Patent Application
20240298601
The present invention relates to herbicide-resistant sesame plants, particularly to sesame plants resistant to herbicides that inhibit the activity of the plant enzyme acetolactate synthase (ALS), and further to compositions and methods for producing same.
Sesame (Sesamum indicum L.; genome 2n=2x=26), belongs to the Sesamum genus of the Padaliaceae family, is an important oil-crop worldwide. Its seeds are used for a wide array of purposes such as the production of oil and Tahini, cooking and baking, and as a source for ingredients used in pharmaceutical products. Sesame seeds are known as one of the best of oil-seeds, since the seeds contain a considerable amount of high-quality oil, proteins, carbohydrates, and a plethora of essential mineral-nutrients (Teboul et al., 2021. Genes, 11:1221). In recent years, the demand for sesame seeds (and secondary products) is increasing as part of the global trends toward healthier plant-based food sources.
However, current sesame seed production is mostly limited to developing countries, using traditional growth practices that are laborious and not cost-effective. Despite its economical and agricultural potential, sesame is an ‘orphan crop-plant’ with limited research performed in modern genetics and breeding. Thus, it is necessary to bridge the knowledge gap resulting from the current limited production and market as to develop novel cultivars adapted for modern, large-scale agricultural practices.
Weeds infestation is the major biotic factor causing a reduction in sesame plant development and yield production. As a consequence of its slow development during the initial growth stage (Gadri et al., 2020. Plant Science, 295:110105; Langham et al., 2007. Review of herbicide research on sesame (Sesamum indicum L.) ASGA, Gainesville, FL, USA), sesame is a poor competitor with weeds. Moreover, its prolonged ‘critical period’ (i.e., a period in the crop growth cycle during which weeds must be controlled to prevent significant yield losses) further emphasizes the importance of efficient weed control practice. The ‘critical period’ for sesame has been found to last up to 10 weeks, depending on the growing degree-days and the level of weed infestation (e.g., Aref et al., 2013. Assiut Journal of Agricultural Sciences, 44:32-45; Karnas et al., 2019. Weed Biology and Management, 19:121-128; Vilan 2017. M.Sc. Thesis submitted to The Hebrew University of Jerusalem, Israel). Thus, if weeds are not controlled during this time, it can lead to a severe yield reduction, from about 60% in West Bengal, and 78% in Turkey (Duary and Hazra, 2013. Indian Journal of Weed Science, 45:253-256 and Karnas et al., 2019, ibid, respectively), and up to a complete yield loss (reviewed by Singh et al., 1992. Agricultural Reviews, 13:163-175).
Since their introduction in 1940, chemicals (i.e., herbicides) provides the most cost-effective and efficient practice for weed control. In most major crops, herbicides advantageously enable selective weed control. However, most of the chemical herbicides in use cause some damage to sesame plants. While most modes of action (MOA) of known herbicides (132 herbicides and 58 herbicide combinations) have been tested in almost 40 countries, all of them resulted in yield reduction of sesame (reviewed by Langham et al., 2018. Sesame Weed Control Part 1. Sesame Research LLC, doi: 10.13140/RG.2.2.21216.94722). Some herbicides which are Acetyl CoA Carboxylase (ACCase) inhibitors were found to be safe; however, this group is effective for post-emergence control of grass weeds only.
Among the various herbicide MOAs, a common activity target is Acetolactate synthase (ALS), also known as acetohydroxyacid synthase (AHAS). ALS is a key enzyme catalyzing the initial step in the biosynthesis of branched-chain amino acids including valine, leucine, and isoleucine (Umbarger, 1978. Annual Reviews in Biochemistry, 47:533-606). Inhibition of this enzyme primarily leads to plant starvation, but secondary effects such as the accumulation of 2-ketobutyrate and the distraction of photosynthate transport have also been shown to be involved in plant death (The Imidazoline Herbicides, 1991. Eds: Shaner and O'Connor, CRC Press). ALS inhibiting herbicides control many weed species, have low mammalian toxicity, and are selective in many crops (Yu et al., 2010. Journal of Experimental Botany, 61:3925-3934). The ALS-inhibiting herbicides are divided according to their molecular structure into five chemical classes: Imidazolinones (IMIs), Sulfonylureas (SUs), Pyrimidinyl thiobenzoates (PTBs), Triazolopyrimidines (TPs), and Sulfonylaminocarbonyltriazolinones (SCTs). Imidazolinone and Sulfonylureas are the most widely used classes and include the largest available commercialized herbicides (Saari et al., 1993. In: Resistance to Herbicides in Plants, Eds. S. B. Powles & J. A. M. Holtum. Lewis Publ. CRC Press, Boca Raton, FL). Point-mutation resistance at different sites on the ALS gene were discovered naturally in various weed species (weedscience.org), and were induced in crop-plants (e.g., Tan et al., 2005. Pest Management Science, 61:246-257; International (PCT) Applications Publication No. WO 2007/149069). Additional sources of mutations resulting in herbicide resistance ALS have been described, for example in U.S. Pat. No. 5,605,011; U.S. Patent Application Publication No. 2003/0097692 and International (PCT) Application WO 2012/049268).
Genetic characterization of the resistance mutation has been classified as semi-dominant inheritance, with the heterozygote allele displaying an intermediate resistance (Ghanizadeh et al., 2019. Critical Reviews in Plant Sciences, 38:295-312).
The broad variety of ALS inhibiting herbicides enables the farmers to control a wide range of weed species independently of their growth stages. However, these highly efficient herbicides cannot be used in sesame because conventional sesame plants/commercial sesame varieties are highly susceptible to these ALS inhibiting herbicides.
Thus, there is an urgent need to develop new sesame cultivars with enhanced herbicide resistance, to ensure high production and sustainability.
The present invention answers the above-described needs, providing sesame plants that are resistant to herbicides inhibiting the activity of acetolactate synthase (ALS). Particularly, the present invention provides sesame plants and parts thereof comprising a mutant ALS gene having a single mutation, said plants having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum. The sesame plants comprising the mutant ALS gene are tolerant and/or resistant to ALS inhibiting herbicides applied pre-emergence or post-emergence, such that weeds can be controlled throughout the sesame growth period, a significant advantage in agricultural cultivation. Unexpectedly, the resistant sesame plants further exhibited significantly higher yield after being exposed to a treatment, post-emergence, with ALS-inhibiting herbicide compared to the yield obtained when the plants were grown under weed-free conditions (obtained by mechanical or manual weeding). Without wishing to be bound by any specific theory or mechanism of action, the resistance may be attributed to a change in the protein conformation at the herbicide binding site due to a single mutation of alanine to valine substitution, which results in a decreased affinity of the herbicide to the ALS enzyme.
According to certain aspects, the present invention provides a sesame (Sesamum indicum L.) plant or a part thereof comprising at least one cell comprising a mutant acetolactate synthase encoding gene (mALS), wherein the mALS encodes a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein, and wherein the plant is resistant to at least one ALS-inhibiting herbicide.
According to certain embodiments, the wild-type SiALS protein comprises an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1, wherein the amino acid sequence comprises alanine at position 188.
According to certain embodiments, the wild-type SiALS protein comprises an amino acid sequence having at least 95% or more identity to the amino acid sequence set forth in SEQ ID NO:1 wherein the amino acid sequence comprises alanine at position 188.
