Sequences and methods for detection of Hepatitis C virus

Information

  • Patent Application
  • 20030032004
  • Publication Number
    20030032004
  • Date Filed
    January 29, 2001
    24 years ago
  • Date Published
    February 13, 2003
    22 years ago
Abstract
Primers and probes derived from the 5′ untranslated region of the HCV genome which facilitate detection and/or quantification of all presently known genotypes of HCV. Disclosed sequences may be used in a variety of primer and probe constructs for amplification and/or detection of HCV nucleic acids.
Description


FIELD OF THE INVENTION

[0001] The present invention relates to materials and methods for detection of Hepatitis C viral nucleic acids, in particular to probes and primers for detection of Hepatitis C in hybridization and amplification assays.



BACKGROUND OF THE INVENTION

[0002] Hepatitis C virus (HCV) is a member of the virus family Flaviviridae and infects at least 1% of the world's population. Infected individuals are at increased risk to develop cirrhosis of the liver and hepatocellular carcinoma. The viral genome is a single strand of RNA which contains a single gene. The polyprotein which is expressed is subsequently processed into at least ten functional proteins. The genome of HCV is highly heterogeneous and has an estimated mutation rate of about 10-2 per base per generation. At least 100 strains have been identified and grouped into six major genotypes.


[0003] At the present time there is no reliable method for growth of HCV in vitro, which makes immunological methods of detection difficult to perform and the results unreliable. Quantitation of viral RNA in plasma is used extensively as a prognostic marker for patients undergoing treatment and as a means for monitoring their response to therapy. Due to the genomic heterogeneity, however, existing molecular assays for detection of HCV RNA are limited by their inability to detect all genotypes with equal efficiency. The probes and primers of the present invention may provide rapid and sensitive detection of HCV nucleic acids and offer an attractive alternative to immunological assays.



SUMMARY OF THE INVENTION

[0004] The present invention provides primers and probes derived from the 5′ untranslated region of the HCV genome which are predicted to facilitate detection and/or quantification of all presently known genotypes of HCV (1-6). That is, a single amplification primer pair according to the invention should efficiently amplify all known genotypes of HCV, which may then be detected in a single detection step using the detector probes and primers of the invention.



DETAILED DESCRIPTION OF THE INVENTION

[0005] The primers, hybridization probes and detector primers of the present invention are based on portions of the 5′ untranslated region (UTR) of the HCV genome. Initially, design of the disclosed primers and probes was based on relatively conserved regions in an alignment of multiple HCV sequences. One goal was to develop probes and primers which, in spite of heterogeneity in the sequence, would be expected to provide amplification, detection and/or quantitation of all presently known HCV genotypes with approximately equal efficiency. In some cases this was accomplished by overlapping the hybridization site of the 5′ ends of certain of the detector probes with the hybridization site of the 3′ end an amplification primer. This approach took advantage of short stretches of relative sequence conservation in the primer hybridization region and avoided much of the sequence heterogeneity evident in the intervening region between the two amplification primers. This technique also allowed use of a smaller target sequence, thereby improving amplification efficiency.


[0006] As used herein, an amplification primer is an oligonucleotide for amplification of a target sequence by extension of the oligonucleotide after hybridization to the target sequence or by ligation of multiple oligonucleotides which are adjacent when hybridized to the target sequence. At least a portion of the amplification primer hybridizes to the target. This portion is referred to as the target binding sequence and it determines the target-specificity of the primer. In addition to the target binding seqence, certain amplification methods require specialized non-target binding sequences in the amplification primer. These specialized sequences are necessary for the amplification reaction to proceed and typically serve to append the specialized sequence to the target. For example, the amplification primers used in SDA include a restriction endonuclease recognition site 5′ to the target binding sequence (US Pat. Nos. 5,455,166 and US Pat. No. 5,270,184). NASBA, 3SR and transcription based amplification primers require an RNA polymerase promoter linked to the target binding sequence of the primer. Linking such specialized sequences to a target binding sequence for use in a selected amplification reaction is routine in the art. In contrast, amplification methods such as PCR which do not require specialized sequences at the ends of the target, generally employ amplification primers consisting of only target binding sequence.


