SF-1 and LRH-1 modulator development

Abstract

Structures of SF1 and LRH are described, along with methods for identifying or developing modulators of those receptors and uses for such modulators.

Description

FIELD OF THE INVENTION

The present invention relates to the human orphan nuclear receptors steroidogenic factor-1 (SF-1) and liver receptor homolog-1 (LRH-1) and modulation of the activity of those receptors.

BACKGROUND OF THE INVENTION

The following description is provided solely to assist the understanding of the reader, and does not constitute an admission that any of the information provided or references cited are prior art to the present invention.

Nuclear receptors constitute a protein superfamily whose members specifically bind particular physiologically relevant small molecules, such as hormones or vitamins. As distinguished from integral membrane receptors and membrane-associated receptors, nuclear receptors are located in either the cytoplasm or nucleus of eukaryotic cells.

In many cases of binding of a molecule to a nuclear receptor, the nuclear receptor changes the ability of a cell to transcribe DNA, i.e. nuclear receptors modulate DNA transcription, but can also have transcription independent effects. Thus nuclear receptors comprise a class of intracellular, soluble ligand-regulated transcription factors. Nuclear receptors include but are not limited to receptors for glucocorticoids, androgens, mineralocorticoids, progestins, estrogens, thyroid hormones, vitamin D retinoids, and icosanoids. Many nuclear receptors identified by either sequence homology to known receptors (see, e.g., Drewes et al., Mol. Cell. Biol., 1996, 16:925-31) or based on their affinity for specific DNA binding sites in gene promoters (see, e.g., Sladek et al., Genes & Dev., 1990, 4:2353-65) have unascertained ligands and are therefore termed “orphan receptors.”

In a structural context, nuclear receptors are generally characterized by two distinct structural elements. First, nuclear receptors include a DNA binding domain that targets the receptor to specific DNA sequences, which are known as hormone response elements (HREs). The DNA binding domains of these receptors are related in structure and sequence. Second, the C-terminal region of nuclear receptors encompasses the ligand binding domain (LBD). Upon binding a ligand, the receptor adopts a transcriptionally active state.

Steroidogenic factor-1 (SF-1), also known as adrenal 4-binding protein (Ad4BP) and NR5A1, is an essential factor in adrenal and gonadal development and for the proper functioning of the hypothalamic-pituitary-gonadal axis. SF-1 maps to human gene map locus 9q33. SF-1 is a transcription factor which activates the promoters of various adrenal/gonadal steroid hydroxylase genes, as well as a variety of genes essential for endocrine organogenesis (Ikeda et al., Mol. Endocrinol., 1993, 7:852-860; Morohashi et al., Mol. Endocrinol., 1993, 7:1196-1204; and Parker & Schimmer, Endocr. Rev., 1997, 18:361-377). Mammalian SF-1 exhibits significant similarity to Drosophila fushi tarazu factor 1 (Ftz-F1), a regulator of the developmental homeobox gene fushi tarazu (Lavorgna et al., Science, 1992, 252:848-851; and Ueda et al., Genes & Dev., 1990, 4:624-635). The mouse SF-1 gene therefore has been designated mouse Ftz-F1.

SF-1 is conserved across both vertebrate and invertebrate species, indicating a conserved role for the protein in all metazoans (Honda et al., J. Biol. Chem., 1993, 268:7494-7502; Lala et al., Mol. Endocrinol., 1992, 6:1249-1258; Nomura et al., J. Biol. Chem., 1995, 270:7453-7461; Oba et al., Biochem. Biophys. Res. Comm., 1996, 226:261-267; Sun et al., Dev. Biol., 1994, 162:426-437; and Wong et al., J. Mol. Endocrinol., 1996, 17:139-147). SF-1 homologs have been cloned, for example, from silkworm, chicken and frog as well as a variety of mammalian species.

SF-1 is a member of the steroid receptor superfamily, and all SF-1 homologs have a common structural organization that shares several features with other members of the steroid receptor superfamily. A classic zinc finger DNA-binding domain (DBD) is present in the amino-terminal region; this domain confers high affinity binding to the SF-1 cognate response element and is essential for DNA binding and subsequent transcriptional activation (Wilson et al., Science, 1992, 256:107-110; Wilson et al., Mol. Cell. Biol., 1993, 13:5794-5804). The major nuclear import signal also maps to the tandem zinc finger domain.

