farnesylation
Pei et al., Science 282: 287-290


and catabolic
Cell Wall Biosynthesis
(1998); Cutler et al.,



Nitrogen Metabolism

Science 273: 1239 (1996)




Secondary Metabolite
Goupil et al., J Exptl. Botany



Biosynthesis and
49: 1855-62 (1998)



Degradation
Walch-Liu et al., J Exppt.





Botany 51, 227-237 (2000)



Water Conservation And
Stomatal Development And
Allen et al., Plant Cell 11:


Resistance To Drought
Physiology
1785-1798 (1999)


And Other Related
Production of polyols
Li et al., Science 287: 300-303


Stresses
Regulation of salt
(2000)


Transport Anion and
concentration
Burnett et al., J Exptl. Botany


Cation Fluxes
ABA response(s)
51: 197-205 (2000)



Ca2+ Accumulation
Raschke, In: Stomatal



K+ Fluxes

Function, Zeiger et al. Eds.,




Na+ Fluxes
253-279 (1987)



Receptor - ligand binding
Lacombe et al., Plant Cell 12:



Anion and Cation fluxes
837-51 (2000);




Wang et al., Plant Physiol.




118: 1421-1429 (1998);




Shi et al., Plant Cell 11:




2393-2406 (1999)




Gaymard et al., Cell 94: 647-655




(1998)




Jonak et al., Proc. Natl. Acad.





Sci. 93: 11274-79 (1996);





Sheen, Proc. Natl. Acad. Sci.




95: 975-80 (1998);




Allen et al., Plant Cell 11:




1785-98 (1999)


Carbon Fixation
Calvin Cycle
Wingler et al., Philo Trans R



Photorespiration

Soe Lond B Biol Sci 355,




Oxygen evolution
1517-1529 (2000);



RuBisCO
Palecanda et al., Plant Mol



Chlorophyll metabolism

Biol 46, 89-97 (2001);




Chloroplast Biogenesis and
Baker et al., J Exp Bot 52,



Metabolism
615-621 (2001)



Fatty Acid and Lipid
Chen et al., Acta Biochim Pol



Biosynthesis
41, 447-457 (1999)



Glyoxylate metabolism
Imlau et al., PlantCell II, 309-322



Sugar Transport
(1999)



Starch Biosynthesis and



Degradation


Hormone Perception and
Hormone Receptors and
Tieman et al., Plant J 26, 47-58


Growth
Downstream Pathways for
(2001)



ethylene
Hilpert et al., Plant J 26, 435-446



jasmonic acid
(2001)



brassinosteroid
Wenzel et al., Plant Phys



gibberellin
124, 813-822 (2000)



Auxin
Dengler and Kang, Curr Opin



cytokinin

Plant Biol 4, 50-56 (2001)




Activation Of Specific
Tantikanjana et al., Genes



Kinases And Phosphatases

Dev 15, 1577-1580 (2001)










Other biological activities that are modulated by the leaf genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table, for example.


III.A.3.d. Use of Leaf Genes, Gene Components and Products to Modulate Transcription Levels


The expression of many genes is “upregulated” or downregulated” in leaves because some leaf genes and their products are integrated into complex networks that regulate transcription of many other genes. Some leaf genes, gene components and products are therefore useful for modifying the transcription of other genes and hence complex phenotypes, as described above. Profiles of leaf gene activities are described in the Table below with associated biological activities. “Up-regulated” profiles are those where the mRNA transcript levels are higher in leaves as compared to the plant as a whole. “Down-regulated” profiles represent higher transcript levels in the whole plant as compared to leaf tissue only.


















EXAMPLES OF



TYPE OF GENES
PHYSIOLOGICAL
BIOCHEMICAL



WHOSE
CONSEQUENCES OF
ACTIVITIES OF GENE


TRANSCRIPT
TRANSCRIPTS
MODIFYING GENE
PRODUCTS WITH


LEVELS
ARE CHANGED
PRODUCT LEVELS
MODIFIED LEVELS







Up Regulated
Genes Involved In
Leaf Cells
Transcription


Transcripts
Leaf Cell
Proliferate And
Factors, Signal



Differentiation, Cell
Differentiate;
Transduction



Division, Cell

Proteins, Kinase



Expansion

And Phosphatases



Genes Involved In
Leaf Structures
Chromatin



Positive Regulation
Form And Expand
Remodeling



Of Leaf Genes

Hormone



Repressors Of Root

Biosynthesis



And Other Non Leaf

Enzymes



Cell Types

Receptors



Genes Involved In
Photosynthesis And
Light Harvesting



Photosynthesis
Plastid
Coupled To ATP




Differentiation
Production





Chlorophyll





Biosynthesis




Calvin Cycle
Ribulose




Activated
Bisphosphate




Chloroplast
Carboxylase




Biogenesis And
Chloroplast




Plastid
Membranes




Differentiation
Synthesis




Activated
Chloroplast





Ribosome





Biogenesis



Other Genes
Starch Biosynthesis
Starch Synthase



Involved In
Lipid Biosynthesis
Nitrate Reductase



Metabolism
Nitrogen
Terpenoid




Metabolism - NO3
Biosynthesis




Reduced And
Transcription




Amino Acids Made
Factors




Secondary
Transporters




Metabolites
Kinases




Produced
Phosphatases And





Signal Transduction





Protein





Chromatin Structure





Modulators


Down
Genes Involved In
Leaf Genes
Transcription


Regulated
Negative Regulation
Activated And Leaf
Factors


Genes
Of Leaf Genes
Functions Induced;
Signal Transduction




Dark-Adapted
Proteins - Kinases




Metabolism
And Phosphatases




Suppressed
Metabolic Enzymes




Meristematic Genes
Chromatin




Suppressed
Remodeling Proteins




Leaf Metabolic




Pathways Induced









While leaf polynucleotides and gene products are used singly, combinations of these polynucleotides are often better to optimize new growth and development patterns. Useful combinations include different leaf polynucleotides and/or gene products with a hormone responsive polynucleotide. These combinations are useful because of the interactions that exist between hormone-regulated pathways, nutritional pathways and development.


Use of Leaf Gene Promoters

Promoters of leaf genes are useful for transcription of desired polynucleotides, both plant and non-plant. If the leaf gene is expressed only in leaves, or specifically in certain kinds of leaf cells, the promoter is used to drive the synthesis of proteins specifically in those cells. For example, extra copies of carbohydrate transporter cDNAs operably linked to a leaf gene promoter and inserted into a plant increase the “sink” strength of leaves. Similarly, leaf promoters are used to drive transcription of metabolic enzymes that alter the oil, starch, protein, or fiber contents of a leaf. Alternatively, leaf promoters direct expression of non-plant genes that can, for instance, confer insect resistance specifically to a leaf. Additionally the promoters are used to synthesize an antisense mRNA copy of a gene to inactivate the normal gene expression into protein. The promoters are used to drive synthesis of sense RNAs to inactivate protein production via RNA interference.


III.A.4. Trichome Genes and Gene Components


Trichomes, defined as hair-like structures that extend from the epidermis of aerial tissues, are present on the surface of most terrestrial plants. Plant trichomes display a diverse set of structures, and many plants contain several types of trichomes on a single leaf. The presence of trichomes can increase the boundary layer thickness between the epidermal tissue and the environment, and can reduce heat and water loss. In many species, trichomes are thought to protect the plant against insect or pathogen attack, either by secreting chemical components or by physically limiting insect access to or mobility on vegetative tissues. The stellate trichomes of Arabidopsis do not have a secretory anatomy, but at a functional level, they might limit herbivore access to the leaf in the field. In addition, trichomes are known to secrete economically valuable substances, such as menthol in mint plants.


III.A.4.a. Identification of Trichome Genes, Gene Components and Products


Trichome genes identified herein are defined as genes or gene components capable of modulating one or more processes in or functions of a trichome, as described below. These genes, their components and products are useful for modulating diverse plant traits from production of secondary metabolites to pathogen resistance. Examples of such trichome genes and gene products are shown in the Reference and Sequence Tables and sequences encoding polypeptides of the Protein Group and Protein Group Matrix tables or fragments thereof, Knock-in, Knock-out, MA-diff and MA-clust. The biochemical functions of the protein products of many of these genes determined from comparisons with known proteins are also given in the Reference tables.


Trichome Genes Identified by Phenotypic Observation


Trichome genes were discovered and characterized from a much larger set of genes by experiments designed to find genes that cause phenotypic changes in trichome number and morphology on leaf, internode, cotyledon, petiole, and inflorescence. In these experiments, trichome genes were identified by either (1) ectopic expression of a cDNA in a plant or (2) mutagenesis of the plant genome. The plants were then cultivated and one or more of the following phenotypes, which varied from parental “wild-type”, were observed: (1) trichome number; (2) trichome spacing (clustering); or (3) trichome branching. The genes regulating trichome phenotypes are identified in the Knock-In and Knock-Out Tables.


Trichome Genes Identified by Differential Expression Trichome genes were also discovered and characterized from a much larger set of genes by experiments designed to find genes whose mRNA products are associated specifically or preferentially with trichomes. These experiments made use of an Arabidopsis glaborous mutant and a hairy mutant. By comparing gene expression profiles of the glabrous mutant with those of the hairy mutant grown under identical conditions, genes specifically or preferentially expressed in trichomes were revealed. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108452). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Trichome genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Trichome Genes Identified by Cluster Analyses of Differential Expression


Trichome Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Trichome genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108452 of the MA_diff table(s).


Trichome Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Trichome genes. A group in the MA_clust is considered a Trichome pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Trichome Genes Identified By Amino Acid Sequence Similarity


Trichome genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Trichome genes. Groups of Trichome genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Trichome pathway or network is a group of proteins that also exhibits Trichome functions/utilities.


It is assumed that the genes differentially expressed in trichomes or leaves producing trichomes are concerned with specifying trichomes and their functions and therefore modulations of such genes and their products modify trichomes and their products.


Examples of phenotypes, biochemical activities, and transcription profiles that can be modulated by selected numbers of these genes and gene products singly or in combinations are described above and below.


III.A.4.b. Use of Trichome Genes, Gene Components and Products to Modulate Phenotypes


Trichome genes of the instant invention, when mutated or activated differently, are useful for modulating one or more processes of trichome structure and/or function including: (1) development; (2) plant stress tolerance; and (3) biosynthesis or secretion of trichome-specific molecules. Trichome genes, components and gene products are useful to alter or modulate one or more of the following phenotypes:


1.) Development


Trichome differentiation is integrated with leaf development, hormone levels and the vegetative development phase. The first trichome at the leaf tip appears only after the leaf grows to ˜100 μm in length. Subsequent events proceed basipetally as the leaf grows. As leaf development progresses, cell division patterns become less regular and islands of dividing cells can be observed among differentiated pavement cells with their characteristic lobed morphology. Trichome initiation in the expanding leaf occurs within these islands of cells and often defines points along the perimeter of a circle, with an existing trichome defining the center.


Once a cell enters the trichome pathway it undergoes an elaborate morphogenesis program that has been divided into different stages based on specific morphological hallmarks. The trichome genes, gene components and gene products of this invention are useful to modulate any one or all of these growth and development processes by affecting rate, timing, direction and size, for example. Trichome genes can also affect trichome number and the organs on which they occur, type of trichomes such as glandular trichomes and stellate trichomes; cell properties such as cell size, cell division rate and direction, cell elongation, cell differentiation, secretory cells, trichome number (average trichome number per leaf for mint: 13,500,000), cell walls, cell death, and response to reactive oxygen species; trichome architecture such as trichome cell structure, placement on leaf, and secretory systems; and trichome responses. Trichome genes, gene components and gene products of this invention are useful to modulate one or more of the growth and development processes above; as in timing and rate, for example. In addition, the polynucleotides and polypeptides of the invention can control the response of these processes to internal plant programs and signaling molecules such as leaf development, hormones (including abscisic acid, Auxin, cytokinin, gibberellins, and brassinosteroids, apoptosis; and coordinated trichome growth and development in flowers, stems, petioles, cotyledons, and hypocotyls.


2.) Plant Stress Tolerance


The physical characteristics of trichomes as well as the substances secreted by trichomes are useful in protecting the plant from both biotic and abiotic attacks. Thus, selected trichome genes and gene products can be used to help protect distinct cells, organs, or tissues as well as overall plant yield and vigor. Examples of stresses, tolerances to which are modulated by trichome genes and gene products are drought (e.g., trichome number variation can decrease the surface area that allows evaporation), heat (e.g., trichomes can produce shade and provide protection for meristems), salt, insects (e.g., trichomes can prevent insects from settling on plant surfaces), herbivory (e.g., trichomes can produce harmful chemicals), and ultraviolet light.


3.) Biosynthesis, Accumulation or Secretion of Metabolites


The glandular trichomes from various species are shown to secrete and, sometimes, locally synthesize a number of substances including salt, monoterpenes and sesquiterpenes, terpenoids, exudate, insect entrapping substances, antifeedants, pheromones, and others. Therefore, trichome genes can be used to modulate the synthesis, accumulation and secretion of a large number of metabolites especially related to trichome biology. Some are synthesized in response to biotic and abiotic stresses. For a more detailed description of these metabolites see the section “Use of Trichome Genes to Modulate Biochemical Activities” below.


Uses of Plants that are Modified as Described Above


Altering trichome properties is useful for modifying one or more plant traits making the plants more useful in agriculture, horticulture and for the production of valuable molecules. These plant traits include Production of specific carbohydrates, proteins, oils, aromas, flavors, pigments, secondary metabolites such as menthol (and other monoterpenes), etc., that can be used in situ or purified and used in a wide variety of industries; Increased production of molecules synthesized in trichomes by increasing the trichome number on different plant organs, such as cotyledons, leaves, hypocotyls, stems, petioles, etc.; Increased cotton fibers per boll due to decreased numbers of trichomes that reduces insect hiding and contamination; More optimal growth rate of a whole plant or specific parts of a plant due to more optimal trichome cellular development and the better resistance to biotic/abiotic stresses (including plant parts such as whole plant seedling, coleoptile elongation, young leaves, flowers, seeds, and fruit); increased harvested yield of plants, organs and their constituent molecules including biomass (such as fresh and dry weight during any time in plant life, including maturation and senescence, number of flowers, seed yield in terms of number, size, weight, harvest index, content and composition, e.g. amino acid, jasmonate, oil, protein and starch, and fruit yield in terms of number, size, weight, harvest index, post harvest quality, content and composition, e.g. amino acid, jasmonate, oil, protein and starch).


To regulate any of the phenotype(s) above, activities of one or more of the trichome genes or gene products can be modulated in an organism and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (Methods. Mol. Biol. 82:259-266 (1998)) and/or screened for variants as in Winkler et al., Plant Physiol. 118: 743-50 (1998) and visually inspected for the desired phenotype or metabolically and/or functionally assayed.


III.A.4.c. Use of Trichome Genes, Gene Components and Products to Modulate Biochemical Activities


The phenotype traits outlined above result from the integration of many cellular trichome associated processes and biochemical activities. Some of these are known from published literature and some can be deduced from the genes discovered in the MA Tables, etc. One or more of these trichome genes, gene components and products are useful to modulate these cellular processes, biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the table below:















BIOCHEMICAL OR




METABOLIC



ACTIVITIES AND/OR
CITATIONS INCLUDING


PROCESS
PATHWAYS
ASSAYS







Growth, Differentiation
Cell wall biosynthetic
Molhoj et. al. (2001). Plant


And Development
enzymes
Mol. Biol. 46, 263-275



Cell fate determination
Krishnakumar and



proteins
Oppenheimer (1999).



Major pathways of carbon
Development 1221, 3079-3088.



and nitrogen metabolism
Kroumova et al. (1994).




PNAS 91, 11437-11441


Water
Cytoskeleton and Trichome
Schnittger et al. (1999).


Conservation And
morphology and spacing
Plant Cell 11, 1105-1116


Resistance To
controls
Hulskamp et al (1994). Cell


Drought And

76, 555-566


Other Related


Stresses


Trichome exudate
Insect repellant
Insects and The Plant




Surface, pp 151-172,




Edward Arnold, London




(1986)


Terpenoid
Terpenoid biosynthesis
Alonso et al. (1992). J. Biol.


biosynthesis
enzymes including:
Chem. 267, 7582-7587


including
Farnesyltranstransferase
Rajonarivony et al (1992).


monoterpenes and
Geranylgeranyl-
Arch. Biochem. Biophys.


sesquiterpenes
diphosphate synthase
299, 77-82



Geranyltranstransferase



Farnesyl-diphosphate



synthase



Dimethylallyltranstransferase



Geranyl-diphosphate



synthase


H2O2
NADPH oxidase (subunit)
Alverez et al (1998) Cell 92,


accumulation and
synthesis and function
773-784


activation of SAR

Grant Orozco-Cardenas and




Ryan (1999) PNAS 96,




6553-6557


Antifeedants
Lactone biosynthesis
Paruch et al. (2000). J.


biosynthesis and
enzymes
Agric. Food Chem. 48,


secretion

4973-4977


Pheromone
Farnesine biosynthesis
Teal et al. (1999) Arch.


biosynthesis and
enzymes
Insect Biochem Physiol. 42,


secretion

225-232


Endoreplication
Cyclin and cyclin dependant
De Veylder et al. (2001)



kinases
Plant Cell 13, 1653-1668




De Veylder et al. (2001)




Plant J. 25, 617-626









Specific enzyme and other activities associated with the functions of individual trichome genes that can be modulated by the trichome genes and gene products are listed in the Reference tables where the functions of individual genes and their products are listed. Assays for detecting such biological activities are described in the Protein Domain table, for example.


III.A.4.d. Use of Trichome Genes, Gene Components and Products to Modulate Phenotypes by Modulating Transcription Levels of Other Genes


Many of the genes are “up regulated” or “down regulated” in trichomes because they are regulated as members of networks or cascade of genes under the control of regulatory genes. Thus some trichome genes are useful to influence levels of other genes and so orchestrate the complex phenotypes. Examples of the types of genes with altered transcript levels in trichomes are described in the Table below, together with associated biological activities. “Up-regulated” profiles are those where the mRNA levels are higher in the glaborous plants as compared to the“hairy” plant. “Down-regulated” profiles represent higher transcript levels in the “hairy” plant as compared to the glaborous plant.

















PHYSIOLOGICAL
EXAMPLES OF



TYPE OF GENES
CONSEQUENCES
BIOCHEMICAL



WHOSE
OF MODIFYING
ACTIVITIES WHOSE


TRANSCRIPT
TRANSCRIPTS ARE
GENE PRODUCT
TRANSCRIPTS ARE


LEVELS
CHANGED
LEVELS
CHANGED







Up Regulated
Genes active in
Changes in
Transcription


Transcripts
suppressing trichome
Hormone
Factors



formation
Perception
Transporters




Changes in
Change In Cell G-




Hormone
proteins




Biosynthesis
Kinases And




Changes in
Phosphatases




Specific Gene
Transcription




Transcription
factors




Initiation
Ca-binding proteins




Changes in
Transcription




cytoskeleton and
Activators




cell wall
Change In




assembly and
Chromatin




structure
Structure And/Or





Localized DNA





Topology





Specific Factors





(Initiation And





Elongation) For





Protein Synthesis





Maintenance Of





mRNA Stability





Maintenance Of





Protein Stability





Maintenance Of





Protein-Protein





Interaction


Down-Regulated
Genes active in
Changes in
Transcription


Transcripts
inducing formation of
Hormone
Factors



trichomes
Perception
Change In Protein



Genes associated with
Changes in
Structure By



Trichome
Hormone
Phosphorylation



differentiation and
Biosynthesis
(Kinases) Or



structure
Changes in
Dephosphorylation



Genes associated with
Specific Gene
(Phosphatases)



trichome-specific
Transcription
Change In



metabolic pathways
Initiation
Chromatin




Changes in
Structure And/Or




cytoskeleton and
DNA Topology




cell wall
G-proteins, Ca2+-




assembly and
binding proteins




structure




Changes in cell




size, cell shape




Changes in




terpenoid




biosynthesis




Changes in




antifeedant and




pheromone




biosynthesis









While trichome polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth, development and leaf biochemistry. Combinations of trichome polynucleotide(s) and/or gene product(s) with genes or gene products involved in leaf development, hormone responses, or vegetative development are useful because trichome development is integrated with these processes.


Use of Promoters of Trichome Genes

Promoters of trichome genes are useful for facilitating transcription of desired polynucleotides, both plant and non-plant in trichomes. For example, extra copies of existing terpenoid synthesis coding sequences can be operably linked to a trichome gene promoter and inserted into a plant to increase the terpenoids in the trichome. Alternatively, trichome promoters can direct expression of non-plant genes or genes from another plant species that can, for instance, lead to new terpenoids being made. The promoters can also be operably linked to antisense copies of coding sequences to achieve down regulation of these gene products in cells.


III.A5. Chloroplast Genes, Gene Components and Products


The chloroplast is a complex and specialized organelle in plant cells. Its complexity comes from the fact that it has at least six suborganellar compartments subdivided by double-membrane envelope and internal thylakoid membranes. It is specialized to carry out different biologically important processes including photosynthesis and amino acid and fatty acid biosynthesis. The biogenesis and development of chloroplast from its progenitor (the proplasptid) and the conversion of one form of plastid to another (e.g., from chloroplast to amyloplast) depends on several factors that include the developmental and physiological states of the cells.


One of the contributing problems that complicate the biogenesis of chloroplast is the fact that some, if not most, of its components must come from the outside of the organelle itself. The import mechanisms must take into account to what part within the different sub-compartments the proteins are being targeted; hence the proteins being imported from the cytoplasm must be able to cross the different internal membrane barriers before they can reach their destinations. The import mechanism must also take into account how to tightly coordinate the interaction between the plastid and the nucleus such that both nuclear and plastidic components are expressed in a synchronous and orchestrated manner. Changes in the developmental and physiological conditions within or surrounding plant cells can consequently change this tight coordination and therefore change how import mechanisms are regulated as well. Manipulation of these conditions and modulation of expression of the import components and their function can have critical and global consequences to the development of the plant and to several biochemical pathways occurring outside the chloroplast. Expression patterns of such genes have been determined using microarray technology.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing about 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in a mutant in a mutant (CiA2) of Arabidopsis thaliana, that is distributed in chloroplast biogenesis relative to wild type grown in the same conditions were identified, compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones identified. The MA_diff table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones that are involved in the import of proteins to chloroplast and chloroplast biogenesis.


Examples of genes and gene products that are involved in the import of proteins to chloroplast are shown in the Reference, Sequence, Protein Group, and Protein Group Matrix tables. While chloroplast protein import polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different chloroplast protein import responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Manipulation of one or more chloroplast protein import gene activities are useful to modulate the biological processes and/or phenotypes listed below. Chloroplast protein import responsive genes and gene products can act alone or in combination. Useful combinations include chloroplast protein import responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. Manipulation of one or more chloroplast protein import gene activities are useful to modulate the biological processes and/or phenotypes listed below.


Such chloroplast protein import responsive genes and gene products can function to either increase or dampen the above phenotypes or activities in response to changes in the regulation of import mechanisms. Further, promoters of chloroplast protein transport responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by chloroplast protein transport or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the chloroplast protein transport responsive genes when the desired sequence is operably linked to a promoter of a chloroplast protein transport responsive gene. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Chloroplast (relating to SMD 8093, SMD 8094)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Chloroplast genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Chloroplast Genes Identified by Cluster Analyses of Differential Expression Chloroplast


Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Chloroplast genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Chloroplast (relating to SMD 8093, SMD 8094) of the MA_diff table(s).


Chloroplast Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Chloroplast genes. A group in the MA_clust is considered a Chloroplast pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Chloroplast Genes Identified by Amino Acid Sequence Similarity


Chloroplast genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Chloroplast genes. Groups of Chloroplast genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Chloroplast pathway or network is a group of proteins that also exhibits Chloroplast functions/utilities.


III.A.5.a. Use of Chloroplast Protein Import Responsive Genes to Modulate Phenotypes


Chloroplast protein import responsive genes and gene products are useful to or modulate one or more phenotypes, including growth, roots, stems, and leaves; development, including plastid biogenesis, plastid division, plastid development and thylakoid membrane structures differentiation including plastid/chloroplast differentiation; photosynthesis including carbon dioxide fixation; transport including transcription/translation regulation within transport complex, phosphate translocation, and targeted starch deposition and accumulation; and biosynthesis of essential compounds such as lipid biosynthesis, riboflavin biosynthesis, carotenoid biosynthesis, and aminoacid biosynthesis.


To improve any of the phenotype(s) above, activities of one or more of the chloroplast protein import responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Saito et al. (1994, Plant Physiol. 106: 887-95), Takahashi et al (1997, Proc. Natl. Acad. Sci. USA 94: 11102-07) and Koprivova et al. (2000, Plant Physiol. 122: 737-46).


III.A.5.b. Use of Chloroplast Protein Import-Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the chloroplast protein import responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the table below:















BIOCHEMICAL OR
CITATIONS



METABOLIC ACTIVITIES
INCLUDING


GENERAL CATEGORY
AND/OR PATHWAYS
ASSAYS







Cell Growth and
Regulation of Leaf
Reinbothe et al. (1997) Proc.


Differentiation
Development Including
Natl. Acad. Sci. USA.



Photosynthetic
94: 8890-8894



Apparatus
Eggink and Hoober (2000) J.




Biol. Chem. 275: 9087-9090




Jagtap et al. (1998) J Exptl




Botany 49: 1715-1721



Regulation of Plastid
Lawrence and Kindle (1997)



Biogenesis and Plastid
J. Biol. Chem. 272: 20357-20363



Division
Lahiri and Allison (2000)




Plant Physiol. 123: 883-894



Development of Plastid
Kouranov et al. (1999) J.



Inner/Outer and
Biol. Chem. 274: 25181-25186



thylakoid Membrane
Jackson et al. (1998) J. Biol.



Structures
Chem. 273: 16583-16588




Li and Chen (1997) J. Biol.




Chem. 272: 10968-10974




Lawrence and Kindle (1997)




J. Biol. Chem. 272: 20357-20363




Silva-Filho et al. (1997) J.




Biol. Chem. 272: 15264-15269



Regulation of
May and Soll (2000) Plant



transcription and/or
Cell 12: 53-63



translation related to
Caliebe et al. (1997) EMBO



maintenance of stability
J. 16: 7342-7350



of protein-protein



interaction within



transport complex


Physiology
Modulation of
Sung and Krieg (1979) Plant



Photosynthesis
Physiol 64: 852-56



Regulation of Lipid
Bourgis et al. (1999) Plant



Biosynthesis
Physiol. 120: 913-922




Reverdatto et al. (1999)




Plant Physiol. 119: 961-978




Roesler et al. (1997) Plant




Physiol. 113: 75-81



Regulation of Riboflavin
Jordan et al. (1999) J. Biol.



(Vitamin B) biosynthesis
Chem. 274: 22114-22121



Regulation of phosphate
Flugge (1999) Annu. Rev.



translocation across
Plant Physiol. Plant Mol.



chloroplast membrane
Biol. 50: 27-45




Silva-Filho et al.




(1997) J. Biol. Chem.




272: 15264-15269



Regulation of targeted
Yu et al. (1998) Plant



starch depostion and
Physiol. 116: 1451-1460



accumulation



Modulation of protein
Summer and Cline (1999)



targeting and
Plant Physiol. 119: 575-584



translocation across
Dabney-Smith et al. (1999)



chloroplast membrane
J. Biol. Chem. 274: 32351-32359




Hinnah et al. (1997) EMBO




J. 16: 7351-7360



Regulation of carotenoid
Bonk et al. (1996) Plant



biosynthesis
Physiol. 111: 931-939



Regulation of amino acid
Flugge (1999) Annu. Rev.



biosynthesis
Plant Physiol. Plant Mol.




Biol. 50: 27-45



Regulation of secondary
Flugge (1999) Annu. Rev.



metabolism
Plant Physiol. Plant Mol.




Biol. 50: 27-45


Signal Transduction
Regulation of gene
Chen et al. (2000) Plant



transcriptional activity
Physiol. 122: 813-822.



specific to chloroplast
Macasev et al. (2000) Plant



protein import
Physiol. 123: 811-816.



Regulation of protein
Lang et al. (1998) J. Biol.



target signal cleavage
Chem. 273: 30973-30978



and protein degradation
Jackson et al. (1998) J. Biol.




Chem. 273: 16583-16588




Richter and Lamppa (1998)




Proc. Natl. Acad. Sci. USA.




95: 7463-7468



Regulation of ion
Van der Wijngaard and



channel conformation
Vredenberg (1999) J. Biol.



and activity
Chem. 274: 25201-25204



Regulation of kinase and
Waegemann and Soll (1996)



phosphatases synthesis
J. Biol. Chem. 271: 6545-6554



and activity
Li et al. (2000) Science 287-300-303




Muller et al. (2000) J. Biol.




Chem. 275: 19475-19481



Modulation of Molecular
Bonk et al. (1996) Plant



Chaperone and Other
Physiol. 111: 931-939



Protein Folding Activity
Walker et al. (1996) J. Biol.




Chem. 271: 4082-4085




Kessler and Blobel (1996).




Proc. Natl. Acad. Sci. USA




93: 7684-7689




Jackson et al. (1998) J. Biol.




Chem. 273: 16583-16588









Other biological activities that can be modulated by the chloroplast protein import responsive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Chloroplast protein import responsive genes are characteristically differentially transcribed in response to fluctuating chloroplast protein import levels or concentrations, whether internal or external to an organism or cell. The MA_diff reports the changes in transcript levels of various chloroplast protein import responsive genes that are differentially expressed among the mutants and the wild type.


Profiles of some of these chloroplast protein import responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF


TRANSCRIPT

PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
TYPE OF GENES
CONSEQUENCES
ACTIVITY







Up regulated
Responders to
Chloroplast
Transporters


transcripts
defective chloroplast
protein import
Metabolic enzymes



protein import
regulation
Change in cell



Genes induced by
Chloroplast
membrane structure



defective import
protein import and
and potential




transport
Kinases and




Chloroplast
phosphatases




import
Transcription




metabolism
activators




Synthesis of
Change in




secondary
chromatin structure




metabolites and/or
and/or localized




proteins
DNA topology




Modulation of
Redox control




chloroplast import
Metabolic enzymes




response
concerned with




transduction
chloroplast




pathways
biochemistry




Changes in
Organelle gene




chloroplast
expression and




membranes
translation




Specific gene




transcription




initiation




Chloroplast and




non-chloroplast




metabolic




pathways


Down-regulated
Responders to
Regulation of
Transcription


transcripts
defective chloroplast
chloroplast protein
factors



protein import.
import pathways
Change in protein



Genes repressed by
released
structure by



defective chloroplast
Chloroplast
phosphorylation



protein import
protein import and
(kinases) or



Genes with unsTable
transport
dephosphoryaltion



mRNAs when
Chloroplast
(phosphatases)



chloroplast import is
import
Change in



defective
metabolism
chromatin structure



Genes with
Changes in
and/or DNA



discontinued
pathways and
topology



expression or
processes
Stability factors for



unsTable mRNA in
operating in
protein mRNA



presence of
chloroplasts
synthesis and



chloroplast protein
Changes in
degradation



import
organelle
Organelle




membranes
transcription and




Loss of organelle
translation proteins




gene expression,
Metabolic enzymes




RNA and protein




synthesis




Changes in




metabolism other




than chloroplast




protein import




pathways




Chloroplast




import




metabolism









Use of Promoters of Chloroplast Genes

Promoters of Chloroplast genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Chloroplast genes where the desired sequence is operably linked to a promoter of a Chloroplast gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression


III.A.6. Reproduction Genes, Gene Components and Products


Reproduction genes are defined as genes or components of genes capable of modulating any aspect of sexual reproduction from flowering time and inflorescence development to fertilization and finally seed and fruit development. These genes are of great economic interest as well as biological importance. The fruit and vegeTable industry grosses over $1 billion USD a year. The seed market, valued at approximately $15 billion USD annually, is even more lucrative.


Expression of many reproduction genes and gene products is orchestrated by internal programs or the surrounding environment of a plant, as described below. These genes and/or products have great importance in determining traits such as fruit and seed yield. Examples of such reproduction genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix tables, Knock-in, Knock-out, MA-diff and MA-clust. The biochemical functions of the protein products of many of these genes determined from comparisons with known proteins are also given in the Reference tables.


Reproduction Genes Identified by Phenotypic Observation


Reproduction genes were discovered and characterized from a much larger set of genes by experiments designed to find genes that cause phenotypic changes in flower, silique, and seed morphology. In these experiments, reproduction genes were identified by either (1) ectopic expression of a cDNA in a plant or (2) mutagenesis of the plant genome. The plants were then cultivated and phenotypes, which varied from the parental “wild-type”, were observed.


One particular example of reproductive genes are those that are regulated by AP2. AP2 is a transcription factor that regulates many genes, both as a repressor of some genes and as an activator of others. Some of these genes are those which establish the floral meristem or those which regulate floral organ identity and development. As such, AP2 has an effect on reproduction. This is, loss of AP2 activity is correlated with decreased male and female reproduction. AP2 is also known to have an effect on seed mass, and therefore on yield. That is, overexpression of AP2 is correlated with smaller seeds or seedless fruit while repression of AP2 correlates with larger seeds (see, e.g. U.S. Pat. No. 5,994,622).


Another example of reproduction genes are those that are regulated by PISTILLATA (PI). PI is a transcription factor that regulates many genes both as a repressor and activator. Some of these genes are those which regulate floral organ identity and development, in conjunction with other transcription factors such as AP2 and AGAMOUS. As such, PI has an effect on reproduction in that loss of PI activity is correlated with decreased male reproduction. PI is also known to have an effect on carpel number, and therefore potentially on ovule/seed number and yield. Specifically, repression of PI results in increased carpel number and therefore ovule number.


Yet another example of reproductive genes are those that are regulated by MEDEA (MEA). MEA is a SET-domain containing protein that associates with other proteins to form complexes that affect chromatin structure and therefore gene expression. As such, loss of MEA function is correlated with global gene activation and repression leading to many phenotypes including decreased female reproduction and therefore reduced seed set and yield.


In the characterization of these and other reproduction genes, the following phenotypes were scored:


I. Flower

    • Size
      • Large
      • Small
    • Shape
      • Abnormal organ numbers
      • Agamous
      • AP-2 like
    • Color
    • Number
    • Fused Sepals


II. Silique

    • Size
    • Seed number
      • Reduced
      • Absent
    • Seed color


The identified genes regulating reproduction are identified in the Knock-in and Knock-out Tables.


Reproduction Genes Identified by Differential Expression


Reproduction genes were also identified in experiments designed to discover genes whose mRNA products were in different concentrations in whole flowers, flower parts, and siliques relative to the plant as a whole. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108473, 108474, 108429, 108430, 108431, 108475, 108476, 108501). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Reproduction genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Reproduction Genes Identified by Cluster Analyses of Differential Expression


Reproduction Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Reproduction genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108473, 108474, 108429, 108430, 108431, 108475, 108476, 108501 of the MA_diff table(s).


Reproduction Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Reproduction genes. A group in the MA_clust is considered a Reproduction pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Reproduction Genes Identified by Amino Acid Sequence Similarity


Reproduction genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Reproduction genes. Groups of Reproduction genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Reproduction pathway or network is a group of proteins that also exhibits Reproduction functions/utilities.


It is assumed that the reproduction genes differentially expressed in floral parts and seeds are concerned with specifying flowers and seeds and their functions, and therefore modulations of such genes produce variant flowers and seeds.


Reproductive genes and gene products can function to either increase or dampen the phenotypes, biochemical activities and transcription profiles, either in response to changes of internal plant programs or to external environmental fluctuations.


III.A.5.a. Use of Reproduction Genes, Gene Components and Products to Modulate Phenotypes


The reproduction genes of the instant invention, when mutated or activated differently, are capable of modulating one or more processes of flower, seed and fruit development. They are thus useful for improving plants for agriculture and horticulture and for providing seeds with a better chemical composition for diverse industries including the food, feed and chemical industries. Reproduction genes, gene components and products are useful to alter the following traits and properties of plants, including development, such as flowering time and number of inflorescences, flower development (including anther, stamen, pollen, style, stigma, ovary, ovule, and gametes), pollination and fertilization (including sporogenesis gametogenesis, zygote formation, embryo development, endosperm development, and male sterility, hybrid breeding systems and heterosis); cellular properties, such as cell size, cell shape, cell death, cell division, cell elongation, cell differentiation, and meiosis; organ characteristics, such as flowers, receptacle, sepals, petals, and tepals color, shape, and size, number, and petal drop); androecium, such as stamen (including anther size, pollen sterile, size, shape, weight and color, number, and filament size), gynoecium, such as carpel, ovary. number. and length) and style (stigma, ovule, size, shape, and number); pedicel and peduncle (size and shape), seeds, such as placenta, embryo. cotyledon, endosperm, suspensor, seed coat (testa), aleurone, development, including apomixis (gametophytic, apospory, diplospory), dormancy and germination; fruits, such as pericarp—thickness, texture (exocarp, mesocarp, endocarp); development (seed set, fruit set, false fruit, fruit elongation and maturation, and dehiscence), and fruit drop; plant seed yield, such as increased biomass, better harvest index, attraction of favorable insects, better seed quality, and better yield of constituent chemicals; and plant population features, such as architecture (shade avoidance and planting density).


To regulate any of the phenotype(s) above, activities of one or more of the reproduction genes or gene products can be modulated in an organism and tested by screening for the desired trait. Specifically, the gene, mRNA levels or protein levels can be altered in a plant using the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (Methods Mol. Biol. 82:259-266 (1998)) and/or screened for variants as in Winkler et al. (Plant Physiol 118:743-50 (1998)) and visually inspected for the desired phenotype or metabolically and/or functionally assayed.


III.A.5.b. Use of Reproduction Genes to Modulate Biochemical Activities


The activities of one or more of the reproduction genes can be modulated to change biochemical or metabolic activities and/or pathways such as those examples noted below. Such biological activities can be measured according to the citations included in the Table below:















EXAMPLES OF




BIOCHEMICAL/MOLECULAR


FUNCTION/PROCESS
ACTIVITIES
Reference AND ASSAY







Metabolism
Energy production and
Ap Rees, T. (1974). In



conversion
“Plant Biochemistry.



Glucosyl-transferase
Biochemistry, Series One”,



(CLONE_ID 1040)
Vol. 11. (H. L. Kornberg and



Heme-binding protein
D. C. Phillips, eds.),



(putative cytochrom
Butterworths, London.



B5)
Juliano, B. O. and Varner, J. E.



(CLONE_ID 3743)
(1969). Plant Physiol.



Storage protein synthesis
44, 886-892.



Inorganic ion transport and
Bewley et al. (1993). Plant



metabolism
Physiol. Biochem. 31, 483-490.



Peroxidase
Hills, M. J. and Beevers, H.



(CLONE_ID 100990)
(1987). Plant Physiol. 84,



Cystathione beta
272-276.



synthase
Olsen, L. J. and Harada, J. J.



(CLONE_ID 21847)
(1991). In “Molecular



Amino acid transport and
Approaches to



metabolism
Compartmentalization and



l-asparaginase
Metabolic Regulation (A. H. C. Huang



(CLONE_ID 92780)
and L. Taiz, eds.),



Putative peptide/amino
ASPP, Rockville, Md.



acid
Mitsuhashi, W. and Oaks, A.



transporter
(1994). Plant Physiol.



(CLONE_ID 113723)
104, 401-407.



Carbohydrate transport and
Walker-Smith, D. J., and



metabolism
Payne, J. W. (1985). Planta



Glucose transport
164, 550-556.



protein
Salmenkallio, M. and



(CLONE_ID 33727)
Sopanen, T. (1989). Plant



Putative sugar
Physiol. 89, 1285-1291.



transporter
Baumgartner, B. and



(CLONE_ID 3250)
Chrispeels, M. J. (1976).



Starch biosynthesis
Plant Physiol. 58, 1-6.



Coenzyme metabolism
Elpidina, E. N. et al. (1991).



Tyrosine
Planta 185, 46-52.



aminotransferase
Ericson, M. C. and



(ROOTY/SUPERROOT1)
Chrispeels, M. J. (1973).



(CLONE_ID 14570)
Plant Physiol. 52, 98-104.



Formate dehydrogenase
Kern, R. and Chrispeels, M. J.



(CLONE_ID 7530)
1978) Plant Physiol. 62,



Lipid metabolism
815-819.



Branched chain α-
Dilworth, M. F. and Dure, L.



ketoacid
III. (1978). Plant Physiol.



dehydrogenase E2
61, 698-702.



subunit
Chrispeels, M. J. and Jones, R. L.



(CLONE_ID 25116)
(1980/81). Isr. J. Bot.



Acyl carrier protein-1
29, 222-245.



(CLONE_ID 14291)
Gould, S. E. B., and Rees, D. A.



Lipid metabolic enzymes
(1964). J. Sci. Food



Secretion
Agric. 16, 702-709.



Sensor protein RcsC-



like



(CLONE_ID 16461)



Signal recognition



particle



RP54 (CLONE_ID



22158)


Modulate floral organ
Transcriptional control
Elliot et al. (1996). Plant


number
ANT (AP2-domain) DNA
Cell 8, 155-168.



binding protein
Sakai et al. (2000). Plant



SUP (Zinc finger)
Cell 12, 1607-1618.




Jacobsen and Meyerowitz




(1997). Science 277, 1100-1103.


Floral organ size
Transcriptional control
Mizukami et al. (2000).



ANT (AP2-domain) DNA
PNAS 97, 942-947.



binding protein
Krizek (1999).




Developmental Genetics 25,




224-236.


Female organ
Membrane receptor kinase
Clark and Meyerowitz


number/Floral meristem
signal transduction
(1997). Cell 89, 575-585


size
CLV1 (LRR domain and
Jeong et al. (1999). Plant



kinase domain) receptor
Cell 11, 1925-1934.



CLV2 (LRR domain)
Fletcher et al. (1999).



receptor
Science 283, 1911-1914.



CLV3 (Receptor ligand)


Female reproduction
DNA binding protein
Yanofsky et al. (1990).



AG (MADS domain) DNA
Nature 346, 35-39.



binding protein


Female reproduction
Signal transduction
Kieber et al. (1993). Cell



CTR1 (Raf kinase)
72, 427-441.


Male organ number
DNA methylation
Jacobsen and Meyerowitz



MET1 (DNA
(1997). Science 277, 1100-1103.



methyltransferase)


Seed size control
DNA binding protein
Jofuku et al. (1994). Plant



AP2 (AP2 domain)
Cell 6, 1211-1225.



RAP2 (AP2 domain)
US Patent #6,093,874;




#5,994,622


Seed size control
Polycomb group protein
Luo et al. (2000). PNAS 97,



complex
10637-10642.



FIE, FIS2, MEA


Seed size control
DNA methylation
Scott et al. (2000).



MET1
Development 127, 2493-2502.




Vinkenoog et al. (2000).




Plant Cell 12, 2271-2282.




Luo et al. (2000). PNAS 97,




10637-10642.


Embryo
CAAT box binding complex
Lotan et al. (1998). Cell 93,


development/Embryo
LEC1/HAP3
1195.


viability
HAP2, HAP5
US Patent #6,235,975


Embryo development/Seed
DNA binding proteins
Finkelstein et al. (1998).


dormancy
ABI4 (AP2 domain)
Plant Cell 10, 1043-1054.



FUS3 (B3 domain)
Luerssen et al. (1998). Plant



VP1 (B3 domain)
J. 15, 755-764.


Embryo development
Signal transduction
Leung et al. (1994). Science



ABI1, ABI2
264, 1448-1452.



[Serine/threonine protein
Leung et al. (1997). Plant



phosphatase 2C (PP2C)]
Cell 9, 759-771.


Endosperm development
Chromatin level control of
Ohad et al. (1996). PNAS



gene activity
93, 5319-5324.



Polycomb complex; FIE,
US Patent #6,229,064



MEA, FIS2
Kiyosue et al. (1999).




PNAS 96, 4186-4191.




Grossniklaus et al. (1998).




Science 280, 446-450.




Chaudhury et al. (1997)




PNAS 94, 4223-4228.


Integument
DNA binding
Jofuku et al. (1994). Plant


development/Seed coat
AP2, ANT (AP2 domain)
Cell 6, 1211-1225.


development
BEL1 (Homeodomain)
Klucher et al. Plant Cell 8,




137-153.




Reiser et al. (1995). Cell 83,




735-742.


Anthocyanin production
Secondary transporter
Debeaujon et al. (2001).



TT12 (MATE; multidrug and
Plant Cell 13, 853-872.



toxic compound extrusion)


Anthocyanin production
DNA binding protein
Nesi et al. (2000). Plant Cell



TT8 (Basic helix-loop-helix
12, 1863-1878.



domain)


Fruit development
Chromatin level control of
Ohad et al. (1996). PNAS



gene activity
93, 5319-5324.



Polycomb complex; FIE,
Kiyosue et al. (1999).



MEA, FIS2
PNAS 96, 4186-4191.




Grossniklaus et al. (1998).




Science 280, 446-450.




Chaudhury et al. (1997)




PNAS 94, 4223-4228.


Fruit size control
Signal transduction
Frary et al. (2000). Science



FW2.2 (c-Ras P21)
289, 85-88.


Fruit development/Pod
Transcriptional control
Liljegren et al. (2000).


shattering
SHP1, SHP2, FUL (MADS
Nature 404, 766-770.



domain) DNA binding
Ferrandiz et al. (2000).



proteins
Science 289, 436-438..


Transcription and
Transcription
Delseny, M. et al. (1977).


Posttranscription
SRF-domain AGL11
Planta 135, 125-128.



(CLONE_ID 32791)
Lalonde, L. and Bewley, J. D.



AP2-domain containing
(1986). J. Exp. Bot. 37,



protein (CLONE_ID
754-764.



332)
Walling, L. et al. (1986).



Myb-DNA binding
PNAS 83, 2123-2125.



protein
Okamuro, J. K. and



(CLONE_ID 94597)
Goldberg, R. B. (1989). In



Transcription factors
“Biochemistry of Plants,



Signal transduction
Vol 15.” Academic Press,



mechanisms
Inc.



Protein-kinases
Wong, J. et al. (1995).



Phosphatases
Genes Dev. 9, 2696-2711.



meiosis proteins
Dimitrov et al. (1994). J.



Chromatin remodeling
Cell Biol. 126, 591-601.



proteins
Landsberger, N. and



Chaperones
Wolffe, A. P. (1997).



Chalcone synthase
EMBO J. 16, 4361-4373.



Putative Ser/Thr protein
Bogdanove, A. J. and



kinase (CLONE_ID
Martin, G. G. (2000). PNAS



31383)
97, 8836-8840.



ER6-like protein
Zhu, H. et al. Science Jul.



(implicated in ethylene
26, 2001:



signal transduction)
10.1126/science.1062191



(CLONE_ID 7474)
(Reports).



Translation, ribosomal



structure and biogenesis



Ribosomal proTein



S15A



(CLONE_ID 17466)



Translation initiation



factor



(CLONE_ID 103464)



Posttranslational



modification, protein



turnover, chaperones



DnaJ-domain containing



protein (CLONE_ID



4150)



Cyclophilin-like protein



(CLONE_ID 35643)


Cell division and Repair
Cell division and
Rogan, P. G. and Simon, E. W.



chromosome partitioning
(1975). New Phytol. 74,



Protein of unknown
273-275.



function
Morahashi, Y. and Bewley, J. D.



with tropomyosin-,
(1980). Plant Physiol



myosin
66, 70-73.



tail- and filament-
Morahashi, Y. et al. (1981).



domains
Plant Physiol. 68, 318-323.



(CLONE_ID 15546)
Morahashi, Y. (1986).



Actin-1
Physiol. Plant. 66, 653-658.



(CLONE_ID 25785)
Zlatanova, J. et al. (1987).



DNA replication,
Plant Mol. Biol. 10, 139-144.



recombination and repair
Zlatanova, J. and Ivanov, P.



Proliferating cell
(1988). Plant Sci. 58, 71-76.



nuclear



antigen-1 (axillary



protein,



DNA polymerase I



delta)



(CLONE_ID 28554)



AAA-type ATPase,



cdc48



(CLONE_ID 100292)



Cell envelope biogenesis,



outer membrane



dTDP-D-glucose 4,6-



dehydratase



(CLONE_ID 28597)



Putative cinnamoyl-



CoA



reductase



(CLONE_ID 109228)









Other biological activities that are modulated by the reproductive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table, for example.


III.5.A.c. Use of Reproduction Genes, Gene Components and Products to Modulate Transcription Levels


Reproduction genes are characteristically differentially transcribed in response to cell signals such as fluctuating hormone levels or concentrations, whether internal or external to an organism or cell. Many reproduction genes belong to networks or cascades of genes under the control of regulatory genes. Thus some reproduction genes are useful to modulate the expression of other genes. Examples of transcription profiles of reproduction genes are described in the Table below with associated biological activities. “Up-regulated” profiles are those where the mRNA transcript levels are higher in flowers, flower parts or siliques as compared to the plant as a whole. “Down-regulated” profiles represent higher transcript levels in the whole plant as compared to flowers, flower parts or siliques alone.


















EXAMPLES OF





BIOCHEMICAL




PHYSIOLOGICAL
ACTIVITIES OF



TYPE OF GENES
CONSEQUENCES
GENES WITH


TRANSCRIPT
WITH ALTERED
OF ALTERING
ALTERED


LEVELS
ACTIVITY
GENE EXPRESSION
EXPRESSION







Up Regulated
Genes that control
Flowers form from
Transcription Factors


Transcripts
flower differentiation,
flower meristem
Signal transduction


Flower
number and size
Floral organs mature
Membrane Structure


Reproduction
Genes that promote
Flavonoid pathways
Protein kinases


Genes
petal, stamen and
induced
Phosphatases



carpel formation

Meiosis proteins



Genes controlling

Chromatin



flower-specific

remodeling proteins



metabolism such as

Chaperones



petal pigments

Chalcone synthase



Genes that promote

Amino acid transport



ovule formation

and metabolism



Genes that promote

Storage protein



fertilization, seed,

synthesis



embryo and

Lipid metabolic



endosperm formation

enzymes





Carbohydrate





transport and





metabolism





Starch biosynthesis


AP2
Genes activated by
Many steps and
Proteins associated


Reproduction
AP2 transcription
pathways induced,
with:


Genes
factors
developmental and
Energy production



Genes that induce
metabolic
and conversion



petal and stamen
No petals or stamens
Amino acid transport



formation
produced
and metabolism





Carbohydrate





transport and





metabolism





Lipid metabolism





Transcription and





signal transduction





Poor translational





modification





DNA replication





Chromatin





remodeling


Down-Regulated
Genes that repress
Flowers form from
Transcritipion factors


Transcripts
flower development
flower meristem
Signal transduction


Flower
Genes that induce
Non-floral organs are
pathways


Reproduction
stem, leaf and other
repressed
Kinases and


Genes
organ differentiation
Flower-specific
phosphatases


AP2 Reproduction
Genes that negatively
pathways are induced
Chromatin


Genes
regulate flower
Many steps and
remodeling proteins



specific metabolism
pathways induced,
Proteins associated



Genes that negatively
developmental and
with:



regulate ovule
metabolic
Energy production



formation, meiosis,
No petals or stamens
and conversion



fertilization and seed
produced
Amino acid transport



development

and metabolism



Genes activated by

Carbohydrate



AP2 transcription

transport and



factors

metabolism



Genes that induce

Lipid metabolism



petal and stamen

Transcription and



formation

signal transduction





Poor translational





modification





DNA replication





Chromatin





remodeling









While polynucleotides and gene products modulating reproduction can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different polynucleotides and/or gene products of the instant invention that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. In addition, the combination of a polynucleotide and/or gene product(s) capable of modulating reproduction with a hormone responsive polynucleotide, particularly one affected by gibberellic acid and/or Auxin, is also useful because of the interactions that exist between hormone-regulated pathways, and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways.


Use of Promoters and Reproduction Genes

Promoter of reproduction genes are useful for transcription of desired polynucleotides, both plant and non-plant. For example, extra copies of carbohydrate transporter genes can be operably linked to a reproduction gene promoter and inserted into a plant to increase the “sink” strength of flowers or siliques. Similarly, reproduction gene promoters can be used to drive transcription of metabolic enzymes capable of altering the oil, starch, protein or fiber of a flower or silique. Alternatively, reproduction gene promoters can direct expression of non-plant genes that can, for instance confer insect resistance specifically to a flower.


III.A.7. Ovule Genes, Gene Components and Products


The ovule is the primary female sexual reproductive organ of flowering plants. It contains the egg cell and, after fertilization occurs, contains the developing seed. Consequently, the ovule is at times comprised of haploid, diploid and triploid tissue. As such, ovule development requires the orchestrated transcription of numerous polynucleotides, some of which are ubiquitous, others that are ovule-specific and still others that are expressed only in the haploid, diploid or triploid cells of the ovule.


Although the morphology of the ovule is well known, little is known of these polynucleotides and polynucleotide products. Mutants allow identification of genes that participate in ovule development. As an example, the pistillata (PI) mutant replaces stamens with carpels, thereby increasing the number of ovules present in the flower. Accordingly, comparison of transcription levels between the wild-type and PI mutants allows identification of ovule-specific developmental polynucleotides.


Changes in the concentration of ovule-specific polynucleotides during development results in the modulation of many polynucleotides and polynucleotide products. Examples of such ovule-specific responsive polynucleotides and polynucleotide products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff, and MA_clust tables. These polynucleotides and/or products are responsible for effects on traits such as fruit production and seed yield.


While ovule-specific developmentally responsive polynucleotides and polynucleotide products can act alone, combinations of these polynucleotides also affect fruit and seed growth and development. Useful combinations include different ovule-specific developmentally responsive polynucleotides and/or polynucleotide products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. In addition, the combination of an ovule-specific developmentally responsive polynucleotide and/or polynucleotide product with an environmentally responsive polynucleotide is also useful because of the interactions that exist between development, hormone-regulated pathways, stress pathways and nutritional pathways. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in a common pathway. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108595). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Ovule genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Ovule Genes Identified by Cluster Analyses of Differential Expression


Ovule Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Ovule genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108595 of the MA_diff table(s).


Ovule Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Ovule genes. A group in the MA_clust is considered a Ovule pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Ovule Genes Identified by Amino Acid Sequence Similarity


Ovule genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Ovule genes. Groups of Ovule genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Ovule pathway or network is a group of proteins that also exhibits Ovule functions/utilities.


Such ovule-specific developmentally responsive polynucleotides and polynucleotide products can function to either increase or dampen the above phenotypes or activities either in response to transcript changes during ovule development or in the absence of ovule-specific polynucleotide fluctuations. More specifically, ovule-specific developmentally responsive polynucleotides and polynucleotide products are useful to or modulate one or more of the phenotypes, including egg cell, maturation (for development of parthenogenic embryos), metabolism, polar nuclei, fusion (for development of parthenogenic endosperm), central cell, maturation, metabolism (for alteration of endosperm metabolism), synergids, maturation, programmed cell death, nucellus, maturation, integuments, maturation, funiculus, extension (for increased seed), cuticle, maturation, tensile properties (for increased seed size), ovule, modulation of ovule senescence, and shaping (for increased seed number).


To produce the desired phenotype(s) above, one or more of the ovule-specific developmentally responsive polynucleotides and polynucleotide products can be tested by screening for the desired trait. Specifically, the polynucleotide, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Weigel et al. (2000, Plant Physiol 122: 1003-14) and Winkler et al. (1998, Plant Physiol 118: 743-50).


Alternatively, the activities of one or more of the ovule-specific developmentally responsive polynucleotides and polynucleotide products can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC


GENERAL
ACTIVITIES


CATEGORY
AND/OR PATHWAYS
ASSAY







Cell Growth and
Programmed Cell Death
Pennell and Lamb


Differentiation
DNA Methylation and
(1997) Plant Cell 9,



Imprinting
1157-1168




Adams et al. (2000)




Development 127:




2493-502


Organ Growth and
Ovule Growth and
De Martinis and


Development
Development
Mariani (1999)



Ethylene Response
Plant Cell 11:



Megagametophyte
1061-72



Development
Christensen et al.



Seed Growth and
(1997) Sexual Plant



Development
Reproduc 10: 49-64



Fertilization
Scott et al. (1998)



Independent
Development 125:



Seed Development
3329-41




Ohad et al. (1996)




PNAS USA 93:




5319-24




Chaudhury et al.




(1997) PNAS USA




94: 4223-28


Signal Transduction
Ethylene Metabolism
DeMartinis and



Protein Remodeling
Mariani (1999)



Sucrose Mobilization
Plant Cell 11:



and
1061-1072



Partitioning
Winkler et al.



Pollen Tube Adhesion
(1998) Plant



Jasmonic Acid
Physiol 118: 743-750



Biosynthesis


Senescence and Cell
Apomixis


Death


Environmental
Wound and Defense
Epple and


Responses
Response Gene
Bohlmann (1997)



Expression
Plant Cell 9: 509-20



Stress Response
He et al. (1998)




Plant J. 14: 55-63









Other biological activities that can be modulated by the ovule-specific developmentally responsive polynucleotides and polynucleotide products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table section.


Ovule-specific developmentally responsive polynucleotides are characteristically differentially transcribed in response to fluctuating developmental-specific polynucleotide levels or concentrations, whether internal or external to a cell. The MA_diff Table reports the changes in transcript levels of various ovule-specific developmentally responsive polynucleotides in ovules.


These data can be used to identify a number of types of ovule-specific developmentally responsive polynucleotides. Profiles of these different ovule-specific developmentally responsive polynucleotides are shown in the Table below with examples of associated biological activities.


















EXAMPLES OF


TRANSCRIPTS

PHYSIOLOGICAL
BIOCHEMICAL


AFFECTED BY
TYPES OF GENES
CONSEQUENCES
ACTIVITY







Ethylene Signals
Responders to
Ethylene Perception
Transcription


Protein
Ethylene
Ethylene Uptake
Factors


Remodeling

Modulation of Ethylene
Transporters




Response Transduction
Inhibit Transport of




Pathways
Abscissic acid




Specific Gene
Degradation




Transcription Initiation




Repression of Pathways




to Optimize Abscissic




acid Response Pathways


Lower at 1 hours
High Abscissic acid
Negative Regulation of
Abscissic acid


than 6 hours
Responders
Abscissic acid Pathways
Metabolic Pathways



Repressor of Abscissic



acid Deprivation



Pathways









Use of Promoters of Ovule Genes

Promoters of Ovule genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Ovule genes where the desired sequence is operably linked to a promoter of a Ovule gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.A.8. Seed and Fruit Development Genes, Gene Components and Products


The ovule is the primary female sexual reproductive organ of flowering plants. At maturity it contains the egg cell and one large central cell containing two polar nuclei encased by two integuments that, after fertilization, develops into the embryo, endosperm, and seed coat of the mature seed, respectively. As the ovule develops into the seed, the ovary matures into the fruit or silique. As such, seed and fruit development requires the orchestrated transcription of numerous polynucleotides, some of which are ubiquitous, others that are embryo-specific and still others that are expressed only in the endosperm, seed coat, or fruit. Such genes are termedfruit development responsive genes.


Changes in the concentration of fruit-development responsive polynucleotides during development results in the modulation of many polynucleotides and polynucleotide products. Examples of such fruit development responsive polynucleotides and polynucleotide products relative to leaves and floral stem are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff, MA_clust, Knock-in and Knock-out tables. The polynucleotides were discovered by isolating fruits at developmental stages from Arabidopsis wild-type ecotype “Wassilewskija”, and measuring the mRNAs expressed in them relative to those in a leaf and floral stem sample. These polynucleotides and/or products are responsible for effects on traits such as seed size, seed yield, seed composition, seed dormancy, fruit ripening, fruit production, and pod shattering.

    • While fruit development responsive polynucleotides and polynucleotide products can act alone, combinations of these polynucleotides also affect fruit and seed growth and development. Useful combinations include different polynucleotides and/or polynucleotide products that have similar transcription profiles or similar biological activities, and members of the same or functionally similar biochemical pathways. In particular, modulation of transcription factors and/or signal transduction pathways are likely to be useful for manipulating whole pathways and hence phenotypes. In addition, the combination of ovule-developmentally responsive polynucleotides and/or polynucleotide products with environmentally responsive polynucleotides is also useful because of the interactions that exist between development, hormone-regulated pathways, stress and pathogen induced pathways and nutritional pathways. Here, useful combinations include polynucleotides that may have different transcription profiles, and participate in common or overlapping pathways but combine to produce a specific, phenotypic change.


Such fruit development responsive polynucleotides and polynucleotide products can function to either increase or dampen the above phenotypes or activities either in response to transcript changes in fruit development or in the absence of fruit development polynucleotide fluctuations.


The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108436, 108437, 108438). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Fruit genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Fruit Genes Identified by Cluster Analyses of Differential Expression


Fruit Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Fruit genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108436, 108437, 108438 of the MA_diff table(s).


Fruit Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Fruit genes. A group in the MA_clust is considered a Fruit pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Fruit Genes Identified by Amino Acid Sequence Similarity


Fruit genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Fruit genes. Groups of Fruit genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Fruit pathway or network is a group of proteins that also exhibits Fruit functions/utilities.


Use of Fruit Development Responsive Genes to Modulate Phenotypes


Manipulation of the polynucleotides in the mature ovule, developing embryo, endosperm, seed coat and fruit enables many features of seed and fruit to be improved including the following:

    • Female fertility, megasporogenesis, embryo and endosperm development, ovule size, endosperm size, embryo size, seed size, seed yield, seed protein, seed oil, seed starch, seed cell number, cell size, seed coat development, organ size, dormancy and acquisition of desiccation tolerance, seed storage and longevity, seed germination, apomixis, production of seedless fruit and vegetables and hybrid seed production.


To improve any of the phenotype(s) above, activities of one or more of the fruit development responsive polynucleotides and polynucleotide products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the polynucleotide, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and visually inspected for the desired phenotype or metabolically and/or functionally assayed.


Use of Fruit Development Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the fruit-expressed polynucleotides and polynucleotide products can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological changes can be achieved and measured according to citations such as the following:


1. Winkler et al. (1998). Plant Physiol. 118, 743-750
2. Weigel et al. (2000). Plant Physiol. 122, 1003-1014
3. Cosgrove (1997). Plant Cell 9, 1031-1041
4. Jacobs (1997). Plant Cell 9, 1021-1029
5. Reismeier et al. (1994). EMBO J. 13, 1-7
6. Carland et al. (1999). Plant Cell 11, 2123-2138
7. Cheng et al. (1996). Plant Cell 8, 971-983
8. Weber et al. (1995). Plant Cell 7, 1835-1846
9. Leyser and Furner (1992). Development 116, 397-403
10. Hayashi et al. (1998). Plant Cell 10, 183-196.
11. Pyke (1999). Plant Cell 11, 549-556
12. Lotan et al. (1998). Cell 93, 1195-1205
13. Lending and Larkins (1989). Plant Cell 1, 1011-1023
14. Hong et al. (1996). Development 122, 2051-2058.
15. Fernandez et al. (2000). Science 289, 436-438
16. D'Aoust et al. (1999). Plant Cell 11, 2407-2418
17. Bewley (1997). Plant Cell 9, 1055-1066
18. Heath et al. (1986). Planta 169, 304-312

19. Browse et al. (1986). Anal. Biochem. 152, 141-145


20. D'Aoust et al. (1999). Plant Cell 11, 2407-2418

Other biological activities that can be modulated by the fruit-specific developmentally responsive polynucleotides and polynucleotide products are listed in Reference Tables. Assays for detecting such biological activities are described in the table as well as in the Protein Domain tables.


















BIOLOGICAL







FUNCTION
UTILITY
CITATION
ASSAY
CITATION







Ovule Growth,
Ethylene and
Manipulate
De Martinis
Analyze
Winkler et al.


Ovule
ethylene
female
and Mariani
ovule and
(1998). Plant


Development
signal
fertility.
(1999). Plant
seed
Physiol. 118,


and Seed
transduction
Manipulate
Cell 11, 1061-1072.
development
743-750.


Growth and
pathway
megasporo-
Silencing
by light
Systematic


Development
Examples:
genesis.
gene
microscopy
reverse



AP2 domain
Manipulate
expression of
or by
genetics of



DNA binding
female
the ethylene-
confocal
transfer-



proteins;
gametophyte
forming
microscopy.
DNA-tagged



EREBP, EBF
development.
enzyme results
Test for
lines of



Example:
Manipulate
in a reversible
fertilization

Arabidopsis.




Leucine-rich
fertilization
inhibition of
independent
Weigel et al.



receptor
independent
ovule
endosperm
(2000). Plant



kinase; ETR-
endosperm
development in
development.
Physiol 122,



like
development.
transgenic
Test for
1003-1014.



Example: Raf
Manipulate
tobacco plants.
fertilization
Activation



kinase; CTR
fertilization
Christensen et
independent
tagging in




independent
al. (1997).
embryo

Arabidopsis.





embryo
Sexual Plant
development.
Ohad et al.




development.
Reproduc. 10,
Test for
(1996). PNAS




Manipulate
49-64.
fertilization
USA 93,




fertilization
Megagametogenesis
independent
5319-5324. A




independent
in
seed
mutation that




seed

Arabidopsis

production.
allows




development.
wild type and
Analyze seed
endosperm




Manipulate
the Gf mutant.
size.
development




ovule size.
Christiansen
Analyze seed
without




Manipulate
and Drews,
yield.
fertilization




endosperm
unpublished
Analyze seed
Chaudhury et




size.

composition.
al. (1997).




Manipulate

Analyze fruit
PNAS USA




embryo size.

size.
94, 4223-4228.




Manipulate


Fertilization-




seed size.


independent




Manipulate


seed




seed yield.


development




Manipulate


in Arabidopsis




seed protein.



thaliana





Manipulate


De Martinis




seed oil.


and Mariani




Manipulate


(1999). Plant




starch


Cell 11, 1061-1072.




production.


Silencing




Manipulate


gene




cell number.


expression of




Manipulate


the ethylene-




cell size.


forming




Produce


enzyme results




seedless fruit


in a reversible




and


inhibition of




vegetables


ovule




Manipulate


development in




fruit size.


transgenic







tobacco plants.







Christensen et







al. (1997).







Sexual Plant







Reproduc. 10,







49-64.







Megagametogenesis







in








Arabidopsis








wild type and







the Gf mutant.







Scott et al.







(1998).







Development







125, 3329-3341.







Parent-







of-origin







effects on







seed







development







in








Arabidopsis









thaliana








Heath et al.







(1986).







Planta 169,







304-312.







Browse et al.







(1986). Anal.







Biochem.







152, 141-145.







D'Aoust et al.







(1999). Plant







Cell 11,







2407-2418.



2. Growth
Manipulate
Wilson et al.
Analyze ovule
Winkler et al.



and
female
(1996). Plant
and seed
(1998). Plant



developmental
fertility.
Cell 8, 659-671. A
development
Physiol. 118,



control
Manipulate
dissociation
by light
743-750.



genes
megasporo-
insertion
microscopy or
Systematic




genesis.
causes a
by confocal
reverse



Upregulated
Manipulate
semidominant
microscopy.
genetics of



genes
female
mutation that
Test for
transfer-



Example:
gametophyte
increases
fertilization
DNA-tagged



DNA binding
development.
expression of
independent
lines of



proteins; tiny-
Manipulate
TINY, an
endosperm

Arabidopsis.




like, AGL1,
fertilization

Arabidopsis

development.
Weigel et al.



FBP2, AGL9,
independent
gene related to
Test for
(2000). Plant



AP3, CPC-
endosperm
APETALA2.
fertilization
Physiol 122,



like myb.
development.
Zhao et al
independent
1003-1014.



Example:
Manipulate
(1999).
embryo
Activation



Protein
fertilization
Developmental
development.
tagging in



kinase;
independent
Genetics 25,
Test for

Arabidopsis.




ASK1.
embryo
209-223. The
fertilization
Ohad et al.



Example:
development.
ASK1 gene
independent
(1996). PNAS



Auxin
Manipulate
regulates
seed
USA 93,



conjugating
fertilization
development
production.
5319-5324. A



enzyme;
independent
and interacts
Analyze seed
mutation that



indole-3-
seed
with the UFO
size.
allows



acetate beta-
development.
gene to
Analyze seed
endosperm



glucosyltransferase.
Manipulate
control floral
yield.
development



Example: S/T
ovule size.
organ identity
Analyze seed
without



protein
Manipulate
in
composition.
fertilization



kinase;
endosperm

Arabidopsis.

Analyze fruit
Chaudhury et



APK1.
size.
Flanagan et
size.
al. (1997).



Example:
Manipulate
al. (1996).
Analyze
PNAS USA



Leucine-rich
embryo size.
Plant J. 10,
seedling size.
94, 4223-4228.



receptor
Manipulate
343-53.
Analyze
Fertilization-



kinase;
organ size
Specific
seedling
independent



CLV1, ER,
and number.
expression of
viability.
seed



BRI, Cf-2-
Manipulate
the AGL1
Screen for
development



like.
seed size.
MADS-box
changes in
in




Manipulate
gene suggests
shatter time.

Arabidopsis




Downregulated
seed yield.
regulatory
Screen for

thaliana




genes
Manipulate
functions in
changes in
De Martinis



Example:
seedling size

Arabidopsis

germination
and Mariani



Cyclin-
through seed
gynoecium
frequency.
(1999). Plant



dependent
size.
and ovule
Screen for
Cell 11, 1061-1072.



kinase; cdc2.
Manipulate
development.
seed longevity
Silencing




seedling vigor
Angenent et
and viability.
gene




through seed
al. (1994).

expression of




size.
Plant J 1994.

the ethylene-




Manipulate
5, 33-44. Co-

forming




seed protein.
suppression of

enzyme results




Manipulate
the petunia

in a reversible




seed oil.
homeotic gene

inhibition of




Manipulate
fbp2 affects

ovule




starch
the identity of

development in




production.
the generative

transgenic




Manipulate
meristem.

tobacco plants.




integument
AGL9 web

Christensen et




development.
page.

al. (1997).




Manipulate
Wada et al.

Sexual Plant




seedcoat
(1997)

Reproduc. 10,




development.
Science 277,

49-64.




Manipulate
1113-6.

Megagametogenesis




cell size.
Epidermal cell

in




Manipulate
differentiation


Arabidopsis





cell number.
in Arabidopsis

wild type and




Manipulate
determined by

the Gf mutant.




homeotic
a Myb

Scott et al.




gene
homolog

(1998).




expression.
CPC.

Development




Manipulate
Szerszen et al.

125, 3329-3341.




organ size.
(1994).

Parent-




Manipulate
Science 16,

of-origin




meristem size.
1699-1701.

effects on




Produce
iaglu, a gene

seed




seedless fruit
from Zea

development




and
mays

in




vegetables
involved in


Arabidopsis





Manipulate
conjugation of


thaliana.





fruit size.
growth

Heath et al.




Manipulate
hormone

(1986).




time of seed
indole-3-

Planta 169,




dispersal.
acetic acid.

304-312.




Manipulate
Ito et al.

Browse et al.




seed viability
(1997). Plant

(1986). Anal.




upon storage.
Cell Physiol.

Biochem.




Manipulate
38, 248-258. A

152, 141-145.




germination
serine/threonine

D'Aoust et al.




frequency.
protein

(1999). Plant





kinase gene

Cell 11, 2407-2418.





isolated by an





in vivo





binding





procedure





using the






Arabidopsis






floral





homeotic





gene product,





AGAMOUS.





Clark et al.





(1997). Cell





89, 575-585.





The





CLAVATA1





gene encodes





a putative





receptor





kinase that





controls shoot





and floral





meristem size





in






Arabidopsis.






Torii et al.





(1996). Plant





Cell 8, 735-746.





The






Arabidopsis






ERECTA





gene encodes





a putative





receptor





protein kinase





with





extracellular





leucine-rich





repeats.





Li and Chory





(1997). Cell





90, 929-38. A





putative





leucine-rich





repeat





receptor





kinase





involved in





brassinosteroid





signal





transduction.



3. Cell
Manipulate
Solomon et al.
Analyze ovule
Winkler et al.



senescence
female
(1999). Plant
and seed
(1998). Plant



and cell death
fertility.
Cell 11, 431-444.
development
Physiol. 118,



Example:
Manipulate
The
by light
743-750.



Cystatin
seed set.
involvement of
microscopy or
Systematic



Example:
Manipulate
cysteine
by confocal
reverse



WIPK
seed yield.
proteases and
microscopy.
genetics of




Manipulate
protease
Analyze seed
transfer-




seed size.
inhibitor genes
set.
DNA-tagged




Manipulate
in the
Analyze seed
lines of




fruit set.
regulation of
size.

Arabidopsis.





Promote
programmed
Analyze seed
Weigel et al.




apomixis.
cell death in
yield.
(2000). Plant




Produce
plants.
Analyze fruit
Physiol 122,




seedless fruit
Zhang et al.
set.
1003-1014.




and
(2000). Plant J.
Screen for
Activation




vegetables.
23, 339-347.
fertilization
tagging in





Multiple levels
independent

Arabidopsis.






of tobacco
seed
Ohad et al.





WIPK
development.
(1996). PNAS





activation

USA 93,





during the

5319-5324. A





induction of cell

mutation that





death by fungal

allows





elicitins.

endosperm







development







without







fertilization



4. Protein
Manipulate
Christensen et
Test for
Winkler et al.



remodeling
female
al. (1997).
altered female
(1998). Plant



Example:
fertility.
Sexual Plant
fertility, seed
Physiol. 118,



DNA-J
Manipulate
Reproduc. 10,
set, seed
743-750.



protein/chaperones
female
49-64.
yield.
Systematic




gametophyte
Megagametogenesis
Analyze ovule
reverse




development.
in
development
genetics of




Promote

Arabidopsis

by light
transfer-




apomixis.
wild type and
microscopy or
DNA-tagged




Manipulate
the Gf mutant.
by confocal
lines of




endosperm
Cory
microscopy.

Arabidopsis.





development.
Christiansen
Analyze seed
Weigel et al.




Manipulate
and Gary
size.
(2000). Plant




embryo
Drews,
Analyze seed
Physiol 122,




development.
unpublished
yield.
1003-1014.




Manipulate

Analyze seed
Activation




seed size.

composition.
tagging in




Manipulate



Arabidopsis.





seed yield.


Christensen et




Manipulate


al. (1997).




seed protein.


Sexual Plant




Manipulate


Reproduc. 10,




seed oil.


49-64.




Manipulate


Megagametogenesis




starch.


in




Produce



Arabidopsis





seedless fruit


wild type and




and


the Gf mutant.




vegetables.


Ohad et al.







(1996). PNAS







USA 93,







5319-5324. A







mutation that







allows







endosperm







development







without







fertilization







Scott et al.







(1998).







Development







125, 3329-3341.







Parent-







of-origin







effects on







seed







development







in








Arabidopsis









thaliana.








Heath et al.







(1986).







Planta 169,







304-312.







Browse et al.







(1986). Anal.







Biochem.







152, 141-145.







D'Aoust et al.







(1999). Plant







Cell 11,







2407-2418.



5. Sucrose
Manipulate
Mapping of
Analyze ovule
Winkler et al.



mobilization and
female
tomato genes
and seed
(1998). Plant



partitioning
fertility.
associated
development
Physiol. 118,



Example:
Manipulate
with sugar
by light
743-750.



Invertase
ovule
metabolism.
microscopy or
Systematic



inhibitor
development.
Tomato
by confocal
reverse



Example:
Manipulate
Genetics Co-
microscopy.
genetics of



bZIP
seed
op Report 48,
Determine
transfer-DNA-



transcription
development.
22-23 (1998)
female
tagged lines of



factor
Manipulate
Ikeda et al.
fertility.

Arabidopsis.




(translation of
endosperm
(1999). Plant
Analyze seed
Weigel et al.



bZIP protein
development.
Physiol 121,
mass.
(2000). Plant



is inhibited by
Manipulate
813-820.
Analyze seed
Physiol 122,



sucrose levels
embryo
Sucrose and
yield.
1003-1014.



greater than
development.
Cytokinin
Analyze seed
Activation



25 mM)
Manipulate
Modulation of
composition.
tagging in



Example:
seed size.
WPK4, a
Analyze

Arabidopsis.




Lipoxygenase
Manipulate
Gene
organ size.
Christensen et




seed yield.
Encoding a
Analyze
al. (1997).



Downregulated
Manipulate
SNF1-Related
seedling size.
Sexual Plant



gene
seed protein.
Protein
Analyze
Reproduc. 10,



Example:
Manipulate
Kinase from
seedling
49-64.



SNF1-related
seed oil.
Wheat.
viability.
Megagametogenesis



protein kinase
Manipulate
Rook et al.

in




starch.
(1998). Plant


Arabidopsis





Manipulate
J. 15, 253-263.

wild type and




cell size.
Sucrose-

the Gf mutant.




Manipulate
specific

Ohad et al.




cell number.
signaling

(1996). PNAS




Manipulate
represses

USA 93,




organ size.
translation of

5319-5324. A




Manipulate
the

mutation that




meristem

Arabidopsis


allows




size.
ATB2 bZIP

endosperm




Manipulate
transcription

development




seedling size
factor gene.

without




through seed
Rook et al.

fertilization




size.
(1998). Plant

Scott et al.




Manipulate
Mol Biol

(1998).




seedling
37, 171-178.

Development




viability
The light-

125, 3329-3341.




through seed
regulated

Parent-




size.

Arabidopsis


of-origin




Produce
bZIP

effects on




seedless fruit
transcription

seed




and
factor gene

development




vegetables.
ATB2

in




Translational
encodes a


Arabidopsis





control of
protein with


thaliana.





gene
an unusually

6. Heath et al.




expression in
long leucine

(1986).




ovule and
zipper

Planta 169,




seed by
domain.

304-312.




sucrose.
Bunker et al.

7. Browse et




Manipulate
(1995). Plant

al. (1986).




assimilate
Cell 7, 1319-1331.

Anal.




partitioning in
Sink

Biochem.




ovule and
limitation

152, 141-145.




seed
induces the

8. D'Aoust et




development.
expression of

al. (1999).





multiple

Plant Cell 11,





soybean

2407-2418.





vegetative





lipoxygenase





mRNAs while





the





endogenous





jasmonic acid





level remains





low.





Lowry et al.





(1998). Plant





Physiol. 116,





923-933.





Specific





soybean





lipoxygenases





localize to





discrete





subcellular





compartments





and their





mRNAs are





differentially





regulated by





source-sink





status.



6. Jasmonic
Targeted
Sanders et al.
Test for
Winkler et al.



acid
death of cells
(2000). Plant
altered female
(1998). Plant



biosynthesis
belonging to
Cell 12, 1041-1062.
fertility.
Physiol. 118,



and
the female
The
Analyze male
743-750.



signal
gametophyte,

Arabidopsis

fertility.
Systematic



transduction
ovule or
DELAYED
Screen for
reverse



pathway
integuments.
DEHISCENCE1
enhanced
genetics of



Example:
Delay
gene
expression of
transfer-



Biosynthetic
senescence of
encodes an
pathogen
DNA-tagged



enzyme;
unfertilized
enzyme in the
defense
lines of



FMN
female
jasmonic acid
response

Arabidopsis




oxidoreductase
gametophyte,
synthesis
genes.
Weigel et al.



12-
ovule or
pathway.

(2000). Plant



oxophyto-
integuments.
Vijayan et al.

Physiol 122,



dienoate
Manipulate
(1998). A role

1003-1014.



reductase,
female
for jasmonate

Activation



OPR1, OPR1-
fertility
in pathogen

tagging in



like.
Coordinate
defense of


Arabidopsis.




Example:
female with

Arabidopsis.




Signal
male
PNAS USA



transduction
reproduction.
95, 7209-7214.



pathway
Manipulate
Seo et al.



kinase WIPK.
male fertility.
(1999). Plant




Enhanced
Cell 11, 289-298.




defense
Jasmonate-




response in
based wound




ovules and
signal




seed
transduction





requires





activation of





WIPK, a





tobacco





mitogen-





activated





protein





kinase.


Environmental
1. Wound and
Pathogen
Song et al.
Resistance to
Winkler et al.


responses
defense
resistant
(1995).
Xanthamonas
(1998). Plant



response gene
ovules.
Science 270,
sp.
Physiol. 118,



expression
Pathogen
1804-1806. A
Resistance to
743-750.



Example:
resistant
receptor
known
Systematic



Leucine rich
seeds.
kinase-like

Arabidopsis

reverse



receptor S/T
Pathogen
protein
pathogens in
genetics of



kinase; Xa21-
resistant fruit.
encoded by the
ovules, seed
transfer-DNA-



like and

rice disease
and fruit.
tagged lines of



TMK-like.

resistance


Arabidopsis.




Example:

gene, Xa21.

Weigel et al.



Cell wall-

Seo et al.

(2000). Plant



associated

(1995). Science

Physiol 122,



protein kinase

270, 1988-1992.

1003-1014.



WAK1.

Tobacco

Activation



Example:

MAP kinase: a

tagging in



Thionins.

possible


Arabidopsis.






mediator in

Epple and





wound signal

Bohlmann





transduction

(1997). Plant





pathways.

Cell 9, 509-520.





He et al.

Overexpression





(1998). Plant J.

of an





14, 55-63.

endogenous





Requirement

thionin





for the induced

enhances





expression of a

resistance of





cell wall


Arabidopsis






associated

against





receptor kinase

Fusarium





for survival

oxysporum.





during the

He et al.





pathogen

(1998). Plant





response.

J. 14, 55-63.





He et al.

Requirement





(1999). Plant

for the





Mol. Biol. 39,

induced





1189-1196. A

expression of





cluster of five

a cell wall





cell wall-

associated





associated

receptor





receptor kinase

kinase for





genes, Wak1-5,

survival





are expressed

during the





in specific

pathogen





organs of

response.






Arabidopsis.






Epple and





Bohlmann





(1997). Plant





Cell 9, 509-520.





Overexpression





of an





endogenous





thionin





enhances





resistance of






Arabidopsis






against





Fusarium





oxysporum.





Ichimura et al.





(1998). DNA





Res. 5,341-5348.





Molecular





cloning and





characterization





of three cDNAs





encoding





putative





mitogen-





activated





protein kinase





kinases





(MAPKKs) in






Arabidopsis







thaliana.




2. Stress
Manipulate
Close, T. J.
Test for
Winkler et al.



response to
drought
(1996).
enhanced
(1998). Plant



cold, drought,
resistance.
Physiol. Plant
sensitivity to
Physiol. 118,



salinity, seed
Manipulate
97, 795-803.
drought,
743-750.



maturation,
desiccation
Dehydrins:
dessication,
Systematic



embryo
tolerance in
emergence of
cold, salinity,
reverse



development,
flowers,
a biochemical
in ovules,
genetics of



ABA.
ovules and
role of a
developing
transfer-



Example:
seeds.
family of
seed and
DNA-tagged



Dehydrins
Manipulate
plant
seedlings.
lines of



Example:
cold tolerance
dehydration
Test for

Arabidopsis.




NPK1-like
in flowers,
proteins.
enhanced
Weigel et al.



protein kinase
ovules, and
Kovtun et al.
tolerance to
(2000). Plant



Example:
seeds.
(2000). PNAS
drought,
Physiol 122,



DNA binding
Manipulate
USA 97,
dessication,
1003-1014.



protein genes:
seed
2940-2945.
cold, salinity,
Activation



CBF-like,
dormancy.
Functional
in ovules,
tagging in



DREB2A,
Manipulate
analysis of
developing

Arabidopsis.




RAP2.1.
germination
oxidative
seed and seed.




frequency.
stress-
Test for




Manipulate
activated
changes in




seed storage
mitogen-
seed viability




and viability.
activated
upon storage.





protein kinase
Test for





cascade in
changes in





plants.
germination






frequencies.



3. Response
Altered
Bender and
Test for
Winkler et al.



to starvation,
response to
Fink (1998).
enhanced
(1998). Plant



wounding,
starvation.
A myb
sensitivity to
Physiol. 118,



and pathogen
Altered
homologue,
starvation,
743-750.



attack by
response to
ATR1,
wounding,
Systematic



tryptophan
wounding.
activates
and pathogen
reverse



synthesis.
Altered
tryptophan
attack.
genetics of



Example:
response to
gene
Test for
transfer-



DNA binding
pathogen
expression in
enhanced
DNA-tagged



protein;
attack.

Arabidopsis.

tolerance to
lines of



ATR1-like

PNAS USA
starvation,

Arabidopsis.




myb.

95, 5655-5660.
wounding,
Weigel et al.



Example:


and pathogen
(2000). Plant



Auxin


attack.
Physiol 122,



conjugating



1003-1014.



enzyme;



Activation



indole-3-



tagging in



acetate beta-




Arabidopsis.




glucosyltransferase.


Cell
Stearoyl-acyl
Production of
Merlo et al.
Analyze seed
Winkler et al.


metabolism
carrier
oils high in
(1998). Plant
size.
(1998). Plant



protein
saturated fatty
Cell 10, 1603-1621.
Analyze seed
Physiol. 118,



desaturase
acids

yield.
743-750.



Example:
Manipulate

Analyze seed
Systematic



C18 fatty acid
membrance

composition.
reverse



desaturation
composition

Analyze seed
genetics of






oil by gas
transfer-






chromatography.
DNA-tagged







lines of








Arabidopsis.








Weigel et al.







(2000). Plant







Physiol 122,







1003-1014.







Activation







tagging in








Arabidopsis.








Browse et al.







(1986). Anal.







Biochem.







152, 141-145.



2. Manipulate
Manipulate
Mathews and
Analyze seed
Winkler et al.



nitrogen
asparagine
Van Holde
size.
(1998). Plant



economy
degradation in

Analyze seed
Physiol. 118,



Example:
ovules and

yield.
743-750.



Asparaginase
seeds.

Analyze seed
Systematic




Manipulate

composition.
reverse




endosperm


genetics of




production.


transfer-




Manipulate


DNA-tagged




embryo


lines of




development.



Arabidopsis.





Manipulate


Weigel et al.




ovule size.


(2000). Plant




Manipulate


Physiol 122,




seed size.


1003-1014.







Activation







tagging in








Arabidopsis.








Heath et al.







(1986).







Planta 169,







304-312.







Browse et al.







(1986). Anal.







Biochem.







152, 141-145.







D'Aoust et al.







(1999). Plant







Cell 11,







2407-2418.









Fruit development responsive polynucleotides are characteristically differentially transcribed in response to fluctuating developmental-specific polynucleotide levels or other signals, whether internal or external to a cell. MA_diff reports the changes in transcript levels of various fruit development responsive polynucleotides in fruits.


These data can be used to identify a number of types of fruit development responsive polynucleotides. Profiles of some of these different fruit development responsive polynucleotides are shown in the table below with examples of the kinds of associated biological activities. Because development is a continuous process and many cell types are being examined together, the expression profiles of genes overlap between stages of development in the chart below.


















Examples of



Developmental

Biochemical


Transcript Levels
Process
Metabolic Pathways
Activity







(0-5 mm) >> (5-10
Ovule Elongation
Hormone Production,
Transcription


mm) ≅ (>10 mm)
Tissue Specialization
Transport, Perception,
Factors


(0-5 mm) >> (5-10
Vascular system
Signalling, Response (e.g.,
Transporters


mm) > (>10 mm)
Meristem
Gibberellin, Ethylene, Auxin)
Kinases


(0-5 mm) > (5-10
Endosperm
Cell wall Biosynthesis
Changes in


mm) ≅ (>10 mm)
Seed coat
Lipid Biosynthesis
cytoskeletal



Fruit
Specific Gene Transcription
protein activity




Initiation
modulating cell




Sucrose Mobilization and
structure




Partitioning
Stability factors




Sucrose Signaling
for protein




Lipoxygenase
translation




Localization
Changes in cell




Repressors of Metabolic
wall/membrane




Pathways
structure




Protein Remodeling
Chromatin





structure and/or





DNA topology





Biosynthetic





enzymes


(5-10 mm) >> (0-5
Tissue Specialization
Cell Wall Biosynthesis
Transcription


mm) > (>10 mm)
Vascular System
Specific Gene Transcription
Factors


(5-10 mm) > (0-5
Organelle
Initiation
Transporters


mm) ≅ (>10 mm)
Differentiation
Sucrose Mobilization and
Kinases


(5-10 mm) >> (0-5
Cotyledon Elongation
Partitioning
Chaperones


mm) ≅ (>10 mm)
(cell division)
Sucrose Signaling
Changes in



Vacuome
Repressors of Metabolic
cytoskeletal



Development
Pathways
protein activity



Lipid Deposition
Auxin Perception,
modulating cell




Response and Signaling
strucure




Protein Remodeling
Stability of




Lipid Biosynthesis and
factors for




Storage
protein





translation





Changes in cell





wall/membrane





structure





Chromatin





structure and/or





DNA topology





Biosynthetic





enzymes


(>10 mm) > (0-5
Cotyledon Elongation
Cell Elongation
Transcription


mm) ≅ (5-10 mm)
(expansion)
Specific Gene Transcription
Factors



Lipid Deposition
Initiation
Transporters



Protein Deposition
Sucrose Mobilization and
Kinases



Desiccation
Partitioning
Chaperones




Sucrose Signaling
for protein




Lipoxygenase
translation




Localization
Changes in cell




Repressors of metabolic
wall/membrane




pathways
structure




Hormone Perception,
Chromatin




Response and Signaling (e.g.
structure and/or




abscissic acid)
DNA topology




Protein Remodeling
Biosynthetic




Protein synthesis and Storage
enzymes




Lipid Synthesis and Storage
Metabolic




Acquisition of Dessication
enzymes




Tolerance





Senescence



(0-5 mm) < (5-10
Ovule Elongation
Cell elongation
Transcription


mm) ≅ (>10 mm)
Repressors of
Negative regulation of
Factors


(0-5 mm) << ( 5-10
Ethylene
ethylene pathways
Transporters


mm) ≅ (>10 mm)
production
Maintenance of Ethylene
Kinases


(0-5 mm) << (5-10
Tissue
response
Chaperones


mm) < (>10 mm)
specialization
Changes in pathways and
Stability of


(0-5 mm) << (>10
Vascular System
processes operation in cells
factors


mm) < (5-10 mm)
Meristem

Biosynthetic



Cotyledon

enzymes



Seed Coat

Metabolic





enzymes


(5-10 mm) < (0-5
Organelle
Negative regulation of
Transcription


mm) ≅ (>10 mm)
differentiation
hormone pathways
Factors



Cotyledon elongation
Maintenance of hormone
Transporters



(division)
response
Kinases



Vacuome
Changes in pathways and
Chaperones



development
processes operation in cells




Lipid development
Dehydration and acquisition of




Desiccation
desiccation tolerance





Senescence



(>10 mm) < (0-5
Cotyledon Elongation
Cell elongation
Transcription


mm) ≅ (5-10 mm)
(expansion)
Negative regulation of
Factors



Lipid deposition
hormone pathways
Transporters



Protein deposition
Maintenance of hormone
Kinases



Desiccation
response
Chaperones




Changes in pathways and
Metabolic




processes operation in cells
enzymes




Dehydration and acquisition of
Biosynthetic




desiccation tolerance
enzymes




Senescence



(0-5 mm) ≅ (5-10
All stages
Ribosome/polysome
Transcription


mm) ≅ (>10 mm)

production and maintenance
Factors




Housekeeping genes
Transporters





Kinases





Chaperones









III.B. Development Genes, Gene Components and Products


III.B.1. Imbibition and Germination Responsive Genes, Gene Components and Products


Seeds are a vital component of the world's diet. Cereal grains alone, which comprise ˜90% of all cultivated seeds, contribute up to half of the global per capita energy intake. The primary organ system for seed production in flowering plants is the ovule. At maturity, the ovule consists of a haploid female gametophyte or embryo sac surrounded by several layers of maternal tissue including the nucleus and the integuments. The embryo sac typically contains seven cells including the egg cell, two synergids, a large central cell containing two polar nuclei, and three antipodal cells. That pollination results in the fertilization of both egg and central cell. The fertilized egg develops into the embryo. The fertilized central cell develops into the endosperm. And the integuments mature into the seed coat. As the ovule develops into the seed, the ovary matures into the fruit or silique. Late in development, the developing seed ends a period of extensive biosynthetic and cellular activity and begins to desiccate to complete its development and enter a dormant, metabolically quiescent state. Seed dormancy is generally an undesirable characteristic in agricultural crops, where rapid germination and growth are required. However, some degree of dormancy is advantageous, at least during seed development. This is particularly true for cereal crops because it prevents germination of grains while still on the ear of the parent plant (preharvest sprouting), a phenomenon that results in major losses to the agricultural industry. Extensive domestication and breeding of crop species have ostensibly reduced the level of dormancy mechanisms present in the seeds of their wild ancestors, although under some adverse environmental conditions, dormancy may reappear. By contrast, weed seeds frequently mature with inherent dormancy mechanisms that allow some seeds to persist in the soil for many years before completing germination.


Germination commences with imbibition, the uptake of water by the dry seed, and the activation of the quiescent embryo and endosperm. The result is a burst of intense metabolic activity. At the cellular level, the genome is transformed from an inactive state to one of intense transcriptional activity. Stored lipids, carbohydrates and proteins are catabolized fueling seedling growth and development. DNA and organelles are repaired, replicated and begin functioning. Cell expansion and cell division are triggered. The shoot and root apical meristem are activated and begin growth and organogenesis. Schematic 4 summarizes some of the metabolic and cellular processes that occur during imbibition. Germination is complete when a part of the embryo, the radicle, extends to penetrate the structures that surround it. In Arabidopsis, seed germination takes place within twenty-four (24) hours after imbibition. As such, germination requires the rapid and orchestrated transcription of numerous polynucleotides. Germination is followed by expansion of the hypocotyl and opening of the cotyledons. Meristem development continues to promote root growth and shoot growth, which is followed by early leaf formation.


Genes with activities relevant to imbibition-germination and early seedling growth are described in the two sections A and B below.