[0007] As used herein, the terms “primer” and “probe” refer to the function of the oligonucleotide. A primer is typically extended by polymerase or ligation following hybridization to the target but a probe typically is not. A hybridized oligonucleotide may function as a probe if it is used to capture or detect a target sequence, and the same oligonucleotide may function as a primer when it is employed as a target binding sequence in an amplification primer. It will therefore be appreciated that any of the target binding sequences disclosed herein for amplification, detection or quantitation of HCV may be used either as hybridization probes or as target binding sequences in primers for detection or amplification, optionally linked to a specialized sequence required by the selected amplification reaction or to facilitate detection.


[0008] Based on the alignment of the 5′ untranslated regions of multiple HCV genotypes, the following amplification primers were designed for testing in SDA reactions. Target binding sequences are underlined. The remaining 5′ portion of the sequence comprises the restriction endonuclease recognition site (RERS) that is required for the SDA reaction to proceed plus a generic non-target-specific tail sequence. It will be readily apparent that the target binding sequences may be used alone to amplify the target in reactions which do not require specialized sequences or structures (e.g., PCR) and that other specialized sequences required by amplification reactions other than SDA (e.g., an RNA polymerase promoter) may be substituted for the RERS-containing sequence shown below. “S1” and “S2” in the primer name indicates “right” and “left” primers, respectively, when the oligonucleotides are used in amplification reactions:
1AMPLIFICATION PRIMERS FOR HCV REGION 11S1.1CGATTCGCCTCCAGACTTCTCGGGTGGTCTGCGGAACSEQ ID NO:11S1.2CGATTCGCCTCCAGACTTCTCGGGATGGTCTGCGGAACSEQ ID NO:21S2.1ACCGCATCGAATGACTGTCTCGGGGAAAGGACCCGGTSEQ ID NO:31S2.1aACTCGCATCGAATGACTGTCTCGGGGAAAGGACCCGGTSEQ ID NO:41S2.2ACCGCATCGAATGACTGTCTCGGGGAAAGGACCCAGTSEQ ID NO:51S2.2aACTCGCATCGAATGACTGTCTCGGGGAAAGGACCCAGTSEQ ID NO:61S2.3ACCGCATCGAATGACTGTCTCGGGGAAAGGACCC(T)GTCSEQ ID NO:71S2.3aACTCGCATCGAATGACTGTCTCGGGGAAAGGACCC(T)GTCSEQ ID NO:8AMPLIFICATION PRIMERS FOR HCV REGION 33S1a.1CGATTCCGCTCCAGACTTCTCGGGTGGGT(A)GCGAAAGGCSEQ ID NO:93S1b.1CGATTCCGCTCCAGACTTCTCGGGTGGGT(A)GCGAAAGGSEQ ID NO:103S1c.1CGATTCCGCTCCAGACTTCTCGGGGGGT(A)GCGAAAGGCSEQ ID NO:113S2a.1ACCGCATCGAATGCATGTCTCGGGCTCC(T)GGGGCACTSEQ ID NO:123S2b.1ACCGCATCGAATGCATGTCTCGGGCCTCC(T)GGGGCACTSEQ ID NO:133S2c.1ACCGCATCGAATGCATGTCTCGGGCCTCC(T)GGGGCACSEQ ID NO:143S2d.1ACCGCATCGAATGCATGTCTCGGGGGCACTCGCAAGCSEQ ID NO:15(X) = Deliberately mismatched bases