According to certain exemplary embodiments, the wild-type SiALS protein comprises the amino acid sequence set forth in SEQ ID NO:1.
According to certain embodiments, the mALS protein comprises an amino acid other than alanine at position 188 of a protein having at least 90%, identity to the amino acid sequence set forth in SEQ ID NO:1.
According to certain currently exemplary embodiments, the alanine is substituted by valine (Ala188Val). According to these embodiments, the mALS protein comprises the amino acid valine at position 188 of an amino acid sequence having at least 90% identity to the nucleic acid sequence set forth in SEQ ID NO:2.
According to certain currently exemplary embodiments, the mALS protein comprises the amino acid sequence set forth in SEQ ID NO:3.
According to certain embodiments, the wild-type SiALS gene comprises a nucleic acid sequence having at least 90% identity to the nucleic acid sequence set forth in SEQ ID NO:2, wherein the sequence comprises an alanine coding sequence at positions 562-564. According to certain embodiments, the wild-type SiALS gene comprises a nucleic acid sequence having at least 95% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2, wherein the sequence comprises an alanine coding sequence at positions 562-564.
According to certain exemplary embodiments, the wild-type SiALS gene comprises the nucleic acid sequence set forth in SEQ ID NO:2.
According to certain embodiments, the alanine-coding sequence comprises the nucleic acids 562-564 of SEQ ID NO:2.
According to certain embodiments, the mALS polynucleotide comprises a substituted codon coding for an amino acid other than alanine at positions 562-564 of a nucleic acid sequence having at least 90% identity to the nucleic acid sequence set forth in SEQ ID NO:2.
According to certain embodiments, the substituted codon codes for the amino acid valine. According to these embodiments, the mALS polynucleotide comprises the nucleotide thymine (T) in position 563 of a nucleic acid sequence having at least 90% identity to the nucleic acid sequence set forth in SEQ ID NO:2.
According to certain currently exemplary embodiments, the mALS polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:4.
According to certain embodiments, the mutant polynucleotide encoding the mutant acetolactate synthase is a mutant of the sesame plant endogenous ALS-encoding gene (mSiALS).
According to certain embodiments, the mutant polynucleotide encoding the mutant acetolactate synthase is an exogenous polynucleotide. The Exogenous polynucleotide can be a mutated endogenous ALS gene or a heterologous ALS gene encoding the mutated ALS protein (mALS).
According to certain embodiments, the plant or the part thereof is homozygous to the mALS polynucleotide.
According to certain embodiments, the plant or the part thereof is heterozygous to the mALS polynucleotide.
It is to be explicitly understood that while sesame plants homozygous for the mutant gene encoding the mutant ALS protein having reduced affinity to ALS-inhibiting herbicides exhibit higher tolerance, typically resistance, to ALS-inhibiting herbicides compared to heterozygous plants, the heterozygous plants show significantly enhanced tolerance/resistance compared to plants comprising the wild-type SiALS gene.
According to certain embodiments, the sesame plants of the invention are resistant to ALS-inhibiting herbicides irrespective to the timing of applying the herbicide to the plant, part thereof or to said plant habitat. Timing of herbicide application includes pre-emergence of sesame plants (after sowing before the seedling emerges); post-emergence at the first pair of two true leaves stage; and any time thereafter until plant maturity.
It is to be explicitly understood that the plants resistant to ALS-inhibiting herbicides according to the teachings of the invention are fertile.
According to certain embodiments, the mALS gene and/or the mALS protein have essentially no deleterious effects on the growth rate and pattern of the sesame plant when grown under standard sesame growth conditions.
According to certain exemplary embodiments, the plant resistant to at least one ALS-inhibiting herbicide produces a higher seed yield after being exposed to treatment with the ALS-inhibiting herbicide post-emergence, compared to the yield obtained when the plant is grown under weed-free conditions obtained by alternative weed control methods (i.e., manual weeding).
According to certain embodiments, the ALS-inhibiting herbicide is of a type selected from the group consisting of herbicidal effective Imidazolinones (IMI), Sulfonylureas (SU), Pyrimidinylthiobenzoates (PTB), Triazolopyrimidines (TP), and Sulfonylaminocarbonyltriazolinone (SCT).
According to certain embodiments, the Imidazolinone herbicide is selected from the group consisting of 5-(methoxymethyl)-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazamox); 5-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazapic); 5-ethyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazethapyr); 2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)pyridine-3-carboxylic acid (Imazapyr); 4-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)benzoic acid (Imazamethabenz); methyl 4-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)benzoate (Imazamethabenz methyl); 2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)quinoline-3-carboxylic acid (Imazaquin) and 1-(2-chloroimidazo[1,2-a]pyridin-3-yl)sulfonyl-3-(4,6-dimethoxypyrimidin-2-yl)urea (Imazosulfuron). Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the Sulfonylurea herbicide is selected from the group consisting of 2-[(4,6-dimethoxypyrimidin-2-yl)carbamoylsulfamoyl]-4-formamido-N,N-dimethylbenzamide (foramsulfuron) and 1-(4,6-dimethoxypyrimidin-2-yl)-3-[3-(2,2,2-trifluoroethoxy)pyridin-2-yl]sulfonylurea (trifloxysulfuron). Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the Pyrimidinylthiobenzoate herbicide is selected from the group consisting of N-(2,6-difluorophenyl)-8-fluoro-5-methoxy-[1,2,4]triazolo[1,5-c]pyrimidine-2-sulfonamide (Florasulam) and sodium;2-chloro-6-(4,6-dimethoxypyrimidin-2-yl)sulfanylbenzoate (Pyrithiobac sodium). Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the Sulfonylaminocarbonyltriazolinone is methyl 2-[(4-methyl-5-oxo-3-propoxy-1,2,4-triazole-1-carbonyl)sulfamoyl]benzoate (Propoxycarbazone).
It is to be explicitly understood that the plants of the invention may be resistant to a single or a plurality of ALS-inhibiting herbicide types. According to certain exemplary embodiments, the plants of the invention are resistant to a plurality of ALS-inhibiting herbicide types, including pre-emergent ALS-inhibiting herbicides and post-emergent ALS-inhibiting herbicides.
According to certain embodiments, the plant part is selected from the group consisting of seeds, pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruit, stems, and shoots. Each possibility represents a separate embodiment of the present invention. Cells and tissue cultures derived from the plant or part thereof are also encompassed within the present invention.
According to certain embodiments, the sesame plant of the invention, characterized as being resistant to at least one ALS-inhibiting herbicide is further characterized by indehiscent capsules.
According to certain embodiments, the sesame plant of the invention is non-transgenic plant.
According to certain embodiments, the non-transgenic plant is produced by creating a mutation within said plant acetolactate synthase encoding gene by cite-directed mutagenesis. According to certain embodiments cite directed mutagenesis is performed by a gene-editing method using at least one artificially engineered nuclease. According to some embodiments, the endonuclease is selected from the group consisting of caspase 9 (Cas9), Cpf1, zinc-finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs). According to certain embodiments, the mutation is inserted using CRISPR/Cas system, CRISPR/Cas homologous system or a modified CRISPR/Cas system.