III.B.1.a. Identification of Imbibition and Germination Genes


Imbibition and germination includes those events that commence with the uptake of water by the quiescent dry seed and terminate with the expansion and elongation of the shoots and roots. The germination period exists from imbibition to when part of the embryo, usually the radicle, extends to penetrate the seed coat that surrounds it. Imbibition and germination genes identified herein are defined as genes, gene components and products capable of modulating one or more processes of imbibition and germination described above. They are useful to modulate many plant traits from early vigor to yield to stress tolerance. Examples of such germination genes and gene products are shown in the Reference and Sequence Tables. The functions of many of the genes were deduced from comparisons with known proteins and are also given in the REF Tables.


Imbibition and Germination Genes Identified by Phenotypic Observations


Imbibition and germination genes are active, potentially active or more active during growth and development of a dry seed into a seedling. These genes herein were discovered and characterized from a much larger set of genes in experiments designed to find genes that cause poor germination.


In these experiments, imbibition and germination genes were identified by either 1) ectopic expression of a cDNA in a plant or (2) mutagenesis of the plant genome. The seeds were then imbibed and cultivated under standardized conditions and any phenotypic differences in the modified plants compared with the parental “wild-type” seedlings were recorded. The genes causing the changes were deduced from the cDNA inserted or gene mutated. The phenotypic differences observed were poor germination and aberrant seedlings.


Imbibition and Germination Genes Identified by Differential Expression


Germination genes were also identified by measuring the relative levels of mRNA products of genes in different stages of germination of a seed versus the plant as a whole. Specifically, mRNA was isolated from whole imbibed seeds of Arabidopsis plants 1, 2, 3 or 4 days after imbibition and compared to mRNA isolated from dry seed-utilizing microarray procedures. The MA_diff Table reports the transcript levels of the experiment. For transcript levels that were higher in the imbibed seed than in dry seed a “+” is shown. A “−” is shown when the transcript levels in dry seed were greater than those in imbibed seed. For more experimental detail, see the examples below:


Germination associated genes can be identified by comparing expression profiles of imbibed gibberellin treated and untreated gal mutant seed. Germination associated genes can also be identified by comparing expression profiles in late maturation seed from wild-type and mutants that are defective for the establishment of dormancy and can germinate precociously (e.g. aba1, aba2, abi4 in arabidopsis and vp1, vp5 in maize) or are defective for the specification of cotyledon identity and dessication tolerance (e.g. lec1, lec2, and fus3).


The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108461, 108462, 108463, 108464, 108528, 108529, 108530, 108531, 108545, 108546, 108547, 108518, 108529, 108543, 108544). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Imbibed & Germinating Seeds genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Imbibed & Germinating Seeds Genes Identified by Cluster Analyses of Differential Expression


Imbibed & Germinating Seeds Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Imbibed & Germinating Seeds genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108461, 108462, 108463, 108464, 108528, 108529, 108530, 108531, 108545, 108546, 108547, 108518, 108529, 108543, 108544 of the MA_diff table(s).


Imbibed & Germinating Seeds Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Imbibed & Germinating Seeds genes. A group in the MA_clust is considered a Imbibed & Germinating Seeds pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Imbibed & Germinating Seeds Genes Identified by Amino Acid Sequence Similarity


Imbibed & Germinating Seeds genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Imbibed & Germinating Seeds genes. Groups of Imbibed & Germinating Seeds genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Imbibed & Germinating Seeds pathway or network is a group of proteins that also exhibits Imbibed & Germinating Seeds functions/utilities.


III.B.1.b. Use of Imbibition and Germination Genes, Gene Components and Products to Modulate Phenotypes


Imbibition and germination genes and gene products can be divided into those that act during primary events, secondary events, and/or termination. The genes and gene products of the instant invention are useful to modulate any one or more of the phenotypes described below:


I. Primary events

    • A. Dormancy


Imbibition and germination genes and gene products of the invention can act to modulate different types of dormancy including:

    • 1. Primary dormancy—dormancy is established during seed development
    • 2. Seed coat-imposed dormancy—dormancy is imposed by blocking water uptake, mechanical restraint of embryo, blocking the exit of inhibitors
    • 3. Embryo dormancy—cotyledon mediated inhibition of embryonic axis growth
    • 4. Secondary dormancy—dormancy is induced when dispersed, mature seeds are exposed to unfavorable conditions for germination (e.g. anoxia, unsuiTable temperature or illumination).
    • 5. Hormone-induced
    • B. Dormancy-breaking signal perception and transduction


Germination genes and gene products include those that are able to modulate the response to dormancy releasing signals such as fruit ripening and seed development; imbibition; temperature (low and high, range 0-23°); light, particularly for coat imposed dormancy (white light, intermittent illumination, orange and red region of the spectrum (longer than 700 or 730 nm), and phytochrome); coat softening; chemicals (respiratory inhibitors, sulfhydryl compounds, oxidants, nitrogenous compounds, growth regulators—ga, ba, ethylene, and various, ethanol, methylene blue, ethyl ether, fusicoccin); oxygen and carbon dioxide; and stress.


II. Secondary Events


During the secondary events of germination, dormancy-maintaining metabolism is repressed, dormancy-breaking metabolism is induced and structures surrounding the embryo weaken (where present). Germination genes and gene products are useful to modulate processes of the secondary events including water uptake, such as cell expansion and change in osmotic state (ion exchange); and respiration—(oxygen consumption). the genes and genes products of the invention can regulate the following pathways which resume during the first respiratory burst of germination including glycolysis, pentose phosphate, citric acid, and tricarboxylic acid cycle.


A. Mitochondrial Development


Tissues of the mature dry seed contain mitochondria, and although these organelles are poorly differentiated as a consequence of the drying, they contain sufficient Kreb's cycle enzymes and terminal oxidases to provide adequate amount of ATP to support metabolism for several hours after imbibition. During germination of embryos, there appears to be two distinct patterns of mitochondrial development. In starch-storing seeds, repair and activation of preexisting organelles predominate, whereas oil-storing seeds typically produce new mitochondria. Germination genes and gene products of the invention are useful to modulate the repair, activation and biogenesis pathways of mitochondria, including membrane formation and repair, DNA repair and synthesis, protein synthesis, and coordinated regulation of mitochondrial and nuclear genomes


B. Metabolism


In addition to respiration and organelle activity, enzyme activity, DNA repair, RNA synthesis and protein synthesis are fundamental cellular activities intimately involved in the completion of germination and the preparation for subsequent growth. Imbibition and germination genes and gene products of the invention can participate in or modulate these activities, including ABA response, GA response, ATP synthesis and adenylate energy charge during germination, and the synthesis and utilization of reducing power: pyridine nucleotides (NADH and NADPH)


III. Termination


The last stage of seed germination is characterized by the emergence of the radicle or root apex through the seed coat. Typically, the cell walls loosen and the radicle extends from the embryo during late germination. Germination genes and gene products are useful to modulate the mobilization of stored reserves, DNA synthesis and cell division that are typical of this stage of germination.


To regulate any of the phenotype(s) above, activities of one or more of the late germination genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Dolan et al. (1993, Development 119: 71-84), Dolan et al. (1997, Development 124: 1789-98), Crawford and Glass (1998, Trends Plant Science 3: 389-95), Wang et al. (1998, PNAS USA 95: 15134-39), Gaxiola et al. (1998, PNAS USA 95: 4046-50), Apse et al. (1999, Science 285: 1256-58), Fisher and Long (1992, Nature 357: 655-60), Schneider et al. (1998, Genes Devel 12: 2013-21) and Hirsch (1999, Curr Opin Plant Biol. 2: 320-326).


III.B.1.c. Use of Imbibition and Germination Genes, Gene Components and Product to Modulate Biochemical Activities


The roles of the biochemical changes associated with imbibition and germination can be appreciated from a summary of the processes occurring.


Physiology


Water plays an important role throughout the plant life cycle. The most dramatic example of this is in seed germination. Although germination is triggered by water, the germination response is also positively regulated by the plant growth regulators the gibberellins and negatively affected by the growth regulator abscisic acid. Genes that are activated by water and genes that are activated by gibberellins can be identified through expression profiling experiments using arabidopsis mutants defective for gibberellin biosynthesis or perception (gal, gai), abscisic acid biosynthesis or perception (aba1, abi3, and abi4) in the presence or absence of exogenous gibberellins. These genes can be used to promote seedling growth and development and other phases of plant development.


Transcriptional Control of Gene Activity


At the end of seed development, dessication and dormancy have imposed a global state of repression on gene activity throughout the seed. Reactivation of the genome requires water and gibberellins. One function of the genes that are activated early by imbibition is the rapid and dramatic reversal of gene repression. For example, expression-profiling experiments revealed that several thousand genes are hyperactivated in arabidopsis upon imbibition. These include genes involved in metabolic pathways, genes that promote cell growth and division, and transcriptional control genes. Thus one class of genes expressed early in imbibition includes those that promote high levels of gene expression. Other early genes are responsible for regulating specific metabolic, cell, and developmental processes. The strategy for distinguishing these functions was outlined in the Introduction.


Mobilization of Storage Reserves


In contrast to the synthesis and accumulation of reserves during seed development an important function of genes expressed during imbibition and germination is the control of the mobilization and catabolism of seed storage reserves in the endosperm (in grasses and cereals) and the embryo. The mobilization of seed storage reserves is triggered by imbibition and may occur over several days. There are three classes of high molecular weight seed storage reserves: carbohydrates, triacylglycerols, and storage proteins. Upon imbibition seed storage reserves are converted into forms that can be transported and metabolized. Genes encoding enzymes for storage reserve catabolism are expressed shortly after imbibition. Starch for example is converted to sucrose. Triacylglycerols are converted into acetyl-CoA. Storage proteins are converted into amino acids or deaminated to provide carbon skeletons for oxidation.


Carbohydrate Catabolism


Starch is the most common storage carbohydrate in seeds. The primary components of starch are amylose and amylopectin.


Mobilization


There are two pathways for starch catabolism—hydrolytic and phosphorolytic. The product of these pathways is the monosaccharide glucose. Examples of the enzymes responsible for hydrolytic catabolism of starch are: amylase, glucosidase, amylase, dextrinase, isoamylase. The enzyme responsible for phosphorolytic activity is starch phosphorylase.


Transport


The mobilization of starch involves the synthesis of sucrose from glucose, which can then be transported to sites for growth in the root and shoot. In some seeds, maltose may be a major form of transported carbohydrate. The production of sucrose-6-P from glucose involves the following enzymes: UDP-glucose pyrophosphorylase, sucrose-6-P synthetase, and sucrose phosphatase.


Sucrose Catabolism


In target tissues sucrose is hydrolyzed by fructofuransidase (invertase) and/or sucrose synthetase. The synthesis of glucose from glucose-1-P involves sucrose synthetase.


Cell Biology


The lumen of the endoplasmic reticulum (ER) is target for other hydrolase activities including mannosidase, glucosaminidase, acid phosphatase, phosphodiesterase, and phospholipase D.


Triacylglycerol (TAG) Catabolism


Triacylglycerols are the major storage lipids of seeds. The products of TAG catabolism in imbibed and germinating seed are glycerol and free fatty acids. Most of the glycerol is converted to sucrose for export. Free fatty acids are catabolized through oxidation through the glyoxylate cycle and gluconeogenesis.


Mobilization


Hydrolysis of triacylglycerols is by lipases yielding glycerol and free fatty acids. Free fatty acids are oxidized to acetyl-CoA and propionyl-CoA via oxidation requiring ATP and coenzyme A. Catabolism of unsaturated fatty acids also requires cis, trans-isomerases, epimerases, and hydratases. Acetyl-CoA is oxidized through the citric acid cycle to CO2 and H2O. More importantly, acetyl-CoA can be utilized via the glyoxylate cycle and gluconeogenesis for glucose synthesis. Free fatty acids are also broken down via oxidation. Glycerol is converted via phosphorylation and oxidation to DHAP and G3P, which are used to synthesize glucose or oxidized via the citric acid cycle. Examples of other induced enzymes include isocitrate lyase and malate synthetase


Transport


Most of the glycerol, acetyl-CoA, and propionyl-CoA are converted to sucrose for transport. This requires the enzymes glycerol kinase and glycerol phosphate oxidoreductase.


Cell Biology


Glyoxysome biogenesis is required to support fatty acid catabolism and gluconeogenesis. Upon exposure to light there is a loss of glyoxysomes due to their conversion to peroxisomes.


Storage Protein Catabolism

Mobilization


The hydrolysis of storage proteins to amino acids is performed by a diverse group of proteinases and peptidases. The peptidases include endopeptidases, aminopeptidases, and carboxypeptidases. They include the A and B class proteinases. The liberated amino acids are available for protein synthesis, for deamination and reutilization of ammonia via glutamine and asparagine synthesis, and to provide carbon skeletons for respiration. Several enzymes including, deaminase, asparagine synthetase, glutamine synthetase and glutamate dehydrogenase are important players in the mobilization and utilization of stored nitrogen in imbibed seed.


Transport


The major transported form of amino acid in germinated seeds is asparagine. In some species glutamine and/or homoserine are the major form of transported amino acid. Aspartate, glutamate, alanine, glycine, and serine can be converted to sucrose and transported as sucrose. Other amino acids are transported unchanged.


Cell Biology


Proteinases are sequestered in lumen of endoplasmic reticulum (ER) which then fuses with protein bodies.


While catabolism is high in the storage tissues of imbibed seed the products of catabolism are transported to sites of growth including the shoot and root apices fueling respiration, biosynthesis, cell division and differentiation.


Development


Imbibition triggers several key processes for seedling development. One is the activation of the shoot and root apical meristems. The shoot apical meristem is responsible for two primary growth activities. One is the production of the protoderm, procambium and ground meristem. The protoderm gives rise to the epidermal system of the plant, the procambium to the primary vascular tissues, and the ground meristem to the ground tissues including the cortex and pith. The second is the production of leaf primordia, which arise on the flanks of the apex. Thus, activation of the shoot apical meristem results in shoot growth and organogenesis.


The root apical meristem, by contrast is responsible for vegetative root development. The first primary growth activity of the root apical meristem is the production of the protoderm, procambium and ground meristem. The second primary growth activity is the production of the cells that give rise to the root cap.


Genes that govern shoot apical meristem activation and development can be identified in arabidopsis by gene profiling experiments comparing gene expression in wild-type imbibed seed and partial loss-of-function stm (shootmeristemless) mutants (see SAM). Genes governing root meristem activity can be identified by gene profiling experiments comparing gene expression in wild-type imbibed seed and rml (rootmeristemless) mutants.


Genes identified in this way are useful to promote or retard meristem growth, modify and strengthen shoot and root development, promote leaf development as described below.


Changes in the concentration of imbibition-germination activated polynucleotides result in the modulation of many other polynucleotides and polynucleotide products. Examples of such activated responsive polynucleotides and polynucleotide products relative to leaves and floral stem and to fruits at different development stages are shown in the Reference and Sequence Tables. These polynucleotides and/or products are responsible fore effects on traits such as seedling growth, seedling viability, and seedling vigor. The polynucleotides were discovered by isolating seeds from Arabidopsis wild-type ecotype “Wassilewskija” imbibed for 24 hours, and measuring the mRNAs expressed in them relative to those in a leaf and floral stem sample and to those in fruits at different developmental stages.


While imbibition-germination activated polynucleotides and polynucleotide products can act alone, combinations of these polynucleotides also affect germination. Useful combinations include different polynucleotides and/or polynucleotide products that have similar transcription profiles or similar biological activities, and members of the same or functionally similar biochemical pathways. In addition, the combination of imbibition germination activated polynucleotides and/or polynucleotide products with environmentally responsive polynucleotides is also useful because of the interactions that exist between development, hormone-regulated pathways, stress and pathogen induced pathways and nutritional pathways. Here, useful combinations include polynucleotides that may have different transcription profiles, and participate in common or overlapping pathways but combine to produce a specific, phenotypic change.


Such imbibition and germination activated polynucleotides and polynucleotide products can function to either increase or dampen the above phenotypes or activities either in response to transcript changes in fruit development or in the absence of fruit-specific polynucleotide fluctuations.















BIOCHEMICAL OR




METABOLIC ACTIVITIES




AND/OR PATHWAYS
CITATIONS INCLUDING


PROCESS
ALTERED
ASSAYS







Growth, Differentiation
Farnesylation Mediated Seed
Pei et al (1998) Science 282:


and Development
Dormancy
287-290; Cutler et al. (1996)




Science 273: 1239


Metabolic activity
Nitrogen metabolism
Goupil et al (1998) J Exptl




Botany 49: 1855-62


Metabolic activity
—H+ export and membrane
Cerana et al. (1983)



hyperpolarization



Metabolic activity
Chloroplast functioning
Benkova et al (1999) Plant




Physil 121: 245-252


Growth, Differentiation
Regulation of Morphogenesis
Riou-Khamlichi et al. (1999)


and development

Science 283: 1541-44


Metabolic activity
Cell Death
Lohman et al. (1994) Physiol




Plant 92: 322-328


Growth and development
Promotion of cell division
Kakimoto (1996) Science



Shoot formation in absence of
274: 982-985



exogenous cytokinin



Metabolic activity
Membrane repair
Heath et al. (1986) Planta 169:




304-12




Browse et al. (1986) Anal




Biochem 152: 141-5




D'Aoust et al (1999) Plant




Cell 11: 2407-18


Metabolism
Organic molecule export
Moody et al. (1988)




Phytochemistry 27: 2857-61


Metabolic activity
Nutrient Uptake
Uozumio et al. (2000) Plant




Physiol 122: 1249-59


Metabolic activity
Ion export
Uozumi et al. (2000) Plant




Physiol 122: 1249-59




Frachisse et al. (2000) Plant J




21: 361-71


Growth, Differentiation
Division and/or elongation
Zhang and Forde (1998)


and development

Science 279: 407-409.




Coruzzi et al. U.S. Pat. No.




5,955,651


Metabolic activity
Regulation of Molecular
Wisniewski et al. (1999)



chaperones
Physiolgia Plantarum 105:




600-608


Metabolic activity
Reactivation of Aggregation
Lee and Vierling (2000) Plant



and Protein Folding
Physiol. 122: 189-197


Metabolic activity
Maintenance of Native
Queitsch et al. (2000) The



Conformation (cytosolic proteins)
Plant Cell 12: 479-92


Metabolic activity
Regulation of Translational
Wells et al. (1998) Genes and



Efficiency
Development 12: 3236-51


Metabolic activity
DNA Repair
Bewley (1997) Plant Cell 9:




1055-66


Metabolic activity
Protein Synthesis using stored
Heath et al. (1986) Planta 169:



or newly synthesized mRNAs
304-12


Metabolic activity
Mitochondrial repair and
MacKenzie and McIntosh



synthesis
(1999) Plant Cell 11: 571-86


Metabolic activity
Commencement of respiration
Debeaujon et al. (2000) Plant




Physiol 122: 403-4132



Water Uptake
Debeaujon et al. (2000) Plant




Physiol 122: 403-4132









Other biological activities that are modulated by the imbibition-activated polynucleotides and polynucleotide products are listed in the Reference Tables. Assays for detecting such biological activities are described in the Table below as well as in the Domain section of the Reference Table.


III.B.1.d. Use of Imbibition and Germination Genes to Modulate the Transcription Levels of Other Genes


The expression of many genes is “upregulated” or “downregulated” during imbibition and germination because some imbibition and germination genes are integrated into complex networks that regulate transcription of many other genes. Some imbibition and germination genes are therefore useful for regulating other genes and hence complex phenotypes.


Imbibition-activated polynucleotides may also be differentially transcribed in response to fluctuating developmental-specific polynucleotide levels or concentrations, whether internal or external to a cell, at different times during the plant life cycle to promote associated biological activities. These activities are, by necessity, a small subset of the genes involved in the development process. Furthermore, because development is a continuous process with few clear demarcations between stages, the associated metabolic and biochemical pathways overlap. Some of the changes in gene transcription are summarized in the Table below:
















EXAMPLES OF




BIOCHEMICAL



PHYSIOLOGICAL/
REGULATORY


DEVELOPMENTAL
METABOLIC
ACTIVITIES


PROCESS REGULATED
CONSEQUENCES OF
ASSOCIATED WITH


BY IMBIBITION-
MODIFYING GENE
IMBIBITION AND


GERMINATION GENES
PRODUCT LEVELS
GERMINATION







Tissue Specialization
Lipid Catabolism
Transcription Factors


Cotyledon Expansion
Lipoxygenase
Transporters


Endosperm (???)
Localization
Kinases


Activation of the Shoot
Starch Catabolism
Changes in cytoskeletal


Apical Meristem
Seed Protein Catabolism
protein activity


Activation of the Root
Growth Regulator Production,
modulating cell structure


Apical Meristem
Transport, Perception,
Stability of factors for


Radicle Growth
Signaling, Response (e.g.,
protein translation


Vascular System
Gibberellins, Ethylene,
Changes in cell


Development
Auxin)
wall/membrane structure



Global Gene Activation
Chromatin structure



Transcription Initiation
and/or DNA topology



Sucrose Synthesis and
Biosynthetic enzymes



Partitioning
Metabolic enzymes



Sucrose catabolism




Sucrose Signaling




Cell Wall Biosynthesis




Activators of Metabolic




Pathways




Protein Remodeling



Organelle Differentiation
Cell Wall Biosynthesis
Transcription Factors


and Development
Membrane Repair and
Transporters



Synthesis
Kinases



Specific Gene Transcription
Chaperones



Initiation
Changes in cytoskeletal



Sucrose Mobilization and
protein activity



Partitioning
modulating cell structure



Sucrose Signaling
Stability of factors for



Activators of Metabolic
protein translation



Pathways
Changes in cell



Auxin Perception,
wall/membrane structure



Response and Signaling
Chromatin structure



Protein Remodeling
and/or DNA topology



Lipid Mobilization,
Biosynthetic enzymes



Metabolism and Biosynthesis
Metabolic enzymes



Protein Transport,




Metabolism, and Biosynthesis



DNA Repair
Cell Division
Transcription Factors



Cell Cycle Control
Transporters



DNA Replication
Kinases



Specific Gene Transcription
Chaperones



Initiation
for protein translation



Protein Remodeling
Changes in cell



Protein Synthesis
wall/membrane structure



Repressors of Senescence
Chromatin structure




and/or DNA topology




Biosynthetic enzymes


Cellular Metabolism
Lipid Catabolism
Transcription Factors



oxidation
Transporters



Glyoxylate cycle
Kinases



Citric acid cycle
Chaperones



Gluconeogenesis
Translation Initiation



Sucrose Synthesis and
Factors



Partitioning
Biosynthetic Enzymes



Starch Catabolism
Metabolic Enzymes



Seed Protein Catabolism




Asparagine Synthesis and




Transport




Sucrose catabolism




Sucrose Signaling




Ribosome/polysome




production and maintenance




Housekeeping genes




Respiration




Photosynthesis









Changes in the processes of germination are the result of modulation of the activities of one or more of these many germination genes and gene products. These genes and/or products are responsible for effects on traits such as fast germination, plant vigor and seed yield, especially when plants are growing in the presence of biotic or abiotic stresses or when they are growing in barren conditions or soils depleted of certain minerals.


Germination genes and gene products can act alone or in combination as described in the introduction. Of particular interest are combination of these genes and gene products with those that modulate stress tolerance and/or metabolism. Stress tolerance and metabolism genes and gene products are described in more detail in the sections below.


Use of Promoters of Imbibition and Germination Genes

These promoters can be used to control expression of any polynucleotide, plant or non-plant, in a plant host. Selected promoters when operably linked to a coding sequence can direct synthesis of the protein in specific cell types or to loss of a protein product, for example when the coding sequence is in the antisense configuration. They are thus useful in controlling changes in imbibition and germination phenotypes or enabling novel proteins to be made in germinating seeds.


III.B.2. Early Seedling-Phase Specific Responsive Genes, Gene Components and Products


One of the more active stages of the plant life cycle is a few days after germination is complete, also referred to as the early seedling phase. During this period the plant begins development and growth of the first leaves, roots, and other organs not found in the embryo. Generally this stage begins when germination ends. The first sign that germination has been completed is usually that there is an increase in length and fresh weight of the radicle.


III.B.2.a. Identification of Early Seedling Phase Genes, Gene Components and Products


These genes defined and identified herein are capable of modulating one or more processes of development and growth of many plant organs as described below. These genes and gene products can regulate a number of plant traits to modulate yield. Examples of such early seedling phase genes and gene products are shown in the Reference and Sequence, Knock-in, Knock-out and MA-diff Tables. The functions of the protein of some of these genes are also given in these Tables.


Early Seedling Genes Identified by Phenotypic Observations


Some early seedling genes were discovered and characterized from a much larger set of genes by experiments designed to find genes that cause phenotypic changes in germinating seeds as the transitioned into seedlings.


In these experiments, leaf genes were identified by either (1) ectopic expression of a cDNA in a plant or (2) mutagenesis of the plant genome. The plants were then cultivated and one or more of the following leaf phenotypes, which varied from the parental “wild-type”, were observed:


Abnormal growth


Abnormal cotyledons or root growth


Reduced growth


Abnormal first leaf


Abnormal hypocotyl


Abnormal pigmentation


The genes identified by these phenotypes are given in the Knock-in and Knock-out Tables.


Early Seedling Phase Genes Identified by Differential Expression


Such genes are active or potentially active to a greater extent in developing and rapidly growing cells, tissues and organs, as exemplified by development and growth of a seedling 3 or 4 days after planting a seed. These genes herein were also discovered and characterized from a much larger set of genes in experiments designed to find genes. Early seedling phase genes were identified by measuring the relative levels of mRNA products in a seedling 3 or 4 days after planting a seed versus a sterilized seed. Specifically, mRNA was isolated from aerial portion of a seedling 3 or 4 days after planting a seed and compared to mRNA isolated from a sterilized seed utilizing microarray procedures. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Sqn (relating to SMD 7133, SMD 7137)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Early Seedling Phase genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Early Seedling Phase Genes Identified by Cluster Analyses of Differential Expression


Early Seedling Phase Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Early Seedling Phase genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Sqn (relating to SMD 7133, SMD 7137) of the MA_diff table(s).


Early Seedling Phase Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Early Seedling Phase genes. A group in the MA_clust is considered a Early Seedling Phase pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Early Seedling Phase Genes Identified By Amino Acid Sequence Similarity


Early Seedling Phase genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Early Seedling Phase genes. Groups of Early Seedling Phase genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Early Seedling Phase pathway or network is a group of proteins that also exhibits Early Seedling Phase functions/utilities.


Of particular interest are early seedling phase genes that are differentially expressed 3 or 4 days after planting a seed but not differentially expressed germinating seeds and/or mature leaves.


Examples of phenotypes, biochemical activities, and transcription profiles that can be modulated by these genes and gene products are described above and below.


III.B.2.b. Use of Early Seedling Genes, Gene Components and Products to Modulate Phenotypes


Rapid, efficient establishment of a seedling is very important in commercial agriculture and horticulture. It is also vital that resources are approximately partitioned between shoot and root to facilitate adaptive growth. Phototropism and geotropism need to be established. All these require post-germination process to be sustained to ensure that vigorous seedlings are produced. Early seedling phase genes, gene components and products are useful to manipulate these and other processes.


I. Development


The early seedling phase genes, gene components and products of the instant invention are useful to modulate one or more processes of the stages of leaf morphogenesis including: stage 1—organogenesis that gives rise to the leaf primordium; stage 2—delimiting basic morphological domains; and stage 3—a coordinated processes of cell division, expansion, and differentiation. Early seedling phase genes include those genes that terminate as well as initiate leaf development. Modulating any or all of the processes leads to beneficial effects at specific locations.


Gene Sequences Affecting Types of Leaves—Applicants provide with these genes, gene components and gene products the means to modulate one or more of the types of leaves, and stem, including cotyledons and major leaves.


Gene sequences affecting cell properties—These genes, gene components and gene products are useful to modulate changes in cell size, cell division, rate and direction, cell elongation, cell differentiation, xylem and phloem cell numbers, cell wall composition, and all cell types.


Gene Sequences Affecting Leaf Architecture—Modifying leaf architecture is useful to modulate change in overall leaf architecture including veination, such as improvements in photosynthetic efficiency, stress tolerance efficiency of solute and nutrient movement to and from the leaf which are accomplished by increases or decreases in vein placement and number of cells in the vein and shape, such as elongated versus rounded and symmetry (around either abaxial-adaxial (dorsiventral) axis or apical-basal (proximodistal) axis, margin-blade-midrib (lateral) axis).


Genes Sequences Influencing Leaf Responses—Shoot apical meristem cells differentiate to become leaf primordia that eventually develop into leaves. The genes, gene components and gene products of this invention are useful to modulate any one or all of these growth and development processes, by affecting timing and rate or planes of cell divisions for example, in response to the internal plant stimuli and/or programs such as embryogenesis, germination, hormones (like Auxin), phototropism, coordination of leaf growth and development with that of other organs (like roots and stems), and stress-related program.


II. Interaction with the Environment


Successful seedling establishment demands successful interaction with the environment in the soil. Early vegetation genes orchestrate and respond to interactions with the environment. Thus early seedling phase genes are useful for improving interactions between a plant and the environment including pigment accumulation, oxygen gain/loss control, carbon dioxide gain/loss control, water gain/loss control, nutrient transport, light harvesting, chloroplast biogenesis, circadian rhythm control, light/dark adaptation, defense systems against biotic and abiotic stresses, metabolite accumulation, and secondary metabolite production


III. Organizing Tissues for Photosynthesis and Metabolism


Following germination and utilization of seed reserves, plant tissues prepare for photosynthesis and seedling metabolism. Leaf meristems, and root meristems participate in these changes before cell differentiation. Many of the uses for plants depend on the success of leaves as the powerhouses for plant growth, their ability to withstand stresses and their chemical composition. Leaves are organs with many different cell types and structures. Most genes of a plant are active in leaves and therefore leaves have very diverse of pathways and physiological processes. Examples of such pathways and processes that are modulated by early seedling phase genes, gene components and products include photosynthesis, sugar metabolism, starch synthesis, starch degradation, nitrate and ammonia metabolism, amino acid biosynthesis, transport, protein biosynthesis, DNA replication, repair, lipid biosynthesis and breakdown, protein biosynthesis, storage and breakdown, nucleotide transport and metabolism, cell envelope biogenesis, membrane formation, mitochondrial and chloroplast biogenesis, transcription and rna metabolism, vitamin biosynthesis, steroid and terpenoid biosynthesis, devise secondary metabolite synthesis, co-enzyme metabolism, flavonoid biosynthesis and degradation, synthesis of waxes, glyoxylate metabolism, and hormone perception and response pathways.


Use of Plants that are Modified as Described Above


Altering leaf genes or gene products in a plant modifies one or more the following plant traits, to make the plants more useful for specific purposes in agriculture, horticulture and for the production of valuable molecules. The useful plants have at least one of the following characteristics: More seedling vigor; a higher yield of early leaves and their molecular constituents due to different number, size, weight, harvest index, composition including and amounts and types of carbohydrates, proteins, oils, waxes, etc., photosynthetic efficiency, e.g. reduced photorespiration, absorption of water and nutrients to enhance yields, including under stresses such as high light, herbicides, and heat, pathways to accumulate new valuable molecules; more optimal leaf shape and architecture in early seedling—enhancing photosynthesis and enhancing appeal in ornamental species including size, number, or pigment; a better overall plant architecture—enhancing photosynthesis and enhancing appeal in ornamental species; reduced negative effects of high planting density, by altering leaf placement to be more vertical instead of parallel to the ground; for instance better stress tolerance, including drought resistance, by decreasing water loss, and pathogen resistance; better overall yield and vigor—Plant yield of biomass and of constituent molecules and plant vigor are modulated to create benefits by genetically changing the growth rate of seedling, coleoptile elongation, and young leaves.


To change any of the phenotype(s) above, activities of one or more of the early seedling phase genes or gene products are modulated in an organism and the consequence evaluated by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels are altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (Methods. Mol. Biol. 82:259-266 (1998)) with leaf gene constructs and/or screened for variants as in Winkler et al., Plant Physiol. 118: 743-50 (1998) and visually inspected for the desired phenotype and metabolically and/or functionally assayed for altered levels of relevant molecules.


III.B.2.c. Use of Early Seedling Phase Genes, Gene Components and Products to Modulate Biochemical Activities


Seedlings are complex and their structure, function and properties result from the integration of many processes and biochemical activities. Some of these are known from the published literature and some can be deduced from the genes and their products described in this application. Early seedling phase genes, and gene components are used singly or in combination to modify these processes and biochemical activities and hence modify the phenotypic and trait characteristics described above. Examples of the processes and metabolic activities are given in the Table below. The resulting changes are measured according to the citations included in the Table.















BIOCHEMICAL OR




METABOLIC




ACTIVITIES




AND/OR
CITATIONS


PROCESS
PATHWAYS
INCLUDING ASSAYS







Metabolism-anabolic
G. Farnesylation
Pei et al., Science 282: 287-290


and catabolic
H. Cell Wall
(1998); Cutler et al., Science 273:



Biosynthesis
1239 (1996)



I. Nitrogen
Goupil et al., J Exptl. Botany



Metabolism

49: 1855-62 (1998)




J. Secondary
Walch-Liu et al., J Exppt. Botany



Metabolite

51, 227-237 (2000)




Biosynthesis




and




Degradation



Water Conservation And
A. Production of
Allen et al., Plant Cell 11: 1785-


Resistance To Drought
polyols
1798 (1999)


And Other Related
B. Regulation of
Li et al., Science 287: 300-303


Stresses
salt
(2000)


Transport Anion and
concentration
Burnett et al., J Exptl. Botany 51:


Cation Fluxes
C. ABA
197-205 (2000)



response(s)
Raschke, In: Stomatal Function,



(i) Ca2+
Zeiger et al. Eds., 253-279 (1987)



Accumulation
Lacombe et al., Plant Cell 12: 837-



(a) K+ Fluxes
51(2000);



(b) Na+ Fluxes
Wang et al., Plant Physiol.



1. Receptor-
118: 1421-1429 (1998);



ligand binding
Shi et al., Plant Cell 11: 2393-



2. Anion and
2406 (1999)



Cation fluxes
Gaymard et al., Cell 94: 647-655




(1998)




Jonak et al., Proc. Natl. Acad. Sci.





93: 11274-79 (1996);





Sheen, Proc. Natl. Acad. Sci. 95:




975-80 (1998);




Allen et al., Plant Cell 11: 1785-98




(1999)


Carbon Fixation
3. Calvin Cycle
Wingler et al., Philo Trans R Soe



5. Photorespiration

Lond B Biol Sci 355, 1517-1529




6. Oxygen
(2000);



evolution
Palecanda et al., Plant Mol Biol



7. RuBisCO

46, 89-97 (2001);




4. Chlorophyll
Baker et al., J Exp Bot 52, 615-



metabolism
621 (2001)



(ii) Chloroplast
Chen et al., Acta Biochim Pol 41,



Biogenesis and
447-457 (1999)



Metabolism
Imlau et al., PlantCell II, 309-322



5. Fatty Acid and
(1999)



Lipid




Biosynthesis




(iii) Glyoxylate




metabolism




(iv) Sugar




Transport




(v) Starch




Biosynthesis




and




Degradation



Hormone Perception and
(vi) Hormone
Tieman et al., Plant J 26, 47-58


Growth
Receptors and
(2001)



Downstream
Hilpert et al., Plant J 26, 435-446



Pathways for
(2001)



(a) ethylene
Wenzel et al., Plant Phys 124,



(b) jasmonic acid
813-822 (2000)



(c) brassinosteroid
Dengler and Kang, Curr Opin



(d) gibberellin

Plant Biol 4, 50-56 (2001)




(e) Auxin
Tantikanjana et al., Genes Dev 15,



(f) cytokinin
1577-1580 (2001)



Activation Of Specific




Kinases And




Phosphatases





See Imbibition, Shoot Apical Meristem, Root and Leaf sections for more details






Other biological activities that are modulated by the leaf genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table, for example.


III.B.2.d. Use of Early Seedling Phase Genes, Gene Components and Products to Modulate Transcription Levels


The expression of many genes is “up regulated” or down regulated” in plants because some genes and their products are integrated into complex networks that regulate transcription of many other genes. Some early seedling phase genes, gene components and products are therefore useful for modifying the transcription of other genes and hence complex phenotypes, as described above. Profiles of leaf gene activities are described in the Table below with associated biological activities. “Up-regulated” profiles are those where the mRNA transcript levels are higher in young seedlings as compared to the sterilized seeds. “Down-regulated” profiles represent higher transcript levels in the plantlet as compared to sterilized seed only.


III.B.3. Size and Stature Genes, Gene Components and Products


Great agronomic value can result from modulating the size of a plant as a whole or of any of its organs. For example, the green revolution came about as a result of creating dwarf wheat plants, which produced a higher seed yield than taller plants because they could withstand higher levels and inputs of fertilizer and water. Size and stature genes elucidated here are capable of modifying the growth of either an organism as a whole or of localized organs or cells. Manipulation of such genes, gene components and products can enhance many traits of economic interest from increased seed and fruit size to increased lodging resistance. Many kinds of genes control the height attained by a plant and the size of the organs. For genes additional to the ones in this section other sections of the Application should be consulted.


III.B.3.a. Identification of Size and Stature Genes, Gene Components and Products


Size and stature genes identified herein are defined as genes, gene components and products capable of modulating one or more processes in growth and development, to produce changes in size of one or more organs. Examples of such stature genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, Knock-in, Knock-out, MA-diff and MA-clust. The biochemical functions of the protein products of many of these genes determined from comparisons with known proteins are also given in the Reference tables.


Size and Stature Genes, Gene Components and Products Identified by Phenotypic Observations


Mutant plants exhibiting increased or decreased stature in comparison to parental wild-type plants were used to identify size and stature genes. In these experiments, size and stature genes were identified by either (1) the ectopic expression of a cDNA in a plant or (2) mutagenesis of the plant genome. The plants were then cultivated and stature genes were identified from plants that were smaller than the parental “wild-type”. The phenotypes and gene mutations associated with them are given in Tables


Examples of phenotypes, biochemical activities, or transcript profiles that are modulated using these genes are described above and below.


Use of Size and Stature Genes, Gene Components and Products to Modulate Phenotypes


Typically, these genes can cause or regulate cell division, rate and time; and also cell size and shape. Many produce their effects via meristems. These genes can be divided into three classes. One class of genes acts during cytokinesis and/or karyokinesis, such as mitosis and/or meiosis. A second class is involved in cell growth; examples include genes regulating metabolism and nutrient uptake pathways. Another class includes genes that control pathways that regulate or constrain cell division and growth. Examples of these pathways include those specifying hormone biosynthesis, hormone sensing and pathways activated by hormones.


Size and stature genes and gene components are useful to selectively alter the size of organs and stems and so make plants specifically improved for agriculture, horticulture and other industries. There are a huge number of utilities. For example, reductions in height of specific ornamentals, crops and tree species can be beneficial, while increasing height of others may be beneficial.


Increasing the length of the floral stems of cut flowers in some species would be useful, while increasing leaf size in others would be economically attractive. Enhancing the size of specific plant parts, such as seeds, to enhance yields by stimulating hormone (Brassinolide) synthesis specifically in these cells would be beneficial. Another application would be to stimulate early flowering by altering levels of gibberellic acid in specific cells. Changes in organ size and biomass also results in changes in the mass of constituent molecules. This makes the utilities of size and stature genes useful for the production of valuable molecules in parts of plants, for extraction by the chemical and pharmaceutical industries.


Examples of phenotypes that can be modulated by the genes and gene components include cell size, cell shape, cell division, rate and direction, cell elongation, cell differentiation, stomata number, and trichome number. The genes of the invention are useful to regulate the development and growth of roots (primary, lateral, root hairs, root cap, apical meristem, epidermis, cortex, and stele); stem (pholem, xylem, nodes, internodes, and shoot apical meristem); leaves (cauline, rosette, and petioles); flowers (receptacle, sepals, petals, and tepals, including color, shape, size, number, and petal drop, androecium, stamen, anther, pollen, sterility, size, shape, weight, color, filament, gynoecium, carpel, ovary, style, stigma, ovule, size, shape, and number, pedicel and peduncle, flowering time, and fertilization); seeds (placenta, embryo, cotyledon, endosperm, suspensor, and seed coat (testa)); and fruits (pericarp—thickness, texture, exocarp, mesocarp, and endocarp. Traits can be modulated with the genes and gene products of this invention to affect the traits of a plant as a whole include architecture (such as branching, ornamental architecture, shade avoidance, planting density effects, and wind resistance) and vigor (such as increased biomass and drought tolerance).


To regulate any of the phenotype(s) above, activities of one or more of the sizing genes or gene products are modulated in an organism and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (Methods. Mol. Biol. 82:259-266 (1998)) and/or screened for variants as in Winkler et al., (Plant Physiol. 118: 743-50 1998) and visually inspected for the desired phenotype or metabolically and/or functionally assayed.


III.B.3.b. Use of Size and Stature Genes, Gene Components and Products to Modulate Biochemical Activities


Many metabolic and developmental processes can be modulated by size and stature genes and gene components to achieve the phenotypic characteristics exemplified above. Some of these are listed below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Growth and Development
Gibberellic Acid Biosynthesis
Swain SM, Tseng Ts,



Gibberellic Acid Receptor and
Olszewski NE. Altered



Downstream Pathways
expression of spindly affects




gibberellin response and plant




development. Plant Physiol




2001 July; 126(3): 1174-85




Hooley, R. Gibberellins:




perception, transduction, and




responses. Plant Mol. Biol.




1994 26: 1529-1555.




Hooley, R. Gibberellins:




perception, transduction, and




responses. Plant Mol. Biol.




1994 26: 1529-1555.




Perata, P, Matsukura, C,




Vernieri, P, Yamaguchi, J,




Sugar repression of a




gibberellin-dependent




signaling pathway in barley




embryos. Plant Cell 1997




9: 2197-2208.



Brassinolide Biosynthesis
Noguchi T, Fujioka S, Choe S,



Brassinolide Receptors,
Takatsuto S, Tax FE, Yoshida S,



Degradation of Brassinolide
Feldmann KA. Biosynthetic



Pathways affected by
pathways of brassinolide in



Brassinolide
Arabidopsis. Plant Physiol




2000 Sep; 124(1): 201-9




Wang ZY, Seto H, Fujioka S,




Yoshida S, Chory J. BRI1 is a




critical component of a




plasma-membrane receptor for




plant steroids. Nature 2001




Mar 15; 410(6826): 380-3




Neff MM, Nguyen SM,




Malancharuvil EJ, Fujioka S,




Noguchi T, Seto H, Tsubuki M,




Honda T, Takatsuto S,




Yoshida S, Chory J. BAS1: A




gene regulating brassinosteroid




levels and light responsiveness




in Arabidopsis. Proc Natl Acad




Sci USA 1999 Dec




21; 96(26): 15316-23




Kang JG, Yun J, Kim DH,




Chung KS, Fujioka S, Kim JI,




Dae HW, Yoshida S,




Takatsuto S, Song PS, Park CM.




Light and brassinosteroid




signals are integrated via a




dark-induced small G protein




in etiolated seedling growth.




Cell 2001 Jun 1; 105(5): 625-36



Cytokinin biosynthesis
Mok DW, Mok MC. Cytokinin



Cytokinin receptor
metabolism and action. Annu



Degradation of Cytokinin
Rev Plant Physiol Plant Mol



Pathways affected by Cytokinin
Biol 2001; 52: 89-118




Schmulling T. CREam of




cytokinin signalling: receptor




identified. Trends Plant Sci




2001 Jul; 6(7): 281-4




Mok DW, Mok MC. Cytokinin




metabolism and action. Annu




Rev Plant Physiol Plant Mol




Biol 2001; 52: 89-118




Seyedi M, Selstam E, Timko MP,




Sundqvist C. The




cytokinin 2-isopentenyladenine




causes partial reversion to




skotomorphogenesis and




induces formation of




prolamellar bodies and




protochlorophyllide657 in the




lip1 mutant of pea. Physiol




Plant 2001 June; 112(2): 261-272



Auxin Biosynthesis
Zhao Y, Christensen SK,



Auxin Receptor
Fankhauser C, Cashman JR,



Auxin Degradation
Cohen JD, Weigel D, Chory J.



Pathways affected by Auxins
A role for flavin



Auxin transport
monooxygenase-like enzymes




in Auxin biosynthesis. Science




2001 Jan. 12; 291(5502): 306-9




Abel S, Ballas N, Wong LM,




Theologis A. DNA elements




responsive to Auxin. Bioessays




1996 August; 18(8): 647-54




del Pozo JC, Estelle M.




Function of the ubiquitin-




proteosome pathway in Auxin




response. Trends Plant Sci




1999 Mar; 4(3): 107-112.




Rahman A, Amakawa T, Goto N,




Tsurumi S. Auxin is a




positive regulator for ethylene-




mediated response in the




growth of Arabidopsis roots.




Plant Cell Physiol 2001 March;




42(3): 301-7




Zhao Y, Christensen SK,




Fankhauser C, Cashman JR,




Cohen JD, Weigel D, Chory J.




A role for flavin




monooxygenase-like enzymes




in Auxin biosynthesis. Science




2001 Jan. 12; 291(5502): 306-9




Abel S, Ballas N, Wong LM,




Theologis A. DNA elements




responsive to Auxin. Bioessays




1996 August; 18(8): 647-54




del Pozo JC, Estelle M.




Function of the ubiquitin-




proteosome pathway in Auxin




response. Trends Plant Sci




1999 Mar; 4(3): 107-112.




Rahman A, Amakawa T, Goto N,




Tsurumi S. Auxin is a




positive regulator for ethylene-




mediated response in the




growth of Arabidopsis roots.




Plant Cell Physiol 2001 Mar;




42(3): 301-7




Gil P, Dewey E, Friml J, Zhao Y,




Snowden KC, Putterill J,




Palme K, Estelle M, Chory J.




BIG: a calossin-like protein




required for polar Auxin




transport in Arabidopsis.




Genes Dev. 2001 Aug.




1; 15(15): 1985-97




Estelle M., Polar Auxin




transport. New support for an




old model. Plant Cell 1998




November; 10(11): 1775-8



Cell wall growth
Cosgrove DJ., Loosening of




plant cell walls by expansins.




Nature 2000 Sep.




21; 407(6802): 321-6









Other biological activities that are modulated by the stature genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table, for example.


Changes in the size, vigor, or yield of a plant are the result of modulation of the activities of one or more of these many size and stature genes and gene products. While size and stature polynucleotides and gene products can act alone, combinations of these polynucleotides and also with others that also affect growth and development are especially useful.


Use of Promoters of “Size and Stature” Genes

Promoters of “size and stature” genes are useful for controlling the transcription of any desired polynucleotides, both plant and non-plant. They can be discovered from the “size and stature” genes in the Reference Tables, and their patterns of activity from the MA Tables. When operably linked to any polynucleotide encoding a protein, and inserted into a plant, the protein will be synthesized in those cells in which the promoter is active. Many “size and stature” genes will function in meristems, so the promoters will be useful for expressing proteins in meristems. The promoters can be used to cause loss of, as well as synthesis of, specific proteins via antisense and sense suppression approaches.


III.B.4. Shoot-Apical Meristem Genes, Gene Components and Products


New organs, stems, leaves, branches and inflorescences develop from the stem apical meristem (SAM). The growth structure and architecture of the plant therefore depends on the behavior of SAMs. Shoot apical meristems (SAMs) are comprised of a number of morphologically undifferentiated, dividing cells located at the tips of shoots. SAM genes elucidated here are capable of modifying the activity of SAMs and thereby many traits of economic interest from ornamental leaf shape to organ number to responses to plant density.


III.B.4.a. Identification of Sam Genes, Gene Components and Products


SAM genes identified herein are defined as genes, gene components and products capable of modulating one or more processes or functions of SAMs as described below. Regulation of SAM genes and gene products are useful to control many plant traits including architecture, yield and vigor. Examples of such SAM genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, phenotype and MA-diff Tables. The functions of many of the protein products of these genes are also given in the Reference tables.


Sam Genes, Gene Components and Products Identified by Phenotypic Observations


SAM genes were discovered and characterized from a much larger set of genes by experiments designed to find genes that cause phenotypic changes in leaf morphology, such as cotyledon or leaf fusion. In these experiments, SAM genes were identified by either (1) ectopic expression of a cDNA in a plant or (2) mutagenesis of the plant genome. The plants were then cultivated and one or more of the following phenotypes, which varied from the parental “wild-type”, was observed:

    • I. Cotyledon
      • Fused
    • II. Leaves
      • Fused
      • Leaf placement on stems
    • III. Branching
      • Number
    • IV. Flowers
      • Petals fused
      • Altered bolting
      • Early bolting
      • Late bolting
      • Strong bolting
      • Weak bolting
      • Abnormal branching


For more experimental detail see the Example section below. The genes identified by these results of the phenotypes that are shown in Knock-in and Knock-out Tables.


Sam Genes, Gene Components and Products Identified by Differential Expression


SAM genes were also identified in experiments designed to find genes whose mRNA products are associated specifically or preferentially with SAMs. The concentration of mRNA products in the arabidopsis plant with the SHOOTMERISTEMLESS (STM) gene knocked-out was measured relative to the concentration in the parental, non-mutant plant. The Arabidopsis STM gene is required for embryonic SAM formation. The STM gene encodes a Knotted1 (Kn1) type of homeodomain protein. Homeodomain proteins regulate transcription of many genes in many species and have been shown to play a role in the regulation of translation as well. Seedlings homozygous for recessive loss-of-function alleles germinate with roots, a hypocotyl, and cotyledons, but no SAM is formed. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108478, 108479, 108480, 108481, 108598, 108535, 108536, 108435). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Meristem genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Meristem Genes Identified by Cluster Analyses of Differential Expression


Meristem Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Meristem genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108478, 108479, 108480, 108481, 108598, 108535, 108536, 108435 of the MA_diff table(s).


Meristem Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Meristem genes. A group in the MA_clust is considered a Meristem pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Meristem Genes Identified by Amino Acid Sequence Similarity


Meristem genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Meristem genes. Groups of Meristem genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Meristem pathway or network is a group of proteins that also exhibits Meristem functions/utilities.


Examples of phenotypes, biochemical activities, and transcription profiles that can be modulated by SAM genes and gene products are described above and below.


III.B.4.b. Use of Sam Genes, Gene Components and Products to Modulate Phenotypes


With the SAM genes and gene products of the invention, Applicants provide the means to modulate one or more of the following types of SAMs:

    • 1. Embryonic meristem
    • 2. Vegetative lateral SAMs
    • 3. Inflorescence lateral SAMs
    • 4. Floral meristems
    • 5. Adventitious SAM


The SAM genes of the instant invention are useful for modulating one or more processes of SAM structure and/or function including (I) cell size and division; (II) cell differentiation and organ primordia.


I. Cell Size and Division


A. Cell Properties


SAM genes and gene products can be used to modulate changes in cell size, cell division, rate and direction, and cell division symmetry.


A key attribute of the SAM is its capacity for self-renewal. The self-renewing initial cell population resides in the central zone of the SAM. A small number of slowly dividing initial cells (typically 2 to 4 per layer) act as a self-replenishing population, whereas some of their descendants, pushed out onto the flanks of the SAM, differentiate into leaves. Other descendants, displaced below the SAM, differentiate into stem. The immediate descendants of the initial cells divide further, amplifying the cell population before being incorporated into leaf or stem primordia.


The genes and gene components of this invention are useful for modulating any one or all of these cell division processes generally, as in timing and rate, for example. In addition, the polynucleotides and polypeptides of the invention can control the response of these processes to the internal plant programs associated with embryogenesis, hormone responses like cytokinin (inhibitory for root development, see section on cytokinin-responsive genes), coordination of growth and development with that of other plant organs (such as leaves, flowers, seeds, and fruits.


SAM genes can also be used to control the response of these processes to changes in the environment, including heat, cold, drought, high light and nutrition.


B. Sam Cell Patterns and Organization


Although SAMs appear as small regions of morphological undifferentiated dividing cells, a group of morphologically undifferentiated dividing cells does not necessarily constitute a SAM. Rather, evidence indicates that SAMs are highly organized or patterned regions of the plant in which many important events in early organogenesis occur. Thus, the term “SAM” is used to denote a highly organized structure and site of pattern formation. The invention also permits engineering of specific as well as overall features of SAM architecture including zones (central, peripheral, and rib), layers (l1, l2, and l3) and symmetry.


II Cell Differentiation and Organ Primordia


The apical meristem in many species first undergoes a vegetative phase whereby cells set aside from the apex become leaf primordia with an axillary vegetative meristem. Upon floral induction, the apical meristem is converted to an inflorescence meristem. The inflorescence meristem arises in the axils of modified leaves and is indeterminate, producing whorls or rings of floral organ primordia. In species which produce terminal flowers, the apical meristem is determinate and eventually adopts a third identity, that of a floral meristem. Examples of the plant properties that the genes and gene products of the invention can be used to modulate include indeterminancy (inhibiting or increasing differentiation and enhancing plant growth and yield), symmetry (symmetry of organs developed, and symmetry of arrangement of organs, such as leaves, petals, flowers, etc.), leaf fate and timing internode length modulation, such as longer internodes to increase shade avoidance and shorter internodes to favor leaf development), and floral fate and timing of flowering.


Uses of Plants Modified as Described Above Using Sam Genes, Gene Components and Products


Because SAMs determine the architecture of the plant, modified plants will be useful in many agricultural, horticultural, forestry and other industrial sectors. Plants with a different shape, numbers of flowers and seed and fruits will have altered yields of plant parts. For example, plants with more branches can produce more flowers, seed or fruits. Trees without lateral branches will produce long lengths of clean timber. Plants with greater yields of specific plant parts will be useful sources of constituent chemicals. Such plants will have, for example, more prolific leaf development, better optimized stem and shoot development, adventitious shoots, more flowers, seeds, and fruits, enhanced vigor (including growth rate of whole plant, including height, flowering time, etc., seedling, coleoptile elongation, young leaves, flowers, seeds, and fruit. higher yields based on biomass (fresh and dry weight during any time in plant life, including maturation and senescence), number of flowers, seed yield (number, size, weight, harvest index, content and composition, e.g. amino acid, jasmonate, oil, protein and starch) and fruit yield (number, size, weight, harvest index, content and composition, e.g. amino acid, jasmonate, oil, protein and starch).


To regulate any of the phenotype(s) above, activities of one or more of the SAM genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Dolan et al. (1993, Development 119: 71-84), Dolan et al. (1997, Development 124: 1789-98), Crawford and Glass (1998, Trends Plant Science 3: 389-95), Wang et al. (1998, PNAS USA 95: 15134-39), Gaxiola et al. (1998, PNAS USA 95: 4046-50), Apse et al. (1999, Science 285: 1256-58), Fisher and Long (1992, Nature 357: 655-60), Schneider et al. (1998, Genes Devel 12: 2013-21) and Hirsch (1999, Curr Opin Plant Biol. 2: 320-326).


III.B.4.c. Use of Sam Genes and Gene Components to Modulate Biochemical Activities


SAM genes and gene components are useful for modulating biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Growth, Differentiation
Leaf shape and inflorescence and
Chuck, G. et al., 1996 Plant Cell


And Development
flower morphology systems
8: 1227-1289.



Activities of SAM
Schneeberger et al., 1998



transcriptional regulatory
Development 125: 2857-2865.



proteins.



Meristem size and organ number
Kayes, J. M. and Clark, S. E.



determinants
1998 Development 125: 3843-3851.



Regulated by Receptor Kinases
Jeong, S. et al., 1999 Plant



Receptor kinase location and
Cell 11: 1925-1934.



activity.



Meristem proliferation activities
Tantikanjana, T. Genes and




Development. Jun. 15, 2001.




15(12): 1577-1588.


Internode elongation
Hormone signaling pathways
Yamamuro, C. et al., 2000 Plant




Cell. 12: 1591-1605.


Hormone
Levels of growth hormones
Kusaba, S. et al; 1998 Plant


Perception
including gibberellic acid, Auxin
Physiology 116(2): 471-476.



and cytokinin.



Gibberellic acid biosynthesis
Modulation of GA perception



GA biosynthetic enzyme GA-20
and function can be assayed as



oxidase is a required step in GA
described in Sakamoto, T. et al.



biosynthesis. GA-20 oxidase is
2001 Genes and Development



Regulated by some SAM gene
15: 581-590.



products.



Over expression of SAM genes
Sakamoto, T. et al. 2001.



can lead to reduced internode
Genes and Development 15:



elongation, reduced cell
581-590.



elongation and reduced cell



expansion.



Cytokinin Receptor activity
Inoue, T. et al., Nature




409: 1060-1063.



SAM gene products can affect
Sieberer, T. et al., 2000 Current



the activity of Auxin dependent
Biology 10: 1595-1598.



postranscriptional gene protein
del Pozo, J. C.; Estelle, M.



expression.
PNAS (USA) 1999.




96(26): 15342-15347.



SAM gene products can affect
Tantikanjana, T. Genes and



Auxin Perception/metabolism in
Development. Jun. 15, 2001.



the meristem to produce useful
15(12): 1577-1588.



changes in plant architecture.


Leaf senescence
SAM gene products can increase
Ori, N. et al; Plant Cell. June,



and decrease leaf senescence
1999. 11(6): 1073-1080.



rate. This can be done by



modulating cytokinin hormone



levels.



Cytokinin effect on cell division
Beemster, Gerrit T. S.; Baskin,



and expansion.
Tobias I. 2000 Plant Physiology




124: 1718-1727.


Adventitious shoot
Alter growth hormone status.
Kusaba, S. et al; 1998 Plant


formation

Physiology 116(2): 471-476



Ectopic expression of SAM
Chuck, G. 1996 Plant Cell 8:



genes in leaf or other non SAM
1227-1289.



organs or tissue can produce



shoots



Pathways comprising



isopentenyl transferase (ipt)









Other biological activities that can be modulated by the SAM genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


III.B.4.d. Use of Sam Genes, Gene Components and Products to Modulate Transcription Levels of Other Genes


The expression of many genes is “upregulated” or “downregulated” in the SAM mutants because some of the SAM genes are integrated into complex networks that regulate the transcription of many other genes. Some SAM genes and gene components are therefore useful for modifying the transcription of other genes and hence complex phenotypes as described above. Profiles of genes altered by SAM mutations and genes are described in the Table below with associated biological activities. “Up-regulated” profiles are for genes whose mRNA levels are higher in the stm plants as compared to parental wild-type plants; and vice-versa for “down-regulated” profiles.

















PHYSIOLOGICAL
EXAMPLES OF



TYPE OF GENES
CONSEQUENCES OF
BIOCHEMICAL



WHOSE
MODIFYING SAM
ACTIVITIES WHOSE


TRANSCRIPT
TRANSCRIPTS ARE
GENE PRODUCT
TRANSCRIPTS ARE


LEVELS
CHANGED
LEVELS
CHANGED







Up Regulated
Genes repressed by
Altered
Transporters


Transcripts
SAMs directly or
Auxin/cytokinin
Metabolic Enzymes



indirectly
hormone ratio and
Cell Membrane




perception.
Structure




Increased/decreased
Kinases, Phosphatases,




cell expansion -
G-Proteins




promoting effects of
Transcription




brassinosteroids and
Activators/Repressors




gibberellic acids, due
Transcription




to altered levels of
coactivators/corepressors




biosynthetic pathway
Chromatin Structure




enzymes and or the
And/Or Localized DNA




amount of functional
Topology Proteins




hormone receptor.
Cell Wall Proteins




Increased or
Translational




decreased rate of cell
activators/repressors




division.
Cell wall proteins




Altered planes of cell
involved in cell rigidity




division
e.g. extensin, glycine




Increased or
rich proteins.




decreased rate and
Cell cycle regulatory




extent of cell
proteins such as cyclins




expansion.
and cyclin dependent




Increased or
protein kinases (CDKs).




decreased rigidity of




cell ways.


Down-Regulated
Genes involved in SAM
Altered pattern of
Auxin transporter


Transcripts
cells and genes whose
organs immerging
proteins



expression is induced by
from the meristem
Auxin receptor proteins



SAMs
Increased or
Cytokinin receptor




decreased the number
proteins




of cells partitioned
Gibberellic acid receptor




into a lateral organ.
proteins




Altered apical
Brassinolide receptor




dominance due to
proteins




suppression of lateral
Hormone biosynthesis




bud growth.
proteins




Altered apical
Hormone degradation




dominance due to
proteins




releasing of axillary
Hormone conjugation




meristems from
proteins




repression.
Ubiquitin conjugating




Increased/or
enzymes.




decreased production
Receptor kinase signal




of adventitious
transduction




meristems.




Increased potential to




form somatic




embryos.




Altered cell signaling




pathways




Altered hormone




levels









SAM genes and gene products can be modulated alone or in combination as described in the introduction. Of particular interest are combination of these genes and gene products with those that modulate hormone responsive pathways. Hormone responsive genes and gene products are described in more detail in the sections below.


Use of Sam Gene Promoters to Modify SAMS

Promoters of SAM genes, as described in the Reference tables, for example, can be used to modulate transcription of coding sequences in SAM cells to influence growth, differentiation or patterning of development or any of the phenotypes or biological activities above. For example, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as a SAM gene when the desired sequence is operably linked to the promoter of the SAM gene.


A specific instance is linking of a SAM gene promoter normally active in floral meristem primordia, to a phytotoxic protein coding sequence to inhibit apical meristem switching into an inflorescence and/or floral meristem, thereby preventing flowering.


SAM gene promoters can also be used to induce transcription of antisense RNA copies of a gene or an RNA variant to achieve reduced synthesis of a specific protein in specific SAM cells. This provides an alternative way to the example above, to prevent flowering.


















EXAMPLES OF




PHYSIOLOGICAL
BIOCHEMICAL



TYPE OF GENES
CONSEQUENCES
ACTIVITIES OF



WHOSE
OF MODIFYING
GENE PRODUCTS


TRANSCRIPT
TRANSCRIPTS
GENE PRODUCT
WITH MODIFIED


LEVELS
ARE CHANGED
LEVELS
LEVELS







Up regulated
Genes involved in
Leaf cells
Transcription


Transcripts
leaf, stem and root
proliferate and
factors, signal



cell differentiation,
differentiate;
transduction



cell division, cell
Leaf structures
proteins, kinase



expansion
form and expand
and phosphatases



Genes involved in

Chromatin



positive regulation of

remodeling



root, stem and leaf

Hormone



genes

biosynthesis



Repressors of root

enzymes



and other organ cell

Receptors



types e.g. flowers



Genes involved in
Photosynthesis
Light harvesting



photosynthesis
and plastid
coupled to ATP




differentiation
production




Calvin cycle
Chlorophyll




activated
biosynthesis




Chloroplast
Ribulose




biogenesis and
Bisphosphate




plastid
carboxylase




differentiation
Chloroplast




activated
membranes





synthesis





Chloroplast





ribosome





biogenesis



Other genes involved
Starch
Starch synthase



in metabolism
biosynthesis
Nitrate reductase




Lipid
Terpenoid




biosynthesis
biosynthesis




Nitrogen
Transcription




metabolism -
factors




NO3 reduced and
Transporters




amino acids made
Kinases




Secondary
Phosphatases and




metabolites
signal




produced
transduction





protein





Chromatin





structure





modulators


Down regulated
Genes involved in
Leaf genes
Transcription


genes
negative regulation
activated and leaf
factors



of root, stem and leaf
functions induced
Signal



genes
Other organs not
transduction



Genes involved in
induced
proteins - kinases



other organs e.g.
Leaf, stem and
and phosphatases



flowers
root metabolic
Metabolic




pathways induced
enzymes





Chromatin





remodeling





proteins









While early seedling phase polynucleotides and gene products are used singly, combinations of these polynucleotides are often better to optimize new growth and development patterns. Useful combinations include different leaf polynucleotides and/or gene products with a hormone responsive polynucleotide. These combinations are useful because of the interactions that exist between hormone-regulated pathways, nutritional pathways and development.


Use of Early Seedling Phase Gene Promoters

Promoters of early seedling phase genes are useful for transcription of desired polynucleotides, both plant and non-plant. If the gene is expressed only in the post-germination seedling, or in certain kinds of leaf cells, the promoter is used to drive the synthesis of proteins specifically in those cells. For example, extra copies of carbohydrate transporter cDNAs operably linked to a early seedling phase gene promoter and inserted into a plant increase the “sink” strength of leaves. Similarly, early seedling phase promoters are used to drive transcription of metabolic enzymes that alter the oil, starch, protein, or fiber contents of the seedling. Alternatively, the promoters direct expression of non-plant genes that can, for instance, confer resistance to specific pathogen. Additionally the promoters are used to synthesize an antisense mRNA copy of a gene to inactivate the normal gene expression into protein. The promoters are used to drive synthesis of sense RNAs to inactivate protein production via RNA interference.


III.B.5. Vegetative-Phase Specific Responsive Genes, Gene Components and Products


Often growth and yield are limited by the ability of a plant to tolerate stress conditions, including water loss. To combat such conditions, plant cells deploy a battery of responses that are controlled by a phase shift, from so called juvenile to adult. These changes at distinct times involve, for example, cotyledons and leaves, guard cells in stomata, and biochemical activities involved with sugar and nitrogen metabolism. These responses depend on the functioning of an internal clock, that becomes entrained to plant development, and a series of downstream signaling events leading to transcription-independent and transcription-dependent stress responses. These responses involve changes in gene expression.


Manipulation of the activation of one or more genes controlling the phase changes is useful to modulate the biological processes and/or phenotypes listed below. Phase responsive genes and gene products can act alone or in combination. Useful combinations include phase responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants.


Phase responsive genes and gene products can function to either increase or dampen the above phenotypes or activities. Characterization of phase responsive genes was carried out using microarray technology. Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing about 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in a mutant of Arabidopsis thaliana, squint, that appears not to undergo phase changes and appears adult-like throughout its growth cycle, compared with wild type were identified, compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones identified. The MA_diff tables reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which represent phase responsive genes. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Sqn (relating to SMD 7133, SMD 7137)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Phase responsive genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Phase Responsive Genes Identified by Cluster Analyses of Differential Expression


Phase Responsive Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of phase responsive genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Sqn (relating to SMD 7133, SMD 7137) of the MA_diff table(s).


Phase Responsive Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of phase responsive genes. A group in the MA_clust is considered a phase responsive pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Phase Responsive Genes Identified By Amino Acid Sequence Similarity


Phase responsive genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis phase responsive genes. Groups of phase responsive genes are identified in the Protein Grouping table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a phase responsive pathway or network is a group of proteins that also exhibits Phase responsive functions/utilities.


Further, promoters of phase responsive genes, as described in Reference tables, for example, are useful to modulate transcription that is induced by phase or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the phase responsive genes when the desired sequence is operably linked to a promoter of a phase responsive gene.


III.B.5.a. Use of Phase Responsive Genes to Modulate


PhenotypesPhase responsive genes and gene products are useful to or modulate one or more phenotype including timing phenotypes, dormancy, germination, cotyledon opening, first leaves, juvenile to adult transition, bolting, flowering, pollination, fertilization, seed development, seed set, fruit drop, senescence, epinasty, biomass, fresh and dry weight during any time in plant life, such as maturation, number of flowers, seeds, branches, and/or leaves, seed yield, including number, size, weight, and/or harvest index, fruit yield, including number, size, weight, and/or harvest index, plant development, time to fruit maturity, cell wall strengthening and reinforcement, stress tolerance, drought tolerance, flooding tolerance, and UV tolerance.


To regulate any of the phenotype(s) above, activities of one or more of the phase responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Anderson et al. (1997) Plant Cell 9: 1727-1743; Heintzen et al. (1997) Proc. Natl. Acad. Sci. USA 94: 8515-20; Schaffer et al. (1998) Cell 93:1219-1229; Somers et al. (1998) Development 125: 485-494; Somers et al. (1998) Science 282: 1488-1490; Wang and Tobin (1998) Cell 93: 1207-1217; Zhong et al. (1998) Plant Cell 10: 2005-2017; Sugano et al. (1998) Proc. Natl. Acad. Sci. USA 95: 11020-11025; Dowson-Day and Millar (1999) Plant J 17: 63-71; Green and Tobin (1999) Proc. Natl. Acad. Sci. USA 96: 4176-419; Staiger and Apel (1999) Mol. Gen. Genet. 261: 811-819; Strayer and Kay (1999) Curr. Opin. Plant Biol. 2:114-120; Strayer et. al. (2000) Science 289:768-771; Kreps et al. (2000) J Biol Rhythms (2000) 15:208-217; Nelson et al. (2000) Cell 101:331-340; Somers et al. (2000) Cell 101:319-329.


III.B.5.b. Use of Phase Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the phase responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations above and included in the table below:















Biochemical Or Metabolic



Process
Activities And/Or Pathways
Citations including assays







Germination And
Cold, Light And Water
Bognar et al. (1999) Proc. Natl. Acad.


Seedling
Modulated Signal Transduction

Sci. USA 96: 14652-14657; Sugano et



Development
Pathways, Receptors, Kinases,
al (1999) Proc. Natl. Acad. Sci. USA



PAS Domain Proteins
96: 12362-12366; Dowson-Day and




Millar (1999) Plant J 17: 63-71;




Somers et al. (2000) Cell 101: 319-329;




Zhong et al. (1998) Plant Cell




10: 2005-2017


Growth
Cold And Light Modulated
Nelson et al. (2000) Cell 101: 331-340;


Transitions And
Signal Transduction Pathways,
Fowler et al. (1999) EMBO J.


Flowering
Receptors, Kinases, PAS
18: 4679-4688



Domain Protiens


Tuber Formation
Cold And Light Modulated
Yanovsky et al. (2000) Plant J. 23:



Signal Transduction Pathways
223-232


METABOLISM


Lipid Metabolism
Membrane Lipid Synthesis
Bradley and Reddy (1997) J.



Including Omega-3 Fatty Acid

Bacteriol. 179: 4407-4410; Martin, M




Desaturase, Lipases, Lipid
et al. 1999 Europe J. Biochem 262:



Transfer Proteins
283-290


Sugar
Glycosylhydrolases,
Liu et al. (1996) Plant Physiol.


Metabolism
Glycosyltransferases,
112: 43-51; Millar and Kay (1996)



Amylases, Sucrose Synthase,

Proc Natl Acad Sci USA 93: 15491-15496;




CAB, Rubisco, Light Signal
Wang et al. (1997) Plant Cell



Transduction
9: 491-507; Shinohara et al (1999) J.





Biol. Chem. 273: 446-452



Nitrogen
Aminotransferases, Arginase,
Bradley and Reddy (1997) J.


Metabolism
Proteases And Vegetative

Bacteriol. 179: 4407-4410




Storage Proteins, Aromatic



Amino Acid Synthesis


Photorespiration
Mitochondrial, Chloroplast And
Zhong and McClung (1996) Mol. Gen.



Peroxisomal Photorespiratory

Genet. 251: 196-203; McClung (1997)




Enzymes, Serine

Free. Radic. Biol. Med. 23: 489-496;




Hydroxymethyl Transferases,
McClung et al. (2000) Plant Physiol.



Catalase
123: 381-392


Responses To
Expression Of Genes Involved
McClung (1997) Free Radic Biol Med


Environmental
In Responses To Drought, Salt,
23: 489-496; Shi et al. (2000) Proc.


Stress
UV

Natl. Acad. Sci. USA 97: 6896-6901










Other biological activities that can be modulated by the phase responsive genes and their products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Phase responsive genes are characteristically differentially transcribed in response to maturity of the cell, organ or tissue which depends on a timing mechanism, which is internal to an organism or cell. The Intensity Table reports the changes in transcript levels of various phase responsive genes in a plant.


The data from this experiment reveal a number of types of phase responsive genes and gene products. Profiles of some classes of phase responsive genes are shown in the table below with examples of which associated biological activities are modulated when the activities of one or more such genes vary in plants.















Transcript

Physiological
Examples Of Biochemical


Levels
Type Of Genes
Consequences
Activity







Up Regulated
Responders To
Adult phase
Metabolic Enzymes


Transcripts
mutation that confers
adoption
Change In Cell



adult like phase
Metabolisms
Membrane Structure



Genes induced in
Affected By phase
And Potential



adult-like phase
change
Kinases And




Synthesis Of
Phosphatases




Secondary
Transcription




Metabolites
Activators




And/Or Proteins
Change In Chromatin




Modulation Of
Structure And/Or




Phase Response
Localized DNA




Transduction
Topology




Pathways




Specific Gene




Transcription




Initiation


Down-
Responders To
Negative
Transcription Factors


Regulated
mutation that confers
Regulation of
Change In Protein


Transcripts
adult phase
adult phase
Structure By



Genes repressed in
pathways
Phosphorylation



adult-like phase
Changes In
(Kinases) Or



Genes With
Pathways And
Dephosphoryaltion



Discontinued
Processes
(Phosphatases)



Expression Or
Operating In Cells
Change In Chromatin



Unstable mRNA in
Changes In
Structure And/Or



adult-like phase
Metabolic
DNA Topology




pathways other
Stability Factors For




than phase
Protein Synthesis And




specific pathways
Degradation





Metabolic Enzymes









Use of Promoters of Phase Responsive Genes

Promoters of phase responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the phase responsive genes where the desired sequence is operably linked to a promoter of a phase responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.C. Hormone Responsive Genes, Gene Components and Products


III.C.1. Abscissic Acid Responsive Genes, Gene Components and Products


Plant hormones are naturally occurring substances, effective in very small amounts, which act as signals to stimulate or inhibit growth or regulate developmental processes in plants. Abscisic acid (ABA) is a ubiquitous hormone in vascular plants that has been detected in every major organ or living tissue from the root to the apical bud. The major physiological responses affected by ABA are dormancy, stress stomatal closure, water uptake, abscission and senescence. In contrast to Auxins, cytokinins and gibberellins, which are principally growth promoters, ABA primarily acts as an inhibitor of growth and metabolic processes.


Changes in ABA concentration internally or in the surrounding environment in contact with a plant results in modulation of many genes and gene products. Examples of such ABA responsive genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix tables, MA_diff, and MA_clust tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. They were discovered and characterized from a much larger set of genes by experiments designed to find genes whose mRNA products changed in concentration in response to application of ABA to plants.


While ABA responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different ABA responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of an ABA responsive polynucleotide and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress and defence induced pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways.


Such ABA responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in ABA concentration or in the absence of ABA fluctuations. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108560, 108561, 108513, 108597). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


ABA genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


ABA Genes Identified by Cluster Analyses of Differential Expression


ABA Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of ABA genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108560, 108561, 108513, 108597 of the MA_diff table(s).


ABA Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of ABA genes. A group in the MA_clust is considered a ABA pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


ABA Genes Identified by Amino Acid Sequence Similarity


ABA genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis ABA genes. Groups of ABA genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a ABA pathway or network is a group of proteins that also exhibits ABA functions/utilities.


Further, promoters of ABA responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by ABA or any of the following phenotypes or biological activities below.


III.C.1.a. Use of Abscissic Acid Responsive Genes to Modulate Phenotypes


ABA responsive genes and gene products are useful to or modulate one or more of the following phenotypes including development such as cell growth (promotion of leaf cell elongation), fruit development (fruit drop and inhibition of parthenocarpy and ovary growth), seed development (maturation of zygotic and somatic embryos, embryo development, seed development and maturation, acquisition of desiccation tolerance, dormancy including control rate and timing of germination, prolongation of seed storage and viability, and inhibition of hydrolytic enzyme synthesis); growth of roots such as inhibition of root elongation under low water potential), stems, buds (such as promotion of dormancy and lateral/axillary bud formation), leaves, and inhibition of aba-induced growth and elongation; biomass (such as fresh and dry weight during any time in plant life, such as maturation), number, size, and weight of flowers and seeds); senescence (including abscission, leaf fall, and flower longevity); differentiation (including plastid/chloroplast differentiation and regulation of sterility); and stress responses (such as mediation of response to desiccation, drought, salt and cold).


To regulate any of the phenotype(s) above, activities of one or more of the ABA responsive genes or gene products can be modulated in an organism and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Koorneef and Karssen (1994, Seed dormancy and germination, In: Arabidopsis, Cold Spring Harbor Lab. Press, pp 314-334), Cramer et al (1998, J. Exptl. Botany 49:191-198), and White and Rivin (2000, Plant Physiol 122: 1089-97). Phillips et al. (1997) EMBO J 16: 4489-96; Nambara et al (1995) Development 121: 629-636; Hays et al (1999) Plant Physiol. 119: 1065-72; Filonova et al (2000) J Exptl Botany 51: 249-64; White et al (2000) Plant Physiol. 122: 1081-88; and Visser et al. (1998) Plant Mol Biol 37: 131-40; Rohde et al. (2000) Plant Cell 12:35-52; and Cramer et al. (1998) J. experimental Botany. 49: 191-198.


III.C.1.b. Use of Abscissic Acid Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the ABA responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES


PROCESS
AND/OR PATHWAYS
CITATIONS INCLUDING ASSAYS







Growth,
Farnesylation
Pei Et Al (1998) Science 282: 287-290;


Differentiation And

Cutler Et Al. (1996) Science


Development

273: 1239



Nitrogen Metabolism
Goupil Et Al (1998) J Exptl Botany




49: 1855-62


Water Conservation
Stomatal Development
Allen Et Al. (1999) Plant Cell 11:


And Resistance To
And Physiology
1785-1798


Drought And Other

Li Et Al. 2000 Science 287: 300-303


Related Stresses

Burnett Et Al 2000. J. Exptl Botany




51: 197-205




Raschke (1987) In: Stomatal




Function Zeiger Et Al. Eds., 253-279



Stress Response Pathways
Bush And Pages (1998) Plant Mol.




Biol. 37: 425-35



Inhibition Of Ethylene
Spollen Et Al (2000) Plant Physiol.



Production Under Low
122: 967-976



Water Potential



Proline And Other
Hare Et Al. (1998) Plant, Cell And



Osmolite Synthesis And
Environment 21: 535-553; Hare Et Al.



Degradation
(1999) J. Exptl. Botany 50: 413-434



Plasmalemma And
Macrobbie (1998) Philos Trans R Soc



Tonoplast Ion Channel
Lond B Biol Sci 353: 1475-88; Li Et



Changes
Al (2000) Science 287: 300-303;




Barkla Et Al. (1999) Plant Physiol.




120: 811-819



Ca2+ Accumulation
Lacombe Et Al. (2000) Plant Cell 12:




837-51; Wang Et Al. (1998) Plant




Physiol 118: 1421-1429; Shi Et Al.




(1999) Plant Cell 11: 2393-2406



K+ Efflux
Gaymard Et Al. (1998) Cell 94: 647-655



Activation Of Kinases
Jonak Et Al. (1996) Proc. Natl. Acad.



And Phosphatases
Sci 93: 11274-79; Sheen (1998) Proc.




Natl. Acad. Sci. 95: 975-80; Allen Et




Al. (1999) Plant Cell 11: 1785-98









Other biological activities that can be modulated by the ABA responsive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


ABA responsive genes are characteristically differentially transcribed in response to fluctuating ABA levels or concentrations, whether internal or external to an organism or cell. The MA_diff reports the changes in transcript levels of various ABA responsive genes in entire seedlings at 1 and 6 hours after a plant was sprayed with a Hoagland's solution enriched with ABA as compared to seedlings sprayed with Hoagland's solution only.


The data from this time course can be used to identify a number of types of ABA responsive genes and gene products, including “early responders,” and “delayed ABA responders”, “early responder repressors” and “delayed repressors”. Profiles of these different ABA responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF


TRANSCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up Regulated
Early Responders
ABA Perception
Transcription Factors


Transcripts
To ABA
ABA Uptake
Transporters


(Level At 1 Hr ≅ 6 Hr)

Modulation Of ABA
Change In Cell Membrane


or

Response
Structure


(Level At 1 Hr > 6 Hr)

Transduction
Kinases And Phosphatases




Pathways
Transcription Activators




Specific Gene
Change In Chromatin




Transcription
Structure And/Or




Initiation
Localized DNA Topology


Up Regulated
Delayed
Maintenance Of
Transcription Factors


Transcripts
Responders
Response To ABA
Specific Factors (Initiation


(Level At 1 Hr < 6 Hr)

Maintenance Of Seed
And Elongation) For




Dormancy, Stress
Protein Synthesis




Stomatal Closure,
Maintenance Of Mrna




Water Uptake
Stability




Control, Abscission
Maintenance Of Protein




And Senescence
Stability




Control Pathways
Maintenance Of Protein-





Protein Interaction


Down-Regulated
Early Responder
Negative Regulation
Transcription Factors


Transcripts
Repressors Of
Of ABA Pathways
Change In Protein


(Level At 1 Hr ≅ 6 Hr)
ABA State Of
Released
Structure By


or
Metabolism
Changes In Pathways
Phosphorylation (Kinases)


(Level At 6 Hr > 1 Hr)
Genes With
And Processes
Or Dephosphoryaltion



Discontinued
Operating In Cells
(Phosphatases)



Expression Or

Change In Chromatin



UnsTable mRNA

Structure And/Or DNA



In Presence Of

Topology



ABA


Down-Regulated
Delayed
Negative Regulation
Transcription Factors


Transcripts
Repressors Of
Of ABA Pathways
Kinases And Phosphatases


(Level At 1 Hr > 6 Hr)
ABA State Of
Released
Stability Of Factors For



Metabolism
Maintenance Of
Protein Synthesis And



Genes With
Pathways Released
Degradation



Discontinued
From Repression



Expression Or
Changes In Pathways



UnsTable mRNA
And Processes



In Presence Of
Operating In Cells



ABA









Use of Promoters of ABA Responsive Genes

Promoters of ABA responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the ABA responsive genes where the desired sequence is operably linked to a promoter of a ABA responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.C.2. Auxin Responsive Genes, Gene Components and Products


Plant hormones are naturally occurring substances, effective in very small amounts that stimulate or inhibit growth or regulate developmental processes in plants. One of the plant hormones is indole-3-acetic acid (IAA), often referred to as Auxin.


Changes in Auxin concentration in the surrounding environment in contact with a plant or in a plant results in modulation of the activities of many genes and hence levels of gene products. Examples of such Auxin responsive genes and their products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. The genes were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to application of Auxin to plants.


Manipulation of one or more Auxin responsive gene activities are useful to modulate the biological activities and/or phenotypes listed below. Auxin response genes and gene products can act alone or in combination. Useful combinations include Auxin response genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of the levels of such proteins is especially useful for altering phenotypes and biochemical activities of plants. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108564, 108565, 108516, 108554, 108466, 107886, 107891, SMD 3743, and NAA (relating to SMD 3749, SMD 6338, SMD 6339)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


NAA genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


NAA Genes Identified by Cluster Analyses of Differential Expression


NAA Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of NAA genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108564, 108565, 108516, 108554, 108466, 107886, 107891, SMD 3743, and NAA (relating to SMD 3749, SMD 6338, SMD 6339) of the MA_diff table(s).


NAA Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of NAA genes. A group in the MA_clust is considered a NAA pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


NAA Genes Identified by Amino Acid Sequence Similarity


NAA genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis NAA genes. Groups of NAA genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a NAA pathway or network is a group of proteins that also exhibits NAA functions/utilities.


Such Auxin responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in Auxin concentration or in the absence of Auxin fluctuations. Further, promoters of Auxin responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by Auxin or any of the following phenotypes or biological activities below.


III.C.2.a. Use of Auxin Responsive Genes, Gene Components and Products to Modulate Phenotypes


Auxin responsive genes and gene products are useful to or modulate one or more phenotypes including growth, apical dominance, vascular growth, roots, inhibition of primary root elongation, increased lateral root formation, stems, lateral buds, lateral branching, reduction of branching, for high density growth per acre, for increased wood production, lateral organ initiation and/or positioning in apical meristem, organ formation, for example, fruit number in tomatoes, leaves, height/stature, e.g., taller crops or increase wood production, regeneration and differentiation of cultured cells or plantlets, biomass, fresh and dry weight during any time in plant life, such as maturation; number of flowers; number of seeds; number of branches; number of leaves; starch content, seed yield, including number, size, weight, harvest index, starch content, fruit yield, number, size, weight, harvest index, starch content, development, orienting cell growth, establishment and maintenance of plant axis, apical dominance, cell plate placement, polarised growth, initiation and/or development, of embryos morphogenic progression, e.g., from early radial to late axialized torpedo stages, differentiation of cells into morphologically different cell layers, cotyledon separation, fruit development, abscission, leading to modulation of fruit drop, parthenocarpy, seedless crops resulting from lack of seed set, vascularization, e.g. hypocotyl and cotyledon tissues, genetic control of vascular patterning and influences its maturation; specification of the sites where vascular differentiation will occur; determination of the direction and extent of vascular tissue formation, maintenance of the continuity of vascular development with plant growth, tropic responses, gravitropic responses, e.g. affecting roots and shoots, and modulation of phototropic sensitivity, e.g. increase growth under a reduced light spectrum.


Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the Auxin responsive genes when the desired sequence is operably linked to a promoter of an Auxin responsive gene.


To modulate any of the phenotype(s) above, activities of one or more of the Auxin response genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and assayed, for example, in accordance with Bechtold and Pelletier (1998). Methods Mol. Biol. 82: 259-266; Clough and Bent (1998). 16: 735-743; Krysan et al. (1999). Plant Cell 11:2283-2290.


III.C.2.b. Use of Auxin Responsive Genes, Gene Components and Products to Biochemical Activities:


The activities of one or more of the Auxin responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Cell Growth and
Protein Ubiquitination
Gray et al. (1999) Genes and


Differentiation

Develop, 13: 1678-1691




Bechtold and Pelletier (1998).




Methods. Mol. Biol. 82: 259-266



Cell Wall loosening and
Catala et al. (2000). Plant Physiol.



Expansion
122: 527-534.




Cosgrove, D. (1993). New Phytol.




124: 1-23.


Auxin/Cytokinin Ratio
Changing Auxin and/or
Chen et al. (1988). Plant Physiol.



cytokinin synthesis and/or
86: 822-825



turnover
Tam et al. (2000). Plant Physiol.




123: 589-595




Bartel and Fink. (1995). Science




268: 1745-1748.




Prinsen et al. (1995). Quantifying




phytohormones in transformed




plants. In: Methods in Molecular




Biology. 44: 245-262.


Auxin Transport
Channeling of polar Auxin
Reed et al. (1998). Plant Physiol.



Transport
118: 1369-1378.




Estelle, M. (1998). Plant Cell




10: 1775-1778



Auxin Efflux Between Cells
Reed et al. (1998). Plant Physiol.




118: 1369-1378.




Marchant et al. (1999). EMBO J.




18: 2066-2073.



Auxin Influx In and Out of a
Reed et al. (1998). Plant Physiol.



Cell
118: 1369-1378.




Marchant et al. (1999). EMBO J.




18: 2066-2073.



Electogenic Proton Symport
Young et al. (1999). Biochim



of Auxin
Biophys Acta. 1415(2): 306-22


Signal Transduction
K+ Accumulation
Philippar et al. (1999). Proc. Natl.




Acad. Sci. 96: 12186-12191



Permeability of Cell
Marchant et al. (1999). EMBO J.



Membranes
18: 2066-2073.



Guanine-Nucleotide
Steinmann et al. (1999). Science



Exchange
286: 316-318.




Peyroche et al. (1996). Nature




384: 479-481.



Protein Phosphorylation
Christensen et al. (2000). Cell




100: 469-478.




Hirt (2000). Proc. Natl. Acad Sci.




97: 2405-2407.



Interaction with Ethylene
Madlung et al. (1999). Plant



mode of action
Physiol. 120: 897-906.




Xu et al. (1998). Plant Physiol.




118: 867-874.


Protein Turnover
Localization of Polypeptides
Grebe et al. (2000). Plant Cell.



with the basal End of Cells
12: 343-356









Other biological activities that can be modulated to by the Auxin responsive genes and their products are listed in the Reference Tables. Assays for detecting such biological activities are described in the Domain section of the Reference Tables.


Auxin responsive genes are characteristically differentially transcribed in response to fluctuating Auxin levels or concentrations, whether internal or external to an organism or cell. The MA_diff(s) report(s) the changes in transcript levels of various Auxin responsive genes in the aerial parts of a seedling at 1 and 6 hours after the seedling was sprayed with a solution enriched with Auxin as compared to aerial parts of a seedling sprayed with water.


The data from this time course can be used to identify a number of types of Auxin responsive genes and gene products, including “early responders,” and “delayed responders.” Profiles of these different classes of Auxin responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF





BIOCHEMICAL


TRANSCRIPT

PHYSIOLOGICAL
ACTIVITY OF GENE


LEVEL
TYPE OF GENES
CONSEQUENCES
PRODUCTS







Upregulated
Early
Auxin perception
Transcription factors


transcripts
responders to
Auxin
Transporters; channeling


(level at 1 hr ≅
Auxin
Uptake/transport
of polar Auxin transport


6 hours)

Modulation of
Kinases and


(level at 1 hr > 6

Auxin response
phosphatases; protein


hours)

transduction
ubiqutination; guanine




pathways
nucelotide exchange;





changing Auxin and/or





cytokininin synthesis





and/or turnover;





interaction with ethylene





mode of action




Initiating
Auxin metabolic




transcription of
pathways




specific gene(s)
Change in chromatin





structure and/or DNA





topology





Transcriptional activators





Change in activity of





protein-protein





interactions




Modification of cell
Cell wall and cell growth




walls
promoting pathways




Modification of cell
Change in activity of




structures
cytoskeletal proteins





modulating cell structure


Upregulated
“Delayed”
Completion and/or
Transcription factors


transcripts (level
Responders
Maintenance of
Changes in membrane


at 1 hr < 6 hr)

Auxin response
protein, membrane channel





and/or transporter protein





activity




Initiating
Change in chromatin




transcription of
structure and/or DNA




specific gene(s)
topology





Transcriptional activators





Change in activity of





protein-protein interactions




Modification of cell
Cell wall proteins




walls





Modification of cell
Change(s) in activity of




structures
cytoskeletal proteins





modulating cell structure




Modification of
Coordination and control of




metabolism
central carbon and Auxin





metabolism





metabolic enzymes


Downregulated
Early repressor
Repression of
Transcription factors


transcripts
responders to
Auxin induced
Changes in activity of


(level at 1 hour ≅
Auxin
proteins released
cytoskeletal proteins


6 hours)
Genes for
Reorientation of
modulating cell structure


(level at 1 hour >
pathways
metabolism in
Changes in chromatin


6 hours)
diminished in
certain cells
structure and/or DNA



presence of

topology



Auxin

Changes in protein





structure and/or function





by phosphorylation





(kinases) and/or





dephosphorylation





(phosphatases)





Stability of factors for





protein translation





Changes in cell





membrane structure





Changes in chromatin





and/or localized DNA





topology





Changes in protein-





protein interaction





Metabolic enzymes


Down-regulated
“Delayed”
Maintenance of
Transcription factors


transcripts
repressor
Auxin stimulated
Change in activity of


(level at 1 hour <
responders to
state(s) in certain
cytoskeletal proteins


6 hours)
Auxin
cells
modulating cell structure



Genes for
Reorientation of
Changes in chromatin



pathways
metabolism in
structure and/or DNA



diminished in
certain cells
topology



presence of

Changes in protein



Auxin

structure and/or function





by phosphorylation





(kinases) and/or





dephosphorylation





(phosphatases)





Stability of factors for





protein translation





Changes in cell





membrane structure





Changes in chromatin





and/or localized DNA





topology





Changes in protein-





protein interaction





Metabolic enzymes









Use of Promoters of NAA Responsive Genes

Promoters of NAA responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the NAA responsive genes where the desired sequence is operably linked to a promoter of a NAA responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.C.3. Brassinosteroid Responsive Genes, Gene Components and Products:


Plant hormones are naturally occurring substances, effective in very small amounts, which act as signals to stimulate or inhibit growth or regulate developmental processes in plants. Brassinosteroids (BRs) are the most recently discovered, and least studied, class of plant hormones. The major physiological response affected by BRs is the longitudinal growth of young tissue via cell elongation and possibly cell division. Consequently, disruptions in BR metabolism, perception and activity frequently result in a dwarf phenotype. In addition, because BRs are derived from the sterol metabolic pathway, any perturbations to the sterol pathway can affect the BR pathway. In the same way, perturbations in the BR pathway can have effects on the later part of the sterol pathway and thus the sterol composition of membranes.


Changes in BR concentration in the surrounding environment or in contact with a plant result in modulation of many genes and gene products. Examples of such BR responsive genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant biomass and seed yield. These genes were discovered and characterized from a much larger set of genes by experiments designed to find genes whose mRNA abundance changed in response to application of BRs to plants.


While BR responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different BR responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factors and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of a BR responsive polynucleotide and/or gene product with another environmentally responsive polynucleotide is useful because of the interactions that exist between hormone-regulated pathways, stress pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108580, 108581, 108557, 108478, 108479, 108480, 108481). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


BR genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


BR Genes Identified by Cluster Analyses of Differential Expression


BR Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of BR genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108580, 108581, 108557, 108478, 108479, 108480, 108481 of the MA_diff table(s).


BR Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of BR genes. A group in the MA_clust is considered a BR pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


BR Genes Identified by Amino Acid Sequence Similarity


BR genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis BR genes. Groups of BR genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a BR pathway or network is a group of proteins that also exhibits BR functions/utilities.


Such BR responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in BR concentration or in the absence of BR fluctuations. Further, promoters of BR responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by BR or any of the following phenotypes or biological activities below.


III.C.3.a. Use of Brassinosteroid Responsive Genes to Modulate Phenotypes


Brassinosteroid responsive genes and gene products are useful to modulate one or more phenotypes including growth (promotes cell elongation, elongation accelerated at low temperatures for increased plant growth in marginal lands, acts in concert with other hormones to promote cell division); roots (inhibitory to root growth, and expression in roots would inhibit bud breaking due to higher auxin:cytokinin ratio in epicotyl); stems (inhibits radial growth while causing stem elongation, in low concentrations, promotes radial expansion, and increases biomass); height; seeds; promotes cell expansion in embryo and thus enhances germination; leaves; increase biomass; flowers, increase reproduction; biomass; fresh and dry weight during any time in plant life, such as maturation; number of flowers; number of seeds; number of branches; number of leaves; starch content; seed yield (including number, size, weight, harvest index, starch content; fruit yield, number, size, weight, harvest index, and starch content); development; morphogenesis; control of organ size and shape; development of new ornamentals; control of leaf size and shape; promotes leaf unrolling and enlargement; for development of new leafy ornamentals; seed development; inhibition of de-etiolation; dormancy; accelerated germination at low temperatures; root; gravitropism; senescence; promoted in light grown plants; inhibiting synthesis or perception could extend life span of desired tissues/organs; differentiation; vascularization; promotes xylem differentiation; increases xylem fiber length; resistance responses; increases resistance to pathogens; and tropic responses.