[0009] The following detector primers were also designed for detection of amplification products produced using the amplification primers. They hybridize to the target sequence downstream of amplification primers so that they are displaced during the amplification reaction. An advantage of this detection method is that the target sequence can be detected and/or quantified as the amplification reaction is occurring, i.e., in “real-time” rather than at an endpoint, as is known in the art. The target binding sequences of the primers are underlined. The remaining portion of the sequence forms a hairpin structure which is typically labeled to facilitate detection of amplification products, for example as described in U.S. Pat. No. 5,98,869. It will be readily apparent that the target sequence may be used alone for detection (typically linked to a detectable label) and that other detectable sequences and labels may be substituted for the hairpin as is known in the art (e.g., G-quartets, linear sequences for specific probe hybridization, or restriction sites). See, for example, U.S. Pat. Nos. 5,547,861; 5,928,869; 5,593,867; 5,550,025; 5,935,791; 5,888,739; 5,846,726.
2DETECTOR PRIMERS FOR HCV REGION 11DR1.1TAGCACCCGAGTGCTCCGGTGTACTCACCSEQ ID NO:161DOL1.1TAGCACCCGAGTGCTACGGAACCGGTGAGSEQ ID NO:171DOL2TAGCACCCGAGTGCTGCGGAACCGGTGASEQ ID NO:181DOL3TAGCACCCGAGTGCTTGCGGAACCGGTGSEQ ID NO:19DETECTOR PRIMERS FOR HCV REGION 33DL1TAGCACCCGAGTGCTGCCTGATAGG(T)TGCTTGCSEQ ID NO:203DL2TAGCACCCGAGTGCTGCCTGATAGGG(A)GCTTGCSEQ ID NO:213DL3TAGCACCCGAGTGCTTGCCTGATAGGG(A)GCTTGCSEQ ID NO:223DR1TAGCACCCGAGTGCTGCAAGC(T)CCCTATCAGGCSEQ ID NO:233DR2TAGCACCCGAGTGCTGCAAGC(T)CCCTATCAGGCASEQ ID NO:243DR3TAGCACCCGAGTGCTCGCAAGC(T)CCCTATCAGGCSEQ ID NO:253DR4TAGCACCCGAGTGCTCGCAAGC(T)CCCTATCAGGCASEQ ID NO:263DOL1TAGCACCCGAGTGCTGCGAAAG(T)CCTTGTGGTACSEQ ID NO:273DOL2TAGCACCCGAGTGCTTAGCGAAAG(T)CCTTGTGGTASEQ ID NO:283DOL3TAGCACCCGAGTGCTGTAGCGAAAG(T)CCTTGTGGTASEQ ID NO:293DOL4TAGCACCCGAGTGCTGTAGCGAAAG(T)CCTTGTGGTSEQ ID NO:30(X) = Deliberately mismatched bases


[0010] SEQ ID NO:16 and SEQ ID NOs:20-26 are conventional non-overlapping detector primers which contain a hairpin as described in U.S. Pat. No.5,928,869. SEQ ID NOs:17-19 and SEQ ID NOs:27-30 also contain the hairpin but the 5′ end of the target binding sequences overlap with the 3′ end of the target binding sequences of the upstream amplification primers. Bumper primers used in SDA were also designed. The entire sequence of these oligonucleotides consists of target binding sequence, and “B1” and “B2” in the primer name indicated “right” and “left” primers, respectively, when used in an amplification reaction:
3BUMPER PRIMERS FOR HCV REGION 11B1.1CCCTCCCGTGAGASEQ ID NO:311B1.2CCTCCCGTGAGAGSEQ ID NO:321B2.1GTCTTGCGGGGGCSEQ ID NO:33BUMPER PRIMERS FOR HCV REGION 33B1.2GCGTGC(T)CCCGC(T)AGASEQ ID NO:343B2.3GCACGGTCTACGASEQ ID NO:35(X) = Deliberately mismatched bases


[0011] The primers and probes set forth above were selected to minimize the effects of heterogeneity in the targeted region of the DNA polymerase gene. Mismatches were confined to the middle or the 5′ end of the primers and probes to permit efficient 3′ extension upon hybridization to the target sequence.