In contrast to the majority of steroid receptors, which function as dimers in DNA-binding and transcriptional regulation, SF-1 binds DNA as a monomer at an extended AGGTCA site such as the perfect SF-1 binding site, TCAAGGTCA (Wilson et al., supra, 1993). In SF-1 and other monomeric nuclear receptors, amino acid residues carboxy-terminal to the DNA-binding domain, denoted the “A” box, contribute to binding specificity by recognizing nucleotides 5′ to the AGGTCA response element, resulting in an extended monomer response element with increased binding fidelity (Ueda et al., Mol. Cell. Biol., 1992, 12:5667-5672; Wilson et al., supra, 1992; and Wilson et al., supra, 1993). Such monomeric nuclear receptors include liver related homolog 1/fetoprotein transcription factor (LRH-1/FTF/SF-1.beta.), nerve growth factor-induced gene-B (NGF-IB), estrogen-related receptor 1 (ERR1), estrogen-related receptor 2 (ERR2) and retinoic acid receptor-related orphan nuclear receptor (ROR).

A variety of genes bound and regulated by SF-1 are known in the art. These SF-1 target genes include, for example, steroidogenic enzymes such as cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc) and other steroidogenic targets such as the ACTH receptor; gonadal SF-1 target genes such as the gene for the male-specific Mullerian inhibiting substance (MIS), which is expressed in the Sertoli cells of the testis and responsible for regression of the female specific Mullerian duct; and pituitary and hypothalamic target genes such as αGSU and the luteinizing hormone β subunit (LHβ). A variety of additional SF-1 target genes are known in the art; see, e.g., Hammer & Ingraham, Frontiers in Neurobiology, 1999, 20:199-223.

Like other members of the steroid receptor superfamily, SF-1 contains a conserved ligand-binding domain positioned at the carboxy-terminus of the receptor and a conserved activation function 2 (AF2) sequence in the carboxy-terminal region of the ligand-binding domain. In many nuclear receptors, this domain confers responsiveness to specific ligands that activate or, in some cases, repress receptor transcriptional activity (Evans, Science, 1988, 240:889-895; Forman et al., Nature, 1998, 395:612-615). While SF-1-dependent transcriptional activity has been shown in one instance to exhibit a modest increase in response to 25-, 26-, and 27-hydroxycholesterol in CV-1 cells (Lala et al., Proc. Natl. Acad. Sci. USA, 1997, 94:4895-4900), a ligand for SF-1 has not been definitively identified, and SF-1 consequently is referred to as an “orphan receptor.”

SF-1 has been shown to have transactivating activity in the absence of exogenous ligand. Two regions have been identified as important for SF-1 transactivation. Point mutations within the conserved AF2 hexamer motif, LLIEML, which is critical for transactivation function of many nuclear receptors (Mangelsdorf et al., Cell, 1995, 83:835-839), abrogated SF-1 activity, as did removal of the distal hinge region that follows the DNA-binding domain. In contrast, much of the ligand-binding domain can be truncated without significantly impairing SF-1 transcriptional activity. Furthermore, in cell lines that support SF-1-transcriptional activity, the AF1 domain of SF-1 is constitutively phosphorylated at serine 203. A nonphosphorylatable mutant, SF-1_S203A, consistently exhibited a significant 50-80% reduction in transcriptional activity on the MIS promoter and other promoters as compared to wild-type SF-1 activity. Point mutations in the AF2 hexamer motif also resulted in significant reduction in SF-1 transactivation, and a further reduction in activity was observed when the AF2 hexamer mutation was combined with the S203A mutation (Hammer et al., Mol. Cel, 1999, 3:521-526). In sum, maximal SF-1 transcriptional activity requires both the AF1 in the distal hinge domain and AF2 (Crawford et al., Mol. Endocrinol., 1997, 11:1626-1635; Ito et al., Mol. Cell. Biol., 1997, 17:1476-1483). Two motifs in particular, the phosphorylated Ser 203 and LLIEML hexamer of the AF2 domain, are essential for full SF-1 transcriptional activity.