Gravitropic Responses Affecting Roots


Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the BR responsive genes when the desired sequence is operably linked to a promoter of a BR responsive gene.


To improve any of the desired phenotype(s) above, activities of one or more of the BR response genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266, and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50, visually inspected for the desired phenotype and metabolically and/or functionally assayed according to Choe et al. (1999, Plant Cell 11:207-21 and Plant Physiol 119: 897-907), Yamamoto et al. (1997, Plant Cell Physiol 38:980-3), Asami and Yshida (1999, Trends in Plant Sciences, 4:348-353) and Azpiroz et al. (1998, Plant Cell 10:219-230)


III.C.3.b. Use of Brassinosteroid Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the BR responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC




ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







BR
BR Efflux Between Cells
B. Schulz and K. Feldmann,


Transport

unpub. results



BR Influx In And Out Of A
B. Schulz and K. Feldmann,



Cell
unpub. results


Signal
Permeability Of Cell



Transduction
Membranes




Protein Phosphorylation



Metabolism
Major Growth Coordinating




Pathways









Other biological activities that can be modulated by the BR responsive genes and gene products are listed in the Reference Tables. Assays for detecting such biological activities are described in the Domain section of the Reference Tables.


BR responsive genes are differentially transcribed in response to fluctuating BR levels or concentrations, whether internal or external to an organism or cell. The MA_diff table(s) report(s) the changes in transcript levels of various BR responsive genes in the aerial parts of a seedling at 1 and 6 hours after a plant was sprayed with a solution enriched with BR as compared to seedlings sprayed with water. The data from this time course can be used to identify a number of types of BR responsive genes and gene products, including “early responders,” “delayed responders.” Profiles of these different categories of BR responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF


TRANSCRIPT

PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
TYPE OF GENES
CONSEQUENCES
ACTIVITY







Up Regulated
Early
BR Perception
Transcription


Transcripts
Responders To
BR Transport
Factors


(Level At 1 Hr ≈ 6 Hr)
BR
BR Biosynthesis
Receptors


(Level At 1 Hr > 6 Hr)

Feedback
Transporters




Modulation Of
Change In Cell




BR Response
Membrane Structure




Transduction
Feedback Regulated




Pathways
Biosynthetic Genes




Specific Gene
Kinases And




Transcription
Phosphatases




Initiation
2nd Messengers, Eg.,





Calmodulin





Transcription





Activators





Change In





Chromatin Structure





And/Or Localized





DNA Topology


Up Regulated
Delayed
Maintenance Of
Transcription


Transcripts
Responders
Response To Br
Factors


(Level At 1 Hr < 6 Hr)

Cell And Organ
BR Biosynthetic




Elongation
Genes




Gravitropism
Specific Factors





(Initiation And





Elongation) For





Protein Synthesis





Maintenance Of





Mrna Stability





Maintenance Of





Protein Stability





Maintenance Of





Protein-Protein





Interaction





Cell Wall





Elongation


Down-Regulated
Early Responder
Negative
Transcription


Transcripts
Repressors Of BR
Regulation Of
Factors


(Level At 1 Hr ≈ 6 Hr)
State Of Metabolism
BR Pathways
Change In Protein


(Level At 6 Hr > 1 Hr)
Genes With
Released
Structure By



Discontinued
Changes In
Phosphorylation



Expression Or
Pathways And
(Kinases) Or



UnsTable Mrna In
Processes
Dephosphoryaltion



Presence Of
Operating In
(Phosphatases)



BR
Cells
Change In





Chromatin Structure





And/Or DNA





Topology


Down-Regulated
Delayed
Negative
Transcription


Transcripts
Repressors Of
Regulation Of
Factors


(Level At 1 Hr > 6 Hr)
BR State Of
BR Pathways
Kinases And



Metabolism
Released
Phosphatases



Genes With
Maintenance Of
Stability Of Factors



Discontinued
Pathways
For Protein



Expression Or
Released From
Synthesis And



UnsTable Mrna
Repression
Degradation



In Presence Of
Changes In




BR
Pathways And





Processes





Operating In





Cells









Use of Promoters of BR Responsive Genes

Promoters of BR responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the BR responsive genes where the desired sequence is operably linked to a promoter of a BR responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.C.4. Cytokinin Responsive Genes, Gene Components and Products


Plant hormones are naturally occurring substances, effective in very small amounts, which act as signals to stimulate or inhibit growth or regulate developmental processes in plants. Cytokinins (BA) are a group of hormones that are best known for their stimulatory effect on cell division, although they also participate in many other processes and pathways. All naturally occurring BAs are aminopurine derivatives, while nearly all synthetic compounds with BA activity are 6-substituted aminopurine derivatives. One of the most common synthetic BAs used in agriculture is benzylaminopurine (BAP).


Changes in BA concentration in the surrounding environment or in contact with a plant results in modulation of many genes and gene products. Examples of such BA responsive genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix tables, MA_diff and MA_clust. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. They were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to application of BA to plants.


While cytokinin responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different BA responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of a BA responsive polynucleotide and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108566, 108567, 108517). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


BA genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


BA Genes Identified by Cluster Analyses of Differential Expression


BA Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of BA genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108566, 108567, 108517 of the MA_diff table(s).


BA Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of BA genes. A group in the MA_clust is considered a BA pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


BA Genes Identified by Amino Acid Sequence Similarity


BA genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis BA genes. Groups of BA genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a BA pathway or network is a group of proteins that also exhibits BA functions/utilities.


Such BA responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in BA concentration or in the absence of BA fluctuations.


Further, promoters of BA responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by BA or any of the following phenotypes or biological activities below.


III.C.4.a. Use of Ba-Responsive Genes to Modulate Phenotypes


BA responsive genes and gene products are useful to or modulate one or more phenotypes including growth, roots (such as inhibition of elongation of root); stems (such as inhibition of elongation of hypocotyl); lateral buds (such as promotion of outgrowth for rapid production of multiple shoots as a source for grafting); leaves such as development (including cell growth, such as expansion of cotyledon and promotes cell enlargement for increased yield from leaf crops, chloroplast development such as delayed degradation of chloroplasts for increased photosynthesis and crop yield, cell division and senescence such as delays for delayed conversion from photosynthesis to salvage programs in leaves and for increased crop yield); differentiation such as regulation of morphogenesis for manipulating callus growth and shoot/root formation in culture; maintenance of shoot meristem such as for increased usable wood production, and reduced tiller number for denser crop planting regimes; nutrient metabolism for effects on seed size and effects on rate of seed set for increased seed yield; induction of ethylene biosynthesis for control of fruit ripening; and parthenocarpy for control of sexual reproduction and production of seedless fruits.


To regulate any of the phenotype(s) above, activities of one or more of the BA responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or molecularly or metabolically or functionally assayed according to Lohman et al (1994, Physil. Plant 92:322-328), Woolhouse (1983, In Agricultural Research-Strategies of Plant reproduction, Meudt, ed., 201-236), Medford et al. (1989, Plant Cell 1: 403-13), Vogel et al. (1998, Genetics 149:417-27), Ehnes and Roitsch (1997, Plant J 1: 539-48), Rotino et al. (1997, Nat. Biotchnol. 15: 1398-1401).


III.C.4.b. Use of Ba-Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the BA responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC




ACTIVITIES AND/OR
CITATIONS


PROCESS
PATHWAYS
INCLUDING ASSAYS







Chloroplast Functioning
Photosynthesis
Benkova et al (1999) Plant




Physil 121: 245-252


Induction And Maintenance
Cell Cycle Phase Transition
Riou-Khamlichi et al.


Of Cell Division

(1999) Science 283: 1541-44


Senescence
Cell Death/Apoptosis
Lohman et al. (1994)




Physiol Plant 92: 322-328


Signal Transduction
Sensing Endogenous Stimuli
Kakimoto (1996) Science



To Trigger Growth And
274: 982-985



Shoot Formation









Other biological activities that can be modulated by the BA responsive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Domain section above.


BA responsive genes are characteristically differentially transcribed in response to fluctuating BA levels or concentrations, whether internal or external to an organism or cell. The MA_diff table reports the changes in transcript levels of various BA responsive genes in the aerial parts of a seedling at 1 and 6 hours after a plant was sprayed with a Hoagland's solution enriched with BA as compared to seedlings sprayed with Hoagland's solution only.


The data from this time course can be used to identify a number of types of BA responsive genes and gene products, including “early responders,” and “delayed responders.” Profiles of these different BA responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.















GENE
FUNCTIONAL
TYPE OF
EXAMPLES OF


EXPRESSION
CATEGORY OF
BIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
ACTIVITY
ACTIVITY







Up Regulated
Early
BA Perception
Transcription Factors


Transcripts
Responders To
BA Uptake
Transporters


(Level At 1 h ≅ 6 h)
BA
Modulation Of BA
Kinase, Receptor-Like


Or

Response
Protein Kinase


(Higher At 1 h

Transduction



Than 6 h)

Pathways





Specific Gene
Ovule-Specific Homeotic




Transcription
Protein, Secretory




Initiation
Pathway




Initiate And
Cell Division Control




Coordinate Cell
Protein, Cyclins, Cyclin-




Division
Dependent Protein





Kinase (Cdpk), Cell





Cycle Phosphatases,





Mitosis-Specific





Chromosome





Segregation Protein,





Mitotic Phosphoprotein,





Dna Replication Proteins,





Helicase Telomerase,





Centromere Protein,





tRNA Synthase




Regulation Of
Senescence-Associated




Pathways To
Protein, Bifunctional




Senescence
Nuclease, Aba Pathway





Genes, Ethylene Pathway





Genes, Proteases,





Nucleases, Pcd Genes




Modulation Of
Calvin Cycle,




Chloroplast Gene
Chlorophyll A/B Binding




Expression And
Protein (Cab),




Photosysthesis
Transketolase,





Lipoxygenase,





Chloroplast Rna





Processing Protein,





Chloroplast Envelope





Membrane Protein.




Modulation Of
Glutamate Synthase,




Photorespiration And
Gogat, Asparagine




Primary Nitrogen
Synthase, Catalase,




Assimilation In
Peroxidase




Leaves





Expression





Stress Response
Heat Shock Proteins,





Gst




Wax Biosynthesis
Fatty Acid Elongase-





Like Protein, Very-Long-





Chain Fatty Acid





Condensing Enzyme, Coa





Synthase




Nutrient Metabolism
Vicilin Storage Protein




Embryogenesis
Homeobox Domain





Proteins




Glycolysis,
Mutase,




Gluconeogenesis
Phosphoglycerate Mutase




Ripening
Pectate Lyase, Ethylene





Pathway Genes


Upregulated
BA Late
BA Responsive
Transfactors, Kinases,


Transcripts
Responders
Pathways
Phosphatases, LRR's,


(Higher At 6 h


Dna Remodelling


Than 1 h)


Proteins, Cu-Binding





Proteins




Cell Wall Extension
Expansins, Extensins,





Proline Rich Proteins




Organogenesis
AP2 Domain Containing





Proteins




Modulate Activation
Transfactors Interacting




Of Disease Defense
With Resistant Genes




Genes





Modulate Responses
Glycin-Rich Proteins,




To External Stimuli
Wall-Associated





Receptor Kinase (Wak)




Osmotic Stress
Proline Oxidase




Tolerance



Down-Regulated
Repressors Of BA
Regulation Of
Transfactors (Such As


Transcripts (Low
Pathway
Senescence-Related
Zinc-Finger Type),


At Both 1 h and

Gene Expression
Kinases, Phosphatases,


6 h)


G-Proteins, LRR





Proteins, DNA





Remodeling Protein





Carbonyl Reductases




Regulation Of Genes
Atpases




Involved In
Oxygenase




Maintenance Of
Octaprenyltransferase




Apical Dominance.
Auxin Pathway Genes





Auxin Binding Proteins









Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the BA responsive genes when the desired sequence is operably linked to a promoter of a BA responsive gene.


III.C.5. Gibberellic Acid Responsive Genes, Gene Components and Products


Plant hormones are naturally occurring substances, effective in very small amounts, which act as signals to stimulate or inhibit growth or regulate developmental processes in plants. Gibberellic acid (GA) is a hormone in vascular plants that is synthesized in proplastids (giving rise to chloroplasts or leucoplasts) and vascular tissues. The major physiological responses affected by GA are seed germination, stem elongation, flower induction, anther development and seed and pericarp growth. GA is similar to Auxins, cytokinins and gibberellins, in that they are principally growth promoters.


Changes in GA concentration in the surrounding environment or in contact with a plant result in modulation of many genes and gene products. Examples of such GA responsive genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and biomass and seed yield. They were discovered and characterized from a much larger set of genes by experiments designed to find genes whose mRNA products changed in concentration in response to application of nitrogen to plants.


While GA responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different GA responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Whole pathways and/or segments of pathways are controlled by transcription factors and proteins that affect the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of a GA responsive polynucleotide and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common overlapping pathways. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108562, 108563, 108519, 108520, 108521, 108484, 108485, 108486). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


GA genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


GA Genes Identified by Cluster Analyses of Differential Expression


GA Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of GA genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108562, 108563, 108519, 108520, 108521, 108484, 108485, 108486 of the MA_diff table(s).


GA Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of GA genes. A group in the MA_clust is considered a GA pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


GA Genes Identified by Amino Acid Sequence Similarity


GA genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis GA genes. Groups of GA genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a GA pathway or network is a group of proteins that also exhibits GA functions/utilities.


Such GA responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in GA concentration or in the absence of GA fluctuations. Further, promoters of GA responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by GA or any of the following phenotypes or biological activities below.


III.C.5.a. Use of GA Responsive Genes to Modulate Phenotypes:


GA responsive genes and gene products are useful to or modulate one or more phenotypes including growth, promotes root growth, promotes cell division, promotes stem elongation, secondary (woody) growth, promotes growth in leaves, biomass, increase in stem and leaf mass, increase in xylem fiber length and biomass production, development, cell growth, fruit development, seed development, dormancy, breaks dormancy in seeds and buds, promotes trichome formation, decrease senescence, regulation of fertility, stress responses, and flowering time.


Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the GA responsive genes when the desired sequence is operably linked to a promoter of a GA responsive gene.


To regulate any of the phenotype(s) above, activities of one or more of the GA response genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Hedden and Proebsting (1999, Plant Physiol. 119:365-370), Hedden and Phillips (1999, Current Opinion in Plant Biotech. 11:130-137), Perazza et al (1998, Plant Physiol. 117:375-383), Kende and Zeevart (1997, Plant Cell 9:1197-1210) and van der Knaap et al. (2000, Plant Physiol. 122:695-704).


III.C.5.b. Use of GA-Responsive Genes to Modulate Biochemical Activities:


The activities of one or more of the GA responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Cell Growth and
Biosynthesis of Gas
Hedden and Proebsting


Differentiation

(1999, Plant Physiol.




119: 365-370)



Cell wall loosening and cell
Cosgrove (1993, New



expansion
Phytol. 124: 1-23)



GA deactivation
Hedden and Proebsting



Major growth promoting
(1999, Plant Physiol.



metabolic pathways
119: 365-370)


Perception and Signal
Receptors
Koornneef and van der


Transduction

Veen (1980, TAG 58: 257-263)



Synthesis of transcriptional
Bethke and Jones (1998,



regulators
Curr. Opin. Plant Biol.



Calcium and Calmodulin
1: 440-446)









Other biological activities that can be modulated by the GA responsive genes and gene products are listed in the Reference Tables. Assays for detecting such biological activities are described in the Protein Domain table.


GA responsive genes are characteristically differentially transcribed in response to fluctuating GA levels or concentrations, whether internal or external to an organism or cell. The MA_diff table(s) report(s) the changes in transcript levels of various GA responsive genes in entire seedlings at 1 and 6 hours after a plant was sprayed with a Hoagland's solution enriched with GA as compared to seedlings sprayed with Hoagland's solution only.


The data from this time course can be used to identify a number of types of GA responsive genes and gene products, including “early responders,” and “delayed responders.” Profiles of some GA responsive genes are shown in the Table below with examples of associated biological activities.


















EXAMPLES OF


TRANSCRIPT

PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
TYPE OF GENES
CONSEQUENCES
ACTIVITY







Up regulated
Early responders to
GA perception
Transcription factors


transcripts
GA
GA transport
Transporters


(level at 1 hr ≈ 6 hr)
Genes induced by
Modulation of GA
Change in cell


(level at 1 hr > 6 hr)
GA
response
membrane structure




transduction
Kinases and




pathways
phosphatases




Specific gene
Transcription activators




transcription
Change in chromatin




initiation
structure and/or




Growth stimulating
localized DNA topology




pathway induction
Cell wall proteins





Metabolic Enzymes


Up regulated
Maintenance of GA
Maintenance of
Transcription factors


transcripts
response
response to GA
Specific factors


(level at 1 hr < 6 hr)
“Delayed” responders
Induction of GA
(initiation and




metabolic pathways
elongation) for protein





synthesis





Maintenance of mRNA





stability





Metabolic enzymes


Down-regulated
Early repressor
Negative regulation
Transcription factors


transcripts
responders to GA
of GA pathways
Calmodulin


(level at 1 hr ≈ 6 hr)
Genes repressed by
released
Change in protein


(level at 6 hr > 1 hr)
GA
Reduced activity of
structure by phosphorylation



Genes whose
repressed pathways
(kinases) or



activities are

dephosphoryaltion



diminished or

(phosphatases)



mRNAs are unsTable

Change in chromatin



in the presence of GA

structure and/or DNA





topology


Down-regulated
Delayed responders
Maintenance or GA
Transcription factors


transcripts
Genes repressed by
repressed pathways
Kinases and


(level at 1 hr > 6 hr)
GA

phosphatases



Genes whose

Stability factors for



activities are

protein translation



diminished or

Metabolic enzymes



mRNAs are unsTable





in the presence of GA









Use of Promoters of GA Responsive Genes

Promoters of GA responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the GA responsive genes where the desired sequence is operably linked to a promoter of a GA responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.D. Metabolism Affecting Genes, Gene Components and Products


III.D.1. Nitrogen Responsive Genes, Gene Components and Products


Nitrogen is often the rate-limiting element in plant growth, and all field crops have a fundamental dependence on exogenous nitrogen sources. Nitrogenous fertilizer which is usually supplied as ammonium nitrate, potassium nitrate, or urea, typically accounts for 40% of the costs associated with crops, such as corn and wheat in intensive agriculture. Increased efficiency of nitrogen use by plants should enable the production of higher yields with existing fertilizer inputs and/or enable existing yields of crops to be obtained with lower fertilizer input, or better yields on soils of poorer quality. Also, higher amounts of proteins in the crops could also be produced more cost-effectively.


Changes in nitrogen concentration in the surrounding environment or in contact with a plant results in modulation of the activities of many genes and hence levels of gene products. Examples of such “nitrogen responsive” genes and gene products with these properties are shown in the Reference, Sequence, Protein Group, Protein Group Matrix tables, MA_diff, MA_clust, Knock-in and Knock-out tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. They were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to changing levels of available nitrogen to plants.


Manipulation of one or more “nitrogen responsive” gene activities is useful to modulate the biological activities and/or phenotypes listed below. “Nitrogen responsive” genes and gene products can act alone or in combination. Useful combinations include nitrogen responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of the levels of such proteins is especially useful for altering phenotypes and biochemical activities of plants. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108592, 108593, 108588, 108589, 108590, 108591, 108532, 108548, 108549, 108550, 108551, 108454, 108455, 108487, 108488, 108489, and Nitrogen (relating to SMD 3787, SMD 3789)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Nitrogen genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Nitrogen Genes Identified by Cluster Analyses of Differential Expression


Nitrogen Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Nitrogen genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108592, 108593, 108588, 108589, 108590, 108591, 108532, 108548, 108549, 108550, 108551, 108454, 108455, 108487, 108488, 108489, and Nitrogen (relating to SMD 3787, SMD 3789) of the MA_diff table(s).


Nitrogen Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Nitrogen genes. A group in the MA_clust is considered a Nitrogen pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Nitrogen Genes Identified by Amino Acid Sequence Similarity


Nitrogen genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Nitrogen genes. Groups of Nitrogen genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Nitrogen pathway or network is a group of proteins that also exhibits Nitrogen functions/utilities.


Such “nitrogen responsive” genes and gene products can function either to either increase or dampen the phenotypes and activities below, either in response to changes in nitrogen concentration or in the absence of nitrogen fluctuations.


Further, promoters of nitrogen responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by nitrogen or any of the following phenotypes or biological activities below.


III.D.5.a. Use of Nitrogen-Responsive Genes to Modulate Phenotypes


“Nitrogen responsive” genes and gene products can be used to alter or modulate one or more phenotypes including plant development, initiation of the reproduction cycle from a vegetative state (such as flower development time and time to fruit maturity); root development and initiation (such as root branching, lateral root, initiation and/or development, nodule formation and nitrogen assimilation from any nitrogen-fixing symbions), growth rate, whole plant (including height, flowering time, etc.), organs (such as flowers, fruits, stems, leaves, roots, and lateral roots), biomass (such as fresh and dry weight during any time in plant life, such as maturation); number, size, and weight of flowers; seeds; branches, and leaves); total plant nitrogen content, amino acid/protein content of whole plant or parts, seed yield (such as number, size, weight, harvest index and content and composition, e.g., amino acid, nitrogen, oil, protein, and carbohydrate) and fruit yield (such as number, size, weight, harvest index, content and composition, e.g., amino acid, nitrogen, oil, protein, carbohydrate, and water.


To regulate any of the phenotype(s) above, activities of one or more of the nitrogen responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and assayed, for example, in accordance to Zhang (1999) Proc. Natl. Acad. Sci. 96(11): 6529-34; or Zhang and Forde (1998) Science 279(5349):407-9; Scheible, W., Lauerer, M., Schultze, E.-D., Caboche, M., and Sitt, M. (1997). Plant J. 11, 671-691; Chevalier C, Bourgeois E, Just D, Raymond P. Plant J. 1996 January; 9(1):1-11.


III.D.5.b. Use of Nitrogen-Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the nitrogen responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations included in the Table below:















Biochemical Or Metabolic



Process
Activities And/Or Pathways
Citations including assays







Nitrate And Ammonium
NO3Influx And Efflux
Lejay et al. (1999) Plant J. 18(5):


Uptake and Assimilation

509-519



Nitrate Channels
Liu et al. (1999) Plant Cell 11: 865-874;




and




Wang et al.(1998) Proc. Natl. Acad.




Sci. USA 95: 15134-15139



Changes In Membrane-
Meharg et al. (1995) J. Membr.



Potential
Biol. 145: 49-66; and




Wang et al. (1998), supra


Amino Acid Synthesis
Glutamine Synthesis And
Coruzzi et al. U.S. Pat. No.



Then Biosynthesis Of Other
5,955,651; and



Amino Acids
Oliveira et al. (1999) Plant. Phys.




121: 301-309



Asparagine Synthesis And
LAM ET AL. (1998) PLANT J.



Then Biosynthesis Of Other
16(3): 345-353



Amino Acids



Coordination Of Carbon
Light-Regulation Of Major
Lam et al. (1998), supra;


And Nitrogen Metabolism
Central Carbon And
Lejay et al. (1999), supra; and



Nitrogen Metabolic
Oliveira et al. (1999), supra



Pathways To Coordinate




Growth




Carbohydrate And Nitrogen
Lam et al. (1998) supra;



Control Of Carbohydrate
Lejay et al. (1999) supra; and



And Organic Nitrogen
Oliveira et al. (1999) supra



Accumulation Pathways



Nitrogen Loading And
Nitrogen Transport From
Walker et al. (1999) 210(1): 9-18


Unloading
Source To Sinks
Elsheikh et al. (1997)




51(2): 137-44.


Nitrogen Storage
Accumulation Of Amino
Johnson et al. (1990) Plant Cell



Acids And/Or Storage
2(6): 525-32.



Proteins In Vacuoles
Herman and Larkins (1999) Plant




Cell. 11(4): 601-14.


Ammonium
Plastid Ammonium
Crawford (1995) Plant Cell


Detoxification
Storage/Glutamine
7(7): 859-68.



Synthesis
Zhang and Forde (1998) Science




279: 407-409.


Cell Growth
DIVISION AND/OR
Zhang and Forde (1998) Science



ELONGATION
279: 407-409.




Coruzzi et al. U.S. Pat. No.




5,955,651









Other biological activities that can be modulated by the nitrogen responsive genes and their products are listed in the Reference tables. Assays for detecting such biological activities are described in the Domain section above.


Nitrogen responsive genes are characteristically differentially transcribed in response to fluctuating nitrogen levels or concentrations, whether internal or external to an organism or cell. The MA_diff table reports the changes in transcript levels of various nitrogen responsive genes in the aerial parts of a seedling at 2, 6, 9 and 12 hours after a plant was sprayed with a solution enriched with ammonium nitrate as compared to seedlings sprayed with water. The MA_diff reports the changes in transcript levels of various nitrogen responsive genes in roots at 12 and 24 hours that were cut from seedlings transferred from a high to low potassium nitrate environment compared to control seedlings transferred to a high potassium nitrate environment.


The data from this time course reveal a number of types of nitrogen responsive genes and gene products, including “early responders,” and “delayed nitrogen responders”. Profiles of the individual categories of nitrogen responsive genes are shown in the Tables below together with examples of the kinds of associated biological activities that are modulated when the activities of one or more such genes vary in plants.


Low to High Ammonium Nitrate Experiment
















Functional




Gene Expression
Category Of
Physiological



Levels
Gene
Consequences
Examples Of Gene Products







Upregulated
Early
Perception Of
Transcription Factors


Transcripts
Responders To
Nitrogen
Transporters


(Level At 2 h ≅ 6,
Nitrogen
Induced Nitrogen
Inhibitors Of Nitrogen


9 Or 12 h) Or

Uptake Into Cells
Fixation


(Level At 2 h > 6,

Induction Of Nitrogen
Components Of Pathways


9 Or 12 h)

Response Transduction
Released From Repression




Pathways
Transaminases




Initiation Of Specific
Amino Acid Biosynthetic




Gene Transcription
Enzymes


Upregulated
Delayed
Maintenance Of High
Nitrogen Metabolic


Transcripts
Nitrogen
Nitrogen Metabolism
Pathway Enzymes


(Level At 2 h < 6,
Responders
And Growth
Transaminases


9, Or 12 h


Amino Acid Biosynthetic





Enzymes





Factors Induced In





Coordination And Control





Of Central Carbon And





Nitrogen Metabolism





Cell Wall And Cell





Growth-Promoting





Pathway Enzymes





Storage Proteins


Down Regulated
Early
Negative Regulation
Transcription Factors


Transcripts
Responder
Of Nitrogen Utilization
Kinases And Phosphatases


(Level At 2 h ≅ 6,
Repressors Of
Pathways Released
Cytoskeletal Proteins


9 Or 12 h) Or
Nitrogen
Pathways Of C And N
Modulating Cell Structure


(Level At 6, 9 Or
Utilization
Metabolism Required
Chromatin Structure


12 h > 2 h)
Pathways
At Lower Levels
Regulatory Proteins



Genes With
Decline In Presence Of
Metabolic Enzymes



Discontinued
High Nitrogen
Transporters



Expression Or

Proteins And Rna



UnsTable Mrna

Turnover Systems



Following





Nitrogen





Uptake




Level At 2 Hours >
Delayed
Negative Regulation
Transcription Factors


6, 9 Or 12 Hours
Response
Of Nitrogen Utilization
Kinases And Phosphatases



Repressors Of
Pathways Released
Cytoskeletal Proteins



Nitrogen
Pathways Of C And N
Modulating Cell Structure



Utilization
Metabolism Required
Chromatin Structure



Pathways
At Lower Levels
Regulatory Proteins



Genes With
Decline In Presence Of
Metabolic Enzymes



Discontinued
High Nitrogen
Transporters



Expression Or

Protein And Rna Turnover



UnsTable Mrna

Systems



Following





Nitrogen





Uptake









High to Low Potassium Nitrate Experiments


















Examples Of Biochemical


Gene Expression
Functional
Type Of Biological
Activities Of Gene


Levels
Category Of Gene
Activity
Products







Upregulated
Early Responders
Perception Of Low
Transcription Factors -


Transcripts (Level
To Low Nitrate
Nitrate
Controlling Transcription


At 12 h~24 h)

Nitrogen Uptake Into
Transporters - Facilitating


(Level At

Cells
Transport


12 h > 24 h)

Low Nitrogen Signal
Cell Wall/Membrane




Transduction Response
Structure Determining




Pathways
Proteins




Initiation Of Specific
Kinases And




Gene Transcription
Phosphatases-




Initiation Of Nitrogen
Regulating Signal




Fixation
Transduction Pathways





Cytoskeletal





Proteins-Modulating Cell





Structure





Chromatin





Structure And/Or Dna





Topology Proteins





Protein-Protein Interaction





Participants





Metabolic Enzymes-





Nitrogen Turnover Enzymes





And Pathway Components


Upregulated
Delayed Low
Maintenance Of Low
Transcription Factors -


Transcripts
Nitrate
Nitrogen Response
Controlling Transcription


(Level 12 h < 24 h)
Responders
Pathways (See the Table
Transporters - Facilitating




Above)
Transport





Cell Wall/Membrane





Structure Determining





Proteins





Kinases And





Phosphatases-





Regulating Signal





Transduction Pathways





Cytoskeletal





Proteins-Modulating Cell





Structure





Chromatin





Structure And/Or Dna





Topology Proteins





Protein-Protein Interaction





Participants





Metabolic Enzymes-





Nitrogen Turnover Enzymes





And Pathway Components


Down-Regulated
Early Repressor
Negative Regulation Of
Transcription Factors


Transcripts (Level
Responders To
Low Nitrogen-Mediated
Cell


At 12 h~24 h)
Low Nitrate
Pathways And/Or
Wall/Membrane Structure


(Level At
Genes Whose
Responses Released
Determining Proteins


12 h > 24 h)
Expression Is
Pathways In C And N
Factors For



Discontinued Or
Metabolism Required At
Promoting Protein



Mrna Is UnsTable
Lower Levels Decline In
Translation



In Presence Of
The Presence Of Low
Kinases And



Low Nitrate
Nitrate
Phosphatases





Cytoskeletal Proteins-





Modulating Cell Structure





Protein And Rna Turnover





Systems


Down-Regulated
Delayed
Negative Regulation Of
Transcription Factors


Transcripts
Repressor
Low Nitrogen-Mediated
Cell


(Level At
Responders To
Pathways And/Or
Wall/Membrane Structure


12 h < 24 h)
Low Nitrate
Responses Released
Determining Proteins



Genes Whose
Pathways In C And N
Factors For



Expression Is
Metabolism Required At
Promoting Protein



Discontinued Or
Lower Levels Decline In
Translation



mRNA Is
The Presence Of Low
Kinases And



UnsTable In
Nitrate
Phosphatases



Presence Of Low

Cytoskeletal Proteins-



Nitrate

Modulating Cell Structure





Protein And Rna Turnover





Systems





Chromatin Structure





And/Or Dna Topology





Proteins









Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the nitrogen responsive genes when the desired sequence is operably linked to a promoter of a nitrogen responsive gene.


III.D.2. Circadian Rhythm (Clock) Responsive Genes, Gene Components and Products


Often growth and yield are limited by the ability of a plant to tolerate stress conditions, including water loss. To combat such conditions, plant cells deploy a battery of responses that are controlled by an internal circadian clock, including the timed movement of cotyledons and leaves, timed movements in guard cells in stomata, and timed biochemical activities involved with sugar and nitrogen metabolism. These responses depend on the functioning of an internal circadian clock, that becomes entrained to the ambient light/dark cycle, and a series of downstream signaling events leading to transcription independent and transcription dependent stress responses.


A functioning circadian clock can anticipate dark/light transitions and prepare the physiology and biochemistry of a plant accordingly. For example, expression of a chlorophyll a/b binding protein (CAB) is elevated before daybreak, so that photosynthesis can operate maximally as soon as there is light to drive it. Similar considerations apply to light/dark transitions and to many areas of plant physiology such as sugar metabolism, nitrogen metabolism, water uptake and water loss, flowering and flower opening, epinasty, germination, perception of season, and senescence.


Manipulation of one or more clock gene activities is useful to modulate the biological processes and/or phenotypes listed below. Clock responsive genes and gene products can act alone or in combination. Useful combinations include clock responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Circadian (relating to SMD 2344, SMD 2359, SMD 2361, SMD 2362, SMD 2363, SMD 2364, SMD 2365, SMD 2366, SMD 2367, SMD 2368, SMD 3242)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Circadian genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Circadian Genes Identified by Cluster Analyses of Differential Expression


Circadian Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Circadian genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Circadian (relating to SMD 2344, SMD 2359, SMD 2361, SMD 2362, SMD 2363, SMD 2364, SMD 2365, SMD 2366, SMD 2367, SMD 2368, SMD 3242) of the MA_diff table(s).


Circadian Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Circadian genes. A group in the MA_clust is considered a Circadian pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Circadian Genes Identified by Amino Acid Sequence Similarity


Circadian genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Circadian genes. Groups of Circadian genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Circadian pathway or network is a group of proteins that also exhibits Circadian functions/utilities.


Such clock responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in daylength or in response to changes in light quality. Further, promoters of cirdadian (clock) responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by circadian or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the circadian (clock) responsive genes when the desired sequence is operably linked to a promoter of a circadian (clock) responsive gene.


The expression of many genes is modulated by the clock. Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing some 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in response to the circadian rhythm clock at various times through the 24 hour cycle relative to the controls were identified, compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones identified. The MA_diff table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which represent clock responsive genes.


III.D.2.a. Use of Circadian Rhythm (Clock) Responsive Genes to Modulate Phenotypes


Clock responsive genes and gene products are useful to or modulate one or more phenotypes including timing phenotypes, dormancy, germination, cotyledon opening, first leaves, juvenile to adult transition, bolting, flowering, pollination, fertilization, seed development, seed set, fruit drop, senescence, epinasty, biomass, fresh and dry weight during any time in plant life, such as maturation, number of flowers, seeds, branches, and/or leaves, seed yield, including number, size, weight, and/or harvest index, fruit yield, including number, size, weight, and/or harvest index, plant development, time to fruit maturity, cell wall strengthening and reinforcement, stress tolerance, drought tolerance, flooding tolerance, and uv tolerance


To regulate any of the phenotype(s) above, activities of one or more of the clock responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Anderson et al. (1997) Plant Cell 9: 1727-1743; Heintzen et al. (1997) Proc. Natl. Acad. Sci. USA 94: 8515-20; Schaffer et al. (1998) Cell 93:1219-1229; Somers et al. (1998) Development 125: 485-494; Somers et al. (1998) Science 282: 1488-1490; Wang and Tobin (1998) Cell 93: 1207-1217; Zhong et al. (1998) Plant Cell 10: 2005-2017; Sugano et al. (1998) Proc. Natl. Acad. Sci. USA 95: 11020-11025; Dowson-Day and Millar (1999) Plant J 17: 63-71; Green and Tobin (1999) Proc. Natl. Acad. Sci. USA 96: 4176-419; Staiger and Apel (1999) Mol. Gen. Genet. 261: 811-819; Strayer and Kay (1999) Curr. Opin. Plant Biol. 2:114-120; Strayer et. al. (2000) Science 289:768-771; Kreps et al. (2000) J Biol Rhythms (2000) 15:208-217; Nelson et al. (2000) Cell 101:331-340; Somers et al. (2000) Cell 101:319-329.


III.D.2.b. Use of Active Clock Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the clock responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations above and included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Germination and seedling/
Cold, light and water modulated
Bognar et al. (1999) Proc.


development
signal transduction pathways,
Natl. Acad. Sci. USA



receptors, kinases, PAS domain
96: 14652-14657; Sugano et al




(1999) Proc. Natl. Acad. Sci.




USA 96: 12362-12366;




Dowson-Day and Millar




(1999) Plant J 17: 63-71;




Somers et al. (2000) Cell




101: 319-329; Zhong et al.




(1998) Plant Cell 10: 2005-




2017


Growth transitions and
Cold and light modulated signal
Nelson et al. (2000) Cell


flowering
transduction pathways,
101: 331-340; Fowler et al.



receptors, kinases, PAS domain
(1999) EMBO J. 18: 4679-




4688


Tuber formation
Cold and light modulated signal
Yanovsky et al. (2000) Plant



transduction pathways
J. 23: 223-232


METABOLISM




Lipid metabolism
Membrane lipid synthesis
Bradley and Reddy (1997) J.



including omega-3 fatty acid
Bacteriol. 179: 4407-4410;



desaturase, lipases, lipid
Martin, M et al. 1999 Europe



transfer proteins
J. Biochem 262: 283-290


Sugar metabolism
Glycosylhydrolases,
Liu et al. (1996) Plant



glycosyltransferases, amylases,
Physiol. 112: 43-51; Millar



sucrose synthase, CAB,
and Kay (1996) Proc Natl



Rubisco, light signal
Acad Sci USA 93: 15491-



transduction
15496; Wang et al. (1997)




Plant Cell 9: 491-507;




Shinohara et al (1999) J. Biol.




Chem. 273: 446-452


Nitrogen metabolism
Aminotransferases, arginase,
Bradley and Reddy (1997) J.



proteases and vegetative storage
Bacteriol. 179: 4407-4410



proteins, aromatic amino acid




synthesis



Photorespiration
Mitochondrial, chloroplast and
Zhong and McClung (1996)



peroxisomal photorespiratory
Mol. Gen. Genet. 251: 196-



enzymes, serine hydroxymethyl
203; McClung (1997) Free.



transferases, catalase
Radic. Biol. Med. 23: 489-




496; McClung et al. (2000)




Plant Physiol. 123: 381-392


Responses to Environmental
Expression of genes involved in
McClung (1997) Free Radic


Stress
responses to drought, salt, UV
Biol Med 23: 489-496; Shi et




al. (2000) Proc. Natl. Acad.




Sci. USA 97: 6896-6901









Other biological activities that can be modulated by the clock responsive genes and their products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Clock responsive genes are characteristically differentially transcribed in response to fluctuations in an entrained oscillator, which is internal to an organism and cell. The MA_diff table(s) report(s) the changes in transcript levels of various clock responsive genes in a plant.


Profiles of clock responsive genes are shown in the table below with examples of which associated biological activities are modulated when the activities of one or more such genes vary in plants.















TRAN-


EXAMPLES OF


SCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up regulated
Responders to
Circadian rhythm
Metabolic


transcripts
circadian rhythm
perception
enzymes



Genes induced
Metabolisms
Change in cell



by rythm
affected by
membrane




Circadian rhythm
structure and




Synthesis of
potential




secondary
Kinases and




metabolites
phosphatases




and/or proteins
Transcription




Modulation of
activators




clock response
Change in




transduction
chromatin




pathways
structure and/or




Specific gene
localized




transcription
DNA topology




initiation
Enzymes in lipid,





sugar and nitrogen





metabolism





Enzymes in





photorespiration





and photosynthesis


Down-
Responders to
Negative
Transcription


regulated
circadian rhythm.
regulation of
factors


transcripts
Repressors of
circadian
Change in protein



circadian “state”
pathways released
structure by



of metabolism
Changes in
phosphorylation



Genes repressed
pathways and
(kinases) or



by rhythm
processes
dephosphoryaltion



Genes with
operating in cells
(phosphatases)



discontinued
Changes in
Change in



expression or
metabolism other
chromatin



unsTable
than circadian
structure and/or



mRNA in
pathways
DNA topology



presence of zinc

Stability of factors





for protein





synthesis and





degradation





Metabolic enzymes





in light, sugar,





lipid and nitrogen





metabolism









Use of Promoters of Clock Responsive Genes

Promoters of Clock responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Clock responsive genes where the desired sequence is operably linked to a promoter of a Clock responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.D.3. Blue Light (Phototropism) Responsive Genes, Gene Components and Products


Phototropism is the orientation or growth of a cell, an organism or part of an organism in relation to a source of light. Plants can sense red (R), far-red (FR) and blue light in their environment and respond differently to particular ratios of these. For example, a low R:FR ratio enhances cell elongation and favors flowering over leaf production, but blue light regulated cryptochromes also appear to be involved in determining hypocotyl growth and flowering time.


Phototropism of Arabidopsis thaliana seedlings in response to a blue light source is initiated by nonphototropic hypocotyl 1 (NPH1), a blue light-activated serine-threonine protein kinase, but the downstream signaling events are not entirely known. Blue light treatment leads to changes in gene expression. These genes have been identified by comparing the levels of mRNAs of individual genes in dark-grown seedlings, compared with in dark grown seedlings treated with 1 hour of blue light. Auxin also affects blue light phototropism. The effect of Auxin on gene expression stimulated by blue light has been explored by studying mRNA levels in a mutant of Arabidopsis thaliana nph4-2, grown in the dark and, treated with blue light for 1 hour compared with wild type seedlings treated similarly. This mutant is disrupted for Auxin-related growth and Auxin-induced gene transcription. Gene expression was studied using microarray technology.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing some 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases over the controls were identified, compared to the Ceres full-length cDNA and genomic sequence databanks, and the equivalent Ceres clones identified. The MA_diff table(s) report(s) the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which represent blue light responsive genes and of those which are blue light responsive in the absence of nph4 gene activity. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Phototropism (relating to SMD 4188, SMD 6617, SMD 6619)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Blue Light genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Blue Light Genes Identified by Cluster Analyses of Differential Expression


Blue Light Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Blue Light genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Phototropism (relating to SMD 4188, SMD 6617, SMD 6619) of the MA_diff table(s).


Blue Light Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Blue Light genes. A group in the MA_clust is considered a Blue Light pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Blue Light Genes Identified by Amino Acid Sequence Similarity


Blue Light genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Blue Light genes. Groups of Blue Light genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Blue Light pathway or network is a group of proteins that also exhibits Blue Light functions/utilities.


III.D.3.a. Use of Blue Light Responsive Genes, Gene Components and Products to Modulate Phenotypes


Changes in blue light in a plant's surrounding environment result in modulation of many genes and gene products. Examples of such blue light response genes and gene products are shown in the REFERENCE and SEQUENCE Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield.


While blue light responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different blue light responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of a blue light responsive polynucleotides and/or gene product with other environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress and pathogen induced pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways.


III.D.3.b. Use of Blue Light Responsive Genes, Gene Components and Products to Modulate Phenotypes


Blue light responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in blue light response concentration or in the absence of blue light responsive fluctuations. Further, promoters of blue light responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by blue light or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the blue light responsive genes when the desired sequence is operably linked to a promoter of a blue light responsive gene.


Blue light responsive genes and gene products can be used to alter or modulate one or more phenotypes including growth, roots (elongation or gravitropism) and stems (such as elongation), development of cell (such as growth or elongation), flower (including flowering time), seedling (including elongation), plant yield, and seed and fruit yield.


To regulate any of the phenotype(s) above, activities of one or more of the blue light responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Liscum and Briggs (1995, Plant Cell 7: 473-85), Vitha et al. (2000, Plant Physiol 122: 453-61), Stowe-Evance et al. (1998, Plant Physiol 118: 1265-75), Baum et al. (1999, PNAS USA 96: 13554-9), Huala et al. (1997) Science 278: 2120-2123), Kanegae et al. (2000, Plant Cell Physiol 41: 415-23), Khanna et al. (1999, Plant Mol Biol 39: 231-42), Sakai et al. (2000, Plant Cell 12: 225-36), Parks et al (1996, Plant Physiol 110: 155-62) and Janoudi et al. (1997, Plant Physiol 113: 975-79).


III.D.3.c. Use of Blue Light Responsive Genes, Gene Components and Products to Modulate Biochemical Activities


The activities of one or more of the blue light responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL




OR METABOLIC




ACTIVITIES




AND/OR
CITATIONS INCLUDING


PROCESS
PATHWAYS
ASSAYS







Cell Growth and
Cell Elongation
Liscum and Briggs (1995) Plant


Development
Seedling
Cell 7: 473-85



Stem




Root
Vitha et al. (2000) Plant Physiol




122: 453-61


Signalling
UV light
Liscum and Briggs (1996) Plant



Perception
Physiol 112: 291-96



Far-red/Red light
Parks et al. (1996) Plant Physiol



Perception
110: 155-62



Phosphorylation of
Liscum and Briggs (1996) Plant



cellular and nuclear-
Physiol 112: 291-96



localized proteins




Activation and
Sakae et al. (2000) Plant Cell



Synthesis of
12: 225-36



Transcription




Factors




Ca + 2 levels
Baum et al. (1999) PNAS USA




96: 13554-9




Pu and Robinson (1998) J Cell




Sci 111: 3197-3207



Auxin
Estelle (1998) Plant Cell 10:



Concentration
1775-8




Reed et al. (1998) Plant Physiol




118: 1369-78



Inter-
Janoudi et al. (1997) Plant



photoreceptors
Physiol 113: 975-79









Other biological activities that can be modulated by blue light response genes and their products are listed in the REF Tables. Assays for detecting such biological activities are described in the Domain section of the REF Table.


The specific genes modulated by blue light, in wild type seedlings and in the mutant deficient in transmitting Auxin effects are given in the Reference and Sequence Tables. The kinds of genes discovered and some of their associated effects are given in the Table below.















TRAN-


EXAMPLES OF


SCRIPT

PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
TYPE OF GENES
CONSEQUENCES
ACTIVITY







Up
Responders to no
Blue light
Transporters


regulated
blue light in wild
perception
Metabolic


transcripts
type or to blue light
Metabolism
enzymes



in mutant lacking
affected by blue
Change in cell



Auxin effects
light
membrane




Synthesis of
structure




secondary
and potential




metabolites and/or
Kinases and




proteins
phosphatases




Modulation of blue
Transcription




light transduction
activators




pathways
Change in




Specific gene
chromatin




transcription
structure




initiation
and/or localized





DNA topology


Down-
Responders to no
Blue light
Transcription


regulated
blue light in wild
perception
factors


transcripts
type or to blue
Metabolism
Change in protein



light in mutants
affected by blue
structure by



lacking Auxin
light
phosphorylation



effects
Synthesis of
(kinases) or



Genes with
secondary
dephosphorylation



discontinued
metabolites and/or
(phosphatases)



expression or
proteins
Change in



unsTable mRNA
Modulation of blue
chromatin



during response
light transduction
structure and/or




pathways
DNA topology




Specific gene
Stability factors




transcription
for protein




initiation
synthesis




Changes in
and degradation




pathways and
Metabolic




processes
enzymes




operating in cells





Changes in





metabolic





pathways other





than phototropic





blue light





responsive





pathways









Use of Promoters of Blue Light Responsive Genes

Promoters of Blue Light responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Blue Light responsive genes where the desired sequence is operably linked to a promoter of a Blue Light responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.D.4 Responsive Genes, Gene Components and Products

There has been a recent and significant increase in the level of atmospheric carbon dioxide. This rise in level is projected to continue over the next 50 years. The effects of the increased level of carbon dioxide on vegetation are just now being examined, generally in large scale, whole plant (often trees) experiments. Some researchers have initiated physiological experiments in attempts to define the biochemical pathways that are either affected by and/or are activated to allow the plant to avert damage from the elevated carbon dioxide levels. A genomics approach to this issue, using a model plant system, allows identification of those pathways affected by and/or as having a role in averting damage due to the elevated carbon dioxide levels and affecting growth. Higher agronomic yields can be obtained for some crops grown in elevated CO2.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The U.S. Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing about 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in plants grown in higher CO2 levels compared with plants grown at more normal CO2 levels, were compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones were identified. The MA_diff table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones cDNA sequences that change in response to CO2.


Examples of CO2 responsive genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix tables, MA_diff and MA_clust tables. While CO2 responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different CO2 responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants.


Manipulation of one or more CO2 responsive gene activities is useful to modulate the biological processes and/or phenotypes listed below. CO2 responsive genes and gene products can act alone or in combination. Useful combinations include genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways.


CO2 responsive genes and gene products can function to either increase or dampen the above phenotypes or activities. Further, promoters of CO2 responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by CO2 or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the CO2 responsive genes when the desired sequence is operably linked to a promoter of a CO2 responsive gene. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: CO2 (relating to SMD7561, SMD 7562, SMD 7261, SMD 7263, SMD 3710, SMD 4649, SMD 4650)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


CO2 genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


CO2 Genes Identified by Cluster Analyses of Differential Expression


CO2 Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of CO2 genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID CO2 (relating to SMD7561, SMD 7562, SMD 7261, SMD 7263, SMD 3710, SMD 4649, SMD 4650) of the MA_diff table(s).


CO2 Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of CO2 genes. A group in the MA_clust is considered a CO2 pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


CO2 Genes Identified by Amino Acid Sequence Similarity


CO2 genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis CO2 genes. Groups of CO2 genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a CO2 pathway or network is a group of proteins that also exhibits CO2 functions/utilities.


III.D.4.a. Use of Co2 Responsive Genes to Modulate Phenotypes


CO2 responsive genes and gene products are useful to or modulate one or more phenotypes including catabolism, energy generation, atp, etc., metabolism, carbohydrate synthesis, growth rate, whole plant, including height, flowering time, etc., organs, flowers, fruits, stems, leaves, roots, lateral roots, biomass, fresh and dry weight during any time in plant life, such as maturation; number, size, and weight of flowers; seeds; branches; leaves; total plant nitrogen content, amino acid/protein content of whole plant or parts, seed yield (such as number, size, weight, harvest index, and content and composition, e.g., amino acid, nitrogen, oil, protein, and carbohydrate); fruit yield; number, size, weight, harvest index; content and composition, e.g., amino acid, nitrogen, oil, protein, carbohydrate, water; and photosynthesis (such as carbon dioxide fixation).


To improve any of the phenotype(s) above, activities of one or more of the CO2 responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Saito et al. (1994, Plant Physiol. 106: 887-95), Takahashi et al (1997, Proc. Natl. Acad. Sci. USA 94: 11102-07) and Koprivova et al. (2000, Plant Physiol. 122: 737-46).


III.D.2. Use of CO2 Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the CO2 responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC



GENERAL
ACTIVITIES AND/OR
CITATIONS


CATEGORY
PATHWAYS
INCLUDING ASSAYS







Cell Division
Cell Cycle Control
Masle (2000) Plant



Genes
Physiol. 122: 1399-1415


Starch
Starch Biosynthesis
Ludewig et al., (1998)


Biosynthesis
Enzymes And Pathways
FEBS Lett. 429: 147-151


Photosynthesis
Photosynthetic
Cheng et al., (1998) Plant



Enzymes, e.g., Rubisco
Physiol 166: 715-723


Respiration
Energy Metabolism
Musgrave et al., (1986)



Pathways
Proc. Natl. Acad. Sci.




USA 83: 8157-8161


CO2 Uptake
Guard Cell Stomata
Allen et al., Plant Cell



Control Systems
(1999) 11(9): 1785-1798




Ichida et al., Plant Cell




(1997) 9(10): 1843-1857




Hedrich et al., EMBO J




(1993) 12(3): 897-901


Coordination
Light-Regulation Of
Lam et al. (1998) Plant J.


Of Carbon
Major Central Carbon
16(3): 345-353


And Nitrogen
And Nitrogen
Lejay et al. (1999) Plant J.


Metabolism
Metabolic Pathways To
18(5): 509-519; and



Coordinate Growth
Oliveira et al. (1999) Plant.




Phys. 121: 301-309



Carbohydrate And
Lam et al. (1998) supra;



Nitrogen Control Of
Lejay et al. (1999) supra;



Carbohydrate And
and



Organic Nitrogen
Oliveira et al. (1999)



Accumulation
supra



Pathways









Other biological activities that can be modulated by the CO2 responsive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


CO2 responsive genes are characteristically differentially transcribed in response to fluctuating CO2 levels or concentrations, whether internal or external to an organism or cell. The MA_diff tables report the changes in transcript levels of various CO2 responsive genes that are differentially expressed in response to high CO2 levels.


Profiles of these different CO2 responsive genes are shown in the Table below with examples of associated biological activities.















TRAN-


EXAMPLES OF


SCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up
Responders
Changes In Generation
Transporters


Regulated
To Higher
Of ATP
Catabolic And


Transcripts
Levels Of
Changes In Catabolism
Anabolic Enzymes



CO2
And Anabolism
Change In Cell



Genes
Enzymes and Pathways
Membrane Structure



Induced
Activation Of Krebs
And Potential



By CO2
Cycle
Kinases And




Specific Gene
Phosphatases




Transcription Initiation
Transcription




Changes In
Activators And




Carbohydrate Synthesis
Repressors




Changes In Chloroplast
Change In




Structure
Chromatin Structure




Changes In
And/Or Localized




Photosynthesis
DNA Topology




Changes In
Redox Control




Respiration



Down-
Responders
Changes In Pathways
Transcription


Regulated
To Higher
And Processes
Factors


Transcripts
Levels Of
Operating In Cells
Change In Protein



CO2
Changes In Catabolism
Structure By



Genes
and Anabolism
Phosphorylation



Repressed
Changes in Chloroplast
(Kinases) Or



By CO2
Structure
Dephosphorylation





(Phosphatases)





Change In





Chromatin Structure





And/Or DNA





Topology





Stability Of Factors





For Protein





Synthesis And





Degradation





Metabolic Enzymes









Use of Promoters of CO2 Responsive Genes

Promoters of CO2 responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the CO2 responsive genes where the desired sequence is operably linked to a promoter of a CO2 responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.D.5. Mitochondria Electron Transport (Respiration) Genes, Gene Components and Products


One means to alter flux through metabolic pathways is to alter the levels of proteins in the pathways. Plant mitochondria contain many proteins involved in various metabolic processes, including the TCA cycle, respiration, and photorespiration and particularly the electron transport chain (mtETC). Most mtETC complexes consist of nuclearly-encoded mitochondrial proteins (NEMPs) and mitochondrially-encoded mitochondrial proteins (MEMPs). NEMPs are produced in coordination with MEMPs of the same complex and pathway and with other proteins in multi-organelle pathways. Enzymes involved in photorespiration, for example, are located in chloroplasts, mitochondria, and peroxisomes and many of the proteins are nuclearly-encoded. Manipulation of the coordination of protein levels within and between organelles can have critical and global consequences to the growth and yield of a plant. Genes which are manipulated by interfering with the mtETC have been characterized using microarray technology.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing about 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in the presence of the ETC inhibitor, 10 mM antimycin A compared with the control lacking antimycin A. were identified, compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones identified. The MA_diff table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones that represent respiration responsive genes.


Examples of genes and gene products that are responsive to antimycin A block of respiration are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff and MA_clust tables. While respiration responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different respiration responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. Manipulation of one or more respiration responsive gene activities are useful to modulate the biological processes and/or phenotypes listed below.


Such respiration responsive genes and gene products can function to either increase or dampen the phenotypes or activities below. Further, promoters of respiration responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by respiration or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the respiration responsive genes when the desired sequence is operably linked to a promoter of a respiration responsive gene. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Mitchondria-Electron Transport (relating to SMD 8061, SMD 8063)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Mitchondria-Electron Transport genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Mitchondria-Electron Transport Genes Identified by Cluster Analyses of Differential Expression


Mitchondria-Electron Transport Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Mitchondria-Electron Transport genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Mitchondria-Electron Transport (relating to SMD 8061, SMD 8063) of the MA_diff table(s).


Mitchondria-Electron Transport Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Mitchondria-Electron Transport genes. A group in the MA_clust is considered a Mitchondria-Electron Transport pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Mitchondria-Electron Transport Genes Identified by Amino Acid Sequence Similarity


Mitchondria-Electron Transport genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Mitchondria-Electron Transport genes. Groups of Mitchondria-Electron Transport genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Mitchondria-Electron Transport pathway or network is a group of proteins that also exhibits Mitchondria-Electron Transport functions/utilities.


III.D.5.a. Use of Respiration Responsive Genes to Modulate Phenotypes


Respiration responsive genes and gene products are useful to or modulate one or more phenotypes including catabolism; energy generation, ATP, etc.; growth rate; whole plant, including height, flowering time, etc.; organs; flowers; fruits; stems; leaves; roots, lateral roots; biomass; fresh and dry weight during any time in plant life, such as maturation; number, size, and weight of flowers; seeds; branches; leaves; total plant nitrogen content; amino acid/protein content of whole plant or parts; seed yield (such as number, size weight, harvest index, and content and composition, e.g., amino acid, nitrogen, oil, protein, and carbohydrate); fruit yield; number, size, weight, harvest index; content and composition, e.g., amino acid, nitrogen, oil, protein, carbohydrate, water; and photosynthesis (such as carbon dioxide fixation).


To improve any of the phenotype(s) above, activities of one or more of the respiration responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Saito et al. (1994, Plant Physiol. 106: 887-95), Takahashi et al (1997, Proc. Natl. Acad. Sci. USA 94: 11102-07) and Koprivova et al. (2000, Plant Physiol. 122: 737-46).


III.D.5.b. Use of Respiration-Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the respiration responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS


PROCESS
AND/OR PATHWAYS
INCLUDING ASSAYS







Respiration and
Mitochondrial Electron
Passam et al. (1973)


energy-related
Transport Chain
Biochem Biophys. Acta


processes

325: 54-61



Alternative oxidase pathway
Saisho et al. (1997) Plant




Mol. Biol. 35: 585-600




Vanlerberghe and




McIntosh (1994) Plant




Physiol. 105: 867-874



ATP generation pathways
Mahler and Cordes (1966)



ATP utilization pathways
In Biological Chemistry,




Harper and Row



Chloroplast energy related
Foyer et al. (1989) Arch.



pathways
Biochem. Biophys. 268:




687-697




Mills et al. (1978)




Biochem. Biophys. Acta




504: 298-309



Peroxisome energy related
Olsen (1998) Plant mol.



pathways
Biol. 38: 163-89



Cytoplasmic energy related
Roberts et al. (1995) Febs Letters



pathways
373: 307-309



Catabolism and Anabolism
Mahler and Cordes (1966) In




Biological Chemistry, Harper and




Row



Aerobic versus anaerobic
Mahler and Cordes (1966) In



pathways
Biological Chemistry, Harper and




Row


Coordination of
Light-regulation of major
Lam et al. (1998) Plant J. 16(3):


Carbon and Nitrogen
central carbon and nitrogen
345-353


Metabolism
Metabolic pathways to
Lejay et al. (1999) Plant J. 18(5):



coordinate growth
509-519; and




Oliveira et al. (1999) Plant. Phys.




121: 301-309



Carbohydrate and nitrogen
Lam et al. (1998) Plant J. 16(3):



control of carbohydrate and
345-353



organic nitrogen accumulation
Lejay et al. (1999) Plant J. 18(5):



pathways
509-519; and




Oliveira et al. (1999) Plant. Phys.




121: 301-309









Other biological activities that can be modulated by the respiration genes and gene products are listed in the REF Tables. Assays for detecting such biological activities are described in the Protein Domain table.


Respiration responsive genes are differentially expressed in response to inhibition of mitochondrial electron transport by antimycin A. The MA_diff table reports the changes in transcript levels of various respiration responsive genes that are differentially expressed in response to this treatment.


Profiles of these different respiration genes are shown in the Table below with examples of associated biological activities.















TRAN-


EXAMPLES OF


SCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up regulated
Responders to
Changes in
Transporters


transcripts
inhibition of
generation of ATP
Catabolic and



mitochondrial
Alternate oxidase
anabolic enzymes



electron
induction
Changes in cell



transport
Changes in
and organelle



respiration
catabolic and
membrane



Genes induced
anabolic enzymes
structures and



by inhibition of
and pathways
potentials



mitochondrial
Specific gene
Kinases and



electron
transcription
phosphatases



transport
initiation
Transcription




Changes in electron
activators




transport proteins
Change in





chromatin





structure and/or





localized DNA





topology





Redox control


Down-
Responders to
Changes in ATP
Transcription


regulated
inhibition of
generating
factors


transcripts
mitochondrial
pathways
Change in protein



electron
Changes in
structure by



transport
pathways and
phosphorylation



Genes repressed
processes operating
(kinases) or



by inhibition of
in cells
dephosphoryaltion



mitochondrial
Induction of
(phosphatases)



electron
aerobic pathways
Transporters



transport
Changes in
Catabolic and




catabolism and
anabolic enzymes




anabolism
Changes in cell





and organelle





membrane





structures and





potentials





Change in





chromatin





structure and/or





localized DNA





topology





changes





Stability factors





for protein





synthesis and





degradation





Metabolic





enzymes




Changes in redox
Changes in redox




activities
enzymes









Use of Promoters of Respiration Genes

Promoters of Respiration genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Respiration genes where the desired sequence is operably linked to a promoter of a Respiration gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.D.6. Protein Degradation Genes, Gene Components and Products


One of the components of molecular mechanisms that operate to support plant development is the “removal” of a gene product from a particular developmental circuit once the substrate protein is not functionally relevant anymore in temporal and/or spatial contexts. The “removal” mechanisms can be accomplished either by protein inactivation (e.g., phosphorylation or protein-protein interaction) or protein degradation most notably via ubiquitination-proteasome pathway. The ubiquitination-proteasome pathway is responsible for the degradation of a plethora of proteins involved in cell cycle, cell division, transcription, and signal transduction, all of which are required for normal cellular functions. Ubiquitination occurs through the activity of ubiquitin-activating enzymes (E1), ubiquitin-conjugating enzymes (E2), and ubiquitin-protein ligases (E3), which act sequentially to catalyze the attachment of ubiquitin (or other modifying molecules that are related to ubiquitin) to substrate proteins (Hochstrasser 2000, Science 289: 563). Ubiquitinated proteins are then routed to proteasomes for degradation processing [2000, Biochemistry and Molecular Biology of Plants, Buchanan, Gruissem, and Russel (eds), Amer. Soc. of Plant Physiologists, Rockville, Md.]. The degradation mechanism can be selective and specific to the concerned target protein (Joazeiro and Hunter2001, Science 289: 2061; Sakamoto et al., 2001, PNAS Online 141230798). This selectivity and specificity may be one of the ways that the activity of gene products is modulated.


III.D.6.a. Identification of Protein Degradation Genes, Gene Components and Products


“Protein degradation” genes identified herein are defined as genes, gene components and products associated with or dependant on the ubiquitination—proteasome protein degradation process. Examples of such “protein degradation” genes and gene products are shown in the Reference and Sequence Tables. The biochemical functions of the protein products of many of these genes are also given in the Reference, Sequence, Protein Group, Protein Group Matrix tables, MA_diff and MA_clust tables. Selected genes, gene components and gene products of the invention can be used to modulate many plant traits from architecture to yield to stress tolerance.


“Protein Degradation” Genes, Gene Components and Products Identified by Phenotypic Observations


“Protein degradation” genes herein were discovered and characterized from a much larger set of genes in experiments designed to find the genes associated with the increased number of lateral branches (and secondary inflorescences) that are formed per cauline node. In these experiments, “protein degradation” genes were identified using a mutant with these characteristics. The gene causing the changes was identified from the mutant gene carrying an inserted tag. The mutant plant was named 13B12-1 and the mutant was in the E2 conjugating enzyme gene of the ubiquitination process. Compared to “wild-type” parental plants, the mutant plants exhibited multiple lateral stems per node and multi-pistillated flowers. For more experimental detail, see Example section below.


Protein Degradation Genes, Gene Components and Products Identified by Differential Expression


“Protein degradation” genes were also identified by measuring the relative levels of mRNA products in the mutant plant 13B12-1 lacking the E2 conjugating enzyme versus a “wild-type” parental plant. Specifically, mRNAs were isolated from 13B12-1 and compared with mRNAs isolated from wild-type plants utilizing microarray procedures. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108451). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Protein Degradation genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Protein Degradation Genes Identified by Cluster Analyses of Differential Expression


Protein Degradation Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Protein Degradation genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108451 of the MA_diff table(s).


Protein Degradation Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Protein Degradation genes. A group in the MA_clust is considered a Protein Degradation pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Protein Degradation Genes Identified by Amino Acid Sequence Similarity


Protein Degradation genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Protein Degradation genes. Groups of Protein Degradation genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Protein Degradation pathway or network is a group of proteins that also exhibits Protein Degradation functions/utilities.


These differentially expressed genes include genes associated with the degradation process and the genes whose expression is disturbed by the aberrant ubiquitination.


Examples of phenotypes, biochemical activities, and transcription profiles that can be modulated using these genes, gene components and gene products are described above and below.


III.D.6.b. Use of “Protein Degradation” Genes, Gene Components and Products to Modulate Phenotypes


The “protein degradation” genes, their components and products of the instant invention are useful for modulating one or more processes required for post-translational modification (e.g., ubiquitination) and degradation or inactivation of substrate proteins and also the pathways and processes that are associated with protein inactivation that are important for either or all of the following: (i) cell proliferation; (ii) cell differentiation; and (iii) cell death. The “protein degradation” genes, gene components and gene products are useful to alter or modulate one or more phenotypes including cell proliferation and cell size.


The intracellular levels of many proteins are regulated by ubiquitin-proteasome proteolysis. Without proper regulation of protein levels, normal cell differentiation can be altered. Examples of cell differentiation and development can be modulated by the genes and gene products of this invention include root size (such as length of primary roots or length of lateral roots) and function; branching and stem formation (such as multiple pistils, multiple lateral stems or secondary inflorescence per cauline node, and internode length) and cell differentiation and/or development in response to hormones (such as Auxin).


Programmed cell death can result from specific and targeted degradation of critical substrate proteins (e.g., transcription factors, enzymes, and proteins involved in signal transduction). Thus, alteration of “protein degradation” genes, their gene products, and the corresponding substrate proteins that they are acting upon are useful to modulate the vigor and yield of the plant overall as well as distinct cells, organs, or tissues. Traits that can be modulated by these genes and gene products include sterility or reproduction and seedling lethality.


Uses of Plants that are Modified as Described Above


Genes that control fundamental steps in regulatory pathways, such as protein inactivation, that in turn influence cascades and networks of other genes and processes are extremely useful. They and their component parts can be used selectively to manipulate development in specific cells, tissues and organs, including meristems when genes are designed to inactivate the normal genes only in specific cells, tissues and organs or to promote protein production where it is not normally produced. They can also be used to promote/control cell death.


Other “protein degradation” genes described here are components of the pathways determining organ identity and phenotypes. These and their component parts are also useful for modifying the characteristics of specific cells, tissues and organs when regulated appropriately. Thus “protein degradation” genes have wide utility for achieving the following: better plant survival by decreased lodging; better responses to high plant density; better stress tolerance; better animal (including human) nutrition values; improved dietary mineral nutrition; more vigor, growth rate and yield in terms of biomass; root/tuber yield (in terms of number, size, weight, or harvest index); content and composition, e.g. amino acid, jasmonate, oil, protein and starch; number of flowers; seed yield (e.g. number, size, weight, harvest index, content and composition, e.g. amino acid, jasmonate, oil, protein and starch); and fruit yield (e.g. number, size, weight, harvest index, post harvest quality, content and composition, e.g. amino acid, jasmonate, oil, protein and starch).


To regulate any of the phenotype(s) above, activities of one or more of the “protein degradation” genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. In addition, a synthetic molecule containing specific domains from “protein degradation” genes or gene product and/or in combination with other domains from gene products that are not necessarily related to protein degradation pathway can be constructed to target the degradation or inactivation of specific substrate proteins. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Dolan et al. (1993, Development 119: 71-84), Dolan et al. (1997, Development 124: 1789-98), Crawford and Glass (1998, Trends Plant Science 3: 389-95), Wang et al. (1998, PNAS USA 95: 15134-39), Gaxiola et al. (1998, PNAS USA 95: 4046-50), Apse et al. (1999, Science 285: 1256-58), Fisher and Long (1992, Nature 357: 655-60), Schneider et al. (1998, Genes Devel 12: 2013-21) and Hirsch (1999, Curr Opin Plant Biol. 2: 320-326).


Use of Protein Degradation Genes, Gene Components and Products to Modulate Biochemical Activities


One or more of the “protein degradation” genes and their components can be used to modulate biochemical or metabolic activities, processes and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Growth, Differentiation
Auxin response
Schwechheimer et al, Science 292:


and Development

1379 (2001);




Leyser et al, Nature 8: 161 (1993);




Lasswell et al, Plant Cell 12: 2395




(2000)



Photomorphogenesis via leaf
Schwechheimer et al, Science 292:



cells and meristems
1379 (2001)



Apical dominance via shoot
Schwechheimer et al, Science 292:



meristems
1379 (2001)



Lateral root development via root
Xie et al, Genes Dev 14: 3024



meristem
(2000)



Hypocotyl, shoot elongation by
Nagpal et al, Plant Physiol 123: 563



hormone controlled process
(2000)


Gene Expression and
mRNA stability
Johnson et al, PNAS 97: 13991


related cellular

(2000);


processes
Gene activation
Pham and Sauer, 289: 2357 (2000)



Cell division and cell cycle
King et al, Cell 81: 279 (1995);



control in meristems
Ciechanover et al, Cell 37: 57




(1984);




Finley et al, Cell 37: 43 (1984);




Robzyk et al, Science 287: 501




(2000)



Chromatin remodeling
Roest et al, Cell 86: 799 (1996)



Post-translational modification
Biederer et al, Science 278: 1806



and organelle targeting of
(1997)



proteins









Other biological activities that can be modulated by the “protein degradation” gene, gene components and products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


III.D.6.d. Use of Protein Degradation Genes, Gene Components and Products to Modulate Transcription Levels of Other Genes


The expression of many genes is “up regulated” or “down regulated” in the 13B12-1 mutant because some protein degradation genes and their products are integrated into complex networks that regulate transcription of many other genes. Some protein degradation genes are therefore useful for modifying the transcription of other genes and hence complex phenotypes, as described above. Profiles of “protein degradation” genes are described in the Table below with associated biological activities. “Up-regulated” profiles are those where the gene produces mRNA levels that are higher in the 13B12-1 as compared to wild-type plant; and vice-versa for “down-regulated” profiles.


















EXAMPLES OF



TYPE OF GENES
PHYSIOLOGICAL
BIOCHEMICAL



WHOSE
CONSEQUENCES OF
ACTIVITIES WHOSE


TRANSCRIPT
TRANSCRIPTS
MODIFYING GENE
TRANSCRIPTS ARE


LEVELS
ARE CHANGED
PRODUCT LEVELS
CHANGED







Up Regulated
Genes induced as
Shoot formation
Transcription


Transcripts
a consequence of
Lateral stem, lateral
Activators and



mutant
and main
Repressors



ubiquitination
inflorescence
Chromatin Structure



degradation
development
and/or Localized



system
Internode
DNA Topology



Genes repressed
elongation
determining proteins



by “protein
Node determination
Methylated DNA



degradation”
and development
binding proteins



system directly or
Root formation
Kinases,



indirectly
Lateral root
Phosphatases



Genes repressed
development
Signal transduction



or mRNAs
Proper response to
pathway proteins



degraded as a
Auxin and other
Transporters



consequence of
growth regulators
Metabolic Enzymes



mutant
Seed dormancy and
Cell cycle



ubiquitination
seed development
checkpoint proteins



degradation
Resistance to
Cell Membrane



process
drought and other
Structure And




forms of stress
Proteins




Secondary
Cell Wall Proteins




metabolite
Proteins involved in




biosynthesis
secondary





metabolism





Seed storage





metabolism


Down Regulated
Genes activated




Transcripts
by “protein





degradation”





systems directly





or indirectly









“Protein degradation” genes and gene products can be modulated alone or in combination as described in the introduction. Of particular interest are combination of these genes and gene products with those that modulate hormone responses and/or metabolism. Hormone responsive and metabolism genes and gene products are described in more detail in the sections above. Such modification can lead to major changes in plant architecture and yield.


Use of Promoters and “Protein Degradation Genes, Gene Components and Products”

Promoters of “protein degradation” genes, as described in the Reference tables, for example, can be used to modulate transcription of any polynucleotide, plant or non plant to achieve synthesis of a protein in association with production of the ubiquitination—proteasome pathway or the various cellular systems associated with it. Additionally such promoters can be used to synthesize antisense RNA copies of any gene to reduce the amount of protein product produced, or to synthesize RNA copies that reduce protein formation by RNA interference. Such modifications can make phenotypic changes and produce altered plants as described above.


III.D.7. Carotenogenesis Responsive Genes, Gene Components and Products


Carotenoids serve important biochemical functions in both plants and animals. In plants, carotenoids function as accessory light harvesting pigments for photosynthesis and to protect chloroplasts and photosystem II from heat and oxidative damage by dissipating energy and scavenging oxygen radicals produced by high light intensities and other oxidative stresses. Decreases in yield frequently occur as a result of light stress and oxidative stress in the normal growth ranges of crop species. In addition light stress limits the geographic range of many crop species. Modest increases in oxidative stress tolerance would greatly improve the performance and growth range of many crop species. The development of genotypes with increased tolerance to light and oxidative stress would provide a more reliable means to minimize crop losses and diminish the use of energy-costly practices to modify the soil environment.


In animals carotenoids such as beta-carotene are essential provitamins required for proper visual development and function. In addition, their antioxidative properties are also thought to provide valuable protection from diseases such as cancer. Modest increases in carotenoid levels in crop species could produce a dramatic effect on plant nutritional quality. The development of genotypes with increased carotenoid content would provide a more reliable and effective nutritional source of Vitamin A and other carotenoid derived antioxidants than through the use of costly nutritional supplements.


Genetic changes produced through DNA mutation in a plant can result in the modulation of many genes and gene products. Examples of such mutation altered genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor, nutritional content and seed yield.


While carotenoid synthesis and/or oxidative stress responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different carotenoid biosynthetic polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. In addition, the combination of an carotenoid synthesis or oxidative stress protective polynucleotide and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in a common pathway.


Such carotenoid synthesis/oxidative stress tolerance genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in light intensity or in the absence of osmotic fluctuations. They were discovered and characterized from a much larger set of genes by experiments designed to find genes whose mRNA products participate in carotenogenesis. These experiments made use of an Arabidopsis mutant (Or) having an accumulation of up to 500 times more beta-carotene than wild-type in non-photosynthetic tissues.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The USArabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing some 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in the mutant plant compared with wild type seedlings were identified, compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones identified. MA_diff Table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which represent Carotenoid synthesis/oxidative stress tolerance responsive genes. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Cauliflower (relating to SMD 5329, SMD 5330)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Carotenogenesis genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Carotenogenesis Genes Identified by Cluster Analyses of Differential Expression


Carotenogenesis Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Carotenogenesis genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Cauliflower (relating to SMD 5329, SMD 5330) of the MA_diff table(s).


Carotenogenesis Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Carotenogenesis genes. A group in the MA_clust is considered a Carotenogenesis pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Carotenogenesis Genes Identified by Amino Acid Sequence Similarity


Carotenogenesis genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Carotenogenesis genes. Groups of Carotenogenesis genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Carotenogenesis pathway or network is a group of proteins that also exhibits Carotenogenesis functions/utilities.


III.D.7.a. Use of Carotenoid Synthesis/Oxidative Stress Tolerance Responsive Genes, Gene Components and Products to Modulate Phenotypes


Carotenoid synthesis/oxidative stress tolerance genes and gene products are useful to or modulate one or more phenotypes including growth rate; whole plant, including height, flowering time, etc.); seedling; organ (such as stem, leaves, roots, flowers, fruits, or seed yield, size, or weight); seed development; embryo; germination; cell differentiation; chloroplasts; plant nutrition; uptake and assimilation of organic compounds; uptake and assimilation of inorganic compounds; animal (including human) nutrition; improved dietary mineral nutrition; stress responses; drought; cold; and osmotic.


To improve any of the phenotype(s) above, activities of one or more of the Carotenoid synthesis/oxidative stress tolerance genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Friedrich, (1999, JAMA 282: 1508), Kumar et al. (1999, Phytochemistry 51: 847-51), La Rocca et al. (2000, Physiologia Plantarum 109: 51-7) and Bartley (1994, In: Ann Rev Plant Physiol Plant Molec Biol, Jones and Somerville, eds, Annual Reviews Inc, Palo Alto, Calif.).


III.D.7.b. Use of Carotenoid Synthesis/Oxidative Stress Tolerance Responsive Genes, Gene Components and Products to Modulate Biochemical Activities


The activities of one or more of the carotenoid synthesis/oxidative stress tolerance genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC




ACTIVITIES AND/OR
CITATIONS


PROCESS
PATHWAYS
INCLUDING ASSAYS







Growth,
Chloroplast biosynthesis
Kumar et al. (1999)


Differentiation

Phytochemistry 51: 847-51


and Development

Fraser et al. (1994) Plant




Physiol 105: 405-13


Metabolism
Carotenoid biosynthesis
Kumar et al. (1999)




Phytochemistry 51: 847-51



Herbicide resistance
La Rocca et al. (2000)




Physiolgia Plantarum 109:




51-57



Regulate abscisic acid
Tan et al. (1997) PNAS



levels
USA 94: 12235-40



Drought, cold and
Tan et al. (1997) PNAS



osmotic tolerance
USA 94: 12235-40









Other biological activities that can be modulated by the Carotenoid synthesis, oxidative stress tolerance genes and gene products are listed in the Reference Tables. Assays for detecting such biological activities are described in the Protein Domain table.


Profiles of these different carotenoid synthesis/oxidative stress tolerance responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.















TRAN-


EXAMPLES OF


SCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up regulated
Genes induced
Gene
Transporters


transcripts
during carotenoid
Repression/
Metabolic



synthesis/
Induction activity
enzymes



oxidative
Cell cycle
Kinases and



stress tolerance
progression
phosphatases



activity
Chromatin
Transcription




condensation
activators




Synthesis of
Change in




metabolites and/or
chromatin




proteins
structure and/or




Modulation of
localized DNA




transduction
topology




pathways





Specific gene





transcription





initiation



Down-
Genes repressed
Gene repression/
Transcription


regulated
during carotenoid
induction activity
factors


transcripts
synthesis/
Changes in
Change in



oxidative stress
pathways and
protein structure



tolerance activity
processes
by



Genes with
operating in cells
phosphorylation



discontinued
Changes in
(kinases) or



expression or
metabolism other
dephosphorylation



unsTable mRNA
than carotenoid
(phosphatases)



in conditions of
synthesis/oxidative
Change in



reduced
stress tolerance
chromatin



carotenoid

structure and/or



synthesis/

DNA topology



oxidative stress

Stability of



tolerance

factors for





protein synthesis





and degradation





Metabolic





enzymes









Use of Promoters of Carotenogenesis Responsive Genes

Promoters of Carotenogenesis responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Carotenogenesis responsive genes where the desired sequence is operably linked to a promoter of a Carotenogenesis responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.D.8. Viability Genes, Gene Components and Products


Plants contain many proteins and pathways that when blocked or induced lead to cell, organ or whole plant death. Gene variants that influence these pathways can have profound effects on plant survival, vigor and performance. The critical pathways include those concerned with metabolism and development or protection against stresses, diseases and pests. They also include those involved in apoptosis and necrosis. The applicants have elucidated many such genes and pathways by discovering genes that when inactivated lead to cell or plant death.


Herbicides are, by definition, chemicals that cause death of tissues, organs and whole plants. The genes and pathways that are activated or inactivated by herbicides include those that cause cell death as well as those that function to provide protection. The applicants have elucidated these genes.


The genes defined in this section have many uses including manipulating which cells, tissues and organs are selectively killed, which are protected, making plants resistant to herbicides, discovering new herbicides and making plants resistant to various stresses.


III.D.8.a. Identification of Viability Genes, Gene Components and Products


Viability genes identified here are defined as genes, gene components and products capable of inhibiting cell, tissue, organ or whole plant death or protecting cells, organs and plants against death and toxic chemicals or stresses. Examples of such viability genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix tables, MA_diff, MA_clust, Knock-in and Knock-out tables. The biochemical functions of the protein products of many of these genes determined from comparisons with known proteins are also given in the Reference tables.


Viability Genes, Gene Components and Products Identified by Phenotypic Observations


These genes were discovered and characterized from a much larger set of genes by experiments designed to find genes that cause serious disturbances in progeny survival, seed germination, development, embryo and/or seedling growth. In these experiments, viability genes were identified by either (1) ectopic expression of a cDNA in a plant or (2) mutagenesis of a plant genome. The plants were then cultivated and one or more of the following phenotypes, which varied from the parental wild-type was observed:

    • A. Gametophytic loss of progeny seedlings (detected from a parent on the basis of a linked herbicide resistance gene showing abnormal segregation ratios, as revealed by treating with herbicide)
    • B. Embryo death, resulting in some cases to loss of seed
    • C. Pigment variation in cotyledons and leaves, including absence of chlorophyll, which leads to seedling death.
      • 1. Abinos
      • 2. Yellow/greens
    • D. Cotyledons produced but no or few leaves and followed by seedling death.
    • E. Very small plantlets


The genes identified in these experiments are shown in Tables X.


Viability Genes, Gene Components and Products Identified by Differential Expression


Viability genes were also identified from a much larger set of genes by experiments designed to find genes whose mRNA products changed in concentration in response to applications of different herbicides to plants. Viability genes are characteristically differentially transcribed in response to fluctuating herbicide levels or concentrations, whether internal or external to an organism or cell. The MA_diff Table reports the changes in transcript levels of various viability genes in entire seedlings at 0, 4, 8, 12, 24, and 48 hours after a plant was sprayed with a Hoagland's nutrient solution enriched with either 2,4 D (Trimec), Glean, Grassgetter, Roundup, or Finale herbicides as compared to seedlings sprayed with Hoagland's solution only.


The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108467, 107871, 107876, 108468, 107881, 108465, 107896, 108466, 107886, 107891, 108501). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Viability genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Viability Genes Identified by Cluster Analyses of Differential Expression


Viability Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Viability genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108467, 107871, 107876, 108468, 107881, 108465, 107896, 108466, 107886, 107891, 108501 of the MA_diff table(s).


Viability Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Viability genes. A group in the MA_clust is considered a Viability pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Viability Genes Identified by Amino Acid Sequence Similarity


Viability genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Viability genes. Groups of Viability genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Viability pathway or network is a group of proteins that also exhibits Viability functions/utilities.


It is assumed that those gene activity changes in response to the toxic herbicides are either responsible, directly or indirectly, for cell death or reflect activation of defense pathways. These genes are therefore useful for controlling plant viability.


Examples of phenotypes, biochemical activities, or transcript profiles that can be modulated using selected viability gene components are described above and below.


III.D.8.b. Use of Viability Genes, Gene Components and Products to Modulate Phenotypes


Deficiencies in viability genes can cause cell death at various rates and under various conditions. Viability genes can be divided into two classes; (1) those that lead to cell death under permissive growth conditions and (2) those that cause cell demise under restrictive conditions. Examples of the first class are viability genes which encode toxins or which participate in the programmed cell death pathway(s). Disruption of metabolic pathways, such as amino acid synthesis, may not cause death when the cell is supplemented with appropriate amino acids, but can cause death under more restrictive conditions.


Some deficiencies in viability genes identified cause the organism as a whole to die, while other genes cause death only of a specific subset of cells or organs. For example, genes identified from embryo viability phenotypes can cause an entire organism to die. In contrast, genes characterized from gametophytic lethals may inhibit cell growth only in a select set of cells. In addition, some viability genes may not cause an immediate demise. A seedling lethal phenotype is one such example, where a seed germinates and produces cotyledons but the plant dies before producing any true leaves. Yellow-green pigment mutants provide yet another set of examples. In some cases, the plant produces a number of yellow-green leaves but dies before producing any seed, due in part, to the necessity to produce chlorophyll in functioning chloroplasts to fix CO2.


Viability genes, in which mutational deficiencies lead to death, carry no duplicates in the haploid plant genome. They thus may be especially likely to promote viability and vigor when expressed more optimally in a plant, in specific tissues or throughout the plant.


Proteins which lead to death when inactivated, and other proteins in the pathways in which they act, are potential targets for herbicides. In this kind of application, chemicals specifically capable of interacting with such proteins are discovered. Typically, this could be done by designing a gene involving the relevant viability gene, that also facilitates a rapid easily measured assay for the functioning of the protein product, and treating plants containing the new genes with the potential herbicides. Those chemicals specifically interfering with the protein activity can then easily be selected for further development.


Genes whose products interact directly with a herbicide can also be modified such that the herbicide no longer inactivates the protein. Such genes are useful for making herbicide resistant plants, valuable in agriculture.


Many of the genes activated or inactivated by the herbicides define genes involved in the pathways that protect the plant against damage and stresses. These genes and gene components, especially those regulating such pathways, are especially useful for enhancing the ability of plants to withstand specific stresses, including herbicides. [See the sections on Stress responsive genes, gene components and products.]


Genes that cause cellular death can be used to design new genes that cause death of specific cells and tissues and hence new valuable products. For example, activation of genes causing death in cells specifying seeds can be used to produce fruits lacking seeds. They can also be used to prevent cell death by pathogens and pests.


The genes and gene components of the instant invention are useful to modulate one or more processes that affect viability and vigor at the (1) cellular level; (2) organelle level; (3) organ level; or (4) overall organism level.


Phenotypes that are modulated by these genese and gene components include (1) at the cellular level: cell size, cell differentiation, cell division, cell longevity, cell position, and cytotoxins; (2) at the organelle level: chloroplasts and/or mitochondria; (3) at the organ level: flower number or size; seed size, number or composition (amino Acid, carbohydrates, lipid, and secondary metabolites); fruit size, number, or composition (amino Acid, carbohydrates, lipid, and secondary metabolites); fruit drop, fruit ripening; leaf (size, composition, amino acid, carbohydrates, lipid, and secondary metabolites, photoefficiency, abscission, or senescence); stem; or root; and (4) at the overall organism level: vigor (e.g. increased biomass), stress tolerance (e.g. cold, drought, heat, herbicide, oxidative, and salt); and pathogen resistance


To regulate any of the phenotype(s) above, activities of one or more of the viability genes or gene products can be modulated in an organism and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (Methods. Mol. Biol. 82:259-266 (1998)) and/or screened for variants as in Winkler et al., Plant Physiol. 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed.


III.D.8.c. Use of Viability Genes, Gene Components and Products to Modulate Biochemical Activities


The viability genes, their components and/or products can be used to modulate processes, biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Amino Acid Synthesis
Aceto-lactate synthase
Hershey et al. (1999) Plant




Mol. Biol. 40, 795-806


Cell Wall Synthesis
Cellulose synthase
Peng et al. (2001) Plant




Physiol. 126, 981-982




Kawagoe and Delmer




(1997) Genet Eng. 19, 63-87


Nucleotide Synthesis
Coenzyme A biosynthesis
Kupke et al. (2001) J. Biol.




Chem. 276, 19190-19196


Lipid Synthesis
Oleosin biosynthesis
Singh et al. (2000)




Biochem. Soc. Trans. 28,




925-927




Zou et al. (1996). Plant Mol.




Biol. 31, 429-433


Hormone Signaling Pathways
Brassinolide and light signal
Kang et al. (2001) Cell 105,



transduction
625-636


Hormone Biosynthesis
Cytokinin biosynthesis
Takei et al, (2001) J. Biol.




Chem. 276, 26405-26410


Secondary Metabolites
Carotenoid biosynthesis
Estevez et al. (2001) J. Biol.




Chem. 276, 22901-22909




Carol and Kuntz (2001)




Trendy Plant Sci. 6, 31-36




Pogson and Rissler (2001)




Phil. Trans. Roy. Soc. Lord.




B 355, 1395-1400


Clearing of Toxic
Ubiquitination



Substances




Growth, Differentiation
Farnesylation
Pei et al (1998) Science 282:


And Development
Nitrogen Metabolism
287-290; Cutler et al. (1996)




Science 273: 1239




Goupil et al (1998) J Exptl




Botany 49: 1855-62


Water Conservation And
Stomatal Development And
Allen et al. (1999) Plant


Resistance To Drought
Physiology
Cell 11: 1785-1798


And Other Related
Stress Response Pathways
Li et al. 2000 Science 287:


Stresses
Inhibition Of Ethylene
300-303



Production Under Low Water
Burnett Et Al 2000. J. Exptl



Potential
Botany 51: 197-205



Proline And Other Osmolite
Raschke (1987) In: Stomatal



Synthesis And Degradation
Function Zeiger et al. Eds.,




253-279




Bush And Pages (1998)




Plant Mol. Biol. 37: 425-35




Spollen Et Al (2000) Plant




Physiol. 122: 967-976




Hare et al. (1998) Plant, Cell




And Environment 21: 535-




553; Hare et al. (1999) J.




Exptl. Botany 50: 413-434


Programmed cell death
Proteases
Kamens et al. (1995) J. Biol.



DNA endonucleases
Chem. 270, 15250-15256



Mitochondriae uncoupling
Wang et al. (2001)



proteins
Anticancer Res. 21, 1789-




1794




Drake et al. (1996) Plant




Mol. Biol 304, 755-767




Mittler and Lam (1995)




Plant Cell 7, 1951-1962




Mittler and Lam (1995)




Plant Physiol. 108, 489-493




Thelen and Northcote




(1989) Planta 179, 181-195




Hanak and Jezek (2001)




FEBS Lett. 495, 137-141



Plasmalemma and Tonoplast
Macrobbie (1998) Philos



Ion Channel Changes
Trans R Soc Lond B Biol



Ca2+ Accumulation
Sci 353: 1475-88; Li et al



K+ Efflux
(2000) Science 287: 300-



Activation Of Kinases And
303; Barkla et al. (1999)



Phosphatases
Plant Physiol. 120: 811-819




Lacombe et al. (2000) Plant




Cell 12: 837-51; Wang et




al. (1998) Plant Physiol




118: 1421-1429; Shi et al.




(1999) Plant Cell 11: 2393-




2406




Gaymard et al. (1998) Cell




94: 647-655




Jonak et al. (1996) Proc.




Natl. Acad. Sci 93: 11274-




79; Sheen (1998) Proc. Natl.




Acad. Sci. 95: 975-80; Allen




et al. (1999) Plant Cell 11:




1785-98









Other biological activities that can be modulated by the viability genes, their components and products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


III.D.8.d. Use of Viability Genes, Gene Components and Products to Modulate Transcript Levels of Other Genes


The expression of many genes is “up regulated” or “down regulated” following herbicide treatment and also in the leaf mutants, because some “viability” genes and their products are integrated into complex networks that regulate transcription of many other genes. Some “viability genes” are therefore useful for modifying the transcription of other genes and hence complex phenotypes, as described above. The data from differential expression experiments can be used to identify a number of types of transcript profiles of “viability genes”, including “early responders,” and “delayed responders”, “early responder repressors” and “delayed repressors”. Profiles of these different types responsive genes are shown in the Table below together with examples of the kinds of associated biological activities. “Up-regulated” profiles are those where the mRNA transcript levels are higher in the herbicide treated plants as compared to the untreated plants. “Down-regulated” profiles represent higher transcript levels in the untreated plant as compared to the herbicide treated plants.

















PHYSIOLOGICAL
EXAMPLES OF



TYPE OF GENES
CONSEQUENCES
BIOCHEMICAL



WHOSE
OF MODIFYING
ACTIVITIES WHOSE


TRANSCRIPT
TRANSCRIPTS ARE
GENE PRODUCT
TRANSCRIPTS ARE


LEVELS
CHANGED
LEVELS
CHANGED







Up Regulated
Early Responders
Suppression of
Transcription


Transcripts
To:
cell, tissue, organ
Factors


(Level At 4 Hr ≅ 0
Gluphosinate
or plant death
Transporters


Hr) or
Chlorsulfuron
following:
Change In Cell


(Level At 4 Hr > 0
Glyphosate
Herbicide
Membrane Structure


Hr)
and/or 2,4-D
treatment or
Kinases And




under stress
Phosphatases




Activation of cell,
Germins, Germin-




tissue, organ or
like proteins,




plant death
Calcium-binding




following:
proteins and H2O2




Herbicide
generating and




treatment or
H2O2 neutralizing




under stress
proteins.





Transcription





Activators





Change In





Chromatin Structure





And/Or Localized





DNA Topology





Annexins, cell wall





structural proteins


Up Regulated
Delayed Responders to
Suppression of
Transcription


Transcripts
Gluphosinate,
cell, tissue, organ
Factors


(Level At 4 Hr < 12
Chlorsulfuron,
or plant death
Specific Factors


Hr)
Glyphosate and/or
following:
(Initiation And



2,4-D
Herbicide
Elongation) For




treatment or
Protein Synthesis




under stress
Lipid transfer




Activation of cell,
proteins




tissue, organ or
Myrosinase-binding




plant death
proteins




following:
Sugar




Herbicide
interconverting




treatment or
enzymes




under stress
Maintenance Of





mRNA Stability





Maintenance Of





Protein Stability





Maintenance Of





Protein-Protein





Interaction





Protein





translocation factors





RNA-binding





proteins





Centromere and





cytoskeleton





proteins





Lipases





Zn/Cu transporters





Cell wall structural





proteins


Down-Regulated
Early Responder
Suppression of
Transcription


Transcripts
Repressors Of Stress
cell, tissue, organ
Factors


(Level At 0 Hr ≅ 4
Response State Of
or plant death
Change In Protein


Hr) or
Metabolism
following:
Structure By


(Level At 0 Hr > 4
Genes With
Herbicide
Phosphorylation


Hr)
Discontinued
treatment or
(Kinases) Or



Expression Or UnsTable
under stress
Dephosphoryaltion



mRNA In Presence Of
Activation of cell,
(Phosphatases)



Herbicide or Abiotic
tissue, organ or
Change In



Stress
plant death
Chromatin Structure




following:
And/Or DNA




Herbicide
Topology




treatment or
H2O2 neutralizing




under stress
proteins




Zn/Cu transporters
Neutralizing




Cell wall
proteins including




structural proteins
SOD and GST


Down-Regulated
Delayed Responder
Suppression of
Transcription


Transcripts
Repressors Of ABA
cell, tissue, organ
Factors


(Level At 4 Hr > 12
Function State Of
or plant death
Kinases And


Hr)
Metabolism
following:
Phosphatases



Genes With
Herbicide
Stability Of Factors



Discontinued
treatment or
For Protein



Expression Or Unstable
under stress
Synthesis And



mRNA In Presence Of
Activation of cell,
Degradation



herbicide or Abiotic
tissue, organ or
Amino Acid



Stress
plant death
biosynthesis




following:
proteins including




Herbicide
aspargive synthase




treatment or
Ca-binding proteins




under stress
Lipid biosynthesis





proteins





Lipases





Zn/Cu transporters





Cell wall structural





proteins









While viability modulating polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development.