[0012] Because the target binding sequence confers target specificity on the primer or probe, it should be understood that the target binding sequences exemplified above for use as particular components of a specific amplification reaction may also be used in a variety of other ways for detection of HCV. For example, the target binding sequences of SEQ ID NOs:1-30 may alternatively be used as hybridization probes for direct detection of HCV, either without prior amplification or as a post-amplification assay. Such hybridization methods are well known in the art and typically employ a detectable label associated with or linked to the target binding sequence to facilitate detection of hybridization. Further, essentially all of the target binding sequences set forth above may be used as amplification primers in amplification reactions which do not require additional specialized sequences (such as PCR) or appended to the appropriate specialized sequences for use in 3SR, NASBA, transcription-based or any other primer extension amplification reactions. For detection of amplification products, amplification primers comprising the target binding sequences disclosed herein may be labeled as is known in the art, or labeled detector primers comprising the disclosed target binding sequences may be used in conjunction with the amplification primers as described in US Pat. Nos. 5,547,861; 5,928,869; 5,593,867; 5,550,025; 5,935,791; 5,888,739; 5,846,726 for real-time homogeneous detection of amplification. Such detector primers may comprise a directly or indirectly detectable sequence which does not initially hybridize to the target but which facilitates detection of the detector primer once it has hybridized to the target and been extended. For example, such detectable sequences may be sequences which form a secondary structure, sequences which contain a restriction site, or linear sequences which are detected by hybridization of their complements to a labeled oligonucleotide (sometimes referred to as a reporter probe) as is known in the art. Alternatively, the amplification products may be detected post-amplification by hybridization of a probe selected from any of the target binding sequences disclosed herein which fall between a selected set of amplification primers.


[0013] It is to be understood that an oligonucleotide according to the invention which consists of a target binding sequence and, optionally, either a sequence required for a selected amplification reaction or a sequence required for a selected detection reaction may also include certain other sequences which serve as spacers, linkers, sequences for labeling or binding of an enzyme, etc. Such additional sequences are typically known to be necessary to obtain optimum function of the oligonucleotide in the selected reaction and are intended to be included by the term “consisting of.”







EXAMPLE

[0014] Use of the primers and probes of the invention may be exemplified using an SDA reaction to detect Region 1 of the HCV UTR. For such a reaction one “left” amplification primer is selected from SEQ ID NOs:1-2 and one “right” amplification primer is selected from SEQ ID NOs:3-8. To detect Region 3 of the UTR, one “left” amplification primer is selected from SEQ ID NOs:9-11 and one “right” amplification primer is selected from SEQ ID NOs:12-15. A detector primer is also selected from SEQ ID NOs:16-19 for detection of Region 1 or from SEQ ID NOs:20-30 for detection of Region 3, and the hairpin is labeled with a donor/quencher dye pair as is known in the art for detection of target amplification. Fluorescein and dabcyl are preferred dyes for this purpose. Finally, either SEQ ID NO:31 or SEQ ID NO:32 may be selected as the “left” bumper primer for amplification of Region 1 and SEQ ID NO:33 serves as the “right” bumper primer. SEQ ID NO:34 and SEQ ID NO:35 are the “left” and “right” bumper primers, respectively, for amplification of Region 3. SDA is preferably performed at about 52° C. as described in U.S. Pat. No. 5,648,211 using the selected detector primer to provide detection of the target during amplification as described in U.S. Pat. Nos. 5,919,630; 5,928,869 and 5,958,700.


[0015] Donor fluorescence is monitored during the amplification reaction. In the presence of HCV target nucleic acids, donor fluorescence will increase as the hairpin holding the donor and quencher in close proximity is unfolded. In the absence of target, fluorescence will remain consistently low throughout the reaction. An increase in fluorescence or a failure of fluorescence to change substantially indicate the presence or absence of HCV target, respectively. Typically, the generation of a relatively higher amount of fluorescence indicates a higher initial level of target.