Consistent with a role for SF-1 as a regulator of steroid hydroxylases, SF-1 is expressed in the primary organs that produce steroid hormones, including adrenal cortical cells, testicular Leydig cells, and ovarian theca and granulosa cells (Ikeda et al., Mol. Endocrinol., 1994, 8:654-662; Sasano et al., J. Clin. Endocrinol. Metab., 1995, 80:2378-2380; Takayama et al., J. Clin. Endocrinol. Metab., 1995, 80:2815-2821). SF-1 also is expressed in the testicular Sertoli cell, the pituitary gonadotrope, and the ventral medial nucleus (VMN) of the hypothalamus (Asa et al., J. Clin. Endocrinol. Metab., 1996, 81:2165-2170; Hatano et al., Develop., 1994, 120:2787-2797; Ikeda et al., supra, 1994; Ingraham et al., Genes & Dev., 1994, 8:2302-2312; Morohashi et al., Mol. Endocrinol., 1993, 7:1196-1204; and Roselli et al:, Brain Res. Mol. Brain Res., 1997, 44:66-72). SF-1 transcripts have been detected in spleen and placenta in addition to the gonad, adrenal, pituitary and hypothalamus.

In vivo significance of SF-1 has been demonstrated in SF-1 knockout mice. Homozygous Ftz-F1 −/− mice all died of glucocorticoid and mineralocorticoid insufficiency (Luo et al., Mol. Endocrinol., 1995, 9:1233-1239). The absence of SF-1 resulted in female external genitalia regardless of chromosomal sex, consistent with a role for SF-1 in gonadal formation and synthesis of androgens such as dihydrotestosterone, which is required for development of male external genitalia. Gonads and adrenal glands were completely absent from both sexes. Furthermore, all mice, regardless of chromosomal sex, displayed a female internal reproductive tract (Luo et al., Cell, 1994, 77:481-490; Sadovsky et al., Proc. Natl. Acad. Sci. USA, 1995, 92:10939-10943), consistent with a known role of SF-1 in regulation of Mullerian inhibiting substance (Giuili et al., Development, 1997, 124:1799-1807; Shen et al., Cell, 1994, 77:651-661). In the absence of this inhibitory substance, regression of the Mullerian duct, the precursor of the vagina, uterus and fallopian tube, does not take place. SF-1 null mice also lacked follicle stimulating hormone (FSH) and luteinizing hormone (LH) expression in the anterior pituitary. These results indicate that SF-1 is critical for appropriate development of the adrenals, gonads and pituitary gonadotropes.

The phenotype of the SF-1 null mice parallels the phenotype observed in the human syndrome of X-linked congenital hypoplasia, a disorder which is characterized by hypoplastic adrenal glands often accompanied by profound hypogonadism. The gene responsible for the human syndrome, DAX-1 (dosage-sensitive sex reversal-adrenal hypoplasia congenita critical region on the X chromosome), localizes to Xp21 and, like deletions of SF-1, DAX-1 deletions result in profound adrenal hypoplasia in humans (Muscatelli et al., Nature, 1994, 372:672-676; Zanaria et al., Nature, 1994, 372:635-641). Dax-1 also is an orphan nuclear receptor expressed in multiple endocrine organs; Dax-1 and SF-1 appear to colocalize to cells of the adrenals, gonads, gonadotropes and VMN (Ikeda et al., Mol. Endocrinol., 1995, 9:478-486; Swain et al., Nat. Genetics, 1996, 12:404-409). Together with the similar phenotypes of SF-1 null mice and Dax mutations in humans, these results reinforce the importance of SF-1 and indicate that SF-1 and DAX-1 can work together as essential regulators of the hypothalamic-pituitary-steroidogenesis axis in humans.

Ingraham et al., U.S. Pat. Pub. No. 20040092716, Appl. No. 10/616,897, discusses a properly folded steroidogenic factor-1 (SF-1)-like receptor variant, or active fragment thereof, which has an amino acid sequence that encodes a SF-1 -like receptor variant or active fragment thereof and that lacks at least one naturally occurring cysteine residue within the ligand-binding domain of the receptor. This patent publication also discusses a LRH-1 receptor variant or an active fragment thereof that contains a substitution at particular cysteine residues.