Use of Promoters of Viability Genes, Gene Components and Products

Promoters of viability genes can include those that are induced by (1) destructive chemicals, e.g. herbicides, (2) stress, or (3) death. These promoters can be linked operably to achieve expression of any polynucleotide from any organism. Specific promoters from viability genes can be selected to ensure transcription in the desired tissue or organ. Proteins expressed under the control of such promoters can include those that can induce or accelerate death or those that can protect plant cells organ death. For example, stress tolerance can be increased by using promoters of viability genes to drive transcription of cold tolerance proteins, for example. Alternatively, promoters induced by apoptosis can be utilized to drive transcription of antisense constructs that inhibit cell death.


III.D.9. Histone Deacetylase (Axel) Responsive Genes, Gene Components and Products


The deacetylation of histones is known to play an important role in regulating gene expression at the chromatin level in eukaryotic cells. Histone deacetylation is catalyzed by proteins known as histone deacetylases (HDAcs). HDAcs are found in multisubunit complexes that are recruited to specific sites on nuclear DNA thereby affecting chromatin architecture and target gene transcription. Mutations in plant HDAc genes cause alterations in vegetative and reproductive growth that result from changes in the expression and activities of HDAc target genes or genes whose expression is governed by HDAc target genes. For example, transcription factor proteins control whole pathways or segments of pathways and proteins also control the activity of signal transduction pathways. Therefore, manipulation of these types of protein levels is especially useful for altering phenotypes and biochemical activities.


Manipulation of one or more HDAc gene activities is useful to modulate the biological activities and/or phenotypes listed below. HDAc genes and gene products can act alone or in combination. Useful combinations include HDAc genes and/or gene products with similar biological activities, or members of the same, co-regulated or functionally related biochemical pathways. Such HDAc genes and gene products can function to either increase or dampen these phenotypes or activities.


Examples of genes whose expression is affected by alterations in HDAc activity are shown in the Reference and Sequence Tables. These genes and/or gene products are responsible for effects on traits such as inflorescence branching and seed production. They were discovered and characterized from a much larger set of genes by experiments designed to find genes whose mRNA products are affected by a decrease in HDAc gene activity. These experiments made use of an Arabidopsis mutant having severely reduced mRNA levels for the histone deactylase gene AtHDAC1.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by simultaneously hybridizing two differentially labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing 10,000 non-redundant ESTs, selected from 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases over the controls were identified, compared to the Ceres full-length cDNA and genomic sequence databanks, and identical Ceres clones identified. MA_diff table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which are HDAc genes. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Axel (relating to SMD 6654, SMD 6655)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Histone Deacetylase genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Histone Deacetylase Genes Identified by Cluster Analyses of Differential Expression


Histone Deacetylase Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Histone Deacetylase genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Axel (relating to SMD 6654, SMD 6655) of the MA_diff table(s).


Histone Deacetylase Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Histone Deacetylase genes. A group in the MA_clust is considered a Histone Deacetylase pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Histone Deacetylase Genes Identified by Amino Acid Sequence Similarity


Histone Deacetylase genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Histone Deacetylase genes. Groups of Histone Deacetylase genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Histone Deacetylase pathway or network is a group of proteins that also exhibits Histone Deacetylase functions/utilities.


III.D.9.a. Use of Hdac Genes, Gene Components and Products to Modulate Phenotypes


HDAc genes and gene products are useful to or modulate one or more phenotypes including growth rate; whole plant, including height, flowering time, etc.; seedling; organ; seed development; embryo; germination, and cell differentiation.


To improve any of the phenotype(s) above, activities of one or more of the HDAc genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Wu et al. (2000, Plant J 22: 19-27), Hu et al. (2000, J Biol Chem 275: 15254-64), Johnson and Turner (1999, Semin Cell Dev Biol 10: 179-88), Koyama et al. (2000, Blood 96: 1490-5), Wu et al. (2000, Plant J 22: 19-27), Li (1999, Nature Genetics 23: 5-6), Adams et al. (2000, Development 127: 2493-2502) and Lechner et al. (2000, Biochemistry 39: 1683-92).


III.D.9.b. Use of Hdac Development Genes, Gene Components and Products to Modulate Biochemical Activities


The activities of one or more of the HDAc genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Growth, Differentiation
Cell Differentiation
Koyama et al. (2000) Blood


And Development

96: 1490-5



Cell Cycle Progression
Hu et al. (2000) J Biol Chem




275: 15254-64


Metabolism
Chromatin Structure
Hu et al. (2000) J Biol Chem




275: 15254-64



Gene Transcription And
Johnson and Turner (1999)



Chromatin Assembly
Semin Cell Dev Biol 10: 179-88


Reproduction And Seed
Seed Development
Wu et al. (2000) Plant J 22: 19-27


Development
Seed Germination
Lechner et al. (2000)



Independent Embryo
Biochemistry 39: 1683-92



Fertilization
Ohad et al. (1996) PNAS USA



Fertilization Independent
93: 5319-24



Seed Development
Chaudhury et al. (1997) PNAS



Megagametogenesis
USA 94: 4222-28




Christensen et al. (1997) Sex




Plant Reproduc 10: 49-64









Other biological activities that can be modulated by the HDAc genes and gene products are listed in the REFERENCE Table. Assays for detecting such biological activities are described in the Protein Domain table.


Profiles of these different HDAc genes are shown in the Table below with examples of associated biological activities.


















EXAMPLES OF


TRANSCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up Regulated
Responders To
Gene Repression
Transporters


Transcripts
HDAc Activity
Activity
Metabolic enzymes




Cell Cycle
Kinases and




Progression
phosphatases




Chromatin
Transcription




Condensation
activators




Synthesis Of
Change in




Metabolites
chromatin structure




And/Or Proteins
and/or localized




DNA topology





Modulation Of





Transduction





Pathways





Specific Gene





Transcription





Initiation



Down-
Responder To
Negative
Transcription


Regulated
Hdac Inhibitors
Regulation Of
factors


Transcripts
Genes With
Acetylation
Change in protein



Discontinued
Pathways
structure by



Expression Or
Changes In
phosphorylation



UnsTable Mrna
Pathways And
(kinases) or



In Presence Of
Processes
dephosphorylation



Hdac
Operating In
(phosphatases)




Cells chromatin
Change in




structure
and/or DNA




Changes In
topology




Metabolism
Stability of factors





for protein





synthesis and





degradation





Metabolic enzymes









Use of Promoters of Histone Deacetylase Responsive Genes

Promoters of Histone Deacetylase responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Histone Deacetylase responsive genes where the desired sequence is operably linked to a promoter of a Histone Deacetylase responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.E. Stress Responsive Genes, Gene Components and Products


III.E.1. Cold Responsive Genes, Gene Components and Products


The ability to endure low temperatures and freezing is a major determinant of the geographical distribution and productivity of agricultural crops. Even in areas considered suiTable for the cultivation of a given species or cultivar, can give rise to yield decreases and crop failures as a result of aberrant, freezing temperatures. Even modest increases (1-2° C.) in the freezing tolerance of certain crop species would have a dramatic impact on agricultural productivity in some areas. The development of genotypes with increased freezing tolerance would provide a more reliable means to minimize crop losses and diminish the use of energy-costly practices to modify the microclimate.


Sudden cold temperatures result in modulation of many genes and gene products, including promoters. Examples of such cold responsive genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix tables, MA_diff and MA_clust tables These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. They were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to cold treatment.


Manipulation of one or more cold responsive gene activities is useful to modulate the biological activities and/or phenotypes listed below. Cold responsive genes and gene products can act alone or in combination. Useful combinations include cold responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of the levels of such proteins is especially useful for altering phenotypes and biochemical activities of plants. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108578, 108579, 108533, 108534). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Cold genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Cold Genes Identified by Cluster Analyses of Differential Expression


Cold Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Cold genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108578, 108579, 108533, 108534 of the MA_diff table(s).


Cold Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Cold genes. A group in the MA_clust is considered a Cold pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Cold Genes Identified by Amino Acid Sequence Similarity


Cold genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Cold genes. Groups of Cold genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Cold pathway or network is a group of proteins that also exhibits Cold functions/utilities.


Such cold responsive genes and their products can function to either increase or dampen the phenotypes and activities below either in response to cold treatment or in the absence of cold temperature fluctuations.


Further, promoters of cold responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by ABA or any of the following phenotypes or biological activities below.


III.E.1.a. Use of Cold-Responsive Genes to Modulate Phenotypes


Cold responsive genes and gene products are useful to or modulate one or more phenotypes including cold tolerance, below 7° c., for example, cells, organelles, proteins, dehydration resistance, growth rate, whole plant, including height, bolting time, etc., organs, biomass, fresh and dry weight during any time in plant life, such as maturation, number, size, and/or weight of flowers, seeds, branches, or leaves; seed yield in terms of number, size, weight, harvest index, or water content, fruit yield in terms of number, size, weight, harvest index, water content.


To regulate any of the phenotype(s) above, activities of one or more of the cold responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and assayed, for example, in accordance to Steponokus et al. (1993) Biochimica et Biophysica Acta 1145: 93-104; Quinn (1988) Symp Soc. Exp. Biol. 42: 237-258; Bectold and Pelletier (1998) Methods Mol. Biol. 82: 259-266; Kasuga et al. (1999) Nature Biotechnology 17: 287-291; Guy et al. (1998) Cryobiology 36: 301-314; or Liu et al. (1998) Plant Cell 10: 1391-1406.


III.E.1.b. Use of Cold-Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the cold responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations above and those included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES



PROCESS
AND/OR PATHWAYS
CITATIONS INCLUDING ASSAYS







Cold Tolerance
Viability Of Plant
Steponkus (1998) PNAS USA 95:



Protoplasts At Low
14570-14575



Temperatures.




Viability Of Yeast At Low
Schirmer et al. (1994) Plant Cell 6:



Temperatures.
1899-1909



Complementation Of Yeast
Zentella et al. (1999) Plant



Tsp Mutant
Physiology, 119: 1473-1482



Viability Of E. Coli At Low
Yeh et. al. (1997) PNAS 94: 10967-



Temperatures.
10972



Induction Of Cold Shock
Pearce (1999) Plant Growth



Response Genes
Regulation 29: 47-76.


Lipid Composition
Altered Composition Of
Sayanova et al. (1999) Journal of



Membrane Fatty Acids
Experimental Botany 50: 1647-1652




Sayanova (1997) PNAS




USA 94: 4211-4216



ALTERATION OF
Porta et al. (1999) Plant and Cell



LIPDXYGENASE
Physiology 40: 850-858.



ENZYME




ACCUMULATION AND




ACTIVITY



Protein
PROTEIN
Wisniewski et al. (1999) Physiologia


Composition
DENATURATION
Plantarum 105: 600-608



Protein Hydrophilicity
Steponkus (1998) PNAS USA 95:




14570-14575


Modulation of
Induced Transcription
Current Protocols in Molecular


Transcription
Factors And Other Dna
Biology/edited by Frederick M.


Induced by Low
Binding Proteins
Ausubel . . . [et all. New York:


Temperatures
Transcription Of
Published by Greene Pub. Associates



Specific Genes
and Wiley-Interscience: J. Wiley,




c1987.




Steponkus (1998) PNAS USA 95:




14570-14575




Kadyrzhanova et al., Plant Mol Biol




(1998) 36(6): 885-895; and




Pearce et al., Plant Physiol (1998)




117(3): 787-795


Signal
Plasma Membrane
Goodwin et al., Plant Mol Biol (1996)


Transduction
Proteins
31(4) 777-781; and




Koike et al., Plant Cell Physiol (1997)




38(6): 707-716


Oxygen
Glutathione
Kocsy et al., Planta (2000) 210(2):


Scavengers

295-301



Accumulation Active O2
Tao et al., Cryobiology (1998)



and H2O2 Scavengers
37(1): 38-45


Dehydration
Dehydrin
Ismail et al., Plant Physiol (1999)




120(1): 237-244



Transcription of mRNA
Kaye et al., Plant Physiol (1998)




116(4): 1367-1377


Metabolism
Soluble Sugars and/or
Wanner et al., (1999) Plant Physiol



Proline
120(2): 391-400


RNA/DNA
Stabilization of
Jiang, Weining et al., (1997) Journal of


Chaperone
RNA/DNA through
Biological Chemistry, 272: 196-202.



RNA binding and
Fukunaga et al., (1999) Journal of



modulation of RNA
Plant Research, 112: 263-272.



translation through RNA




binding and or




unwinding.



Protein Chaperone
Stabilize protein
Forreiter and Nover (1998) Journal of



structure and facilitate
Biosciences 23: 287-302



protein folding









Other biological activities that can be modulated by the cold responsive genes and their products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Cold responsive genes are characteristically differentially expressed in response to fluctuating cold temperature levels, whether internal or external to an organism or cell. The MA_diff table reports the changes in transcript levels of various cold responsive genes in the aerial parts of seedlings at 1 and 6 hours at 4° C. in the dark as compared to aerial parts of seedlings covered with aluminium foil, and grown at 20° C. in the growth chamber.


The data from this time course can be used to identify a number of types of cold responsive genes and gene products, including “early responders” and “delayed responders”. Profiles of these different cold responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF



FUNCTIONAL
TYPE OF
BIOCHEMICAL


GENE EXPRESSION
CATEGORY OF
BIOLOGICAL
ACTIVITIES OF GENE


LEVELS
GENE
ACTIVITY
PRODUCTS







Upregulated Genes
Early
Perception Of Cold
Transcription Factors


(Level At 1 h ≅ 6 h)
Responders To
Induction Of
Kinases And


or
Cold
Cold Response
Phosphatases


(Level At 1 h > 6 h)

Signal
Amino Acid Sugar And




Transduction
Metabolite Transporters




Pathway s
Carbohydrate Catabolic




Initiating
And Anabolic Enzymes.




Specific Gene
Lipid Biosynthesis




Transcription
Enzymes




Osmotic
Lipid Modification




Adjustment
Enzymes, Example




Alteration Of
Desaturases




Lipid
Ice Crystal Binding




Composition.
Proteins




Ice Nucleation
Hydrophilic Proteins




Inhibition





Mitigation Of





Dehydration By





Sequestering





Water




Stress Response
Repression Of
Transcription Factors




General
Kinases And




Biochemical
Phosphatases




Pathways To
Protein Stability Factors




Optimize Cold
mRNA Stability Factors




Response
mRNA Translation




Pathways.
Factors




Stabilization Of
Protein Turnover Factors




Protein/Enzyme
Oxygen Radical




Activity At Low
Scavengers, Example




Temperature
Peroxidases




Protection
Energy Generation




Against Oxidative
Enzymes EtOH




Stress
Detoxification




Anaerobic





Metabolism



Upregulated Genes
Delayed
Respiration,
Transcription Factors


(Level At 1 h < 6 h)
Responders To
Photosynthesis
Kinases And



Cold Stress
And Protein
Phosphatases



Cold
Synthesis
Protein Stability Factors



Acclimation
Carbohydrate
mRNA Stability Factors



Genes
And Amino Acid
mRNA Translation




Solute
Factors




Accumulation
Protein Turnover Factors




Increased Fatty
Oxygen Radical




Acid Desaturation
Scavengers, Peroxidase




To Increase Lipid
Metabolic Enzymes




Membrane





Stability





Increased





Accumulation Or





Activity Of





Oxidative Stress





Protection Proteins





Stabilization Of





Protein/Enzyme





Activity At Low





Temperature





Protection





Against Oxidative





Stress





Extracellular





Matrix





Modification




Stress Response
Stabilization Of
Transcription Factors



Genes
Protein/Enzyme
Kinases And




Activity At Low
Phosphatases




Temperature
Protein Stability Factors




Protection
mRNA Stability Factors




Against Oxidative
mRNA Translation




Stress
Factors




Anaerobic
Protein Turnover Factors




Metabolism
Oxygen Radical





Scavengers, Example





Peroxidase





Energy Generation





Enzymes, Etoh





Detoxification


Downregulated
Early
Negative
Transcription Factors


(Level At 1 h ≅ 6 h)
Responder
Regulation Of
Kinases And


(Level At 6 h > 1 h)
Repressors Of
Cold Signal
Phosphatases



Cold Stress
Transduction
Protein Stability Factors



Metabolism
Pathways Released
mRNA Stability Factors





mRNA Translation





Factors





Protein Turnover Factors



Genes With
Negative
Cold Repressed



Discontinued
Regulation Of
Metabolic Pathway



Expression Or
Cold Induced
Proteins



UnsTable
Transcription
Factors Coordinating And



mRNA In Cold
Reduced
Controlling Central C and




Reduction In
N Metabolism




Gene Expression
Storage Proteins




In Pathways Not





Required Under





Cold Conditions





Induced mRNA





Turnover



DownRegulated
Delayed
Maintenance Of
Transcription Factors


Transcripts
Responder
Cold Induced State
Kinases And


(Level At 1 h > 6 h)
Repressors Of
Of Metabolism
Phosphatases



Cold Stress
Reduction In
Protein Stability Factors



Metabolism
Gene Expression
mRNA Stability Factors



Genes With
For Pathways Not
mRNA Translation



Discontinued
Required Under
Factors



Expression Or
Cold Conditions
Protein Turnover Factors



UnsTable
Induced mRNA
Cold Repressed



mRNA In Cold
Turnover
Metabolic Pathway





Proteins





Factors Coordinating And





Controlling Central C and





N Metabolism





Storage Proteins









Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the cold responsive genes when the desired sequence is operably linked to a promoter of a cold responsive gene.


III.E.2. Heat Responsive Genes, Gene Components and Products


The ability to endure high temperatures is a major determinant of the geographical distribution and productivity of agricultural crops. Decreases in yield and crop failure frequently occur as a result of aberrant, hot conditions even in areas considered suiTable for the cultivation of a given species or cultivar. Only modest increases in the heat tolerance of crop species would have a dramatic impact on agricultural productivity. The development of genotypes with increased heat tolerance would provide a more reliable means to minimize crop losses and diminish the use of energy-costly practices to modify the microclimate.


Changes in temperature in the surrounding environment or in a plant microclimate results in modulation of many genes and gene products. Examples of such heat stress responsive genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff and MA_clust tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. They were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to high temperatures.


While heat stress responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different heat stress responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of a heat stress responsive polynucleotide and/or gene product with other environmentally responsive polynucleotide is also useful because of the interactions that exist between stress pathways, pathogen stimulated pathways, hormone-regulated pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles, but which participate in common or overlapping pathways. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108576, 108577, 108522, 108523). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Heat genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Heat Genes Identified by Cluster Analyses of Differential Expression


Heat Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Heat genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108576, 108577, 108522, 108523 of the MA_diff table(s).


Heat Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Heat genes. A group in the MA_clust is considered a Heat pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Heat Genes Identified by Amino Acid Sequence Similarity


Heat genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Heat genes. Groups of Heat genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Heat pathway or network is a group of proteins that also exhibits Heat functions/utilities.


Such heat stress responsive genes and gene products can function either to increase or dampen the above phenotypes or activities either in response to changes in temperature or in the absence of temperature fluctuations.


Further, promoters of heat responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by heat or any of the following phenotypes or biological activities below.


III.E.2.a. Use of Heat Stress Responsive Genes to Modulate Phenotypes


Heat stress responsive genes and gene products can be used to alter or modulate one or more phenotypes including heat tolerance (above 20° C., 23° C., 27° C., 30° C., 33° C., 37° C., 40° C. or 42° C.), heat tolerance of cells, of organelles, of proteins, of cells or organelles dehydration resistance, growth rate, whole plant, including height, bolting time, etc., organs, biomass, fresh and dry weight during any time in plant life, such as maturation, number, size, and weight of flowers, seeds, branches, or leaves; seed yield in number, size, weight, harvest index; fruit yield in terms of number, size, weight, or harvest index, stress responses such as mediation of response to desiccation, drought, salt, disease, wounding, cold and other stresses, and reproduction


To regulate any of the phenotype(s) above, activity of one or more of the heat stress responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Queitsch et al. (2000, The Plant Cell 12: 479-92).


III.E.2.b. Use of Heat Stress Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the heat stress responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES



PROCESS
AND/OR PATHWAYS
CITATION INCLUDING ASSAY







Cell Growth and
Regulation And Molecular
Wisniewski et al.


Differentiation
Chaperones
(1999) Physiolgia



Maintenance Of Native
Plantarum 105: 600-608



Conformation (Cytosolic
Queitsch et al.



Proteins)
(2000) The Plant



Reactivation Of
Cell 12: 479-92



Aggregation And Protein
Lee and Vierling



Folding
(2000) Plant



Autoregulation Of Heat
Physiol. 122: 189-197



Shock Response
Schwechheimer



Regulation Of
(1998) Plant Mol



Translational Efficiency
Biol 36: 195-204



Regulation Of Kinase
Shi et al. (1998)



Activity
Genes and



Regulation Of Calcium
Development 12:



Mediated Signal
654-66



Transduction
Wells et al. (1998)




Genes and




Development 12:




3236-51




Lis et al. (2000)




Genes and




Development 14:




792-803




Malho, R. (1999) Plant




Biology 1: 487-494.




Sheen, Jen. (1996)




Science 274: 1900-




1902.




Farmer, P. et al., (1999.)




Biochimica et Biophysica




Acta 1434: 617.


Gene regulation
Transcriptional Regulation Of
Current Protocols in



Heat Induced Proteins Through
Molecular Biology/edited



DNA Binding
by Frederick M. Ausubel . . .



Proteins.
[et al]. New York:



Transcriptional Regulation Of
Published by Greene Pub.



Heat Induced Proteins
Associates and Wiley



Through ProteinProtein
Interscience: J. Wiley,



Interactions Between DNA
c1987.



Binding Proteins And
Steponkus (1998)



Coactivators.
PNAS USA 95:



Transcriptional Regulation Of
14570-14575



Heat Induced Proteins
Gubler et al.



Through Protein
(1999) Plant



Phosphorylation And
Journal 17: 1-9



Dephosphorylation
Glenn et al.



Transcriptional Regulation Of
(1999) Journal of



Thermal Stress Induced
Biological



Genes By ProteinProtein
Chemistry, 274:



Interactions.
36159-36167



Translational Regulation Of




Thermal Stress Induced
Zhou et al., (1997)



Messenger Rnas.
EMBO Journal 16: 3207



Transcriptional Regulation Of
3218.



Heat Induced Genes Through
Sessa et al.,



Chromatin Remodeling.
(2000) EMBO Journal 19:




2257-2269.




Burnett et




al., (2000) Journal




of Experimental




Botany. 51: 197-205.




Osterlund et




al., (2000) Nature




405: 462-466.




Gross and




Watson (1998)




Canadian Journal of




Microbiology,




44: 341-350




Luo, R. X., Dean, D.C.




(1999)




Journal of the




National Cancer




Institute 91: 1288-




1294.




Chromatin protocols




(1999) edited by Peter B.




Becker. Totowa, N.J.:




Humana Press.


Cell Structure
Thermal Stress Protection By
Goodwin et al. (1996)



Plasma Membrane Anchored
Plant Mol Biol 31(4) 777-



Or Secreted And/Or Cell
781; and



Wall Associated Proteins.
Koike et al. (1997) Plant




Cell Physiol 38(6): 707-




716


Signal Transduction
Regulation Of Thermal Stress
Jonak (1996) Proceedings



Pathways And Protein
of the National Academy of



Activity By Protein Kinase
Sciences of the United



And Protein Phosphatase
States of America, 93:



Mediated Phosphorylation
11274-11279.



And Dephosphorylation
Monroy. et al., (1998)



Respectively.
Analytical Biochemistry




265: 183-185.


Photosynthesis
Regulation Of
Schroda et al. (1999) The



Photoprotection And Repair
Plant Cell 11: 1165-178



Of Photosystem II
Oh and Lee (1996) J Plant




Biol. 39: 301-07


Stress Response
Regulation Of Cytosol
Dat et al. (1998) Plant



Peroxide Levels
Physiol 116: 1351-1357



Regulation Of Heat Shock
Kurek et al. (1999) Plant



Factor Binding
Physiol 119: 693-703



Regulation Of Protein
Storozhenko et al. (1998)



Stability During Thermal
Plant Physiol 118: 1005-14



Stress
Soto et al. (1999) Plant



Nucleocytoplasmic Export Of
Physiol 120: 521-28



Heat Shock Protein Mrnas
Yeh et al. (1997) PNAS 94:



Regulation/Reconfiguration
10967-10972



Of Cell Architecture
Winkler et al. (1998) Plant



Regulation Of Pathways For
Physiol 118: 743-50



Reactivation Of ″Damaged″
Saavedra et al. (1997)



And/Or Denatured Proteins
Genes and Development



Regulation Of Protein
11: 2845-2856



Degradation During Thermal
Parsell and Lindquist



Stress.
(1993). Ann. Rev. Genet.



Regulation Of Osmotic
27: 437-496.



Potential During Thermal
Parsell and Lindquist



Stress.
(1993). Ann. Rev. Genet.



Regulation Of Universal
27: 437-496.



Stress Protein Homologue
Georgopoulos and Welch



Activity By Phosphorylation
(1993). Ann Rev. Cell Biol.



And Dephosphorylation.
9: 601-634.



Regulation Of Dehydrin,
Vierstra, Richard D.



LEA-Like And Other Heat
(1996) Plant Molecular



STable Protein Accumulation
Biology, 32: 275-302.




Vierstra, Richard D.;




Callis, Judy. (1999) Plant




Molecular Biology,




41: 435-442.




Liu, J. et al., (1998) Plant




Science 134: 11-20.




Freestone, P. 1997 et al.,




Journal of Molecular




Biology, v. 274: 318-324.




Robertson, A. J. (1994)




Plant Physiology 105: 181-190.









Other biological activities that can be modulated by the heat stress responsive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Heat stress responsive genes are characteristically differentially transcribed in response to fluctuating temperatures, whether internal or external to an organism or cell. The MA_diff table reports the changes in transcript levels of various heat stress responsive genes in aerial tissues at 1 and 6 hours after plants were placed at 42° C. as compared to aerial tissues kept at 20° C. growth chamber temperature.


The data from this time course can be used to identify a number of types of heat stress responsive genes and gene products, including “early responders to heat stress,” “delayed responders to heat stress,” “early responder repressors,” and “delayed repressor responders.” Profiles of these different heat stress responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF



FUNCTIONAL

BIOCHEMICAL


GENE EXPRESSION
CATEGORY OF
PHYSIOLOGICAL
ACTIVITIES/GENE


LEVELS
GENE
CONSEQUENCES
PRODUCTS







Up Regulated
Early Responders
Heat Stress Perception
Transcription Factors


Transcripts
To Heat Stress
Modulation Of Heat
Transporters


(Level At 1 h ≈ 6 h)

Stress Response
Changes In Cell


Or

Transduction
Membrane Structure


(Level At 1 h > 6 h)

Pathways
Kinases And




Specific Gene
Phosphatases




Transcription
Transcription




Initiation
Activators




Conditional Shift In
Changes In




Preferential
Chromatin Structure




Translation Of
And/Or Localized




Transcripts
Dna Topology




Changes In Cell
Modification Of Pre-




Architecture To
Existing Translation




Optimize Cell
Factors By




Adaptation To Heat
Phosphorylation




Stress
(Kinases) Or





Dephosphorylation





(Phosphatases)





Synthesis Of New





Translation Factors





Stability Of





Mediators Of





Protein-Protein





Interaction





Heat Shock Proteins





Changes In





Organelle





Structures,





Membranes And





Energy-Related





Activities





Proteins To Catalyse





Metabolic Turnover


Up Regulated Transcripts
″Delayed″
Maintenance Of
Transcription


(Level At 1 h < 6 h)
Responders
Response To Heat
Factors



Maintenance Of
Stress
Specific Factors



Heat Stress
Maintenance Of
(Initiation And



Response
Protein Stability And
Elongation) For




Conformation
Protein Synthesis





Maintenance Of





Mrna Stability





Heat Shock Proteins





Changes In





Organelle





Structures,





Membranes And





Energy-Related





Activities





Proteins To Catalyse





Metabolic Turnover.





Stability Of





Mediators Of





Protein-Protein





Interaction


Down-Regulated
Early Responder
Negative Regulation
Transcription


Transcripts
Repressors Of
Of Heat Stress
Factors And


(Level At 1 h ≈ 6 h)
″Normal″ State Of
Response Released
Activators


Or
Metabolism
Changes In
Change In Protein


(Level At 6 h > 1 h)
Genes With
Biochemical And
Structure By



Discontinued
Signal Transduction
Phosphorylation



Expression Or
Pathways And
(Kinases) Or



UnsTable mRNA
Processes Operating In
Dephosphoryaltion



In Presence Of
Cells
(Phosphatases)



Heat Stress
Reorientation Of
Change In




Metabolism
Chromatin Structure





And/Or Dna





Topology


Down-Regulated
Delayed
Maintenance Of Heat
Transcription


Transcripts
Repressors Of
Stress Response
Factors And


(Level At 1 hr >
″Normal″ State Of
Maintenance Of
Activators


6 hr)
Metabolism
Pathways Released
Kinases And



Genes With
From Repression
Phosphatases



Discontinued
Changes In Pathways
Stability Of Factors



Expression Or
And Processes
For Protein



UnsTable mRNA
Operating In Cells
Translation



In Presence Of
Reorientation Of




Heat Stress
Metabolism









Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the heat responsive genes when the desired sequence is operably linked to a promoter of a heat responsive gene.


III.E.3. Drought Responsive Genes, Gene Components and Products


The ability to endure drought conditions is a major determinant of the geographical distribution and productivity of agricultural crops. Decreases in yield and crop failure frequently occur as a result of aberrant, drought conditions even in areas considered suiTable for the cultivation of a given species or cultivar. Only modest increases in the drought tolerance of crop species would have a dramatic impact on agricultural productivity. The development of genotypes with increased drought tolerance would provide a more reliable means to minimize crop losses and diminish the use of energy-costly practices to modify the microclimate.


Drought conditions in the surrounding environment or within a plant, results in modulation of many genes and gene products. Examples of such drought responsive genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. They were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to availability of water.


While drought responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different drought responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Whole pathways, or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of the levels of such proteins is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of a drought responsive polynucleotide and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in a common pathway. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108572, 108573, 108502, 108503, 108504, 108556, 108482, 108483, 108473, 108474, 108477). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Drought genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Drought Genes Identified by Cluster Analyses of Differential Expression


Drought Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Drought genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108572, 108573, 108502, 108503, 108504, 108556, 108482, 108483, 108473, 108474, 108477 of the MA_diff table(s).


Drought Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Drought genes. A group in the MA_clust is considered a Drought pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Drought Genes Identified by Amino Acid Sequence Similarity


Drought genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Drought genes. Groups of Drought genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Drought pathway or network is a group of proteins that also exhibits Drought functions/utilities.


Such drought responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to drought conditions or in the absence of drought conditions. Further, promoters of drought responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by drought or any of the following phenotypes or biological activities below.


More specifically, drought responsive genes and gene products are useful to or modulate one or more phenotypes including growth, roots, stems, buds, leaves, development, cell growth, leaves, fruit development, seed development, senescence, stress responses, and mediates response to desiccation, drought, salt and cold.


Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the drought responsive genes when the desired sequence is operably linked to a promoter of a drought responsive gene.


To produce the desired phenotype(s) above, one or more of the drought response genes or gene products can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Ruzin (1999, In: Plant Microtechnique and Microscopy, Oxford University Press, London) and Khanna-Chopra et al. (1999, BBRC 255:324-7).


Alternatively, the activities of one or more of the drought responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES



GENERAL CATEGORY
AND/OR PATHWAYS
ASSAY







Cell Growth and
Preservation of Leaf Sub-Cellular
Jagtap et al. (1998) J Exptl


Differentiation
Structures Including
Botany 49: 1715-1721



Photosynthetic Apparatus




Preservation of Cell Membrane
Munne-Bosch and Alegre



Structures
(2000) Planta 210: 925-31



Regulation of Stomatal
Menke et al. (2000) Plant



development and Physiology
Physiol. 122: 677-686.



Regulation of Factors Involved in
Harrak et al. (1999) Plant



the Drought-adapted change in
Physiol. 121: 557-564.



cell ultrastructure



Physiology
Modulation of Transpiration
Allen et al. (1999) Plant




Cell 11: 1785-98




Li et al. (2000) Science




287: 300-303




Burnett et al. (2000) J Exptl




Bot 51: 197-205




Raschke (1987) In:




Stomatal function, Zeiger




et al., Eds, 253-79



Modulation of Photosynthesis
Sung and Krieg (1979)




Plant Physiol 64: 852-56



Regulation of Epicuticular Wax
Rhee et al. (1998) Plant



Biosynthesis
Physiol 116: 901-11



Regulation of Carotenoid
Alegre (2000) Planta 210:



Biosynthesis
925-31




Loggini et al (2000) Plant




Physiol 119: 1091


Stress Response
Modulation of Leaf Rolling to
Taiz and Zeiger (1991) In:



minimize water loss
Plant Physiology,




Benjamin/Cummings




Publishing Co., Redwood




City, pp 346-70



Modulation of Osmolite
Hare et al. (1998) Plant,



Synthesis
Cell and Environment 21:




535-553




Huan et al. (2000) Plant




Physiol 122: 747-756



Regulation of gene
Hare et al. (1999) J. Exptl.



transcriptional activity specific to
Botany 333: 413-434.



the establishment of drought




tolerance




Regulation of protein degradation
Lee and Vierling (2000)



and reactivation during drought
Plant Physiol. 122: 189-197



stress condition




Modulation/reconfiguration of
Lis et al. (2000) Genes and



translation machineries
Development 14: 792-803



(″recycling″ mechanisms)




adaptable to drought condition



Signal Transduction
Regulation of Ion Sequestration
Bush and Jones (1987) Cell




Calcium 8: 455-72



Regulation of Nuclear Targeted
Ferringno and Silver



Protein Transport
(1999) Methods in Cell




Biology 58: 107-22



Regulation of Cytoplasmic
Shi et al. (1999) Plant Cell



Ca + 2
11: 2393-2406



Regulation of Kinase Synthesis
Li et al. (2000) Science



and Activity
287-300-03



Modulation of Molecular
Mayhew et al (1996)



Chaperone Activity
Nature 379: 420-26




Kimura et al. (1995)




Science 268: 1362-1365.









Other biological activities that can be modulated by the drought responsive genes and gene products are listed in the Reference Tables. Assays for detecting such biological activities are described in the Protein Domain table.


Drought responsive genes are characteristically differentially transcribed in response to drought conditions, whether internal or external to an organism or cell. The MA_diff table(s) report(s) the changes in transcript levels of various drought responsive genes at 1 and 6 hours after aerial tissues were isolated and left uncovered at room temperature on 3 MM paper, as compared to isolated aerial tissues placed on 3 MM paper wetted with Hoagland's solution. The data from this time course can be used to identify a number of types of drought responsive genes and gene products, including “early responders,” and “delayed responders.” Profiles of these different drought responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF


GENE
FUNCTIONAL

BIOCHEMICAL


EXPRESSION
CATEGORY OF
PHYSIOLOGICAL
ACTIVITIES OF GENE


LEVELS
GENE
CONSEQUENCES
PRODUCTS







Up regulated
Early responders to
Drought perception
Transcription factors


transcripts
drought
leading to the
Transporters


(level at 1 hr ≈ 6 hr)

establishment of



(level at 1 hr > 6 hr)

tolerance to drought





Modulation of drought
Change in cell membrane




response transduction
structure




pathways
Kinases and phosphatases




Specific gene
Transcription activators




transcription initiation
Change in chromatin





structure and/or localized





DNA topology




Conditional shift in
Modification of pre-




preferential translation
existing translation factors




of transcripts
by phosphorylation





(kinases) or





dephosphorylation





(phosphatases)





Synthesis of new





translation factors




Changes in cell
Stability of mediators of




architecture to optimize
protein-protein interaction




cell adaptation to heat





stress





Changes in cell
Synthesis and/or stability




division cycle
of factors regulating cell





division


Up regulated
Maintenance of
Maintenance of
Transcription factors


transcripts
drought response
response to drought and
Specific factors (initiation


(level at 1 hr < 6 hr)
″Delayed″ responders
maintenance of
and elongation) for protein




drought-tolerance
synthesis




mechanisms
RNA-binding proteins





effective for mRNA





stability





Change in chromatin





structure and/or DNA





topology




Maintenance of
Stability of mediators of




mechanisms effective
protein-protein interaction




for ions sequestration,
Stability of factors to




osmolite biosynthesis,
effectively utilize pre-




nuclear protein
existing translation




transport, regulation of
machinery (″recycling″




cytoplasmic Ca + 2, and
mechanisms) under




regulation of proteins
drought condition




effective for





maintaining protein





stability and





conformation





Maintenance of cellular
Stability of mediators of




structures
protein-protein interaction


Down-regulated
Early responder
Negative regulation of
Transcription factors and


transcripts
repressors of ″normal″
drought response
activators


(level at 1 hr ≈ 6 hr)
state of metabolism
inducible pathways
Change in protein structure


(level at 6 hr > 1 hr)

released
by phosphorylation



Genes with
Changes in
(kinases) or



discontinued
biochemical and signal
dephosphoryaltion



expression or
transduction pathways
(phosphatases)



unsTable mRNA in
and processes operating
Change in chromatin



presence of water
in cells
structure and/or DNA



stress

topology


Down-regulated
Delayed repressors of
Maintenance of
Transcription factors and


transcripts
″normal″ state of
drought response
activators


(level at 1 hr > 6 hr)
metabolism
Maintenance of
Kinases and phosphatases




pathways released from
Stability of factors for




repression
protein translation



Genes with
Changes in pathways




discontinued
and processes operating




expression or
in cells




unsTable mRNA in





presence of water





stress









Use of Promoters of Drought Responsive Genes

Promoters of Drought responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Drought responsive genes where the desired sequence is operably linked to a promoter of a Drought responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.E.4. Wounding Responsive Genes, Gene Components and Products


Plants are continuously subjected to various forms of wounding from physical attacks including the damage created by pathogens and pests, wind, and contact with other objects. Therefore, survival and agricultural yields depend on constraining the damage created by the wounding process and inducing defense mechanisms against future damage.


Plants have evolved complex systems to minimize and/or repair local damage and to minimize subsequent attacks by pathogens or pests or their effects. These involve stimulation of cell division and cell elongation to repair tissues, induction of programmed cell death to isolate the damage caused mechanically and by invading pests and pathogens, and induction of long-range signaling systems to induce protecting molecules, in case of future attack. The genetic and biochemical systems associated with responses to wounding are connected with those associated with other stresses such as pathogen attack and drought.


Wounding results in the modulation of activities of specific genes and, in consequence, of the levels of key proteins and metabolites. These genes, called here wounding responsive genes, are important for minimizing the damage induced by wounding from pests, pathogens and other objects. Examples of such wounding responsive genes, gene components and products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff, and MA_clust tables. They can be active in all parts of a plant and so where, when and to what extent they are active is crucial for agricultural performance and for the quality, visual and otherwise, of harvested products. They were discovered and characterized from a much larger set of genes by experiments designed to find genes whose products changed in response to wounding.


Manipulation of one or more wounding responsive gene activities is useful to modulate the biological activities and/or phenotypes listed below. Wounding responsive genes and gene products can act alone or in combination with genes induced in other ways. Useful combinations include wounding responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of the levels of such proteins is especially useful for altering phenotypes and biochemical activities of plants. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108574, 108575, 108524, 108525, and Wounding (relating to SMD 3714, SMD 3715)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Wounding genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Wounding Genes Identified by Cluster Analyses of Differential Expression


Wounding Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Wounding genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108574, 108575, 108524, 108525, and Wounding (relating to SMD 3714, SMD 3715) of the MA_diff table(s).


Wounding Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Wounding genes. A group in the MA_clust is considered a Wounding pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Wounding Genes Identified by Amino Acid Sequence Similarity


Wounding genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Wounding genes. Groups of Wounding genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Wounding pathway or network is a group of proteins that also exhibits Wounding functions/utilities.


Such wounding responsive genes and gene products can function either to increase or dampen the phenotypes and activities below, either in response to wounding or in the absence of wounding.


Further, promoters of wounding responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by wounding or any of the following phenotypes or biological activities below.


III.E.4.a. Use of Wounding-Responsive Genes to Modulate Phenotypes


Wounding responsive genes and gene products can be used to alter or modulate one or more phenotypes including growth rate; whole plant height, width, or flowering time; organs (such as coleoptile elongation, young leaves, roots, lateral roots, tuber formation, flowers, fruit, and seeds); biomass; fresh and dry weight during any time in plant life, such as at maturation; number of flowers; number of seeds seed yield, number, size, weight, harvest index (such as content and composition, e.g., amino acid, nitrogen, oil, protein, and carbohydrate); fruit yield, number, size, weight, harvest index, post harvest quality, content and composition (e.g., amino acid, carotenoid, jasmonate, protein, and starch); seed and fruit development; germination of dormant and non-dormant seeds; seed viability, seed reserve mobilization, fruit ripening, initiation of the reproductive cycle from a vegetative state, flower development time, insect attraction for fertilization, time to fruit maturity, senescence; fruits, fruit drop; leaves; stress and disease responses; drought; heat and cold; wounding by any source, including wind, objects, pests and pathogens; uv and high light damage (insect, fungus, virus, worm, nematode damage).


To regulate any of the phenotype(s) above, activities of one or more of the wounding responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and assayed, for example, in accordance with Johnson et. al. (1998) Plant Physiol 116:643-649, Reymond et. al. (2000) Plant Cell 12 707-720, or Keith et. al. (1991) Proc. Nat. Acad. Sci. USA 888821 8825.


III.E.4.b. Use of Wounding-Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the wounding responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations included in the Table below:















BIOLOGICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Plant Tissue
Cell Damage Repair; Cell
Flanders (1990) J. Cell Biol.


Proliferation
Division
110: 1111-1122


Wound Induced
Synthesis Of Jasmonic And
Reymond, P and Farmer E.E.


Pathways Providing
Salicylic Acids And The
Current Opinion in Plant


Defense Against
Pathways Induced By These
Biology 1998 1: 404-411


Pests And Pathogens
Signaling Molecules.
Creelman, RA and Mullet,



Induction Of Jasmonic Acid
J.E. (1997) Ann Rev. Plant



Independent Defense
Physiol Mol Biol 48: 355-387



Pathways.
Leon et al. 1998 Mol Gen



Induction Of Lipoxygenase,
Genet 254: 412-419



Thionins And Nodulins
Titarentko et al. 1997 Plant




Physiol 115: 817-826



Cell Wall Degradation,
Rojo, E. et al. 1998. Plant J



Ethylene Formation, Systemic
13: 153-165



Signaling And Induction Of
Ryan, CA and Pearce, G.



Defense Related Genes
1998. Ann Rev. Cell Dev.




Biol 14: 1-17



Specific Rnase Induction
Reymond, P. et al. 2000.




Plant Cell 12: 707-720




Glazebrook, J. 1999. Current




Opinion in Plant Biol. 2: 280-




286




O'Donnel P. J., et al. 1996




Science 274: 1914-1917




Rojo et al. 1999. Plant J. 20:




135-142




Merkouropoulus G. et al.




1999 Planta 208: 212-219




Kariu et al. 1998. Bioscience




Biotechnology and




Biochemistry 62: 1144-1151




Mcoann et al. 1997 PNAS 94:




5473-5477


Other Stress Induced
Abscisic Acid Formation And
Carrera, E and Prat, S. 1998.


Pathways
Its Signaling Pathway
Plant J 15: 767-771



Cold Responsive Genes and
Chao et. al. 1999. Plant



Pathways
Physiol 120: 979-992



Drought Induced Dehydrins




And Pathways



Modified Lipid
Membrane Lipid Synthesis
Martin, M et al. 1999 Europe


Motabolism
Including Omega-3 Fatty
J. Biochem 262: 283-290



Acid Desaturase




Lipases




Lipid Transfer Proteins



Modified Sugar And
Induction Of Glycohydrolases



Energy Metabolism
And Glycotransferases,




Amylases




Induction Of



Modified Protein And
Aminotransferases, Arginase,



Nitrogen Metabolism
Proteases And Vegetative




Storage Proteins, Aromatic




Amino Acid Synthesis



Secondary Metabolite
Aromatic Amino Acid
Keith, B et al. 1991 PNAS 88:


Induction
Synthesis And Secondary
8821-8825



Metabolites









Other biological activities that can be modulated by wound responsive genes and their products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


The MA_diff table reports the changes in transcript levels of various wound responsive genes in the aerial parts of a plant, 1 and 6 hours after the plants were wounded with forceps. The comparison was made with aerial tissues from unwounded plants.


The data from this time course reveal a number of types of wound responsive genes and gene products, including “early responders,” and “delayed responders.” Profiles of the individual wounding responsive genes are shown in the Table below together with examples of the kinds of associated biological activities that are modulated when the activities of one or more such genes vary in plants.


















EXAMPLES OF


TRANSCRIPT
TYPES OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up Regulated
Early Responders
Induction Of Key
Transcription Factors


Transcripts
To Wounding
Signaling Pathways
Kinases And


(Level At 1 h ≈ 6 h)

Within And Between
Phosphatases


Or

Cells



(Level At 1 h > 6 h)

Modulation Of
Jasmonic




Wounding And Stress
Acid, Salicylic Acid




Induced Signal
And Nitric Oxide




Transduction Pathways
Pathway Proteins.




Specific Gene
Glycohydrolases




Transcription Initiation
Dehydrins




Induction Of Repair
Rnases




Processes Or Cell Death
Metabolic Enzymes





Nodulins





Cell Division And





Cell Wall Proteins




Reorientation Of
Cold Response




Metabolism, Including
Proteins




Management Of Active
Lipoxygenase




Oxygen
Jacalin





Proteins To Detoxify





Active Oxygen





Species




Movement Of Wound
Systemin




Induced Signals Through





Plant





Synthesis Of
Biosynthetic




Phytoalexins And
Enzymes




Secondary Metabolites



Up Related
Delayed
Maintenance Of
Transcription Factors


Transcripts
Responders
Defence Pathways
Kinases And


( Level At 1 h < 6 h)


Phosphatases



Genes Involved In
Maintenance Of
Jasmonic



Wounding
Reorientated Metabolism
Acid, S alicylic Acid



Response At

And Nitric Oxide



Distant Sites From

Pathway Proteins



Wound.





Genes Involved In
Maintenance Of Wound
Glycohydrolases



Maintenance Of
Response
Dehydrins



Wounding
Programmed Cell Death
Rnases



Response
In Selected Cells
Metabolic Enzymes




Reorientation Of
Nodulins




Metabolism
Cold Response





Proteins





Lipoxygenase





Jacalin





Proteins To Detoxify





Active Oxygen





Species





Cell Division And





Cell Wall Proteins




Movement Of Wound
Systemin




Induced Signals Through





Plant





Synthesis Of
Biosynthetic




Phytoalexins And
Enzymes




Secondary Metabolites



Down - Regulated
Early
Negative Regulation Of
Transcription Factors


Transcripts
Responder
Wounding Response
Change In Protein


(Level At 1 hr ≈ 6 h)
Repressors Of
Pathways Released
Structure By


Or
Wounding

Phosphory-Laton


(Level At 6 hr > 1
Response

(Kinases) Or


h)
State

Dephos-Phorylation





(Phosphatases)





Change In Chromatin





Structure And Or





Dna Topology



Genes With
Changes In Pathways
Local Changes In



Discontinued
And Processes Operating
Regulatory Proteins,



Expression Or
In Cells
Metabolic Enzymes,



UnsTable

Transporters Etc.



mRNA





Following





Wounding




Down - Regulated
Delayed
Negative Regulation Of
Transcription


Transcripts
Repressors Of
Wounding Response
Factors,


(Level At 1 hr > 6 h)
Wounding
Pathways Released
Phosphatases,



Response State

Kinases





Changes In Protein





Complex Structures





Chromatin





Restructuring





Proteins



Genes With
Change In Pathways And
Local Changes In



Discontinued
Process Operating In
Regulatory Proteins,



Expression Or
Cells
Metabolic Enzymes,



UnsTable mRNA

Transporters Etc.



Following
Programmed Cell Death
Most Proteins In



Wounding

Selected Cells





Undergoing Death









Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the wounding responsive genes when the desired sequence is operably linked to a promoter of a wounding responsive gene.


III.E.5. Methyl Jasmonate (Jasmonate) Responsive Genes, Gene Components and Products


Jasmonic acid and its derivatives, collectively referred to as jasmonates, are naturally occurring derivatives of plant lipids. These substances are synthesized from linolenic acid in a lipoxygenase-dependent biosynthetic pathway. Jasmonates are signalling molecules which have been shown to be growth regulators as well as regulators of defense and stress responses. As such, jasmonates represent a separate class of plant hormones.


Changes in external or internal jasmonate concentration result in modulation of the activities of many genes and gene products. Examples of such “jasmonate responsive” genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield, especially when plants are growing in the presence of biotic or abiotic stresses. They were discovered and characterized from a much larger set of genes by experiments designed to find genes whose mRNA products changed in concentration in response to application of methyl jasmonate to plants.


Manipulation of one or more jasmonate responsive gene activities is useful to modulate the biological activities and/or phenotypes tested below. Jasmonate response genes and gene products can act alone or in combination. Useful combinations include jasmonate responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same co-regulated or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities Such jasmonate responsive genes and gene products can function to either increase or dampen the phenotypes or activities below either in response to changes in jasmonate concentration or in the absence of jasmonate fluctuations. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108568, 108569, 108555). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


MeJA genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


MeJA Genes Identified by Cluster Analyses of Differential Expression


MeJA Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of MeJA genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108568, 108569, 108555 of the MA_diff table(s).


MeJA Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of MeJA genes. A group in the MA_clust is considered a MeJA pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


MeJA Genes Identified by Amino Acid Sequence Similarity


MeJA genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis MeJA genes. Groups of MeJA genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a MeJA pathway or network is a group of proteins that also exhibits MeJA functions/utilities.


Further, promoters of jasmonate responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by jasmonate or any of the following phenotypes or biological activities below.


III.E.5.a. Use of Jasmonate Responsive Genes to Modulate Phenotypes:


Jasmonate responsive genes and their gene products can be used to alter or modulate one or more phenotypes including growth rate, whole plant (including height, flowering time, etc.), seedling, organ, coleoptile elongation, young leaves, roots, lateral roots, tuber formation, flowers, fruit, seeds, biomass; fresh and dry weight during any time in plant life, including maturation and senescence; number of flowers, number of seeds (including secondary metabolite accumulation, alkaloids, anthocyanins; paclitaxel and related taxanes, rosmarinic; seed yield (such as number, size, weight, harvest index, content and composition, e.g., amino acid, jasmonate, oil, protein, and starch); fruit yield (such as number, size, weight, harvest index, post harvest quality, content and composition e.g., amino acid, carotenoid, jasmonate, protein, starch); seed and fruit development; germination of dormant and non-dormant seeds; seed viability; seed reserve mobilization; fruit ripening (such as initiation of the reproductive cycle from a vegetative state); flower development time; insect attraction for fertilization; time to fruit maturity; senescence; fruits, fruit drop; leaves; stress and disease responses; drought; wounding; UV damage; and insect, fungus, virus, or worm damage.


Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the jasmonate responsive genes when the desired sequence is operably linked to a promoter of a jasmonate responsive gene.


To improve any of the phenotype(s) above, activities of one or more of the jasmonate responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed, for example, in accordance to citations described below.


III.E.5.b. Use of Jasmonate-Responsive Genes to Modulate Biochemical Activities:


The activities of one or more of the jasmonate responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC




ACTIVITIES AND/OR
CITATIONS INCLUDING


PROCESS
PATHWAYS
ASSAYS







Turnover of proteins
Induction of various
This study. Standard



proteases, ubiquitin and
biochemical assays.



proteosome components




and turnover of RNA




polymerases and




translation initiation factors




Reduction in many




ribosomal proteins



Activation of nitrogen
Induction of glutamine
Crawford (1995) Plant Cell


metabolism
synthetase, many
7, 859-868



aminotransferases,
This study. Standard



vegetative storage proteins
biochemical assays.


Lipid turnover
Induction of various
This study. Standard



lipases, desaturases, and
biochemical assays.



reduction of lipid transfer




protein mRNAs



Sugar metabolism
Induction of sugar
This study. Standard



transporters, UDP
biochemical assays.



glucosyltransferases, other




transferases



Glycolysis and central carbon
Induction of glycolytic
This study. Standard


metabolism
related enzymes. Example,
biochemical assays.



glucose 6-phosphate




dehydrogenase,




glyceraldehyde-3-




phosphate dehydrogenase,




phosphoglycerate kinase,




phosphoglucomutase ATP




synthase



Chlorosis
Degradation of
Tsuchiya et al. (1999) Proc.



Chlorophyll
Natl. Acad. Sci. USA




96: 15362-15367



Inhibition of
Reinbothe et al. (1993) J.



Photosynthesis Related
Biol. Chem. 268, 10606-



Proteins
10611


Carbon Assimilation and
Induction of chlorophyll ab
Reinbothe et al. (1993) J.


turnover
binding protein precursor
Biol. Chem. 268, 10606-




10611


Jasmonate metabolism
Induction of lipid
This study. Standard



biosynthesis, myrosinase
biochemical assays.



and jacalin



Jasmonate mediated signal
Receptor binding
Cho and Pai (2000) Mol


transduction

Cells 10, 317-324



Protein kinases
Lee et al. (1998) Mol. Gen.




Genet. 259, 516-522




Seo et al. (1999) Plant Cell




11, 289-298




Yoon et al. (1999) Plant Mol.




Biol. 39, 991-1001



Ubiquitination of
Xie et al. (1998) Science 280,



Repressor Proteins
1091-1094



Calcium Flux regulators
Bergey and Ryan (1999)




Plant Mol. Biol. 40, 815-823



Transcription Activators.
Xiang et al. (1996) Plant



Example-induction of
Mol. Biol. 32, 415-426



various zinc finger, myb
Menke et al. (1999) EMBO J.



and AP-2 related factors
18, 4455-4463


Response to Cell
Lipid Peroxidation
Dubery et al. (2000) Mol.


Membrane Damage

Cell Biol. Res. Commun. 3,




105-110


Cell Elongation
Inhibition of incorporation
Burnett et al. (1993) Plant



of Glucose into Cell Wall
Physiol. 103, 41-48



Saccharides



Cell Organization and
Reductions in
Ishikawa et al. (1994) Plant


Division
tropomyosin related
Mol. Biol. 26, 403-414



proteins and certain cyclins




Induction of actins and




tubulins



Cell Wall Turnover and
Induction of cell wall
Creelman et al. (1992) Proc.


modulation
proteins, glycine-rich
Natl. Acad. Sci. USA 89,



proteins, annexins, pectate
4938-4941



lyase and pectin esterases




Reductions in various
Garcia-Muniz et al. (1998)



dehydrins and expansins
Plant Mol. Biol. 38, 623-632




Norman et al (1999) Mol.




Plant Microbe Interact. 12,




640-644


Stress, Disease, and
Induction of antifungal
Hildmann et al. (1992) Plant


Pathogen Resistance
proteins, wounding
Cell 4, 1157-1170



responsive proteins,
Reinbothe et al. (1994) Proc.



dehydrins, heat shock type
Natl. Acad. Sci. USA 91,



proteins and elicitor
7012-7016



response proteins
Moons et al. (1997) Plant




Cell 9, 2243-2259




Richard et al. (2000) Plant




Mol. Biol. 43, 1-10




Van Wees et al. (2000) Proc.




Natl. Acad. Sci. USA 97,




8711-8716



Phytoalexin Biosynthesis
Creelman et al. (1992) Proc.




Natl. Acad. Sci. USA 89,




4938-4941




Choi et al. (1994) Proc. Natl.




Acad. Sci. USA 91, 2329-




2333



Biosynthesis of phenolics
Doares et al., (1995) Proc.




Natl. Acad. Sci. USA 92,




4095-5098



Production of Protease
Botella et al. (1996) Plant



Inhibitors
Physiol 112, 1201-1210



Defense Gene
Mason et al. (1993) Plant



Transcription in Response
Cell 5, 241-251



to UV





Schaller et al. (2000) Planta




210, 979-984


Secondary Metabolite
Fruit Cartenoid
Czapski and Saniewski


biosynthesis
Composition
(1992) J. Plant Physol. 139,




265-268



Palitaxel and Related
Yukimune et al. (1996)



Taxanes
Nature Biotech. 14, 1129-




1132



Alkaloids
Aerts et al. (1994) Plant J. 4,




635-643




Geerlings et al. (2000) J.




Biol. Chem. 275, 3051-3056



Anthocyanins
Franceschi et al. (1991) Proc.




Natl. Acad. Sci. USA 83,




6745-6749



Rosmarinic
Mizukami et al., (1993) Plant




Cell Reprod. 12, 706-709



Activation of Ethylene-
Czapski and Saniewski



forming Enzyme and
(1992) J. Plant Physiol. 139,



Production of Ethylene
265-268









Other biological activities that can be modulated by the jasmonate responsive genes and their products are listed in the Reference Tables. Assays for detecting such biological activities are described in the Domain section of the Reference Tables.


Jasmonate responsive genes are characteristically differentially transcribed in response to fluctuating jasmonate levels or concentrations, whether internal or external to an organism or cell. The MA_diff table(s) report(s) the changes in transcript levels of various jasmonate responsive genes in the aerial parts of a seedling at 1 and 6 hours after being sprayed with Silwet L-77 solution enriched with methyl jasmonate as compared to seedlings sprayed with Silwet L-77 alone.


The data from this time course reveal a number of types of jasmonate responsive genes and gene products, including “early responders” and “delayed responders”. Profiles of the individual kinds of jasmonate responsive genes are shown in the Table below, together with examples of the kinds of associated biological activities that are modulated when the activities of such genes vary.















GENE
FUNCTIONAL
TYPE OF
EXAMPLES OF


EXPRESSION
CATEGORY OF
BIOLOGICAL
BIOCHEMICAL


LEVELS
GENE
ACTIVITY
ACTIVITY







Upregulated
Early Responders to
Binding and
Transcription Factors


genes
Jasmonate
Perception of
Transporters


(Level at 1 hour ≅ 6

Jasmonate





Transduction of
Kinases, Phosphatases,


hours).

Jasmonate signal
Leucine-rich Repeat


(Level at 1 hour > 6

tranduction response
Proteins (LRRs), GTP-


hours)

pathways
binding proteins (G-





proteins), calcium-





binding proteins and





calcium responsive





proteins




Initiation of Specific
Proteases, lipases,




Gene Transcription to
glutamine synthetase




reorientate
(GS), arginase,




metabolism
aminotransferases,





glycosyltransferases,





sugar transporters, cell





wall proteins, methyl





transferases, glycolytic





enzymes.


Upregulated
Delayed Jasmonate
Maintenance of
Enzymes of methyl


genes
Responders
Metabolism under
jasmonate-induced


(Level at 1 hour > 6

high Jasmonate
pathways, including


hours)

Jasmonate signal
dehydrin, phytoalexin,




Tranduction Response
phenolic, carotenoid,




Pathways
alkaloid and





anthocyanin





biosynthesis.




Gene Transcription to
Transcription factors,




Reorientate
Transporters, Kinases




Metabolism
and phosphatases




Gene Transcription to
Proteases, Lipases,




Maintain Reorientated
Glutaminae




Metabolism
Synthetase, Arginase,





Aminotransferases,





Lipid Peroxidases,





Glycosyltransferases,





Sugar transporters,





Cell Wall Proteins,





Glycolytic Enzymes,





Chlorophyll Binding





Proteins




Reorient Cell
Transcription factors,




Division and Cell
kinases, phosphatases,




Development
LRRs, G-proteins





Actins, Tubulins,





Myosins Cyclins,





Cyclin-dependent





Kinases (CDPKs)





Glycosyl Transferases,





Glycosyl hydrolases,





Expansins, Extensins,





O-Methyl





Transferases





Arabinogalactan-





proteins (AGPs),





Enzymes of Lipid





Biosynthesis, Cutinase


Down regulated
Early responders of
Relese of Suppression
Transcription Factors,


transcripts
Jasmonate
of Jasmonate Induced
Kinases, Phosphatases,


(level at 1 hour = 6

Pathways
LRRs, G-Proteins,


hours)
Genes with
Reorientation of
Chromatin


(level at 6 hours > 1
discontinued
metabolism
Restructuring proteins,


hour)
expression or

Ribosomal proteins,



unsTable mRNA

Translation Factors,



following Jasmonate

Histones, RNA



uptake

polymerases, Pectin





esterase, Lipid transfer





proteins


Down regulated
Genes with
Negative Regulation
Transcription factors


transcripts
Discontinued
of Jasmonate Induced
Kinases, Phosphatases


(level at 1 hour > 6
expression or
Pathways Released.
Chromatin


hours)
UnsTable mRNA

Restructuring Proteins,



Following Jasmonate

LRRs, G-proteins



uptake
Reorientation of
Ribosomal proteins,




metabolism
Translation Factors,





Histones





RNA Polymerases,





Cyclins





Pectin esterase, Lipid





Transfer Proteins









Use of Promoters of Jasmonate Responsive Genes

Promoters of Jasmonate responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Jasmonate responsive genes where the desired sequence is operably linked to a promoter of a Jasmonate responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.E.6. Reactive Oxygen Responsive Genes, Gene Components and H2O2 Products


Often growth and yield are limited by the ability of a plant to tolerate stress conditions, including pathogen attack, wounding, extreme temperatures, and various other factors. To combat such conditions, plant cells deploy a battery of inducible defense responses, including triggering an oxidative burst. The burst of reactive oxygen intermediates occurs in time, place and strength to suggest it plays a key role in either pathogen elimination and/or subsequent signaling of downstream defense functions. For example, H2O2 can play a key role in the pathogen resistance response, including initiating the hypersensitive response (HR). HR is correlated with the onset of systemic acquired resistance (SAR) to secondary infection in distal tissues and organs.


Changes in reactive oxygen, such as H2O2 or O2, in the surrounding environment or in contact with a plant results in modulation of the activities of many genes and hence levels of gene products. Examples of such reactive oxygen responsive genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff and MA_clust tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. The genes were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to application of reactive oxygen, such as H2O2, to plants.


Manipulation of one or more reactive oxygen responsive gene activities is useful to modulate the following biological activities and/or phenotypes listed below. Reactive oxygen responsive genes and gene products can act alone or in combination. Useful combinations include reactive oxygen responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants.


Such reactive oxygen responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in reactive oxygen concentration or in the absence of reactive oxygen fluctuations. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108582, 108583, 108537, 108538, 108558, and H2O2 (relating to SMD 7523)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Reactive Oxygen genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Reactive Oxygen Genes Identified by Cluster Analyses of Differential Expression


Reactive Oxygen Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Reactive Oxygen genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108582, 108583, 108537, 108538, 108558, and H2O2 (relating to SMD 7523) of the MA_diff table(s).


Reactive Oxygen Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Reactive Oxygen genes. A group in the MA_clust is considered a Reactive Oxygen pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Reactive Oxygen Genes Identified by Amino Acid Sequence Similarity


Reactive Oxygen genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Reactive Oxygen genes. Groups of Reactive Oxygen genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Reactive Oxygen pathway or network is a group of proteins that also exhibits Reactive Oxygen functions/utilities.


Further, promoters of reactive oxygen responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by reactive oxygen or any of the following phenotypes or biological activities below.


III.E.6.a. Use of Reactive Oxygen Responsive Genes to Modulate Phenotypes


Reactive oxygen responsive genes and gene products are useful to or modulate one or more phenotypes including pathogen tolerance and/or resistance; Avr/R locus sensitive; non-host sensitive; HR; SAR (e.g., where the reactive oxygen responsive gene and products are modulated in conjunction with any of the bacterial, fungal, virus, or other organism listed below); bacteria resistance, e.g. to Erwinia stewartii, Pseudomonas syringae, Pseudomonas tabaci, Stuart's wilt, etc.; fungal resistance including to downy mildews such as Scleropthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora sacchari, Peronosclerospora maydis; rusts such as Puccinia sorphi, Puccinia polysora, Physopella zeae, etc.; other fungal diseases such as Cercospora zeae-maydis, Colletotrichum graminicola, Fusarium monoliforme, Exserohilum turcicum, Bipolaris maydis, Phytophthora parasitica, Peronospora tabacina, Septoria, etc.; virus or viroid resistance, e.g. to tobacco or cucumber mosaic virus, ringspot virus, necrosis virus, pelargonium leaf curl virus, red clover mottle virus, tomato bushy stunt virus, and like viruses; insect resistance, such as to aphids e.g. Myzus persicae; beetles, beetle larvae; etc.; nematodes, e.g. Meloidogyne incognita; lepidoptera, e.g. Heliothus spp. etc.; resistance specifically in primary or secondary leaves; stress tolerance; winter survival; cold tolerance; heavy metal tolerance, such as cadmium; physical wounding; increased organelle tolerance to redox stress, such as in mitochondria, and chloroplasts; cell death; apoptosis, including death of diseased tissue; senescence; fruit drop; biomass; fresh and dry weight during any time in plant life, such as maturation; number of flowers, seeds, branches, and/or leaves; seed yield, including number, size, weight, and/or harvest index; fruit yield, including number, size, weight, and/or harvest index; plant development; time to fruit maturity; cell wall strengthening and reinforcement; plant product quality, e.g. paper making quality); food additives; treatment of indications modulated by free radicals, and cancer


To regulate any of the phenotype(s) above, activities of one or more of the reactive oxygen responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and assayed, for example, in accordance to Alvarez et al., (1998) Cell 92: 773-784; Halhbrock and Scheel, (1989) Ann. Rev. Plant Physiol. Plant Mol. Biol. 40: 347-369; Lamb et al., (1997) Ann. Rev. Plant Mol. Biol. Plant Physio. 48: 251-275; Lapwood et al. (1984) Plant Pathol. 33: 13-20; Levine et al. (1996) Curr. Biol. 6: 427-437; McKersie et al., (2000) Plant Physiol. 122(4): 1427-1437; Olson and Varner (1993) Plant J. 4: 887-892; Pastore et al., (2000), FEBS Lett 470(1): 88-92; Pastori et al., (1997) Plant Physiol. 113: 411-418. Romero-Puertas et al., (1999) Free Radic. Res. 1999 31 Suppl: S25-31; Shirataki et al., Anticancer Res 20(1A): 423-426 (2000); Wu et al., (1995) Plant Cell 7: 1357-1368;


III.E.6.b. Use of Reactive Oxygen Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the reactive oxygen responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations above and included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Reinforcement of
Modulation Of The Production Of
Bradley et al. 1992. Cell 70,


Cell Walls
ExtracTable Proline-Rich Protein
21-30



Modulation Of Lignification
Mansouri et al. (1999) Physiol




Plant 106: 355-362


Stress, Disease,
Induction Of Pathogenesis Related
Chamnongpol et. al. (1998)


Pathogen Resistance
Proteins, Phytoalexins And Many
Proc. Nat. Acad Sci USA


and Wounding
Defense Pathways.
12; 95: 5818-23.



Induction Of Detoxifying
Davis et al. (1993)



Enzymes Such As Glutathione S-
Phytochemistry 32: 607-611.



Transferase And Ascorbate
Chen et. al. Plant J. (1996)



Peroxidase
10: 955-966



Disease Resistance
Gadea et. al. (1999) Mol Gen




Genet 262: 212-219




Wu et. al. (1995) Plant Cell 7:




1357-68



Reactive Oxygen Generation
Orozco-Cardenas and Ryan



Following Wounding And
(1999) Proc. Nat. Acad. Sci.



Changes In Physical Pressure
USA 25; 96: 6553-7.




Yahraus et al. (1995) Plant




Physiol. 109: 1259-1266



Modulation Of Genes Involved In
LEGENDRE ET AL. (1993)



Wound Repair And Cell Division
PLANT PHYSIOL. 102: 233-




240



Modulation Of Nitric Oxide
DELLEDONNE ET AL.



Signaling
(1998) NATURE 394: 585-588



Salicyclic Acid Accumulation And
DURNER AND KLESSIG



Signaling
(1996) J. BIOL. CHEM.




271: 28492-501


Programmed Cell
Induction Of Cell Death Pathway
LEVINE ET AL. (1996)


Death
Genes
CURR. BIOL. 6: 427-437.




REYNOLDS ET. AL. (1998)




BIOCHEM. J. 330: 115-20









Other biological activities that can be modulated by the reactive oxygen responsive genes and their products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Reactive oxygen responsive genes are characteristically differentially transcribed in response to fluctuating reactive oxygen levels or concentrations, whether internal or external to an organism or cell. The MA_diff table reports the changes in transcript levels of various reactive oxygen responsive genes in the aerial parts of a plant at 1 and 6 hours after the plant was sprayed with Silwett L-77 solution enriched with hydrogen peroxide as compared to plants sprayed with Silwett L-77 alone.


The data from this time course reveal a number of types of reactive oxygen responsive genes and gene products, including “early responders,” and “delayed responders”. Profiles of individual reactive oxygen responsive genes are shown in the Table below together with examples of which associated biological activities are modulated when the activities of one or more such genes vary in plants.


















EXAMPLES OF


GENE
FUNCTIONAL

BIOCHEMICAL


EXPRESSION
CATEGORY OF
PHYSIOLOGICAL
ACTIVITY


LEVELS
GENE
CONSequence
OF GENE PRODUCTS







Upregulated
Early Responders
Perceiving
Transcription Factors


transcripts
To
Reactive Oxygen
Kinases And Phosphatases


(Higher at 1 h
Reactive Oxygen

Transporters


Than 6 h)

Reactive Oxygen
Glutathione S-Transferase


(Level at 1 h ≅ 6 h)

Response
Heat Shock Proteins




Transduction
Salicylic Acid Response




Pathways
Pathway Proteins




Initiating Specific
Jasmonic Acid Pathway




Gene Transcription
Proteins





Dehydrins





Peroxidases





Catalase





Proteases





Pathogen Response Proteins





Ca 2+ Channel Blockers





Phenylalanine Ammonia





Lyase


Upregulated
Delayed Reactive
Maintenance Of
Transcription Factors


transcripts
Oxygen
Defence Pathways
Kinases And Phosphatases


(Lower at 1 h
Responders
To Control Active
Reactive Oxygen


Than 6 h)

Oxygen
Scavenging Enzymes





Cell Wall And Cell





Division/Growth Promoting




Activation Of Cell
Pathway Enzymes




Death Pathways In
Pathogen Response




Specific Cells
Proteins





Proteins Of Defence





Pathways





Proteases, Cellulases,





Nucleases And Other





Degrading Enzymes.





Membrane Proteins





Mitochondrial And





Chloroplast Energy Related





Proteins


Downregulated
Early Responder
Negative
Transcription Factors


transcripts
Repressors Of
Regulation Of
Kinases And Phosphatases


Level at 1 h ≅ 6 h
Reactive Oxygen
Reactive Oxygen
Chromatin Remodelling


Level at 6 h > 1 h.
Response
Inducible Pathways
Proteins



Pathways
Released



Down Regulated
Genes Of
Reduction In
Metabolic Enzymes In


Transcripts
Pathways That
Activities Of
Affected Cells


(Level at 1 h > 6 h
Are Minimized In
Pathways Not
Membrane Proteins And



Response To
Maintained Under
Cell Wall Proteins



Reactive Oxygen
High Reactive
Transcription Factors



Delayed
Oxygen
Kinases And Phosphatases



Responder
Negative
Chromatin Remodelling



Repressors Of
Regulation Of
Proteins



Reactive Oxygen
Reactive Oxygen




Response
Inducible Pathways
Metabolic Enzymes In



Pathways
Released
Affected Cells



Genes Of
Reduction In
Membrane Proteins And



Pathways That
Activities Of
Cell Wall Proteins



Are Minimised In
Pathways Not
Many Proteins In Cells



Response To
Maintained Under
Undergoing Cell Death Or



Reactive Oxygen
Reactive Oxygen
In Damaged Cells




Programmed Cell





Death









Further, promoters of reactive oxygen responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by reactive oxygen or any of the following phenotypes or biological activities below.


III.E.7. Salicylic Acid Responsive Genes, Gene Components and Products


Plant defense responses can be divided into two groups: constitutive and induced. Salicylic acid (SA) is a signaling molecule necessary for activation of the plant induced defense system known as systemic acquired resistance or SAR. This response, which is triggered by prior exposure to avirulent pathogens, is long lasting and provides protection against a broad spectrum of pathogens. Another induced defense system is the hypersensitive response (HR). HR is far more rapid, occurs at the sites of pathogen (avirulent pathogens) entry and precedes SAR. SA is also the key signaling molecule for this defense pathway.


Changes in SA concentration in the surrounding environment or within a plant results in modulation of many genes and gene products. Examples of such SA responsive genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff and MA_clust tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. They were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to SA treatment.


While SA responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different SA responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. In addition, the combination of SA responsive polynucleotides and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress and pathogen induced pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common and overlapping pathways.


Such SA responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in SA concentration or in the absence of SA fluctuations. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108586, 108587, 108515, 108552, 108471, 108472, 108469, 108470, 107953, 107960, 108443, 108440, 108441, 108475, 108476). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


SA genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


SA Genes Identified by Cluster Analyses of Differential Expression


SA Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of SA genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108586, 108587, 108515, 108552, 108471, 108472, 108469, 108470, 107953, 107960, 108443, 108440, 108441, 108475, 108476 of the MA_diff table(s).


SA Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of SA genes. A group in the MA_clust is considered a SA pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


SA Genes Identified by Amino Acid Sequence Similarity


SA genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis SA genes. Groups of SA genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a SA pathway or network is a group of proteins that also exhibits SA functions/utilities.


Further, promoters of SA responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by SA or any of the following phenotypes or biological activities below.


III.E.7.a. Use of Salicylic Acid-Responsive Genes to Modulate Phenotypes


SA responsive genes and gene products are useful to or modulate one or more phenotypes including pathogen tolerance and/or resistance; Avr/R locus Interactions; non-host interactions; HR; SAR, e.g., SA responsive genes and/or products in conjuction with any of the organisms listed below; resistance to bacteria e.g. to Erwinia stewartii, Pseudomonas syringae, Pseudomonas tabaci, Stuart's wilt, etc.; resistance to fungi e.g. to Downy mildews such as Scleropthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora sacchari, Peronosclerospora maydis; rusts such As Puccinia sorphi, Puccinia polysora, Physopella zeae, etc.; and to other fungal diseases e.g. Cercospora zeae-maydis, Colletotrichum graminicola, Fusarium monoliforme, Exserohilum turcicum, Bipolaris maydis, Phytophthora parasitica, Peronospora tabacina, Septoria, etc.; resistance to viruses or viroids e.g., to Tobacco or Cucumber Mosaic Virus, Ringspot Virus, Necrosis Virus, Pelargonium Leaf Curl Virus, Red Clover Mottle Virus, Tomato Bushy Stunt Virus, and like viruses; resistance to insects, such as to aphids e.g. Myzus persicae; to beetles and beetle larvae; to lepidoptera larvae e.g. Heliothus etc.; resistance to nematodes, e.g. Meloidogyne incognita etc.; local resistance in primary (infected) or secondary (uninfected) leaves; stress tolerance; winter survival; cold tolerance; salt tolerance; heavy metal tolerance, such as cadmium; tolerance to physical wounding; increased organelle tolerance to redox stress (such as in mitochondria, and chloroplasts); cell death; programmed cell death, including death of diseased tissue and during senescence); fruit drop; biomass; fresh and dry weight during any time in plant life, such as maturation; number of flowers, seeds, branches, and/or leaves; seed yield, including number, size, weight, and/or harvest index; fruit yield, including number, size, weight, and/or harvest index; plant development; time to fruit maturity; cell wall strengthening and reinforcement; plant product quality; e.g. paper making quality); food additives; treatment of indications modulated by free radicals; and cancer.


To regulate any of the desired phenotype(s) above, activities of one or more of the SA responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Zhao et al. (1998, Plant Cell 10:359-70) and Alvarez et al. (1998, Cell 92: 733-84).


III.E.7.b. Use of Salicylic Acid-Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the SA responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATION INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Protection
Systemic Acquired
Alvarez et al. (1998) Cell


From
Resistance (SAR)
92: 733-84


Microbial
Phytoalexin Biosynthesis
Lapwood et al. (1984) Plant


Pathogens
PR Protein Biosynthesis
Pathol. 33: 13-20



Local Resistance
Davis et al. (1993)



Wound Response
Phytochemistry 32: 607-11




Yahraus et al. (1995) Plant




Physiol. 109: 1259-66


Cell Signaling
Modulation Of Reactive
Alvarez et al. (1998) Cell



Oxygen Signaling
92: 773-784



Modulation Of No
Delledonne et al. (1998)



Signaling
Nature 394: 585-588


Growth And
Lignification
Redman et al. (1999) Plant


Development

Physiol. 119: 795-804









Other biological activities that can be modulated by the SA responsive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Salicylic acid responsive genes are characteristically differentially transcribed in response to fluctuating SA levels or concentrations, whether internal or external to an organism or cell. The MA_diff table reports the changes in transcript levels of various SA responsive genes in entire seedlings at 1 and 6 hours after the seedling was sprayed with a Hoagland's solution enriched with SA as compared to seedlings sprayed with Hoagland's solution only.


The data from this time course can be used to identify a number of types of SA responsive genes and gene products, including “early responders” and “delayed responders.” Profiles of these different SA responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF


GENE
FUNCTIONAL

BIOCHEMICAL


EXPRESSION
CATEGORY
PHYSIOLOGICAL
ACTIVITIES OF GENE


LEVELS
OF GENE
CONSEQUENCES
PRODUCTS







Upregulated Genes
Early
SA Perception
Transcription Factors


(Level At 1 h ≅ 6 h)
Responders To
SA Uptake
Transporters, Kinases,


Or
SA
Modulation Of SA
Phosphatases, G-


(Level At 1 h > 6 h)

Response Transduction
Proteins, LRR, DNA




Pathways
Remodelling Proteins


Upregulated Genes
Delayed
Specific Defensegene
Proteases, PRProteins,


(Level At 1 h < 6 h)
Responders To
Transcription Initiation
Cellulases, Chitinases,



SA
(E.G. Pr Genes, Pal
Cutinases, Other





Degrading Enzymes, Pal,





Proteins Of Defense





Pathways, Cell Wall





Proteins





Epoxide Hydrolases,





Methyl Transferases


Downregulated
Early
Negative Regulation
Transcription factors,


(Level At 1 h ≅ 6 h)
Responder
Of SA Inducible
kinases, phosphatases, G-


Or
Repressors To
Pathways Released
proteins, LRR,


(Level At 6 h > 1 h)
SA

transporters, calcium



Genes With

binding proteins,



Discontinued

chromatin remodelling



Expression Or

protein



UnsTable





mRNA In The





Presence Of SA




Down-Regulated
Delayed
Negative Regulation Of
Transcription Factors,


Transcripts
Responders To
SA Inducible Pathways
Kinases, Phosphatases,


(Level At 1 h > 6 h)
SA Metabolism
Released
G-Proteins, LRR,



Genes With

Transporters, Calcium



Discontinued

Binding Proteins,



Expression Or

Chromatin Remodelling



UnsTable

Protein



mRNA In The





Presence Of SA









Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the SA responsive genes when the desired sequence is operably linked to a promoter of a SA responsive gene.


III.E.8. Nitric Oxide Responsive Genes, Gene Components and Products


The rate-limiting element in plant growth and yield is often its ability to tolerate suboptimal or stress conditions, including pathogen attack conditions, wounding and the presence of various other factors. To combat such conditions, plant cells deploy a battery of inducible defense responses, including synergistic interactions between nitric oxide (NO), reactive oxygen intermediates (ROS), and salicylic acid (SA). NO has been shown to play a critical role in the activation of innate immune and inflammatory responses in animals. At least part of this mammalian signaling pathway is present in plants, where NO is known to potentiate the hypersensitive response (HR). In addition, NO is a stimulator molecule in plant photomorphogenesis.


Changes in nitric oxide concentration in the internal or surrounding environment, or in contact with a plant, results in modulation of many genes and gene products. Examples of such nitric oxide responsive genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. They were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to nitric oxide treatment.


While nitric oxide responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different nitric oxide responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of the levels of such proteins is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of a nitric oxide responsive polynucleotide and/or gene product with other environmentally responsive polynucleotides is also useful because of the interactions that exist between hormone-regulated pathways, stress pathways, pathogen stimulated pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108584, 108585, 108526, 108527, 108559). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


NO genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


NO Genes Identified by Cluster Analyses of Differential Expression


NO Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of NO genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108584, 108585, 108526, 108527, 108559 of the MA_diff table(s).


NO Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of NO genes. A group in the MA_clust is considered a NO pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


NO Genes Identified by Amino Acid Sequence Similarity


NO genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis NO genes. Groups of NO genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a NO pathway or network is a group of proteins that also exhibits NO functions/utilities.


Such nitric oxide responsive genes and gene products can function either to increase or dampen the above phenotypes or activities either in response to changes in nitric oxide concentration or in the absence of nitric oxide fluctuations. Further, promoters of nitric oxide responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by nitric oxide or any of the following phenotypes or biological activities below.


III.E.8.a. Use of Nitric Oxide-Responsive Genes to Modulate Phenotypes:


Nitric oxide responsive genes and gene products are useful to or modulate one or more phenotypes including Stress Responses, Mediation of response to stresses, Disease resistance, Growth, Roots, Stems, Leaves, Cells, Promotes leaf cell elongation, Biomass; Fresh and Dry Weight during any time in plant life, such as at maturation; Size and/or Weight; Flowers, Seeds, Branches, Leaves, Roots, Development, Seed Development, Dormancy; Control rate and timing of germination, Prolongs seed storage and viability; and Senescence.


Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the nitric responsive genes when the desired sequence is operably linked to a promoter of a nitric responsive gene.


To regulate any of the desired phenotype(s) above, activities of one or more of the nitric oxide responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998) Methods. Mol. Biol. 82: 259-266 and/or screened for variants as described in Winkler et al. (1998) Plant Physiol. 118: 743-50 and visually inspected for the desired phenotype. Alternatively, plants can be metabolically and/or functionally assayed according to Beligni and Lamattina (2000) Planta 210: 215-21), Lapwood et al (1984) Plant Pathol 33: 13-20, and/or Brown and Botstein (1999) Nature Genet. 21: 33-37.


III.E.8.b. Use of Nitric Oxide-Responsive Genes to Modulate Biochemical Activities:


The activities of one or more of the nitric oxide responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Stress Response
Programmed Cell Death
Levine et al (1996) Curr.




Biol 6: 427-37




Sellins and Cohen (1991)



Reactive Oxygen based Defence
Radiat. Res. 126: 88-95



Pathways
Kumar and Klessig (2000)




Mol. Plant Microbe




Interact. 13: 347-351


Disease Resistance
Microbial Pathogen resistance
Lapwood et al (1984) Plant



pathways
Pathol 33: 13-20




Kumar and Klessig (2000)




Mol. Plant microbe




interact. 13: 347-351




Klessig et. al. (2000) Proc.




Nat. Acad. Sci USA 97:




8849-8855




Delledonna et al (1998)




Nature 394: 585-588



Programmed Cell Death
Levine et al (1996) Curr.




Biol 6: 427-437




Sellins and Cohen (1991)




Radiat. Res. 126: 88-95



Cellular Protectant Gene
Brown and Botstein (1999)



expression
Nat Genet 21: 33-37



Phytoalexin Biosynthesis
Davis et al. (1993)




Phytochemistry 32: 607-




611


Signal Transduction
Regulation of hydrogen peroxide
Wu et al. (1995) Plant Cell



signaling
7, 1357-1368


Reorientation of nitrogen
Induction of ribosomal proteins,
This study. Standard


metabolism
asparagine synthesis, proteases,
assays for detection of



Rnases
changes


Reorientation of sugar and
Induction of sugar transporters,
This study. Standard


energy metabolism
ATPases, glycohydrolases, and
assays for detection of



glycolytic enzymes, for example
changes









Other biological activities that can be modulated by the NO responsive genes and gene products are listed in the Reference Tables. Assays for detecting such biological activities are described in the Protein Domain table.


NO responsive genes are characteristically differentially transcribed in response to fluctuating NO levels or concentrations, whether internal or external to an organism or cell. The MA_diff table(s) report(s) the changes in transcript levels of various NO responsive genes in aerial tissues at 1 and 6 hours after a plant was sprayed with a Silwett L-77 solution enriched with 5 mM sodium nitroprusside, which is an NO donor. These changes are in comparison with plants sprayed with Silwett L-77 solution only.


The data from this time course can be used to identify a number of types of NO responsive genes and gene products, including “early responders” and “delayed responders” Profiles of these different nitric oxide responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.















GENE
FUNCTIONAL

EXAMPLES OF


EXPRESSION
CATEGORY OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVEL
GENE
CONSEQUENCES
ACTIVITY







Upregulated genes
Early responder
NO Perception
Transcription Factors


(level at 1 hour ≅ 6
repressors to NO
NO Uptake



hours)

Modulation of NO
Transporters


(level at 1 hour > 6

Response Transduction
Pathogen responsive


hours)

Pathways
proteins, salicylic and





jasmonate pathway





proteins




Specific Gene
Proteins to provide




Transcription Initiation
defence against active




of Pathways to
oxygen e.g. glutathione




Optimize NO Response
transferase, ascorbate




Pathways
free radical reductase,





ascorbate peroxidase,





nitrilase, heat shock





proteins





Proteins to reorient





metabolism





e.g. proteases, Rnases,





proteasomes,





asparagine synthetase,





glycohydrolases,





transporters





Proteins to inhibit





transport of nitric oxide





Degradation enzymes


Upregulated
Delayed NO
Maintenance of
NO Metabolic


transcripts
responders
metabolism in presence
Pathway enzymes


(level at 1 hour < 6

of High NO
Pathogen responsive


hours)

Maintenace of disease
proteins, salicylic and




defence pathways
jasmonate pathway





proteins




Maintenance of
Proteins to provide




pathways against
defence against active




reactive oxygen
oxygen e.g. glutathione




production
transferase, ascorbate





free radical reductase,





ascorbate peroxidase,





nitrilase, heat shock





proteins




Maintenance of
Proteins to reorient




different metabolic
and sustain metabolism




programs
e.g. proteases, Rnases,





proteasomes, asparagine





synthetase, glycohydrol





ases, transporters,





Proteins to inhibit





transport of NO




Selective cell death
Degradation enzymes


Down Regulated
Early responders of
Negative regulation of
Transcription factors


Transcripts
NO utilization
NO utilization
Kinases and


(level at 1 hours ≅ 6
pathways
pathways released
phosphatases


hour)


Chromatin


(level at 6 hours > 1


restructuring proteins


hour)
Genes with
Reorientation of
Transcription



discontinued
metabolism
factors, metabolic



expression or

enzymes, kinases and



unsTable mRNA

phosphatases,



following nitric oxide

transporters, ribosomal



uptake

proteins




Programmed cell death
Most proteins in cells





undergoing cell death


Down Regulated
Delayed responder
Negative regulation of
Transcription factors


Transcripts
repressors of NO
NO utilization
Kinases and


(level at 1 hour > 6
stress metabolism
pathways released
phosphatases


hours)


Chromatin





restructuring proteins



Genes with
Reorientation of
Transcription



discontinued
metabolism
factors, metabolic



expression or

enzymes, kinases and



unsTable

phosphatases,



mRNA following

transporters, ribosomal



nitric oxide uptake

proteins.




Programmed cell death
Most proteins in cells





undergoing





programmed cell death









Use of Promoters of No Responsive Genes

Promoters of NO responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the NO responsive genes where the desired sequence is operably linked to a promoter of a NO responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.9. Osmotic Stress Responsive Genes, Gene Components and Products


The ability to endure and recover from osmotic and salt related stress is a major determinant of the geographical distribution and productivity of agricultural crops. Osmotic stress is a major component of stress imposed by saline soil and water deficit. Decreases in yield and crop failure frequently occur as a result of aberrant or transient environmental stress conditions even in areas considered suitable for the cultivation of a given species or cultivar. Only modest increases in the osmotic and salt tolerance of a crop species would have a dramatic impact on agricultural productivity. The development of genotypes with increased osmotic tolerance would provide a more reliable means to minimize crop losses and diminish the use of energy-costly practices to modify the soil environment.


Changes in the osmotic concentration of the surrounding environment or within a plant results in modulation of many genes and gene products. Examples of such osmotic stress responsive genes and gene products, including salt responsive genes, are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff and MA_clust tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield.


While osmotic and/or salt stress responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different osmotic stress responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. In addition, the combination of an osmotic stress responsive polynucleotide and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in a common pathway.


Such osmotic and/or salt stress responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in osmotic concentration or in the absence of osmotic fluctuations. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: 108570, 108571, 108541, 108542, 108553, 108539, 108540). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Osmotic Stress genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Osmotic Stress Genes Identified by Cluster Analyses of Differential Expression


Osmotic Stress Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Osmotic Stress genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID 108570, 108571, 108541, 108542, 108553, 108539, 108540 of the MA_diff table(s).


Osmotic Stress Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Osmotic Stress genes. A group in the MA_clust is considered a Osmotic Stress pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Osmotic Stress Genes Identified by Amino Acid Sequence Similarity


Osmotic Stress genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Osmotic Stress genes. Groups of Osmotic Stress genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Osmotic Stress pathway or network is a group of proteins that also exhibits Osmotic Stress functions/utilities.


Further, promoters of osmotic stress responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by osmotic stress or any of the following phenotypes or biological activities below.


III.E.9.a. Use of Osmotic Stress Responsive Genes to Modulate Phenotypes


Osmotic stress responsive genes and gene products are useful to or modulate one or more phenotypes including growth; roots; stems; leaves; development (such as cell growth by DNA synthesis and cell division, seed development (with regard to desiccation tolerance and dormancy, such as control rate of germination and prolongs seed storage and viability and senescence); stress responses; desiccation; drought; and salt.


To regulate any of the phenotype(s) above, activities of one or more of the osmotic stress responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to de Castro (1998, Phytochemistry 47: 689-694), Xu (1998, J Exp Bot 49: 573-582), Ausubel et al. (In: Current Protocols in Molecular Biology (1999) Volume 1, chapter 4, eds. Ausubel, Brent, Kingston, Moore, Seidman, Smith and Struhl, New York, N.Y.) and De Castro et al. (2000, Plant Physiol 122: 327-36)


III.E.9.b. Use of Osmotic Stress Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the osmotic stress responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Cell Growth And
Regulation Of Osmolyte Synthesis
Yoshu et al. (1995)


Differentiation

The Plant Journal 7: 751-60



Regulation Of Glycolate Pathway
Streb et al. (1993)



And Photoinhibition Of
Physiologia



Photosystem II In Response To
Plantarum. 88: 590-598



Stress



Gene Regulation
Transcriptional Regulation Of
Current Protocols in



Osmotic Stress Induced Proteins
Molecular Biology/edited



Through DNA Binding Proteins
by Frederick M. Ausubel . . .




[et al.]. New York:




Published by Greene Pub.




Associates and Wiley-




Interscience: J. Wiley,



Transcriptional Regulation Of
Jonak (1996) Proceedings



Osmotic Stress Induced Proteins
of the National Academy of



Through Protein Phosphorylation
Sciences of the United



And Dephosphorylation
States of America, 93:




11274-11279; Monroy, A. et




al., (1998)




Analytical Biochemistry




265: 183-185;



Regulation Of Osmotic Stress
McCright (1998) IN:



Induced Gene Protein
Methods in Molecular



Accumulation By Protein Protein
Biology; Protein



Intereaction Between Osmotic
phosphatase protocols;



Stress Regulated Genes And
Ludlow (1998) Humana



Protein Phosphatase 2C
Press Inc.; Suite 808, 999




Riverview Drive, Totowa,




New Jersey




07512, USA.: 263-277.



Transcriptional Regulation Of
Luo and Dean (1999)



Heat Induced Genes Through
Journal of the



Chromatin Remodeling
National Cancer




Institute 91: 1288-1294;




Chromatin




protocols (1999)




edited by Peter B.




Becker. Totowa,




N.J.: Humana




Press



Activity Of Abcisic Acid
Gubler et al. (1999)



Regulated DNA Binding Proteins
Plant Journal 17: 1-9



Accumulation Of RNA Binding
Sato (1995)



Proteins That Regulate Osmotic
Nucleic Acids Research 23:



Stress
2161-2167.


Stress Response
Synthesis And Metabolism Of
Minocha et al.



Osmoprotectants Such As
(1999) Plant



Betaine, Proline And Trehalase
Physiol and




Biochem 37: 597-




603



Regulation Of Sugar Transporters
Dejardin et al.




(1999) Biochem J;




344 Pt 2: 503-9



Regulation Of Vacuolar
Gaxiola et al.



Sodium/Proton Antiport Activity
(1999) PNAS USA



And The Detoxification Of
96: 1480-1485



Cations




Regulation Of Intracellular Na+
Espinoza-Ruiz et



And Li+ Ion Concentrations
al. (1999) The Plant




Journal 20: 529-539



Regulation Of Universal Stress
Freestone et al.



Protein Homologue Activity By
(1997) Journal of



Phosphorylation And
Molecular Biology,



Dephosphorylation.
v. 274: 318-324



Regulation/Maintenance Of
Walker (1996)



Protein Stability During Thermal
Humana Press Inc.