According to other embodiments, the sesame plant of the invention is a transgenic plant comprising at least one cell comprising at least one exogenous polynucleotide encoding an mALS protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type SiALS.
The mALS protein having a reduced affinity to at least one ALS-inhibiting herbicide and the polynucleotides encoding same are as described hereinabove.
According to certain exemplary embodiments, the present invention provides a seed of the sesame plants of the invention, wherein a sesame plant grown from the seed comprises at least one cell comprising a mutant acetolactate synthase encoding gene (mALS), wherein the mSAL encodes a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein, and wherein the plant is resistant to at least one ALS-inhibiting herbicide.
According to additional certain aspects, the present invention provides a method for producing a sesame plant having tolerance and/or resistance to at least one ALS-inhibiting herbicide, the method comprising introducing at least one mutation in at least one allele of the plant endogenous ALS encoding gene, wherein the at least one mutation results in an encoded ALS protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to an ALS protein encoded by a non-mutated gene.
The wild type and mutant proteins and polynucleotides encoding same, and the ALS-inhibiting herbicide are as described hereinabove.
According to further aspects, the present invention provides an isolated polynucleotide encoding acetolactate synthase (ALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS protein.
According to certain embodiments, the encoded ALS protein comprises an amino acid other than alanine at position 188 of a protein having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:1.
According to certain embodiments, the encoded ALS protein comprises an amino acid other than alanine at position 188 of a protein having at least 95% identity to the amino acid sequence set forth in SEQ ID NO:1.
According to certain exemplary embodiments, the encoded protein comprises the amino acid valine at position 188.
According to certain currently exemplary embodiments, the encoded protein comprises the amino acid sequence set forth in SEQ ID NO:3.
According to certain embodiments, the isolated polynucleotide comprises a substituted codon coding for an amino acid other than alanine at positions 562-564 of a nucleic acid sequence having at least 90% identity to the nucleic acid sequence set forth in SEQ ID NO:2.
According to certain embodiments, the isolated polynucleotide comprises a substituted codon coding for an amino acid other than alanine at positions 562-564 of a nucleic acid sequence having at least 95% identity to the nucleic acid sequence set forth in SEQ ID NO:2.
According to certain exemplary embodiments, the isolated polynucleotide comprises a valine-encoding codon at positions 562-564. According to certain currently exemplary embodiments, the isolated polynucleotide comprises the nucleotide thymine (T) in position 563 of a nucleic acid sequence having at least 90% identity to the nucleic acid sequence set forth in SEQ ID NO:2.
According to further currently exemplary embodiments, the isolated polynucleotide comprises the nucleotide thymine (T) in position 563 of SEQ ID NO:2 to form SEQ ID NO:4.
According to certain embodiments, the isolated polynucleotide is comprised within a DNA construct further comprising at least one regulatory element. According to certain embodiments, the regulatory element is selected from the group consisting of a promoter, an enhancer, a termination sequence and any combination thereof. According to certain embodiments, the isolated polynucleotide or the DNA construct comprising same is comprised within a plant-cell compatible expression vector.
A host sesame plant cell comprising the isolated polynucleotides of the invention, a DNA construct and/or expression vector comprising same are also encompassed within the scope of the present invention, as well as a sesame plant comprising the host cell.
According to yet additional aspects, the present invention provides a method for identifying a sesame plant having an enhanced tolerance and/or resistance to at least one type of ALS-inhibiting herbicide, the method comprising detecting, in a genetic material obtained from the plant the presence of a nucleic acid marker amplified by a pair of primer comprising the nucleic acid sequence set forth in ID NO:5 (CAGGTTCCCCGTCGTATG) and SEQ ID NO:6 (TCCTTGACAACCCGAGGA).
According to certain embodiments, the amplified marker comprises the nucleic acid sequence set for the in SEQ ID NO:7 (ATCGGCACTGATGTTTTCCAAGAAACCCCTATTGTTGAGGTAACTAGGTCG ATTACCAAGCATAATTATCTTGTTTTAGATGTTGAGGATAT).
According to certain aspects, the present invention provides a method for producing a sesame plant having tolerance and/or resistance to at least one ALS-inhibiting herbicide, the method comprising introducing into at least one cell of a sesame plant susceptible to ALS-inhibiting herbicide at least one polynucleotide encoding ALS protein having a reduced affinity to at least one ALS-inhibiting herbicide.
According to certain embodiments, the ALS protein having a reduced affinity to at least one ALS-inhibiting herbicide comprises valine at position 188 compared to alanine in a wild-type SiALS protein.
The ALS protein having a reduced affinity to at least one ALS-inhibiting herbicide and the isolated polynucleotide encoding same are as described hereinabove.
According to yet further certain aspects, the present invention provides a method for controlling weeds in the vicinity of at least one sesame plant resistant to at least one ALS-inhibiting herbicide according to the teachings of the invention, the method comprises applying at least one ALS-inhibiting herbicide to the weeds and the plant in an amount sufficient to inhibit the weed growth.
According to certain embodiments, the amount of the ALS-inhibiting herbicide does not significantly inhibit the growth of the sesame plant resistant to the herbicide.
According to certain embodiments, the amount of the ALS-inhibiting herbicide inhibits the growth of a corresponding sesame plant susceptible to the herbicide.
According to certain embodiment, the amount of the ALS-inhibiting herbicide results in an enhanced seed yield of the sesame plant resistant to the herbicide compared to the yield of a corresponding sesame plant resistant to the herbicide grown in a weed-free environment obtained by an alternative weed control method, wherein the herbicide is applied post-emergence.
It is to be understood that any combination of each of the aspects and the embodiments disclosed herein is explicitly encompassed within the disclosure of the present invention.
Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
Weeds infestation is a major agronomical factor preventing the implantation of sesame-crop in intensive agro-systems. Thus, developing novel weed-control practices is highly required. The present invention is the first to disclose sesame lines with high tolerance and/or resistance to ALS-inhibiting herbicides. The resistance was obtained by mutation induction and selection of plants resistant to the herbicides. The obtained resistant plant carried a single mutation in the 188 Alanine codon (in relation to the sesame ALS amino acid reference sequence shown in SEQ ID NO:1), which resulted in a change in the ALS protein configuration at the binding site of the herbicide toward decreased affinity of the herbicide to the enzyme. The sesame plants of the invention carrying the mutated ALS were tolerant to broadleaf ALS-inhibiting herbicides applied pre- and post-emergence. The present invention thus significantly contributes to the adoption of integrated weed management in sesame to meet the rising global demand for sesame seeds.
The terms “plant” and “sesame plant” are used herein interchangeably in the terms broadest sense. The terms also refer to a plurality of plant cells that are largely differentiated into a structure that is present at any stage of a plant's development. Such structures include, but are not limited to, a root, stem, shoot, leaf, flower, petal, and fruit. According to certain exemplary embodiments, the sesame plants of the present invention are hardy cultivars grown for commercial production of sesame seeds. According to certain exemplary embodiments, the sesame plants of the present invention are indehiscent, i.e., characterized by capsules (fruit) that are visibly closed when fully ripen (matured).