Liver receptor homolog-1 (LRH-1) is a second orphan nuclear receptor that has sequence similarity to SF-1. LRH-1 is expressed in liver, intestine, and pancreas, and acts on genes coordinating bile acid synthesis, enterohepatic circulation, and absorption. Gene knockout and heterozygous loss-of-function studies show that both SF-1 and LRH-1 are essential during embryogenesis for normal development of the organs in which they are expressed, and mammalian cell transfection experiments indicate that SF-1 and LRH-1 function as obligate factors for their target genes, acting apparently constitutively. The mouse LRH-1 structure contains a cavity available for potential ligands, but mutations to fill this cavity did not diminish activity, supporting a model of constitutive, ligand-independent function.

LRH-1 is involved in the regulation of a number of different genes, including, for example, steroidogenic acute regulatory protein (Kim et al., J. Clin Endocrinol Metab., 2004, 89:3042-3047), apolipoprotein Al (Delerive et al., Mol. Endocrinol., 2004, 18:2378-87), cholesterol 7 alpha-hydroxylase (Qin et al., Mol. Endocrinol., 2004, 18:2424-2439), aromatase (Clyne et al., Mol. Cell. Endocrinol., 2004, 215:39-44), carboxyl ester lipase (Fayard et al., J. Biol. Chem., 2003, 278:35725-31), and cytochrome P450 7A.

Zhao et al. U.S. Pat. Pub. No. 20030077664, application Ser. No. 09/922,226 provides methods of screening for compounds that modulate hormone receptor activity in which an isolated receptor-containing complex is assayed for an altered modification state as compared to a control modification state. The presence of an altered modification state serves to identify an effective agent that modulates a biological activity of the nuclear hormone receptor.” Potential receptors mentioned for use in the methods include without limitation RXR, HNF4, TLX, COUP-TF, TR, RAR, PPAR, reverb, ROR, SF-1, LRH-1, EcR, PXR, CAR, NOR1, NURR1, ER, ERR, GR, AR, PR, and MR.

Goodwin et al., U.S. Pat. Pub. No. 2004/0038862, application Ser. No. 10/343,289 concerns a method to identify compounds that modulate bile acid synthesis by assessing the ability of a compound to act as a ligand for short heterodimerizing partner-i or liver receptor homologue-1, preferably a compound that modulates the interaction of short heterodimerizing partner-1 with liver receptor homologue-1.

SUMMARY OF THE INVENTION

In accordance with the present invention, it has been discovered that “orphan” nuclear receptors human steroidogenic factor-1 (SF-1) and liver receptor homolog-1 (LRH-1) bind phospholipid ligands in a ligand binding domain (LBD) pocket. As a result, the invention provides methods for the identification of modulators that bind in the respective LBD pockets of these receptors.

Thus, in a first aspect, the invention provides a method for identifying compounds that bind to the ligand binding domain of SF-1 or LRH-1 by contacting the ligand binding domain with a test compound and determining whether the compound binds to the domain, thereby identifying compounds that bind to the ligand binding domain of SF-1 or LRH-1. Compounds that bind to the ligand binding domain but do not have detectable modulating activity can be useful for development of derivative compounds that are active modulators, but in preferred embodiments, such binding compounds modulate activity of SF-1 or LRH-1. Thus, such binding compounds can be assayed for modulating activity. The method can be carried out for a plurality of compounds, e.g., a large plurality such as at least 100, 500, 1000, 5000, 10000 compounds. The method additionally contemplates whether the compound binds in a ligand binding pocket. Such a binding determination can be carried out in a variety of ways, e.g., as a direct binding assay or as a competitive assay in which the test compound competes for binding with a known binding compound, e.g., a molecular scaffold as identified herein. The method can also involve determining whether the compound binds at one or both of the co-activator binding surfaces as identified herein. Such a binding determination can be carried out in a variety of ways, e.g., as a direct binding assay or as a competitive assay in which the test compound competes for binding with a known binding compound, e.g., a phospholipid as identified herein.

Identification of such compounds enables a method for identifying or developing additional compounds active on these receptors, e.g., improved modulators. Such identification includes without limitation determining whether any of a plurality of test compounds active on SF-1 or LRH-1 provides an improvement in one or more desired pharmacologic properties relative to an active reference compound. Thereafter, invention methods comprise selecting a compound, if any, that has an improvement in the desired pharmacologic property, thereby providing an improved modulator. In particular embodiments of aspects of modulator development, the desired pharmacologic property is serum half-life longer than 2 hr or longer than 4 hr or longer than 8 hr, aqueous solubility, oral bioavailability more than 10%, or oral bioavailability more than 20%. In certain embodiments, a plurality of derivatives of an active reference compound (e.g., a compound identified in a method described herein) are used.