Stress
Suite 808, 999




Riverview Drive,




Totowa, New




Jersey 07512, USA



Regulation Of Protein
Vierstra (1996) Plant



Degradation During Thermal
Molecular Biology, 32: 275-302.



Stress.
Vierstra and Callis




(1999) Plant




Molecular Biology,




41: 435-442


Signal Transduction
Activation Of Stress Response
Xinong et al.



Genes
(1999) The Plant




Journal 19: 569-578



Salt Tolerance
Piao (1999) Plant




Physiol 19: 1527-1534



Calcium Mediated Stress
Subbaiah et al.



Response
(1994) Plant




Physiology




105: 369-376




Kudla et al. (1999)




PNAS USA 96:




4718-4723









Other biological activities that can be modulated by the osmotic stress responsive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Osmotic stress responsive genes are characteristically differentially transcribed in response to fluctuating osmotic stress levels or concentrations, whether internal or external to an organism or cell. MA_diff table reports the changes in transcript levels of various osmotic stress responsive genes in aerial tissues of plants at 1 and 6 hours after the plants were sprayed with Hoagland's solution containing 20% PEG as compared to aerial tissues from plants sprayed with Hoagland's solution only.


The data from this time course can be used to identify a number of types of osmotic stress responsive genes and gene products, including “early responding,” “sustained osmotic stress responders,” “repressors of osmotic stress pathways” and “osmotic stress responders.” Profiles of these different osmotic stress responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF


GENE
FUNCTIONAL

BIOCHEMICAL


EXPRESSION
CATEGORY OF
PHYSIOLOGICAL
ACTIVITIES OF


LEVELS
GENES
CONSEQUENCES
GENE PRODUCTS







Up Regulated
Early Responders
Osmotic Stress
Transcription


Transcripts
To Osmotic
Perception
Factors


(Level At 1 Hour ≅
Stress
Osmolyte Uptake
Transcription


6 Hours)
Universal Stress
Modulation Of
Coactivators


(Level At 1 Hour >
Response Genes
Osmotic Stress
Membrane


6 Hours)
Osmotic Stress
Response Signal
Transporters



Responders
Transduction Pathways
Proline



Abscisic Acid
Specific Gene
Biosynthesis



Biosynthesis And
Transcription
Selective Inhibition



Perception
Initiation
Of Osmolyte




Specific Gene
Transport




Transcription
Protein




Repression
Ubiquitination




Translation Activation
Protein




Translation
Degradation




Repression
Rna Binding




Repression Of
Proteins




“Normal State”
Modification Of




Pathways To Optimize
Protein Activity By




Osmotic Stress
Phosphatases,




Response
Kinases




Activation Of Stress
Synthesis And Or




Signaling Pathways
Activation Of




Up Regulation Of
Oxide Hydrolases,




Abscisic Acid
Suoeroxidedismutase,




Biosynthesis Pathway
Iron Ascorbate




Protein Accumulation
Peroxidase




And Activity
Activation Of




Scavenging Reactive
Signaling Pathway




Oxygen Species
By Calcium




Modification Of Cell
Binding Proteins,




Wall Composition
Modification Of




Up-Regulation Of
Protein Activity By




Universal Stress
Protein-Protein




Response Protein
Interaction




Accumulation
Change In





Chromatin





Structure And/Or





Localized Dna





Topology





Modification Of





Pre-Existing





Translation Factors





By Phosphorylation





(Kinases) Or





Dephosphorylation





(Phosphatases)





Synthesis Of New





Translation Factors





Abscisic Acid





Biosynthesis


Up Regulated
Sustained
Osmolyte Adjustment
Osmotic Stress


Transcripts
Osmotic Stress
And Adaptation
Metabolic


(Level At 1 Hr < 6
Responders
Photosynthetic
Pathways


Hr)
Repressor Of
Activity Modification
Sugar Biosynthetic



Osmotic Stress
Activation Of
Pathways



Pathways
“Normal State”
Sugar Transporters



Abscisic Acid
Biosynthesis Genes
Transcription



Perception,
Negative Regulation
Factors



Biosynthesis And
Of Osmotic Stress
Transcription



Regulation
Pathways
Coactivators




Negative Regulation
Membrane




Of Abscisic Acid
Transporters




Biosynthesis
Abscisic Acid




Acivation Of Abscisic
Biosynthesis




Acid Degradation





Pathway





Cell Wall





Composition





Modification



Down-Regulated
Early Responder
Metabolic Repression
Transcription


Transcripts
Repressors Of
Specific Gene
Factors


(Level At 1 Hr ≈ 6
“Normal” State Of
Transcription
Transcription


Hr)
Metabolism
Initiation
Coactivators


(Level At 6 Hr > 1
Negative Regulators
Specific Gene
Protein


Hr)
Of Abscisic Acid
Transcription
Degradation



Biosynthesis And
Repression
Rna Binding



Perception.
Translation Activation
Proteins



Positive Regulators
Translation
Modification Of



Of “Normal State”
Repression
Protein Activity By



Metabolic Pathways.
Abscisic Acid
Phosphatases,




Degradation
Kinases




Protein Degradation
Activation Of





Signaling Pathway





By Calcium





Binding Proteins,





Modification Of





Protein Activity By





Protein-Protein





Interaction





Change In





Chromatin





Structure And/Or





Localized Dna





Topology





Modification Of





Pre-Existing





Translation Factors





By Phosphorylation





(Kinases) Or





Dephosphorylation





(Phosphatases)





Synthesis Of New





Translation Factors


Down-Regulated
Repressors Of
Osmotic Stress
Transcription


Transcripts
“Normal” State Of
Adaptation
Factors


(Level At 1 Hr > 6
Metabolism
Negative Regulation
Transcription


Hr)
Genes With
Of Abscisic Acid
Coactivators



Discontinued
Biosynthesis
Protein



Expression Or
Negative Regulation
Degradation



UnsTable mRNA In
Of Osmotic Stress
Rna Binding



Presence Of Osmotic
Response Pathways
Proteins



Stress
Genes
Modification Of



Repressor Of
Osmolyte Synthesis
Protein Activity By



Osmotic Stress
And Osmolyte
Phosphatases,



Pathways
Cellular Partitioning
Kinases



Repressors Of
Readjustment
Activation Of



Abscisic Acid
Activation Of
Signaling Pathway



Biosynthesis,
“Normal State”
By Calcium



Perception And
Metabolic Pathways
Binding Proteins,



Regulation

Modification Of





Protein Activity By





Protein-Protein





Interaction





Change In





Chromatin





Structure And/Or





Localized Dna





Topology





Modification Of





Pre-Existing





Translation Factors





By Phosphorylation





(Kinases) Or





Dephosphorylation





(Phosphatases)





Synthesis Of New





Translation Factors





Sugar Biosynthetic





Pathways





Sugar Transporters









Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the osmotic stress responsive genes when the desired sequence is operably linked to a promoter of an osmotic stress responsive gene.


III.E.10. Aluminum Responsive Genes, Gene Components and Products


Aluminum is toxic to plants in soluble form (Al3+). Plants grown under aluminum stress have inhibited root growth and function due to reduced cell elongation, inhibited cell division and metabolic interference. As an example, protein inactivation frequently results from displacement of the Mg2+ cofactor with aluminum. These types of consequences result in poor nutrient and water uptake. In addition, because stress perception and response occur in the root apex, aluminum exposure leads to the release of organic acids, such as citrate, from the root as the plant attempts to prevent aluminum uptake.


The ability to endure soluble aluminum is a major determinant of the geographical distribution and productivity of agricultural crops. Decreases in yield and crop failure frequently occur as a result of aberrant, hot conditions even in areas considered suiTable for the cultivation of a given species or cultivar. Only modest increases in the aluminum tolerance of crop species would have a dramatic impact on agricultural productivity. The development of genotypes with increased aluminum tolerance would provide a more reliable means to minimize crop losses and diminish the use of costly practices to modify the environment.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by simultaneously hybridizing two differentially labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing 10,000 non-redundant ESTs, selected from 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases over the controls were identified, compared to the Ceres full-length cDNA and genomic sequence databanks, and identical Ceres clones identified. MA_diff table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which are aluminum response responsive genes.


The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Aluminum (relating to SMD 7304, SMD 7305)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Aluminum genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Aluminum Genes Identified by Cluster Analyses of Differential Expression


Aluminum Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Aluminum genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Aluminum (relating to SMD 7304, SMD 7305) of the MA_diff table(s).


Aluminum Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Aluminum genes. A group in the MA_clust is considered a Aluminum pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Aluminum Genes Identified by Amino Acid Sequence Similarity


Aluminum genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Aluminum genes. Groups of Aluminum genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Aluminum pathway or network is a group of proteins that also exhibits Aluminum functions/utilities.


III.E.10.a. Use of Aluminum Response Genes to Modulate Phenotypes


Changes in aluminum concentrations in a plant's surrounding environment results in modulation of many genes and gene products. Examples of such aluminum response genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield.


While aluminum responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different aluminum responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. In addition, the combination of a aluminum responsive polynucleotide and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in a common pathway.


Such aluminum responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either

    • in response to changes in aluminum concentration or
    • in the absence of aluminum fluctuations.


More specifically, aluminum responsive genes and gene products are useful to or modulate one or more phenotypes including growth; roots (such as inhibition of root elongation); stems; leaves; whole plant; development (such as cell growth, elongation, and division) and mediates response to oxidative stress, calcium-mediated defense, antioxidant defense and pathogenesis.


To produce the desired phenotype(s) above, one or more of the aluminum response genes or gene products can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Li and Fleming (1999, FEBS Lett 461: 1-5), Delhaize et al. (1999, J Biol Chem 274: 7082-8), Sigimoto and Sakamoto (1997, Genes Genet Syst 72: 311-6), Esaki et al. (2000, Plant Physiol 122: 657-65), Leonard and Gerber (1988, Mutat Res 196: 247-57), Baisakhi et al. (2000, Mutat Res 465: 1-9), Ma (2000, Plant Cell Physiol 41: 383-90) and Koyama et al. (1999, Plant Cell 40: 482-8)


Alternatively, the activities of one or more of the aluminum responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:


















BIOCHEMICAL OR





METABOLIC




GENERAL
ACTIVITIES AND/OR




CATEGORY
PATHWAYS
ASSAY









Cell Growth and
Phospholipase D (PLD)
Toda et al. (1999)



Development
activity
Biosci Biotechnol




Regulation of
Biochem 63: 210-212




Phosphtidylserine
Hamel et al. (1998)




Synthase (PSS)
Planta 205: 531-38




Cell wall strengthening




Stress Response
Regulation of oxidative
Esaki et al. (2000)




stress
Plant Physiol 122:





657-655




Regulation of
Baisakhi et al.




antioxidant defense and
(2000) Mutat Res




DNA repair
465: 1-9




Secretion of Organic
Koyama et al.




Acids (e.g. maleate,
(1999) Plant Cell




citrate) from root apex
40: 482-8




Ca2+ mediated Defense
Plieth et al. (1999)




Responses Against Low
Plant J 18: 634-50




pH




Signaling
H+ transport
Degenhardt et al.





(1988) Plant Physil





117: 19-27




Auxin transport
Rashotte et al.





(2000) Plant





Physiol 122: 481-90










Other biological activities that can be modulated by aluminum response genes and their products are listed in the REFERENCE Table. Assays for detecting such biological activities are described in the Protein Domain table.


















EXAMPLES OF


TRANSCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up regulated
responders to
Aluminum
Transporters


transcripts
aluminum
perception
Metabolic enzymes



application
Aluminum uptake
Change in cell




and transport
membrane




Aluminum
structure




metabolism
and potential




Synthesis of
Kinases and




secondary
phosphatases




metabolites and/or
Transcription




proteins
activators




Modulation of
Change in




aluminum
chromatin




response
structure and/or




transduction
localized DNA




pathways
topology




Specific gene





transcription





initiation



Down-
responder to
Negative
Transcription


regulated
aluminum
regulation of
factors


transcripts
repressors of
aluminum
Change in protein



aluminum
pathways
structure by



state of
Changes in
phosphorylation



metabolism
pathways and
(kinases) or



Genes with
processes
dephosphorylation



discontinued
operating in cells
(phosphatases)



expression or
Changes in other
Change in



unsTable
metabolisms than
chromatin



mRNA in
aluminum
structure and/or



presence of

DNA topology



aluminum

Stability of factors





forprotein synthesis





and degradation





Metabolic enzymes









Use of Promoters of Aluminum Responsive Genes

Promoters of Aluminum responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Aluminum responsive genes where the desired sequence is operably linked to a promoter of a Aluminum responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.E.11. Cadmium Responsive Genes, Gene Components and Products


Cadmium (Cd) has both toxic and non-toxic effects on plants. Plants exposed to non-toxic concentrations of cadmium are blocked for viral disease due to the inhibition of systemic movement of the virus. Surprisingly, higher, toxic levels of Cd do not inhibit viral systemic movement, suggesting that cellular factors that interfere with the viral movement are triggered by non-toxic Cd concentrations but repressed in high Cd concentrations. Furthermore, exposure to non-toxic Cd levels appears to reverse posttranslational gene silencing, an inherent plant defense mechanism. Consequently, exploring the effects of Cd exposure has potential for advances in plant disease control in addition to soil bio-remediation and the improvement of plant performance in agriculture.


Changes in cadmium concentrations in a plant's surrounding environment results in modulation of many genes and gene products. Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by simultaneously hybridizing two differentially labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing some 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in plants treated with 10 μM cadmium compared with untreated plants were identified, compared to the Ceres full length cDNA and genomic sequence databanks, and the equivalent Ceres clones identified. The MA_diff table(s) report(s) the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which represent cadmium responsive genes.


Examples of such cadmium responsive genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield.


While cadmium responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different cadmium responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants. In addition, the combination of a cadmium responsive polynucleotide and/or gene product with other environmentally responsive polynucleotides is also useful because of the interactions that exist between, for example, stress and pathogen induced pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways.


The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Cadium (relating to SMD 7427, SMD 7428)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Cadium genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Cadium Genes Identified by Cluster Analyses of Differential Expression


Cadium Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Cadium genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Cadium (relating to SMD 7427, SMD 7428) of the MA_diff table(s).


Cadium Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Cadium genes. A group in the MA_clust is considered a Cadium pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Cadium Genes Identified by Amino Acid Sequence Similarity


Cadium genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Cadium genes. Groups of Cadium genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Cadium pathway or network is a group of proteins that also exhibits Cadium functions/utilities.


Such cadmium responsive genes and gene products can function to either increase or dampen phenotypes or activities either in response to changes in cadmium concentration or in the absence of cadmium fluctuations. Further, promoters of cadmium responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by cadmium or any of the following phenotypes or biological activities below.


III.E.11.a. Use of Cadmium Responsive Genes, Gene Components and Products to Modulate Phenotypes


Cadmium responsive genes and gene products are useful to or modulate one or more phenotypes including growth, roots, initiation and maintenance of cell division, stems, leaves, development, mitochondria, post-embryonic root meristem development, senescence, stress response, modulation of jasmonic acid and other stress control pathways, metabolic detoxification, heavy metals, plant and seed yield; and fruit yield.


Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the cadmium responsive genes when the desired sequence is operably linked to a promoter of a cadmium responsive gene.


To regulate any of the phenotype(s) above, activities of one or more of the cadmium responsive genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998) Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Ghoshroy et al. (1998, Plant J 13: 591-602), Citovsky et al. (1998, Plant J 16: 13-20), Clemens et al. (1999, EMBO J 18: 3325-33), Chen et al. (2000, Chemosphere 41: 229-34), Xian and Oliver (1998, Plant Cell 10: 1539-90), Romero-Peurtas et al. (1999, Free Rad Res 31: S25-31), Gaur and Noraho (1995, Biomed Environ Sci 8: 202-10), Thomine et al. (2000, PNAS USA 97: 4991-6), Howden et al. (1995, Plant Physiol 107: 1067-73), Kesseler and Brand (1994, Eur J Biochem 225: 907-22) and Vernoux et al. (2000, Plant Cell 12: 97-110).


III.E.10.b. Use of Cadmium-Responsive Genes, Gene Components and Products to Modulate Biochemical Activities


The activities of one or more of the cadmium responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Growth, Differentiation
Root Growth
Thomine et al. (2000) PNAS


and Development
Initiation and maintenance
USA 97: 4991-6



of cell division
Vernoux et al. (2000) Plant Cell



Resistance to Cadmium-
12: 97-110



inhibition of root growth



Metabolism
Cadmium sensing
Howden et al. (1995) Plant




Physiol 107: 1067-73



Cadmium uptake and
Gaur and Noraho (1995) Biomed



transport
Environ Sci 8: 202-10



Decreased cadmium
Thomine et al. (2000) PNAS



transport
USA 97: 4991-6



Phytoremediation




Inhibition of oxidative
Kesseler and Brand (1994) Eur.



phophorylation
Biochem 225: 907-22


Plant Defenses
Viral resistance
Ghoshroy et al. (1998) Plant J



Inhibition of systemic
13: 591-602



movement of virus




Block of viral disease




Detoxification of heavy
Clemens et al. (1999) EMBO J



metals
18: 3325-33



Enhanced stress resistance
Romero-Peurtas et al. (1999)




Free Rad Res 31: S25-31



Cadmium resistance
Xiang and Oliver (1998) Plant



via modulation of jasmonic
Cell 10: 1539-90



acid signaling pathway



Signaling
Relief of post-translational
Citovsky et al. (1998) Plant J 16:



gene silencing
13-20









Other biological activities that can be modulated by the cadmium responsive genes and gene products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Cadmium responsive genes are characteristically differentially transcribed in response to fluctuating cadmium levels or concentrations, whether internal or external to an organism or cell. The MA_diff table(s) report(s) the changes in transcript levels of various cadmium responsive genes following treatment with 10 μM cadmium, relative to untreated plants.


Profiles of some cadmium responsive genes are shown in the Table below together with examples of the kinds of associated biological activities.


















EXAMPLES OF


TRANSCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up regulated
Responders to
Cadmium perception
Transporters


transcripts
cadmium
Cadmium uptake and
Metabolic enzymes



Application
transport
Change in cell membrane




Cadmium metabolism
structure and potential



Genes induced by
Synthesis of secondary
Kinases and



cadmium
metabolites and/or
Phosphatases




proteins
Transcription activators




Modulation of
Change in chromatin




cadmium response
structure and/or localized




transduction pathways
DNA topology




Specific gene
RNA binding proteins




transcription initiation





Genes involved in





inhibiting systemic





movement of plant





viral RNA





Genes involved in post





translational gene





silencing



Down-regulated
Responders to
Negative regulation of
Transcription factors


transcripts
cadmium
cadmium pathways
Change in protein



Genes repressed
released
structure by



by cadmium
Changes in pathways
phosphorylation



Genes with
and processes operating
(kinases) or



discontinued
in cells
Dephosphoryaltion



expression or
Changes in metabolism
(phosphatases)



unsTable mRNA
other than cadmium
Change in chromatin



in presence of
pathways
structure and/or DNA



cadmium
Genes involved in
topology




facilitating systemic
Factors for protein




movement of plant
synthesis and degradation




viral RNA
Metabolic enzymes




Genes involved in
RNA binding proteins




promoting post





translational gene





silencing









Use of Promoters of Cadmium Responsive Genes

Promoters of Cadmium responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Cadmium responsive genes where the desired sequence is operably linked to a promoter of a Cadmium responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.12. Disease Responsive Genes, Gene Components and Products


Often growth and yield are limited by the ability of a plant to tolerate stress conditions, including pathogen attack. To combat such conditions, plant cells deploy a battery of inducible defense responses, including the triggering of an oxidative burst and the transcription of pathogenesis-related protein (PR protein) genes. These responses depend on the recognition of a microbial avirulence gene product (avr) by a plant resistance gene product (R), and a series of downstream signaling events leading to transcription-independent and transcription-dependent disease resistance responses. Reactive oxygen species (ROS) such as H2O2 and NO from the oxidative burst plays a signaling role, including initiation of the hypersensitive response (HR) and induction of systemic acquired resistance (SAR) to secondary infection by unrelated pathogens. PR proteins are able to degrade the cell walls of invading microorganisms, and phytoalexins are directly microbicidal.


The presence of an avirulent pathogen and/or changes in the concentrations of O2, H2O2 and NO in the environment surrounding a plant cell modulate the activities of many genes and, therefore, the levels of many gene products. Examples of tobacco mosaic virus (TMV) responsive genes and gene products, many of them operating through an ROS signaling system, are shown in The Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield. The genes were discovered and characterized from a much larger set by experiments designed to find genes whose mRNA products changed in response to application of TMV to plants.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing some 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in response to TMV infection over the non infected controls were identified, compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones identified. The MA_diff table(s) report(s) the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which represent disease responsive genes.


Manipulation of one or more disease responsive gene activities is useful to modulate the biological processes and/or phenotypes listed below. Disease responsive genes and gene products can act alone or in combination. Useful combinations include disease responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants.


Such disease responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in active oxygen concentration or in the absence of active oxygen fluctuations. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Disease (relating to SMD 7342, SMD 7343)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Disease genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Disease Genes Identified by Cluster Analyses of Differential Expression


Disease Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Disease genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Disease (relating to SMD 7342, SMD 7343) of the MA_diff table(s).


Disease Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Disease genes. A group in the MA_clust is considered a Disease pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Disease Genes Identified by Amino Acid Sequence Similarity


Disease genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Disease genes. Groups of Disease genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Disease pathway or network is a group of proteins that also exhibits Disease functions/utilities.


Further, promoters of disease responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by disease or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the disease responsive genes when the desired sequence is operably linked to a promoter of a disease responsive gene.


III.E.12.a. Use of Disease Responsive Genes, Gene Components and Products to Modulate Phenotypes


Disease responsive genes and gene products are useful to or modulate one or more phenotypes including pathogen tolerance and/or resistance; Avr/R locus interactions; non-host interactions; HR; SAR; resistance to bacteria e.g. to Erwinia stewartii, Pseudomonas syringae, Pseudomonas tabaci, Stuart's wilt, etc.; resistance to fungi, e.g. to downy mildews such as Scleropthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora sacchari, Peronosclerospora maydis; rusts such as Puccinia sorphi, Puccinia polysora, Physopella zeae, etc.; and to other fungal diseases e.g. Cercospora zeae-maydis, Colletotrichum graminicola, Fusarium monoliforme, Exserohilum turcicum, Bipolaris maydis, Phytophthora parasitica, Peronospora tabacina, Septoria, etc.; resistance to viruses or viroids e.g. to tobacco or cucumber mosaic virus, ringspot virus, necrosis virus, pelargonium leaf curl virus, red clover mottle virus, tomato bushy stunt virus, and like viruses; rrResistance to insects, such as to aphids e.g. Myzus persicae; to beetles and beetle larvae; to lepidoptera larvae, e.g. Heliothus etc.; resistance to Nematodes, e.g. Meloidogyne incognita etc.; local resistance in primary (infected) or secondary (uninfected) leaves; stress tolerance; winter survival; cold tolerance; salt tolerance; heavy metal tolerance, such as cadmium; tolerance to physical wounding; increased organelle tolerance to redox stress, such as in mitochondria, and chloroplasts; cell death; programmed cell death, including death of diseased tissue and during senescence; fruit drop; biomass; fresh and dry weight during any time in plant life, such as maturation; number of flowers, seeds, branches, and/or leaves; seed yield, including number, size, weight, and/or harvest index; fruit yield, including number, size, weight, and/or harvest index; plant development; time to fruit maturity; cell wall strengthening and reinforcement; plant product quality; paper making quality; food additives; treatment of indications modulated by free radicals; cancer; kinds of low molecular weight compounds such as phytoalexins; abundance of low molecular weight compounds such as phytoalexins; other phenotypes based on gene silencing.


To regulate any of the phenotype(s) above, activities of one or more of the disease responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and assayed, for example, in accordance to Alvarez et al., (1998) Cell 92: 773-784; Halhbrock and Scheel, (1989) Ann. Rev. Plant Physiol. Plant Mol. Biol. 40: 347-369; Lamb et al., (1997) Ann. Rev. Plant Mol. Biol. Plant Physiol. 48: 251-275; Lapwood et al. (1984) Plant Pathol. 33: 13-20; Levine et al. (1996) Curr. Biol. 6: 427-437; McKersie et al., (2000) Plant Physiol. 122: 1427-1437; Olson and Varner (1993) Plant J. 4: 887-892; Pastore et al., (2000), FEBS Lett 470: 88-92; Pastori et al., (1997) Plant Physiol. 113: 411-418; Romero-Puertas et al., (1999) Free Radic. Res. 1999 31 Suppl: S25-31; Shirataki et al., Anticancer Res 20: 423-426 (2000); Wu et al., (1995) Plant Cell 7: 1357-1368.


III.E.12.b. Use of Disease Responsive Genes, Gene Components and Products to Modulate Biochemical Activities


The activities of one or more of the disease responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations above and included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Resistance to Pathogens
Induction of ROS signaling
Wu et. al. (1995) Plant Cell 7:



pathways
1357-68



Modulation of nitric oxide
Delledonne et al. (1998) Nature



signaling
394: 585-588



Induction of PR proteins,
Chamnongpol et. al. (1998) Proc.



phytoalexins, and defense
Nat. Acad Sci USA 12; 95:



pathways
5818-23.




Davis et al. (1993)




Phytochemistry 32: 607-611



Induction of cellular
Chen et. al. Plant J. (1996)



protectant genes such as
10: 955-966



glutathione 5-transferase
Gadea et. al. (1999) Mol Gen



(GST) and ascorbate
Genet 262: 212-219



peroxidase
Wu et. al. (1995) Plant Cell 7:




1357-68



ROS levels following
Orozco-Cardenas and Ryan



wounding and changes in
(1999) Proc. Nat. Acad. Sci.



physical pressure
USA 25; 96: 6553-7.




Yahraus et al. (1995) Plant




Physiol. 109: 1259-1266



Salicyclic acid levels and
Durner and Klessig (1996)



signaling
J. Biol. Chem. 271: 28492-501


Responses to Wounding
Expression of genes Involved
Legendre et al. (1993) Plant



in wound repair and cell
Physiol. 102: 233-240



division



Responses to Environmental
Expression of genes involved
Shi et al. (2000) Proc. Natl.


Stress
in responses to drought, cold,
Acad. Sci. USA 97: 6896-6901



salt, heavy metals



Reinforcement of Cell Walls
Modulation of the Production
Bradley et al. (1992) Cell 70,



of ExtracTable Proline-Rich
21-30



Protein




Modulation of Lignification
Mansouri et al. (1999) Physiol.




Plant 106: 355-362


Programmed Cell Death
Induction of PCD activating
Levine et al. (1996) Curr. Biol.



genes
6: 427-437. Reynolds et. al.




(1998) Biochem. J. 330: 115-20



Suppression of PCD
Pennell and Lamb (1997) Plant



suppressing genes
Cell 9, 1157-1168









Other biological activities that can be modulated by the disease responsive genes and their products are listed in the Reference Table. Assays for detecting such biological activities are described in the Protein Domain table.


Disease responsive genes are characteristically differentially transcribed in response to fluctuating levels of disease. The MA_diff table(s) report(s) the changes in transcript levels of various disease responsive genes in the aerial parts of a plant 3 days after the plant was sprayed with a suspension of TMV relative to control plants sprayed with water.


The data from this experiment reveal a number of types of disease responsive genes and gene products, including “early responders,” and “delayed responders”. Profiles of individual disease responsive genes are shown in the Table below with examples of which associated biological activities are modulated when the activities of one or more such genes vary in plants.


















EXAMPLES OF


GENE
FUNCTIONAL

BIOCHEMICAL


EXPRESSION
CATEGORY
PHYSIOLOGICAL
ACTIVITY


LEVELS
OF GENE
CONSequence
OF GENE PRODUCTS







Upregulated
Early
ROS Perception and
Transcription factors,


transcripts
Responders to
Response
kinases, phosphatases, GTP-



Pathogens

binding proteins (G-





proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodeling proteins




Initiation of Gene
Glutathione S-transferase




Transcription
(GST),





heat shock proteins,





salicylic acid (SA) response





pathway proteins, jasmonate





response pathway proteins,





dehydrins, peroxidases,





catalases



Delayed
Initiation of Defence
Proteases, pathogen



Responders to
Gene Transcription
response (PR) proteins,



Pathogens

cellulases, chitinases,





cutinases, glucanases, other





degrading enzymes, calcium





channel blockers,





phenylalanine ammonia





lyase, proteins of defense





pathways, cell wall proteins





incuding proline rich





proteins and glycine rich





proteins, epoxide hydrolase,





methyl transferases




Activation of cell death
Transcription factors




pathways
kinases, phosphatases, DNA





surveillance proteins, p53,





proteases, endonucleases,





GTP-binding proteins (G-





proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins,





mitochondrial and





chloroplast energy related





proteins, ribosome





inactivating proteins




Initiation of Cellular
Reactive oxygen scavenging




Protectant Gene
enzymes, GST, catalase,




Transcription
peroxidase, ascorbate





oxidase


Downregulated
Early
Negative regulation of
Transcription factors,


transcripts
responders to
pathogen inducible
kinases, phosphatases, GTP-



pathogens
pathways released
binding proteins (G-





proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodelling proteins



Genes repressed
Negative regulation of
Transcription factors,



by TMV
ROS inducible
kinases, phosphatases, GTP-




pathways released
binding proteins (G-





proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodelling proteins



Delayed
Negative regulation of
Transcription factors,



Responders to
pathogen inducible
kinases, phosphatases, GTP-



Pathogens
pathways released
binding proteins (G-





proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodelling proteins



Genes repressed
Negative regulation of
Transcription factors,



by TMV
genes suppressing
kinases, phosphatases, GTP-




programmed cell death
binding proteins (G-




released
proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodelling proteins









Use of Promoters of Disease Responsive Genes

Promoters of Disease responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Disease responsive genes where the desired sequence is operably linked to a promoter of a Disease responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


II.E.13. Defense (LOL2) Responsive Genes, Gene Components and Products


Often growth and yield are limited by the ability of a plant to tolerate stress conditions, including pathogen attack. To combat such conditions, plant cells deploy a battery of inducible defense responses, including the triggering of an oxidative burst and the transcription of pathogenesis-related protein (PR protein) genes. Reactive oxygen species (ROS) such as H2O2 and NO from the oxidative burst play a signaling role, including initiation of the hypersensitive response (HR) and induction of systemic acquired resistance (SAR) to secondary infection by unrelated pathogens. Some PR proteins are able to degrade the cell walls of invading microorganisms, and phytoalexins are directly microbicidal. Other defense related pathways are regulated by salicylic acid (SA) or methyl jasmonate (MeJ).


These responses depend on the recognition of a microbial avirulence gene product (avr) by a plant resistance gene product (R), and a series of downstream signaling events leading to transcription-independent and transcription-dependent disease resistance responses. Current models suggest that R-gene-encoded receptors specifically interact with pathogen-encoded ligands to trigger a signal transduction cascade. Several components include ndr1 and eds1 loci. NDR1, EDS1, PR1, as well as PDF1.2, a MeJ regulated gene and Nim1, a SA regulated gene, are differentially regulated in plants with mutations in the LOL2 gene.


LOL2 shares a novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to an alternative splice site the LOL2 gene encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains. Modulation in this gene can also confer enhanced resistance to virulent and avirulent Peronospora parasitica isolates


Examples of LOL2 responsive genes and gene products are shown in the Reference, Sequence, Protein Group, Protein Group Matrix, MA_diff and MA_clust tables. These genes and/or products are responsible for effects on traits such as plant vigor, disease resistance, and seed yield. The genes were discovered and characterized from a much larger set by microarray experiments designed to find genes whose mRNA products changed when the LOL2 gene was mutated in plants.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing some about 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in plants with the LOL2 mutation versus wildtype were obtained. Specifically, the plant line lol-2-2 tested, a loss of function mutation. The ESTs were compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones identified. The MA_diff table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which represent LOL2 responsive genes.


Manipulation of one or more LOL2 responsive gene activities is useful to modulate the biological processes and/or phenotypes listed below. LOL2 responsive genes and gene products can act alone or in combination. Useful combinations include LOL2 responsive genes and/or gene products with similar transcription profiles, similar biological activities, or members of the same or functionally related biochemical pathways. Whole pathways or segments of pathways are controlled by transcription factor proteins and proteins controlling the activity of signal transduction pathways. Therefore, manipulation of such protein levels is especially useful for altering phenotypes and biochemical activities of plants.


Such LOL2 responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in active LOL2 gene or in the absence. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: lol2 (relating to SMD 8031, SMD 8032)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Defense genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Defense Genes Identified by Cluster Analyses of Differential Expression


Defense Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Defense genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID lol2 (relating to SMD 8031, SMD 8032) of the MA_diff table(s).


Defense Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Defense genes. A group in the MA_clust is considered a Defense pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Defense Genes Identified by Amino Acid Sequence Similarity


Defense genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Defense genes. Groups of Defense genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Defense pathway or network is a group of proteins that also exhibits Defense functions/utilities.


Further, promoters of LOL2 responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by LOL2 responsive genes or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the LOL2 responsive genes when the desired sequence is operably linked to a promoter of a LOL2 responsive gene.


III.E.12.a. Use of Lol2 Responsive Genes, Gene Components and Products to Modulate Phenotypes


LOL2 responsive genes and gene products are useful to or modulate one or more phenotypes including pathogen tolerance and/or resistance; Avr/r locus interactions; Non-Host interactions; HR; SAR, e.g., disease responsive genes acting in conjunction with infection with any of the organisms listed below; resistance to bacteria e.g. to Erwinia stewartii, Pseudomonas syringae, Pseudomonas tabaci, Stuart's wilt, etc.; resistance to fungi e.g. to downy mildews such as Scleropthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora sacchari, Peronosclerospora maydis; rusts such as Puccinia sorphi, Puccinia polysora, Physopella zeae, etc.; and to other fungal diseases e.g. Cercospora zeae-maydis, Colletotrichum graminicola, Fusarium monoliforme, Exserohilum turcicum, Bipolaris maydis, Phytophthora parasitica, Peronospora tabacina, Septoria, etc.; resistance to viruses or viroids e.g. to tobacco or cucumber mosaic virus, ringspot virus, necrosis virus, pelargonium leaf curl virus, red clover mottle virus, tomato bushy stunt virus, and like viruses; resistance to insects, such as to aphids e.g. Myzus persicae; to beetles and beetle larvae; to lepidoptera larvae, e.g. Heliothus etc.; resistance to nematodes, e.g. Meloidogyne incognita etc.; local resistance in primary (infected) or secondary (uninfected) leaves; stress tolerance; winter survival; cold tolerance; salt tolerance, heavy metal tolerance, such as cadmium; tolerance to physical wounding; increased organelle tolerance to redox stress, such as in mitochondria, and chloroplasts; cell death; programmed cell death, including death of diseased tissue and during senescence; fruit drop; biomass; fresh and dry weight during any time in plant life, such as maturation; number of flowers, seeds, branches, and/or leaves; seed yield, including number, size, weight, and/or harvest index; fruit yield, including number, size, weight, and/or harvest index; plant development; time to fruit maturity; cell wall strengthening and reinforcement; plant product quality; paper making quality; food additives; treatment of indications modulated by free radicals; cancer; kinds of low molecular weight compounds such as phytoalexins; abundance of low molecular weight compounds such as phytoalexins; and other phenotypes based on gene silencing.


To regulate any of the phenotype(s) above, activities of one or more of the LOL2 responsive genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and assayed, for example, in accordance to Alvarez et al., (1998) Cell 92: 773-784; Halhbrock and Scheel, (1989) Ann. Rev. Plant Physiol. Plant Mol. Biol. 40: 347-369; Lamb et al., (1997) Ann. Rev. Plant Mol. Biol. Plant Physiol. 48: 251-275; Lapwood et al. (1984) Plant Pathol. 33: 13-20; Levine et al. (1996) Curr. Biol. 6: 427-437; McKersie et al., (2000) Plant Physiol. 122: 1427-1437; Olson and Varner (1993) Plant J. 4: 887-892; Pastore et al., (2000), FEBS Lett 470: 88-92; Pastori et al., (1997) Plant Physiol. 113: 411-418; Romero-Puertas et al., (1999) Free Radic. Res. 1999 31 Suppl: S25-31; Shirataki et al., Anticancer Res 20: 423-426 (2000); Wu et al., (1995) Plant Cell 7: 1357-1368.


III.E.12.b. Use of Defense Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the defense (LOL2) responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities are documented and can be measured according to the citations above and included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Resistance To Pathogens
Induction Of ROS Signaling
Wu et. al. (1995) Plant Cell 7:



Pathways
1357-68



Modulation Of Nitric Oxide
Delledonne et al. (1998) Nature



Signaling
394: 585-588



Induction Of PR Proteins,
Chamnongpol et. al. (1998) Proc.



Phytoalexins, And Defense
Nat. Acad Sci USA 12; 95: 5818-23.



Pathways
Davis et al. (1993) Phytochemistry




32: 607-611



Induction Of Cellular
Chen et. al. Plant J. (1996) 10: 955-



Protectant Genes Such As
966



Glutathione S-Transferase
Gadea et. al. (1999) Mol Gen Genet



(GST) And Ascorbate
262: 212-219



Peroxidase
Wu et. al. (1995) Plant Cell




7: 1357-68



ROS Levels Following
Orozco-Cardenas and Ryan (1999)



Wounding And Changes In
Proc. Nat. Acad. Sci. USA



Physical Pressure
25; 96: 6553-7.




Yahraus et al. (1995) Plant




Physiol. 109: 1259-1266



Salicyclic Acid Levels And
Durner and Klessig (1996)



Signaling
J. Biol. Chem. 271: 28492-501


Responses To Wounding
Expression Of Genes Involved
Legendre et al. (1993) Plant



In Wound Repair And Cell
Physiol. 102: 233-240



Division



Responses To
Expression Of Genes Involved
Shi et al. (2000) Proc. Natl. Acad.


Environmental Stress
In Responses To Drought,
Sci. USA 97: 6896-6901



Cold, Salt, Heavy Metals



Reinforcement Of Cell
Modulation Of The Production
Bradley et al. (1992) Cell 70,


Walls
Of ExtracTable Proline-Rich
21-30



Protein




Modulation Of Lignification
Mansouri et al. (1999) Physiol.




Plant 106: 355-362


Programmed Cell Death
Induction Of Pcd Activating
Levine et al. (1996) Curr. Biol. 6:



Genes
427-437. Reynolds et. al. (1998)




Biochem. J. 330: 115-20



Suppression Of PCD
Pennell and Lamb (1997) Plant



Suppressing Genes
Cell 9, 1157-1168









Other biological activities that can be modulated by the LOL2 responsive genes and their products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


LOL2 responsive genes are characteristically differentially transcribed in response to fluctuating levels of disease. MA_diff table reports the changes in transcript levels of various LOL2 responsive genes in the lol-2 line versus control plants.


The data from this experiment reveal a number of types of LOL2 responsive genes and gene products. Profiles of individual LOL2 responsive genes are shown in the Table below with examples of which associated biological activities are modulated when the activities of one or more such genes vary in plants.


















EXAMPLES OF


GENE
FUNCTIONAL

BIOCHEMICAL


EXPRESSION
CATEGORY
PHYSIOLOGICAL
ACTIVITY


LEVELS
OF GENE
CONSequence
OF GENE PRODUCTS







Upregulated
Early
ROS Perception and
Transcription factors,


transcripts
Responders to
Response
kinases, phosphatases, GTP-



the LOL2

binding proteins (G-



Mutation

proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodeling proteins




Initiation of Gene
Glutathione S-transferase




Transcription
(GST),





heat shock proteins,





salicylic acid (SA) response





pathway proteins, jasmonate





response pathway proteins,





dehydrins, peroxidases,





catalases



Delayed
Initiation of Defence
Proteases, pathogen



Responders to
Gene Transcription
response (PR) proteins,



the LOL2

cellulases, chitinases,



Mutation

cutinases, glucanases, other





degrading enzymes, calcium





channel blockers,





phenylalanine ammonia





lyase, proteins of defense





pathways, cell wall proteins





incuding proline rich





proteins and glycine rich





proteins, epoxide hydrolase,





methyl transferases




Activation of cell death
Transcription factors




pathways
kinases, phosphatases, DNA





surveillance proteins, p53,





proteases, endonucleases,





GTP-binding proteins (G-





proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins,





mitochondrial and





chloroplast energy related





proteins, ribosome





inactivating proteins




Initiation of Cellular
Reactive oxygen scavenging




Protectant Gene
enzymes, GST, catalase,




Transcription
peroxidase, ascorbate





oxidase


Downregulated
Early
Negative regulation of
Transcription factors,


transcripts
Responders to
LOL2 Mutation
kinases, phosphatases, GTP-



the LOL2
inducible pathways
binding proteins (G-



Mutation
released
proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodelling proteins



Genes
Negative regulation of
Transcription factors,



Repressed by
ROS inducible
kinases, phosphatases, GTP-



the LOL2
pathways released
binding proteins (G-



Mutation

proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodelling proteins



Delayed
Negative regulation of
Transcription factors,



Responders to
LOL2 Mutation
kinases, phosphatases, GTP-



the LOL2
inducible pathways
binding proteins (G-



Mutation
released
proteins), leucine rich repeat





proteins (LRRs),





transporters, calcium





binding proteins, chromatin





remodelling proteins



Genes
Negative Regulation
Transcription Factors,



Repressed By
Of Genes Suppressing
Kinases, Phosphatases,



The LOL2
Programmed Cell
GTP-Binding Proteins (G-



Mutation
Death Released
Proteins), Leucine Rich





Repeat Proteins (Lrrs),





Transporters, Calcium





Binding Proteins,





Chromatin Remodelling





Proteins









Use of Promoters of Defense Responsive Genes

Promoters of Defense responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Defense responsive genes where the desired sequence is operably linked to a promoter of a Defense responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.E.14. Iron Responsive Genes, Gene Components and Products


Iron (Fe) deficiency in humans is the most prevalent nutritional problem worldwide today. Increasing iron availability via diet is a sustainable malnutrition solution for many of the world's nations. One-third of the world's soils, however, are iron deficient. Consequently, to form a food-based solution to iron malnutrition, we need a better understanding of iron uptake, storage and utilization by plants. Furthermore, exposure to non-toxic Fe levels appears to affect inherent plant defense mechanisms. Consequently, exploring the effects of Fe exposure has potential for advances in plant disease resistance in addition to human nutrition.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by simultaneously hybridizing two differentially labeled fluorescent FeNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing 10,000 non-redundant ESTs, selected from 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases over the controls were identified, compared to the Ceres full length FeNA and genomic sequence databanks, and identical Ceres clones identified. MA_diff table reports the results of this analysis, indicating those Ceres clones that are up or down regulated over controls, thereby indicating the Ceres clones which are iron responsive genes.


The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Iron (relating to SMD 7114, SMD 7115, SMD 7125)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Iron genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Iron Genes Identified by Cluster Analyses of Differential Expression


Iron Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Iron genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Iron (relating to SMD 7114, SMD 7115, SMD 7125) of the MA_diff table(s).


Iron Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Iron genes. A group in the MA_clust is considered a Iron pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Iron Genes Identified by Amino Acid Sequence Similarity


Iron genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Iron genes. Groups of Iron genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Iron pathway or network is a group of proteins that also exhibits Iron functions/utilities.


III.E.14.a. Use of Iron Responsive Genes to Modulate Phenotypes


Iron responsive genes and gene products are useful to or modulate one or more phenotypes including growth; roots; root hair formation; stems, leaves; development; senescence; plant nutrition; uptake and assimilation of organic compounds; uptake and assimilation of inorganic compounds; animal (including human) nutrition; improved dietary mineral nutrition; stress response metabolic detoxification; and heavy metals.


To improve any of the phenotype(s) above, activities of one or more of the iron responsive genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Schmidt et al. (2000, Plant Physiol 122:1109-18), Meagher (2000) Current Opinion in Plant Biology 3: 153-62), Deak (1999, Nature Biotechnology (1999, Nature Biotechnology 17: 192-96), Wei and Theil (2000, J. Biol Chem 275: 17488-93) and Vansuyt et al. (1997, FEBS Letters 410: 195-200).


III.E.14.b. Use of Iron-Responsive Genes, Gene Components and Products to Modulate Biochemical Activities


The activities of one or more of the iron responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC




ACTIVITIES
CITATIONS


PROCESS
AND/OR PATHWAYS
INCLUDING ASSAYS







Growth,
Root Growth
Robinson et al. (1999)


Differentiation
Initiation of root
Nature 397: 694-97


and Development
hairs



Metabolisms
Iron sensing
Thomine et al. (2000)




PNAS USA 97: 4991-6



Iron uptake and transport
Thomine et al. (2000)



decreased iron
PNAS USA 97: 4991-6



transport
Zhu (1999) Plant



phytoremediation
Physiol 119: 73-79


Plant Defenses
Protection from oxidative
Deak (1999) Nature



damage
Biotechnology 17: 192-6


Signaling
Specific gene
Brand and Perrimon



transcription gene
(1993) Development



silencing
118: 401-415









Other biological activities that can be modulated by the iron responsive genes and gene products are listed in the REFERENCE Table. Assays for detecting such biological activities are described in the Protein Domain table.


Iron responsive genes are characteristically differentially transcribed in response to fluctuating iron levels or concentrations, whether internal or external to an organism or cell. MA_diff table reports the changes in transcript levels of various iron responsive genes.


The microarray comparison consists of probes prepared from root RNA of A. thaliana (Columbia) seedlings grown under iron-sufficient conditions and seedlings grown under iron-deficient. The data from this experiment reveal a number of types genes and gene products. Profiles of these different iron responsive genes are shown in the Table below with examples of associated biological activities.


















EXAMPLES OF


TRANSCRIPT
TYPE OF
PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
GENES
CONSEQUENCES
ACTIVITY







Up regulated
responders
Iron perception
Transporters


transcripts
to iron
Iron uptake and
Metabolic



application
transport
enzymes




Iron metabolism
Change in cell




Synthesis of
membrane




secondary
structure and




metabolites
potential




and/or proteins
Kinases and




Modulation of
phosphatases




iron response
Transcription




transduction
activators




pathways
Change in




Specific gene
chromatin




transcription
structure and/or




initiation
localized DNA





topology


Down-
responder to
Negative
Transcription


regulated
iron repressors
regulation of iron
factors


transcripts
of iron state of
pathways
Change in protein



metabolism
Changes in
structure by



Genes with
pathways and
phosphorylation



discontinued
processes
(kinases) or



expression or
operating in cells
dephosphoryaltion



unsTable
Changes in other
(phosphatases)



mRNA in
metabolisms than
Change in



presence of
iron
chromatin



iron

structure and/or





DNA topology





Stability of





factors for protein





synthesis and





degradation





Metabolic enzymes









Use of Promoters of Iron Responsive Genes

Promoters of Iron responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Iron responsive genes where the desired sequence is operably linked to a promoter of a Iron responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.E.15. Shade Responsive Genes, Gene Components and Products


Plants sense the ratio of Red (R):Far Red (FR) light in their environment and respond differently to particular ratios. A low R:FR ratio, for example, enhances cell elongation and favors flowering over leaf production. The changes in R:FR ratios mimic and cause the shading response effects in plants. The response of a plant to shade in the canopy structures of agricultural crop fields influences crop yields significantly. Therefore manipulation of genes regulating the shade avoidance responses can improve crop yields. While phytochromes mediate the shade avoidance response, the down-stream factors participating in this pathway are largely unknown. One potential downstream participant, ATHB-2, is a member of the HD-Zip class of transcription factors and shows a strong and rapid response to changes in the R:FR ratio. ATHB-2 overexpressors have a thinner root mass, smaller and fewer leaves and longer hypocotyls and petioles. This elongation arises from longer epidermal and cortical cells, and a decrease in secondary vascular tissues, paralleling the changes observed in wild-type seedlings grown under conditions simulating canopy shade. On the other hand, plants with reduced ATHB-2 expression have a thick root mass and many larger leaves and shorter hypocotyls and petioles. Here, the changes in the hypocotyl result from shorter epidermal and cortical cells and increased proliferation of vascular tissue. Interestingly, application of Auxin is able to reverse the root phenotypic consequences of high ATHB-2 levels, restoring the wild-type phenotype. Consequently, given that ATHB-2 is tightly regulated by phytochrome, these data suggest that ATHB-2 may link the Auxin and phytochrome pathways in the shade avoidance response pathway.


Changes in R:FR ratios promote changes in gene expression. Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by hybridizing labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The US Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing about 10,000 non-redundant ESTs, selected from about 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases in plants given 4 hours of FR rich light after growth in high R:FR light compared with the controls of plants grown in high R:FR light only, were identified, compared to the Ceres full length cDNA and genomic sequence databanks, and equivalent Ceres clones identified. The MA_diff table(s) report(s) the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which are shade avoidance responsive genes.


Examples of far red light induced, shade avoidance responsive genes and gene products are shown in the Reference and Sequence Tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield.


While far red light, shade avoidance responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different shade avoidance responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. In addition, the combination of a shade avoidance responsive polynucleotide and/or gene product with another environmentally responsive polynucleotides is also useful because of the interactions that exist between hormone-regulated pathways, stress and pathogen induced pathways, nutritional pathways, light induced pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in common or overlapping pathways.


Such far red light induced shade avoidance responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either in response to changes in far red light or in the absence of far red light fluctuations. The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Shade (relating to SMD 8130, SMD 7230)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Shade genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Shade Genes Identified by Cluster Analyses of Differential Expression


Shade Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Shade genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Shade (relating to SMD 8130, SMD 7230) of the MA_diff table(s).


Shade Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Shade genes. A group in the MA_clust is considered a Shade pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Shade Genes Identified by Amino Acid Sequence Similarity


Shade genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Shade genes. Groups of Shade genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Shade pathway or network is a group of proteins that also exhibits Shade functions/utilities.


Further, promoters of shade avoidance responsive genes, as described in the Reference tables, for example, are useful to modulate transcription that is induced by shade avoidance or any of the following phenotypes or biological activities below. Further, any desired sequence can be transcribed in similar temporal, tissue, or environmentally specific patterns as the shade avoidance responsive genes when the desired sequence is operably linked to a promoter of a circadian (clock) responsive gene.


III.E.15.a. Use of Far Red Responsive, Shade Avoidance Response Genes to Modulate Phenotypes


High FR:R, shade avoidance responsive genes and gene products can be used to alter or modulate one or more phenotypes including growth; roots; elongation; lateral root formation; stems; elongation; expansion; leaves; expansion; carotenoid composition; development; cell; photosynthetic apparatus; efficiency; flower; flowering time; fruit; seed; dormancy; control rate and timing of germination; prolongs seed storage and viability; inhibition of hydrolytic enzyme synthesis; seed and fruit yield; senescence; abscission; leaf fall; flower longevity; differentiation; vascularization; and shade (avoidance) responses in plant architecture.


To regulate any of the phenotype(s) above, activities of one or more of the High FR: R light, shade avoidance responsive genes or gene products can be modulated and the plants tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and/or screened for variants as in Winkler et al. (1998) Plant Physiol 118: 743-50 and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Carabelli et al. (1996, PNAS USA 93: 3530-3535), Aguirrezabal and Tardieu (1996, J Exp Bot 47: 411-20), Heyer et al. (1995, Plant Physiol 109: 53-61), Garcia-Plazaola et al. (1997, J Exp Bot 48: 1667-74), Schwanz et al. (1996, J Exp Bot 47L 1941-50), Koehne et al. (1999, Biochem Biophys Acta 1412:94-107), Melis (1984, J Cell Biochem 24: 271-85), Steindeler et al. (1999, Development 126: 4235-45), Cruz (1997, J Exp Bot 48: 15-24), Stephanou and Manetas (1997, J Exp Bot 48: 1977-85), Grammatikopoulos et al (1999, J Exp Bot 50:517-21), Krause et al. (1999, Plant Physiol 121: 1349-58), Aukerman et al. (1997, Plant Cell 9: 1317-26), Wagner et al. (1997, Plant Cell 9: 731-43), Weinig (2000) Evolution Int J Org Evolution 54: 124-26), Cocburn et al. (1996, J Exp Bot 47: 647-53), Devlin et al. (1999, Plant Physiol 119: 909-15), Devlin et al. (1998, Plant Cell 10: 1479-87), Finlayson et al. (1998, Plant Physiol 116: 17-25), Morelli and Ruberti (2000, Plant Physiol 122: 621-26), Aphalo et al. (1999, J Exp Bot 50: 1629-34), Sims et al. (1999, J Exp Bot 50: 50: 645-53) and Ballare (1999, Trends Plant Sci 4: 97-102).


III.E.15.b. Use of Far Red Light, Shade Avoidance Responsive Genes to Modulate Biochemical Activities


The activities of one or more of the far red light, shade avoidance responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC



ACTIVITIES AND/OR
CITATIONS INCLUDING


PROCESS
PATHWAYS
ASSAYS







Cell Growth and
Cell Elongation
Carabelli et al. (1996) PNAS USA


Differentiation

93: 3530-35



Leaf Expansion
Heyer et al. (1995) Plant Physiol




109: 53-61


Photosynthesis
Development of
Jagtap et al. (1998) J Exp Bot 49:



Photosynthetic Apparatus
1715-21




Melis (1984) J Cell Biochem 24:




271-285




McCain (1995) Biophys J 69: 1105-10



Carotenoid Composition
Garcia-Plazaola et al (1997) J Exp




Bot 48: 1667-74


Carbon/Nitrogen
Carbon and Nitrogen
Cruz (1997) J Exp Bot 48: 15-24


Metabolism
Assimilation


Far red light, shade

Newton AL, Sharpe BK, Kwan A,


avoidance response

Mackay JP, Crossley M. J Biol


binding by transcription

Chem. 2000May19; 275(20): 15128-34;


factors

Lopez Ribera I, Ruiz-Avila L,




Puigdomenech P. Biochem Biophys




Res Commun. 1997 Jul




18; 236(2): 510-6; de Pater S, Greco V,




Pham K, Memelink J, Kijne J.




Nucleic Acids Res. 1996 Dec 1;




24(23): 4624-31.


Signaling
UV Light Perception
Stephanou and Manetas (1997) J




Exp Bot 48: 1977-85



Far-red/Red Light
Aukerman et al. (1997) Plant Cell



Perception
9: 1317-26




Wagner et al. (1997) Plant Cell 9:




731-43



Interaction of “Shade
Finlayson et al. (1998) Plant



Factor” with Ethylene
Physiol 116: 17-25



Production/Transduction



Interaction of “Shade
Reed et al. (1998) Plant Physiol



Factor” with Auxin
118: 1369-78



Production/Transduction



Plant to Plant signalling
Sims et al. (1999) J Exp Bot 50:




645-53









Other biological activities that can be modulated by shade avoidance response genes and their products are listed in the REF TABLES. Assays for detecting such biological activities are described in the Protein Domain table.


High FR:R, shade avoidance responsive genes are differentially transcribed in response to high FR:R ratios. The microarray comparison to reveal such genes consisted of probes prepared from RNA isolated from the aerial tissues of A. thaliana (Columbia) two-week old seedlings grown in high R:FR ratios compared to seedlings grown in high R:FR ratios followed by 4 hours of FR-rich light treatment. The data from this experiment reveal a number of types genes and gene products and examples of the classes of genes are given in the Table below.


















EXAMPLES OF


TRANSCRIPT

PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
TYPE OF GENES
CONSEQUENCES
ACTIVITY







Up regulated
Responders to high
Far red light
Transporters


transcripts
FR:R light ratios
perception
Metabolic enzymes



Genes induced by
Metabolism
Change in cell



high FR:R light ratio
affected by far red
membrane structure




light
and potential




Synthesis of
Kinases and




secondary
phosphatases




metabolites and/or
Transcription




proteins
activators




Modulation of
Change in chromatin




high FR:R light
structure and/or




ratio transduction
localized DNA




pathways
topology




Specific gene
Leaf production




transcription
factors




initiation


Down-regulated
Responders to high
Changes in
Transcription factors


transcripts
FR:R light ratios
pathways and
Change in protein



Genes repressed by
processes
structure by



high FR:R light ratio
operating in cells
phosphorylation



Genes with
Changes in
(kinases) or



discontinued
metabolisms other
dephosphorylation



expression or
than far red
(phosphatases)



unsTable mRNA
stimulated
Change in chromatin



during high FR:R
pathways
structure and/or DNA



ratio light

topology





Stability of factors for





protein synthesis and





degradation





Metabolic enzymes





Cell elongation factors





Flowering promotion





factors









Use of Promoters of Shade Avoidance Genes

Promoters of Shade Avoidance genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Shade Avoidance genes where the desired sequence is operably linked to a promoter of a Shade Avoidance gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.E.16. Sulfur Responsive Genes, Gene Components and Products


Sulfur is one of the important macronutrients required by plants. It is taken up from the soil solution by roots as in the form of sulfate anion which higher plants are dependent on to fulfill their nutritional sulfur requirement. After uptake from the soil, sulfate is either accumulated and stored in vacuole or it is assimilated into various organic compounds, e.g. cysteine, glutathione, methionine, etc. Thus, plants also serve as nutritional sulfur sources for animals. Sulfur can be assimilated in one of two ways: it is either incorporated as sulfate in a reaction called sulfation, or it is first reduced to sulfide, the substrate for cysteine synthesis. In plants, majority of sulfur is assimilated in reduced form.


Sulfur comprises a small by vital fraction of the atoms in many protein molecules. As disulfide bridges, the sulfur atoms aid in stabilizing the folded proteins, such cysteine residues. Cys is the first sulfur-containing amino acids, which in proteins form disulfide bonds that may affect the tertiary structures and enzyme activities. This redox balance is mediated by the disulfide/thiol interchange of thioredoxin or glutaredoxin using NADPH as an electron donor. Sulfur can also become sulfhydryl (SH) groups participating in the active sites of some enzymes and some enzymes require the aid of small molecules that contain sulfur. In addition, the machinery of photosynthesis includes some sulfur-containing compounds, such as ferrodoxin. Thus, sulfate assimilation plays important roles not only in the sulfur nutrition but also in the ubiquitous process that may regulate the biochemical reactions of various metabolic pathways.


Deficiency of sulfur leads to a marked chlorosis in younger leaves, which may become white in color. Other symptoms of sulfur deficiency also include weak stems and reduced growth. Adding sulfur fertilizer to plants can increase root development and a deeper green color of the leaves in sulfur-deficient plants. However, Sulfur is generally sufficient in soils for two reasons: it is a contaminant in potassium and other fertilizers and a product of industrial combustion. Sulfur limitation in plants is thus likely due to the limitation of the uptake and distribution of sulfate in plants. Seven cell type specific sulfate transporter genes have been isolated from Arabidopsis. In sulfate-starved plants, expression of the high-affinity transporter, AtST1-1, is induced in root epidermis and cortex for acquisition of sulfur. The low affinity transporter, AtST2-1 (AST68), accumulates in the root vascular tissue by sulfate starvation for root-to-shoot transport of sulfate. These studies have shown that the whole-plant process of sulfate transport is coordinately regulated by the expression of these 2 sulfate transporter genes under sulfur limited conditions. Recent studies have proposed that feeding of O-acetylserine, GSH and selenate may regulate the expression of AtST1-1 and AtST2-1 (AST68) in roots either positively or negatively. However, regulatory proteins that may directly control the expression of these genes have not been identified yet.


It has been established that there are regulatory interactions between assimilatory sulfate and nitrate reduction in plants. The two assimilatory pathways are very similar and well coordinated; deficiency for one element was shown to repress the other pathway. The coordination between them should be taken into consideration when one tries to alter one of pathways.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by simultaneously hybridizing two differentially labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing 10,000 non-redundant ESTs, selected from 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases over the controls were identified, compared to the Ceres full-length cDNA and genomic sequence databanks, and identical Ceres clones identified. MA_diff table reports the results of this analysis, indicating those Ceres clones which are up or down regulated over controls, thereby indicating the Ceres clones which are sulfur response responsive genes.


The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Sulfur (relating to SMD 8034, SMD 8035)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Sulfur genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Sulfur Genes Identified by Cluster Analyses of Differential Expression


Sulfur Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Sulfur genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Sulfur (relating to SMD 8034, SMD 8035) of the MA_diff table(s).


Sulfur Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Sulfur genes. A group in the MA_clust is considered a Sulfur pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Sulfur Genes Identified by Amino Acid Sequence Similarity


Sulfur genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Sulfur genes. Groups of Sulfur genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Sulfur pathway or network is a group of proteins that also exhibits Sulfur functions/utilities.


III.E.16.a. Use of Sulfur Responsive Genes to Modulate Phenotypes


Sulfur responsive genes and gene products are useful to or modulate one or more phenotypes including growth; roots; stems; leaves; development; chloroplasts and mitochondria; fruit development; seed development; seed storage proteins; senescence; differentiation; plastid/chloroplast and mitochondria differentiation; protection against oxidative damage; regulation of enzymes via redox control by thiol groups; metabolic detoxification; photosynthesis; and carbon dioxide fixation.


To improve any of the phenotype(s) above, activities of one or more of the sulfur responsive genes or gene products can be modulated and tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed. As an example, a plant can be transformed according to Bechtold and Pelletier (1998, Methods. Mol. Biol. 82:259-266) and visually inspected for the desired phenotype or metabolically and/or functionally assayed according to Saito et al. (1994, Plant Physiol. 106: 887-95), Takahashi et al (1997, Proc. Natl. Acad. Sci. USA 94: 11102-07) and Koprivova et al. (2000, Plant Physiol. 122: 737-46).


III.E.16.b. Use of Sulfur-Responsive Genes, Gene Components and Products to Modulate Biochemical Activities


The activities of one or more of the sulfur responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC ACTIVITIES
CITATIONS INCLUDING


PROCESS
AND/OR PATHWAYS
ASSAYS







Growth,
Root
Klein and Klein (1988) Mineral


Differentiation and
Leaf
Nutrition, In CM Wilson and J Gregory,


Development
Stem
eds Fundamentals of



Chloroplast/Mitochondria
Plant Science. Harper and Row



development/differentiation
Publishers, Inc., NY, p163




Rost et al. (1984) The Absorption




and Transport System, In R Bem,




ed, Botany-A Brief Introduction to




Plant Biology. John Wiley and




Sons, NY, p96.




Huluigue et al. (2000) Biochem




Biophys Res Commun 271: 380-5




Kapazoglou et al. (2000) Eur J




Biochem 267: 352-60



Seed storage protein
Kim et al. (1999) 209: 282-9



synthesis


Metabolisms
Sulfate uptake and transport
Takahashi et al. (1997) Proc Natl




Acad Sci USA 94: 11102-07



Cysteine Biosynthesis
Saito et al. (1992) Proc Natl Acad




Sci USA 89: 8078-82




Hesse et al. (1999) Amino Acids




16: 113-31



Methionine biosynthesis
Bourgis et al. (1999) Plant Cell 11:




1485-98



Carbon dioxide fixation in
Buchana (1991) Arch Biochem



photosynthesis
Biophys 288: 1-9



Thioredoxin reduction
Leustek and Saito (1999) Plant




Phyiol 120: 637-43




Mamedova et al. (1999) FEBS




Lett 462: 421-4



Nitrogen metabolism
Koprivova et al. (2000) Plant




Physiol. 122: 737-46




Yamaguchi et al. (1999) Biosci




Biotechnol Biochem 63: 762-6


Plant Defenses
Reduction of oxidative
May et al. (1998) J Expt Bio 49:



stress - oxygen metabolism
649-67



and reactive oxygen species
Kreuz et al. (1996) Plant Physiol



Detoxification of toxins,
111: 349-53



xenobiotics and heavy
Zhao et al. (1998) Plant Cell 10:



metals
359-70



Defense against pathogens
Kyung and Fleming (1997) J Food



or microbes
Prot 60: 67-71



Disease prevention by
Fahey et al. (1997) Proc Natl Acad



secondary sulfur-containing
Sci USA 94: 10367-72



compounds



Activation of kinases and
Davis et al. (1999) Plant Cell 11:



phosphatases
1179-90









Other biological activities that can be modulated by the sulfur responsive genes and gene products are listed in the REFERENCE Table. Assays for detecting such biological activities are described in the Protein Domain table.


Sulfur responsive genes are characteristically differentially transcribed in response to fluctuating sulfur levels or concentrations, whether internal or external to an organism or cell. MA_diff table reports the changes in transcript levels of various sulfur responsive genes.


Profiles of these different sulfur responsive genes are shown in the Table below with examples of associated biological activities.


















EXAMPLES OF


TRANSCRIPT

PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
TYPE OF GENES
CONSEQUENCES
ACTIVITY







Up regulated
Responders to sulfur
Sulfur perception
Transporters


transcripts
Application
Sulfur uptake and
Metabolic enzymes




transport
Change in cell




Sulfur metabolism
membrane structure




Synthesis of
and potential




secondary
Kinases and




metabolites and/or
phosphatases




proteins
Transcription




Modulation of
activators




sulfur response
Change in chromatin




transduction
structure and/or




pathways
localized DNA




Specific gene
topology




transcription
Redox control




initiation


Down-regulated
responder to sulfur
Negative
Transcription factors


transcripts
repressors of sulfur
regulation of
Change in protein



state of metabolism
sulfur pathways
structure by



Genes with
Changes in
phosphorylation



discontinued
pathways and
(kinases) or



expression or
processes
dephosphoryaltion



unsTable mRNA in
operating in cells
(phosphatases)



presence of sulfur
Changes in other
Change in chromatin




metabolisms than
structure and/or DNA




sulfur
topology





Stability of factors for





protein synthesis and





degradation





Metabolic enzymes









Use of Promoters of Sulfur Responsive Genes

Promoters of Sulfur responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Sulfur responsive genes where the desired sequence is operably linked to a promoter of a Sulfur responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


III.E.17. Zinc Responsive Genes, Gene Components and Products


Phytoremediation of soils contaminated with toxic levels of heavy metals requires the understanding of plant metal transport and tolerance. The numerous Arabidopsis thaliana studies have given scientists the potential for dissection and elucidation of plant micronutrient/heavy metal uptake and accumulation pathways. It has been shown altered regulation of ZNT1, a Zn/Cd transporter, contributes to high Zn uptake. Isolation and characterization of Zn/Cd hyperaccumulation genes may allow expression in higher biomass plant species for efficient contaminated soil clean up. Identification of additional Zn transport, tolerance and nutrition-related genes involved in heavy metal accumulation will enable manipulation of increased uptake (for phytoremediation) as well as limitation of uptake or leak pathways that contribute to toxicity in crop plants. Additionally, Zn-binding ligands involved in Zn homeostasis or tolerance may be identified, as well as factors affecting the activity or expression of Zn binding transcription factors. Gene products acting in concert to effect Zn uptake, which would not have been identified in complementation experiments, including multimeric transporter proteins, could also be identified.


Microarray technology allows monitoring of gene expression levels for thousands of genes in a single experiment. This is achieved by simultaneously hybridizing two differentially labeled fluorescent cDNA pools to glass slides that contain spots of DNA (Schena et al. (1995) Science 270: 467-70). The Arabidopsis Functional Genomics Consortium (AFGC) has recently made public the results from such microarray experiments conducted with AFGC chips containing 10,000 non-redundant ESTs, selected from 37,000 randomly sequenced ESTs generated from mRNA of different tissues and developmental stages.


The sequences of the ESTs showing at least two-fold increases or decreases over the controls were identified, compared to the Ceres full-length cDNA and genomic sequence databanks, and identical Ceres clones identified. The Zn response information was then used in conjunction with the existing annotation to attribute biological function or utility to the full-length cDNA and corresponding genomic sequence.


The MA_diff Table(s) reports the transcript levels of the experiment (see EXPT ID: Zinc (relating to SMD 7310, SMD 7311)). For transcripts that had higher levels in the samples than the control, a “+” is shown. A “−” is shown for when transcript levels were reduced in root tips as compared to the control. For more experimental detail see the Example section below.


Zinc genes are those sequences that showed differential expression as compared to controls, namely those sequences identified in the MA_diff tables with a “+” or “−” indication.


Zinc Genes Identified by Cluster Analyses of Differential Expression


Zinc Genes Identified by Correlation to Genes that are Differentially Expressed


As described above, the transcription profiles of genes that act together are well correlated. Applicants not only have identified the genes that are differentially expressed in the microarray experiments, but also have identified the genes that act in concert with them. The MA_clust table indicates groups of genes that have well correlated transcription profiles and therefore participate in the same pathway or network.


A pathway or network of Zinc genes is any group in the MA_clust that comprises a cDNA ID that also appears in Expt ID Zinc (relating to SMD 7310, SMD 7311) of the MA_diff table(s).


Zinc Genes Identified by Correlation to Genes that Cause Physiological Consequences


Additionally, the differential expression data and the phenotypic observations can be merged to identify pathways or networks of Zinc genes. A group in the MA_clust is considered a Zinc pathway or network if the group comprises a cDNA ID that also appears in Knock-in or Knock-out tables that causes one or more of the phenotypes described in section above.


Zinc Genes Identified by Amino Acid Sequence Similarity


Zinc genes from other plant species typically encode polypeptides that share amino acid similarity to the sequences encoded by corn and Arabidopsis Zinc genes. Groups of Zinc genes are identified in the Protein Group table. In this table, any protein group that comprises a peptide ID that corresponds to a cDNA ID member of a Zinc pathway or network is a group of proteins that also exhibits Zinc functions/utilities.


III.E.17.a. Use of Zn Transport, Tolerance and Nutrition-Related Genes to Modulate Phenotypes


Changes in zinc concentration in the surrounding environment or in contact with a plant results in modulation of many genes and gene products. Examples of such zinc responsive genes and gene products are shown in the Reference, Sequence tables, Protein Group, Protein Group Matrix, MA_diff, and MA_clust tables. These genes and/or products are responsible for effects on traits such as plant vigor and seed yield.


While zinc responsive polynucleotides and gene products can act alone, combinations of these polynucleotides also affect growth and development. Useful combinations include different zinc responsive polynucleotides and/or gene products that have similar transcription profiles or similar biological activities, and members of the same or similar biochemical pathways. In addition, the combination of a zinc responsive polynucleotide and/or gene product with another environmentally responsive polynucleotide is also useful because of the interactions that exist between hormone-regulated pathways, stress pathways, nutritional pathways and development. Here, in addition to polynucleotides having similar transcription profiles and/or biological activities, useful combinations include polynucleotides that may have different transcription profiles but which participate in a common pathway.


Such zinc responsive genes and gene products can function to either increase or dampen the above phenotypes or activities either

    • in response to changes in zinc concentration or
    • in the absence of zinc fluctuations.


Zn transport, tolerance and nutrition-related genes and gene products can be used to alter or modulate one or more phenotypes including Zn uptake; transport of Zn or other heavy metals into roots; epidermal/cortical uptake; Xylem loading; Zn compartmentation; Xylem unloading; Phloem loading; efflux from cells to apoplast; sequestration in vacuoles/subcellular compartments; Zn tolerance; chelation of Zn; transport of Zn; metabolic and transcriptional control; activity of Zn binding enzymes; and activity of Zn binding transcription factors.


To improve any of the phenotype(s) above, activities of one or more of the Zn transport, tolerance and nutrition-related genes or gene products can be modulated and the plants can be tested by screening for the desired trait. Specifically, the gene, mRNA levels, or protein levels can be altered in a plant utilizing the procedures described herein and the phenotypes can be assayed, for example, in accordance to Lasat M M, Pence N S, Garvin D F, Ebbs S D, Kochian L V. J Exp Bot. 2000 January; 51(342):71-9; Grotz N, Fox T, Connolly E, Park W, Guerinot M L, Eide D. Proc Natl Acad Sci USA. 1998 Jun. 9; 95(12):7220-4; Crowder M W, Maiti M K, Banovic L, Makaroff C A. FEBS Lett. 1997 Dec. 1; 418(3):351-4; Hart J J, Norvell W A, Welch R M, Sullivan L A, Kochian L V. Plant Physiol. 1998 September; 118(1):219-26.


III.E.17.b. Use of Zn Transport, Tolerance and Nutrition-Related Genes to Modulate Biochemical Activities


Alternatively, the activities of one or more of the zinc responsive genes can be modulated to change biochemical or metabolic activities and/or pathways such as those noted below. Such biological activities can be measured according to the citations included in the Table below:















BIOCHEMICAL OR




METABOLIC



ACTIVITIES AND/OR
CITATIONS INCLUDING


PROCESS
PATHWAYS
ASSAYS







Zn Uptake and
Zn Influx
Lasat MM, Pence NS, Garvin DF,


Assimilation

Ebbs SD, Kochian LV. J Exp Bot.




2000 Jan; 51(342): 71-9.



Zn compartmentation
Hart JJ, Norvell WA, Welch RM,




Sullivan LA, Kochian LV. Plant




Physiol. 1998 Sep; 118(1): 219-26.


Zn binding by metabolic

Crowder MW, Maiti MK, Banovic L,


enzymes

Makaroff CA. FEBS Lett. 1997




Dec 1; 418(3): 351-4; Kenzior AL,




Folk WR. FEBS Lett. 1998 Dec




4; 440(3): 425-9.


Zn binding by

Newton AL, Sharpe BK, Kwan A,


transcription factors

Mackay JP, Crossley M. J Biol




Chem. 2000May19; 275(20): 15128-34;




Lopez Ribera I, Ruiz-Avila L,




Puigdomenech P. Biochem Biophys




Res Commun. 1997 Jul




18; 236(2): 510-6; de Pater S, Greco V,




Pham K, Memelink J, Kijne J.




Nucleic Acids Res. 1996 Dec




1; 24(23): 4624-31.


Synthesis of proteins to

Schafer HJ, Greiner S,


chelate Zn and other

Rausch T, Haag-Kerwer A.


metals

FEBS Lett. 1997 Mar




10; 404(2-3): 216-20.




Rauser WE. Cell Biochem




Biophys. 1999; 31(1): 19-48.


Synthesis of metabolites

Rauser WE. Cell Biochem Biophys.


to chelate Zn and other

1999; 31(1): 19-48.


metals









Other biological activities that can be modulated by Zn transport, tolerance and nutrition-related genes and their products are listed in the Reference tables. Assays for detecting such biological activities are described in the Protein Domain table.


Zn transport, tolerance and nutrition-related genes are differentially transcribed in response to low Zn concentrations. The microarray comparison consists of probes prepared from root RNA of A. thaliana (Columbia) seedlings hydroponically grown in complete nutrient medium (control) and Zn deficient seedlings grown in —Zn nutrient medium (experimental). The data from this experiment reveal a number of types genes and gene products. MA_diff table reports the changes in transcript levels of various zinc responsive genes in entire seedlings at 1 and 6 hours after a plant was sprayed with a Hoagland's solution enriched with zinc as compared to seedlings sprayed with Hoagland's solution only.


The data from this time course can be used to identify a number of types of zinc responsive genes and gene products, including “early responding,” “high zinc responders,” “repressors of zinc deprivation pathways” and “zinc deprivation responders.” Profiles of these different zinc responsive genes are shown in the Table below with examples of associated biological activities.


















EXAMPLES OF


TRANSCRIPT

PHYSIOLOGICAL
BIOCHEMICAL


LEVELS
TYPE OF GENE
CONSequence
ACTIVITY







Upregulated
Early responders to
Zinc Perception
Transcription


transcripts (level at
Zinc
Zinc Uptake
Factors


1 hour ≅ 6 hours)

Modulation of Zinc
Transporters


(level at 1 hour > 6

Response Transduction


hours)

Pathways




Specific Gene




Transcription Initiation



Zinc Deprivation
Repression of Pathways
Inhibit Transport of



Responders
to Optimize Zinc
Zinc




Response Pathways
Degradation


Level at 1 hour < 6
Delayed Zinc

Zinc Metabolic


hours
Responders

Pathways



Repressor of Zinc
Negative Regulation of



Deprivation Pathways
Zinc Pathways


Down Regulated
Early responder
Negative Regulators of
Suppressing Zinc


transcripts (Level
repressors of Zinc
Zinc Utilization Pathways
Requiring processes


at 1 hour ≅ 6
utilization Pathways


hours)


(Level at 6 hours >


1 hour)


Level at 1 hour > 6
Genes with
Changes in pathways and


hours
discontinued
processes operating I cells



expression or



unsTable mRNA



following Zinc uptake









Use of Promoters of Zinc Responsive Genes

Promoters of Zinc responsive genes are useful for transcription of any desired polynucleotide or plant or non-plant origin. Further, any desired sequence can be transcribed in a similar temporal, tissue, or environmentally specific patterns as the Zinc responsive genes where the desired sequence is operably linked to a promoter of a Zinc responsive gene. The protein product of such a polynucleotide is usually synthesized in the same cells, in response to the same stimuli as the protein product of the gene from which the promoter was derived. Such promoter are also useful to produce antisense mRNAs to down-regulate the product of proteins, or to produce sense mRNAs to down-regulate mRNAs via sense suppression.


IV. Utilities of Particular Interest

Genes capable of modulating the phenotypes in the following table are useful produce the associated utilities in the table. Such genes can be identified by their cDNA ID number in the Knock-in and Knock-out Tables. That is, those genes noted in those Tables to have a phenotype as listed in the following column entitled “Phenotype Modulated by a Gene” are useful for the purpose identified in the corresponding position in the column entitled “Utilities”.













Phenotype



Modulated by a


Gene
Utilities

















Leaf shape
Cordate
decrease wind opacity,



Cup-shaped
decrease lodging (plant fall over),



Curled
increase biomass by making larger or




different shaped leaves,



Laceolate
improve the efficiency of mechanical




harvesting,



Lobed
decrease transpiration for better drought




tolerance,



Oval
changing leaf shape to collect and absorb




water,



Ovate
modulation of canopy structure and shading




for altered irradiance close to the ground,



Serrate
enhanced uptake of pesticides (herbicides,




fungicides, etc),



Trident
creation of ornamental leaf shapes,



Undulate
increase resistance to pathogens by




decreasing amount of water that collects on




leaves,



Vertically Oblong
change proporation of cell types in the




leaves for enhanced photosynthesis,




decreased transpiration, and enhanced



Other Shapes
accumulation of desirable compounds




including secondary metabolites in




specialized cells,




decrease insect feeding,



Long petioles
decrease wind opacity,



Short petioles
decrease lodging (plant fall over),




increase biomass by better positioning of




the leaf blade,




decrease insect feeding,




decrease transpiration for better drought




tolerance,




position leaves most effectively for




photosynthetic efficiency



Fused
ornamental applications to make distinctive




plants,


Reduced fertility
Short siliques
increase or decrease the number of seeds in




a fruit,




increasing fruit size,




modulating fruit shape to better fit




harvesting or packaging requirements,




useful for controlling dehisence and seed




scatter



Reduced fertility
useful in hybrid breeding programs,



Sterility
increasing fruit size,




production of seedless fruit,




useful as targets for gametocides,




modulating fruit shape to better fit




harvesting or packaging requirements,




useful for controlling dehisence and seed




scatter



Flower size
useful for edible flowers




useful for flower derived products such as




fragrances




useful for modulating seed size and number




in combination with seed-specific genes




value in the ornamental industry


Stature
Large
increasing or decreasing plant biomass,



Small
optimizing plant stature to increase yield




under various diverse environmental




conditions, e.g., when water or nutrients




are limiting,



Dwarfs
decreasing lodging,




increasing fruit number and size,




controlling shading and canopy effects


Meristems

Change plant architecture,




increase or decrease number of leaves as




well as change the types of leaves to




increase biomass,




improve photosynthetic efficiency,




create new varieties of ornamental plants




with enhanced leaf design,




preventing flowering to opimize vegetative




growth,




control of apical dominace,




increase or decrease flowering time to fit




season, water or fertilizer schedules,




change arrangement of leaves on the stem




(phyllotaxy) to optimize plant density,




decrease insect feeding,




or decrease pathogen infection,




increase number of trichome/glandular




trichome producing leaves




targets for herbicides,




generate ectopic meristems and ectopic




growth of vegetative and floral tissues and




seeds and fruits


Stem
Strong
modify lignin content/composition for




creation of harder woods or reduce




difficulty/costs in pulping for



Weak
paper production or increase




digestibility of forage crops,




decrease lodging,




modify cell wall polysaccharides in stems




and fruits for improved texture and




nutrition.




increase biomass



Late/Early Bolting
Break the need for long vernalization of




vernalization-dependent crops, e.g., winter




wheat, thereby increasing yield




decrease or increase generaton time




increase biomass


Lethals
Embryo-lethal
produce seedless fruit,




use as herbicide targets



Embryo-defective
produce seedless fruit,




use as herbicide targets



Seedling
use as herbicide targets,




useful for metabolic engineering,



Pigment-lethals
use as herbicide targets,




increase photosynthetic efficiency


Pigment
Dark Green
Increase nutritional value,




enhanced photosynthesis and carbon




dioxide combustion and therefore increase




plant vigor and biomass,




enhanced photosynthetic efficiency and




therefore increase plant vigor and biomass,




prolong vegetative development,




enhanced protection against pathogens,



YGV1
Useful as targets for herbicides,




increase photosynthetic efficiency and




therefore increase plant vigor and biomass,



YGV2
Useful as targets for herbicides,




control of change from embryonic to adult




organs,




increase metabolic efficiency,




increase photosynthetic efficiency and




therefore increased plant vigor and biomass,



YGV3
Useful as targets for herbicides,




nitrogen sensing/uptake/usage,




increase metabolic efficiency and therefore




increased plant vigor and biomass,



Interveinal chlorosis
to increase photosynthetic efficiency and




therefore increase plant vigor and biomass




to increase or decrease nitrogen transport




and therefore increase plant vigor and




biomass




use as herbicide targets




increase metabolic efficiency,


Roots
Short (primary root)
to access water from rainfall,




to access rhizobia spray application, for




anaerobic soils,




useful to facilitate harvest of root crops,



Thick (primary root)
useful for increasing biomass of root crops,




for preventing plants dislodging during




picking and harvesting,




as root grafts, for animal feeds



Branching (primary root)
modulation allows betters access to water,




minerals, fertilizers, rhizobia prevent soil




erosion, s




increasing root biomass




decrease root lodging,



Long (lateral roots)
modulation allows improved access to




water, nutrients, fertilizer, rhizobia, prevent




soil erosion




increase root biomass




decrease root lodging




modulation allows control on the depth of




root growth in soil to access water and




nutriennts




modulation allows hormonal control of root




growth and development (size)



Agravitropic
modulation allows control on the depth of




root growth in soil



Curling (primary root)
modulation allows hormonal control of root




growth and development (size)




useful in anaerobic soils in allowing roots




to stay close to surface




harvesting of root crops



Poor germination


Trichome
Reduced Number
Genes useful for decreasing transpiration,



Glabrous
increased production of glandular trichomes




for oil or other secreted chemicals of value,



Increased Number
use as deterrent for insect herbivory and




ovipostion




modulation will increase resistance to UV




light,


Wax mutants

decrease insect herbivory and oviposition,




compostion changes for the cosmetics




industry,




decrease transpiration,




provide pathogen resistance,




UV protection,




modulation of leaf runoff properties and




improved access for herbicides and




fertilizers


Cotyledons

modulation of seeds structure in legumes,




increase nutritional value,




improve seedling competion under field




conditions,


Seeds
Transparent testa
genes useful for metabolic engineering




anthocyanin and flavonoid pathways



Light
improved nutritional content



Dark




decrease petal abscission


Flowers
Other
decrease pod shattering


Hypocotysl
Long
to improve germination rates




to improve plant survivability



Short
to improve germination rates




to improve plant survivability









V. Enhanced Foods

Animals require external supplies of amino acids that they cannot synthesize themselves. Also, some amino acids are required in larger quantities. The nutritional values of plants for animals and humans can thus be modified by regulating the amounts of the constituent amino acids that occur as free amino acids or in proteins. For instance, higher levels of lysine and/or methionine would enhance the nutritional value of corn seed. Applicants herein provide several methods for modulating the amino acid content:

    • (1) expressing a naturally occurring protein that has a high percentage of the desired amino acid(s);
    • (2) expressing a modified or synthetic coding sequence that has an enhanced percentage of the desired amino acids; or
    • (3) expressing the protein(s) that are capable of synthesizing more of the desired amino acids.


      A specific example is expressing proteins with enhanced, for example, methionine content, preferentially in a corn or cereal seed used for animal nutrition or in the parts of plants used for nutritional purposes.


A protein is considered to have a high percentage of an amino acid if the amount of the desired amino acid is at least 1% of the total number of residues in a protein; more preferably 2% or greater. Amino acids of particular interest are tryptophan, lysine, methionine, phenylalanine, threonine leucine, valine, and isoleucine. Examples of naturally occurring proteins with a high percentage of any one of the amino acid of particular interest are listed in the Enhanced Amino Acid Table.


The sequence(s) encoding the selected protein(s) are operably linked to a promoter and other regulatory sequences and transformed into a plant as described below. The promoter is chosen optimally for promoting the desired level of expression of the protein in the selected organ e.g. a promoter highly functional in seeds. Modifications may be made to the sequence encoding the protein to ensure protein transport into, for example, organelles or storage bodies or its accumulation in the organ. Such modifications may include addition of signal sequences at or near the N terminus and amino acid residues to modify protein stability or appropriate glycosylation. Other modifications may be made to the transcribed nucleic acid sequence to enhance the stability or translatability of the mRNA, in order to ensure accumulation of more of the desired protein. Suitable versions of the gene construct and transgenic plants are selected on the basis of, for example, the improved amino acid content and nutritional value measured by standard biochemical tests and animal feeding trials.


VI. Use of Novel Genes to Facilitate Exploitation of Plants as Factories for the Synthesis of Valuable Molecules

Plants and their constituent cells, tissues, and organs are factories that manufacture small organic molecules such as sugars, amino acids, fatty acids, vitamins, etc., as well as macromolecules such as proteins, nucleic acids, oils/fats and carbohydrates. Plants have long been a source of pharmaceutically beneficial chemicals; particularly, the secondary metabolites and hormone-related molecules synthesized by plants. Plants can also be used as factories to produce carbohydrates or lipids that comprises a carbon backbone useful as precursors of plastics, fiber, fuel, paper, pulp, rubber, solvents, lubricants, construction materials, detergents, and other cleaning materials. Plants can also generate other compounds that are of economic value, such as dyes, flavors, and fragrances. Both the intermediates as well as the end-products of plant bio-synthetic pathways have been found useful.


With the polynucleotides and polypeptides of the instant invention, modification of both in-vitro and in-vivo synthesis of such products is possible. One method of increasing the amount of either the intermediates or the end-products synthesized in a cell is to increase the expression of one or more proteins in the synthesis pathway as discussed below. Another method of increasing production of an intermediate is to inhibit expression of protein(s) that synthesize the end-product from the intermediate. Levels of end-products and intermediates can also be modified by changing the levels of enzymes that specifically change or degrade them. The kinds of molecules made can be also be modified by changing the genes encoding specific enzymes performing reactions at specific steps of the biosynthetic pathway. These genes can be from the same or a different organism. The molecular structures in the biosynthetic pathways can thus be modified or diverted into different branches of a pathway to make novel end-products.


Novel genes comprising selected promoters and sequences encoding enzymes are transformed into the selected plant to modify the levels, composition and/or structure of, without limitation:

    • Terpenoids
    • Alkaloids
    • Hormones, including brassinosteroids
    • Flavonoids
    • Steroids
    • Vitamins such as
      • Retinol
      • Riboflavin
      • Thiamine
    • Caffeine
    • Morphine and other alkaloids
    • Peptides and amino acid synthesis
    • Antioxidants
    • Starches and lipids
    • Fatty acids
    • Fructose, mannose and other sugars
    • Glycerolipid
    • Citric acid
    • Lignin
    • Flavors
    • Fragrances
    • Essential oils
    • Colors or dyes
    • Gum
    • Gels
    • Waxes


The modifications are made by designing one or more novel genes per application comprising promoters, to ensure production of the enzyme(s) in the relevant cells, in the right amount, and polynucleotides encoding the relevant enzyme. The promoters and polynucleotides are the subject of this application. The novel genes are transformed into the relevant species using standard procedures. Their effects are measured by standard assays for the specific chemical/biochemical products.


These polynucleotides and proteins of the invention that participate in the relevant pathways and are useful for changing production of the above chemicals and biochemicals are identified in the Reference tables by their enzyme function. More specifically, proteins of the invention that have the enzymatic activity of one of the entries in the following table entitled “Emzymes Effecting Modulation of Biological Pathways” are of interest to modulate the corresponding pathways to produce precursors or final products noted above that are of industrial use. Biological activities of particular interest are listed below.


Other polynucleotides and proteins that regulate where, when and to what extent a pathway is active in a plant are extremely useful for modulating the synthesis and accumulation of valuable chemicals. These elements including transcription factors, proteins involved in signal transduction and other proteins in the control of gene expression are described elsewhere in this application.