Claims
  • 1. A method for detecting an HCV target sequence comprising: a) amplifying the target sequence using a first amplification primer having a sequence consisting of the target binding sequence of any one of SEQ ID NO:1 through SEQ ID NO:35 and, optionally, a sequence required for a selected amplification reaction, and; b) detecting the amplified target sequence.
  • 2. The method of claim 1 further comprising a second amplification primer having a sequence consisting of the target binding sequence of any one of SEQ ID NO:1 through SEQ ID NO:35 and, optionally a sequence required for a selected amplification reaction.
  • 3. The method of claim 1 wherein the target binding sequence of the first amplification primer is the target binding sequence of any one of SEQ ID NO:3 through SEQ ID NO:8 or any one of SEQ ID NO:12 through SEQ ID NO:15.
  • 4. The method of claim 3 wherein the first amplification primer consists of any one of SEQ ID NO:3 through SEQ ID NO:8 or any one of SEQ ID NO:12 through SEQ ID NO:15.
  • 5. The method of claim 2 wherein the target binding sequence of the second amplification primer is the target binding sequence of any one of SEQ ID NO:1 through SEQ ID NO:2 or any one of SEQ ID NO:9 through SEQ ID NO:11.
  • 6. The method of claim 5 wherein the second amplification primer is consists of SEQ ID NO:1, SEQ ID NO:2 or any one of SEQ ID NO:9 through SEQ ID NO:11.
  • 7. The method of claim 1 or 2 wherein the amplified target sequence is detected using an oligonucleotide having a sequence consisting of the target binding sequence of any one of SEQ ID NO:16 through SEQ ID NO:30 and, optionally, a sequence required for a selected detection reaction.
  • 8. The method of claim 7 wherein the oligonucleotide is selected such that a 5′ end of the target binding sequence of the oligonucleotide for detection overlaps a 3′ end of the target binding sequence of the first or second amplification primer.
  • 9. The method of claim 8 wherein the oligonucleotide consists of any one of SEQ ID NO:17 through SEQ ID NO:19 or any one of SEQ ID NO:27 through SEQ ID NO:30.
  • 10. The method of claim 7 wherein the sequence required for the selected detection reaction is a hairpin, G-quartet, restriction site or a sequence which hybridizes to a reporter probe.
  • 11. The method of claim 7 wherein the oligonucleotide comprises a detectable label.
  • 12. The method of claim 11 wherein the label is a fluorescent label.
  • 13. The method of claim 7 wherein the oligonucleotide is unlabeled and the target sequence is detected by hybridization of the oligonucleotide to a labeled reporter probe.
  • 14. The method of claim 1 further comprising quantifying the target sequence.
  • 15. The method of claim 14 wherein the target sequence is quantified by coamplification of a control sequence and the target sequence.
  • 16. The method of claim 15 wherein the coamplification of the target and control sequences is competitive and detected in real-time.
  • 17. The method of claim 15 wherein coamplification is detected in a homogeneous assay.
  • 18. An oligonucleotide having a sequence consisting of the target binding sequence of any one of SEQ ID NO:1 through SEQ ID NO:35 and, optionally, either a sequence required for a selected amplification reaction or a sequence required for a selected detection reaction.
  • 19. The oligonucleotide of claim 18 which consists of the target binding sequence of any one of SEQ ID NO:1 through SEQ ID NO:15 and, optionally, a sequence required for a selected amplification reaction.
  • 20. The oligonucleotide of claim 19 which consists of any one of SEQ ID NO:1 through SEQ ID NO:8.
  • 21. The oligonucleotide of claim 18 which consists of the target binding sequence of any one of SEQ ID NO:16 through SEQ ID NO:30 and, optionally, a sequence required for a selected detection reaction.
  • 22. The oligonucleotide of claim 21 which consists of any one of SEQ ID NO:16 through SEQ ID NO:30.
  • 23. The oligonucleotide of claim 21 wherein the sequence required for the detection reaction is a hairpin, a G-quartet, a restriction site or a sequence which hybridizes to a reporter probe.
  • 24. The oligonucleotide of claim 21 which is labeled with a detectable label.
  • 25. The oligonucleotide of claim 24 wherein the label is a fluorescent label.