Also in particular embodiments of aspects of modulator development, the process can be repeated multiple times, i.e., multiple rounds of preparation of derivatives and/or selection of additional related compounds and evaluation of such further derivatives of related compounds, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more additional rounds.

In another aspect, the invention provides a method of designing a ligand that binds to SF-1 or LRH-1, by identifying one or more molecular scaffolds that bind to a binding site of SF-1 or LRH-1 ligand binding domain polypeptide with low affinity; determining the orientation of the one or more molecular scaffolds at the binding site of the polypeptide by obtaining co-crystal structures of the one or more molecular scaffolds in the binding site; and modifying one or more structures of at least one scaffold molecule so as to provide a ligand having altered binding affinity or binding specificity or both for binding to the polypeptide as compared to the binding of the scaffold molecule. The designed ligand(s) can then be provided, e.g., by synthesizing or otherwise obtaining the ligand(s). In particular embodiments, one or more molecular scaffolds interact with at least 3 conserved amino acid residues in a binding pocket of the ligand binding domain and/or with at least 3 residues with which a phospholipid ligand interacts. In another aspect, the invention provides a method of developing altered modulators for SF-1 or LRH-1 by selecting a molecular scaffold from a set of at least 3 molecular scaffolds that bind to SF-1 or LRH-1, and modifying one or more structures of the scaffold molecule so as to provide a ligand having altered binding affinity or binding specificity or both for binding to SF-1 or LRH-1 as compared to the binding of the scaffold molecule.

In particular embodiments, a plurality of distinct compounds are assayed for binding to the binding site of the SF-1 or LRH-1 ligand binding domain polypeptide; co-crystals of the molecular scaffolds bound to the polypeptide are isolated, and the orientation of the molecular scaffold is determined by performing X-ray crystallography on the co-crystals. In further embodiments, the method involves identifying common chemical structures of the molecular scaffolds, placing the molecular scaffolds into groups based on having at least one common chemical structure, and determining the orientation of the one or more molecular scaffolds at the binding site of the polypeptide for at least one representative compound from a plurality of groups; the ligand binds to the target molecule with greater binding affinity or greater binding specificity or both than the molecular scaffold; the orientation of the molecular scaffold is determined by nuclear magnetic resonance in co-crystal structure determination; the plurality of distinct compounds are each assayed for binding to a plurality of members of the NR5A nuclear receptor family.

Also in particular embodiments, after the identification of common chemical structures of the distinct compounds that bind, the compounds are grouped into classes based on common chemical structures and a representative compound from a plurality of the classes is selected for performing X-ray crystallography on co-crystals of the compound and target molecule; the distinct compounds are selected based on criteria selected from molecular weight, clogP, and the number of hydrogen bond donors and acceptors; the clogP is less than 2, and the number of hydrogen bond donors and acceptors is less than 5.

In certain embodiments, the distinct compounds have a molecular weight of from about 100 to about 350 daltons, or more preferably from about 150 to about 350 daltons or from 150 to 300 daltons, or from 200 to 300 daltons. The distinct compounds can be of a variety of structures. In some embodiments, the distinct compounds can have a ring structure, either a carbocyclic or heterocyclic ring, such as for example, a phenyl ring, a pyrrole, imidazole, pyridine, purine, or any ring structure.

In various embodiments, a compound or compounds binds with extremely low affinity, very low affinity, low affinity, moderate affinity, or high affinity; at least about 5% of the binding compounds bind with low affinity (and/or has low activity), or at least about 10%, 15%, or 20% of the compounds bind with low affinity (or very low or extremely low). After the identification of common chemical structures of the distinct compounds that bind, the compounds can be grouped into classes based on common chemical structures and at least one representative compound from at least one, or preferably a plurality, of the classes selected for performing orientation determination, e.g., by X-ray crystallography and/or NMR analysis.