Pathway




Name
Enzyme Description
Comments







Alkaloid
Morphine 6-
Also acts on other alkaloids, including codeine,


biosynthesis I
dehydrogenase
normorphine and ethylmorphine, but only very




slowly on 7,8-saturated derivatives such as




dihydromorphine and dihydrocodeine In the




reverse direction, also reduces naloxone to the




6-alpha-hydroxy analog Activated by 2-




mercaptoethanol



Codeinone reductase
Stereospecifically catalyses the reversible



(NADPH)
reduction of codeinone to codeine, which is a




direct precursor of morphine in the opium




poppy plant, Papaver somniferum



Salutaridine reductase
Stereospecifically catalyses the reversible



(NADPH)
reduction of salutaridine to salutaridinol, which




is a direct precursor of morphinan alkaloids in




the poppy plant, Papaver somniferum



(S)-stylopine synthase
Catalyses an oxidative reaction that does not




incorporate oxygen into the product Forms the




second methylenedioxy bridge of the




protoberberine alkaloid stylopine from




oxidative ring closure of adjacent phenolic and




methoxy groups of cheilanthifoline



(S)-cheilanthifoline
Catalyses an oxidative reaction that does not



synthase
incorporate oxygen into the product Forms the




methylenedioxy bridge of the protoberberine




alkaloid cheilanthifoline from oxidative ring




closure of adjacent phenolic and methoxy




groups of scoulerine



Salutaridine synthase
Forms the morphinan alkaloid salutaridine by




intramolecular phenol oxidation of reticuline




without the incorporation of oxygen into the




product



(S)-canadine synthase
Catalyses an oxidative reaction that does not




incorporate oxygen into the product Oxidation




of the methoxyphenol group of the alkaloid




tetrahydrocolumbamine results in the




formation of the methylenedioxy bridge of




canadine



Protopine 6-
Involved in benzophenanthridine alkaloid



monooxygenase
synthesis in higher plants



Dihydrosanguinarine
Involved in benzophenanthridine alkaloid



10-monooxygenase
synthesis in higher plants



Monophenol
A group of copper proteins that also catalyse



monooxygenase
the reaction of EC 1.10.3.1, if only 1,2-




benzenediols are available as substrate



L-amino acid oxidase



1,2-dehydroreticulinium
Stereospecifically reduces the 1,2-



reductase (NADPH)
dehydroreticulinium ion to (R)-reticuline,




which is a direct precursor of morphinan




alkaloids in the poppy plant, papaver




somniferum The enzyme does not catalyse the




reverse reaction to any significant extent under




physiological conditions



Dihydrobenzo-
Also catalyzes: dihydrochelirubine + O(2) =



phenanthridine oxidase
chelirubine + H(2)O(2) Also catalyzes:




dihydromacarpine + O(2) = macarpine +




H(2)O(2) Found in higher plants Produces




oxidized forms of the benzophenanthridine




alkaloids



Reticuline oxidase
The product of the reaction, (S)-scoulerine, is a




precursor of protopine, protoberberine and




benzophenanthridine alkaloid biosynthesis in




plants Acts on (S)-reticuline and related




compounds, converting the N-methyl group




into the methylene bridge (‘berberine




bridge[PRIME]) of (S)-




tetrahydroprotoberberines



3[PRIME]-hydroxy-N-
Involved in isoquinoline alkaloid metabolism



methyl-(S)-coclaurine
in plants Has also been shown to catalyse the



4[PRIME]-O-
methylation of (R,S)-laudanosoline, (S)-



methyltransferase
3[PRIME]-hydroxycoclaurine and (R,S)-7-O-




methylnoraudanosoline



(S)-scoulerine 9-O-
The product of this reaction is a precursor for



methyltransferase
protoberberine alkaloids in plants



Columbamine O-
The product of this reaction is a protoberberine



methyltransferase
alkaloid that is widely distributed in the plant




kingdom Distinct in specificity from EC




2.1.1.88



10-hydroxydihydro-
Part of the pathway for synthesis of



sanguinarine 10-O-
benzophenanthridine alkaloids in plants



methyltransferase



12-hydroxydi-
Part of the pathway for synthesis of



hydrochelirubine 12-O-
benzophenanthridine alkaloid macarpine in



methyltransferase
plants



(R,S)-norcoclaurine 6-
Norcoclaurine is 6,7-dihydroxy-1-[(4-



O-methyltransferase
hydroxyphenyl)methyl]-1,2,3,4-




tetrahydroisoquinoline The enzyme will also




catalyse the 6-O-methylation of (R,S)-




norlaudanosoline to form 6-O-methyl-




norlaudanosoline, but this alkaloid has not




been found to occur in plants



Salutaridinol 7-O-
At higher pH values the product, 7-O-



acetyltransferase
acetylsalutaridinol, spontaneously closes the 4->




5 oxide bridge by allylic elimination to form




the morphine precursor thebaine From the




opium poppy plant, Papaver somniferum



Aspartate
Also acts on L-tyrosine, L-phenylalanine and



aminotransferase
L-tryptophan. This activity can be formed from




EC 2.6.1.57 by controlled proteolysis



Tyrosine
L-phenylalanine can act instead of L-tyrosine



aminotransferase
The mitochondrial enzyme may be identical




with EC 2.6.1.1 The three isoenzymic forms




are interconverted by EC 3.4.22.4



Aromatic amino acid
L-methionine can also act as donor, more



transferase
slowly Oxaloacetate can act as acceptor




Controlled proteolysis converts the enzyme to




EC 2.6.1.1



Tyrosine decarboxylase
The bacterial enzyme also acts on 3-




hydroxytyrosine and, more slowly, on 3-




hydroxyphenylalanine



Aromatic-L-amino-acid
Also acts on L-tryptophan, 5-hydroxy-L-



decarboxylase
tryptophan and dihydroxy-L-phenylalanine




(DOPA)


Alkaloid
Tropine dehydrogenase
Oxidizes other tropan-3-alpha-ols, but not the


biosynthesis

corresponding beta-derivatives


II



Tropinone reductase



Hyoscyamine (6S)-



dioxygenase



6-beta-



hydroxyhyoscyamine



epoxidase



Amine oxidase (copper-
A group of enzymes including those oxidizing



containing)
primary amines, diamines and histamine One




form of EC 1.3.1.15 from rat kidney also




catalyses this reaction



Putrescine N-



methyltransferase



Ornithine



decarboxylase



Oxalyl-CoA



decarboxylase



Phenylalanine
May also act on L-tyrosine



ammonia-lyase


Androgen and
3-beta-hydroxy-
Acts on 3-beta-hydroxyandrost-5-en-17-one to


estrogen
delta(5)-steroid
form androst-4-ene-3,17-dione and on 3-beta-


metabolism
dehydrogenase
hydroxypregn-5-en-20-one to form




progesterone



11-beta-hydroxysteroid



dehydrogenase



Estradiol 17-alpha-



dehydrogenase



3-alpha-hydroxy-5-



beta-androstane-17-one



3-alpha-dehydrogenase



3-alpha (17-beta)-
Also acts on other 17-beta-hydroxysteroids, on



hydroxysteroid
the 3-alpha-hydroxy group of pregnanes and



dehydrogenase (NAD+)
bile acids, and on benzene dihydrodiol




Different from EC 1.1.1.50 or EC 1.1.1.213



3-alpha-hydroxysteroid
Acts on other 3-alpha-hydroxysteroids and on



dehydrogenase (B-
9-, 11- and 15-hydroxyprostaglandin B-



specific)
specific with respect to NAD(+) or NADP(+)




(cf. EC 1.1.1.213)



3(or 17)beta-
Also acts on other 3-beta- or 17-beta-



hydroxysteroid
hydroxysteroids (cf EC 1.1.1.209)



dehydrogenase



Estradiol 17 beta-
Also acts on (S)-20-hydroxypregn-4-en-3-one



dehydrogenase
and related compounds, oxidizing the (S)-20-




group B-specific with respect to NAD(P)(+)



Testosterone 17-beta-



dehydrogenase



Testosterone 17-beta-
Also oxidizes 3-hydroxyhexobarbital to 3-



dehydrogenase
oxohexobarbital



(NADP+)



Steroid 11-beta-
Also hydroxylates steroids at the 18-position,



monooxygenase
and converts 18-hydroxycorticosterone into




aldosterone



Estradiol 6-beta-



monooxygenase



Androst-4-ene-3,17-
Has a wide specificity A single enzyme from



dione monooxygenase
Cylindrocarpon radicicola (EC 1.14.13.54)




catalyses both this reaction and that catalysed




by EC 1.14.99.4



3-oxo-5-alpha-steroid



4-dehydrogenase



3-oxo-5-beta-steroid 4-



dehydrogenase



UDP-
Family of enzymes accepting a wide range of



glucuronosyltransferase
substrates, including phenols, alcohols, amines




and fatty acids Some of the activities catalysed




were previously listed separately as EC




2.4.1.42, EC 2.4.1.59, EC 2.4.1.61, EC




2.4.1.76, EC 2.4.1.77, EC 2.4.1.84, EC




2.4.1.107 and EC 2.4.1.108 A temporary




nomenclature for the various forms whose




delineation is in a state of flux



Steroid sulfotransferase
Broad specificity resembling EC 2.8.2.2, but




also acts on estrone



Alcohol
Primary and secondary alcohols, including



sulfotransferase
aliphatic alcohols, ascorbate, chloramphenicol,




ephedrine and hydroxysteroids, but not




phenolic steroids, can act as acceptors (cf. EC




2.8.2.15)



Estrone sulfotransferase



Arylsulfatase
A group of enzymes with rather similar




specificities



Steryl-sulfatase
Also acts on some related steryl sulfates



17-alpha-



hydroxyprogesterone



aldolase



Steroid delta-isomerase


C21-Steroid
3-beta-hydroxy-
Acts on 3-beta-hydroxyandrost-5-en-17-one to


hormone
delta(5)-steroid
form androst-4-ene-3,17-dione and on 3-beta-


metabolism
dehydrogenase
hydroxypregn-5-en-20-one to form




progesterone



11-beta-hydroxysteroid



dehydrogenase



20-alpha-
A-specific with respect to NAD(P)(+)



hydroxysteroid



dehydrogenase



3-alpha-hydroxysteroid
Acts on other 3-alpha-hydroxysteroids and on



dehydrogenase (B-
9-, 11- and 15-hydroxyprostaglandin B-



specific)
specific with respect to NAD(+) or NADP(+)




(cf. EC 1.1.1.213)



3-alpha(or 20-beta)-
The 3-alpha-hydroxyl group or 20-beta-



hydroxysteroid
hydroxyl group of pregnane and androstane



dehydrogenase
steroids can act as donors



Steroid 11-beta-
Also hydroxylates steroids at the 18-position,



monooxygenase
and converts 18-hydroxycorticosterone into




aldosterone



Corticosterone 18-



monooxygenase



Cholesterol
The reaction proceeds in three stages, with



monooxygenase (side-
hydroxylation at C-20 and C-22 preceding



chain cleaving)
scission of the side-chain at C-20



Steroid 21-



monooxygenase



Progesterone 11-alpha-



monooxygenase



Steroid 17-alpha-



monooxygenase



Cholestenone 5-beta-



reductase



Cortisone beta-



reductase



Progesterone 5-alpha-
Testosterone and 20-alpha-hydroxy-4-pregnen-



reductase
3-one can act in place of progesterone



3-oxo-5-beta-steroid 4-



dehydrogenase



Steroid delta-isomerase


Flavonoids,
Coniferyl-alcohol
Specific for coniferyl alcohol; does not act on


stilbene and
dehydrogenase
cinnamyl alcohol, 4-coumaryl alcohol or


lignin

sinapyl alcohol


biosynthesis



Cinnamyl-alcohol
Acts on coniferyl alcohol, sinapyl alcohol, 4-



dehydrogenase
coumaryl alcohol and cinnamyl alcohol (cf. EC




1.1.1.194)



Dihydrokaempferol 4-
Also acts, in the reverse direction, on (+)-



reductase
dihydroquercetin and (+)-dihydromyricetin




Each dihydroflavonol is reduced to the




corresponding cis-flavon-3,4-diol NAD(+) can




act instead of NADP(+), more slowly Involved




in the biosynthesis of anthocyanidins in plants



Flavonone 4-reductase
Involved in the biosynthesis of 3-




deoxyanthocyanidins from flavonones such as




naringenin or eriodictyol



Peroxidase



Caffeate 3,4-



dioxygenase



Naringenin 3-



dioxygenase



Trans-cinnamate 4-
Also acts on NADH, more slowly



monooxygenase



Trans-cinnamate 2-



monooxygenase



Flavonoid 3[PRIME]-
Acts on a number of flavonoids, including



monooxygenase
naringenin and dihydrokaempferol Does not




act on 4-coumarate or 4-coumaroyl-CoA



Monophenol
A group of copper proteins that also catalyse



monooxygenase
the reaction of EC 1.10.3.1, if only 1,2-




benzenediols are available as substrate



Cinnamoyl-CoA
Also acts on a number of substituted



reductase
cinnamoyl esters of coenzyme A



Caffeoyl-CoA O-



methyltransferase



Luteolin O-
Also acts on luteolin-7-O-beta-D-glucoside



methyltransferase



Caffeate O-
3,4-dihydroxybenzaldehyde and catechol can



methyltransferase
act as acceptor, more slowly



Apigenin 4[PRIME]-O-
Converts apigenin into acacetin Naringenin



methyltransferase
(5,7,4[PRIME]-trihydroxyflavonone) can also




act as acceptor, more slowly



Quercetin 3-O-
Specific for quercetin. Related enzymes bring



methyltransferase
about the 3-O-methylation of other flavonols,




such as galangin and kaempferol



Isoflavone-7-O-beta-
The 6-position of the glucose residue of



glucoside
formononetin can also act as acceptor Some



6[PRIME][PRIME]-O-
other 7-O-glucosides of isoflavones, flavones



malonyltransferase
and flavonols can also act, more slowly



Pinosylvin synthase
Not identical with EC 2.3.1.74 or EC 2.3.1.95



Naringenin-chalcone
In the presence of NADH and a reductase,



synthase
6[PRIME]-deoxychalcone is produced



Trihydroxystilbene
Not identical with EC 2.3.1.74 or EC 2.3.1.146



synthase



Quinate O-
Caffeoyl-CoA and 4-coumaroyl-CoA can also



hydroxycinnamoyltransferase
act as donors, more slowly Involved in the




biosynthesis of chlorogenic acid in sweet




potato and, with EC 2.3.1.98 in the formation




of caffeoyl-CoA in tomato



Coniferyl-alcohol
Sinapyl alcohol can also act as acceptor



glucosyltransferase



2-coumarate O-beta-
Coumarinate (cis-2-hydroxycinnamate) does



glucosyltransferase
not act as acceptor



Scopoletin



glucosyltransferase



Flavonol-3-O-glucoside
Converts flavonol 3-O-glucosides to 3-O-



L-rhamnosyltransferase
rutinosides Also acts, more slowly, on rutin,




quercetin 3-O-galactoside and flavonol O3-




rhamnosides



Flavone 7-O-beta-
A number of flavones, flavonones and



glucosyltransferase
flavonols can function as acceptors Different




from EC 2.4.1.91



Flavonol 3-O-
Acts on a variety of flavonols, including



glucosyltransferase
quercetin and quercetin 7-O-glucoside




Different from EC 2.4.1.81



Flavone
7-O-beta-D-glucosides of a number of



apiosyltransferase
flavonoids and of 4-substituted phenols can act




as acceptors



Coniferin beta-
Also hydrolyzes syringin, 4-cinnamyl alcohol



glucosidase
beta-glucoside, and, more slowly, some other




aryl beta-glycosides A plant cell-wall enzyme




involved in the biosynthesis of lignin



Beta-glucosidase
Wide specificity for beta-D-glucosides. Some




examples also hydrolyse one or more of the




following: beta-D-galactosides, alpha-L-




arabinosides, beta-D-xylosides, and beta-D-




fucosides



Chalcone isomerase



4-coumarate--CoA



ligase


Pathway Name
Enzyme Description
Enzyme Comments


Ascorbate and aldarate
D-threo-aldose 1-
Acts on L-fucose, D-arabinose and L-


metabolism
dehydrogenase
xylose The animal enzyme was also




shown to act on L-arabinose, and the




enzyme from Pseudomonas caryophyllion




L-glucose



L-threonate 3-



dehydrogenase



Glucuronate reductase
Also reduces D-galacturonate May be




identical with EC 1.1.1.2



Glucuronolactone



reductase



L-arabinose 1-



dehydrogenase



L-galactonolactone
Acts on the 1,4-lactones of L-galactonic,



oxidase
D-altronic, L-fuconic, D-arabinic and D-




threonic acids Not identical with EC




1.1.3.8 (cf. EC 1.3.2.3)



L-gulonolactone
The product spontaneously isomerizes to



oxidase
L-ascorbate



L-ascorbate oxidase



L-ascorbate peroxidase



Ascorbate 2,3-



dioxygenase



2,5-dioxovalerate



dehydrogenase



Aldehyde
Wide specificity, including oxidation of



dehydrogenase (NAD+)
D-glucuronolactone to D-glucarate



Galactonolactone
Cf. EC 1.1.3.24



dehydrogenase



Monodehydroascorbate



reductase (NADH)



Glutathione



dehydrogenase



(ascorbate)



L-arabinonolactonase



Gluconolactonase
Acts on a wide range of hexono-1,5-




lactones



Uronolactonase



1,4-lactonase
Specific for 1,4-lactones with 4-8 carbon




atoms Does not hydrolyse simple




aliphatic esters, acetylcholine, sugar




lactones or substituted aliphatic lactones,




e.g. 3-hydroxy-4-butyrolactone



2-dehydro-3-



deoxyglucarate aldolase



L-arabinonate



dehydratase



Glucarate dehydratase



5-dehydro-4-



deoxyglucarate



dehydratase



Galactarate dehydratase



2-dehydro-3-deoxy-L-



arabinonate



dehydratase


Carbon fixation
Malate dehydrogenase
Also oxidizes some other 2-




hydroxydicarboxylic acids



Malate dehydrogenase
Does not decarboxylates added



(decarboxylating)
oxaloacetate



Malate dehydrogenase
Also decarboxylates added oxaloacetate



(oxaloacetate



decarboxylating)



(NADP+)



Malate dehydrogenase
Activated by light



(NADP+)



Glyceraldehyde-3-



phosphate



dehydrogenase



(NADP+)



(phosphorylating)



Transketolase
Wide specificity for both reactants, e.g.




converts hydroxypyruvate and R—CHO




into CO(2) and R—CHOH—CO—CH(2)OH




Transketolase from Alcaligenes faecalis




shows high activity with D-erythrose as




acceptor



Aspartate
Also acts on L-tyrosine, L-phenylalanine



aminotransferase
and L-tryptophan. This activity can be




formed from EC 2.6.1.57 by controlled




proteolysis



Alanine
2-aminobutanoate acts slowly instead of



aminotransferase
alanine



Sedoheptulokinase



Phosphoribulokinase



Pyruvate kinase
UTP, GTP, CTP, ITP and dATP can also




act as donors Also phosphorylates




hydroxylamine and fluoride in the




presence of CO(2)



Phosphoglycerate



kinase



Pyruvate, phosphate



dikinase



Fructose-
The animal enzyme also acts on



bisphosphatase
sedoheptulose 1,7-bisphosphate



Sedoheptulose-



bisphosphatase



Phosphoenolpyruvate



carboxylase



Ribulose-bisphosphate
Will utilize O(2) instead of CO(2),



carboxylase
forming 3-phospho-D-glycerate and 2-




phosphoglycolate



Phosphoenolpyruvate



carboxykinase (ATP)



Fructose-bisphosphate
Also acts on (3S,4R)-ketose 1-phosphates



aldolase
The yeast and bacterial enzymes are zinc




proteins The enzymes increase electron-




attraction by the carbonyl group, some




(Class I) forming a protonated imine with




it, others (Class II), mainly of microbial




origin, polarizing it with a metal ion, e.g




zinc



Phosphoketolase



Ribulose-phosphate 3-
Also converts D-erythrose 4-phosphate



epimerase
into D-erythrulose 4-phosphate and D-




threose 4-phosphate



Triosephosphate



isomerase



Ribose 5-phosphate
Also acts on D-ribose 5-diphosphate and



epimerase
D-ribose 5-triphosphate


Phenylalanine
(R)-4-
Also acts, more slowly, on (R)-3-


metabolism
hydroxyphenyllactate
phenyllactate, (R)-3-(indole-3-yl)lactate



dehydrogenase
and (R)-lactate



Hydroxyphenyl-
Also acts on 3-(3,4-



pyruvate reductase
dihydroxyphenyl)lactate Involved with




EC 2.3.1.140 in the biosynthesis of




rosmarinic acid



Aryl-alcohol
A group of enzymes with broad



dehydrogenase
specificity towards primary alcohols with




an aromatic or cyclohex-1-ene ring, but




with low or no activity towards short-




chain aliphatic alcohols



Peroxidase



Catechol 1,2-
Involved in the metabolism of nitro-



dioxygenase
aromatic compounds by a strain of




Pseudomonas putida



2,3-dihydroxybenzoate



3,4-dioxygenase



3-carboxyethylcatechol



2,3-dioxygenase



Catechol 2,3-
The enzyme from Alcaligines sp. strain



dioxygenase
O-1 has also been shown to catalyse the




reaction: 3-Sulfocatechol + O(2) + H(2)O =




2-hydroxymuconate + bisulfite. It has




been referred to as 3-sulfocatechol 2,3-




dioxygenase. Further work will be




necessary to show whether or not this is a




distinct enzyme



4-



hydroxyphenylpyruvate



dioxygenase



Protocatechuate 3,4-



dioxygenase



Hydroxyquinol 1,2-
The product isomerizes to 2-



dioxygenase
maleylacetate (cis-hex-2-enedioate)




Highly specific; catechol and pyrogallol




are acted on at less than 1% of the rate at




which benzene-1,2,4-triol is oxidized



Protocatechuate 4,5-



dioxygenase



Phenylalanine 2-
Also catalyses a reaction similar to that



monooxygenase
of EC 1.4.3.2, forming 3-phenylpyruvate,




NH(3) and H(2)O(2), but more slowly



Anthranilate 1,2-



dioxygenase



(deaminating,



decarboxylating)



Benzoate 1,2-
A system, containing a reductase which



dioxygenase
is an iron-sulfur flavoprotein (FAD), and




an iron-sulfur oxygenase



Toluene dioxygenase
A system, containing a reductase which




is an iron-sulfur flavoprotein (FAD), an




iron-sulfur oxygenase, and a ferredoxin




Some other aromatic compounds,




including ethylbenzene, 4-xylene and




some halogenated toluenes, are converted




into the corresponding cis-dihydrodiols



Naphthalene 1,2-
A system, containing a reductase which



dioxygenase
is an iron-sulfur flavoprotein (FAD), an




iron-sulfur oxygenase, and ferredoxin



Benzene 1,2-
A system, containing a reductase which



dioxygenase
is an iron-sulfur flavoprotein, an iron-




sulfur oxygenase and ferredoxin



Salicylate 1-



monooxygenase



Trans-cinnamate 4-
Also acts on NADH, more slowly



monooxygenase



Benzoate 4-



monooxygenase



4-hydroxybenzoate 3-
Most enzymes from Pseudomonas are



monooxygenase
highly specific for NAD(P)H (cf EC




1.14.13.33)



3-hydroxybenzoate 4-
Also acts on a number of analogs of 3-



monooxygenase
hydroxybenzoate substituted in the 2, 4, 5




and 6 positions



3-hydroxybenzoate 6-
Also acts on a number of analogs of 3-



monooxygenase
hydroxybenzoate substituted in the 2, 4, 5




and 6 positions NADPH can act instead




of NADH, more slowly



4-hydroxybenzoate 3-
The enzyme from Corynebacterium



monooxygenase
cyclohexanicum is highly specific for 4-



(NAD(P)H)
hydroxybenzoate, but uses NADH and




NADPH at approximately equal rates (cf.




EC 1.14.13.2). It is less specific for




NADPH than EC 1.14.13.2



Anthranilate 3-
The enzyme from Aspergillus niger is an



monooxygenase
iron protein; that from the yeast



(deaminating)
Trichosporon cutaneum is a flavoprotein




(FAD)



Melilotate 3-



monooxygenase



Phenol 2-
Also active with resorcinol and O-cresol



monooxygenase



Mandelate 4-



monooxygenase



3-hydroxybenzoate 2-



monooxygenase



4-cresol dehydrogenase
Phenazine methosulfate can act as



(hydroxylating)
acceptor A quinone methide is probably




formed as intermediate The product is




oxidized further to 4-hydroxybenzoate



Benzaldehyde



dehydrogenase (NAD+)



Aminomuconate-
Also acts on 2-hydroxymuconate



semialdehyde
semialdehyde



dehydrogenase



Phenylacetaldehyde



dehydrogenase



4-carboxy-2-
Does not act on unsubstituted aliphatic or



hydroxymuconate-6-
aromatic aldehydes or glucose NAD(+)



semialdehyde
can replace NADP(+), but with lower



dehydrogenase
affinity



Aldehyde



dehydrogenase



(NAD(P)+)



Benzaldehyde



dehydrogenase



(NADP+)



Coumarate reductase



Cis-1,2-



dihydrobenzene-1,2-



diol dehydrogenase



Cis-1,2-dihydro-1,2-
Also acts, at half the rate, on cis-



dihydroxynaphthalene
anthracene dihydrodiol and cis-



dehydrogenase
phenanthrene dihydrodiol



2-enoate reductase
Acts, in the reverse direction, on a wide




range of alkyl and aryl alpha,beta-




unsaturated carboxylate ions 2-butenoate




was the best substrate tested



Maleylacetate reductase



Phenylalanine
The enzyme from Bacillus badius and



dehydrogenase
Sporosarcina ureae are highly specific for




L-phenylalanine, that from Bacillus




sphaericus also acts on L-tyrosine



L-amino acid oxidase



Amine oxidase (flavin-
Acts on primary amines, and usually also



containing)
on secondary and tertiary amines



Amine oxidase (copper-
A group of enzymes including those



containing)
oxidizing primary amines, diamines and




histamine One form of EC 1.3.1.15 from




rat kidney also catalyses this reaction



D-amino-acid
Acts to some extent on all D-amino acids



dehydrogenase
except D-aspartate and D-glutamate



Aralkylamine
Phenazine methosulfate can act as



dehydrogenase
acceptor Acts on aromatic amines and,




more slowly, on some long-chain




aliphatic amines, but not on methylamine




or ethylamine (cf EC 1.4.99.3)



Glutamine N-



phenylacetyltransferase



Acetyl-CoA C-



acyltransferase



D-amino-acid N-



acetyltransferase



Phenylalanine N-
Also acts, more slowly, on L-histidine



acetyltransferase
and L-alanine



Glycine N-
Not identical with EC 2.3.1.13 or EC



benzoyltransferase
2.3.1.68



Aspartate
Also acts on L-tyrosine, L-phenylalanine



aminotransferase
and L-tryptophan. This activity can be




formed from EC 2.6.1.57 by controlled




proteolysis



D-alanine
Acts on the D-isomers of leucine,



aminotransferase
aspartate, glutamate, aminobutyrate,




norvaline and asparagine



Tyrosine
L-phenylalanine can act instead of L-



aminotransferase
tyrosine The mitochondrial enzyme may




be identical with EC 2.6.1.1 The three




isoenzymic forms are interconverted by




EC 3.4.22.4



Aromatic amino acid
L-methionine can also act as donor, more



transferase
slowly Oxaloacetate can act as acceptor




Controlled proteolysis converts the




enzyme to EC 2.6.1.1



Histidinol-phosphate



aminotransferase



3-oxoadipate CoA-



transferase



3-oxoadipate enol-
Acts on the product of EC 4.1.1.44



lactonase



Carboxymethylene-



butenolidase



2-pyrone-4,6-
The product isomerizes to 4-



dicarboxylate lactonase
oxalmesaconate



Hippurate hydrolase
Acts on various N-benzoylamino acids



Amidase



Acylphosphatase



2-hydroxymuconate-



semialdehyde hydrolase



Aromatic-L-amino-acid
Also acts on L-tryptophan, 5-hydroxy-L-



decarboxylase
tryptophan and dihydroxy-L-




phenylalanine (DOPA)



Phenylpyruvate
Also acts on indole-3-pyruvate



decarboxylase



4-carboxymucono-



lactone decarboxylase



O-pyrocatechuate



decarboxylase



Phenylalanine
Also acts on tyrosine and other aromatic



decarboxylase
amino acids



4-hydroxybenzoate



decarboxylase



Protocatechuate



decarboxylase



Benzoylformate



decarboxylase



4-oxalocrotonate
Involved in the meta-cleavage pathway



decarboxylase
for the degradation of phenols, cresols




and catechols



4-hydroxy-4-methyl-2-
Also acts on 4-hydroxy-4-methyl-2-



oxoglutarate aldolase
oxoadipate and 4-carboxy-4-hydroxy-2-




oxohexadioate



2-oxopent-4-enoate
Also acts, more slowly, on cis-2-oxohex-



hydratase
4-enoate, but not on the trans-isomer



Phenylalanine
May also act on L-tyrosine



ammonia-lyase



Phenylalanine racemase



(ATP-hydrolysing)



Mandelate racemase



Phenylpyruvate
Also acts on other arylpyruvates



tautomerase



5-carboxymethyl-2-



hydroxymuconate



delta-isomerase



Muconolactone delta-



isomerase



Muconate
Also acts, in the reverse reaction, on 3-



cycloisomerase
methyl-cis-cis-hexa-dienedioate and,




very slowly, on cis-trans-hexadienedioate




Not identical with EC 5.5.1.7 or EC




5.5.1.11



3-carboxy-cis,cis-



muconate



cycloisomerase



Carboxy-cis,cis-



muconate cyclase



Chloromuconate
Spontaneous elimination of HCl produces



cycloisomerase
cis-4-carboxymethylenebut-2-en-4-olide




Also acts in reverse direction on 2-




chloro-cis,cis-muconate Not identical




with EC 5.5.1.1 or EC 5.5.1.11



Phenylacetate--CoA
Phenoxyacetate can replace phenylacetate



ligase



Benzoate--CoA ligase
Also acts on 2-, 3- and 4-fluorobenzoate,




but only very slowly on the




corresponding chlorobenzoates



4-hydroxybenzoate--



CoA ligase



Phenylacetate--CoA
Also acts, more slowly, on acetate,



ligase
propanoate and butanoate, but not on




hydroxy derivatives of phenylacetate and




related compounds


Phenylalanine, tyrosine
Quinate 5-


and tryptophan biosynthesis
dehydrogenase



Shikimate 5-



dehydrogenase



Quinate dehydrogenase



(pyrroloquinoline-



quinone)



Phenylalanine 4-



monooxygenase



Prephenate
This enzyme in the enteric bacteria also



dehydrogenase
possesses chorismate mutase activity (EC




5.4.99.5) and converts chorismate into




prephenate



Prephenate



dehydrogenase



(NADP+)



Cyclohexadienyl
Also acts on prephenate and D-



dehydrogenase
prephenyllactate (cf. EC 1.3.1.12)



2-methyl-branched-
From Ascaris suum The reaction



chain-enoyl-CoA
proceeds only in the presence of another



reductase
flavoprotein (ETF = [PRIME]Electron-




Transferring Flavoprotein[PRIME])



Phenylalanine
The enzyme from Bacillus badius and



dehydrogenase
Sporosarcina ureae are highly specific for




L-phenylalanine, that from Bacillus




sphaericus also acts on L-tyrosine



L-amino acid oxidase



Anthranilate
In some organisms, this enzyme is part of



phosphoribosyl-
a multifunctional protein together with



transferase
one or more components of the system




for biosynthesis of tryptophan (EC




4.1.1.48, EC 4.1.3.27, EC 4.2.1.20, and




EC 5.3.1.24)



3-phosphoshikimate 1-



carboxyvinyl-



transferase



Aspartate
Also acts on L-tyrosine, L-phenylalanine



aminotransferase
and L-tryptophan. This activity can be




formed from EC 2.6.1.57 by controlled




proteolysis



Tyrosine
L-phenylalanine can act instead of L-



aminotransferase
tyrosine The mitochondrial enzyme may




be identical with EC 2.6.1.1 The three




isoenzymic forms are interconverted by




EC 3.4.22.4



Aromatic amino acid
L-methionine can also act as donor, more



transferase
slowly Oxaloacetate can act as acceptor




Controlled proteolysis converts the




enzyme to EC 2.6.1.1



Histidinol-phosphate



aminotransferase



Shikimate kinase



Indole-3-glycerol-
In some organisms, this enzyme is part of



phosphate synthase
a multifunctional protein together with




one or more components of the system




for biosynthesis of tryptophan (EC




2.4.2.18, EC 4.1.3.27, EC 4.2.1.20, and




EC 5.3.1.24)



2-dehydro-3-



deoxyphosphoheptonate



aldolase



Anthranilate synthase
In some organisms, this enzyme is part of




a multifunctional protein together with




one or more components of the system




for biosynthesis of tryptophan (EC




2.4.2.18, EC 4.1.1.48, EC 4.2.1.20, and




EC 5.3.1.24) The native enzyme in the




complex with uses either glutamine or




(less efficiently) NH(3). The enzyme




separated from the complex uses NH(3)




only



3-dehydroquinate



dehydratase



Phosphopyruvate
Also acts on 3-phospho-D-erythronate



hydratase



Tryptophan synthase
Also catalyses the conversion of serine




and indole into tryptophan and water and




of indoleglycerol phosphate into indole




and glyceraldehyde phosphate In some




organisms, this enzyme is part of a




multifunctional protein together with one




or more components of the system for




biosynthesis of tryptophan (EC 2.4.2.18,




EC 4.1.1.48, EC 4.1.3.27, and EC




5.3.1.24)



Prephenate dehydratase
This enzyme in the enteric bacteria also




possesses chorismate mutase activity and




converts chorismate into prephenate



Carboxycyclohexadienyl
Also acts on prephenate and D-



dehydratase
prephenyllactate Cf. EC 4.2.1.51



3-dehydroquinate
The hydrogen atoms on C-7 of the



synthase
substrate are retained on C-2 of the




products



Chorismate synthase
Shikimate is numbered so that the




double-bond is between C-1 and C-2, but




some earlier papers numbered in the




reverse direction



Phosphoribosylanthranilate
In some organisms, this enzyme is part of



isomerase
a multifunctional protein together with




one or more components of the system




for biosynthesis of tryptophan (EC




2.4.2.18, EC 4.1.1.48, EC 4.1.3.27, and




EC 4.2.1.20)



Chorismate mutase



Tyrosine--tRNA ligase



Phenylalanine--tRNA



ligase


Starch and sucrose
UDP-glucose 6-
Also acts on UDP-2-deoxyglucose


metabolism
dehydrogenase



Glucoside 3-
The enzyme acts on D-glucose, D-



dehydrogenase
galactose, D-glucosides and D-




galactosides, but D-glucosides react more




rapidly than D-galactosides



CDP-4-dehydro-6-
Two proteins are involved but no partial



deoxyglucose reductase
reaction has been observed in the




presence of either alone



Phosphorylase
The recommended name should be




qualified in each instance by adding the




name of the natural substance, e.g.




maltodextrin phosphorylase, starch




phosphorylase, glycogen phosphorylase



Levansucrase
Some other sugars can act as D-fructosyl




acceptors



Glycogen (starch)
The recommended name varies according



synthase
to the source of the enzyme and the




nature of its synthetic product Glycogen




synthase from animal tissues is a




complex of a catalytic subunit and the




protein glycogenin The enzyme requires




glucosylated glycogenin as a primer; this




is the reaction product of EC 2.4.1.186 A




similar enzyme utilizes ADP-glucose (Cf.




EC 2.4.1.21)



Cellulose synthase
Involved in the synthesis of cellulose A



(UDP-forming)
similar enzyme utilizes GDP-glucose (Cf.




EC 2.4.1.29)



Sucrose synthase



Sucrose-phosphate



synthase



Alpha,alpha-trehalose-
See also EC 2.4.1.36



phosphate synthase



(UDP-forming)



UDP-
Family of enzymes accepting a wide



glucuronosyltransferase
range of substrates, including phenols,




alcohols, amines and fatty acids Some of




the activities catalysed were previously




listed separately as EC 2.4.1.42, EC




2.4.1.59, EC 2.4.1.61, EC 2.4.1.76, EC




2.4.1.77, EC 2.4.1.84, EC 2.4.1.107 and




EC 2.4.1.108 A temporary nomenclature




for the various forms whose delineation




is in a state of flux



1,4-alpha-glucan
Converts amylose into amylopectin The



branching enzyme
recommended name requires a




qualification depending on the product,




glycogen or amylopectin, e.g. glycogen




branching enzyme, amylopectin




branching enzyme. The latter has




frequently been termed Q-enzyme



Cellobiose



phosphorylase



Starch (bacterial
The recommended name various



glycogen) synthase
according to the source of the enzyme




and the nature of its synthetic product,




e.g. starch synthase, bacterial glycogen




synthase A similar enzyme utilizes UDP-




glucose (Cf. EC 2.4.1.11)



4-alpha-
An enzymic activity of this nature forms



glucanotransferase
part of the mammalian and Yeast




glycogen branching system (see EC




3.2.1.33)



Cellulose synthase
Involved in the synthesis of cellulose A



(GDP-forming)
similar enzyme utilizes UDP-glucose (Cf.




EC 2.4.1.12)



1,3-beta-glucan



synthase



Phenol beta-
Acts on a wide range of phenols



glucosyltransferase



Amylosucrase



Polygalacturonate 4-



alpha-



galacturonosyltransferase



Dextransucrase



Alpha,alpha-trehalose



phosphorylase



Sucrose phosphorylase
In the forward reaction, arsenate may




replace phosphate In the reverse reaction




various ketoses and L-arabinose may




replace D-fructose



Maltose phosphorylase



1,4-beta-D-xylan



synthase



Hexokinase
D-glucose, D-mannose, D-fructose,




sorbitol and D-glucosamine can act as




acceptors ITP and dATP can act as




donors The liver isoenzyme has




sometimes been called glucokinase



Phosphoglucokinase



Glucose-1,6-
D-glucose 6-phosphate can act as



bisphosphate synthase
acceptor, forming D-glucose 1,6-




bisphosphate



Glucokinase
A group of enzymes found in




invertebrates and microorganisms highly




specific for glucose



Fructokinase



Glucose-1-phosphate



phosphodismutase



Protein-N(PI)-
Comprises a group of related enzymes



phosphohistidine-sugar
The protein substrate is a phosphocarrier



phosphotransferase
protein of low molecular mass (9.5 Kd) A




phosphoenzyme intermediate is formed




The enzyme translocates the sugar it




phosphorylates into bacteria Aldohexoses




and their glycosides and alditols are




phosphorylated on O-6; fructose and




sorbose on O-1 Glycerol and




disaccharides are also substrates



Glucose-1-phosphate



adenylyltransferase



Glucose-1-phosphate



cytidylyltransferase



Glucose-1-phosphate
Also acts, more slowly, on D-mannose 1-



guanylyltransferase
phosphate



UTP--glucose-1-



phosphate



uridylyltransferase



Pectinesterase



Trehalose-phosphatase



Sucrose-phosphatase



Glucose-6-phosphatase
Wide distribution in animal tissues Also




catalyses potent transphosphorylations




from carbamoyl phosphate, hexose




phosphates, pyrophosphate,




phosphoenolpyruvate and nucleoside di-




and triphosphates, to D-glucose, D-




mannose, 3-methyl-D-glucose, or 2-




deoxy-D-glucose (cf. EC 2.7.1.62, EC




2.7.1.79, and EC 3.9.1.1)



Alpha-amylase
Acts on starch, glycogen and related




polysaccharides and oligosaccharides in a




random manner; reducing groups are




liberated in the alpha-configuration



Oligo-1,6-glucosidase
Also hydrolyses palatinose The enzyme




from intestinal mucosa is a single




polypeptide chain also catalysing the




reaction of EC 3.2.1.48



Maltose-6[PRIME]-
Hydrolyses a variety of 6-phospho-D-



phosphate glucosidase
glucosides, including maltose 6-




phosphate, alpha[PRIME]alpha-trehalose




6-phosphate, sucrose 6-phosphate and p-




nitrophenyl-alpha-D-glucopyranoside 6-




phosphate (as a chromogenic substrate)




The enzyme is activated by Fe(II),




Mn(II), Co(II) and Ni(II). It is rapidly




inactivated in air



Polygalacturonase



Beta-amylase
Acts on starch, glycogen and related




polysaccharides and oligosaccharides




producing beta-maltose by an inversion



Alpha-glucosidase
Group of enzymes whose specificity is




directed mainly towards the




exohydrolysis of 1,4-alpha-glucosidic




linkages, and that hydrolyse




oligosaccharides rapidly, relative to




polysaccharides, which are hydrolysed




relatively slowly, or not at all The




intestinal enzyme also hydrolyses




polysaccharides, catalysing the reactions




of EC 3.2.1.3, and, more slowly,




hydrolyses 1,6-alpha-D-glucose links



Beta-glucosidase
Wide specificity for beta-D-glucosides.




Some examples also hydrolyse one or




more of the following: beta-D-




galactosides, alpha-L-arabinosides, beta-




D-xylosides, and beta-D-fucosides



Beta-fructofuranosidase
Substrates include sucrose Also catalyses




fructotransferase reactions



Alpha,alpha-trehalase



Glucan 1,4-alpha-
Most forms of the enzyme can rapidly



glucosidase
hydrolyse 1,6-alpha-D-glucosidic bonds




when the next bond in sequence is 1,4,




and some preparations of this enzyme




hydrolyse 1,6- and 1,3-alpha-D-




glucosidic bonds in other polysaccharides




This entry covers all such enzymes acting




on polysaccharides more rapidly than on




oligosaccharides EC 3.2.1.20 from




mammalian intestine can catalyse similar




reactions



Beta-glucuronidase



Amylo-1,6-glucosidase
In mammals and yeast this enzyme is




linked to a glycosyltransferase similar to




EC 2.4.1.25; together these two activities




constitute the glycogen debranching




system



Xylan 1,4-beta-
Also hydrolyses xylobiose Some other



xylosidase
exoglycosidase activities have been




found associated with this enzyme in




sheep liver



Glucan endo-1,3-beta-
Very limited action on mixed-link (1,3-



D-glucosidase
1,4-)-beta-D-glucans Hydrolyses




laminarin, paramylon and pachyman




Different from EC 3.2.1.6



Cellulase
Will also hydrolyse 1,4-linkages in beta-




D-glucans also containing 1,3-linkages



Sucrose alpha-
This enzyme is isolated from intestinal



glucosidase
mucosa as a single polypeptide chain also




displaying activity towards isomaltose




(oligo-1,6-glucosidase, cf. EC 3.2.1.10)



Cyclomaltodextrinase
Also hydrolyses linear maltodextrin



Glucan 1,3-beta-
Acts on oligosaccharides but very slowly



glucosidase
on laminaribiose



Levanase



Galacturan 1,4-alpha-



galacturonidase



Glucan 1,4-beta-
Acts on 1,4-beta-D-glucans and related



glucosidase
oligosaccharides Cellobiose is




hydrolysed, very slowly



Cellulose 1,4-beta-



cellobiosidase



Alpha,alpha-



phosphotrehalase



ADP-sugar
Has a distinct specificity from the UDP-



diphosphatase
sugar pyrophosphatase (EC 3.6.1.45)



Nucleotide
Substrates include NAD(+), NADP(+),



pyrophosphatase
FAD, CoA and also ATP and ADP



UDP-glucuronate



decarboxylase



CDP-glucose 4,6-



dehydratase



CDP-abequose



epimerase



UDP-glucuronate 4-



epimerase



Glucose-6-phosphate
Also catalyses the anomerization of D-



isomerase
glucose 6-phosphate



Phosphoglucomutase
Maximum activity is only obtained in the




presence of alpha-D-glucose 1,6-




bisphosphate. This bisphosphate is an




intermediate in the reaction, being




formed by transfer of a phosphate residue




from the enzyme to the substrate, but the




dissociation of bisphosphate from the




enzyme complex is much slower than the




overall isomerization Also, more slowly,




catalyses the interconversion of 1-




phosphate and 6-phosphate isomers of




many other alpha-D-hexoses, and the




interconversion of alpha-D-ribose 1-




phosphate and 5-phosphate



Beta-



phosphoglucomutase



Maltose alpha-D-



glucosyltransferase


Tryptophan metabolism
Indole-3-lactate



dehydrogenase



Indole-3-acetaldehyde



reductase (NADH)



Indole-3-acetaldehyde



reductase (NADPH)



3-hydroxyacyl-CoA
Also oxidizes S-3-hydroxyacyl-N-



dehydrogenase
acylthioethanolamine and S-3-




hydroxyacylhydrolipoate Some enzymes




act, more slowly, with NADP(+) Broad




specificity to acyl chain-length (cf. EC




1.1.1.211)



O-aminophenol oxidase
Isophenoxazine may be formed by a




secondary condensation from the initial




oxidation product



Catalase
This enzyme can also act as a peroxidase




(EC 1.11.1.7) for which several organic




substances, especially ethanol, can act as




a hydrogen donor A manganese protein




containing Mn(III) in the resting state,




which also belongs here, is often called




pseudocatalase Enzymes from some




microorganisms, such as Penicillium




simplicissimum, which exhibit both




catalase and peroxidase activity, have




sometimes been referred to as catalase-




peroxidase



7,8-



dihydroxykynurenate



8,8A-dioxygenase



Tryptophan 2,3-
Broad specificity towards tryptamine and



dioxygenase
derivatives including D- and L-




tryptophan, 5-hydroxytryptophan and




serotonin



Indole 2,3-dioxygenase
The enzyme from jasminum is a




flavoprotein containing copper, and




forms anthranilate as the final product




One enzyme from Tecoma stans is also a




flavoprotein containing copper and uses




three atoms of oxygen per molecule of




indole, to form anthranil (3,4-




benzisoxazole) A second enzyme from




Tecoma stans, which is not a




flavoprotein, uses four atoms of oxygen




and forms anthranilate as the final




product



2,3-dihydroxyindole



2,3-dioxygenase



Indoleamine-pyrrole
Acts on many substituted and



2,3-dioxygenase
unsubstituted indoleamines, including




melatonin Involved in the degradation of




melatonin



3-hydroxyanthranilate
The product of the reaction



3,4-dioxygenase
spontaneously rearrange to quinolinic




acid (quin)



Tryptophan 2-



monooxygenase



Tryptophan 2[PRIME]-
Acts on a number of indolyl-3-alkane



dioxygenase
derivatives, oxidizing the 3-side-chain in




the 2[PRIME]-position. Best substrates




are L-tryptophan and 5-hydroxy-L-




tryptophan



Kynurenine 3-



monooxygenase



Unspecific
Acts on a wide range of substrates



monooxygenase
including many xenobiotics, steroids,




fatty acids, vitamins and prostaglandins




Reactions catalysed include




hydroxylation, epoxidation, N-oxidation,




sulfooxidation, N-, S- and O-




dealkylations, desulfation, deamination,




and reduction of azo, nitro, and N-oxide




groups



Anthranilate 3-



monooxygenase



Tryptophan 5-
Activated by phosphorylation, catalysed



monooxygenase
by a CA(2+)-activated protein kinase



Kynurenine 7,8-



hydroxylase



Aldehyde
Wide specificity, including oxidation of



dehydrogenase (NAD+)
D-glucuronolactone to D-glucarate



Aminomuconate-
Also acts on 2-hydroxymuconate



semialdehyde
semialdehyde



dehydrogenase



Aldehyde oxidase
Also oxidizes quinoline and pyridine




derivatives May be identical with EC




1.1.3.22



Indole-3-acetaldehyde
Also oxidizes indole-3-aldehyde and



oxidase
acetaldehyde, more slowly



Oxoglutarate
Component of the multienzyme 2-



dehydrogenase
oxoglutarate dehydrogenase complex



(lipoamide)



Kynurenate-7,8-



dihydrodiol



dehydrogenase



Glutaryl-CoA



dehydrogenase



L-amino acid oxidase



Amine oxidase (flavin-
Acts on primary amines, and usually also



containing)
on secondary and tertiary amines



Amine oxidase (copper-
A group of enzymes including those



containing)
oxidizing primary amines, diamines and




histamine One form of EC 1.3.1.15 from




rat kidney also catalyses this reaction



Acetylindoxyl oxidase



Acetylserotonin O-
Some other hydroxyindoles also act as



methyltransferase
acceptor, more slowly



Indole-3-pyruvate C-



methyltransferase



Amine N-
A wide range of primary, secondary, and



methyltransferase
tertiary amines can act as acceptors,




including tryptamine, aniline, nicotine




and a variety of drugs and other




xenobiotics



Aralkylamine N-
Narrow specificity towards



acetyltransferase
aralkylamines, including serotonin Not




identical with EC 2.3.1.5



Acetyl-CoA C-



acetyltransferase



Tryptophan
Also acts on 5-hydroxytryptophan and, to



aminotransferase
a lesser extent on the phenyl amino acids



Kynurenine--
Also acts on 3-hydroxykynurenine



oxoglutarate



aminotransferase



Thioglucosidase
Has a wide specificity for thioglycosides



Amidase



Formamidase
Also acts, more slowly, on acetamide,




propanamide and butanamide



Arylformamidase
Also acts on other aromatic




formylamines



Nitrilase
Acts on a wide range of aromatic nitriles




including (indole-3-yl)-acetonitrile and




also on some aliphatic nitriles, and on the




corresponding acid amides (cf. EC




4.2.1.84)



Kynureninase
Also acts on 3[PRIME]-




hydroxykynurenine and some other (3-




arylcarbonyl)-alanines



Aromatic-L-amino-acid
Also acts on L-tryptophan, 5-hydroxy-L-



decarboxylase
tryptophan and dihydroxy-L-




phenylalanine (DOPA)



Phenylpyruvate
Also acts on indole-3-pyruvate



decarboxylase



Aminocarboxymuconate-
The product rearranges non-enzymically



semialdehyde
to picolinate



decarboxylase



Tryptophanase
Also catalyses the synthesis of




tryptophan from indole and serine Also




catalyses 2,3-elimination and beta-




replacement reactions of some indole-




substituted tryptophan analogs of L-




cysteine, L-serine and other 3-substituted




amino acids



Enoyl-CoA hydratase
Acts in the reverse direction With cis-




compounds, yields (3R)-3-hydroxyacyl-




CoA (cf. EC 4.2.1.74)



Nitrile hydratase
Acts on short-chain aliphatic nitriles,




converting them into the corresponding




acid amides Does not act on these amides




or on aromatic nitriles (cf EC 3.5.5.1)



Tryptophan--tRNA



ligase


Tyrosine metabolism
Alcohol dehydrogenase
Acts on primary or secondary alcohols or




hemiacetals The animal, but not the




yeast, enzyme acts also on cyclic




secondary alcohols



(R)-4-
Also acts, more slowly, on (R)-3-



hydroxyphenyllactate
phenyllactate, (R)-3-(indole-3-yl)lactate



dehydrogenase
and (R)-lactate



Hydroxyphenylpyruvate
Also acts on 3-(3,4-



reductase
dihydroxyphenyl)lactate Involved with




EC 2.3.1.140 in the biosynthesis of




rosmarinic acid



Aryl-alcohol
A group of enzymes with broad



dehydrogenase
specificity towards primary alcohols with




an aromatic or cyclohex-1-ene ring, but




with low or no activity towards short-




chain aliphatic alcohols



Catechol oxidase
Also acts on a variety of substituted




catechols Many of these enzymes also




catalyse the reaction listed under EC




1.14.18.1; this is especially true for the




classical tyrosinase



Iodide peroxidase



3,4-



dihydroxyphenylacetate



2,3-dioxygenase



4-



hydroxyphenylpyruvate



dioxygenase



Stizolobate synthase
The intermediate product undergoes ring




closure and oxidation, with NAD(P)(+)




as acceptor, to stizolobic acid



Stizolobinate synthase
The intermediate product undergoes ring




closure and oxidation, with NAD(P)(+)




as acceptor, to stizolobinic acid



Gentisate 1,2-



dioxygenase



Homogentisate 1,2-



dioxygenase



4-hydroxyphenylacetate
Also acts on 4-hydroxyhydratropate



1-monooxygenase
forming 2-methylhomogentisate and on




4-hydroxyphenoxyacetate forming




hydroquinone and glycolate



4-hydroxyphenylacetate



3-monooxygenase



Tyrosine N-



monooxygenase



Hydroxyphenylacetonitrile



2-monooxygenase



Tyrosine 3-
Activated by phosphorylation, catalysed



monooxygenase
by EC 2.7.1.128



Dopamine-beta-
Stimulated by fumarate



monooxygenase



Monophenol
A group of copper proteins that also



monooxygenase
catalyse the reaction of EC 1.10.3.1, if




only 1,2-benzenediols are available as




substrate



Succinate-



semialdehyde



dehydrogenase



(NAD(P)+)



Aryl-aldehyde
Oxidizes a number of aromatic



dehydrogenase
aldehydes, but not aliphatic aldehydes



Aldehyde
Wide specificity, including oxidation of



dehydrogenase (NAD+)
D-glucuronolactone to D-glucarate



4-carboxy-2-
Does not act on unsubstituted aliphatic or



hydroxymuconate-6-
aromatic aldehydes or glucose NAD(+)



semialdehyde
can replace NADP(+), but with lower



dehydrogenase
affinity



Aldehyde



dehydrogenase



(NAD(P)+)



4-
With EC 4.2.1.87, brings about the



hydroxyphenylacetaldehyde
metabolism of octopamine in



dehydrogenase
Pseudomonas



Aldehyde oxidase
Also oxidizes quinoline and pyridine




derivatives May be identical with EC




1.1.3.22



L-amino acid oxidase



Amine oxidase (flavin-
Acts on primary amines, and usually also



containing)
on secondary and tertiary amines



Amine oxidase (copper-
A group of enzymes including those



containing)
oxidizing primary amines, diamines and




histamine One form of EC 1.3.1.15 from




rat kidney also catalyses this reaction



Aralkylamine
Phenazine methosulfate can act as



dehydrogenase
acceptor Acts on aromatic amines and,




more slowly, on some long-chain




aliphatic amines, but not on methylamine




or ethylamine (cf EC 1.4.99.3)



Phenol O-
Acts on a wide variety of simple alkyl-,



methyltransferase
methoxy- and halo-phenols



Tyramine N-
Has some activity on phenylethylamine



methyltransferase
analogs



Phenylethanolamine N-
Acts on various phenylethanolamines;



methyltransferase
converts noradrenalin into adrenalin



Catechol O-
The mammalian enzymes act more



methyltransferase
rapidly on catecholamines such as




adrenaline or noradrenaline than on




catechols



Glutamine N-



phenylacetyltransferase



Rosmarinate synthase
Involved with EC 1.1.1.237 in the




biosynthesis of rosmarinic acid



Hydroxymandelonitrile
3,4-dihydroxymandelonitrile can also act



glucosyltransferase
as acceptor



Aspartate
Also acts on L-tyrosine, L-phenylalanine



aminotransferase
and L-tryptophan. This activity can be




formed from EC 2.6.1.57 by controlled




proteolysis



Dihydroxyphenylalanine



aminotransferase



Tyrosine
L-phenylalanine can act instead of L-



aminotransferase
tyrosine The mitochondrial enzyme may




be identical with EC 2.6.1.1 The three




isoenzymic forms are interconverted by




EC 3.4.22.4



Aromatic amino acid
L-methionine can also act as donor, more



transferase
slowly Oxaloacetate can act as acceptor




Controlled proteolysis converts the




enzyme to EC 2.6.1.1



Histidinol-phosphate



aminotransferase



Fumarylacetoacetase
Also acts on other 3,5- and 2,4-dioxo




acids



Acylpyruvate hydrolase
Acts on formylpyruvate, 2,4-




dioxopentanoate, 2,4-dioxohexanoate and




2,4-dioxoheptanoate



Tyrosine decarboxylase
The bacterial enzyme also acts on 3-




hydroxytyrosine and, more slowly, on 3-




hydroxyphenylalanine



Aromatic-L-amino-acid
Also acts on L-tryptophan, 5-hydroxy-L-



decarboxylase
tryptophan and dihydroxy-L-




phenylalanine (DOPA)



Gentisate



decarboxylase



5-oxopent-3-ene-1,2,5-



tricarboxylate



decarboxylase



Tyrosine phenol-lyase
Also slowly catalyses pyruvate formation




from D-tyrosine, S-methyl-L-cysteine,




L-cysteine, L-serine and D-serine



(S)-norcoclaurine
The reaction makes a 6-membered ring



synthase
by forming a bond between C-6 of the




3,4-dihydroxyphenyl group of the




dopamine and C-1 of the aldehyde in the




imine formed between the substrates The




product is the precursor of the




benzylisoquinoline alkaloids in plants




Will also catalyse the reaction of 4-(2-




aminoethyl)benzene-1,2-diol + (3,4-




dihydroxyphenyl)acetaldehyde to form




(S)-norlaudanosoline, but this alkaloid




has not been found to occur in plants



Dihydroxyphenylalanine



ammonia-lyase



Phenylalanine
May also act on L-tyrosine



ammonia-lyase



Maleylacetoacetate
Also acts on maleylpyruvate



isomerase



Maleylpyruvate



isomerase



Phenylpyruvate
Also acts on other arylpyruvates



tautomerase



5-carboxymethyl-2-



hydroxymuconate



delta-isomerase



Tyrosine 2,3-



aminomutase



Phenylacetate--CoA
Also acts, more slowly, on acetate,



ligase
propanoate and butanoate, but not on




hydroxy derivatives of phenylacetate and




related compounds









VII. Promoters as Sentinels

Useful promoters include those that are capable of facilitating preferential transcription, i.e. tissue-specific or developmentally regulated gene expression and being a component of facile systems to evaluate the metabolic/physiological state of a plant cell, tissue or organ. Many such promoters are included in this application. Operably linking a sequence to these promoters that can act as a reporter and inserting the construct into a plant allows detection of the preferential in plantar transcription. For example, the quantitative state of responses to environmental conditions can be detected by using a plant having a construct that contains a stress-inducible promoter linked to and controlling expression of a sequence encoding GFP. The greater the stress promoter is induced, the greater the levels of fluorescence from GFP will be produced and this provides a measure of the level of stress being expressed by the plant and/or the ability of the plant to respond internally to the stress.


More specifically, using this system the activities of any metabolic pathway (catabolic and anabolic), stress-related pathways as on any plant gene repeated activity can be monitored. In addition, assays can be developed using this sentinel system to select for superior genotypes with greater yield characteristics or to select for plants with altered responses to chemical, herbicide, or plant growth regulators or to identify chemical, herbicides or plant growth regulators by their response on such sentinels.


Specifically, a promoter that is regulated in plants in the desired way, is operably linked to a reporter such as GFP, RFP, etc., and the constructs are introduced into the plant of interest. The behavior of the reporter is monitored using technologies typically specific for that reporter. With GFP, RFP, etc., it could typically be by microscopy of whole plants, organs, tissues or cells under excitation by an appropriate wavelength of UV light.


VIII. How to Make Different Embodiments of the Invention

The invention relates to (I) polynucleotides and methods of use thereof, such as


IA. Probes, Primers and Substrates;


IB. Methods of Detection and Isolation;

    • B.1. Hybridization;
    • B.2. Methods of Mapping;
    • B.3. Southern Blotting;
    • B.4. Isolating cDNA from Related Organisms;
    • B.5. Isolating and/or Identifying Orthologous Genes


IC. Methods of Inhibiting Gene Expression

    • C.1. Antisense
    • C.2. Ribozyme Constructs;
    • C.3. Chimeraplasts;
    • C.4 Co-Suppression;
    • C.5. Transcriptional Silencing
    • C.6. Other Methods to Inhibit Gene Expression


ID. Methods of Functional Analysis;


IE. Promoter Sequences and Their Use;


IF. UTRs and/or Intron Sequences and Their Use; and


IG. Coding Sequences and Their Use.


The invention also relates to (II) polypeptides and proteins and methods of use thereof, such as


IIA. Native Polypeptides and Proteins

    • A.1 Antibodies
    • A.2 In Vitro Applications


IIB. Polypeptide Variants, Fragments and Fusions

    • B.1 Variants
    • B.2 Fragments
    • B.3 Fusions


The invention also includes (III) methods of modulating polypeptide production, such as


IIIA. Suppression

    • A.1 Antisense
    • A.2 Ribozymes
    • A.3 Co-suppression
    • A.4 Insertion of Sequences into the Gene to be Modulated
    • A.5 Promoter Modulation
    • A.6 Expression of Genes containing Dominant-Negative Mutations


IIIB. Enhanced Expression

    • B.1 Insertion of an Exogenous Gene
    • B.2 Promoter Modulation


The invention further concerns (IV) gene constructs and vector construction, such as


IVA. Coding Sequences


IVB. Promoters


IVC. Signal Peptides


The invention still further relates to


V. Transformation Techniques


I. Polynucleotides

Exemplified SDFs of the invention represent fragments of the genome of corn, wheat, rice, soybean or Arabidopsis and/or represent mRNA expressed from that genome. The isolated nucleic acid of the invention also encompasses corresponding fragments of the genome and/or cDNA complement of other organisms as described in detail below.


Polynucleotides of the invention can be isolated from polynucleotide libraries using primers comprising sequences similar to those described, in the attached Reference, Sequences Protein Group, and Protein Group Matrix Tables or complements thereof. See, for example, the methods described in Sambrook et al., supra.


Alternatively, the polynucleotides of the invention can be produced by chemical synthesis. Such synthesis methods are described below.


It is contemplated that the nucleotide sequences presented herein may contain some small percentage of errors. These errors may arise in the normal course of determination of nucleotide sequences. Sequence errors can be corrected by obtaining seeds deposited under the accession numbers cited above, propagating them, isolating genomic DNA or appropriate mRNA from the resulting plants or seeds thereof, amplifying the relevant fragment of the genomic DNA or mRNA using primers having a sequence that flanks the erroneous sequence, and sequencing the amplification product.


I.A. Probes, Primers and Substrates


SDFs of the invention can be applied to substrates for use in array applications such as, but not limited to, assays of global gene expression, for example under varying conditions of development, growth conditions. The arrays can also be used in diagnostic or forensic methods (WO95/35505, U.S. Pat. No. 5,445,943 and U.S. Pat. No. 5,410,270).


Probes and primers of the instant invention will hybridize to a polynucleotide comprising a sequence in or encoded by those in the Reference, Sequence, Protein Group, and Protein Group Matrix tables or fragments or complement thereof. Though many different nucleotide sequences can encode an amino acid sequence, the sequences of the reference and Sequence table or sequences that encode polypeptides or fragments thereof described in Protein Group and Protein Group Matrix tables are generally preferred for encoding polypeptides of the invention. However, the sequence of the probes and/or primers of the instant invention need not be identical to those in the Reference and Sequence tables or the complements thereof. For example, some variation in probe or primer sequence and/or length can allow additional family members to be detected, as well as orthologous genes and more taxonomically distant related sequences. Similarly, probes and/or primers of the invention can include additional nucleotides that serve as a label for detecting the formed duplex or for subsequent cloning purposes.


Probe length will vary depending on the application. For use as primers, probes are 12-40 nucleotides, preferably 18-30 nucleotides long. For use in mapping, probes are preferably 50 to 500 nucleotides, preferably 100-250 nucleotides long. For Southern hybridizations, probes as long as several kilobases can be used as explained below.


The probes and/or primers can be produced by synthetic procedures such as the triester method of Matteucci et al. J. Am. Chem. Soc. 103:3185(1981); or according to Urdea et al. Proc. Natl. Acad. 80:7461 (1981) or using commercially available automated oligonucleotide synthesizers.


I.B. Methods of Detection and Isolation


The polynucleotides of the invention can be utilized in a number of methods known to those skilled in the art as probes and/or primers to isolate and detect polynucleotides, including, without limitation: Southerns, Northerns, Branched DNA hybridization assays, polymerase chain reaction, and microarray assays, and variations thereof. Specific methods given by way of examples, and discussed below include:


Hybridization


Methods of Mapping


Southern Blotting


Isolating cDNA from Related Organisms


Isolating and/or Identifying Orthologous Genes.


Also, the nucleic acid molecules of the invention can used in other methods, such as high density oligonucleotide hybridizing assays, described, for example, in U.S. Pat. Nos. 6,004,753; 5,945,306; 5,945,287; 5,945,308; 5,919,686; 5,919,661; 5,919,627; 5,874,248; 5,871,973; 5,871,971; and 5,871,930; and PCT Pub. Nos. WO 9946380; WO 9933981; WO 9933870; WO 9931252; WO 9915658; WO 9906572; WO 9858052; WO 9958672; and WO 9810858.


B.1. Hybridization


The isolated SDFs of the Reference and Sequence tables or SDFs encoding polypeptides of the Protein Group and Protein Group Matrix tables or fragments thereof of the present invention can be used as probes and/or primers for detection and/or isolation of related polynucleotide sequences through hybridization. Hybridization of one nucleic acid to another constitutes a physical property that defines the subject SDF of the invention and the identified related sequences. Also, such hybridization imposes structural limitations on the pair. A good general discussion of the factors for determining hybridization conditions is provided by Sambrook et al. (“Molecular Cloning, a Laboratory Manual, 2nd ed., c. 1989 by Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; see esp., chapters 11 and 12). Additional considerations and details of the physical chemistry of hybridization are provided by G. H. Keller and M. M. Manak “DNA Probes”, 2nd Ed. pp. 1-25, c. 1993 by Stockton Press, New York, N.Y.


Depending on the stringency of the conditions under which these probes and/or primers are used, polynucleotides exhibiting a wide range of similarity to those in the Reference and Sequence or encoding polypeptides of the Protein Group and Protein Group Matrix tables or fragments thereof can be detected or isolated. When the practitioner wishes to examine the result of membrane hybridizations under a variety of stringencies, an efficient way to do so is to perform the hybridization under a low stringency condition, then to wash the hybridization membrane under increasingly stringent conditions.


When using SDFs to identify orthologous genes in other species, the practitioner will preferably adjust the amount of target DNA of each species so that, as nearly as is practical, the same number of genome equivalents are present for each species examined. This prevents faint signals from species having large genomes, and thus small numbers of genome equivalents per mass of DNA, from erroneously being interpreted as absence of the corresponding gene in the genome.


The probes and/or primers of the instant invention can also be used to detect or isolate nucleotides that are “identical” to the probes or primers. Two nucleic acid sequences or polypeptides are said to be “identical” if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below.


Isolated polynucleotides within the scope of the invention also include allelic variants of the specific sequences presented in the Reference, Sequence, Protein Group, and Protein Group Matrix tables. The probes and/or primers of the invention can also be used to detect and/or isolate polynucleotides exhibiting at least 80% sequence identity with the sequences of the reference, Sequence or encoding polypeptides of the Protein Group and Protein Group Matrix tables or fragments thereof.


With respect to nucleotide sequences, degeneracy of the genetic code provides the possibility to substitute at least one base of the base sequence of a gene with a different base without causing the amino acid sequence of the polypeptide produced from the gene to be changed. Hence, the DNA of the present invention may also have any base sequence that has been changed from a sequence in the Reference, Sequence, Protein Group, and Protein Group Matrix tables by substitution in accordance with degeneracy of genetic code. References describing codon usage include: Carels et al., J. Mol. Evol. 46: 45 (1998) and Fennoy et al., Nucl. Acids Res. 21(23): 5294 (1993).


B.2. Mapping


The isolated SDF DNA of the invention can be used to create various types of genetic and physical maps of the genome of corn, Arabidopsis, soybean, rice, wheat, or other plants. Some SDFs may be absolutely associated with particular phenotypic traits, allowing construction of gross genetic maps. While not all SDFs will immediately be associated with a phenotype, all SDFs can be used as probes for identifying polymorphisms associated with phenotypes of interest. Briefly, one method of mapping involves total DNA isolation from individuals. It is subsequently cleaved with one or more restriction enzymes, separated according to mass, transferred to a solid support, hybridized with SDF DNA and the pattern of fragments compared. Polymorphisms associated with a particular SDF are visualized as differences in the size of fragments produced between individual DNA samples after digestion with a particular restriction enzyme and hybridization with the SDF. After identification of polymorphic SDF sequences, linkage studies can be conducted. By using the individuals showing polymorphisms as parents in crossing programs, F2 progeny recombinants or recombinant inbreds, for example, are then analyzed. The order of DNA polymorphisms along the chromosomes can be determined based on the frequency with which they are inherited together versus independently. The closer two polymorphisms are together in a chromosome the higher the probability that they are inherited together. Integration of the relative positions of all the polymorphisms and associated marker SDFs can produce a genetic map of the species, where the distances between markers reflect the recombination frequencies in that chromosome segment.


The use of recombinant inbred lines for such genetic mapping is described for Arabidopsis by Alonso-Blanco et al. (Methods in Molecular Biology, vol. 82, “Arabidopsis Protocols”, pp. 137-146, J. M. Martinez-Zapater and J. Salinas, eds., c. 1998 by Humana Press, Totowa, N.J.) and for corn by Burr (“Mapping Genes with Recombinant Inbreds”, pp. 249-254. In Freeling, M. and V. Walbot (Ed.), The Maize Handbook, c. 1994 by Springer-Verlag New York, Inc.: New York, N.Y., USA; Berlin Germany; Burr et al. Genetics (1998) 118: 519; Gardiner, J. et al., (1993) Genetics 134: 917). This procedure, however, is not limited to plants and can be used for other organisms (such as yeast) or for individual cells.


The SDFs of the present invention can also be used for simple sequence repeat (SSR) mapping. Rice SSR mapping is described by Morgante et al. (The Plant Journal (1993) 3: 165), Panaud et al. (Genome (1995) 38: 1170); Senior et al. (Crop Science (1996) 36: 1676), Taramino et al. (Genome (1996) 39: 277) and Ahn et al. (Molecular and General Genetics (1993) 241: 483-90). SSR mapping can be achieved using various methods. In one instance, polymorphisms are identified when sequence specific probes contained within an SDF flanking an SSR are made and used in polymerase chain reaction (PCR) assays with template DNA from two or more individuals of interest. Here, a change in the number of tandem repeats between the SSR-flanking sequences produces differently sized fragments (U.S. Pat. No. 5,766,847). Alternatively, polymorphisms can be identified by using the PCR fragment produced from the SSR-flanking sequence specific primer reaction as a probe against Southern blots representing different individuals (U. H. Refseth et al., (1997) Electrophoresis 18: 1519).


Genetic and physical maps of crop species have many uses. For example, these maps can be used to devise positional cloning strategies for isolating novel genes from the mapped crop species. In addition, because the genomes of closely related species are largely syntenic (that is, they display the same ordering of genes within the genome), these maps can be used to isolate novel alleles from relatives of crop species by positional cloning strategies.


The various types of maps discussed above can be used with the SDFs of the invention to identify Quantitative Trait Loci (QTLs). Many important crop traits, such as the solids content of tomatoes, are quantitative traits and result from the combined interactions of several genes. These genes reside at different loci in the genome, oftentimes on different chromosomes, and generally exhibit multiple alleles at each locus. The SDFs of the invention can be used to identify QTLs and isolate specific alleles as described by de Vicente and Tanksley (Genetics 134:585 (1993)). In addition to isolating QTL alleles in present crop species, the SDFs of the invention can also be used to isolate alleles from the corresponding QTL of wild relatives. Transgenic plants having various combinations of QTL alleles can then be created and the effects of the combinations measured. Once a desired allele combination has been identified, crop improvement can be accomplished either through biotechnological means or by directed conventional breeding programs (for review see Tanksley and McCouch, Science 277:1063 (1997)).


In another embodiment, the SDFs can be used to help create physical maps of the genome of corn, Arabidopsis and related species. Where SDFs have been ordered on a genetic map, as described above, they can be used as probes to discover which clones in large libraries of plant DNA fragments in YACs, BACs, etc. contain the same SDF or similar sequences, thereby facilitating the assignment of the large DNA fragments to chromosomal positions. Subsequently, the large BACs, YACs, etc. can be ordered unambiguously by more detailed studies of their sequence composition (e.g. Marra et al. (1997) Genomic Research 7:1072-1084) and by using their end or other sequences to find the identical sequences in other cloned DNA fragments. The overlapping of DNA sequences in this way allows large contigs of plant sequences to be built that, when sufficiently extended, provide a complete physical map of a chromosome. Sometimes the SDFs themselves will provide the means of joining cloned sequences into a contig.


The patent publication WO95/35505 and U.S. Pat. Nos. 5,445,943 and 5,410,270 describe scanning multiple alleles of a plurality of loci using hybridization to arrays of oligonucleotides. These techniques are useful for each of the types of mapping discussed above.


Following the procedures described above and using a plurality of the SDFs of the present invention, any individual can be genotyped. These individual genotypes can be used for the identification of particular cultivars, varieties, lines, ecotypes and genetically modified plants or can serve as tools for subsequent genetic studies involving multiple phenotypic traits.


B.3 Southern Blot Hybridization


The sequences from Reference and Sequence and those encoding polypeptides of Protein Group and Protein Group Matrix tables or fragments thereof can be used as probes for various hybridization techniques. These techniques are useful for detecting target polynucleotides in a sample or for determining whether transgenic plants, seeds or host cells harbor a gene or sequence of interest and thus might be expected to exhibit a particular trait or phenotype.


In addition, the SDFs from the invention can be used to isolate additional members of gene families from the same or different species and/or orthologous genes from the same or different species. This is accomplished by hybridizing an SDF to, for example, a Southern blot containing the appropriate genomic DNA or cDNA. Given the resulting hybridization data, one of ordinary skill in the art could distinguish and isolate the correct DNA fragments by size, restriction sites, sequence and stated hybridization conditions from a gel or from a library.


Identification and isolation of orthologous genes from closely related species and alleles within a species is particularly desirable because of their potential for crop improvement. Many important crop traits, such as the solid content of tomatoes, result from the combined interactions of the products of several genes residing at different loci in the genome. Generally, alleles at each of these loci can make quantitative differences to the trait. By identifying and isolating numerous alleles for each locus from within or different species, transgenic plants with various combinations of alleles can be created and the effects of the combinations measured. Once a more favorable allele combination has been identified, crop improvement can be accomplished either through biotechnological means or by directed conventional breeding programs (Tanksley et al. Science 277:1063(1997)).


The results from hybridizations of the SDFs of the invention to, for example, Southern blots containing DNA from another species can also be used to generate restriction fragment maps for the corresponding genomic regions. These maps provide additional information about the relative positions of restriction sites within fragments, further distinguishing mapped DNA from the remainder of the genome.


Physical maps can be made by digesting genomic DNA with different combinations of restriction enzymes.


Probes for Southern blotting to distinguish individual restriction fragments can range in size from 15 to 20 nucleotides to several thousand nucleotides. More preferably, the probe is 100 to 1,000 nucleotides long for identifying members of a gene family when it is found that repetitive sequences would complicate the hybridization. For identifying an entire corresponding gene in another species, the probe is more preferably the length of the gene, typically 2,000 to 10,000 nucleotides, but probes 50-1,000 nucleotides long might be used. Some genes, however, might require probes up to 1,500 nucleotides long or overlapping probes constituting the full-length sequence to span their lengths.


Also, while it is preferred that the probe be homogeneous with respect to its sequence, it is not necessary. For example, as described below, a probe representing members of a gene family having diverse sequences can be generated using PCR to amplify genomic DNA or RNA templates using primers derived from SDFs that include sequences that define the gene family.


For identifying corresponding genes in another species, the next most preferable probe is a cDNA spanning the entire coding sequence, which allows all of the mRNA-coding fragment of the gene to be identified. Probes for Southern blotting can easily be generated from SDFs by making primers having the sequence at the ends of the SDF and using corn or Arabidopsis genomic DNA as a template. In instances where the SDF includes sequence conserved among species, primers including the conserved sequence can be used for PCR with genomic DNA from a species of interest to obtain a probe.


Similarly, if the SDF includes a domain of interest, that fragment of the SDF can be used to make primers and, with appropriate template DNA, used to make a probe to identify genes containing the domain. Alternatively, the PCR products can be resolved, for example by gel electrophoresis, and cloned and/or sequenced. Using Southern hybridization, the variants of the domain among members of a gene family, both within and across species, can be examined.


B.4.1 Isolating DNA from Related Organisms


The SDFs of the invention can be used to isolate the corresponding DNA from other organisms. Either cDNA or genomic DNA can be isolated. For isolating genomic DNA, a lambda, cosmid, BAC or YAC, or other large insert genomic library from the plant of interest can be constructed using standard molecular biology techniques as described in detail by Sambrook et al. 1989 (Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, New York) and by Ausubel et al. 1992 (Current Protocols in Molecular Biology, Greene Publishing, New York).


To screen a phage library, for example, recombinant lambda clones are plated out on appropriate bacterial medium using an appropriate E. coli host strain. The resulting plaques are lifted from the plates using nylon or nitrocellulose filters. The plaque lifts are processed through denaturation, neutralization, and washing treatments following the standard protocols outlined by Ausubel et al. (1992). The plaque lifts are hybridized to either radioactively labeled or non-radioactively labeled SDF DNA at room temperature for about 16 hours, usually in the presence of 50% formamide and 5×SSC (sodium chloride and sodium citrate) buffer and blocking reagents. The plaque lifts are then washed at 42° C. with 1% Sodium Dodecyl Sulfate (SDS) and at a particular concentration of SSC. The SSC concentration used is dependent upon the stringency at which hybridization occurred in the initial Southern blot analysis performed. For example, if a fragment hybridized under medium stringency (e.g., Tm−20° C.), then this condition is maintained or preferably adjusted to a less stringent condition (e.g., Tm−30° C.) to wash the plaque lifts. Positive clones show detectable hybridization e.g., by exposure to X-ray films or chromogen formation. The positive clones are then subsequently isolated for purification using the same general protocol outlined above. Once the clone is purified, restriction analysis can be conducted to narrow the region corresponding to the gene of interest. The restriction analysis and succeeding subcloning steps can be done using procedures described by, for example Sambrook et al. (1989) cited above.


The procedures outlined for the lambda library are essentially similar to those used for YAC library screening, except that the YAC clones are harbored in bacterial colonies. The YAC clones are plated out at reasonable density on nitrocellulose or nylon filters supported by appropriate bacterial medium in petri plates. Following the growth of the bacterial clones, the filters are processed through the denaturation, neutralization, and washing steps following the procedures of Ausubel et al. 1992. The same hybridization procedures for lambda library screening are followed.


To isolate cDNA, similar procedures using appropriately modified vectors are employed. For instance, the library can be constructed in a lambda vector appropriate for cloning cDNA such as λgt11. Alternatively, the cDNA library can be made in a plasmid vector. cDNA for cloning can be prepared by any of the methods known in the art, but is preferably prepared as described above. Preferably, a cDNA library will include a high proportion of full-length clones.


B. 5. Isolating and/or Identifying Orthologous Genes


Probes and primers of the invention can be used to identify and/or isolate polynucleotides related to those in the Reference, Sequence, Protein Group, and Protein Group Matrix tables. Related polynucleotides are those that are native to other plant organisms and exhibit either similar sequence or encode polypeptides with similar biological activity. One specific example is an orthologous gene. Orthologous genes have the same functional activity. As such, orthologous genes may be distinguished from homologous genes. The percentage of identity is a function of evolutionary separation and, in closely related species, the percentage of identity can be 98 to 100%. The amino acid sequence of a protein encoded by an orthologous gene can be less than 75% identical, but tends to be at least 75% or at least 80% identical, more preferably at least 90%, most preferably at least 95% identical to the amino acid sequence of the reference protein.


To find orthologous genes, the probes are hybridized to nucleic acids from a species of interest under low stringency conditions, preferably one where sequences containing as much as 40-45% mismatches will be able to hybridize. This condition is established by Tm−40° C. to Tm−48° C. (see below). Blots are then washed under conditions of increasing stringency. It is preferable that the wash stringency be such that sequences that are 85 to 100% identical will hybridize. More preferably, sequences 90 to 100% identical will hybridize and most preferably only sequences greater than 95% identical will hybridize. One of ordinary skill in the art will recognize that, due to degeneracy in the genetic code, amino acid sequences that are identical can be encoded by DNA sequences as little as 67% identical or less. Thus, it is preferable, for example, to make an overlapping series of shorter probes, on the order of 24 to 45 nucleotides, and individually hybridize them to the same arrayed library to avoid the problem of degeneracy introducing large numbers of mismatches.


As evolutionary divergence increases, genome sequences also tend to diverge. Thus, one of skill will recognize that searches for orthologous genes between more divergent species will require the use of lower stringency conditions compared to searches between closely related species. Also, degeneracy of the genetic code is more of a problem for searches in the genome of a species more distant evolutionarily from the species that is the source of the SDF probe sequences.


Therefore the method described in Bouckaert et al., U.S. Ser. No. 60/121,700 Atty. Dkt. No. 2750-117P, Client Dkt. No. 00010.001, filed Feb. 25, 1999, hereby incorporated in its entirety by reference, can be applied to the SDFs of the present invention to isolate related genes from plant species which do not hybridize to the corn Arabidopsis, soybean, rice, wheat, and other plant sequences of the reference, Sequence, Protein Group, and Protein Group Matrix tables.


Identification of the relationship of nucleotide or amino acid sequences among plant species can be done by comparing the nucleotide or amino acid sequences of SDFs of the present application with nucleotide or amino acid sequences of other SDFs such as those present in applications listed in the table below:


The SDFs of the invention can also be used as probes to search for genes that are related to the SDF within a species. Such related genes are typically considered to be members of a gene family. In such a case, the sequence similarity will often be concentrated into one or a few fragments of the sequence. The fragments of similar sequence that define the gene family typically encode a fragment of a protein or RNA that has an enzymatic or structural function. The percentage of identity in the amino acid sequence of the domain that defines the gene family is preferably at least 70%, more preferably 80 to 95%, most preferably 85 to 99%. To search for members of a gene family within a species, a low stringency hybridization is usually performed, but this will depend upon the size, distribution and degree of sequence divergence of domains that define the gene family. SDFs encompassing regulatory regions can be used to identify coordinately expressed genes by using the regulatory region sequence of the SDF as a probe.


In the instances where the SDFs are identified as being expressed from genes that confer a particular phenotype, then the SDFs can also be used as probes to assay plants of different species for those phenotypes.


I.C. Methods to Inhibit Gene Expression


The nucleic acid molecules of the present invention can be used to inhibit gene transcription and/or translation. Example of such methods include, without limitation:


Antisense Constructs;


Ribozyme Constructs;


Chimeraplast Constructs;


Co-Suppression;


Transcriptional Silencing; and


Other Methods of Gene Expression.


C.1 Antisense


In some instances it is desirable to suppress expression of an endogenous or exogenous gene. A well-known instance is the FLAVOR-SAVOR™ tomato, in which the gene encoding ACC synthase is inactivated by an antisense approach, thus delaying softening of the fruit after ripening. See for example, U.S. Pat. No. 5,859,330; U.S. Pat. No. 5,723,766; Oeller, et al, Science, 254:437-439(1991); and Hamilton et al, Nature, 346:284-287 (1990). Also, timing of flowering can be controlled by suppression of the FLOWERING LOCUS C (FLC); high levels of this transcript are associated with late flowering, while absence of FLC is associated with early flowering (S. D. Michaels et al., Plant Cell 11:949 (1999). Also, the transition of apical meristem from production of leaves with associated shoots to flowering is regulated by TERMINAL FLOWER1, APETALA1 and LEAFY. Thus, when it is desired to induce a transition from shoot production to flowering, it is desirable to suppress TFL1 expression (S. J. Liljegren, Plant Cell 11:1007 (1999)). As another instance, arrested ovule development and female sterility result from suppression of the ethylene forming enzyme but can be reversed by application of ethylene (D. De Martinis et al., Plant Cell 11:1061 (1999)). The ability to manipulate female fertility of plants is useful in increasing fruit production and creating hybrids.


In the case of polynucleotides used to inhibit expression of an endogenous gene, the introduced sequence need not be perfectly identical to a sequence of the target endogenous gene. The introduced polynucleotide sequence will typically be at least substantially identical to the target endogenous sequence.


Some polynucleotide SDFs in the Reference, Sequence, Protein Group, and Protein Group Matrix tables represent sequences that are expressed in corn, wheat, rice, soybean Arabidopsis and/or other plants. Thus the invention includes using these sequences to generate antisense constructs to inhibit translation and/or degradation of transcripts of said SDFs, typically in a plant cell.


To accomplish this, a polynucleotide segment from the desired gene that can hybridize to the mRNA expressed from the desired gene (the “antisense segment”) is operably linked to a promoter such that the antisense strand of RNA will be transcribed when the construct is present in a host cell. A regulated promoter can be used in the construct to control transcription of the antisense segment so that transcription occurs only under desired circumstances.


The antisense segment to be introduced generally will be substantially identical to at least a fragment of the endogenous gene or genes to be repressed. The sequence, however, need not be perfectly identical to inhibit expression. Further, the antisense product may hybridize to the untranslated region instead of or in addition to the coding sequence of the gene. The vectors of the present invention can be designed such that the inhibitory effect applies to other proteins within a family of genes exhibiting homology or substantial homology to the target gene.


For antisense suppression, the introduced antisense segment sequence also need not be full length relative to either the primary transcription product or the fully processed mRNA. Generally, a higher percentage of sequence identity can be used to compensate for the use of a shorter sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments may be equally effective. Normally, a sequence of between about 30 or 40 nucleotides and the full length of the transcript can be used, though a sequence of at least about 100 nucleotides is preferred, a sequence of at least about 200 nucleotides is more preferred, and a sequence of at least about 500 nucleotides is especially preferred.


C.2. Ribozymes


It is also contemplated that gene constructs representing ribozymes and based on the SDFs in the Reference and Sequence tables or those encoding polypeptides of the Protein Group and Protein Group Matrix tables and fragment thereof are an object of the invention. Ribozymes can also be used to inhibit expression of genes by suppressing the translation of the mRNA into a polypeptide. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs.


A number of classes of ribozymes have been identified. One class of ribozymes is derived from a number of small circular RNAs, which are capable of self-cleavage and replication in plants. The RNAs replicate either alone (viroid RNAs) or with a helper virus (satellite RNAs). Examples include RNAs from avocado sunblotch viroid and the satellite RNAs from tobacco ringspot virus, lucerne transient streak virus, velvet tobacco mottle virus, solanum nodiflorum mottle virus and subterranean clover mottle virus. The design and use of target RNA-specific ribozymes is described in Haseloff et al. Nature, 334:585 (1988).


Like the antisense constructs above, the ribozyme sequence fragment necessary for pairing need not be identical to the target nucleotides to be cleaved, nor identical to the sequences in the Reference and Sequence tables or those encoding polypeptide of the Protein Group and Protein Group Matrix tables or fragments thereof. Ribozymes may be constructed by combining the ribozyme sequence and some fragment of the target gene which would allow recognition of the target gene mRNA by the resulting ribozyme molecule. Generally, the sequence in the ribozyme capable of binding to the target sequence exhibits a percentage of sequence identity with at least 80%, preferably with at least 85%, more preferably with at least 90% and most preferably with at least 95%, even more preferably, with at least 96%, 97%, 98% or 99% sequence identity to some fragment of a sequence in the Reference, Sequence, Protein Group, and Protein Group Matrix tables or the complement thereof. The ribozyme can be equally effective in inhibiting mRNA translation by cleaving either in the untranslated or coding regions. Generally, a higher percentage of sequence identity can be used to compensate for the use of a shorter sequence. Furthermore, the introduced sequence need not have the same intron or exon pattern, and homology of non-coding segments may be equally effective.


C.3. Chimeraplasts


The SDFs of the invention, such as those described by Reference, Sequence, Protein Group, and Protein Group Matrix tables, can also be used to construct chimeraplasts that can be introduced into a cell to produce at least one specific nucleotide change in a sequence corresponding to the SDF of the invention. A chimeraplast is an oligonucleotide comprising DNA and/or RNA that specifically hybridizes to a target region in a manner which creates a mismatched base-pair. This mismatched base-pair signals the cell's repair enzyme machinery which acts on the mismatched region resulting in the replacement, insertion or deletion of designated nucleotide(s). The altered sequence is then expressed by the cell's normal cellular mechanisms. Chimeraplasts can be designed to repair mutant genes, modify genes, introduce site-specific mutations, and/or act to interrupt or alter normal gene function (U.S. Pat. Nos. 6,010,907 and 6,004,804; and PCT Pub. No. WO99/58723 and WO99/07865).


C.4. Sense Suppression


The SDFs of the reference, Sequence, Protein Group, and Protein Group Matrix tables of the present invention are also useful to modulate gene expression by sense suppression. Sense suppression represents another method of gene suppression by introducing at least one exogenous copy or fragment of the endogenous sequence to be suppressed.


Introduction of expression cassettes in which a nucleic acid is configured in the sense orientation with respect to the promoter into the chromosome of a plant or by a self-replicating virus has been shown to be an effective means by which to induce degradation of mRNAs of target genes. For an example of the use of this method to modulate expression of endogenous genes see, Napoli et al., The Plant Cell 2:279 (1990), and U.S. Pat. Nos. 5,034,323, 5,231,020, and 5,283,184. Inhibition of expression may require some transcription of the introduced sequence.


For sense suppression, the introduced sequence generally will be substantially identical to the endogenous sequence intended to be inactivated. The minimal percentage of sequence identity will typically be greater than about 65%, but a higher percentage of sequence identity might exert a more effective reduction in the level of normal gene products. Sequence identity of more than about 80% is preferred, though about 95% to absolute identity would be most preferred. As with antisense regulation, the effect would likely apply to any other proteins within a similar family of genes exhibiting homology or substantial homology to the suppressing sequence.


C.5. Transcriptional Silencing


The nucleic acid sequences of the invention, including the SDFs of the reference, Sequence, Protein Group, and Protein Group Matrix tables, and fragments thereof, contain sequences that can be inserted into the genome of an organism resulting in transcriptional silencing. Such regulatory sequences need not be operatively linked to coding sequences to modulate transcription of a gene. Specifically, a promoter sequence without any other element of a gene can be introduced into a genome to transcriptionally silence an endogenous gene (see, for example, Vaucheret, H et al. (1998) The Plant Journal 16: 651-659). As another example, triple helices can be formed using oligonucleotides based on sequences from Reference, Sequence, Protein Group, and Protein Group Matrix tables, fragments thereof, and substantially similar sequence thereto. The oligonucleotide can be delivered to the host cell and can bind to the promoter in the genome to form a triple helix and prevent transcription. An oligonucleotide of interest is one that can bind to the promoter and block binding of a transcription factor to the promoter. In such a case, the oligonucleotide can be complementary to the sequences of the promoter that interact with transcription binding factors.


C.6. Other Methods to Inhibit Gene Expression


Yet another means of suppressing gene expression is to insert a polynucleotide into the gene of interest to disrupt transcription or translation of the gene.


Low frequency homologous recombination can be used to target a polynucleotide insert to a gene by flanking the polynucleotide insert with sequences that are substantially similar to the gene to be disrupted. Sequences from Reference, Sequence, Protein Group, and Protein Group Matrix tables, fragments thereof, and substantially similar sequence thereto can be used for homologous recombination.


In addition, random insertion of polynucleotides into a host cell genome can also be used to disrupt the gene of interest. Azpiroz-Leehan et al., Trends in Genetics 13:152 (1997). In this method, screening for clones from a library containing random insertions is preferred to identifying those that have polynucleotides inserted into the gene of interest. Such screening can be performed using probes and/or primers described above based on sequences from Reference, Sequence, Protein Group, and Protein Group Matrix tables, fragments thereof, and substantially similar sequence thereto. The screening can also be performed by selecting clones or R1 plants having a desired phenotype.


I.D. Methods of Functional Analysis


The constructs described in the methods under I.C. above can be used to determine the function of the polypeptide encoded by the gene that is targeted by the constructs.


Down-regulating the transcription and translation of the targeted gene in the host cell or organisms, such as a plant, may produce phenotypic changes as compared to a wild-type cell or organism. In addition, in vitro assays can be used to determine if any biological activity, such as calcium flux, DNA transcription, nucleotide incorporation, etc., are being modulated by the down-regulation of the targeted gene.


Coordinated regulation of sets of genes, e.g., those contributing to a desired polygenic trait, is sometimes necessary to obtain a desired phenotype. SDFs of the invention representing transcription activation and DNA binding domains can be assembled into hybrid transcriptional activators. These hybrid transcriptional activators can be used with their corresponding DNA elements (i.e., those bound by the DNA-binding SDFs) to effect coordinated expression of desired genes (J. J. Schwarz et al., Mol. Cell. Biol. 12:266 (1992), A. Martinez et al., Mol. Gen. Genet. 261:546 (1999)).


The SDFs of the invention can also be used in the two-hybrid genetic systems to identify networks of protein-protein interactions (L. McAlister-Henn et al., Methods 19:330 (1999), J. C. Hu et al., Methods 20:80 (2000), M. Golovkin et al., J. Biol. Chem. 274:36428 (1999), K. Ichimura et al., Biochem. Biophys. Res. Comm. 253:532 (1998)). The SDFs of the invention can also be used in various expression display methods to identify important protein-DNA interactions (e.g. B. Luo et al., J. Mol. Biol. 266:479 (1997)).


I.E. Promoters


The SDFs of the invention are also useful as structural or regulatory sequences in a construct for modulating the expression of the corresponding gene in a plant or other organism, e.g. a symbiotic bacterium. For example, promoter sequences associated to SDFs of the reference, Sequence, Protein Group, and Protein Group Matrix tables of the present invention can be useful in directing expression of coding sequences either as constitutive promoters or to direct expression in particular cell types, tissues, or organs or in response to environmental stimuli.


With respect to the SDFs of the present invention a promoter is likely to be a relatively small portion of a genomic DNA (gDNA) sequence located in the first 2000 nucleotides upstream from an initial exon identified in a gDNA sequence or initial “ATG” or methionine codon or translational start site in a corresponding cDNA sequence. Such promoters are more likely to be found in the first 1000 nucleotides upstream of an initial ATG or methionine codon or translational start site of a cDNA sequence corresponding to a gDNA sequence. In particular, the promoter is usually located upstream of the transcription start site. The fragments of a particular gDNA sequence that function as elements of a promoter in a plant cell will preferably be found to hybridize to gDNA sequences presented and described in the Reference table at medium or high stringency, relevant to the length of the probe and its base composition.


Promoters are generally modular in nature. Promoters can consist of a basal promoter that functions as a site for assembly of a transcription complex comprising an RNA polymerase, for example RNA polymerase II. A typical transcription complex will include additional factors such as TFIIB, TFIID, and TFIIE. Of these, TFIID appears to be the only one to bind DNA directly. The promoter might also contain one or more enhancers and/or suppressors that function as binding sites for additional transcription factors that have the function of modulating the level of transcription with respect to tissue specificity and of transcriptional responses to particular environmental or nutritional factors, and the like.


Short DNA sequences representing binding sites for proteins can be separated from each other by intervening sequences of varying length. For example, within a particular functional module, protein binding sites may be constituted by regions of 5 to 60, preferably 10 to 30, more preferably 10 to 20 nucleotides. Within such binding sites, there are typically 2 to 6 nucleotides that specifically contact amino acids of the nucleic acid binding protein. The protein binding sites are usually separated from each other by 10 to several hundred nucleotides, typically by 15 to 150 nucleotides, often by 20 to 50 nucleotides. DNA binding sites in promoter elements often display dyad symmetry in their sequence. Often elements binding several different proteins, and/or a plurality of sites that bind the same protein, will be combined in a region of 50 to 1,000 basepairs.


Elements that have transcription regulatory function can be isolated from their corresponding endogenous gene, or the desired sequence can be synthesized, and recombined in constructs to direct expression of a coding region of a gene in a desired tissue-specific, temporal-specific or other desired manner of inducibility or suppression. When hybridizations are performed to identify or isolate elements of a promoter by hybridization to the long sequences presented in the Reference tables, conditions are adjusted to account for the above-described nature of promoters. For example short probes, constituting the element sought, are preferably used under low temperature and/or high salt conditions. When long probes, which might include several promoter elements are used, low to medium stringency conditions are preferred when hybridizing to promoters across species.


If a nucleotide sequence of an SDF, or part of the SDF, functions as a promoter or fragment of a promoter, then nucleotide substitutions, insertions or deletions that do not substantially affect the binding of relevant DNA binding proteins would be considered equivalent to the exemplified nucleotide sequence. It is envisioned that there are instances where it is desirable to decrease the binding of relevant DNA binding proteins to silence or down-regulate a promoter, or conversely to increase the binding of relevant DNA binding proteins to enhance or up-regulate a promoter and vice versa. In such instances, polynucleotides representing changes to the nucleotide sequence of the DNA-protein contact region by insertion of additional nucleotides, changes to identity of relevant nucleotides, including use of chemically-modified bases, or deletion of one or more nucleotides are considered encompassed by the present invention. In addition, fragments of the promoter sequences described by Reference tables and variants thereof can be fused with other promoters or fragments to facilitate transcription and/or transcription in specific type of cells or under specific conditions.


Promoter function can be assayed by methods known in the art, preferably by measuring activity of a reporter gene operatively linked to the sequence being tested for promoter function. Examples of reporter genes include those encoding luciferase, green fluorescent protein, GUS, neo, cat and bar.


I.F. UTRs and Junctions


Polynucleotides comprising untranslated (UTR) sequences and intron/exon junctions are also within the scope of the invention. UTR sequences include introns and 5′ or 3′ untranslated regions (5′ UTRs or 3′ UTRs). Fragments of the sequences shown in the Reference and Sequence tables can comprise UTRs and intron/exon junctions.


These fragments of SDFs, especially UTRs, can have regulatory functions related to, for example, translation rate and mRNA stability. Thus, these fragments of SDFs can be isolated for use as elements of gene constructs for regulated production of polynucleotides encoding desired polypeptides.


Introns of genomic DNA segments might also have regulatory functions. Sometimes regulatory elements, especially transcription enhancer or suppressor elements, are found within introns. Also, elements related to stability of heteronuclear RNA and efficiency of splicing and of transport to the cytoplasm for translation can be found in intron elements. Thus, these segments can also find use as elements of expression vectors intended for use to transform plants.


Just as with promoters UTR sequences and intron/exon junctions can vary from those shown in the Reference and Sequence tables. Such changes from those sequences preferably will not affect the regulatory activity of the UTRs or intron/exon junction sequences on expression, transcription, or translation unless selected to do so. However, in some instances, down- or up-regulation of such activity may be desired to modulate traits or phenotypic or in vitro activity.


I.G. Coding Sequences


Isolated polynucleotides of the invention can include coding sequences that encode polypeptides comprising an amino acid sequence encoded by sequences described in the Reference and Sequence tables or an amino acid sequence presented in the Reference, Sequence, Protein Group, and Protein Group Matrix tables.


A nucleotide sequence encodes a polypeptide if a cell (or a cell free in vitro system) expressing that nucleotide sequence produces a polypeptide having the recited amino acid sequence when the nucleotide sequence is transcribed and the primary transcript is subsequently processed and translated by a host cell (or a cell free in vitro system) harboring the nucleic acid. Thus, an isolated nucleic acid that encodes a particular amino acid sequence can be a genomic sequence comprising exons and introns or a cDNA sequence that represents the product of splicing thereof. An isolated nucleic acid encoding an amino acid sequence also encompasses heteronuclear RNA, which contains sequences that are spliced out during expression, and mRNA, which lacks those sequences.