As used herein, the term “plant part” typically refers to a part of the sesame plant. Examples of plant parts include, but are not limited to, pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruit (capsules), stems, shoots, and seeds. The term “plant part” also encompasses single cells and cell tissues such as plant cells that are intact in the plant parts, cell clumps and tissue cultures from which sesame plants can be regenerated.
The terms “Acetolactate synthase”, “ALS” ALS protein” and “ALS enzyme” are used herein interchangeably and refer to the enzyme (also known as acetohydroxyacid synthase [AHAS]) involved in the conversion of pyruvate to acetolactate:
2CH3COCO2−→−O2CC(OH)(CH3)COCH3+CO2
The reaction uses thiamine pyrophosphate in order to link the two pyruvate molecules. The resulting product of this reaction, acetolactate, eventually becomes valine, leucine, and isoleucine. According to certain embodiments, with reference to wild-type SiALS, the term refers to sesame SiALS having the amino acid sequence set forth in SEQ ID NO:1 or an enzyme having at least 90% sequence identity to SEQ ID NO: 1 comprising alanine at position 188.
It is to be explicitly understood that the wild-type sesame SiALS gene or the encoded protein may, may, or may not, comprise mutations, other than the mutation that causes the Ala188 substitution. As used herein, “sequence identity” or “identity” in the context of two polypeptide or nucleic acid sequences includes reference to the residues in the two sequences which are the same when aligned. When the percentage of sequence identity is used in reference to proteins it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are considered to have “sequence similarity” or “similarity”. Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Henikoff S and Henikoff JG. (Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. U.S.A. 89(22), 10915-9, 1992).
Identity (e.g., percent homology) can be determined using any homology comparison software, including, for example, the BlastN, BlastX or Blastp software of the National Center of Biotechnology Information (NCBI) such as by using default parameters.
According to certain currently exemplary embodiments of the invention, the identity is a global identity, i.e., an identity over the entire amino acid or nucleic acid sequences of the invention and not over portions thereof.
The term “gene” refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of RNA or a polypeptide. A polypeptide can be encoded by a full-length coding sequence or by any part thereof. The term “parts thereof” when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, “a nucleic acid sequence comprising at least a part of a gene” may comprise fragments of the gene or the entire gene.
The term “gene” also encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5′ and 3′ ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5′ of the coding region and which are present on the mRNA are referred to as 5′ non-translated sequences. The sequences which are located 3′ or downstream of the coding region and which are present on the mRNA are referred to as 3′ non-translated sequences.
The terms “polynucleotide”, “polynucleotide sequence”, “nucleic acid sequence”, and “isolated polynucleotide” are used interchangeably herein. These terms encompass nucleotide sequences and the like. A polynucleotide may be a polymer of RNA or DNA or hybrid thereof, that is single- or double-stranded, linear or branched, and that optionally contains synthetic, non-natural or altered nucleotide bases. The terms also encompass RNA/DNA hybrids.
As used herein, the term “reduced affinity” with regard to the interaction of ALS enzyme and herbicide refers to a reduction of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, %, at least 95%, at least 96% at least 97%, at least 98%, at least 99%, or more in the mALS enzyme-herbicide interaction compared to a corresponding wild type ALS-herbicide interaction. The reduced mALS-herbicide affinity results in reduced or no inhibition of the mALS activity by the herbicide. According to certain embodiments, the mALS enzyme shows activity in the presence of an ALS-inhibiting herbicide which is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, %, at least 95%, at least 96% at least 97%, at least 98%, at least 99%, or identical to its activity in the absence of the herbicide. According to certain additional or alternative embodiments, the mALS enzyme shows activity in the presence of an ALS-inhibiting herbicide which is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, %, at least 95%, at least 96% at least 97%, at least 98%, at least 99%, or identical to the activity of a corresponding wild type ALS enzyme in the absence of the herbicide.
As used herein, the terms “tolerant”, “tolerance”, “resistant” or “resistance” of a plant with regard to herbicide(s) treatment refers to a plant that survives treatment with the herbicide. The survived tolerant/resistant plant may show no or reduced symptoms caused by the herbicide. In certain embodiments, a plant tolerant and/or resistant to herbicide shows reduced symptoms when challenged with the herbicide compared to a plant susceptible to said herbicide. For example, a plant tolerant and/or resistant to an herbicide, after the herbicide is applied, can exhibit one or more symptoms associated with the herbicide effect (including, e.g., leaf wilt, leaf or vascular yellowing), spike bleaching etc., and yet not exhibit a reduction in yield in comparison to the yield of a corresponding plant to which the herbicide was not applied and grown under the same conditions.
The application of ethyl methanesulfonate (EMS) mutagenesis chemical was proved to be an efficient approach for producing genetic diversity in many crops, such as tomato [Solanum lycopersicum (Dor E et al., 2016. Weed Science, 64:348-360)], rapeseed [Brassica napus L. (Channaoui et al., 2019. Oilseeds fats Crop Lipids, 26, 35)], sesame (Kouighat et Journal of Crop Improvement. al., 2020. doi.org/10.1080/15427528.2020.1861155) and many more. In the course of the work of the present invention, a large EMS-mutagenized population (˜80,000 M1 plants) was developed according to the small genome size of sesame (˜370 Mbps) and the G:C content. In Arabidopsis, Jander et al. (2003. Plant Physiology, 131:139-146) found that fewer than 50,000 M1 EMS-mutagenized lines are needed to find a mutation in any given G:C base pair in the genome. Likewise, in soybean, Sebastian et al. (1989. Crop Science, 29:1403-1408) found resistance to ALS herbicide using a population of 70,000 M1 plants. Field-based screening of response to Imidazolinone herbicide (IMI), resulted in the identification of a single mutant plant (SiRM).
The genetic analysis exposed a point mutation in the SiALS gene which confers a change in amino acid Ala188.
The SiRM plants exhibited strong resistance to Imazamox, under both controlled (up to 192 g a.i. ha−1) and field (48 g a.i. ha−1) conditions (
Thus, according to certain aspects, the present invention provides a sesame (Sesamum indicum L.) plant or a part thereof comprising at least one cell comprising a mutant acetolactate synthase encoding gene (mALS), wherein the mALS encodes a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein, and wherein the plant is resistant to at least one ALS-inhibiting herbicide.
According to certain embodiments, the wild-type SiALS protein comprises an amino acid sequence having at least 91%, least 92%, least 93%, least 94%, least 95%, least 96%, least 97%, least 98%, least 99%, or more identity to the amino acid sequence set forth in SEQ ID NO:1 wherein the amino acid sequence comprises alanine at position 188. Each possibility represents a separate embodiment of the present invention.
According to certain exemplary embodiments, the wild-type SiALS protein comprises the amino acid sequence set forth in SEQ ID NO:1.
According to certain embodiments, the mALS protein comprises an amino acid other than alanine at position 188 of a protein having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the amino acid sequence set forth in SEQ ID NO:1. Each possibility represents a separate embodiment of the present invention.
According to certain currently exemplary embodiments, the alanine is substituted by valine (Ala188Val). According to these embodiments, the mALS protein comprises the amino acid valine at position 188 of an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2. Each possibility represents a separate embodiment of the present invention.
According to certain currently exemplary embodiments, the mALS protein comprises the amino acid sequence set forth in SEQ ID NO:3.