In selecting the distinct compounds for assay in the present invention, the selection can be based on various criteria appropriate for the particular application, such as molecular weight, clogP (or other method of assessing lipophilicity), Polar Surface Area (PSA) (or other indicator of charge and polarity or related properties), and the number of hydrogen bond donors and acceptors. Compounds can also be selected using the presence of specific chemical moieties which, based on information derived from the molecular family, might be indicated as having some affinity for members of the family. Compounds with highly similar structures and/or properties can be identified and grouped using computational techniques to facilitate the selection of a representative subset of the group. As indicated above, in preferred embodiments, the molecular weight is from about 150 to about 350 daltons, more preferably from 150 to 300 daltons. The clogp is preferably less than 2, the number of hydrogen bond donors and acceptors is preferably less than 5 and the PSA less than 100. Compounds can be selected that include chemical structures of drugs having acceptable pharmacalogical properties and/or lacking chemical structures that are known to result in undesirable pharmacological properties, e.g., excessive toxicity and lack of solubility.

In some embodiments, the assay is an enzymatic assay, and the number of groups of molecular scaffolds formed can conveniently be about 500. In some embodiments, the assay is a competition assay, e.g., a binding competition assay. Cell-based assays can also be used. As indicated above, compounds can be used that have low, very low, or extremely low activity in a biochemical or cell-based assay.

The modification of a molecular scaffold can be the addition, subtraction, or substitution of a chemical group. The modification may desirably cause the scaffold to be actively transported to or into or out of particular cells and/or a particular organ. In various embodiments, the modification of the compound includes the addition or subtraction of a chemical atom, substituent or group, such as, for example, a hydrogen, alkyl, alkoxy, phenoxy, alkenyl, alkynyl, phenylalkyl, hydroxyalkyl, haloalkyl, aryl, arylalkyl, alkyloxy, alkylthio, alkenylthio, phenyl, phenylalkyl, phenylalkylthio, hydroxyalkyl-thio, alkylthiocarbamylthio, cyclohexyl, pyridyl, piperidinyl, alkylamino, amino, nitro, mercapto, cyano, hydroxyl, a halogen atom, halomethyl, an oxygen atom (e.g., forming a,ketone, ether or N-oxide), and a sulphur atom (e.g., forming a thiol, thione, sulfonamide or di-alkylsulfoxide (sulfone)).

In certain embodiments, the information provided by performing X-ray crystallography on the co-crystals is provided to a computer program, wherein the computer program provides a measure of the interaction between the molecular scaffold and the protein and a prediction of changes in the interaction between the molecular scaffold and the protein that result from specific modifications to the molecular scaffold, and the molecular scaffold is chemically modified based on the prediction of the biochemical result. The computer program can provide the prediction based on a virtual assay such as, for example, virtual docking of the compound to the protein, shape-based matching, molecular dynamics simulations, free energy perturbation studies, and similarity to a three-dimensional pharmacophore. A variety of such programs are well-known in the art.

Chemical modification of a chemically tractable structure can result in, or be selected to provide, one or more physical changes, e.g., to result in a ligand that fills a void volume in the protein-ligand complex, or in an attractive polar interaction being produced in the protein-ligand complex. The modification can also result in a sub-structure of the ligand being present in a binding pocket of the protein binding site when the protein-ligand complex is formed. After common chemical structures of the compounds that bind are identified, the compounds can be grouped based on having a common chemical sub-structure and a representative compound from each group (or a plurality of groups) can be selected for co-crystallization with the protein and performance of the X-ray crystallography. The X-ray crystallography is preferably performed on the co-crystals under distinct environmental conditions, such as at least 20, 30, 40, or 50 distinct environmental conditions, or more preferably under about 96 distinct environmental conditions. The X-ray crystallography and the modification of a chemically tractable structure of the compound can each be performed a plurality of times, e.g., 2, 3, 4, or more rounds of crystallization and modification.

Also in certain embodiments, one or more molecular scaffolds are selected which bind to a plurality of nuclear receptors, such as members of the NR5A group of nuclear receptors.