Coding sequences can be constructed using chemical synthesis techniques or by isolating coding sequences or by modifying such synthesized or isolated coding sequences as described above.


In addition to coding sequences encoding the polypeptide sequences of the reference, Sequence, Protein Group, and Protein Group Matrix tables, which are native to corn, Arabidopsis, soybean, rice, wheat, and other plants, the isolated polynucleotides can be polynucleotides that encode variants, fragments, and fusions of those native proteins. Such polypeptides are described below in part II.


In variant polynucleotides generally, the number of substitutions, deletions or insertions is preferably less than 20%, more preferably less than 15%; even more preferably less than 10%, 5%, 3% or 1% of the number of nucleotides comprising a particularly exemplified sequence. It is generally expected that non-degenerate nucleotide sequence changes that result in 1 to 10, more preferably 1 to 5 and most preferably 1 to 3 amino acid insertions, deletions or substitutions will not greatly affect the function of an encoded polypeptide. The most preferred embodiments are those wherein 1 to 20, preferably 1 to 10, most preferably 1 to 5 nucleotides are added to, or deleted from and/or substituted in the sequences specifically disclosed in the Reference and Sequence tables or polynucleotides that encode polypeptides of the Protein Group, and Protein Group Matrix tables or fragments thereof.


Insertions or deletions in polynucleotides intended to be used for encoding a polypeptide preferably preserve the reading frame. This consideration is not so important in instances when the polynucleotide is intended to be used as a hybridization probe.


II. Polypeptides and Proteins

IIA. Native Polypeptides and Proteins


Polypeptides within the scope of the invention include both native proteins as well as variants, fragments, and fusions thereof. Polypeptides of the invention are those encoded by any of the six reading frames of sequences shown in the Reference and Sequence tables, preferably encoded by the three frames reading in the 5′ to 3′ direction of the sequences as shown.


Native polypeptides include the proteins encoded by the sequences shown in the Reference and Sequence tables. Such native polypeptides include those encoded by allelic variants.


Polypeptide and protein variants will exhibit at least 75% sequence identity to those native polypeptides of the Reference and Sequence tables. More preferably, the polypeptide variants will exhibit at least 85% sequence identity; even more preferably, at least 90% sequence identity; more preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity. Fragments of polypeptide or fragments of polypeptides will exhibit similar percentages of sequence identity to the relevant fragments of the native polypeptide. Fusions will exhibit a similar percentage of sequence identity in that fragment of the fusion represented by the variant of the native peptide.


Polypeptide and protein variants of the invention will exhibit at least 75% sequence identity to those motifs or consensus sequences of the Protein Group and Protein Group Matrix tables. More preferably, the polypeptide variants will exhibit at least 85% sequence identity; even more preferably, at least 90% sequence identity; more preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity. Fragments of polypeptide or fragments of polypeptides will exhibit similar percentages of sequence identity to the relevant fragments of the native polypeptide that are indicated in the Protein Group table. Fusions will exhibit a similar percentage of sequence identity in that fragment of the fusion represented by the variant of the native peptide.


Furthermore, polypeptide variants will exhibit at least one of the functional properties of the native protein. Such properties include, without limitation, protein interaction, DNA interaction, biological activity, immunological activity, receptor binding, signal transduction, transcription activity, growth factor activity, secondary structure, three-dimensional structure, etc. As to properties related to in vitro or in vivo activities, the variants preferably exhibit at least 60% of the activity of the native protein; more preferably at least 70%, even more preferably at least 80%, 85%, 90% or 95% of at least one activity of the native protein.


One type of variant of native polypeptides comprises amino acid substitutions, deletions and/or insertions. Conservative substitutions are preferred to maintain the function or activity of the polypeptide.


Within the scope of percentage of sequence identity described above, a polypeptide of the invention may have additional individual amino acids or amino acid sequences inserted into the polypeptide in the middle thereof and/or at the N-terminal and/or C-terminal ends thereof. Likewise, some of the amino acids or amino acid sequences may be deleted from the polypeptide.


A.1 Antibodies


Isolated polypeptides can be utilized to produce antibodies. Polypeptides of the invention can generally be used, for example, as antigens for raising antibodies by known techniques. The resulting antibodies are useful as reagents for determining the distribution of the antigen protein within the tissues of a plant or within a cell of a plant. The antibodies are also useful for examining the production level of proteins in various tissues, for example in a wild-type plant or following genetic manipulation of a plant, by methods such as Western blotting.


Antibodies of the present invention, both polyclonal and monoclonal, may be prepared by conventional methods. In general, the polypeptides of the invention are first used to immunize a suitable animal, such as a mouse, rat, rabbit, or goat. Rabbits and goats are preferred for the preparation of polyclonal sera due to the volume of serum obtainable, and the availability of labeled anti-rabbit and anti-goat antibodies as detection reagents. Immunization is generally performed by mixing or emulsifying the protein in saline, preferably in an adjuvant such as Freund's complete adjuvant, and injecting the mixture or emulsion parenterally (generally subcutaneously or intramuscularly). A dose of 50-200 μg/injection is typically sufficient. Immunization is generally boosted 2-6 weeks later with one or more injections of the protein in saline, preferably using Freund's incomplete adjuvant. One may alternatively generate antibodies by in vitro immunization using methods known in the art, which for the purposes of this invention is considered equivalent to in vivo immunization.


Polyclonal antisera is obtained by bleeding the immunized animal into a glass or plastic container, incubating the blood at 25° C. for one hour, followed by incubating the blood at 4° C. for 2-18 hours. The serum is recovered by centrifugation (e.g., 1,000×g for 10 minutes). About 20-50 ml per bleed may be obtained from rabbits.


Monoclonal antibodies are prepared using the method of Kohler and Milstein, Nature 256: 495 (1975), or modification thereof. Typically, a mouse or rat is immunized as described above. However, rather than bleeding the animal to extract serum, the spleen (and optionally several large lymph nodes) is removed and dissociated into single cells. If desired, the spleen cells can be screened (after removal of nonspecifically adherent cells) by applying a cell suspension to a plate, or well, coated with the protein antigen. B-cells producing membrane-bound immunoglobulin specific for the antigen bind to the plate, and are not rinsed away with the rest of the suspension. Resulting B-cells, or all dissociated spleen cells, are then induced to fuse with myeloma cells to form hybridomas, and are cultured in a selective medium (e.g., hypoxanthine, aminopterin, thymidine medium, “HAT”). The resulting hybridomas are plated by limiting dilution, and are assayed for the production of antibodies which bind specifically to the immunizing antigen (and which do not bind to unrelated antigens). The selected Mab-secreting hybridomas are then cultured either in vitro (e.g., in tissue culture bottles or hollow fiber reactors), or in vivo (as ascites in mice).


Other methods for sustaining antibody-producing B-cell clones, such as by EBV transformation, are known.


If desired, the antibodies (whether polyclonal or monoclonal) may be labeled using conventional techniques. Suitable labels include fluorophores, chromophores, radioactive atoms (particularly 32P and 125I) electron-dense reagents, enzymes, and ligands having specific binding partners. Enzymes are typically detected by their activity. For example, horseradish peroxidase is usually detected by its ability to convert 3,3′,5,5′-tetramethylbenzidine (TNB) to a blue pigment, quantifiable with a spectrophotometer.


A.2 In Vitro Applications of Polypeptides


Some polypeptides of the invention will have enzymatic activities that are useful in vitro. For example, the soybean trypsin inhibitor (Kunitz) family is one of the numerous families of proteinase inhibitors. It comprises plant proteins which have inhibitory activity against serine proteinases from the trypsin and subtilisin families, thiol proteinases and aspartic proteinases. Thus, these peptides find in vitro use in protein purification protocols and perhaps in therapeutic settings requiring topical application of protease inhibitors.


Delta-aminolevulinic acid dehydratase (EC 4.2.1.24) (ALAD) catalyzes the second step in the biosynthesis of heme, the condensation of two molecules of 5-aminolevulinate to form porphobilinogen and is also involved in chlorophyll biosynthesis (Kaczor et al. (1994) Plant Physiol. 1-4: 1411-7; Smith (1988) Biochem. J. 249: 423-8; Schneider (1976) Z. naturforsch. [C] 31: 55-63). Thus, ALAD proteins can be used as catalysts in synthesis of heme derivatives. Enzymes of biosynthetic pathways generally can be used as catalysts for in vitro synthesis of the compounds representing products of the pathway.


Polypeptides encoded by SDFs of the invention can be engineered to provide purification reagents to identify and purify additional polypeptides that bind to them. This allows one to identify proteins that function as multimers or elucidate signal transduction or metabolic pathways. In the case of DNA binding proteins, the polypeptide can be used in a similar manner to identify the DNA determinants of specific binding (S. Pierrou et al., Anal. Biochem. 229:99 (1995), S. Chusacultanachai et al., J. Biol. Chem. 274:23591 (1999), Q. Lin et al., J. Biol. Chem. 272:27274 (1997)).


II.B. Polypeptide Variants, Fragments, and Fusions


Generally, variants, fragments, or fusions of the polypeptides encoded by the maximum length sequence (MLS) can exhibit at least one of the activities of the identified domains and/or related polypeptides described in Sections (C) and (D) of The Reference tables corresponding to the MLS of interest.


II.B.(1) Variants


A type of variant of the native polypeptides comprises amino acid substitutions. Conservative substitutions, described above (see II.), are preferred to maintain the function or activity of the polypeptide. Such substitutions include conservation of charge, polarity, hydrophobicity, size, etc. For example, one or more amino acid residues within the sequence can be substituted with another amino acid of similar polarity that acts as a functional equivalent, for example providing a hydrogen bond in an enzymatic catalysis. Substitutes for an amino acid within an exemplified sequence are preferably made among the members of the class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid.


Within the scope of percentage of sequence identity described above, a polypeptide of the invention may have additional individual amino acids or amino acid sequences inserted into the polypeptide in the middle thereof and/or at the N-terminal and/or C-terminal ends thereof. Likewise, some of the amino acids or amino acid sequences may be deleted from the polypeptide. Amino acid substitutions may also be made in the sequences; conservative substitutions being preferred.


One preferred class of variants are those that comprise (1) the domain of an encoded polypeptide and/or (2) residues conserved between the encoded polypeptide and related polypeptides. For this class of variants, the encoded polypeptide sequence is changed by insertion, deletion, or substitution at positions flanking the domain and/or conserved residues.


Another class of variants includes those that comprise an encoded polypeptide sequence that is changed in the domain or conserved residues by a conservative substitution.


Yet another class of variants includes those that lack one of the in vitro activities, or structural features of the encoded polypeptides. One example is polypeptides or proteins produced from genes comprising dominant negative mutations. Such a variant may comprise an encoded polypeptide sequence with non-conservative changes in a particular domain or group of conserved residues.


II. A.(2) Fragments


Fragments of particular interest are those that comprise a domain identified for a polypeptide encoded by an MLS of the instant invention and variants thereof. Also, fragments that comprise at least one region of residues conserved between an MLS encoded polypeptide and its related polypeptides are of great interest. Fragments are sometimes useful as polypeptides corresponding to genes comprising dominant negative mutations are.


II.A.(3) Fusions



Of interest are chimeras comprising (1) a fragment of the MLS encoded polypeptide or variants thereof of interest and (2) a fragment of a polypeptide comprising the same domain. For example, an AP2 helix encoded by a MLS of the invention fused to second AP2 helix from ANT protein, which comprises two AP2 helices. The present invention also encompasses fusions of MLS encoded polypeptides, variants, or fragments thereof fused with related proteins or fragments thereof.


Definition of Domains

The polypeptides of the invention may possess identifying domains as shown in The Reference tables. Specific domains within the MLS encoded polypeptides are indicated in The Reference tables. In addition, the domains within the MLS encoded polypeptide can be defined by the region that exhibits at least 70% sequence identity with the consensus sequences listed in the detailed description below of each of the domains.


The majority of the protein domain descriptions given in the protein domain table are obtained from Prosite, (http//www.expasy.ch/prosite/), and Pfam, (http//pfam.wustl.edu/browse.shtml). Examples of domain descriptions are listed in the Protein Domain table.


A. Activities of Polypeptides Comprising Signal Peptides


Polypeptides comprising signal peptides are a family of proteins that are typically targeted to (1) a particular organelle or intracellular compartment, (2) interact with a particular molecule or (3) for secretion outside of a host cell. Example of polypeptides comprising signal peptides include, without limitation, secreted proteins, soluble proteins, receptors, proteins retained in the ER, etc.


These proteins comprising signal peptides are useful to modulate ligand-receptor interactions, cell-to-cell communication, signal transduction, intracellular communication, and activities and/or chemical cascades that take part in an organism outside or within of any particular cell.


One class of such proteins are soluble proteins which are transported out of the cell. These proteins can act as ligands that bind to receptor to trigger signal transduction or to permit communication between cells.


Another class is receptor proteins which also comprise a retention domain that lodges the receptor protein in the membrane when the cell transports the receptor to the surface of the cell. Like the soluble ligands, receptors can also modulate signal transduction and communication between cells.


In addition the signal peptide itself can serve as a ligand for some receptors. An example is the interaction of the ER targeting signal peptide with the signal recognition particle (SRP). Here, the SRP binds to the signal peptide, halting translation, and the resulting SRP complex then binds to docking proteins located on the surface of the ER, prompting transfer of the protein into the ER.


A description of signal peptide residue composition is described below in Subsection IV.C.1.


III. Methods of Modulating Polypeptide Production

It is contemplated that polynucleotides of the invention can be incorporated into a host cell or in-vitro system to modulate polypeptide production. For instance, the SDFs prepared as described herein can be used to prepare expression cassettes useful in a number of techniques for suppressing or enhancing expression.


An example are polynucleotides comprising sequences to be transcribed, such as coding sequences, of the present invention can be inserted into nucleic acid constructs to modulate polypeptide production. Typically, such sequences to be transcribed are heterologous to at least one element of the nucleic acid construct to generate a chimeric gene or construct.


Another example of useful polynucleotides are nucleic acid molecules comprising regulatory sequences of the present invention. Chimeric genes or constructs can be generated when the regulatory sequences of the invention linked to heterologous sequences in a vector construct. Within the scope of invention are such chimeric gene and/or constructs.


Also within the scope of the invention are nucleic acid molecules, whereof at least a part or fragment of these DNA molecules are presented in the Reference and Sequence tables or polynucleotide encoding polypeptides of the Protein Group or Protein Group Matrix tables of the present application, and wherein the coding sequence is under the control of its own promoter and/or its own regulatory elements. Such molecules are useful for transforming the genome of a host cell or an organism regenerated from said host cell for modulating polypeptide production.


Additionally, a vector capable of producing the oligonucleotide can be inserted into the host cell to deliver the oligonucleotide.


More detailed description of components to be included in vector constructs are described both above and below.


Whether the chimeric vectors or native nucleic acids are utilized, such polynucleotides can be incorporated into a host cell to modulate polypeptide production. Native genes and/or nucleic acid molecules can be effective when exogenous to the host cell.


Methods of modulating polypeptide expression includes, without limitation:


Suppression methods, such as

    • Antisense
    • Ribozymes
    • Co-suppression
    • Insertion of Sequences into the Gene to be Modulated
    • Regulatory Sequence Modulation.


as well as Methods for Enhancing Production, such as

    • Insertion of Exogenous Sequences; and
    • Regulatory Sequence Modulation.


III.A. Suppression


Expression cassettes of the invention can be used to suppress expression of endogenous genes which comprise the SDF sequence. Inhibiting expression can be useful, for instance, to tailor the ripening characteristics of a fruit (Oeller et al., Science 254:437 (1991)) or to influence seed size (WO98/07842) or to provoke cell ablation (Mariani et al., Nature 357: 384-387 (1992).


As described above, a number of methods can be used to inhibit gene expression in plants, such as antisense, ribozyme, introduction of exogenous genes into a host cell, insertion of a polynucleotide sequence into the coding sequence and/or the promoter of the endogenous gene of interest, and the like.


III.A.1. Antisense


An expression cassette as described above can be transformed into host cell or plant to produce an antisense strand of RNA. For plant cells, antisense RNA inhibits gene expression by preventing the accumulation of mRNA which encodes the enzyme of interest, see, e.g., Sheehy et al., Proc. Nat. Acad. Sci. USA, 85:8805 (1988), and Hiatt et al., U.S. Pat. No. 4,801,340.


III.A.2. Ribozymes


Similarly, ribozyme constructs can be transformed into a plant to cleave mRNA and down-regulate translation.


III.A.3. Co-Suppression


Another method of suppression is by introducing an exogenous copy of the gene to be suppressed. Introduction of expression cassettes in which a nucleic acid is configured in the sense orientation with respect to the promoter has been shown to prevent the accumulation of mRNA. A detailed description of this method is described above.


III.A.4. Insertion of Sequences into the Gene to be Modulated


Yet another means of suppressing gene expression is to insert a polynucleotide into the gene of interest to disrupt transcription or translation of the gene.


Homologous recombination could be used to target a polynucleotide insert to a gene using the Cre-Lox system (A. C. Vergunst et al., Nucleic Acids Res. 26:2729 (1998), A. C. Vergunst et al., Plant Mol. Biol. 38:393 (1998), H. Albert et al., Plant J. 7:649 (1995)).


In addition, random insertion of polynucleotides into a host cell genome can also be used to disrupt the gene of interest. Azpiroz-Leehan et al., Trends in Genetics 13:152 (1997). In this method, screening for clones from a library containing random insertions is preferred for identifying those that have polynucleotides inserted into the gene of interest. Such screening can be performed using probes and/or primers described above based on sequences from the Reference and Sequence tables or polynucleotides encoding polypeptides of the Protein Group or Protein Group Matrix tables, fragments thereof, and substantially similar sequence thereto. The screening can also be performed by selecting clones or any transgenic plants having a desired phenotype.


III.A.5. Regulatory SequenceModulation


The SDFs described in the Reference and Sequence tables or polynucleotides encoding polypeptides of the Protein Group or Protein Group Matrix tables, and fragments thereof are examples of nucleotides of the invention that contain regulatory sequences that can be used to suppress or inactivate transcription and/or translation from a gene of interest as discussed in I.C.5.


III.A.6. Genes Comprising Dominant-Negative Mutations


When suppression of production of the endogenous, native protein is desired it is often helpful to express a gene comprising a dominant negative mutation. Production of protein variants produced from genes comprising dominant negative mutations is a useful tool for research Genes comprising dominant negative mutations can produce a variant polypeptide which is capable of competing with the native polypeptide, but which does not produce the native result. Consequently, over expression of genes comprising these mutations can titrate out an undesired activity of the native protein. For example, The product from a gene comprising a dominant negative mutation of a receptor can be used to constitutively activate or suppress a signal transduction cascade, allowing examination of the phenotype and thus the trait(s) controlled by that receptor and pathway. Alternatively, the protein arising from the gene comprising a dominant-negative mutation can be an inactive enzyme still capable of binding to the same substrate as the native protein and therefore competes with such native protein.


Products from genes comprising dominant-negative mutations can also act upon the native protein itself to prevent activity. For example, the native protein may be active only as a homo-multimer or as one subunit of a hetero-multimer. Incorporation of an inactive subunit into the multimer with native subunit(s) can inhibit activity.


Thus, gene function can be modulated in host cells of interest by insertion into these cells vector constructs comprising a gene comprising a dominant-negative mutation.


III.B. Enhanced Expression


Enhanced expression of a gene of interest in a host cell can be accomplished by either (1) insertion of an exogenous gene; or (2) promoter modulation.


III.B.1. Insertion of an Exogenous Gene


Insertion of an expression construct encoding an exogenous gene can boost the number of gene copies expressed in a host cell.


Such expression constructs can comprise genes that either encode the native protein that is of interest or that encode a variant that exhibits enhanced activity as compared to the native protein. Such genes encoding proteins of interest can be constructed from the sequences from the Reference and Sequence tables or polynucleotides encoding polypeptides of the Protein Group or Protein Group Matrix tables, fragments thereof, and substantially similar sequence thereto.


Such an exogenous gene can include either a constitutive promoter permitting expression in any cell in a host organism or a promoter that directs transcription only in particular cells or times during a host cell life cycle or in response to environmental stimuli.


III.B.2. Regulatory Sequence Modulation


The SDFs of the Reference and Sequence tables, and fragments thereof, contain regulatory sequences that can be used to enhance expression of a gene of interest. For example, some of these sequences contain useful enhancer elements. In some cases, duplication of enhancer elements or insertion of exogenous enhancer elements will increase expression of a desired gene from a particular promoter. As other examples, all 11 promoters require binding of a regulatory protein to be activated, while some promoters may need a protein that signals a promoter binding protein to expose a polymerase binding site. In either case, over-production of such proteins can be used to enhance expression of a gene of interest by increasing the activation time of the promoter.


Such regulatory proteins are encoded by some of the sequences in the Reference and Sequence tables or polynucleotides encoding polypeptides of the Protein Group or Protein Group Matrix tables, fragments thereof, and substantially similar sequences thereto.


Coding sequences for these proteins can be constructed as described above.


IV. Gene Constructs and Vector Construction

To use isolated SDFs of the present invention or a combination of them or parts and/or mutants and/or fusions of said SDFs in the above techniques, recombinant DNA vectors which comprise said SDFs and are suitable for transformation of cells, such as plant cells, are usually prepared. The SDF construct can be made using standard recombinant DNA techniques (Sambrook et al. 1989) and can be introduced to the species of interest by Agrobacterium-mediated transformation or by other means of transformation (e.g., particle gun bombardment) as referenced below.


The vector backbone can be any of those typical in the art such as plasmids, viruses, artificial chromosomes, BACs, YACs and PACs and vectors of the sort described by


(a) BAC: Shizuya et al., Proc. Natl. Acad. Sci. USA 89: 8794-8797 (1992); Hamilton et al., Proc. Natl. Acad. Sci. USA 93: 9975-9979 (1996);


(b) YAC: Burke et al., Science 236:806-812 (1987);


(c) PAC: Sternberg N. et al., Proc Natl Acad Sci USA. January; 87(1):103-7 (1990);


(d) Bacteria-Yeast Shuttle Vectors: Bradshaw et al., Nucl Acids Res 23: 4850-4856 (1995);


(e) Lambda Phage Vectors: Replacement Vector, e.g.,


Frischauf et al., J. Mol Biol 170: 827-842 (1983); or Insertion vector, e.g.,


Huynh et al., In: Glover NM (ed) DNA Cloning: A practical Approach, Vol. 1 Oxford: IRL Press (1985);


(f) T-DNA gene fusion vectors: Walden et al., Mol Cell Biol 1: 175-194 (1990); and


(g) Plasmid vectors: Sambrook et al., infra.


Typically, a vector will comprise the exogenous gene, which in its turn comprises an SDF of the present invention to be introduced into the genome of a host cell, and which gene may be an antisense construct, a ribozyme construct chimeraplast, or a coding sequence with any desired transcriptional and/or translational regulatory sequences, such as promoters, UTRs, and 3′ end termination sequences. Vectors of the invention can also include origins of replication, scaffold attachment regions (SARs), markers, homologous sequences, introns, etc.


A DNA sequence coding for the desired polypeptide, for example a cDNA sequence encoding a full length protein, will preferably be combined with transcriptional and translational initiation regulatory sequences which will direct the transcription of the sequence from the gene in the intended tissues of the transformed plant.


For example, for over-expression, a plant promoter fragment may be employed that will direct transcription of the gene in all tissues of a regenerated plant. Alternatively, the plant promoter may direct transcription of an SDF of the invention in a specific tissue (tissue-specific promoters) or may be otherwise under more precise environmental control (inducible promoters).


If proper polypeptide productionis desired, a polyadenylation region at the 3′-end of the coding region is typically included. The polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from T-DNA.


The vector comprising the sequences from genes or SDF or the invention may comprise a marker gene that confers a selectable phenotype on plant cells. The vector can include promoter and coding sequence, for instance. For example, the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosulfuron or phosphinotricin.


IV.A. Coding Sequences


Generally, the sequence in the transformation vector and to be introduced into the genome of the host cell does not need to be absolutely identical to an SDF of the present invention. Also, it is not necessary for it to be full length, relative to either the primary transcription product or fully processed mRNA. Furthermore, the introduced sequence need not have the same intron or exon pattern as a native gene. Also, heterologous non-coding segments can be incorporated into the coding sequence without changing the desired amino acid sequence of the polypeptide to be produced.


IV.B. Promoters


As explained above, introducing an exogenous SDF from the same species or an orthologous SDF from another species are useful to modulate the expression of a native gene corresponding to that SDF of interest. Such an SDF construct can be under the control of either a constitutive promoter or a highly regulated inducible promoter (e.g., a copper inducible promoter). The promoter of interest can initially be either endogenous or heterologous to the species in question. When re-introduced into the genome of said species, such promoter becomes exogenous to said species. Over-expression of an SDF transgene can lead to co-suppression of the homologous endogeneous sequence thereby creating some alterations in the phenotypes of the transformed species as demonstrated by similar analysis of the chalcone synthase gene (Napoli et al., Plant Cell 2:279 (1990) and van der Krol et al., Plant Cell 2:291 (1990)). If an SDF is found to encode a protein with desirable characteristics, its over-production can be controlled so that its accumulation can be manipulated in an organ- or tissue-specific manner utilizing a promoter having such specificity.


Likewise, if the promoter of an SDF (or an SDF that includes a promoter) is found to be tissue-specific or developmentally regulated, such a promoter can be utilized to drive or facilitate the transcription of a specific gene of interest (e.g., seed storage protein or root-specific protein). Thus, the level of accumulation of a particular protein can be manipulated or its spatial localization in an organ- or tissue-specific manner can be altered.


IV. C Signal Peptides


SDFs of the present invention containing signal peptides are indicated in the Reference, Sequence, the Protein Group and Protein Group Matrix tables. In some cases it may be desirable for the protein encoded by an introduced exogenous or orthologous SDF to be targeted (1) to a particular organelle intracellular compartment, (2) to interact with a particular molecule such as a membrane molecule or (3) for secretion outside of the cell harboring the introduced SDF. This will be accomplished using a signal peptide.


Signal peptides direct protein targeting, are involved in ligand-receptor interactions and act in cell to cell communication. Many proteins, especially soluble proteins, contain a signal peptide that targets the protein to one of several different intracellular compartments. In plants, these compartments include, but are not limited to, the endoplasmic reticulum (ER), mitochondria, plastids (such as chloroplasts), the vacuole, the Golgi apparatus, protein storage vessicles (PSV) and, in general, membranes. Some signal peptide sequences are conserved, such as the Asn-Pro-Ile-Arg amino acid motif found in the N-terminal propeptide signal that targets proteins to the vacuole (Marty (1999) The Plant Cell 11: 587-599). Other signal peptides do not have a consensus sequence per se, but are largely composed of hydrophobic amino acids, such as those signal peptides targeting proteins to the ER (Vitale and Denecke (1999) The Plant Cell 11: 615-628). Still others do not appear to contain either a consensus sequence or an identified common secondary sequence, for instance the chloroplast stromal targeting signal peptides (Keegstra and Cline (1999) The Plant Cell 11: 557-570). Furthermore, some targeting peptides are bipartite, directing proteins first to an organelle and then to a membrane within the organelle (e.g. within the thylakoid lumen of the chloroplast; see Keegstra and Cline (1999) The Plant Cell 11: 557-570). In addition to the diversity in sequence and secondary structure, placement of the signal peptide is also varied. Proteins destined for the vacuole, for example, have targeting signal peptides found at the N-terminus, at the C-terminus and at a surface location in mature, folded proteins. Signal peptides also serve as ligands for some receptors.


These characteristics of signal proteins can be used to more tightly control the phenotypic expression of introduced SDFs. In particular, associating the appropriate signal sequence with a specific SDF can allow sequestering of the protein in specific organelles (plastids, as an example), secretion outside of the cell, targeting interaction with particular receptors, etc. Hence, the inclusion of signal proteins in constructs involving the SDFs of the invention increases the range of manipulation of SDF phenotypic expression. The nucleotide sequence of the signal peptide can be isolated from characterized genes using common molecular biological techniques or can be synthesized in vitro.


In addition, the native signal peptide sequences, both amino acid and nucleotide, described in the Reference, Sequence, Protein Group or Protein Group Matrix tables can be used to modulate polypeptide transport. Further variants of the native signal peptides described in the Reference, Sequence, Protein Group or Protein Group Matrix tables are contemplated. Insertions, deletions, or substitutions can be made. Such variants will retain at least one of the functions of the native signal peptide as well as exhibiting some degree of sequence identity to the native sequence.


Also, fragments of the signal peptides of the invention are useful and can be fused with other signal peptides of interest to modulate transport of a polypeptide.


V. Transformation Techniques

A wide range of techniques for inserting exogenous polynucleotides are known for a number of host cells, including, without limitation, bacterial, yeast, mammalian, insect and plant cells.


Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, e.g. Weising et al., Ann. Rev. Genet. 22:421 (1988); and Christou, Euphytica, v. 85, n.1-3:13-27, (1995).


DNA constructs of the invention may be introduced into the genome of the desired plant host by a variety of conventional techniques. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. Alternatively, the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria (McCormac et al., Mol. Biotechnol. 8:199 (1997); Hamilton, Gene 200:107 (1997)); Salomon et al. EMBO J. 3:141 (1984); Herrera-Estrella et al. EMBO J. 2:987 (1983).


Microinjection techniques are known in the art and well described in the scientific and patent literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al. EMBO J. 3:2717 (1984). Electroporation techniques are described in Fromm et al. Proc. Natl Acad. Sci. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein et al. Nature 327:773 (1987). Agrobacterium tumefaciens-mediated transformation techniques, including disarming and use of binary or co-integrate vectors, are well described in the scientific literature. See, for example Hamilton, CM., Gene 200:107 (1997); Müller et al. Mol. Gen. Genet. 207:171 (1987); Komari et al. Plant J. 10:165 (1996); Venkateswarlu et al. Biotechnology 9:1103 (1991) and Gleave, A P., Plant Mol. Biol. 20:1203 (1992); Graves and Goldman, Plant Mol. Biol. 7:34 (1986) and Gould et al., Plant Physiology 95:426 (1991).


Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant that possesses the transformed genotype and thus the desired phenotype such as seedlessness. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture in “Handbook of Plant Cell Culture,” pp. 124-176, MacMillan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1988. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee et al. Ann. Rev. of Plant Phys. 38:467 (1987). Regeneration of monocots (rice) is described by Hosoyama et al. (Biosci. Biotechnol. Biochem. 58:1500 (1994)) and by Ghosh et al. (J. Biotechnol. 32:1 (1994)). The nucleic acids of the invention can be used to confer desired traits on essentially any plant.


Thus, the invention has use over a broad range of plants, including species from the genera Anacardium, Arachis, Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Daucus, Elaeis, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lupinus, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Olea, Oryza, Panieum, Pannesetum, Persea, Phaseolus, Pistachia, Pisum, Pyrus, Prunus, Raphanus, Ricinus, Secale, Senecio, Sinapis, Solanum, Sorghum, Theobromus, Trigonella, Triticum, Vicia, Vitis, Vigna, and, Zea.


One of skill will recognize that after the expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.


The particular sequences of SDFs identified are provided in the attached Reference and Sequence tables.


IX. Definitions

The following terms are utilized throughout this application:


Allelic variant: An “allelic variant” is an alternative form of the same SDF, which resides at the same chromosomal locus in the organism. Allelic variations can occur in any portion of the gene sequence, including regulatory regions. Allelic variants can arise by normal genetic variation in a population. Allelic variants can also be produced by genetic engineering methods. An allelic variant can be one that is found in a naturally occurring plant, including a cultivar or ecotype. An allelic variant may or may not give rise to a phenotypic change, and may or may not be expressed. An allele can result in a detectable change in the phenotype of the trait represented by the locus. A phenotypically silent allele can give rise to a product.


Alternatively spliced messages: Within the context of the current invention, “alternatively spliced messages” refers to mature mRNAs originating from a single gene with variations in the number and/or identity of exons, introns and/or intron-exon junctions.


Chimeric: The term “chimeric” is used to describe genes, as defined supra, or constructs wherein at least two of the elements of the gene or construct, such as the promoter and the coding sequence and/or other regulatory sequences and/or filler sequences and/or complements thereof, are heterologous to each other.


Constitutive Promoter: Promoters referred to herein as “constitutive promoters” actively promote transcription under most, but not necessarily all, environmental conditions and states of development or cell differentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcript initiation region and the 1′ or 2′ promoter derived from T-DNA of Agrobacterium tumefaciens, and other transcription initiation regions from various plant genes, such as the maize ubiquitin-1 promoter, known to those of skill.


Coordinately Expressed: The term “coordinately expressed,” as used in the current invention, refers to genes that are expressed at the same or a similar time and/or stage and/or under the same or similar environmental conditions.


Domain: Domains are fingerprints or signatures that can be used to characterize protein families and/or parts of proteins. Such fingerprints or signatures can comprise conserved (1) primary sequence, (2) secondary structure, and/or (3) three-dimensional conformation. Generally, each domain has been associated with either a family of proteins or motifs. Typically, these families and/or motifs have been correlated with specific in-vitro and/or in-vivo activities. A domain can be any length, including the entirety of the sequence of a protein. Detailed descriptions of the domains, associated families and motifs, and correlated activities of the polypeptides of the instant invention are described below. Usually, the polypeptides with designated domain(s) can exhibit at least one activity that is exhibited by any polypeptide that comprises the same domain(s).


Endogenous: The term “endogenous,” within the context of the current invention refers to any polynucleotide, polypeptide or protein sequence which is a natural part of a cell or organisms regenerated from said cell.


Exogenous: “Exogenous,” as referred to within, is any polynucleotide, polypeptide or protein sequence, whether chimeric or not, that is initially or subsequently introduced into the genome of an individual host cell or the organism regenerated from said host cell by any means other than by a sexual cross. Examples of means by which this can be accomplished are described below, and include Agrobacterium-mediated transformation (of dicots—e.g. Salomon et al. EMBO J. 3:141 (1984); Herrera-Estrella et al. EMBO J. 2:987 (1983); of monocots, representative papers are those by Escudero et al., Plant J. 10:355 (1996), Ishida et al., Nature Biotechnology 14:745 (1996), May et al., Bio/Technology 13:486 (1995)), biolistic methods (Armaleo et al., Current Genetics 17:97 1990)), electroporation, in planta techniques, and the like. Such a plant containing the exogenous nucleic acid is referred to here as a T0 for the primary transgenic plant and T1 for the first generation. The term “exogenous” as used herein is also intended to encompass inserting a naturally found element into a non-naturally found location.


Filler sequence: As used herein, “filler sequence” refers to any nucleotide sequence that is inserted into DNA construct to evoke a particular spacing between particular components such as a promoter and a coding region and may provide an additional attribute such as a restriction enzyme site.


Gene: The term “gene,” as used in the context of the current invention, encompasses all regulatory and coding sequence contiguously associated with a single hereditary unit with a genetic function (see SCHEMATIC 1). Genes can include non-coding sequences that modulate the genetic function that include, but are not limited to, those that specify polyadenylation, transcriptional regulation, DNA conformation, chromatin conformation, extent and position of base methylation and binding sites of proteins that control all of these. Genes comprised of “exons” (coding sequences), which may be interrupted by “introns” (non-coding sequences), encode proteins. A gene's genetic function may require only RNA expression or protein production, or may only require binding of proteins and/or nucleic acids without associated expression. In certain cases, genes adjacent to one another may share sequence in such a way that one gene will overlap the other. A gene can be found within the genome of an organism, artificial chromosome, plasmid, vector, etc., or as a separate isolated entity.


Gene Family: “Gene family” is used in the current invention to describe a group of functionally related genes, each of which encodes a separate protein.


Heterologous sequences: “Heterologous sequences” are those that are not operatively linked or are not contiguous to each other in nature. For example, a promoter from corn is considered heterologous to an Arabidopsis coding region sequence. Also, a promoter from a gene encoding a growth factor from corn is considered heterologous to a sequence encoding the corn receptor for the growth factor. Regulatory element sequences, such as UTRs or 3′ end termination sequences that do not originate in nature from the same gene as the coding sequence originates from, are considered heterologous to said coding sequence. Elements operatively linked in nature and—contiguous to each other are not heterologous to each other. On the other hand, these same elements remain operatively linked but become heterologous if other filler sequence is placed between them. Thus, the promoter and coding sequences of a corn gene expressing an amino acid transporter are not heterologous to each other, but the promoter and coding sequence of a corn gene operatively linked in a novel manner are heterologous.


Homologous gene: In the current invention, “homologous gene” refers to a gene that shares sequence similarity with the gene of interest. This similarity may be in only a fragment of the sequence and often represents a functional domain such as, examples including without limitation a DNA binding domain, a domain with tyrosine kinase activity, or the like. The functional activities of homologous genes are not necessarily the same.


Inducible Promoter: An “inducible promoter” in the context of the current invention refers to a promoter which is regulated under certain conditions, such as light, chemical concentration, protein concentration, conditions in an organism, cell, or organelle, etc. A typical example of an inducible promoter, which can be utilized with the polynucleotides of the present invention, is PARSK1, the promoter from the Arabidopsis gene encoding a serine-threonine kinase enzyme, and which promoter is induced by dehydration, abscissic acid and sodium chloride (Wang and Goodman, Plant J. 8:37 (1995)) Examples of environmental conditions that may affect transcription by inducible promoters include anaerobic conditions, elevated temperature, or the presence of light.


Intergenic region: “Intergenic region,” as used in the current invention, refers to nucleotide sequence occurring in the genome that separates adjacent genes.


Mutant gene: In the current invention, “mutant” refers to a heritable change in DNA sequence at a specific location. Mutants of the current invention may or may not have an associated identifiable function when the mutant gene is transcribed.


Orthologous Gene: In the current invention “orthologous gene” refers to a second gene that encodes a gene product that performs a similar function as the product of a first gene. The orthologous gene may also have a degree of sequence similarity to the first gene. The orthologous gene may encode a polypeptide that exhibits a degree of sequence similarity to a polypeptide corresponding to a first gene. The sequence similarity can be found within a functional domain or along the entire length of the coding sequence of the genes and/or their corresponding polypeptides.


Percentage of sequence identity: “Percentage of sequence identity,” as used herein, is determined by comparing two optimally aligned sequences over a comparison window, where the fragment of the polynucleotide or amino acid sequence in the comparison window may comprise additions or deletions (e.g., gaps or overhangs) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (USA) 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), or by inspection. Given that two sequences have been identified for comparison, GAP and BESTFIT are preferably employed to determine their optimal alignment. Typically, the default values of 5.00 for gap weight and 0.30 for gap weight length are used. The term “substantial sequence identity” between polynucleotide or polypeptide sequences refers to polynucleotide or polypeptide comprising a sequence that has at least 80% sequence identity, preferably at least 85%, more preferably at least 90% and most preferably at least 95%, even more preferably, at least 96%, 97%, 98% or 99% sequence identity compared to a reference sequence using the programs.


Plant Promoter: A “plant promoter” is a promoter capable of initiating transcription in plant cells and can drive or facilitate transcription of a fragment of the SDF of the instant invention or a coding sequence of the SDF of the instant invention. Such promoters need not be of plant origin. For example, promoters derived from plant viruses, such as the CaMV35S promoter or from Agrobacterium tumefaciens such as the T-DNA promoters, can be plant promoters. A typical example of a plant promoter of plant origin is the maize ubiquitin-1 (ubi-1) promoter known to those of skill.


Promoter: The term “promoter,” as used herein, refers to a region of sequence determinants located upstream from the start of transcription of a gene and which are involved in recognition and binding of RNA polymerase and other proteins to initiate and modulate transcription. A basal promoter is the minimal sequence necessary for assembly of a transcription complex required for transcription initiation. Basal promoters frequently include a “TATA box” element usually located between 15 and 35 nucleotides upstream from the site of initiation of transcription. Basal promoters also sometimes include a “CCAAT box” element (typically a sequence CCAAT) and/or a GGGCG sequence, usually located between 40 and 200 nucleotides, preferably 60 to 120 nucleotides, upstream from the start site of transcription.


Public sequence: The term “public sequence,” as used in the context of the instant application, refers to any sequence that has been deposited in a publicly accessible database. This term encompasses both amino acid and nucleotide sequences. Such sequences are publicly accessible, for example, on the BLAST databases on the NCBI FTP web site (accessible at ncbi.nlm.gov/blast). The database at the NCBI GTP site utilizes “gi” numbers assigned by NCBI as a unique identifier for each sequence in the databases, thereby providing a non-redundant database for sequence from various databases, including GenBank, EMBL, DBBJ, (DNA Database of Japan) and PDB (Brookhaven Protein Data Bank).


Regulatory Sequence: The term “regulatory sequence,” as used in the current invention, refers to any nucleotide sequence that influences transcription or translation initiation and rate, and stability and/or mobility of the transcript or polypeptide product. Regulatory sequences include, but are not limited to, promoters, promoter control elements, protein binding sequences, 5′ and 3′ UTRs, transcriptional start site, termination sequence, polyadenylation sequence, introns, certain sequences within a coding sequence, etc.


Related Sequences: “Related sequences” refer to either a polypeptide or a nucleotide sequence that exhibits some degree of sequence similarity with a sequence described by The Reference tables and The Sequence tables.


Scaffold Attachment Region (SAR): As used herein, “scaffold attachment region” is a DNA sequence that anchors chromatin to the nuclear matrix or scaffold to generate loop domains that can have either a transcriptionally active or inactive structure (Spiker and Thompson (1996) Plant Physiol. 110: 15-21).


Sequence-determined DNA fragments (SDFs): “Sequence-determined DNA fragments” as used in the current invention are isolated sequences of genes, fragments of genes, intergenic regions or contiguous DNA from plant genomic DNA or cDNA or RNA the sequence of which has been determined.


Signal Peptide: A “signal peptide” as used in the current invention is an amino acid sequence that targets the protein for secretion, for transport to an intracellular compartment or organelle or for incorporation into a membrane. Signal peptides are indicated in the tables and a more detailed description located below.


Specific Promoter: In the context of the current invention, “specific promoters” refers to a subset of inducible promoters that have a high preference for being induced in a specific tissue or cell and/or at a specific time during development of an organism. By “high preference” is meant at least 3-fold, preferably 5-fold, more preferably at least 10-fold still more preferably at least 20-fold, 50-fold or 100-fold increase in transcription in the desired tissue over the transcription in any other tissue. Typical examples of temporal and/or tissue specific promoters of plant origin that can be used with the polynucleotides of the present invention, are: PTA29, a promoter which is capable of driving gene transcription specifically in tapetum and only during anther development (Koltonow et al., Plant Cell 2:1201 (1990); RCc2 and RCc3, promoters that direct root-specific gene transcription in rice (Xu et al., Plant Mol. Biol. 27:237 (1995); TobRB27, a root-specific promoter from tobacco (Yamamoto et al., Plant Cell 3:371 (1991)). Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only in certain tissues or organs, such as root, ovule, fruit, seeds, or flowers. Other suitable promoters include those from genes encoding storage proteins or the lipid body membrane protein, oleosin. A few root-specific promoters are noted above.


Stringency: “Stringency” as used herein is a function of probe length, probe composition (G+C content), and salt concentration, organic solvent concentration, and temperature of hybridization or wash conditions. Stringency is typically compared by the parameter Tm, which is the temperature at which 50% of the complementary molecules in the hybridization are hybridized, in terms of a temperature differential from Tm. High stringency conditions are those providing a condition of Tm−5° C. to Tm−10° C. Medium or moderate stringency conditions are those providing Tm−20° C. to Tm−29° C. Low stringency conditions are those providing a condition of Tm−40° C. to Tm−48° C. The relationship of hybridization conditions to Tm (in ° C.) is expressed in the mathematical equation






T
m=81.5−16.6(log10[Na+])+0.41(% G+C)−(600/N)  (1)


where N is the length of the probe. This equation works well for probes 14 to 70 nucleotides in length that are identical to the target sequence. The equation below for Tm of DNA-DNA hybrids is useful for probes in the range of 50 to greater than 500 nucleotides, and for conditions that include an organic solvent (formamide).






T
m=81.5+16.6 log {[Na+]/(1+0.7[Na+])}±0.41(% G+C)−500/L0.63(% formamide)  (2)


where L is the length of the probe in the hybrid. (P. Tijessen, “Hybridization with Nucleic Acid Probes” in Laboratory Techniques in Biochemistry and Molecular Biology, P. C. vand der Vliet, ed., c. 1993 by Elsevier, Amsterdam.) The Tm of equation (2) is affected by the nature of the hybrid; for DNA-RNA hybrids Tm is 10-15° C. higher than calculated, for RNA-RNA hybrids Tm is 20-25° C. higher. Because the Tm decreases about 1° C. for each 1% decrease in homology when a long probe is used (Bonner et al., J. Mol. Biol. 81:123 (1973)), stringency conditions can be adjusted to favor detection of identical genes or related family members.


Equation (2) is derived assuming equilibrium and therefore, hybridizations according to the present invention are most preferably performed under conditions of probe excess and for sufficient time to achieve equilibrium. The time required to reach equilibrium can be shortened by inclusion of a hybridization accelerator such as dextran sulfate or another high volume polymer in the hybridization buffer.


Stringency can be controlled during the hybridization reaction or after hybridization has occurred by altering the salt and temperature conditions of the wash solutions used. The formulas shown above are equally valid when used to compute the stringency of a wash solution. Preferred wash solution stringencies lie within the ranges stated above; high stringency is 5-8° C. below Tm, medium or moderate stringency is 26-29° C. below Tm and low stringency is 45-48° C. below Tm.


Substantially free of: A composition containing A is “substantially free of” B when at least 85% by weight of the total A+B in the composition is A. Preferably, A comprises at least about 90% by weight of the total of A+B in the composition, more preferably at least about 95% or even 99% by weight. For example, a plant gene or DNA sequence can be considered substantially free of other plant genes or DNA sequences.


Translational start site: In the context of the current invention, a “translational start site” is usually an ATG in the cDNA transcript, more usually the first ATG. A single cDNA, however, may have multiple translational start sites.


Transcription start site: “Transcription start site” is used in the current invention to describe the point at which transcription is initiated. This point is typically located about 25 nucleotides downstream from a TFIID binding site, such as a TATA box. Transcription can initiate at one or more sites within the gene, and a single gene may have multiple transcriptional start sites, some of which may be specific for transcription in a particular cell-type or tissue.


Untranslated region (UTR): A “UTR” is any contiguous series of nucleotide bases that is transcribed, but is not translated. These untranslated regions may be associated with particular functions such as increasing mRNA message stability. Examples of UTRs include, but are not limited to polyadenylation signals, terminations sequences, sequences located between the transcriptional start site and the first exon (5′ UTR) and sequences located between the last exon and the end of the mRNA (3′ UTR).


Variant: The term “variant” is used herein to denote a polypeptide or protein or polynucleotide molecule that differs from others of its kind in some way. For example, polypeptide and protein variants can consist of changes in amino acid sequence and/or charge and/or post-translational modifications (such as glycosylation, etc).


X. Examples

The invention is illustrated by way of the following examples. The invention is not limited by these examples as the scope of the invention is defined solely by the claims following.


Example 1: cDNA Preparation

A number of the nucleotide sequences disclosed in the Reference and Sequence tables or polynucleotides encoding polypeptides of the Protein Group or Protein Group Matrix tables, herein as representative of the SDFs of the invention can be obtained by sequencing genomic DNA (gDNA) and/or cDNA from corn plants grown from HYBRID SEED #35A19, purchased from Pioneer Hi-Bred International, Inc., Supply Management, P.O. Box 256, Johnston, Iowa 50131-0256.


A number of the nucleotide sequences disclosed in the Reference and Sequence tables or polynucleotides encoding polypeptides of the Protein Group or Protein Group Matrix tables, herein as representative of the SDFs of the invention can also be obtained by sequencing genomic DNA from Arabidopsis thaliana, Wassilewskija ecotype or by sequencing cDNA obtained from mRNA from such plants as described below. This is a true breeding strain. Seeds of the plant are available from the Arabidopsis Biological Resource Center at the Ohio State University, under the accession number CS2360. Seeds of this plant were deposited under the terms and conditions of the Budapest Treaty at the American Type Culture Collection, Manassas, Va. on Aug. 31, 1999, and were assigned ATCC No. PTA-595.


Other methods for cloning full-length cDNA are described, for example, by Seki et al., Plant Journal 15:707-720 (1998) “High-efficiency cloning of Arabidopsis full-length cDNA by biotinylated Cap trapper”; Maruyama et al., Gene 138:171 (1994) “Oligo-capping a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides”; and WO 96/34981.


Tissues were, or each organ was, individually pulverized and frozen in liquid nitrogen. Next, the samples were homogenized in the presence of detergents and then centrifuged. The debris and nuclei were removed from the sample and more detergents were added to the sample. The sample was centrifuged and the debris was removed. Then the sample was applied to a 2M sucrose cushion to isolate polysomes. The RNA was isolated by treatment with detergents and proteinase K followed by ethanol precipitation and centrifugation. The polysomal RNA from the different tissues was pooled according to the following mass ratios: 15/15/1 for male inflorescences, female inflorescences and root, respectively. The pooled material was then used for cDNA synthesis by the methods described below.


Starting material for cDNA synthesis for the exemplary corn cDNA clones with sequences presented in the Reference and Sequence tables or polynucleotides encoding polypeptides of the Protein Group or Protein Group Matrix tables was poly(A)-containing polysomal mRNAs from inflorescences and root tissues of corn plants grown from HYBRID SEED #35A19. Male inflorescences and female (pre- and post-fertilization) inflorescences were isolated at various stages of development. Selection for poly(A) containing polysomal RNA was done using oligo d(T) cellulose columns, as described by Cox and Goldberg, “Plant Molecular Biology: A Practical Approach”, pp. 1-35, Shaw ed., c. 1988 by IRL, Oxford. The quality and the integrity of the polyA+RNAs were evaluated.


Starting material for cDNA synthesis for the exemplary Arabidopsis cDNA clones with sequences presented in the Reference and Sequence tables or polynucleotides encoding polypeptides of the Protein Group or Protein Group Matrix tables was polysomal RNA isolated from the top-most inflorescence tissues of Arabidopsis thaliana Wassilewskija (Ws.) and from roots of Arabidopsis thaliana Landsberg erecta (L. er.), also obtained from the Arabidopsis Biological Resource Center. Nine parts inflorescence to every part root was used, as measured by wet mass. Tissue was pulverized and exposed to liquid nitrogen. Next, the sample was homogenized in the presence of detergents and then centrifuged. The debris and nuclei were removed from the sample and more detergents were added to the sample. The sample was centrifuged and the debris was removed and the sample was applied to a 2M sucrose cushion to isolate polysomal RNA. Cox et al., “Plant Molecular Biology: A Practical Approach”, pp. 1-35, Shaw ed., c. 1988 by IRL, Oxford. The polysomal RNA was used for cDNA synthesis by the methods described below. Polysomal mRNA was then isolated as described above for corn cDNA. The quality of the RNA was assessed electrophoretically.


Following preparation of the mRNAs from various tissues as described above, selection of mRNA with intact 5′ ends and specific attachment of an oligonucleotide tag to the 5′ end of such mRNA was performed using either a chemical or enzymatic approach. Both techniques take advantage of the presence of the “cap” structure, which characterizes the 5′ end of most intact mRNAs and which comprises a guanosine generally methylated once, at the 7 position.


The chemical modification approach involves the optional elimination of the 2′, 3′-cis diol of the 3′ terminal ribose, the oxidation of the 2′, 3′-cis diol of the ribose linked to the cap of the 5′ ends of the mRNAs into a dialdehyde, and the coupling of the such obtained dialdehyde to a derivatized oligonucleotide tag. Further detail regarding the chemical approaches for obtaining mRNAs having intact 5′ ends are disclosed in International Application No. WO96/34981 published Nov. 7, 1996.


The enzymatic approach for ligating the oligonucleotide tag to the intact 5′ ends of mRNAs involves the removal of the phosphate groups present on the 5′ ends of uncapped incomplete mRNAs, the subsequent decapping of mRNAs having intact 5′ ends and the ligation of the phosphate present at the 5′ end of the decapped mRNA to an oligonucleotide tag. Further detail regarding the enzymatic approaches for obtaining mRNAs having intact 5′ ends are disclosed in Dumas Milne Edwards J. B. (Doctoral Thesis of Paris VI University, Le clonage des ADNc complets: difficultés et perspectives nouvelles. Apports pour l'étude de la régulation de l'expression de la tryptophane hydroxylase de rat, 20 Dec. 1993), EP0 625572 and Kato et al., Gene 150:243-250 (1994).


In both the chemical and the enzymatic approach, the oligonucleotide tag has a restriction enzyme site (e.g. an EcoRI site) therein to facilitate later cloning procedures. Following attachment of the oligonucleotide tag to the mRNA, the integrity of the mRNA is examined by performing a Northern blot using a probe complementary to the oligonucleotide tag.


For the mRNAs joined to oligonucleotide tags using either the chemical or the enzymatic method, first strand cDNA synthesis is performed using an oligo-dT primer with reverse transcriptase. This oligo-dT primer can contain an internal tag of at least 4 nucleotides, which can be different from one mRNA preparation to another. Methylated dCTP is used for cDNA first strand synthesis to protect the internal EcoRI sites from digestion during subsequent steps. The first strand cDNA is precipitated using isopropanol after removal of RNA by alkaline hydrolysis to eliminate residual primers.


Second strand cDNA synthesis is conducted using a DNA polymerase, such as Klenow fragment and a primer corresponding to the 5′ end of the ligated oligonucleotide. The primer is typically 20-25 bases in length. Methylated dCTP is used for second strand synthesis in order to protect internal EcoRI sites in the cDNA from digestion during the cloning process.


Following second strand synthesis, the full-length cDNAs are cloned into a phagemid vector, such as pBlueScript™ (Stratagene). The ends of the full-length cDNAs are blunted with T4 DNA polymerase (Biolabs) and the cDNA is digested with EcoRI. Since methylated dCTP is used during cDNA synthesis, the EcoRI site present in the tag is the only hemi-methylated site; hence the only site susceptible to EcoRI digestion. In some instances, to facilitate subcloning, an Hind III adapter is added to the 3′ end of full-length cDNAs.


The full-length cDNAs are then size fractionated using either exclusion chromatography (AcA, Biosepra) or electrophoretic separation which yields 3 to 6 different fractions. The full-length cDNAs are then directionally cloned either into pBlueScript™ using either the EcoRI and SmaI restriction sites or, when the Hind III adapter is present in the full-length cDNAs, the EcoRI and Hind III restriction sites. The ligation mixture is transformed, preferably by electroporation, into bacteria, which are then propagated under appropriate antibiotic selection.


Clones containing the oligonucleotide tag attached to full-length cDNAs are selected as follows.


The plasmid cDNA libraries made as described above are purified (e.g. by a column available from Qiagen). A positive selection of the tagged clones is performed as follows. Briefly, in this selection procedure, the plasmid DNA is converted to single stranded DNA using phage F1 gene II endonuclease in combination with an exonuclease (Chang et al., Gene 127:95 (1993)) such as exonuclease III or T7 gene 6 exonuclease. The resulting single stranded DNA is then purified using paramagnetic beads as described by Fry et al., Biotechniques 13: 124 (1992). Here the single stranded DNA is hybridized with a biotinylated oligonucleotide having a sequence corresponding to the 3′ end of the oligonucleotide tag. Preferably, the primer has a length of 20-25 bases. Clones including a sequence complementary to the biotinylated oligonucleotide are selected by incubation with streptavidin coated magnetic beads followed by magnetic capture. After capture of the positive clones, the plasmid DNA is released from the magnetic beads and converted into double stranded DNA using a DNA polymerase such as ThermoSequenase™ (obtained from Amersham Pharmacia Biotech). Alternatively, protocols such as the Gene Trapper™ kit (Gibco BRL) can be used. The double stranded DNA is then transformed, preferably by electroporation, into bacteria. The percentage of positive clones having the 5′ tag oligonucleotide is typically estimated to be between 90 and 98% from dot blot analysis.


Following transformation, the libraries are ordered in microtiter plates and sequenced. The Arabidopsis library was deposited at the American Type Culture Collection on Jan. 7, 2000 as “E-coli liba 010600” under the accession number PTA-1161.


A. Example 2: Southern Hybridizations

The SDFs of the invention can be used in Southern hybridizations as described above. The following describes extraction of DNA from nuclei of plant cells, digestion of the nuclear DNA and separation by length, transfer of the separated fragments to membranes, preparation of probes for hybridization, hybridization and detection of the hybridized probe.


The procedures described herein can be used to isolate related polynucleotides or for diagnostic purposes. Moderate stringency hybridization conditions, as defined above, are described in the present example. These conditions result in detection of hybridization between sequences having at least 70% sequence identity. As described above, the hybridization and wash conditions can be changed to reflect the desired percenatge of sequence identity between probe and target sequences that can be detected.


In the following procedure, a probe for hybridization is produced from two PCR reactions using two primers from genomic sequence of Arabidopsis thaliana. As described above, the particular template for generating the probe can be any desired template.


The first PCR product is assessed to validate the size of the primer to assure it is of the expected size. Then the product of the first PCR is used as a template, with the same pair of primers used in the first PCR, in a second PCR that produces a labeled product used as the probe.


Fragments detected by hybridization, or other bands of interest, can be isolated from gels used to separate genomic DNA fragments by known methods for further purification and/or characterization.


Buffers for Nuclear DNA Extraction
1. 10× HB












1000 ml


















40 mM
10.2
g
Spermine (Sigma S-2876)


spermidine


and spermidine (Sigma S-2501)


10 mM
3.5
g
Stabilize chromatin and


spermine


the nuclear membrane


0.1M EDTA
37.2
g
EDTA inhibits nuclease


(disodium)





0.1M Tris 
12.1
g
Buffer


0.8M KCl 
59.6
g
Adjusts ionic strength





for stability of nuclei











    • Adjust pH to 9.5 with 10 N NaOH. It appears that there is a nuclease present in leaves. Use of pH 9.5 appears to inactivate this nuclease.


      2. 2 M sucrose (684 g per 1000 ml)

    • Heat about half the final volume of water to about 50° C. Add the sucrose slowly then bring the mixture to close to final volume; stir constantly until it has dissolved. Bring the solution to volume.


      3. Sarkosyl solution (lyses nuclear membranes)















1000 ml



















N-lauroyl sarcosine
20.0
g



(Sarkosyl)





0.1M Tris   
12.1
g



0.04M EDTA
14.9
g



(Disodium)












    • Adjust the pH to 9.5 after all the components are dissolved and bring up to the proper volume.





4. 20% Triton X-100





    • 80 ml Triton X-100

    • 320 ml 1×HB (w/o β-ME and PMSF)





Prepare in advance; Triton takes some time to dissolve


A. Procedure



  • 1. Prepare 1× “H” buffer (keep ice-cold during use)













1000 ml




















10X
HB
100
ml



2M
sucrose
250
ml











a non-ionic




osmoticum











Water
634
ml










Added just before use:


















100 mM PMSF*
10 ml a protease inhibitor;




protects nuclear




membrane proteins



β-mercaptoethanol
1 ml inactivates




nuclease by reducing




disulfide bonds










*100 mM PMSF

    • (phenyl methyl sulfonyl fluoride, Sigma P-7626)
    • (add 0.0875 g to 5 ml 100% ethanol)
  • 2. Homogenize the tissue in a blender (use 300-400 ml of 1×HB per blender). Be sure that you use 5-10 ml of HB buffer per gram of tissue. Blenders generate heat so be sure to keep the homogenate cold. It is necessary to put the blenders in ice periodically.
  • 3. Add the 20% Triton X-100 (25 ml per liter of homogenate) and gently stir on ice for 20 min. This lyses plastid, but not nuclear, membranes.
  • 4. Filter the tissue suspension through several nylon filters into an ice-cold beaker. The first filtration is through a 250-micron membrane; the second is through an 85-micron membrane; the third is through a 50-micron membrane; and the fourth is through a 20-micron membrane. Use a large funnel to hold the filters. Filtration can be sped up by gently squeezing the liquid through the filters.
  • 5. Centrifuge the filtrate at 1200×g for 20 min. at 4° C. to pellet the nuclei.
  • 6. Discard the dark green supernatant. The pellet will have several layers to it. One is starch; it is white and gritty. The nuclei are gray and soft. In the early steps, there may be a dark green and somewhat viscous layer of chloroplasts.
    • Wash the pellets in about 25 ml cold H buffer (with Triton X-100) and resuspend by swirling gently and pipetting. After the pellets are resuspended.
    • Pellet the nuclei again at 1200-1300×g. Discard the supernatant.
    • Repeat the wash 3-4 times until the supernatant has changed from a dark green to a pale green. This usually happens after 3 or 4 resuspensions. At this point, the pellet is typically grayish white and very slippery. The Triton X-100 in these repeated steps helps to destroy the chloroplasts and mitochondria that contaminate the prep.
    • Resuspend the nuclei for a final time in a total of 15 ml of H buffer and transfer the suspension to a sterile 125 ml Erlenmeyer flask.
  • 7. Add 15 ml, dropwise, cold 2% Sarkosyl, 0.1 M Tris, 0.04 M EDTA solution (pH 9.5) while swirling gently. This lyses the nuclei. The solution will become very viscous.
  • 8. Add 30 grams of CsCl and gently swirl at room temperature until the CsCl is in solution. The mixture will be gray, white and viscous.
  • 9. Centrifuge the solution at 11,400×g at 4° C. for at least 30 min. The longer this spin is, the firmer the protein pellicle.
  • 10. The result is typically a clear green supernatant over a white pellet, and (perhaps) under a protein pellicle. Carefully remove the solution under the protein pellicle and above the pellet. Determine the density of the solution by weighing 1 ml of solution and add CsCl if necessary to bring to 1.57 g/ml. The solution contains dissolved solids (sucrose etc) and the refractive index alone will not be an accurate guide to CsCl concentration.
  • 11. Add 20 μl of 10 mg/ml EtBr per ml of solution.
  • 12. Centrifuge at 184,000×g for 16 to 20 hours in a fixed-angle rotor.
  • 13. Remove the dark red supernatant that is at the top of the tube with a plastic transfer pipette and discard. Carefully remove the DNA band with another transfer pipette. The DNA band is usually visible in room light; otherwise, use a long wave UV light to locate the band.
  • 14. Extract the ethidium bromide with isopropanol saturated with water and salt. Once the solution is clear, extract at least two more times to ensure that all of the EtBr is gone. Be very gentle, as it is very easy to shear the DNA at this step. This extraction may take a while because the DNA solution tends to be very viscous. If the solution is too viscous, dilute it with TE.
  • 15. Dialyze the DNA for at least two days against several changes (at least three times) of TE (10 mM Tris, 1 mM EDTA, pH 8) to remove the cesium chloride.
  • 16. Remove the dialyzed DNA from the tubing. If the dialyzed DNA solution contains a lot of debris, centrifuge the DNA solution at least at 2500×g for 10 min. and carefully transfer the clear supernatant to a new tube. Read the A260 concentration of the DNA.
  • 17. Assess the quality of the DNA by agarose gel electrophoresis (1% agarose gel) of the DNA. Load 50 ng and 100 ng (based on the OD reading) and compare it with known and good quality DNA. Undigested lambda DNA and a lambda-HindIII-digested DNA are good molecular weight makers.


Protocol for Digestion of Genomic DNA
Protocol:



  • 1. The relative amounts of DNA for different crop plants that provide approximately a balanced number of genome equivalent is given in Table 3. Note that due to the size of the wheat genome, wheat DNA will be underrepresented. Lambda DNA provides a useful control for complete digestion.

  • 2. Precipitate the DNA by adding 3 volumes of 100% ethanol. Incubate at −20° C. for at least two hours. Yeast DNA can be purchased and made up at the necessary concentration, therefore no precipitation is necessary for yeast DNA.

  • 3. Centrifuge the solution at 11,400×g for 20 min. Decant the ethanol carefully (be careful not to disturb the pellet). Be sure that the residual ethanol is completely removed either by vacuum desiccation or by carefully wiping the sides of the tubes with a clean tissue.

  • 4. Resuspend the pellet in an appropriate volume of water. Be sure the pellet is fully resuspended before proceeding to the next step. This may take about 30 min.

  • 5. Add the appropriate volume of 10× reaction buffer provided by the manufacturer of the restriction enzyme to the resuspended DNA followed by the appropriate volume of enzymes. Be sure to mix it properly by slowly swirling the tubes.

  • 6. Set-up the lambda digestion-control for each DNA that you are digesting.

  • 7. Incubate both the experimental and lambda digests overnight at 37° C. Spin down condensation in a microfuge before proceeding.

  • 8. After digestion, add 2 μl of loading dye (typically 0.25% bromophenol blue, 0.25% xylene cyanol in 15% Ficoll or 30% glycerol) to the lambda-control digests and load in 1% TPE-agarose gel (TPE is 90 mM Tris-phosphate, 2 mM EDTA, pH 8). If the lambda DNA in the lambda control digests are completely digested, proceed with the precipitation of the genomic DNA in the digests.

  • 9. Precipitate the digested DNA by adding 3 volumes of 100% ethanol and incubating in—20° C. for at least 2 hours (preferably overnight).
    • EXCEPTION: Arabidopsis and yeast DNA are digested in an appropriate volume; they don't have to be precipitated.

  • 10. Resuspend the DNA in an appropriate volume of TE (e.g., 22 μl×50 blots=1100 μl) and an appropriate volume of 10× loading dye (e.g., 2.4 μl×50 blots=120 μl). Be careful in pipetting the loading dye—it is viscous. Be sure you are pipetting the correct volume.










TABLE 3







Some guide points in digesting genomic DNA.














Genome






Equivalent





Size
to 2 μg
Amount



Genome
Relative to

Arabidopsis

of DNA


Species
Size

Arabidopsis

DNA
per blot

















Arabidopsis

120
Mb
  1X
  1X
2
μg



Brassica

1,100
Mb
 9.2X
0.54X
10
μg


Corn
2,800
Mb
23.3X
0.43X
20
μg


Cotton
2,300
Mb
19.2X
0.52X
20
μg


Oat
11,300
Mb
  94X
0.11X
20
μg


Rice
400
Mb
 3.3X
0.75X
5
μg


Soybean
1,100
Mb
 9.2X
0.54X
10
μg


Sugarbeet
758
Mb
 6.3X
 0.8X
10
μg


Sweetclover
1,100
Mb
 9.2X
0.54X
10
μg


Wheat
16,000
Mb
 133X
0.08X
20
μg


Yeast
15
Mb
0.12X
  1X
0.25
μg









Protocol for Southern Blot Analysis

The digested DNA samples are electrophoresed in 1% agarose gels in 1×TPE buffer. Low voltage; overnight separations are preferred. The gels are stained with EtBr and photographed.

  • 1. For blotting the gels, first incubate the gel in 0.25 N HCl (with gentle shaking) for about 15 min.
  • 2. Then briefly rinse with water. The DNA is denatured by 2 incubations. Incubate (with shaking) in 0.5 M NaOH in 1.5 M NaCl for 15 min.
  • 3. The gel is then briefly rinsed in water and neutralized by incubating twice (with shaking) in 1.5 M Tris pH 7.5 in 1.5 M NaCl for 15 min.
  • 4. A nylon membrane is prepared by soaking it in water for at least 5 min, then in 6×SSC for at least 15 min. before use. (20×SSC is 175.3 g NaCl, 88.2 g sodium citrate per liter, adjusted to pH 7.0.)
  • 5. The nylon membrane is placed on top of the gel and all bubbles in between are removed. The DNA is blotted from the gel to the membrane using an absorbent medium, such as paper toweling and 6×SCC buffer. After the transfer, the membrane may be lightly brushed with a gloved hand to remove any agarose sticking to the surface.
  • 6. The DNA is then fixed to the membrane by UV crosslinking and baking at 80° C. The membrane is stored at 4° C. until use.


B. Protocol for PCR Amplification of Genomic Fragments in Arabidopsis

Amplification Procedures:


1. Mix the following in a 0.20 ml PCR tube or 96-well PCR plate:














Volume
Stock
Final Amount or Conc.




















0.5
μl
~10
ng/μl genomic DNA1
5
ng











2.5
μl

10X PCR buffer

20
mM Tris,





50
mM KCl












0.75
μl
50
mM MgCl2
1.5
mM


1
μl
10
pmol/μl Primer 1 (Forward)
10
pmol


1
μl
10
pmol/μl Primer 2 (Reverse)
10
pmol


0.5
μl
5
mM dNTPs
0.1
mM


0.1
μl
5
units/μl PlatinumTaq ™
1
units





(Life Technologies,







Gaithersburg, MD)







DNA Polymerase













(to 25
μl)

Water









1
Arabidopsis DNA is used in the present experiment, but the procedure is a general one.







2. The template DNA is amplified using a Perkin Elmer 9700 PCR machine:


1) 94° C. for 10 min. followed by














2)
3)
4)


5 cycles:
5 cycles:
25 cycles:







94° C.-30 sec
94° C.-30 sec
94° C.-30 sec


62° C.-30 sec
58° C.-30 sec
53° C.-30 sec


72° C.-3 min
72° C.-3 min
72° C.-3 min









5) 72° C. for 7 min. Then the reactions are stopped by chilling to 4° C.


The procedure can be adapted to a multi-well format if necessary.


Quantification and Dilution of PCR Products:



  • 1. The product of the PCR is analyzed by electrophoresis in a 1% agarose gel. A linearized plasmid DNA can be used as a quantification standard (usually at 50, 100, 200, and 400 ng). These will be used as references to approximate the amount of PCR products. HindIII-digested Lambda DNA is useful as a molecular weight marker. The gel can be run fairly quickly; e.g., at 100 volts. The standard gel is examined to determine that the size of the PCR products is consistent with the expected size and if there are significant extra bands or smeary products in the PCR reactions.

  • 2. The amounts of PCR products can be estimated on the basis of the plasmid standard.

  • 3. For the small number of reactions that produce extraneous bands, a small amount of DNA from bands with the correct size can be isolated by dipping a sterile 10-μl tip into the band while viewing though a UV Transilluminator. The small amount of agarose gel (with the DNA fragment) is used in the labeling reaction.



C. Protocol for PCR-Dig-Labeling of DNA
Solutions:





    • Reagents in PCR reactions (diluted PCR products, 10×PCR Buffer, 50 mM MgCl2, 5 U/μl Platinum Taq Polymerase, and the primers)

    • 10×dNTP+DIG-11-dUTP [1:5]: (2 mM dATP, 2 mM dCTP, 2 mM dGTP, 1.65 mM dTTP, 0.35 mM DIG-11-dUTP)

    • 10×dNTP+DIG-11-dUTP [1:10]: (2 mM dATP, 2 mM dCTP, 2 mM dGTP, 1.81 mM dTTP, 0.19 mM DIG-11-dUTP)

    • 10×dNTP+DIG-11-dUTP [1:15]: (2 mM dATP, 2 mM dCTP, 2 mM dGTP, 1.875 mM dTTP, 0.125 mM DIG-11-dUTP)

    • TE buffer (10 mM Tris, 1 mM EDTA, pH 8)

    • Maleate buffer: In 700 ml of deionized distilled water, dissolve 11.61 g maleic acid and 8.77 g NaCl. Add NaOH to adjust the pH to 7.5. Bring the volume to 1 L. Stir for 15 min. and sterilize.

    • 10% blocking solution: In 80 ml deionized distilled water, dissolve 1.16 g maleic acid. Next, add NaOH to adjust the pH to 7.5. Add 10 g of the blocking reagent powder (Boehringer Mannheim, Indianapolis, Ind., Cat. no. 1096176). Heat to 60° C. while stirring to dissolve the powder. Adjust the volume to 100 ml with water. Stir and sterilize.

    • 1% blocking solution: Dilute the 10% stock to 1% using the maleate buffer.

    • Buffer 3 (100 mM Tris, 100 mM NaCl, 50 mM MgCl2, pH9.5). Prepared from autoclaved solutions of 1M Tris pH 9.5, 5 M NaCl, and 1 M MgCl2 in autoclaved distilled water.





Procedure:



  • 1. PCR reactions are performed in 25 μl volumes containing:



















PCR buffer
1X











MgCl2
1.5
mM










10X dNTP +
1X (please see



DIG-11-dUTP
the note below)











Platinum Taq ™
1
unit










Polymerase












10
pg probe DNA




10
pmol primer 1







Note:



Use for: 10X dNTP + DIG-11-dUTP (1:5) < 1 kb



10X dNTP + DIG-11-dUTP (1:10) 1 kb to 1.8 kb



10X dNTP + DIG-11-dUTP (1:15) > 1.8 kb






  • 2. The PCR reaction uses the following amplification cycles:



1) 94° C. for 10 min.














2)
3)
4)


5 cycles:
5 cycles:
25 cycles:







95° C.-30 sec
95° C.-30 sec
95° C.-30 sec


61° C.-1 min
59° C.-1 min
51° C.-1 min


73° C.-5 min
75° C.-5 min
73° C.-5 min









5) 72° C. for 8 min. The reactions are terminated by chilling to 4° C. (hold).

  • 3. The products are analyzed by electrophoresis—in a 1% agarose gel, comparing to an aliquot of the unlabelled probe starting material.
  • 4. The amount of DIG-labeled probe is determined as follows:
    • Make serial dilutions of the diluted control DNA in dilution buffer (TE: 10 mM Tris and 1 mM EDTA, pH 8) as shown in the following table:














DIG-labeled

Final Conc.


control DNA

(Dilution


starting conc.
Stepwise Dilution
Name)



















5
ng/μl
 1 μl in 49 μl TE
100
pg/μl (A)


100
pg/μl (A)
25 μl in 25 μl TE
50
pg/μl (B)


50
pg/μl (B)
25 μl in 25 μl TE
25
pg/μl (C)


25
pg/μl (C)
20 μl in 30 μl TE
10
pg/μl (D)











    • a. Serial deletions of a DIG-labeled standard DNA ranging from 100 pg to 10 pg are spotted onto a positively charged nylon membrane, marking the membrane lightly with a pencil to identify each dilution.

    • b. Serial dilutions (e.g., 1:50, 1:2500, 1:10,000) of the newly labeled DNA probe are spotted.

    • c. The membrane is fixed by UV crosslinking.

    • d. The membrane is wetted with a small amount of maleate buffer and then incubated in 1% blocking solution for 15 min at room temp.

    • e. The labeled DNA is then detected using alkaline phosphatase conjugated anti-DIG antibody (Boehringer Mannheim, Indianapolis, Ind., cat. no. 1093274) and an NBT substrate according to the manufacture's instruction.

    • f. Spot intensities of the control and experimental dilutions are then compared to estimate the concentration of the PCR-DIG-labeled probe.





D. Prehybridization and Hybridization of Southern Blots
Solutions:


















100% Formamide
purchased from Gibco



20X SSC
(1X = 0.15M NaCl,




0.015M Na3citrate)











per L:
175
g NaCl




87.5
g Na3citrate-





2H20












    • 20% Sarkosyl (N-lauroyl-sarcosine)

    • 20% SDS (sodium dodecyl sulphate)

    • 10% Blocking Reagent: In 80 ml deionized distilled water, dissolve 1.16 g maleic acid. Next, add NaOH to adjust the pH to 7.5. Add 10 g of the blocking reagent powder. Heat to 60° C. while stirring to dissolve the powder. Adjust the volume to 100 ml with water. Stir and sterilize.





Prehybridization Mix:


















Final

Volume




Concentration
Components
(per 100 ml)
Stock






















  50%
Formamide
50
ml
100%



5X
SSC
25
m1
20X



 0.1%
Sarkosyl
0.5
ml
 20%



0.02%
SDS
0.1
ml
 20%



  2%
Blocking Reagent
20
ml
 10%




Water
4.4
ml










General Procedures:



  • 1. Place the blot in a heat-sealable plastic bag and add an appropriate volume of prehybridization solution (30 ml/100 cm2) at room temperature. Seal the bag with a heat sealer, avoiding bubbles as much as possible. Lay down the bags in a large plastic tray (one tray can accommodate at least 4-5 bags). Ensure that the bags are lying flat in the tray so that the prehybridization solution is evenly distributed throughout the bag. Incubate the blot for at least 2 hours with gentle agitation using a waver shaker.

  • 2. Denature DIG-labeled DNA probe by incubating for 10 min. at 98° C. using the PCR machine and immediately cool it to 4° C.

  • 3. Add probe to prehybridization solution (25 ng/ml; 30 ml=750 ng total probe) and mix well but avoid foaming. Bubbles may lead to background.

  • 4. Pour off the prehybridization solution from the hybridization bags and add new prehybridization and probe solution mixture to the bags containing the membrane.

  • 5. Incubate with gentle agitation for at least 16 hours.

  • 6. Proceed to medium stringency post-hybridization wash:
    • Three times for 20 min. each with gentle agitation using 1×SSC, 1% SDS at 60° C.
    • All wash solutions must be prewarmed to 60° C. Use about 100 ml of wash solution per membrane.
    • To avoid background keep the membranes fully submerged to avoid drying in spots; agitate sufficiently to avoid having membranes stick to one another.

  • 7. After the wash, proceed to immunological detection and CSPD development.


    E. Procedure for Immunological Detection with CSPD



Solutions:



  • Buffer 1: Maleic acid buffer (0.1 M maleic acid, 0.15 M NaCl; adjusted to pH 7.5 with NaoH)

  • Washing buffer: Maleic acid buffer with 0.3% (v/v) Tween 20.

  • Blocking stock solution 10% blocking reagent in buffer 1. Dissolve (10× concentration): blocking reagent powder (Boehringer Mannheim, Indianapolis, Ind., cat. no. 1096176) by constantly stirring on a 65° C. heating block or heat in a microwave, autoclave and store at 4° C.

  • Buffer 2

  • (1× blocking solution): Dilute the stock solution 1:10 in Buffer 1.

  • Detection buffer: 0.1 M Tris, 0.1 M NaCl, pH 9.5



Procedure:



  • 1. After the post-hybridization wash the blots are briefly rinsed (1-5 min.) in the maleate washing buffer with gentle shaking.

  • 2. Then the membranes are incubated for 30 min. in Buffer 2 with gentle shaking.

  • 3. Anti-DIG-AP conjugate (Boehringer Mannheim, Indianapolis, Ind., cat. no. 1093274) at 75 mU/ml (1:10,000) in Buffer 2 is used for detection. 75 ml of solution can be used for 3 blots.

  • 4. The membrane is incubated for 30 min. in the antibody solution with gentle shaking.

  • 5. The membrane are washed twice in washing buffer with gentle shaking. About 250 mls is used per wash for 3 blots.

  • 6. The blots are equilibrated for 2-5 min in 60 ml detection buffer.

  • 7. Dilute CSPD (1:200) in detection buffer. (This can be prepared ahead of time and stored in the dark at 4° C.).
    • The following steps must be done individually. Bags (one for detection and one for exposure) are generally cut and ready before doing the following steps.

  • 8. The blot is carefully removed from the detection buffer and excess liquid removed without drying the membrane. The blot is immediately placed in a bag and 1.5 ml of CSPD solution is added. The CSPD solution can be spread over the membrane. Bubbles present at the edge and on the surface of the blot are typically removed by gentle rubbing. The membrane is incubated for 5 min. in CSPD solution.

  • 9. Excess liquid is removed and the membrane is blotted briefly (DNA side up) on Whatman 3 MM paper. Do not let the membrane dry completely.

  • 10. Seal the damp membrane in a hybridization bag and incubate for 10 min at 37° C. to enhance the luminescent reaction.

  • 11. Expose for 2 hours at room temperature to X-ray film. Multiple exposures can be taken. Luminescence continues for at least 24 hours and signal intensity increases during the first hours.



Example 3: Microarray Experiments and Results
1. Sample Tissue Preparation
(a) Roots

Seeds of Arabidopsis thaliana (Ws) were sterilized in full strength bleach for less than 5 min., washed more than 3 times in sterile distilled deionized water and plated on MS agar plates. The plates were placed at 4° C. for 3 nights and then placed vertically into a growth chamber having 16 hr light/8 hr dark cycles, 23° C., 70% relative humidity and ˜11,000 LUX. After 2 weeks, the roots were cut from the agar, flash frozen in liquid nitrogen and stored at −80° C. (EXPT REP: 108439 and 108434)


(b) Root Hairless Mutants

Plants mutant at the rhl gene locus lack root hairs. This mutation is maintained as a heterozygote.


Seeds of Arabidopsis thaliana (Landsberg erecta) mutated at the rhl gene locus were sterilized using 30% bleach with 1 ul/ml 20% Triton-X 100 and then vernalized at 4° C. for 3 days before being plated onto GM agar plates. Plates were placed in growth chamber with 16 hr light/8 hr. dark, 23° C., 14,500-15,900 LUX, and 70% relative humidity for germination and growth.


After 7 days, seedlings were inspected for root hairs using a dissecting microscope. Mutants were harvested and the cotyledons removed so that only root tissue remained. Tissue was then flash frozen in liquid nitrogen and stored at −80 C. (EXPT REP: 108433)



Arabidopsis thaliana (Landsberg erecta) seedlings grown and prepared as above were used as controls. (EXPT REP: 108433)


Alternatively, seeds of Arabidopsis thaliana (Landsberg erecta), heterozygous for the rhl1 (root hairless) mutation, were surface-sterilized in 30% bleach containing 0.1% Triton X-100 and further rinsed in sterile water. They were then vernalized at 4° C. for 4 days before being plated onto MS agar plates. The plates were maintained in a growth chamber at 24° C. with 16 hr light/8 hr dark for germination and growth. After 10 days, seedling roots that expressed the phenotype (i.e. lacking root hairs) were cut below the hypocotyl junction, frozen in liquid nitrogen and stored at −80° C. Those seedlings with the normal root phenotype (heterozygous or wt) were collected as described for the mutant and used as controls.


(c) Rosette Leaves, Stems, and Siliques


Arabidopsis thaliana (Ws) seed was vernalized at 4° C. for 3 days before sowing in Metro-mix soil type 350. Flats were placed in a growth chamber having 16 hr light/8 hr dark, 80% relative humidity, 23° C. and 13,000 LUX for germination and growth. After 3 weeks, rosette leaves, stems, and siliques (see EXPT REP: 108436, 108437 and 108438) were harvested, flash frozen in liquid nitrogen and stored at −80° C. until use. After 4 weeks, siliques (<5 mm, 5-10 mm and >10 mm) were harvested, flash frozen in liquid nitrogen and stored at −80° C. until use. 5 week old whole plants (used as controls) were harvested, flash frozen in liquid nitrogen and kept at −80° C. until RNA was isolated.


(d) Trichomes


Arabidopsis thaliana (Colombia glabrous) inflorescences were used as a control and CS8143 (hairy inflorescence ecotype) inflorescences, having increased trichomes, were used as the experimental sample.


Approximately 10 μl of each type of seed was sown on a flat of 350 soil (containing 0.03% marathon) and vernalized at 4° C. for 3 days. Plants were then grown at room temperature under florescent lighting. Young inflorescences were collected at 30 days for the control plants and 37 days for the experimental plants. Each inflorescence was cut into one-half inch (½″) pieces, flash frozen in liquid nitrogen and stored at −80° C. until RNA was isolated.


(e) Germination


Arabidopsis thaliana seeds (ecotype Ws) were sterilized in bleach and rinsed with sterile water. The seeds were placed in 100 mm petri plates containing soaked autoclaved filter paper. Plates were foil-wrapped and left at 4° C. for 3 nights to vernalize. After cold treatment, the foil was removed and plates were placed into a growth chamber having 16 hr light/8 hr dark cycles, 23° C., 70% relative humidity and ˜11,000 lux. Seeds were collected 1 d (EXPT REP: 108461), 2 d (EXPT REP: 108462), 3 d (EXPT REP: 108463) and 4 d (EXPT REP: 108464) later, flash frozen in liquid nitrogen and stored at −80° C. until RNA was isolated.


(f) Shoot Apical Meristem


Arabidopsis thaliana (Landsberg erecta) plants mutant at the stm gene locus lack shoot meristems, produce aerial rosettes, have a reduced number of flowers per inflorescence, as well as a reduced number of petals, stamens and carpels, and is female sterile. This mutation is maintained as a heterozygote.


Seeds of Arabidopsis thaliana (Landsberg erecta) mutated at the stm locus were sterilized using 30% bleach with 1 ul/ml 20% Triton-X100. The seeds were vernalized at 4° C. for 3 days before being plated onto GM agar plates. Half were then put into a 22° C., 24 hr light growth chamber and half in a 24° C. 16 hr light/8 hr dark growth chamber having 14,500-15,900 LUX, and 70% relative humidity for germination and growth.


After 7 days, seedlings were examined for leaf primordia using a dissecting microscope. Presence of leaf primordia indicated a wild type phenotype. Mutants were selected based on lack of leaf primordia. Mutants were then harvested and hypocotyls removed leaving only tissue in the shoot region. Tissue was then flash frozen in liquid nitrogen and stored at −80° C.


Control tissue was isolated from 5 day old Landsberg erecta seedlings grown in the same manner as above. Tissue from the shoot region was harvested in the same manner as the stun tissue, but only contained material from the 24° C., 16 hr light/8 hr dark long day cycle growth chamber. (EXPT REP: 108453)


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 8 days. Seedlings were carefully removed from the sand and the outer layers of leaf shealth removed. About 2 mm sections were cut and flash frozen in liquid nitrogen prior to storage at −80° C. The tissues above the shoot apices (˜1 cm long) were cut, treated as above and used as control tissue.


(g) Abscissic acid (ABA)


Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in trays and left at 4° C. for 4 days to vernalize. They were then transferred to a growth chamber having grown 16 hr light/8 hr dark, 13,000 LUX, 70% humidity, and 20° C. and watered twice a week with 1 L of 1× Hoagland's solution. Approximately 1,000 14 day old plants were spayed with 200-250 mls of 100 μM ABA in a 0.02% solution of the detergent Silwet L-77. Whole seedlings, including roots, were harvested within a 15 to 20 minute time period at 1 hr and 6 hr after treatment, flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 100 μM ABA for treatment. Control plants were treated with water. After 6 hr and 24 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(h) Auxin Responsive

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in trays and left at 4° C. for 4 days to vernalize. They were then transferred to a growth chamber having 16 hr light/8 hr dark, 13,000 LUX, 70% humidity, 20° C. and watered twice a week with 1 L of 1× Hoagland's solution (recipe recited in Feldmann et al., (1987) Mol. Gen. Genet. 208: 1-9 and described as complete nutrient solution). Approximately 1,000 14 day old plants were spayed with 200-250 mls of 100 μM NAA in a 0.02% solution of the detergent Silwet L-77. Aerial tissues (everything above the soil line) were harvested within a 15 to 20 minute time period 1 hr and 6 hrs after treatment, flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 100 μM NAA for treatment. Control plants were treated with water. After 6 hr and 24 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(i) Cytokinin

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in trays and left at 4° C. for 4 days to vernalize. They were then transferred to a growth chamber having 16 hr light/8 hr dark, 13,000 LUX, 70% humidity, 20° C. temperature and watered twice a week with 1 L of 1× Hoagland's solution. Approximately 1,000 14 day old plants were spayed with 200-250 mls of 100 μM BA in a 0.02% solution of the detergent Silwet L-77. Aerial tissues (everything above the soil line) were harvested within a 15 to 20 minute time period 1 hr and 6 hrs after treatment, flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 100 μM BA for treatment. Control plants were treated with water. After 6 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(j) Brassinosteroid Responsive

Two separate experiments were performed, one with epi-brassinolide and one with the brassinosteroid biosynthetic inhibitor brassinazole.


In the epi-brassinolide experiments, seeds of wild-type Arabidopsis thaliana (ecotype Wassilewskija) and the brassinosteroid biosynthetic mutant dwf4-1 were sown in trays and left at 4° C. for 4 days to vernalize. They were then transferred to a growth chamber having 16 hr light/8 hr dark, 11,000 LUX, 70% humidity and 22° C. temperature. Four week old plants were spayed with a 1 μM solution of epi-brassinolide and shoot parts (unopened floral primordia and shoot apical meristems) harvested three hours later. Tissue was flash-frozen in liquid nitrogen and stored at −80° C. (EXPT REP 108480)


In the brassinazole experiments, seeds of wild-type Arabidopsis thaliana (ecotype Wassilewskija) were grown as described above. Four week old plants were spayed with a 1 μM solution of brassinazole and shoot parts (unopened floral primordia and shoot apical meristems) harvested three hours later. Tissue was flash-frozen in liquid nitrogen and stored at −80° C. (EXPT REP 108481)


In addition to the spray experiments, tissue was prepared from two different mutants; (1) a dwf4-1 knock out mutant (EXPT REP: 108478) and (2) a mutant overexpressing the dwf4-1 gene (EXPT REP: 108479).


Seeds of wild-type Arabidopsis thaliana (ecotype Wassilewskija) and of the dwf4-1 knock out and overexpressor mutants were sown in trays and left at 4° C. for 4 days to vernalize. They were then transferred to a growth chamber having 16 hr light/8 hr dark, 11,000 LUX, 70% humidity and 22° C. temperature. Tissue from shoot parts (unopened floral primordia and shoot apical meristems) was flash-frozen in liquid nitrogen and stored at −80° C.


Another experiment was completed with seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in trays and left at 4° C. for 4 days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr. dark) conditions, 13,000 LUX light intensity, 70% humidity, 20° C. temperature and watered twice a week with 1 L 1× Hoagland's solution (recipe recited in Feldmann et al., (1987) Mol. Gen. Genet. 208: 1-9 and described as complete nutrient solution). Approximately 1,000 14 day old plants were spayed with 200-250 mls of 0.1 μM Epi-Brassinolite in 0.02% solution of the detergent Silwet L-77. At 1 hr. and 6 hrs. after treatment aerial tissues were harvested within a 15 to 20 minute time period and flash-frozen in liquid nitrogen.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 0.1 μM epi-brassinolide for treatment. Control plants were treated with distilled deionized water. After 24 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(k) Gibberillic Acid

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in trays and left at 4° C. for 4 days to vernalize. They were then transferred to a growth chamber having 16 hr light/8 hr. dark, 13,000 LUX, 70% humidity, 20° C. and watered twice a week with 1 L of 1× Hoagland's solution. Approximately 1,000 14 day old plants were spayed with 200-250 mls of 100 μM gibberillic acid in a 0.02% solution of the detergent Silwet L-77. At 1 hr. and 6 hrs. after treatment, aerial tissues (everything above the soil line) were harvested within a 15 to 20 minute time period, flash-frozen in liquid nitrogen and stored at −80° C.


Alternatively, seeds of Arabidopsis thaliana (ecotype Ws) were sown in Metro-mix soil type 350 and left at 4° C. for 3 days to vernalize. They were then transferred to a growth chamber having 16 hr light/8 hr dark, 13,000 LUX, 80% humidity, 20° C. temperature and watered every four days with 1.5 L water. 14 days after germination, plants were sprayed with 100 μM gibberillic acid or with water. Aerial tissues were harvested 1 hr (EXPT REP: 108484), 6 hrs (EXPT REP: 108485), 12 hrs (EXPT REP: 108486), and 24 hrs post-treatment, flash frozen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 100 μM gibberillic acid for treatment. Control plants were treated with water. After 1 hr, 6 hr and 12 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(l) Nitrogen: High to Low

Wild type Arabidopsis thaliana seeds (ecotpye Ws) were surface sterilized with 30% Clorox, 0.1% Triton X-100 for 5 minutes. Seeds were then rinsed with 4-5 exchanges of sterile double distilled deionized water. Seeds were vernalized at 4° C. for 2-4 days in darkness. After cold treatment, seeds were plated on modified 1×MS media (without NH4NO3 or KNO3), 0.5% sucrose, 0.5 g/L MES pH5.7, 1% phytagar and supplemented with KNO3 to a final concentration of 60 mM (high nitrate modified 1×MS media). Plates were then grown for 7 days in a Percival growth chamber at 22° C. with 16 hr. light/8 hr dark.


Germinated seedlings were then transferred to a sterile flask containing 50 mL of high nitrate modified 1×MS liquid media. Seedlings were grown with mild shaking for 3 additional days at 22° C. in 16 hr. light/8 hr dark (in a Percival growth chamber) on the high nitrate modified 1×MS liquid media.


After three days of growth on high nitrate modified 1×MS liquid media, seedlings were transferred either to a new sterile flask containing 50 mL of high nitrate modified 1×MS liquid media or to low nitrate modified 1×MS liquid media (containing 20 □M KNO3). Seedlings were grown in these media conditions with mild shaking at 22° C. in 16 hr light/8 hr dark for the appropriate time points and whole seedlings harvested for total RNA isolation via the Trizol method (LifeTech.). The time points used for the microarray experiments were 10 min. (EXPT REP: 108454) and 1 hour (EXPT REP: 108455) time points for both the high and low nitrate modified 1×MS media.


Alternatively, seeds that were surface sterilized in 30% bleach containing 0.1% Triton X-100 and further rinsed in sterile water, were planted on MS agar, (0.5% sucrose) plates containing 50 mM KNO3 (potassium nitrate). The seedlings were grown under constant light (3500 LUX) at 22° C. After 12 days, seedlings were transferred to MS agar plates containing either 1 mM KNO3 or 50 mM KNO3. Seedlings transferred to agar plates containing 50 mM KNO3 were treated as controls in the experiment. Seedlings transferred to plates with 1 mM KNO3 were rinsed thoroughly with sterile MS solution containing 1 mM KNO3. There were ten plates per transfer. Root tissue was collected and frozen in 15 mL Falcon tubes at various time points which included 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 9 hours, 12 hours, 16 hours, and 24 hours.


Maize 35A19 Pioneer hybrid seeds were sown on flats containing sand and grown in a Conviron growth chamber at 25° C., 16 hr light/8 hr dark, ˜13,000 LUX and 80% relative humidity. Plants were watered every three days with double distilled deionized water. Germinated seedlings are allowed to grow for 10 days and were watered with high nitrate modified 1×MS liquid media (see above). On day 11, young corn seedlings were removed from the sand (with their roots intact) and rinsed briefly in high nitrate modified 1×MS liquid media. The equivalent of half a flat of seedlings were then submerged (up to their roots) in a beaker containing either 500 mL of high or low nitrate modified 1×MS liquid media (see above for details).