According to certain embodiments, the wild-type SiALS gene comprises a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2, wherein the sequence comprises an alanine coding sequence at positions 562-564. Each possibility represents a separate embodiment of the present invention.
According to certain exemplary embodiments, the wild-type SiALS gene comprises the nucleic acid sequence set forth in SEQ ID NO:2.
According to certain embodiments, the alanine-coding sequence comprises the nucleic acids 562-564 of SEQ ID NO:2.
According to certain embodiments, the mALS polynucleotide comprises a substituted codon coding for an amino acid other than alanine at positions 562-564 of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the substituted codon codes for the amino acid valine. According to these embodiments, the mALS polynucleotide comprises the nucleotide thymine (T) in position 563 of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2. Each possibility represents a separate embodiment of the present invention.
According to certain currently exemplary embodiments, the mALS polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:4.
Relying the weed control on a single class herbicide is not a recommended agricultural practice, as it can lead to rapid selection pressure and expose resistant weeds (Kumar et al., 2018, International Journal of Chemical Studies, 6:2844-2850). Therefore, to test if the newly identified mutation can promote resistance to the other four classes of ALS inhibitors, representative herbicides of each class were screened. In general, SiRM plants were more resistant to each of the herbicides (i.e., RI>2) tested, as compared to WT plants. Under the application of SU. TP, and SCT representative herbicides, SiRM plants exhibited tolerance at the field dosage while WT plants were susceptible to all classes (
According to certain embodiments, the ALS-inhibiting herbicide is selected from the group consisting of herbicidal effective Imidazolinones (IMI), Sulfonylureas (SU), Pyrimidinylthiobenzoates (PTB), Triazolopyrimidines (TP), and Sulfonylaminocarbonyltriazolinone (SCT).
As used herein, the term “imidazolinone” means an herbicidal composition comprising one or more chemical compounds of the imidazolinone class, including, but not limited to, 2-(2-imidazolin-2-yl)pyridines, 2-(2-imidazolin-2-yl)quinolines and 2-(2-imidazolin-2-yl) benzoates or derivatives thereof, including their optical isomers, diastereomers and/or tautomers exhibiting herbicidal activity. According to certain embodiments, the Imidazolinone herbicide is selected from the group consisting of 5-(methoxymethyl)-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazamox); 5-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazapic); 5-ethyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl) pyridine-3-carboxylic acid (Imazethapyr); 2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)pyridine-3-carboxylic acid (Imazapyr); 4-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)benzoic acid (Imazamethabenz); methyl 4-methyl-2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)benzoate (Imazamethabenz methyl); 2-(4-methyl-5-oxo-4-propan-2-yl-1H-imidazol-2-yl)quinoline-3-carboxylic acid (Imazaquin) and 1-(2-chloroimidazo[1,2-a]pyridin-3-yl)sulfonyl-3-(4,6-dimethoxypyrimidin-2-yl)urea (Imazosulfuron). Each possibility represents a separate embodiment of the present invention.
As used herein, the term “sulfonylurea” refers to an herbicidal composition comprising one or more chemical compounds of the sulfonylurea class, which generally comprise a sulfonylurea bridge, —SO2NHCONH—, linking two aromatic or heteroaromatic rings. According to certain embodiments, the Sulfonylurea herbicide is selected from the group consisting of 2-[(4,6-dimethoxypyrimidin-2-yl)carbamoylsulfamoyl]-4-formamido-N,N-dimethylbenzamide (foramsulfuron) and 1-(4,6-dimethoxypyrimidin-2-yl)-3-[3-(2,2,2-trifluoroethoxy)pyridin-2-yl]sulfonylurea (trifloxysulfuron). Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the Pyrimidinylthiobenzoate herbicide is selected from the group consisting of N-(2,6-difluorophenyl)-8-fluoro-5-methoxy-[1,2,4]triazolo[1,5-c]pyrimidine-2-sulfonamide (Florasulam) and sodium;2-chloro-6-(4,6-dimethoxypyrimidin-2-yl)sulfanylbenzoate (Pyrithiobac sodium). Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the Sulfonylaminocarbonyltriazolinone is methyl 2-[(4-methyl-5-oxo-3-propoxy-1,2,4-triazole-1-carbonyl)sulfamoyl]benzoate (Propoxycarbazone).
The genetic inheritance of known resistance to ALS inhibitors was suggested to be controlled by a complete or partial dominant allele (Yu and Powles, 2014. Pest Management Science, 70:1340-1350), and differ between species and dosage of application (Ghanizadeh et al., 2019, ibid). To evaluate the mode of inheritance in sesame the hybrid response to Imazamox (48 g a.i. ha−1) and of the parental lines (WT and SiRM) was characterized. An intermediate response for the F1 plants during the first 4 days after application, and full photosynthetic recovery afterward was observed. These results indicate an additive effect in which each copy of the resistant allele promotes a higher level of resistance. Imaizumi et al. (2008. Weed Research, 48:187-196) suggested, based on the allelic test of F2 population for SU-resistant x susceptible Monochoria vaginalis plants, that at a low dose (i.e., 25 g a.i. ha−1 bensulfuron-methyl) there is a dominant response of the resistance allele and at high dose (i.e., 225 g a.i. ha−1) the susceptible allele is dominant. Together, these findings indicate that the number of copies of the mutant ALS enzyme on one hand, and the number of herbicide molecules on the other, play a key role in the level of resistance, and may change between species and environmental conditions.
The present invention now shows that under field conditions, SiRM plants treated, post-emergence, with the ALS-inhibiting herbicide Imazamox, exhibited a two-fold greater yield compared to the corresponding weed-free UTC (
Thus, according to certain embodiments, the plant resistant to at least one ALS-inhibiting herbicide produces a higher seed yield after being exposed to treatment with the ALS-inhibiting herbicide compared to the yield obtained when the plant is grown under conditions of mechanical/manual weed control, wherein said ALS-inhibiting herbicide is applied post-emergence.
During the first two days after application of Imazamox, the mutant plants exhibit a slight yellowing of the apex, which may lead to the breaking of the apical meristem dominance and alters the source-sink relationship. Likewise, it has been shown that sesame cutting of apical bud can increase the formation of lateral branches and increase seed yield (Vasanthan et al., 2019. International Journal of Chemical Studies, 7:4180-4183). Unexpectedly, following the above mention recovery, the hybrid plants exhibited a compact and bushy phenotype (i.e., shorter nodes) (
According to certain embodiments, the sesame plant of the invention, characterized as being resistant to at least one ALS-inhibiting herbicide is further characterized by indehiscent capsules.
According to certain embodiments, the sesame plant of the invention comprises at least one cell comprising a mutant acetolactate synthase (mALS) gene, encoding a mutant acetolactate synthase (mALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS (SiALS) protein being tolerant and/or resistant to at least one ALS-inhibiting herbicide, further characterized by indehiscent capsules, has the genetic background of Sesamum indicum S-91 plant, seeds of which have been deposited with NCIMB Ltd. as the International Depositary Authority under Accession No. 43877.
The ALS-inhibiting herbicide-resistant plants of the present invention can be produced by any method as is known or will be known to a person skilled in the art.
According to certain embodiments, the mutant polynucleotide encoding the mutant acetolactate synthase is a mutant of the sesame plant endogenous ALS-encoding gene (mSiALS).
Any mutation(s) can be inserted into the polynucleotide encoding ALS including deletions, insertions, site-specific mutations including nucleotide substitution and the like, as long as the mutation(s) results in reduced affinity of the encoded protein to an ALS-inhibiting herbicide.
According to certain exemplary embodiments, mutating the endogenous ALS encoding gene of the sesame plant is performed by cite-directed mutagenesis. According to certain embodiments, cite-directed mutagenesis is performed by a gene-editing method.
Genome editing is a reverse genetics method that uses artificially engineered nucleases to cut and create specific double-stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homology directed repair (HDR) and non-homologous end-joining (NFfEJ). NFfEJ directly joins the DNA ends in a double-stranded break, while HDR utilizes a homologous sequence as a template for regenerating the missing DNA sequence at the breakpoint. To introduce specific nucleotide modifications to the genomic DNA, a DNA repair template containing the desired sequence must be present during HDR. Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and the probability is very high that the recognized base-pair combination will be found in many locations across the genome resulting in multiple cuts not limited to a desired location. To overcome this challenge and create site-specific single- or double-stranded breaks, several distinct classes of nucleases have been discovered and bioengineered to date. These include the meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system.
According to certain embodiments, the plants of the present invention are produced by inserting a mutation within the sesame endogenous ALS gene using the CRISPR/Cas system, a CRISPR/Cas homologous and CRISPR/Cas modified systems.
The CRISPR/Cas system for genome editing contains two distinct components: a gRNA (guide RNA) and an endonuclease e.g., Cas9.
The gRNA is typically a 20-nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA/Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break. Comparable with other genome-editing nucleases, Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), the double-stranded brakes produced by CRISPR/Cas can undergo homologous recombination or nonhomologous end-joining (NHEJ). The Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both of these domains are active, the Cas9 causes double-strand breaks in the genomic DNA.
Since most genome-editing techniques can leave behind minimal traces of DNA alterations evident in a small number of nucleotides as compared to transgenic plants, crops created through gene editing could avoid the stringent regulation procedures commonly associated with genetically modified (GM) crop development.
According to further aspects, the present invention provides an isolated polynucleotide encoding acetolactate synthase (ALS) protein having a reduced affinity to at least one ALS-inhibiting herbicide compared to a wild-type S. indicum ALS protein.
According to certain embodiments, the encoded ALS protein comprises an amino acid other that alanine at position 188 of a protein having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the amino acid sequence set forth in SEQ ID NO:1. According to certain exemplary embodiments, the encoded protein comprises the amino acid valine at position 188.
According to certain currently exemplary embodiments, the encoded protein comprises the amino acid sequence set forth in SEQ ID NO:3.
According to certain embodiments, the isolated polynucleotide comprises a substituted codon coding for an amino acid other than alanine at positions 562-564 of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2.
According to certain exemplary embodiments, the isolated polynucleotide comprises a valine-encoding codon at positions 562-564. According to certain currently exemplary embodiments, the isolated polynucleotide comprises the nucleotide thymine (T) in position 563 of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the nucleic acid sequence set forth in SEQ ID NO:2.
According to further currently exemplary embodiments, the isolated polynucleotide comprises the nucleotide thymine (T) in position 563 of SEQ ID NO:2 to form SEQ ID NO:4.
According to certain embodiments, the isolated polynucleotide is comprised within a DNA construct further comprising at least one regulatory element. According to certain embodiments, the regulatory element is selected from the group consisting of a promoter, an enhancer, a termination sequence and any combination thereof. According to certain embodiments, the isolated polynucleotide or the DNA construct comprising same is comprised within a plant-cell compatible expression vector.
According to certain further aspects, the sesame plants of the invention being tolerant and/or resistant to at least one ALS-inhibiting herbicide are transgenic plants comprising at least one cell comprising at least one exogenous polynucleotide encoding a mutated ALS protein as described hereinabove.
Any method as is known and will be known in the art for introducing an isolated polynucleotide into sesame plant or a part thereof can be used according to the teachings of the present invention.
According to certain embodiments, introducing the isolated polynucleotide into at least one cell of a sesame plant susceptible to ALS-inhibiting herbicide is performed by methods of gene editing as described hereinabove.
According to certain embodiments, introducing the isolated polynucleotide into at least one cell of a sesame plant susceptible to ALS-inhibiting herbicide comprises transforming the at least one cell with said isolated polynucleotide.
As used herein the term “transformation” or “transforming” describes a process by which a foreign nucleic acid sequence, such as a vector, enters and changes a recipient cell into a transformed, genetically modified or transgenic cell. Transformation may be stable, wherein the nucleic acid sequence is integrated into the plant genome and as such represents a stable and inherited trait, or transient, wherein the nucleic acid sequence is expressed by the cell transformed but is not integrated into the genome, and as such represents a transient trait. According to typical embodiments, the nucleic acid sequences of the present invention are stably transformed into a plant cell.
Transforming plants with isolated nucleic acid sequence generally involves the construction of an expression vector that will function in plant cells. According to the teachings of the present invention, such a vector comprises the isolated polynucleotide encoding the nutated ALS protein having reduced affinity to at least one ALS-inhibiting herbicide. Typically, the vector comprises the polynucleotide under control of, or operatively linked to, a regulatory element. According to certain embodiments, the regulatory element is selected from the group consisting of a promoter, enhancer, a translation termination sequence, and any combinations thereof. The vector(s) may be in the form of a plasmid, and can be used, alone or in combination with other plasmids, in a method for producing transgenic ALS-inhibiting herbicide-tolerant and/or resistant sesame plants.
Agrobacterium-mediated gene transfer: The Agrobacterium-mediated system includes the use of plasmid vectors that contain defined DNA segments which integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf-disc procedure, which can be performed with any tissue explant that provides a good source for initiation of whole-plant differentiation (Horsch et al., 1988. Plant Molecular Biology Manual A5, 1-9, Kluwer Academic Publishers, Dordrecht). A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. Agrobacterium mediated transformation protocols for tomato plants are known to a person skilled in the art.
Direct nucleic acid transfer: There are various methods of direct nucleic acid transfer into plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field, opening up mini-pores to allow DNA to enter. In microinjection, the nucleic acid is mechanically injected directly into the cells using micropipettes. In microparticle bombardment, the nucleic acid is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues. Another method for introducing nucleic acids to plants is via the sonication of target cells. Alternatively, liposome or spheroplast fusion has been used to introduce expression vectors into plants.
Expression vectors can include at least one marker (reporter) gene, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the markers gene). Many commonly used selectable marker genes for plant transformation are known in the art, and include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or an herbicide, or genes that encode an altered target which is insensitive to the inhibitor. Several positive selection methods are known in the art, such as mannose selection.
Alternatively, the transgenic as well as the non-transgenic sesame plants of the present invention can be identified using a marker specific for the mutant ALS protein.
According to yet additional certain aspects, the present invention provides a method for identifying a sesame plant having an enhanced tolerance and/or resistance to at least one type of ALS-inhibiting herbicide, the method comprising detecting, in a genetic material obtained from the plant, the presence of a nucleic acid marker amplified by a pair of primer comprising the nucleic acid sequence set forth in SEQ ID NO:5 (CAGGTTCCCCGTCGTATG) and SEQ ID NO:6 (TCCTTGACAACCCGAGGA).