At appropriate time points, seedlings were removed from their respective liquid media, the roots separated from the shoots and each tissue type flash frozen in liquid nitrogen and stored at −80° C. This was repeated for each time point. Total RNA was isolated using the Trizol method (see above) with root tissues only.


Corn root tissues isolated at the 4 hr and 16 hr time points were used for the microarray experiments. Both the high and low nitrate modified 1×MS media were used.


(m) Nitrogen: Low to High


Arabidopsis thaliana ecotype Ws seeds were sown on flats containing 4 L of a 1:2 mixture of Grace Zonolite vermiculite and soil. Flats were watered with 3 L of water and vernalized at 4° C. for five days. Flats were placed in a Conviron growth chamber having 16 hr light/8 hr dark at 20° C., 80% humidity and 17,450 LUX. Flats were watered with approximately 1.5 L of water every four days. Mature, bolting plants (24 days after germination) were bottom treated with 2 L of either a control (100 mM mannitol pH 5.5) or an experimental (50 mM ammonium nitrate, pH 5.5) solution. Roots, leaves and siliques were harvested separately 30, 120 and 240 minutes after treatment, flash frozen in liquid nitrogen and stored at −80° C.


Hybrid maize seed (Pioneer hybrid 35A19) were aerated overnight in deionized water. Thirty seeds were plated in each flat, which contained 4 liters of Grace zonolite vermiculite. Two liters of water were bottom fed and flats were kept in a Conviron growth chamber with 16 hr light/8 hr dark at 20° C. and 80% humidity. Flats were watered with 1 L of tap water every three days. Five day old seedlings were treated as described above with 2 L of either a control (100 mM mannitol pH 6.5) solution or 1 L of an experimental (50 mM ammonium nitrate, pH 6.8) solution. Fifteen shoots per time point per treatment were harvested 10, 90 and 180 minutes after treatment, flash frozen in liquid nitrogen and stored at −80° C.


Alternatively, seeds of Arabidopsis thaliana (ecotype Wassilewskija) were left at 4° C. for 3 days to vernalize. They were then sown on vermiculite in a growth chamber having 16 hours light/8 hours dark, 12,000-14,000 LUX, 70% humidity, and 20° C. They were bottom-watered with tap water, twice weekly. Twenty-four days old plants were sprayed with either water (control) or 0.6% ammonium nitrate at 4 μL/cm2 of tray surface. Total shoots and some primary roots were cleaned of vermiculite, flash-frozen in liquid nitrogen and stored at −80° C.


(n) Methyl Jasmonate

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in trays and left at 4° C. for 4 days to vernalize before being transferred to a growth chamber having 16 hr light/8 hr. dark, 13,000 LUX, 70% humidity, 20° C. temperature and watered twice a week with 1 L of a 1× Hoagland's solution. Approximately 1,000 14 day old plants were spayed with 200-250 mls of 0.001% methyl jasmonate in a 0.02% solution of the detergent Silwet L-77. At 1 hr and 6 hrs after treatment, whole seedlings, including roots, were harvested within a 15 to 20 minute time period, flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 0.001% methyl jasmonate for treatment. Control plants were treated with water. After 24 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(O) Salicylic Acid

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in trays and left at 4° C. for 4 days to vernalize before being transferred to a growth chamber having 16 hr light/8 hr. dark, 13,000 LUX, 70% humidity, 20° C. temperature and watered twice a week with 1 L of a 1× Hoagland's solution. Approximately 1,000 14 day old plants were spayed with 200-250 mls of 5 mM salicylic acid (solubilized in 70% ethanol) in a 0.02% solution of the detergent Silwet L-77. At 1 hr and 6 hrs after treatment, whole seedlings, including roots, were harvested within a 15 to 20 minute time period flash-frozen in liquid nitrogen and stored at −80° C.


Alternatively, seeds of wild-type Arabidopsis thaliana (ecotype Columbia) and mutant CS3726 were sown in soil type 200 mixed with osmocote fertilizer and Marathon insecticide and left at 4° C. for 3 days to vernalize. Flats were incubated at room temperature with continuous light. Sixteen days post germination plants were sprayed with 2 mM SA, 0.02% SilwettL-77 or control solution (0.02% SilwettL-77. Aerial parts or flowers were harvested 1 hr (EXPT REP: 108471 and 108472), 4 hr (EXPT REP: 108469 and 108470), 6 hr (EXPT REP: 108440) 24 hr (EXPT REP: 108443, 107953 and 107960) and 3 weeks (EXPT REP: 108475, 108476) post-treatment flash frozen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 2 mM SA for treatment. Control plants were treated with water. After 12 hr and 24 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(P) Wounding

Seeds of Arabidopsis thaliana (Wassilewskija) were sown in trays and left at 4° C. for three days to vernalize before being transferred to a growth chamber having 16 hr light/8 hr dark, 12,000-14,000 LUX, 70% humidity and 20° C. After 14 days, the leaves were wounded with forceps. Aerial tissues were harvested 1 hour and 6 hours after wounding. Aerial tissues from unwounded plants served as controls. Tissues were flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were wounded (one leaf nicked by scissors) and placed in 1-liter beakers of water for treatment. Control plants were treated not wounded. After 1 hr and 6 hr aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(q) Drought Stress

Seeds of Arabidopsis thaliana (Wassilewskija) were sown in pots and left at 4° C. for three days to vernalize before being transferred to a growth chamber having 16 hr light/8 hr dark, 150,000-160,000 LUX, 20° C. and 70% humidity. After 14 days, aerial tissues were cut and left to dry on 3 MM Whatman paper in a petri-plate for 1 hour and 6 hours. Aerial tissues exposed for 1 hour and 6 hours to 3 MM Whatman paper wetted with 1× Hoagland's solution served as controls. Tissues were harvested, flash-frozen in liquid nitrogen and stored at −80° C.


Alternatively, Arabidopsis thaliana (Ws) seed was vernalized at 4° C. for 3 days before sowing in Metromix soil type 350. Flats were placed in a growth chamber with 23° C., 16 hr light/8 hr. dark, 80% relative humidity, ˜13,000 LUX for germination and growth. Plants were watered with 1-1.5 L of water every four days. Watering was stopped 16 days after germination for the treated samples, but continued for the control samples. Rosette leaves and stems (EXPT REP 108477, 108482 and 108483), flowers (see EXPT REP: 108473, 108474) and siliques were harvested 2 d, 3 d, 4 d, 5 d, 6 d and 7 d (EXPT REP: 108473) after watering was stopped. Tissue was flash frozen in liquid nitrogen and kept at −80° C. until RNA was isolated. Flowers and siliques were also harvested on day 8 from plants that had undergone a 7 d drought treatment followed by 1 day of watering (EXPT REP: 108474). Control plants (whole plants) were harvested after 5 weeks, flash frozen in liquid nitrogen and stored as above.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in empty 1-liter beakers at room temperature for treatment. Control plants were placed in water. After 1 hr, 6 hr, 12 hr and 24 hr aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(R) Osmotic Stress

Seeds of Arabidopsis thaliana (Wassilewskija) were sown in trays and left at 4° C. for three days to vernalize before being transferred to a growth chamber having 16 hr light/8 hr dark, 12,000-14,000 LUX, 20° C., and 70% humidity. After 14 days, the aerial tissues were cut and placed on 3 MM Whatman paper in a petri-plate wetted with 20% PEG (polyethylene glycol-Mr 8,000) in 1× Hoagland's solution. Aerial tissues on 3 MM Whatman paper containing 1× Hoagland's solution alone served as the control. Aerial tissues were harvested at 1 hour and 6 hours after treatment, flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 20% PEG (polyethylene glycol-Mr 8,000) for treatment. Control plants were treated with water. After 1 hr and 6 hr aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 150 mM NaCl for treatment. Control plants were treated with water. After 1 hr, 6 hr, and 24 hr aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(S) Heat Shock Treatment

Seeds of Arabidopsis thaliana (Wassilewskija) were sown in trays and left at 4° C. for three days to vernalize before being transferred to a growth chamber with 16 hr light/8 hr dark, 12,000-14,000 LUX, 70% humidity and 20° C., fourteen day old plants were transferred to a 42° C. growth chamber and aerial tissues were harvested 1 hr and 6 hr after transfer. Control plants were left at 20° c. and aerial tissues were harvested. Tissues were flashfrozen in liquid nitrogen and stored at −80° c.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers containing 42° C. water for treatment. Control plants were treated with water at 25° C. After 1 hr and 6 hr aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(T) Cold Shock Treatment

Seeds of Arabidopsis thaliana (Wassilewskija) were sown in trays and left at 4° C. for three days to vernalize before being transferred to a growth chamber having 16 hr light/8 hr dark, 12,000-14,000 LUX, 20° C. and 70% humidity. Fourteen day old plants were transferred to a 4° C. dark growth chamber and aerial tissues were harvested 1 hour and 6 hours later. Control plants were maintained at 20° C. and covered with foil to avoid exposure to light. Tissues were flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers containing 4° C. water for treatment. Control plants were treated with water at 25° C. After 1 hr and 6 hr aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(U) Oxidative Stress-Hydrogen Peroxide Treatment

Seeds of Arabidopsis thaliana (Wassilewskija) were sown in trays and left at 4° C. for three days to vernalize. Before being transferred to a growth chamber having 16 hr light/8 hr dark, 12,000-14,000 LUX, 20° C. and 70% humidity. Fourteen day old plants were sprayed with 5 mM H2O2 (hydrogen peroxide) in a 0.02% Silwett L-77 solution. Control plants were sprayed with a 0.02% Silwett L-77 solution. Aerial tissues were harvested 1 hour and 6 hours after spraying, flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 5 mM H2O2 for treatment. Control plants were treated with water. After 1 hr, 6 hr and 24 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(V) Nitric Oxide Treatment

Seeds of Arabidopsis thaliana (Wassilewskija) were sown in trays and left at 4° C. for three days to vernalize before being transferred to a growth chamber having 16 hr light/8 hr dark, 12,000-14,000 LUX, 20° C. and 70% humidity. Fourteen day old plants were sprayed with 5 mM sodium nitroprusside in a 0.02% Silwett L-77 solution. Control plants were sprayed with a 0.02% Silwett L-77 solution. Aerial tissues were harvested 1 hour and 6 hours after spraying, flash-frozen in liquid nitrogen and stored at −80° C.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 7 days. Seedlings were carefully removed from the sand and placed in 1-liter beakers with 5 mM nitroprus side for treatment. Control plants were treated with water. After 1 hr, 6 hr and 12 hr, aerial and root tissues were separated and flash frozen in liquid nitrogen prior to storage at −80° C.


(w) S4 Immature Buds, Inflorescence Meristem

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. Inflorescences containing immature floral buds [stages 1-12; Smyth et al., 1990] as well as the inflorescence meristem were harvested and flash frozen in liquid nitrogen.


(x) S5 Flowers (Opened)

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. Mature, unpollinated flowers [stages 12-14; Smyth et al. 1990] were harvested and flash frozen in liquid nitrogen.


(y) S6 Siliques (All Stages)

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. Siliques bearing developing seeds containing post fertilization through pre-heart stage [0-72 hours after fertilization (HAF)], heart-through early curled cotyledon stage [72-120 HAF] and late-curled cotyledon stage [>120 HAF] embryos were harvested separately and pooled prior to RNA isolation in a mass ratio of 1:1:1. The tissues were then flash frozen in liquid nitrogen. Description of the stages of Arabidopsis embryogenesis used were reviewed by Bowman (1994).


(z) Arabidopsis Endosperm

mea/mea Fruits 0-10 mm


Seeds of Arabidopsis thaliana heterozygous for the fertilization-independent endosperm1 (fie1)[Ohad et al., 1996; ecotype Landsberg erecta (Ler)] were sown in pots and left at 4° C. for two to three days to vernalize. Kiyosue et al. (1999) subsequently determined that fie1 was allelic to the gametophytic maternal effect mutant medea (Grossniklaus et al., 1998). Imbibed seeds were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 1-2 siliques (fruits) bearing developing seeds just prior to dessication [9 days after flowering (DAF)] were selected from each plant and were hand-dissected to identify wild-type, mea/+heterozygotes, and mea/mea homozygous mutant plants. At this stage, homozygous mea/mea plants produce short siliques that contain >70% aborted seed and can be distinguished from those produced by wild-type (100% viable seed) and mea/+heterozygous (50% viable seed) plants (Ohad et al., 1996; Grossniklaus et al., 1998; Kiyosue et al., 1999). Siliques 0-10 mm in length containing developing seeds 0-9 DAF produced by homozygous mea/mea plants were harvested and flash frozen in liquid nitrogen.


Pods 0-10 mm (Control Tissue for Sample 70)

Seeds of Arabidopsis thaliana heterozygous for the fertilization-independent endosperm1 (fie1) [Ohad et al., 1996; ecotype Landsberg erecta (Ler)] were sown in pots and left at 4° C. for two to three days to vernalize. Kiyosue et al. (1999) subsequently determined that fie1 was allelic to the gametophytic maternal effect mutant medea (Grossniklaus et al., 1998). Imbibed seeds were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 1-2 siliques (fruits) bearing developing seeds just prior to dessication [9 days after flowering (DAF)] were selected from each plant and were hand-dissected to identify wild-type, mea/+heterozygotes, and mea/mea homozygous mutant plants. At this stage, homozygous mea/mea plants produce short siliques that contain >70% aborted seed and can be distinguished from those produced by wild-type (100% viable seed) and mea/+heterozygous (50% viable seed) plants (Ohad et al., 1996; Grossniklaus et al., 1998; Kiyosue et al., 1999). Siliques 0-10 mm in length containing developing seeds 0-9 DAF produced by segregating wild-type plants were opened and the seeds removed. The remaining tissues (pods minus seed) were harvested and flash frozen in liquid nitrogen.


(Aa) Arabidopsis Seeds

Fruits (Pod+Seed) 0-5 mm


Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 3-4 siliques (fruits) bearing developing seeds were selected from at least 3 plants and were hand-dissected to determine what developmental stage(s) were represented by the enclosed embryos. Description of the stages of Arabidopsis embryogenesis used in this determination were summarized by Bowman (1994). Silique lengths were then determined and used as an approximate determinant for embryonic stage. Siliques 0-5 mm in length containing post fertilization through pre-heart stage [0-72 hours after fertilization (HAF)] embryos were harvested and flash frozen in liquid nitrogen.


Fruits(Pod+Seed) 5-10 mm


Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 3-4 siliques (fruits) bearing developing seeds were selected from at least 3 plants and were hand-dissected to determine what developmental stage(s) were represented by the enclosed embryos. Description of the stages of Arabidopsis embryogenesis used in this determination were summarized by Bowman (1994). Silique lengths were then determined and used as an approximate determinant for embryonic stage. Siliques 5-10 mm in length containing heart-through early upturned-U-stage [72-120 hours after fertilization (HAF)] embryos were harvested and flash frozen in liquid nitrogen.


Fruits(Pod+Seed)>10 mm


Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 3-4 siliques (fruits) bearing developing seeds were selected from at least 3 plants and were hand-dissected to determine what developmental stage(s) were represented by the enclosed embryos. Description of the stages of Arabidopsis embryogenesis used in this determination were summarized by Bowman (1994). Silique lengths were then determined and used as an approximate determinant for embryonic stage. Siliques>10 mm in length containing green, late upturned-U-stage [>120 hours after fertilization (HAF)-9 days after flowering (DAF)] embryos were harvested and flash frozen in liquid nitrogen.


Green Pods 5-10 mm (Control Tissue for Samples 72-74)


Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 3-4 siliques (fruits) bearing developing seeds were selected from at least 3 plants and were hand-dissected to determine what developmental stage(s) were represented by the enclosed embryos. Description of the stages of Arabidopsis embryogenesis used in this determination were summarized by Bowman (1994). Silique lengths were then determined and used as an approximate determinant for embryonic stage. Green siliques 5-10 mm in length containing developing seeds 72-120 hours after fertilization (HAF)] were opened and the seeds removed. The remaining tissues (green pods minus seed) were harvested and flash frozen in liquid nitrogen.


Green Seeds from Fruits>10 mm


Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 3-4 siliques (fruits) bearing developing seeds were selected from at least 3 plants and were hand-dissected to determine what developmental stage(s) were represented by the enclosed embryos. Description of the stages of Arabidopsis embryogenesis used in this determination were summarized by Bowman (1994). Silique lengths were then determined and used as an approximate determinant for embryonic stage. Green siliques>10 mm in length containing developing seeds up to 9 days after flowering (DAF)] were opened and the seeds removed and harvested and flash frozen in liquid nitrogen.


Brown Seeds from Fruits>10 mm


Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 3-4 siliques (fruits) bearing developing seeds were selected from at least 3 plants and were hand-dissected to determine what developmental stage(s) were represented by the enclosed embryos. Description of the stages of Arabidopsis embryogenesis used in this determination were summarized by Bowman (1994). Silique lengths were then determined and used as an approximate determinant for embryonic stage. Yellowing siliques>10 mm in length containing brown, dessicating seeds>11 days after flowering (DAF)] were opened and the seeds removed and harvested and flash frozen in liquid nitrogen.


Green/Brown Seeds from Fruits>10 mm


Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature. 3-4 siliques (fruits) bearing developing seeds were selected from at least 3 plants and were hand-dissected to determine what developmental stage(s) were represented by the enclosed embryos. Description of the stages of Arabidopsis embryogenesis used in this determination were summarized by Bowman (1994). Silique lengths were then determined and used as an approximate determinant for embryonic stage. Green siliques>10 mm in length containing both green and brown seeds>9 days after flowering (DAF)] were opened and the seeds removed and harvested and flash frozen in liquid nitrogen.


Mature Seeds (24 Hours after Imbibition)


Mature dry seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown onto moistened filter paper and left at 4° C. for two to three days to vernalize. Imbibed seeds were then transferred to a growth chamber [16 hr light: 8 hr dark conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature], the emerging seedlings harvested after 48 hours and flash frozen in liquid nitrogen.


Mature Seeds (Dry)

Seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 70% humidity, and 22° C. temperature and taken to maturity. Mature dry seeds are collected, dried for one week at 28° C., and vernalized for one week at 4° C. before used as a source of RNA.


Ovules

Seeds of Arabidopsis thaliana heterozygous for pistillata (pi) [ecotype Landsberg erecta (Ler)] were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light: 8 hr dark) conditions, 7000-8000 LUX light intensity, 76% humidity, and 24° C. temperature. Inflorescences were harvested from seedlings about 40 days old. The inflorescences were cut into small pieces and incubated in the following enzyme solution (pH 5) at room temperature for 0.5-1 hr.: 0.2% pectolyase Y-23, 0.04% pectinase, 5 mM MES, 3% Sucrose and MS salts (1900 mg/l KNO3, 1650 mg/l NH4NO3, 370 mg/l MgSO4.7 H2O, 170 mg/l KH2PO4, 440 mg/l CaCl2.2 H2O, 6.2 mg/l H2BO3, 15.6 mg/l MnSO4.4 H2O, 8.6 mg/l ZnSO4.7 H2O, 0.25 mg/l NaMoO4.2 H2O, 0.025 mg/l CuCO4.5 H2O, 0.025 mg/l CoCl2.6 H2O, 0.83 mg/l KI, 27.8 mg/l FeSO4.7 H2O, 37.3 mg/l Disodium EDTA, pH 5.8). At the end of the incubation the mixture of inflorescence material and enzyme solution was passed through a size 60 sieve and then through a sieve with a pore size of 125 μm. Ovules greater than 125 μm in diameter were collected, rinsed twice in B5 liquid medium (2500 mg/l KNO3, 250 mg/l MgSO4.7 H2O, 150 mg/l NaH2PO4.H2O, 150 mg/l CaCl2.2 H2O, 134 mg/l (NH4)2 CaCl2.SO4, 3 mg/l H2BO3, 10 mg/l MnSO4.4 H2O, 2 ZnSO4.7 H2O, 0.25 mg/l NaMoO4.2 H2O, 0.025 mg/l CuCO4.5 H2O, 0.025 mg/l CoCl2.6 H2O, 0.75 mg/l KI, 40 mg/l EDTA sodium ferric salt, 20 g/l sucrose, 10 mg/l Thiamine hydrochloride, 1 mg/l Pyridoxine hydrochloride, 1 mg/l Nicotinic acid, 100 mg/l myo-inositol, pH 5.5)), rinsed once in deionized water and flash frozen in liquid nitrogen. The supernatant from the 125 μm sieving was passed through subsequent sieves of 50 μm and 32 μm. The tissue retained in the 32 μm sieve was collected and mRNA prepared for use as a control.


(Bb) Herbicide Treatment


Arabidopsis thaliana (Ws) seeds were sterilized for 5 min. with 30% bleach, 50 μl Triton in a total volume of 50 ml. Seeds were vernalized at 4° C. for 3 days before being plated onto GM agar plates at a density of about 144 seeds per plate. Plates were incubated in a Percival growth chamber having 16 hr light/8 hr dark, 80% relative humidity, 22° C. and 11,000 LUX for 14 days.


Plates were sprayed (˜0.5 mls/plate) with water, Finale (1.128 g/L), Glean (1.88 g/L), RoundUp (0.01 g/L) or Trimec (0.08 g/L). Tissue was collected and flash frozen in liquid nitrogen at the following time points: 0, 1, 2, 4 (EXPT REP: 107871 (Finale), 107881 (Glean), 107896 (Round-up) and 107886 (Trimec)), 8, 12 (EXPT REP: 108467 (Finale), 108468 (Glean), 108465 (Round-up) and 108466, 107891 (Trimec)), and 24 hours. Frozen tissue was stored at −80° C. prior to RNA isolation.


(cc) Ap2

Seeds of Arabidopsis thaliana (ecotype Landesberg erecta) and floral mutant apetala2 (Jofuku et al., 1994, Plant Cell 6:1211-1225) were sown in pots and left at 4° C. for two to three days to vernalize. They were then transferred to a growth chamber. Plants were grown under long-day (16 hr light, 8 hr dark) conditions 7000-8000 LUX light intensity, 70% humidity and 22° C. temperature. Inflorescences containing immature floral buds (stages 1-7; Bowman, 1994) as wel as the inflorescence meristem were harvested and flashfrozen. Polysomal polyA+RNA was isolated from tissue according to Cox and Goldberg, 1988).


(dd) Protein Degradation


Arabidopsis thaliana (ecotype Ws) wild-type and 13B12-1 (homozygous) mutant seed were sown in pots containing Metro-mix 350 soil and incubated at 4° C. for four days. Vernalized seeds were germinated in the greenhouse (16 hr light/8 hr dark) over a 7 day period. Mutant seedlings were sprayed with 0.02% (active ingredient) Finale to confirm their transgenic standing. Plants were grown until the mutant phenotype (either multiple pistils in a single flower and/or multiple branching per node) was apparent. Young inflorescences immediately forming from the multiple-branched stems were cut and flash frozen in liquid nitrogen. Young inflorescences from wild-type plants grown in parallel and under identical conditions were collected as controls. All collected tissue was stored at −80° C. until RNA isolation. (EXPT REP 108451)


(Ee) Root Tips

Seeds of Arabidopsis thaliana (ecotye Ws) were placed on MS plates and vernalized at 4° C. for 3 days before being placed in a 25° C. growth chamber having 16 hr light/8 hr dark, 70% relative humidty and about 3 W/m2. After 6 days, young seedlings were transferred to flasks containing B5 liquid medium, 1% sucrose and 0.05 mg/l indole-3-butyric acid. Flasks were incubated at room temperature with 100 rpm agitation. Media was replaced weekly. After three weeks, roots were harvested and incubated for 1 hr with 2% pectinase, 0.2% cellulase, pH 7 before straining through a #80 (Sigma) sieve. The root body material remaining on the sieve (used as the control) was flash frozen and stored at −80° C. until use. The material that passed through the #80 sieve was strained through a #200 (Sigma) sieve and the material remaining on the sieve (root tips) was flash frozen and stored at −80° C. until use. Approximately 10 mg of root tips were collected from one flask of root culture.


Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. Covered flats were watered every three days for 8 days. Seedlings were carefully removed from the sand and the root tips (˜2 mm long) were removed and flash frozen in liquid nitrogen prior to storage at −80° C. The tissues above the root tips (˜1 cm long) were cut, treated as above and used as control tissue.


(ff) rt1


The rt1 allele is a variation of rt1 rootless1 and is recessive. Plants displaying the rt1 phenotype have few or no secondary roots.


Seed from plants segregating for rt1 were sown on sand and placed in a growth chamber having 16 hr light/8 hr dark, 13,000 LUX, 70% humidity and 20° C. temperature. Plants were watered every three days with tap water. Eleven (11) day old seedlings were carefully removed from the sand, keeping the roots intact. rt1-type seedlings were separated from their wild-type counterparts and the root tissue isolated. Root tissue from normal seedlings (control) and rt1 mutants were flash frozen in liquid nitrogen and stored at −80° C. until use.


(Gg) Imbibed Seed

Seeds of maize hybrid 35A (Pioneer) were sown in water-moistened sand in covered flats (10 rows, 5-6 seed/row) and covered with clear, plastic lids before being placed in a growth chamber having 16 hr light (25° C.)/8 hr dark (20° C.), 75% relative humidity and 13,000-14,000 LUX. One day after sowing, whole seeds were flash frozen in liquid nitrogen prior to storage at −80° C. Two days after sowing, embryos and endosperm were isolated and flash frozen in liquid nitrogen prior to storage at −80° C. On days 3-6, aerial tissues, roots and endosperm were isolated and flash frozen in liquid nitrogen prior to storage at −80° C.


(hh) Rough Sheath2-R (Rs2-R) Mutants (1400-6/S-17)

This experiment was conducted to identify abnormally expressed genes in the shoot apex of rough sheath2-R (rs2-R) mutant plants. rs2 encodes a myb domain DNA binding protein that functions in repression of several shoot apical meristem expressed homeobox genes. Two homeobox gene targets are known for rs2 repression, rough sheath1, liguleless 3. The recessive loss of function phenotype of rs2-R homozygous plants is described in Schneeberger et al. 1998 Development 125: 2857-2865.


The seed stock genetically segregates 1:1 for rs2-R/rs2-R:rs2-R/+


Preparation of tissue samples: 160 seedlings pooled from 2 and 3 week old plants grown in sand. Growth conditions; Conviron #107 @ 12 hr days/12 hr night, 25° C., 75% humidity. Shoot apex was dissected to include leaf three and older. (Pictures available upon request).


1) rough sheath2-R homozygous (mutant) shoot apex


2) rough sheath2-R heterozygous (wt, control) shoot apex


(ii) Leaf Mutant 3642:

Mutant 3642 is a recessive mutation that causes abnormal leaf development. The leaves of mutant 3642 plants are characterized by leaf twisting and irregular leaf shape. Mutant 3642 plants also exhibit abnormally shaped floral organs which results in reduced fertility.


Seed segregating for the mutant phenotype was sown in Metro-mix 350 soil and grown in a Conviron growth chamber with watering by sub-irrigation twice a week. Environmental conditions were set at 20 degrees Celsius, 70% humidity with an 8 hour day, 16 hour night light regime. Plants were harvested after 4 weeks of growth and the entire aerial portion of the plant was harvested and immediately frozen in liquid nitrogen and stored at −80 C. Mutant phenotype plants were harvested separately from normal phenotype plants, which serve as the control tissue.


(jj) Flowers (Green, White or Buds)

Approximately 10 μl of Arabidopsis thaliana seeds (ecotype Ws) were sown on 350 soil (containing 0.03% marathon) and vernalized at 4 C for 3 days. Plants were then grown at room temperature under fluorescent lighting until flowering. Flowers were harvested after 28 days in three different categories. Buds that had not opened at all and were completely green were categorized as “flower buds” (also referred to as green buds by the investigator). Buds that had started to open, with white petals emerging slightly were categorized as “green flowers” (also referred to as white buds by the investigator). Flowers that had opened mostly (with no silique elongation) with white petals completely visible were categorized as “white flowers” (also referred to as open flowers by the investigator). Buds and flowers were harvested with forceps, flash frozen in liquid nitrogen and stored at −80 C until RNA was isolated.


2. Microarray Hybridization Procedures

Microarray technology provides the ability to monitor mRNA transcript levels of thousands of genes in a single experiment. These experiments simultaneously hybridize two differentially labeled fluorescent cDNA pools to glass slides that have been previously spotted with cDNA clones of the same species. Each arrayed cDNA spot will have a corresponding ratio of fluorescence that represents the level of disparity between the respective mRNA species in the two sample pools. Thousands of polynucleotides can be spotted on one slide, and each experiment generates a global expression pattern.


Coating Slides

The microarray consists of a chemically coated microscope slide, referred herein as a “chip” with numerous polynucleotide samples arrayed at a high density. The poly-L-lysine coating allows for this spotting at high density by providing a hydrophobic surface, reducing the spreading of spots of DNA solution arrayed on the slides. Glass microscope slides (Gold Seal #3010 manufactured by Gold Seal Products, Portsmouth, N.H., USA) were coated with a 0.1% W/V solution of Poly-L-lysine (Sigma, St. Louis, Mo.) using the following protocol:


1. Slides were placed in slide racks (Shandon Lipshaw #121). The racks were then put in chambers (Shandon Lipshaw #121).


2. Cleaning solution was prepared:


70 g NaOH was dissolved in 280 mL ddH2O.


420 mL 95% ethanol was added. The total volume was 700 mL (=2×350 mL); it was stirred until completely mixed.


If the solution remained cloudy, ddH2O was added until clear.


3. The solution was poured into chambers with slides; the chambers were covered with glass lids. The solution was mixed on an orbital shaker for 2 hr.


4. The racks were quickly transferred to fresh chambers filled with ddH2O. They were rinsed vigorously by plunging racks up and down.


Rinses were repeated 4× with fresh ddH2O each time, to remove all traces of NaOH-ethanol.


5. Polylysine solution was prepared:


0 mL poly-L-lysine+70 mL tissue culture PBS in 560 mL water, using plastic graduated cylinder and beaker.


6. Slides were transferred to polylysine solution and shaken for 1 hr.


7. The rack was transferred to a fresh chambers filled with ddH2O. It was plunged up and down 5× to rinse.


8. The slides were centrifuged on microtiter plate carriers (paper towels were placed below the rack to absorb liquid) for 5 min. @ 500 rpm. The slide racks were transferred to empty chambers with covers.


9. Slide racks were dried in a 45 C oven for 10 min.


10. The slides were stored in a closed plastic slide box.


11. Normally, the surface of lysine coated slides was not very hydrophobic immediately after this process, but became increasingly hydrophobic with storage. A hydrophobic surface helped ensure that spots didn't run together while printing at high densities. After they aged for 10 days to a month the slides were ready to use. However, coated slides that have been sitting around for long periods of time were usually too old to be used. This was because they developed opaque patches, visible when held to the light, and these resulted in high background hybridization from the fluorescent probe.


Alternatively, precoated glass slides were purchased from TeleChem Internation, Inc. (Sunnyvale, Calif., 94089; catalog number SMM-25, Superamine substrates).


PCR Amplification of cDNA Clone Inserts


Polynucleotides were amplified from Arabidopsis cDNA clones using insert specific probes. The resulting 100 uL PCR reactions were purified with Qiaquick 96 PCR purification columns (Qiagen, Valencia, Calif., USA) and eluted in 30 uL of 5 mM Tris. 8.5 uL of the elution were mixed with 1.5 uL of 20×SSC to give a final spotting solution of DNA in 3×SSC. The concentrations of DNA generated from each clone varied between 10-100 ng/ul, but were usually about 50 ng/ul.


Arraying of PCR Products on Glass Slides

PCR products from cDNA clones were spotted onto the poly-L-Lysine coated glass slides using an arrangement of quill-tip pins (ChipMaker 3 spotting pins; Telechem, International, Inc., Sunnyvale, Calif., USA) and a robotic arrayer (PixSys 3500, Cartesian Technologies, Irvine, Calif., USA). Around 0.5 nl of a prepared PCR product was spotted at each location to produce spots with approximately 100 um diameters. Spot center-to-center spacing was from 180 um to 210 um depending on the array. Printing was conducted in a chamber with relative humidity set at 50%.


Slides containing maize sequences were purchased from Agilent Technology (Palo Alto, Calif. 94304).


Post-Processing of Slides

After arraying, slides were processed through a series of steps—rehydration, UV cross-linking, blocking and denaturation—required prior to hybridization. Slides were rehydrated by placing them over a beaker of warm water (DNA face down), for 2-3 sec, to distribute the DNA more evenly within the spots, and then snap dried on a hot plate (DNA side, face up). The DNA was then cross-linked to the slides by UV irradiation (60-65mJ; 2400 Stratalinker, Stratagene, La Jolla, Calif., USA).


Following this a blocking step was performed to modify remaining free lysine groups, and hence minimize their ability to bind labeled probe DNA. To achieve this the arrays were placed in a slide rack. An empty slide chamber was left ready on an orbital shaker. The rack was bent slightly inwards in the middle, to ensure the slides would not run into each other while shaking. The blocking solution was prepared as follows:


3×350-ml glass chambers (with metal tops) were set to one side, and a large round Pyrex dish with dH2O was placed ready in the microwave. At this time, 15 ml sodium borate was prepared in a 50 ml conical tube.


6-g succinic anhydride was dissolved in approx. 325-350 mL 1-methyl-2-pyrrolidinone. Rapid addition of reagent was crucial.


a. Immediately after the last flake of the succinic anhydride dissolved, the 15-mL sodium borate was added.


b. Immediately after the sodium borate solution mixed in, the solution was poured into an empty slide chamber.


c. The slide rack was plunged rapidly and evenly in the solution. It was vigorously shaken up and down for a few seconds, making sure slides never left the solution.


d. It was mixed on an orbital shaker for 15-20 min. Meanwhile, the water in the Pyrex dish (enough to cover slide rack) was heated to boiling.


Following this, the slide rack was gently plunge in the 95 C water (just stopped boiling) for 2 min. Then the slide rack was plunged 5× in 95% ethanol. The slides and rack were centrifuged for 5 min. @ 500 rpm. The slides were loaded quickly and evenly onto the carriers to avoid streaking. The arrays were used immediately or store in slide box.


The Hybridization process began with the isolation of mRNA from the two tissues (see “Isolation of total RNA” and “Isolation of mRNA”, below) in question followed by their conversion to single stranded cDNA (see “Generation of probes for hybridization”, below). The cDNA from each tissue was independently labeled with a different fluorescent dye and then both samples were pooled together. This final differentially labeled cDNA pool was then placed on a processed microarray and allowed to hybridize (see “Hybridization and wash conditions”, below).


Isolation of Total RNA

Approximately 1 g of plant tissue was ground in liquid nitrogen to a fine powder and transferred into a 50-ml centrifuge tube containing 10 ml of Trizol reagent. The tube was vigorously vortexed for 1 min and then incubated at room temperature for 10-20 min. on an orbital shaker at 220 rpm. Two ml of chloroform was added to the tube and the solution vortexed vigorously for at least 30-sec before again incubating at room temperature with shaking. The sample was then centrifuged at 12,000×g (10,000 rpm) for 15-20 min at 4° C. The aqueous layer was removed and mixed by inversion with 2.5 ml of 1.2 M NaCl/0.8 M Sodium Citrate and 2.5 ml of isopropyl alcohol added. After a 10 min. incubation at room temperature, the sample was centrifuged at 12,000×g (10,000 rpm) for 15 min at 4° C. The pellet was washed with 70% ethanol, re-centrifuged at 8,000 rpm for 5 min and then air dried at room temperature for 10 min. The resulting total RNA was dissolved in either TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) or DEPC (diethylpyrocarbonate) treated deionized water (RNAse-free water). For subsequent isolation of mRNA using the Qiagen kit, the total RNA pellet was dissolved in RNAse-free water.


Isolation of mRNA


mRNA was isolated using the Qiagen Oligotex mRNA Spin-Column protocol (Qiagen, Valencia, Calif.). Briefly, 500 μl OBB buffer (20 mM Tris-Cl, pH 7.5, 1 M NaCl, 2 mM EDTA, 0.2% SDS) was added to 500 μl of total RNA (0.5-0.75 mg) and mixed thoroughly. The sample was first incubated at 70° C. for 3 min, then at room temperature for 10 minutes and finally centrifuged for 2 min at 14,000-18,000×g. The pellet was resuspended in 400 μl OW2 buffer (10 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1 mM EDTA) by vortexing, the resulting solution placed on a small spin column in a 1.5 ml RNase-free microcentrifuge tube and centrifuged for 1 min at 14,000-18,000×g. The spin column was transferred to a new 1.5 ml RNase-free microcentrifuge tube and washed with 400 μl of OW2 buffer. To release the isolated mRNA from the resin, the spin column was again transferred to a new RNase-free 1.5 ml microcentrifuge tube, 20-100 μl 70° C. OEB buffer (5 mM Tris-Cl, pH 7.5) added and the resin resuspended in the resulting solution via pipetting. The mRNA solution was collected after centrifuging for 1 min at 14,000-18,000×g.


Alternatively, mRNA was isolated using the Stratagene Poly(A) Quik mRNA Isolation Kit (Startagene, La Jolla, Calif.). Here, up to 0.5 mg of total RNA (maximum volume of 1 ml) was incubated at 65° C. for 5 minutes, snap cooled on ice and 0.1× volumes of 10× sample buffer (10 mM Tris-HCl (pH 7.5), 1 mM EDTA (pH 8.0) 5 M NaCl) added. The RNA sample was applied to a prepared push column and passed through the column at a rate of ˜1 drop every 2 sec. The solution collected was reapplied to the column and collected as above. 200 μl of high salt buffer (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.5 NaCl) was applied to the column and passed through the column at a rate of ˜1 drop every 2 sec. This step was repeated and followed by three low salt buffer (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.1 M NaCl) washes preformed in a similar manner. mRNA was eluted by applying to the column four separate 200 μl aliquots of elution buffer (10 mM Tris-HCl (pH 7.5), 1 mM EDTA) preheated to 65° C. Here, the elution buffer was passed through the column at a rate of 1 drop/sec. The resulting mRNA solution was precipitated by adding 0.1× volumes of 10× sample buffer, 2.5 volumes of ice-cold 100% ethanol, incubating overnight at −20° C. and centrifuging at 14,000-18,000×g for 20-30 min at 4° C. The pellet was washed with 70% ethanol and air dried for 10 min. at room temperature before resuspension in RNase-free deionized water.


Preparation of Yeast Controls

Plasmid DNA was isolated from the following yeast clones using Qiagen filtered maxiprep kits (Qiagen, Valencia, Calif.): YAL022c(Fun26), YAL031c(Fun21), YBR032w, YDL131w, YDL182w, YDL194w, YDL196w, YDR050c and YDR116c. Plasmid DNA was linearized with either BsrBI (YAL022c(Fun26), YAL031c(Fun21), YDL131w, YDL182w, YDL194w, YDL196w, YDR050c) or AflIII (YBR032w, YDR116c) and isolated.


In Vitro Transcription of Yeast Clones

The following solution was incubated at 37° C. for 2 hours: 17 μl of isolated yeast insert DNA (1 μg), 20 μl 15× buffer, 10 μl 100 mM DTT, 2.5 μl (100 U) RNasin, 20 μl 2.5 mM (ea.) rNTPs, 2.7 μl (40U) SP6 polymerase and 27.8 μl RNase-free deionized water. 2 μl (2 U) Ampli DNase I was added and the incubation continued for another 15 min. 10 μl 5M NH4OAC and 100 μl phenol:chloroform:isoamyl alcohol (25:24:1) were added, the solution vortexed and then centrifuged to separate the phases. To precipitate the RNA, 250 μl ethanol was added and the solution incubated at −20° C. for at least one hour. The sample was then centrifuged for 20 min at 4° C. at 14,000-18,000×g, the pellet washed with 500 μl of 70% ethanol, air dried at room temperature for 10 min and resuspended in 100 μl of RNase-free deionized water. The precipitation procedure was then repeated.


Alternatively, after the two-hour incubation, the solution was extracted with phenol/chloroform once before adding 0.1 volume 3M sodium acetate and 2.5 volumes of 100% ethanol. The solution was centrifuged at 15,000 rpm, 4° C. for 20 minutes and the pellet resuspended in RNase-free deionized water. The DNase I treatment was carried out at 37° C. for 30 minutes using 2 U of Ampli DNase I in the following reaction condition: 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2. The DNase I reaction was then stopped with the addition of NH4OAC and phenol:chloroform:isoamyl alcohol (25:24:1), and RNA isolated as described above.


0.15-2.5 ng of the in vitro transcript RNA from each yeast clone were added to each plant mRNA sample prior to labeling to serve as positive (internal) probe controls.


Generation of Probes for Hybridization

Generation of Labeled Probes for Hybridization from First-Strand cDNA


Hybridization probes were generated from isolated mRNA using an Atlas™ Glass Fluorescent Labeling Kit (Clontech Laboratories, Inc., Palo Alto, Calif., USA). This entails a two step labeling procedure that first incorporates primary aliphatic amino groups during cDNA synthesis and then couples fluorescent dye to the cDNA by reaction with the amino functional groups. Briefly, 5 μg of oligo(dT)18 primer d(TTTTTTTTTTTTTTTTTTV) was mixed with Poly A+mRNA (1.5-2 μg mRNA isolated using the Qiagen Oligotex mRNA Spin-Column protocol or-the Stratagene Poly(A) Quik mRNA Isolation protocol (Stratagene, La Jolla, Calif., USA)) in a total volume of 25 μl. The sample was incubated in a thermocycler at 70° C. for 5 min, cooled to 48° C. and 10 μl of 5×cDNA Synthesis Buffer (kit supplied), 5 μl 10×dNTP mix (dATP, dCTP, dGTP, dTTP and aminoallyl-dUTP; kit supplied), 7.5 μl deionized water and 2.5 μl MMLV Reverse Transcriptase (500U) added. The reaction was then incubated at 48° C. for 30 minutes, followed by 1 hr incubation at 42° C. At the end of the incubation the reaction was heated to 70° C. for 10 min, cooled to 37° C. and 0.5 μl (5 U) RNase H added, before incubating for 15 min at 37° C. The solution was vortexed for 1 min after the addition of 0.5 μl 0.5 M EDTA and 5 μl of QuickClean Resin (kit supplied) then centrifuged at 14,000-18,000×g for 1 min. After removing the supernatant to a 0.45 μm spin filter (kit supplied), the sample was again centrifuged at 14,000-18,000×g for 1 min, and 5.5 μl 3M sodium acetate and 137.5 μl of 100% ethanol added to the sample before incubating at −20° C. for at least 1 hr. The sample was then centrifuged at 14,000-18,000×g at 4° C. for 20 min, the resulting pellet washed with 500 μl 70% ethanol, air-dried at room temperature for 10 min and resuspended in 10 μl of 2× fluorescent labeling buffer (kit provided). 10 μl each of the fluorescent dyes Cy3 and Cy5 (Amersham Pharmacia (Piscataway, N.J., USA); prepared according to Atlas™ kit directions of Clontech) were added and the sample incubated in the dark at room temperature for 30 min.


The fluorescently labeled first strand cDNA was precipitated by adding 2 μl 3M sodium acetate and 50 μl 100% ethanol, incubated at −20° C. for at least 2 hrs, centrifuged at 14,000-18,000×g for 20 min, washed with 70% ethanol, air-dried for 10 min and dissolved in 100 μl of water.


Alternatively, 3-4 μg mRNA, 2.5 (˜8.9 ng of in vitro translated mRNA) μl yeast control and 3 μg oligo dTV (TTTTTTTTTTTTTTTTTT(A/C/G); Sequence ID No.: X) were mixed in a total volume of 24.7 μl. The sample was incubated in a thermocycler at 70° C. for 10 min. before chilling on ice. To this, 8 μl of 5× first strand buffer (SuperScript II RNase H-Reverse Transcriptase kit from Invitrogen (Carlsbad, Calif. 92008); cat no. 18064022), 0.8° C. of aa-dUTP/dNTP mix (50×; 25 mM dATP, 25 mM dGTP, 25 mM dCTP, 15 mM dTTP, 10 mM aminoallyl-dUTP), 4 μl of 0.1 M DTT and 2.5 μl (500 units) of Superscript R.T.II enzyme (Stratagene) were added. The sample was incubated at 42° C. for 2 hours before a mixture of 10° C. of 1M NaOH and 10° C. of 0.5 M EDTA were added. After a 15 minute incubation at 65° C., 25 μl of 1 M Tris pH 7.4 was added. This was mixed with 450 μl of water in a Microcon 30 column before centrifugation at 11,000×g for 12 min. The column was washed twice with 450 μl (centrifugation at 11,000 g, 12 min.) before eluting the sample by inverting the Microcon column and centrifuging at 11,000×g for 20 seconds. Sample was dehydrated by centrifugation under vacuum and stored at −20° C.


Each reaction pellet was dissolved in 9 μl of 0.1 M carbonate buffer (0.1M sodium carbonate and sodium bicarbonate, pH=8.5-9) and 4.5 μl of this placed in two microfuge tubes. 4.5 μl of each dye (in DMSO) were added and the mixture incubated in the dark for 1 hour. 4.5 μl of 4 M hydroxylamine was added and again incubated in the dark for 15 minutes.


Regardless of the method used for probe generation, the probe was purified using a Qiagen PCR cleanup kit (Qiagen, Valencia, Calif., USA), and eluted with 100 ul EB (kit provided). The sample was loaded on a Microcon YM-30 (Millipore, Bedford, Mass., USA) spin column and concentrated to 4-5 ul in volume. Probes for the maize microarrays were generated using the Fluorescent Linear Amplification Kit (cat. No. G2556A) from Agilent Technologies (Palo Alto, Calif.).


Hybridization and Wash Conditions

The following Hybridization and Washing Condition were developed:


Hybridization Conditions:

Labeled probe was heated at 95° C. for 3 min and chilled on ice. Then 25 □L of the hybridization buffer which was warmed at 42 C was added to the probe, mixing by pipetting, to give a final concentration of:


50% formamide


4×SSC


0.03% SDS


5×Denhardt's solution


0.1 μg/ml single-stranded salmon sperm DNA


The probe was kept at 42 C. Prior to the hybridization, the probe was heated for 1 more min., added to the array, and then covered with a glass cover slip. Slides were placed in hybridization chambers (Telechem, Sunnyvale, Calif.) and incubated at 42° C. overnight.


Washing Conditions:

A. Slides were washed in 1×SSC+0.03% SDS solution at room temperature for 5 minutes,


B. Slides were washed in 0.2×SSC at room temperature for 5 minutes,


C. Slides were washed in 0.05×SSC at room temperature for 5 minutes.


After A, B, and C, slides were spun at 800×g for 2 min. to dry. They were then scanned.


Maize microarrays were hybridized according to the instructions included Fluorescent Linear Amplification Kit (cat. No. G2556A) from Agilent Technologies (Palo Alto, Calif.).


Scanning of Slides

The chips were scanned using a ScanArray 3000 or 5000 (General Scanning, Watertown, Mass., USA). The chips were scanned at 543 and 633 nm, at 10 urn resolution to measure the intensity of the two fluorescent dyes incorporated into the samples hybridized to the chips.


Data Extraction and Analysis

The images generated by scanning slides consisted of two 16-bit TIFF images representing the fluorescent emissions of the two samples at each arrayed spot. These images were then quantified and processed for expression analysis using the data extraction software Imagene™ (Biodiscovery, Los Angeles, Calif., USA). Imagene output was subsequently analyzed using the analysis program Genespring™ (Silicon Genetics, San Carlos, Calif., USA). In Genespring, the data was imported using median pixel intensity measurements derived from Imagene output. Background subtraction, ratio calculation and normalization were all conducted in Genespring. Normalization was achieved by breaking the data in to 32 groups, each of which represented one of the 32 pin printing regions on the microarray. Groups consist of 360 to 550 spots. Each group was independently normalized by setting the median of ratios to one and multiplying ratios by the appropriate factor.


The results of the microarray experiments are reported in the MA_DIFF Table as described above in the section entitled “Brief Description of the Individual Tables”.


Example 4: AFLP Experiments and Results
Production of Samples

mRNA was prepared from 27 plant tissues. Based on preliminary cDNA-AFLP analysis with a few primer combinations, 11 plant tissues and/or pooled samples were selected. Samples were selected to give the greatest representation of unique band upon electrophoresis. The final 11 samples or pooled samples used in the cDNA-AFLP analysis were:















 S1
Dark adapted seedlings


 S2
Roots/Etiolated Seedlings


 S3
Mature leaves, soil grown


 S4
Immature buds, inflorescence meristem


 S5
Flowers opened


 S6
Siliques, all stages


 S7
Senescing leaves (just beginning to yellow)


 S8
Callus Inducing medium



Callus shoot induction



Callus root induction


 S9
Wounding



Methyl-jasmonate-treated


S10
Oxidative stress



Drought stress



Oxygen Stress-flooding


S11
Heat treated light grown seedling



Cold treated light grown seedlings









cDNA from each of the 11 samples was digested with two restriction endonucleases, namely TaqI and MseI. TaqI and MseI adapters were then ligated to the restriction enzyme fragments. Using primers to these adapters that were specific in sequence (i.e. without extensions), the restriction fragments were subjected to cycles of non-radioactive pre-amplification.


Selective PCR

In order to limit the number of fragments or bands on each lane of the AFLP gel, fragments were subjected to another round of selective radioactive polymerase chain amplification. The TaqI primers used in this amplification were 5′-labelled with P33. For these amplifications, the TaqI primers had two extra nucleotides at their 3′ end and the MseI primers had three extra nucleotides at their 3′ end. This resulted in 16 primer designs for the TaqI primer and 64 primer designs for the MseI primer. Altogether, this gave rise to a total of 1024 primer designs. Fragments generated in this selective amplification protocol were run with labeled molecular weight markers on polyacrylamide gels to separate fragments in the size range of 100-600 nucleotides.


Following gel electrophoresis, profiles were analyzed with a phosphoimager. From these images, electronic files, giving the mobilities of all bands on the gels and their intensities in each of the samples, were compiled.


All unique bands were cut out of the gels. The gel pieces were placed in 96 well plates for elution and their plate designation was linked to their electrophoretic mobilities recorded in the electronic files. The eluted fragments were then subjected to another round of amplification, this time using reamplification primers (see below). After amplification, DNA fragments were sequenced.


A computer database was established linking the mobilities of all the bands observed on the cDNA-AFLP gels with the sequence of the correspondingly isolated fragment. The sequence allowed for identification of the gene from which the cDNA-AFLP fragment was derived, allowing for a linkage of band mobility with the transcript of a specific gene. Also linked to the band mobilities were their intensities recorded for each of the eleven samples used in constructing the database.


This cDNA-AFLP analysis with TaqI/MseI and 1024 primer combinations was repeated using the enzymes NlaIII in place of TaqI, and Csp6I in place of MseI.


Using the Database for the Transcript Profiling of Experimental Samples

Experimental Samples were subjected to cDNA-AFLP as described above, resulting in electronic files recording band mobilities and intensities. Through use of the database established above, band mobilities could be linked to specific cDNAs, and therefore genes. Furthermore, the linkage with the intensities in the respective samples allowed for the quantification of specific cDNAs in these samples, and thus the relative concentration of specific transcripts in the samples, indicating the level to which specific genes were expressed.









Reamplification primers


99G24


CGCCAGGGTTTTCCCAGTCACGAC|ACGACTCACT|gatgagtcctgag


taa|





M13 forward +10 MseI +0


99G20





AGCGGATAACAATTTCACACAGGA|CACACTGGTA|tagactgcgtacc


ga|


M13 reverse +10 TaqI +0






Purification of the Reamplifiction Reaction Before Sequencing















5
μl reamplification reaction


0.25
μl 10xPCR buffer


0.33
μl Shrimp Alkaline



Phosphatase



(Amersham Life



Science)


0.033
μl Exonuclease I (USB)


0.297
μl SAP dilution buffer


1.59
μl MQ


7.5
μl total







30’ 37° C.


10’ 80° C.


   4° C.









Sample Preparation
S1: Dark Adapted Seedlings:

Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. After 8 days, the seedlings were foil-wrapped and harvested after two days.


S2: Roots/Etiolated Seedlings:

Seeds of Arabidopsis thaliana (wassilewskija) were germinated on solid germination media (1×MS salts, 1×MS vitamins, 20 g/L sucrose, 50 mg/L MES pH 5.8) in the dark. Tissues were harvested 14 days later.


S3: Mature Leaves, Soil Grown:

Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. Leaves were harvested 17 days later from plants that had not yet bolted.


S4: Immature Buds, Inflorescence Meristem:

Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark.


S5: Flowers, Opened:

Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark.


S6: Siliques, all Stages:

Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark.


S7: Senescing Leaves (Just Beginning to Yellow):

Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. When the plant had leaves that were less than 50% yellow, the leaves that were just beginning to yellow were harvested.


S8:

Callus Inducing Medium:


Seeds of Arabidopsis thaliana (wassilewskija) were surface sterilized (1 min-75% Ethanol, 6 min-bleach 100%+Tween 20, rinse) and incubated on MS medium containing 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg/l and Kinetin 1 mg/l in the dark for 3 weeks to generate primary callus.


Hypocotyls and roots of the seedling were swollen after a week after incubation in this callus induction medium and subsequently callus was initiated from these swollen areas.


Callus Shoot Induction:


Primary calluses were transferred to the fresh callus induction medium for another 2 weeks growth to generate secondary callus. Secondary callus were transferred to shoot induction medium containing MS basal medium and Benzyladenine (BA) 2 mg/l and Naphthaleneacetic acid (NAA)).1 mg/l for 2 weeks growth in the light before it was harvested and frozen and sent to Keygene. Many shoot meristems were observed under the microscope.


Callus Root Induction:


Secondary calluses were transferred to root induction medium containing MS basal medium, sucrose 1% and Indolebutyric acid (IBA) 0.05 mg/l in the dark. Many root primordia were observed under microscope after 10 days in the root induction medium. Those callus tissue were harvested and frozen and sent to Keygene.


S9:

Wounding:


Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. After 20 days, leaves of plants were wounded with pliers. Wounded leaves were harvested I hour and 4 hours after wounding.


Methyl Jasmonate Treatment:


Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. After 13 days, plants were sprayed with 0.001% methyl jasmonate. Leaves were harvested 1.5 hours and 6 hours after spraying


S10:

Oxidative Stress:


Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. After 24 days, a few leaves were inoculated with a mixture of 2.5 mM D-glucose, 2.5 U/mL glucose oxidase in 20 mM sodium phosphate buffer pH 6.5. After an hour, 3 hours, or 5 hours after inoculation, whole plant, except for the inoculated leaves, was harvested. This sample was mixed with sample from plants that were sitting in full sun (152,000 LUX) for 2 hours or four hours.


Drought Stress:


Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. After 20 days, aerial tissues were harvested and left to dry in 3 MM Whatman paper for 1 hour or 4 hours.


Oxygen Stress:


Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. After 21 days, the plant was flooded by immersing its pot in a beaker of tap water. After 6 days, the upper tissues were harvested.


S11: Heat-Treated Light Grown Seedlings:

Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. Over a 5 hour period, the temperature was raised to 42° C. at the rate of approximately 4° C. per hour. After 1 hour at 42° C., the aerial tissues were collected. This sample was mixed with an equal volume of sample that went through a heat-recovery treatment namely bringing down the temperature to 22° C. from 42° C. over a 5 hour period at the rate of 4° C. per hour.


Cold-Treated Light Grown Seedlings:


Seeds of Arabidopsis thaliana (wassilewskija) were sown in pots and left at 4° C. for two to three days to vernalize. They were transferred to a growth chamber after three days. The intensity of light in the growth chamber was 7000-8000 LUX, temperature was 22° C., with 16 h light and 8 h dark. After 18 days, the plant was transferred to 4° C. for an hour before the aerial tissues were harvested. This sample was mixed with aerial tissues from another plant that was transferred to 4° C. for 27 hours before being harvested.


Analysis of Data:

Intensity: The intensity of the band corresponds to the value in each lane marked S1, S2 etc.


P-values: The data shows P-values of each of the samples 1-11. P-values are calculated using the following formula 2*(1−NORMDIST(ABS(Sx−AVERAGE(of S1 to S11, not including Sx))/STDEV(of S1 to S11 not including Sx),0,1,TRUE)) using Excel functions.


The equivalent mathematical formula of P-value is as follows:


∫ϕ(x)dx, integrated from a to ∞,


where ϕ(x) is a normal distribution:


where a=|Sx−μ|

    • σ(S1 . . . S11, not including Sx);


where μ=is the average of the intensities of all samples except Sx,






=



(

Σ





S





1







Sn

)

-
Sx


n
-
1






where σ(S1 . . . S11, not including Sx)=the standard deviation of all sample intensities except Sx.


Results:

The results are shown in the MA_diff tables.


Example 5: Transformation of Carrot Cells

Transformation of plant cells can be accomplished by a number of methods, as described above. Similarly, a number of plant genera can be regenerated from tissue culture following transformation. Transformation and regeneration of carrot cells as described herein is illustrative.


Single cell suspension cultures of carrot (Daucus carota) cells are established from hypocotyls of cultivar Early Nantes in B5 growth medium (O. L. Gamborg et al., Plant Physiol. 45:372 (1970)) plus 2,4-D and 15 mM CaCl2 (B5-44 medium) by methods known in the art. The suspension cultures are subcultured by adding 10 ml of the suspension culture to 40 ml of B5-44 medium in 250 ml flasks every 7 days and are maintained in a shaker at 150 rpm at 27° C. in the dark.


The suspension culture cells are transformed with exogenous DNA as described by Z. Chen et al. Plant Mol. Bio. 36:163 (1998). Briefly, 4-days post-subculture cells are incubated with cell wall digestion solution containing 0.4 M sorbitol, 2% driselase, 5 mM MES (2-[N-Morpholino] ethanesulfonic acid) pH 5.0 for 5 hours. The digested cells are pelleted gently at 60×g for 5 min. and washed twice in W5 solution containing 154 mM NaCl, 5 mM KCl, 125 mM CaCl2 and 5 mM glucose, pH 6.0. The protoplasts are suspended in MC solution containing 5 mM MES, 20 mM CaCl2, 0.5 M mannitol, pH 5.7 and the protoplast density is adjusted to about 4×106 protoplasts per ml.


15-60 μg of plasmid DNA is mixed with 0.9 ml of protoplasts. The resulting suspension is mixed with 40% polyethylene glycol (MW 8000, PEG 8000), by gentle inversion a few times at room temperature for 5 to 25 min. Protoplast culture medium known in the art is added into the PEG-DNA-protoplast mixture. Protoplasts are incubated in the culture medium for 24 hour to 5 days and cell extracts can be used for assay of transient expression of the introduced gene. Alternatively, transformed cells can be used to produce transgenic callus, which in turn can be used to produce transgenic plants, by methods known in the art. See, for example, Nomura and Komamine, Plt. Phys. 79:988-991 (1985), Identification and Isolation of Single Cells that Produce Somatic Embryos in Carrot Suspension Cultures.


Example 6: Phenotype Screens and Results
A: Triparental Mating and Vacuum Infiltration Transformation of Plants

Standard laboratory techniques are as described in Sambrook et al. (1989) unless otherwise stated. Single colonies of Agrobacterium C58C1Rif, E. coli helper strain HB101 and the E. coli strain containing the transformation construct to be mobilized into Agrobacterium were separately inoculated into appropriate growth media and stationary cultures produced. 100 μl of each of the three cultures were mixed gently, plated on YEB (5 g Gibco beef extract, 1 g Bacto yeast extract, 1 g Bacto peptone, 5 g sucrose, pH 7.4) solid growth media and incubated overnight at 28° C. The bacteria from the triparental mating were collected in 2 ml of lambda buffer (20 mM Tris (pH 7.5), 100 mM NaCl, 10 mM MgCl2) and serial dilutions made. An aliquot of the each dilution was then plated and incubated for 2 days at 28° C. on YEB plates supplemented with 100 μg/ml rifampicin and 100 μg/ml carbenicillin for calculation of the number of acceptor cells and on YEB plates supplemented with 100 μg/ml rifampicin, 100 μg/ml carbenicillin and 100 μg/ml spectinomycin for selection of transconjugant cells. The cointegrate structure of purified transconjugants was verified via Southern blot hybridization.


A transconjugant culture was prepared for vacuum infiltration by inoculating 1 ml of a stationary culture arising from a single colony into liquid YEB media and incubating at 28° C. for approximately 20 hours with shaking (220 rpm) until the OD taken at 600 nm was 0.8-1.0. The culture was then pelleted (8000 rpm, 10 min, 4° C. in a Sorvall SLA 3000 rotor) and the bacteria resuspended in infiltration medium (0.5×MS salts, 5% w/v sucrose, 10 μg/l BAP, 200 μl/l Silwet L-77, pH 5.8) to a final OD600 of 1.0. This prepared transconjugant culture was used within 20 minutes of preparation.


Wild-type plants for vacuum infiltration were grown in 4-inch pots containing Metromix 200 and Osmocote. Briefly, seeds of Arabidopsis thaliana (ecotype Wassilewskija) were sown in pots and left at 4° C. for two to four days to vernalize. They were then transferred to 22-25° C. and grown under long-day (16 hr light: 8 hr dark) conditions, sub-irrigated with water. After bolting, the primary inflorescence was removed and, after four to eight days, the pots containing the plants were inverted in the vacuum chamber to submerge all of the plants in the prepared transconjugant culture. Vacuum was drawn for two minutes before pots were removed, covered with plastic wrap and incubated in a cool room under darkness or very low light for one to two days. The plastic wrap was then removed, the plants returned to their previous growing conditions and subsequently produced (T1) seed collected.


B: Selection of T-DNA Insertion Lines

Approximately 10,750 seeds from the initial vacuum infiltrated plants were sown per flat of Metromix 350 soil. Flats were vernalized for four to five days at 4° C. before being transferred to


22-25° C. and grown under long-day (16 hr light: 8 hr dark) conditions, sub-irrigated with water. Approximately seven to ten days after germination, the (T1) seedlings were sprayed with 0.02% Finale herbicide (AgrEvo). After another five to seven days, herbicide treatment was repeated. Herbicide resistant T1 plants were allowed to self-pollinate and T2 seed were collected from each individual. In the few cases where the T1 plant produced few seed, the T2 seed was planted in bulk, the T2 plants allowed to self-pollinate and T3 seed collected.


C: Phenotype Screening

Approximately 40 seed from each T2 (or T3) line were planted in a 4-inch pot containing either Sunshine mix or Metromix 350 soil. Pots were vernalized for four to five days at 4° C. before being transferred to 22-25° C. and grown under long-day (16 hr light: 8 hr dark) conditions, sub-irrigated with water. A first phenotype screen was conducted by visually inspecting the seedlings five to seven days after germination and aberrant phenotypes noted. Plants were then sprayed with Finale herbicide within four days (i.e. about seven to nine days after germination). The second visual screen was conducted on surviving T2 (or T3) plants about sixteen to seventeen days after germination and the final screen was conducted after the plants had bolted and formed siliques. Here, the third and fourth green siliques were collected and aberrant phenotypes noted. The Knock-in and Knock-out Tables contain descriptions of identified phenotypes.


Alternative, seed were surface sterilized and transferred to agar solidified medium containing Murashige and Skoog salts (1×), 1% sucrose (wt/v) pH 5.7 before autoclaving. Seed were cold treated for 48 hours and transferred to long days [16 hours light and 8 hours dark], 25° C. Plants were screened at 5 and 10 days.


In another screen, seed were surface sterilized and transferred to agar solidified medium containing Murashige and Skoog salts (1×), and combinations of various nitrogen and sucrose amounts as specified below:


Medium 1: no sucrose, 20.6 mM NH4NO3, 18.8 mM KNO3;


Medium 2: 0.5% sucrose, 20.6 mM NH4NO3, 18.8 mM KNO3;


Medium 3: 3% sucrose, 20.6 mM NH4NO3, 18.8 mM KNO3;


Medium 4: no sucrose, 20.6 μM NH4NO3, 18.8 μM KNO3;


Medium 5: 0.5% sucrose, 20.6 μM NH4NO3, 18.8 μM KNO3; and


Medium 6: 3% sucrose, 20.6 μM NH4NO3, 18.8 μM KNO3.


The 0.5% sucrose was the control concentration for the sucrose. The low nitrogene, 20.6 μM NH4NO3, 18.8 μM KNO3, is the control for the nitrogen. Seed were cold treated for 48 hours and transferred to long days [16 hours light and 8 hours dark], 25° C. Plants were screened at 2, 5, and 10 days.


D: TAIL-PCR and Fragment Sequencing

Rosette leaves were collected from each putative mutant and crushed between parafilm and FTA paper (Life Technologies). Two 2 mm2 hole punches were isolated from each FTA sample and washed according to the manufacturer's instructions by vortexing with 200 ul of the provided FTA purification reagent. The FTA reagent was removed and the washing procedure repeated two more times. The sample was then washed twice with 200 ul of FTA TE (10 mM Tris, 0.1 mM EDTA, pH 8.0) and vortexing prior to PCR.


Primers used for TAIL-PCR are as follows:









AD2:


5′ NGTCGASWGANAWGAA 3′ (128-fold degeneracy)


S = G or C, W = A or T, and N = A, G, C, or T





LB1:


5′ GTTTAACTGCGGCTCAACTGTCT 3′





LB2:


5′ CCCATAGACCCTTACCGCTTTAGTT 3′





LB3:


5′ GAAAGAAAAAGAGGTATAACTGGTA 3′






The extent to which the left and right borders of the T-DNA insert were intact was measured for each line by PCR. The following components were mixed for PCR: 1 2 mm2 FTA sample, 38.75 μl distilled water, 5 μl 10× Platinum PCR buffer (Life Technologies), 2 μl 50 mM MgCl2, 1 μl 10 mM dNTPs, 1 μl 10 μM primer LB1 (or RB1 for analysis of the right border), 1 μl 10 μM primer LB3R (or RB3R for analysis of the right border) and 1.25 U Platinum Taq (Life Technologies). Cycling conditions were: 94° C., 10 sec.; thirty cycles of 94° C., 1 sec.—54° C., 1 sec.—72° C., 1 sec.; 72° C., 4 sec. The expected band size for an intact left border is bp, while an intact right border generates a bp band.


Fragments containing left or right border T-DNA sequence and adjacent genomic DNA sequence were obtained via PCR. First product PCR reactions use the following reaction mixture: 1 2 mm2 FTA sample, 12.44 μl distilled water, 2 μl 10× Platinum PCR buffer (Life Technologies), 0.6 μl 50 mM MgCl2, 0.4 μl 10 mM dNTPs, 0.4 μl 10 μM primer LB1 (or RB1 for analysis of the right border), 3 μl 20 μM primer AD2 and 0.8 U Platinum Taq (Life Technologies). Cycling conditions for these reactions were: 93° C., 1 min.; 95° C., 1 min.; three cycles of 94° C., 45 sec.—62° C., 1 min.—72° C., 2.5 min.; 94° C., 45 sec.; 25° C., 3 min.; ramp to 72° C. in 3 min.; 72° C., 2.5 min.; fourteen cycles of 94° C., 20 sec.—68° C., 1 min.—72° C., 2.5 min.—94° C., 20 sec.—68° C., 1 min.—72° C., 2.5 min.—94° C., 20 sec.—44° C., 1 min.—72° C., 2.5 min.; 72° C., 5 min.; end; ˜4.5 hrs. For second product PCR reactions 1 μl of a 1:50 dilution of the first PCR product reaction was mixed with 13.44 μl distilled water, 2 μl 10× Platinum PCR buffer (Life Technologies), 0.6 μl 50 mM MgCl2, 0.4 μl 10 mM dNTPs, 0.4 μl 10 μM primer LB2 (or RB2 for analysis of the right border), 2 μl 20 μM primer AD2 and 0.8 U Platinum Taq (Life Technologies). Second product cycling conditions were: eleven cycles of 94° C., 20 sec.—64° C., 1 min.—72° C., 2.5 min.—94° C., 20 sec.—64° C., 1 min.—72° C., 2.5 min.—94° C., 20 sec.—44° C., 1 min.; 72° C., 5 min.; end; ˜3 hrs. Third product PCR reactions were prepared by first diluting 2 μl of the second PCR product with 98 μl of distilled water and then adding 1 μl of the dilution to 13.44 μl distilled water, 2 μl 10× Platinum PCR buffer (Life Technologies), 0.6 μl 50 mM MgCl2, 0.4 μl 10 mM dNTPs, 0.4 μl 10 μM primer LB3 (or RB3 for analysis of the right border), 2 μl 20 μM primer AD2 and 0.8 U Platinum Taq (Life Technologies). Third product cycling conditions were: twenty cycles of 94° C., 38 sec.—44° C., 1 min.—72° C., 2.5 min.; 72° C., 5 min.; end; ˜2 hrs. Aliquots of the first, second and third PCR products were electrophoresed on 1% TAE (40 mM Tris-acetate, 1 mM EDTA) to determine their size.


Reactions were purified prior to sequencing by conducting a final PCR reaction. Here, 0.25 μl Platinum PCR Buffer (Life Technologies), 0.1 μl 50 mM MgCl2, 3.3 U SAP shrimp alkaline phosphatase, 0.33 U Exonuclease and 1.781 μl distilled water were added to a 5 μl third product and the reaction cycled at 37° C., 30 min.; 80° C., 10 min.; 4° C. indefinitely.


Di-deoxy “Big Dye” sequencing was conducted on Perkin-Elmer 3700 or 377 machines.


Knock-in Experiments

For the following examples, a two-component system was constructed in a plant to ectopically express the desired cDNA.


First, a plant was generated by inserting a sequence encoding a transcriptional activator downstream of a desired promoter, thereby creating a first component where the desired promoter facilitates expression of the activator generated a plant. The first component also is referred to as the activator line.


Next, the second component is constructed by linking a desired cDNA to a sequence that the transcriptional activator can bind to and facilitate expression of the desired cDNA. The second component can be inserted into the activator line by transformation. Alternatively, the second component can be inserted into a separate plant, also referred to as the target line. Then, the target and activator lines can be crossed to generate progeny that have both components.


Two component lines were generated by both means.


Part I—from Crosses


Target lines containing cDNA constructs are generated using the Agrobacterium-mediated transformation. Selected target lines are genetically crossed to activation lines (or promoter lines). Generally, the promoter lines used are as described above. Evaluation of phenotypes is done on the resulting F1 progenies.


Part II—from Type I Supertransformation


Promoter activation lines (generally Vascular/Ovule/Young Seed/Embryo line, Seed/Epidermis/Ovary/Fruit line, Roots/Shoots/Ovule line, and Vasculature/Meristem are transformed with cDNA constructs using the Agrobacterium mediated transformation. Selected transformants (and their progenies) are evaluated for changes in phenotypes. The table for the knock-in of the Type I supertransformation comprises the following information

    • Clone ID,
    • Pfam,
    • Gemini ID
    • Trans. Unique ID (which indicates what promoter activation line was transformed
    • S Ratio: segregation ratio after the transformed plants are selected for the marker.
    • Assay
    • Stage: phenotype was observed
    • Feature: Where the phenotype was observed
    • Phenotype
    • P Ratio: phenotype ratio
    • Comments


      Part III—from Type II Supertransformation


Target lines generated using the procedure mentioned in Part I are transformed with T-DNA construct containing constitutive promoter. Selected transformants (and their progenies) are evaluated for changes in phenotypes.


An additional deposit of an E. coli Library, E. coliLibA021800, was made at the American Type Culture Collection in Manassas, Va., USA on Feb. 22, 2000 to meet the requirements of Budapest Treaty for the international recognition of the deposit of microorganisms. This deposit was assigned ATCC accession no. PTA-1411. Additionally, ATCC Library deposits; PTA-1161, PTA-1411 and PTA-2007 were made at the American Type Culture Collection in Manassas, Va., USA on; Jan. 7, 2000, Feb. 23, 2000 and Jun. 8, 2000 respectively, to meet the requirements of Budapest Treaty for the international recognition of the deposit of microorganisms.


The invention being thus described, it will be apparent to one of ordinary skill in the art that various modifications of the materials and methods for practicing the invention can be made. Such modifications are to be considered within the scope of the invention as defined by the following claims.


Each of the references from the patent and periodical literature cited herein is hereby expressly incorporated in its entirety by such citation.









SEQUENCE LISTING


The patent application contains a lengthy “Sequence Listing” section. A copy of the “Sequence Listing” is available in electronic form from the USPTO web site https://bulkdata.uspto.gov/data2/lengthysequencelisting/2018/. An electronic copy of the “Sequence Listing” will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).








Claims
  • 1. An isolated nucleic acid molecule comprising: a) a nucleic acid having a nucleotide sequence which encodes an amino acid sequence exhibiting at least 40% sequence identity to an amino acid sequence encoded by (1) a nucleotide sequence described in Tables 1 and/or 2 or a fragment thereof; or(2) a complement of a nucleotide sequence shown in Tables 1 and/or 2 or a fragment thereof;b) a nucleic acid which is the reverse of the nucleotide sequence according to subparagraph (a), such that the reverse nucleotide sequence has a sequence order which is the reverse of the sequence order of the nucleotide sequence according to subparagraph (a);c) a nucleic acid capable of hybridizing to a nucleic acid having a sequence selected from the group consisting of: (1) a nucleotide sequence which is shown in Tables 1 and/or 2; and a nucleotide sequence which is complementary to a nucleotide sequence shown in Tables 1 and/or 2, under conditions that permit formation of a nucleic acid duplex at a temperature from about 40° C. and 48° C. below the melting temperature of the nucleic acid duplex, with the proviso that said nucleotide sequence is not any of the sequences described in the Tables of any of Patent Publication Nos. WO 200040695, CA 2300692 A1, EP 1033405 A2, CA 2302828 A1 and EP 1059354 A2 and any proteins listed in the application that are identified by gi number or otherwise as being from the non-redundant GenBank CDS translations or Protein Database (PDB) at http://www.rcsb.org/pdb/+SwissProt (http://www.expasy.ch/sprot/sprot-top.html) or (PIR-International) Database (PIR) at http://pir.georgetown.edu/index.shtml.
  • 2. An isolated nucleic acid molecule comprising a nucleic acid having a nucleotide sequence which exhibits at least 65% sequence identity to a) a nucleotide sequence shown in Tables 1 and/or 2 or a fragment thereof; orb) a complement of a nucleotide sequence described in Tables 1 and/or 2 or a fragment thereof, with the proviso that said nucleotide sequence is not any of the sequences described in the Tables of any of Patent Publication Nos. WO 200040695, CA 2300692 A1, EP 1033405 A2, CA 2302828 A1 and EP 1059354 A2 and any proteins listed in the application that are identified by gi number or otherwise as being from the non-redundant GenBank CDS translations or Protein Database (PDB) at http://www.rcsb.org/pdb/+SwissProt (http://www.expasy.ch/sprot/sprot-top.html) or (PIR-International) Database (PIR) at http://pir.georgetown.edu/index.shtml.
  • 3. The nucleic acid molecule according to claim 1, wherein said nucleic acid comprises an open reading frame.
  • 4. The isolated nucleic acid molecule of claim 1, wherein said nucleic acid is capable of functioning as a promoter, a 3′ end termination sequence, an untranslated region (UTR), or as a regulatory sequence.
  • 5. The isolated nucleic acid molecule of claim 4, wherein (a) when said nucleic acid is a promoter it comprises a sequence selected from the group consisting of a TATA box sequence, a CAAT box sequence, a motif of GCAATCG or any transcription-factor binding sequence, and any combination thereof; and (b) when said nucleic acid sequence is a regulatory sequence it is capable of promoting seed-specific expression, embryo-specific expression, ovule-specific expression, tapetum-specific expression or root-specific expression of a sequence or any combination thereof.
  • 6. A vector construct comprising: a) a first nucleic acid having a regulatory sequence capable of causing transcription and/or translation; andb) a second nucleic acid having the sequence of the isolated nucleic acid molecule according to claim 1;wherein said first and second nucleic acids are operably linked and wherein said second nucleic acid is heterologous to any element in said vector construct.
  • 7. The vector construct according to claim 6, wherein said first nucleic acid is native to said second nucleic acid.
  • 8. The vector construct according to claim 6, wherein said first nucleic acid is heterologous to said second nucleic acid.
  • 9. A host cell comprising an isolated nucleic acid molecule according to claim 1, wherein said nucleic acid molecule is flanked by exogenous sequence.
  • 10. A host cell comprising a vector construct of claim 6.
  • 11. An isolated polypeptide comprising an amino acid sequence a) exhibiting at least 40%, or 75%, or 85%, or 90% sequence identity of an amino acid sequence encoded by a sequence shown in Tables 1 and/or 2 or a fragment thereof; andb) capable of exhibiting at least one of the biological activities of the polypeptide encoded by said nucleotide sequence shown in Tables 1 and/or 2 or a fragment thereof, with the proviso that said nucleotide sequence is not any of the sequences described in the Tables of any of Patent Publication Nos. WO 200040695, CA 2300692 A1, EP 1033405 A2, CA 2302828 A1 and EP 1059354 A2 and any proteins listed in the application that are identified by gi number or otherwise as being from the non-redundant GenBank CDS translations or Protein Database (PDB) at http://www.rcsb.org/pdb/+SwissProt (http://www.expasy.ch/sprot/sprot-top.html) or (PIR-International) Database (PIR) at http://pir.georgetown.edu/index.shtml.
  • 12. An antibody capable of binding the isolated polypeptide of claim 11.
  • 13. A method of introducing an isolated nucleic acid into a host cell comprising: a) providing an isolated nucleic acid molecule according to claim 1; andb) contacting said isolated nucleic with said host cell under conditions that permit insertion of said nucleic acid into said host cell.
  • 14. A method of transforming a host cell which comprises contacting a host cell with a vector construct according to claim 6.
  • 15. A method of modulating transcription and/or translation of a nucleic acid in a host cell comprising: a) providing the host cell of claim 9; andb) culturing said host cell under conditions that permit transcription or translation.
  • 16. A method for detecting a nucleic acid in a sample which comprises: a) providing an isolated nucleic acid molecule according to claim 1;b) contacting said isolated nucleic acid molecule with a sample under conditions which permit a comparison of the sequence of said isolated nucleic acid molecule with the sequence of DNA in said sample; andc) analyzing the result of said comparison.
  • 17. A plant or cell of a plant which comprises a nucleic acid molecule according to claim 1 which is exogenous or heterologous to said plant or plant cell.
  • 18. A plant or cell of a plant which comprises a vector construct according to claim 6.
  • 19. A plant which has been regenerated from a plant cell according to claim 17.
  • 20. A plant which has been regenerated from a plant cell according to claim 18
Parent Case Info

This application is a continuation of U.S. application Ser. No. 11/006,231, filed Dec. 6, 2004 (now abandoned), which application is a continuation of co-pending U.S. application Ser. No. 10/645,822, filed on Aug. 22, 2003 (now abandoned), and for which priority is claimed under 35 U.S.C § 120, the entire contents of which are hereby incorporated by reference.

Provisional Applications (315)
Number Date Country
60433952 Dec 2002 US
60224391 Aug 2000 US
60199123 Apr 2000 US
60194698 Apr 2000 US
60196168 Apr 2000 US
60197397 Apr 2000 US
60195258 Apr 2000 US
60194884 Apr 2000 US
60196483 Apr 2000 US
60194682 Apr 2000 US
60194385 Apr 2000 US
60198400 Apr 2000 US
60198765 Apr 2000 US
60198629 Apr 2000 US
60198268 Apr 2000 US
60169692 Dec 1999 US
60169691 Dec 1999 US
60134221 May 1999 US
60139453 Jun 1999 US
60145089 Jul 1999 US
60145088 Jul 1999 US
60164319 Nov 1999 US
60164260 Nov 1999 US
60164317 Nov 1999 US
60164259 Nov 1999 US
60164321 Nov 1999 US
60164318 Nov 1999 US
60167382 Nov 1999 US
60167362 Nov 1999 US
60361089 Mar 2002 US
60361110 Mar 2002 US
60121825 Feb 1999 US
60123180 Mar 1999 US
60123548 Mar 1999 US
60125788 Mar 1999 US
60126264 Mar 1999 US
60126785 Mar 1999 US
60127462 Apr 1999 US
60128234 Apr 1999 US
60128714 Apr 1999 US
60129845 Apr 1999 US
60130077 Apr 1999 US
60130449 Apr 1999 US
60130891 Apr 1999 US
60131449 Apr 1999 US
60132407 Apr 1999 US
60132048 Apr 1999 US
60132484 May 1999 US
60132485 May 1999 US
60132487 May 1999 US
60132486 May 1999 US
60132863 May 1999 US
60134256 May 1999 US
60134221 May 1999 US
60134218 May 1999 US
60134370 May 1999 US
60134219 May 1999 US
60134768 May 1999 US
60134941 May 1999 US
60135124 May 1999 US
60135353 May 1999 US
60135629 May 1999 US
60136021 May 1999 US
60136392 May 1999 US
60136782 May 1999 US
60137222 Jun 1999 US
60137528 Jun 1999 US
60137502 Jun 1999 US
60137724 Jun 1999 US
60138094 Jun 1999 US
60138540 Jun 1999 US
60138847 Jun 1999 US
60139119 Jun 1999 US
60139452 Jun 1999 US
60139453 Jun 1999 US
60139492 Jun 1999 US
60139461 Jun 1999 US
60139750 Jun 1999 US
60139463 Jun 1999 US
60139457 Jun 1999 US
60139459 Jun 1999 US
60139462 Jun 1999 US
60139455 Jun 1999 US
60139458 Jun 1999 US
60139454 Jun 1999 US
60139456 Jun 1999 US
60139460 Jun 1999 US
60139763 Jun 1999 US
60139817 Jun 1999 US
60139899 Jun 1999 US
60140354 Jun 1999 US
60140353 Jun 1999 US
60140695 Jun 1999 US
60140823 Jun 1999 US
60140991 Jun 1999 US
60141287 Jun 1999 US
60142154 Jul 1999 US
60141842 Jul 1999 US
60142055 Jul 1999 US
60142390 Jul 1999 US
60142803 Jul 1999 US
60142920 Jul 1999 US
60142977 Jul 1999 US
60143542 Jul 1999 US
60143624 Jul 1999 US
60144005 Jul 1999 US
60144085 Jul 1999 US
60144086 Jul 1999 US
60144333 Jul 1999 US
60144335 Jul 1999 US
60144325 Jul 1999 US
60144334 Jul 1999 US
60144332 Jul 1999 US
60144331 Jul 1999 US
60144884 Jul 1999 US
60144352 Jul 1999 US
60144632 Jul 1999 US
60144814 Jul 1999 US
60145086 Jul 1999 US
60145088 Jul 1999 US
60145192 Jul 1999 US
60145085 Jul 1999 US
60145089 Jul 1999 US
60145087 Jul 1999 US
60145145 Jul 1999 US
60145224 Jul 1999 US
60145218 Jul 1999 US
60145276 Jul 1999 US
60145919 Jul 1999 US
60145913 Jul 1999 US
60145918 Jul 1999 US
60145951 Jul 1999 US
60146388 Aug 1999 US
60146389 Aug 1999 US
60146386 Aug 1999 US
60147038 Aug 1999 US
60147302 Aug 1999 US
60147204 Aug 1999 US
60147260 Aug 1999 US
60147192 Aug 1999 US
60147303 Aug 1999 US
60147416 Aug 1999 US
60147493 Aug 1999 US
60147935 Aug 1999 US
60148171 Aug 1999 US
60148319 Aug 1999 US
60148341 Aug 1999 US
60148565 Aug 1999 US
60148684 Aug 1999 US
60149368 Aug 1999 US
60149175 Aug 1999 US
60149426 Aug 1999 US
60149722 Aug 1999 US
60149929 Aug 1999 US
60149723 Aug 1999 US
60149902 Aug 1999 US
60149930 Aug 1999 US
60150566 Aug 1999 US
60150884 Aug 1999 US
60151065 Aug 1999 US
60151066 Aug 1999 US
60151080 Aug 1999 US
60151303 Aug 1999 US
60151438 Aug 1999 US
60151930 Sep 1999 US
60152363 Sep 1999 US
60153070 Sep 1999 US
60153758 Sep 1999 US
60154018 Sep 1999 US
60154039 Sep 1999 US
60154779 Sep 1999 US
60155139 Sep 1999 US
60155486 Sep 1999 US
60155659 Sep 1999 US
60156458 Sep 1999 US
60156596 Sep 1999 US
60157117 Oct 1999 US
60157753 Oct 1999 US
60157865 Oct 1999 US
60158029 Oct 1999 US
60158232 Oct 1999 US
60158369 Oct 1999 US
60159294 Oct 1999 US
60159295 Oct 1999 US
60159293 Oct 1999 US
60159638 Oct 1999 US
60159637 Oct 1999 US
60159329 Oct 1999 US
60159331 Oct 1999 US
60159330 Oct 1999 US
60159584 Oct 1999 US
60160815 Oct 1999 US
60160767 Oct 1999 US
60160768 Oct 1999 US
60160741 Oct 1999 US
60160770 Oct 1999 US
60160814 Oct 1999 US
60160981 Oct 1999 US
60160980 Oct 1999 US
60160989 Oct 1999 US
60161405 Oct 1999 US
60161404 Oct 1999 US
60161406 Oct 1999 US
60161361 Oct 1999 US
60161360 Oct 1999 US
60161359 Oct 1999 US
60161920 Oct 1999 US
60161992 Oct 1999 US
60161993 Oct 1999 US
60162143 Oct 1999 US
60162142 Oct 1999 US
60162228 Oct 1999 US
60162895 Nov 1999 US
60162891 Nov 1999 US
60162894 Nov 1999 US
60163093 Nov 1999 US
60163092 Nov 1999 US
60163091 Nov 1999 US
60163249 Nov 1999 US
60163248 Nov 1999 US
60163281 Nov 1999 US
60163380 Nov 1999 US
60163381 Nov 1999 US
60163379 Nov 1999 US
60164151 Nov 1999 US
60164150 Nov 1999 US
60164146 Nov 1999 US
60164260 Nov 1999 US
60164259 Nov 1999 US
60164548 Nov 1999 US
60164317 Nov 1999 US
60164321 Nov 1999 US
60164318 Nov 1999 US
60164544 Nov 1999 US
60164545 Nov 1999 US
60164319 Nov 1999 US
60164870 Nov 1999 US
60164959 Nov 1999 US
60164962 Nov 1999 US
60164960 Nov 1999 US
60164871 Nov 1999 US
60164961 Nov 1999 US
60164927 Nov 1999 US
60164929 Nov 1999 US
60164926 Nov 1999 US
60165669 Nov 1999 US
60165671 Nov 1999 US
60166173 Nov 1999 US
60166157 Nov 1999 US
60166158 Nov 1999 US
60165911 Nov 1999 US
60165918 Nov 1999 US
60165919 Nov 1999 US
60165661 Nov 1999 US
60166412 Nov 1999 US
60166419 Nov 1999 US
60166411 Nov 1999 US
60166733 Nov 1999 US
60166750 Nov 1999 US
60167362 Nov 1999 US
60167382 Nov 1999 US
60167233 Nov 1999 US
60167234 Nov 1999 US
60167235 Nov 1999 US
60167904 Nov 1999 US
60167908 Nov 1999 US
60167902 Nov 1999 US
60168232 Dec 1999 US
60168233 Dec 1999 US
60168231 Dec 1999 US
60168546 Dec 1999 US
60168549 Dec 1999 US
60168548 Dec 1999 US
60168673 Dec 1999 US
60168675 Dec 1999 US
60168674 Dec 1999 US
60169278 Dec 1999 US
60169302 Dec 1999 US
60169298 Dec 1999 US
60169692 Dec 1999 US
60169691 Dec 1999 US
60171107 Dec 1999 US
60171098 Dec 1999 US
60171114 Dec 1999 US
60176866 Jan 2000 US
60176867 Jan 2000 US
60176910 Jan 2000 US
60178547 Jan 2000 US
60177666 Jan 2000 US
60178546 Jan 2000 US
60178544 Jan 2000 US
60178545 Jan 2000 US
60178755 Jan 2000 US
60178754 Jan 2000 US
60179395 Feb 2000 US
60179388 Feb 2000 US
60180039 Feb 2000 US
60180139 Feb 2000 US
60180207 Feb 2000 US
60180206 Feb 2000 US
60180695 Feb 2000 US
60180696 Feb 2000 US
60181228 Feb 2000 US
60181214 Feb 2000 US
60181476 Feb 2000 US
60181551 Feb 2000 US
60182477 Feb 2000 US
60182516 Feb 2000 US
60182512 Feb 2000 US
60182478 Feb 2000 US
60183165 Feb 2000 US
60183166 Feb 2000 US
60228279 Aug 2000 US
60228247 Aug 2000 US
60228246 Aug 2000 US
Continuations (17)
Number Date Country
Parent 11006231 Dec 2004 US
Child 15706418 US
Parent 10645822 Aug 2003 US
Child 11006231 US
Parent 10084376 Feb 2002 US
Child 10409117 US
Parent 09924701 Aug 2001 US
Child 10084376 US
Parent 10136365 May 2002 US
Child 10336798 US
Parent 09731809 Dec 2000 US
Child 10136365 US
Parent 10103783 Mar 2002 US
Child 10289416 US
Parent 09570582 May 2000 US
Child 10314246 US
Parent 10119718 Apr 2002 US
Child 10336816 US
Parent 09925897 Aug 2001 US
Child 10119718 US
Parent 10112879 Apr 2002 US
Child 10340649 US
Parent 09594599 Jun 2000 US
Child 10112879 US
Parent 10128238 Apr 2002 US
Child 10340584 US
Parent 09925483 Aug 2001 US
Child 10128238 US
Parent 09620111 Jul 2000 US
Child 10428842 US
Parent 10156076 May 2002 US
Child 10360648 US
Parent 09940257 Aug 2001 US
Child 10216621 US
Continuation in Parts (68)
Number Date Country
Parent 09754184 Jan 2001 US
Child 10645822 US
Parent 10409117 Apr 2003 US
Child 09754184 US
Parent 09824790 Apr 2001 US
Child 10409117 US
Parent 09750044 Dec 2000 US
Child 09824790 US
Parent 10300941 Nov 2002 US
Child 09750044 US
Parent 10336798 Jan 2003 US
Child 10300941 US
Parent 10289416 Nov 2002 US
Child 10336798 US
Parent 10314246 Dec 2002 US
Child 10289416 US
Parent 10336816 Jan 2003 US
Child 10314246 US
Parent 10340649 Jan 2003 US
Child 10336816 US
Parent 10340584 Jan 2003 US
Child 10340649 US
Parent 10428842 May 2003 US
Child 10340584 US
Parent 09620394 Jul 2000 US
Child 10428842 US
Parent 09708427 Nov 2000 US
Child 09620394 US
Parent 09750910 Jan 2001 US
Child 09708427 US
Parent 10360648 Feb 2003 US
Child 09750910 US
Parent 10216621 Aug 2002 US
Child 10360648 US
Parent 10282058 Oct 2002 US
Child 10216621 US
Parent 10376785 Mar 2003 US
Child 10282058 US
Parent 10376797 Mar 2003 US
Child 10376785 US
Parent 09513996 Feb 2000 US
Child 10376797 US
Parent 09935625 Aug 2001 US
Child 09513996 US
Parent 10375265 Feb 2003 US
Child 09935625 US
Parent 10376766 Mar 2003 US
Child 10375265 US
Parent 09686093 Oct 2000 US
Child 10376766 US
Parent 09680498 Oct 2000 US
Child 09686093 US
Parent 09671635 Sep 2000 US
Child 09680498 US
Parent 09667517 Sep 2000 US
Child 09671635 US
Parent 09665714 Sep 2000 US
Child 09667517 US
Parent 09621323 Jul 2000 US
Child 09665714 US
Parent 09633191 Aug 2000 US
Child 09621323 US
Parent 09651370 Aug 2000 US
Child 09633191 US
Parent 10426837 May 2003 US
Child 09651370 US
Parent 09702841 Nov 2000 US
Child 10426837 US
Parent 09696751 Oct 2000 US
Child 09702841 US
Parent 10356562 Feb 2003 US
Child 09696751 US
Parent 10336799 Jan 2003 US
Child 10356562 US
Parent 10347322 Jan 2003 US
Child 10336799 US
Parent 10406556 Apr 2003 US
Child 10347322 US
Parent 10340820 Jan 2003 US
Child 10406556 US
Parent 09617682 Jul 2000 US
Child 10300941 US
Parent 09617681 Jul 2000 US
Child 09617682 US
Parent 09688051 Oct 2000 US
Child 09617681 US
Parent 09479221 Jan 2000 US
Child 09708427 US
Parent 09559232 Apr 2000 US
Child 09479221 US
Parent 09595331 Jun 2000 US
Child 09559232 US
Parent 09614388 Jul 2000 US
Child 09595331 US
Parent 09617683 Jul 2000 US
Child 09614388 US
Parent 09620998 Jul 2000 US
Child 09617683 US
Parent 09620313 Jul 2000 US
Child 09620998 US
Parent 09620390 Jul 2000 US
Child 09620313 US
Parent 09620314 Jul 2000 US
Child 09620390 US
Parent 09630442 Aug 2000 US
Child 09620314 US
Parent 09635643 Aug 2000 US
Child 09630442 US
Parent 09635640 Aug 2000 US
Child 09635643 US
Parent 09635642 Aug 2000 US
Child 09635640 US
Parent 09635641 Aug 2000 US
Child 09635642 US
Parent 09643672 Aug 2000 US
Child 09635641 US
Parent 09643671 Aug 2000 US
Child 09643672 US
Parent 09649868 Aug 2000 US
Child 09643671 US
Parent 09649867 Aug 2000 US
Child 09649868 US
Parent 09689981 Oct 2000 US
Child 09649867 US
Parent 09688050 Oct 2000 US
Child 09689981 US
Parent 09688052 Oct 2000 US
Child 09688050 US
Parent 09689982 Oct 2000 US
Child 09688052 US
Parent 09689983 Oct 2000 US
Child 09689982 US
Parent 09940258 Aug 2001 US
Child 10282058 US
Parent 10162726 Jun 2002 US
Child 09940258 US