According to certain embodiments, the amplified marker comprises the nucleic acid sequence set for the in SEQ ID NO:7. SEQ ID NO:7 comprises the nucleobase thymine (T) at position14.
According to yet further certain aspects, the present invention provides a method for controlling weeds in the vicinity of at least one sesame plant resistant to at least one ALS-inhibiting herbicide according to the teachings of the invention, the method comprises applying at least one ALS-inhibiting herbicide to the weeds and the plant in an amount sufficient to inhibit the weed growth.
According to certain embodiments, the method comprises controlling weeds in a field planted with a plurality of plants resistant to at least one ALS-inhibiting herbicide according to the teachings of the invention. According to these embodiments, the method comprises applying at least one ALS-inhibiting herbicide to the field.
According to certain embodiments, the amount of the ALS-inhibiting herbicide does not significantly inhibit the growth of the sesame plant resistant to the herbicide.
According to certain embodiments, the amount of the ALS-inhibiting herbicide inhibits the growth of a corresponding sesame plant susceptible to the herbicide.
According to certain embodiment, the amount of the ALS-inhibiting herbicide results in an enhanced seed yield of the sesame plant resistant to the herbicide compared to the yield of a corresponding sesame plant resistant to the herbicide grown in a weed-free environment obtained by an alternative weed control method, wherein the herbicide is applied post-emergence.
The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
The wild-type (WT) sesame line S-416 was selected for the current study. This mechanical harvest adapted line was previously developed by the inventors of the present invention and co-workers for the Mediterranean climate (Sabag et al., 2021. BMC Plant Biology, 21:549). Plants were selfed over six generations to get homozygote uniform seeds. About 80,000 WT seeds were washed and soaked in water for 6 hours. Seeds were divided into five containers with ddH2O and the mutagen Ethyl methanesulfonate (EMS, Merck KGaA, USA) at a concentration of 0.2, 0.4, 0.6, 0.8, or 1% (v/v). After 16 hours, seeds were washed under running water for 4 hours to remove the remains of the mutagen. M1 seeds were sown in planting trays and transplanted in the field, a month later. At maturation, M2 seeds were harvested as bulk and systematically mixed to randomly distribute the progeny of any given M1 plant.
The bulk of M2 seeds were sown in the field (Moshav Revaha; 31°38′41.30″N, 34° 45′51.72″E) with clay soil, at a rate of 6,000,000 seeds ha−1 (˜4.2 million seeds). At the two real leaves stage, plants were sprayed with Imazamox (Pulsar, BSAF, 48 g active ingredient (a.i.) ha−1) using a commercial sprayer (Degania Industries Ltd., Israel). To prevent possible plant escape, a second dose after three weeks was applied. A weekly observation was conducted to identify plants that were not affected by the herbicide. The identified candidate plant was harvested for further examination in the laboratory. The Sesamum indicum resistant mutant (hereafter SiRM) plant was selfed up to Ms generation.
Leaf samples (˜2 mg) were taken from two-weeks old plants of SiRM M3 plants and the susceptible WT (S-416). Plants were sprayed with Imazamox (48 g a.i. ha−1) for resistance validation (after DNA sampling). Genomic DNA was extracted using the CTAB protocol, with modification for sesame as described before (Teboul et al., 2020. Genes, 11, 1221). To test possible mutation(s) in the SiALS gene, a targeted sequencing was applied using four primer pairs covering the whole gene sequence (Table 1) according to the sequenced sesame genome (Zhongzhi No. 13; Wang et al., 2014. Genome Biology, 15:1-13). The gene was amplified, and PCR products were sequenced (HUJI genome center, Israel). Sequence alignment was performed using the Clustal Omega tool (Madeira et al., 2019. Nucleic Acids Research, 47:636-641).
A high-resolution melting (HRM) protocol was developed to determine the allelic configuration of SiALS mutation, based on dsDNA melting temperatures. One μl of forward (CAGGTTCCCCGTCGTATG, SEQ ID NO:5) and reverse (TCCTTGACAACCCGAGGA, SEQ ID NO:6) primers designed to amplify DNA segments that contain the SNP, were mixed with 2 μl of genomic DNA (20 ng/μl), 4 μl of HRM mix (HOT FIREPol EvaGreen HRM Mix, Solis BioDyne, Tartu, Estonia) and 13 μl of ddH2O. Each mix was transferred to a separate well within a plate (96-well Piko PCR Plate, Thermo Fisher Scientific, Massachusetts, USA), and placed in a Real-Time PCR System (PikoReal 96, Thermo Fisher Scientific, Massachusetts, USA). Reaction settings (i.e., cycles, temperature, and duration) were determined according to the supplied protocol.
Seeds of WT and SiRM were sown in a 9×9×10 cm pot with clay soil (57% clay, 23% silt, 20% sand) from Newe Yaar Research Station. At the stage of two true leaves, plants were exposed to increasing rates (0, ⅛X, ¼X, ½X, X, 2X, 4X, 8X) of representative herbicides from all ALS sub-groups (Table 2). Herbicides were sprayed on the plants using a Generation 4 Research Track Sprayer (DeVries Manufacturing, Inc., USA) at a 200 L ha−1 spray volume. Plant heights were measured sixteen days after treatments (DAT), and the aboveground material was harvested and oven-dried (at 80° C. for 48 h) to obtain the shoot dry weight (DW).
A cross between SiRM (♂) and the WT (♀) was made to produce F1 seeds. Uniform F1 seeds were sown in a 9×9×10 cm pot with clay soil alongside the two parental lines (WT and SiRM). The pots were placed in a growth chamber under long-day conditions (16/8 light/dark and 32/25° C.). At the stage of two true leaves, half of the plants were sprayed with Imazamox (48 g a.i. h−1). Plants were characterized daily for canopy coverage (Canopeo software, Oklahoma State University, USA; Patrignani and Ochsner, 2015. Agronomy Journal, 107:2312-2320) and gas exchange (IRGA 6800; Li-Cor, Lincoln, Nebraska, USA), over the next 11 days. At the end of the experiment, 21 DAT, the aboveground material was harvested, oven-dried (80° C., 48 h), and weighed to obtain shoot DW.
The experiment was conducted in the Experimental Farm of the Hebrew University of Jerusalem in Rehovot, Israel (34°47′ N, 31°54′ E; 54 m above sea level). The soil at this location is brown-red, degrading, sandy soil (Rhodoxeralf), composed of 76% sand, 8% silt, and 16% clay. A pair-samples experimental design was applied with the two genotypes (WT and SiRM) and two treatments: untreated control (UTC) and Imazamox application (40 g a.i. h−1). Each plot consisted of a 5-meter row, with a sowing density of 7-plants m−1 (n=6). At the end of the season, the survival rate was analyzed (number of plants per plot) and the plants in the plot were harvested. Samples were threshed using a laboratory thresher (Wintersteiger AG LD 350, Austria) and after sifting, the seeds were weighed to obtain seed yield.
To test the efficiency of Imazamox for weed control, Amaranthus palmeri was used as a model. Seeds of A. palmeri were sown (20-seeds m-1) as competitor weeds alongside the two sesame lines described above. As a negative control, plots that were not treated were used. At the end of the experiment, the number of A. palmeri plants per plot was counted.
Seeds of WT and SiRM, and two weed species, A. palmeri and Euphorbia heterophylla were sowed in pots (9×9×10 cm) with clay soil (Newe Yaar Research Station), 5 seed per pot, except A. palmeri with 20 seeds. Five pots from each plant species were sprayed with Imazapic (144 g a.i. h−1). Herbicide application was followed by irrigation equivalent to 200-millimeter ha−1. The pots were placed in a growth chamber under long-day conditions (16/8 light/dark and 32/25° C.) and the canopy coverage (Canopeo) was measured at 14 DAT.
An additional field experiment was conducted during the summer of 2021 at the Experimental Farm of the Hebrew University of Jerusalem, Rehovot, Israel. A split-plot random block design with six replicates was applied. Treatments included: weed-free plots (i.e., manual weeding), untreated control (i.e., herbicide-free treatment) and application of Imazapic (48 g a.i. ha−1) pre-germination. The plot size was 3.6 m×0.8 m (10 cm between plants) with two rows per plot. To evaluate the efficacy of weed control, two weeds were sown on the sesame sowing lines (Amaranthus Palmeri, 500 seeds per plot, and Abutilon Theophrastus, 70 seeds per plot). Phenological characterization was conducted during the growing season for the flowering date, the number of brunches per plant and the height to the first capsule. At the end of the growing season, the number of weeds per plot was counted and weeds were harvested for dry weight measurements. Sesame plants were harvested 1 m from the middle of the plot, samples were threshed using a laboratory thresher (Wintersteiger AG LD 350, Austria), and after sifting, the seeds were weighed to obtain seed yield.
Three seeds of SiRM were sown in plastic columns (30 cm long) filled with sandy soil (composed of 76% sand, 8% silt, and 16% clay) (n=5) and sprayed with increasing doses of Imazapic (24, 48, 96, and 192 g a.i. ha−1). Herbicide application was followed by irrigation equivalent to 200-millimeter ha−1 and placed in a growth chamber under long-day conditions (16/8 light/dark and 32/25° C.). Fourteen DAT, the roots were washed and scanned using a flatbed scanner (Epson 12000XL, Seiko EPSON, Japan), and root architecture was analyzed using the WinRHIZO Pro software (Regent Instruments Ltd., Ontario, Canada).
The JMP® (ver. 15) statistical package (SAS Institute Inc., Cary, NC. USA) was used for all statistical analyses. Descriptive statistics are graphically presented in box-plot: median value (horizontal short line), quartile range (25 and 75%), and data range (vertical long line). Dose-response curves were constructed by plotting the shoot DW data 16 DAT, from the different accessions as a percentage of untreated control (UTC). A nonlinear curve model (Exponential two parameters) was adjusted to analyze the effects of the tested herbicides in the different experiments.
where Y is the shoot DW, a=scale, b=growth rate, and d represents the herbicide dosage. The resistance/susceptible ratio of the ED50 was calculated to determine the resistance index (RI) of the resistant plants compared to that of the susceptible plants.
To identify a possible mutation(s) in the ALS encoding gene, over 4,000,000 M2 plants were screened in the field. Visual characterization of the plants after two consecutive applications of Imazamox (48 g a.i. ha−1) resulted in a single candidate plant without any visual symptoms (i.e., no visible growth reduction and meristem damage). Seeds from this candidate plant were harvested, and the M3 plants were sprayed with a similar dose of Imazamox. Seven days after spraying, the WT plants (S-416) showed reduced growth and meristem damages, while the mutant plants (SiRM) did not display any visual symptoms. It is worth noting that SiRM plants exhibited higher vigor under Imazamox treatment as compared with its untreated control (
To test the genetic inheritance of the mutant ALS gene the time-response to ALS-inhibitors of hybrid (F1) plants and their parental lines (WT and SiRM) was analyzed. In general, while the SiRM (homozygote) plants did not differ from the UTC plants and maintained a normal growth pattern, both WT and hybrid plants exhibited a significant reduction in growth during the first 4 DAT. The hybrid plants were able to recover and, already after 7 DAT, they looked like the SiRM plants. Fourteen DAT, the hybrid plants shifted their growth pattern from stem elongation to the production of more lateral branch meristems, as expressed in shorter plant height. At the end of the experiment, WT plants were fully eradicated, whereas SiRM plants showed no effect of Imazamox treatment (
While all three lines exhibited a similar trend of reduction in assimilation and transpiration during the first 48 hours after application, the severity of response was significantly stronger for the WT plants, with hybrid plants exhibiting intermediate response. After 48 h, WT had less than a 20% assimilation rate, and the SiRM plant recover completely and did not differ from the UTC plants. The hybrid plants showed slower recovery, though after six days they fully recovered (
To evaluate the level of field resistance and its effectiveness in sesame weed control, a field experiment was done with the two lines (WT and SiRM) under Amaranthus palmeri infestation and Imazamox (40 g a.i. h−1) application (
To test if the point mutation in the SiALS gene also promotes resistance to other herbicides in the same class of Imidazolinone, Imazapic and Imazethapyr were used. These herbicides were chosen based on their widespread use in field crops. Dose-response assay showed a similar trend, with clear differences between lines. Under Imazapic application, the WT exhibited a significant reduction in growth already at 6 g a.i. h−1 (18%, P=0.0055), which become more pronounced visually as Imazapic dosages increased. SiRM plants were not affected up to 2X of the recommended dose (96 g a.i. h−1) and exhibited severe damage symptoms only at a high rate of 16X (768 g a.i. h−1;
To test if the point-mutation in the SiALS gene affects sesame plant response to other herbicides of the ALS class, a dose-response assays for the additional classes was performed. Overall, for all herbicides applied, SiRM plants showed better performance compared with WT plants, as reflected in their higher ED50, and a higher growth rate at the field dose level (Table 3). Application of two sulfonylurea (SU) herbicides, foramsulfuron, and trifloxysulfuron exposed mild resistance of the SiRM plants as compared with WT plants. Under the recommended dose, WT plants exhibited significant reduction compared with SiRM in shoot DW (63% vs. 18% and 25% vs. 8% for trifloxysulfuron and foramsulfuron, respectively) and shoot length (74% vs. 7% and 64% vs. 58%) (
Table 3: Shoot dry weight (DW) and shoot length as a percentage of that of the untreated control (UTC) and ED50 values (herbicide rate reducing plant growth by 50%) are presented. Values are means (n=5).
To evaluate the response of SiRM plants to the pre-emergence application of Imazapic, a responsiveness assay at increasing doses (48, 96, and 144 g a.i. h−1) was performed. In general, under all tested doses, the SiRM plants exhibited normal growth and development (100% survival rate;
ALS herbicides are known to have a strong effect on the root developments due to their phloemic transport to the meristems (sink organs), as was also found here (
Under the control treatment (herbicide-free) the A. palmeri was the dominant weed (98 plants per plot), and no other weeds or sesame plants were able to develop as displayed visually (
The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IL2022/050607 | 6/8/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63208007 | Jun 2021 | US |