The method can also include the identification of conserved residues in a binding site(s) of a SF-1 or LRH-1 ligand binding domain polypeptide, that interact with a molecular scaffold, ligand or other binding compound. Conserved residues can, for example, be identified by sequence alignment of different members of the NR5A family and/or homologs of SF-1 or LRH-1, and identifying binding site residues that are the same or at least similar between multiple members of the group. Interacting residues can be characterized as those within a selected distance from the binding compound(s), e.g., 3, 3.5, 4, 4.5, or 5 angstroms.

As used in connection with binding of a compound with a target, the term “interact” indicates that the distance from a bound compound to a particular amino. acid residue will be 5.0 angstroms or less. In particular embodiments, the distance from the compound to the particular amino acid residue is 4.5 angstroms or less, 4.0 angstroms or less, or 3.5 angstroms or less. Such distances can be determined, for example, using co-crystallography, or estimated using computer fitting of a compound in an active site.

In a related aspect, the invention provides a method of designing a ligand that binds to at least one member of the NR5A family, by identifying as molecular scaffolds one or more compounds that bind to binding sites of a plurality of members of the NR5A family, determining the orientation of one or more molecular scaffolds at the binding site of a NR5A receptor(s) to identify chemically tractable structures of the scaffold(s) that, when modified, alter the binding affinity or binding specificity between the scaffold(s) and the receptor(s), and synthesizing a ligand wherein one or more of the chemically tractable structures of the molecular scaffold(s) is modified to provide a ligand that binds to the receptor with altered binding affinity or binding specificity relative to binding of the scaffold.

Particular embodiments include those described for the preceding aspect.

The invention also provides a method to identify interaction properties that a likely SF-1 or LRH-1 binding compound will possess, thereby allowing, for example, more efficient selection of compounds for structure activity relationship determinations and/or for selection for screening. Thus, another aspect concerns a method for identifying binding characteristics of a ligand of a NR5A protein (e.g., SF-1 or LRH-1), by identifying at least one conserved interacting residue in the receptor that interacts with at least two binding compounds; and identifying at least one common interaction property of those binding compounds with the conserved residue(s). The interaction property and location with respect to the structure of the binding compound defines the binding characteristic.

In various embodiments, the identification of conserved interacting residues involves comparing (e.g., by sequence alignment) a plurality of amino acid sequences in the NR5A family and identifying binding site residues conserved in that family; identification of binding site residues by determining co-crystal structure(s); identifying interacting residues (preferably conserved residues) within a selected distance of the binding compounds, e.g., 3, 3.5, 4, 4.5, or 5 angstroms; the interaction property involves hydrophobic interaction, charge-charge interaction, hydrogen bonding, charge-polar interaction, polar-polar interaction, or combinations thereof.

Another related aspect concerns a method for developing ligands for SF-1 or LRH-1 using a set of scaffolds. The method involves selecting one or both of those receptors, selecting a molecular scaffold, or a compound from a scaffold group, from a set of at least 3 scaffolds or scaffold groups where each of the scaffolds or compounds from each scaffold group are known to bind to the target. In particular embodiments, the set of scaffolds or scaffold groups is at least 4, 5, 6, 7, 8, or even more scaffolds or scaffold groups.

In another aspect the invention provides a method of identifying a modulator of a SF-1 or LRH-1 polypeptide by designing or selecting a compound that interacts with amino acid residues in a ligand binding site of the SF-1 or LRH-1 polypeptide, based upon a crystal structure of the respective ligand binding domain polypeptide, e.g., a structure of such a peptide in complex with one or more of a ligand and a coactivator polypeptide. The method can also involve synthesizing the modulator, and/or determining whether the compound modulates the activity of the SF-1 or LRH-1 polypeptide. Compounds that modulate SF-1 or LRH-1 are thus identified as modulators.

In certain embodiments the amino acid residues are conserved residues; are residues that interact with a phospholipid ligand as described herein; include at least 3, 4, 5, 6, or more conserved residues; include at least 3, 4, 5, 6, or more residues that interact with a phospholipid ligand as described herein; or include at least 2, 3, 4, or more residues that, when mutated from wild-type to a non-similar amino acid residue, changes the level of transcription or expression of a gene regulated by SF-1 or LRH-1 by at least 20% in an assay appropriate for determining such transcription or expression level (in particular embodiments, the gene is one identified herein as regulated by SF-1 or LRH-1).

The invention also provides a method of designing a modulator that modulates the activity of a SF-1 or LRH-1 by evaluating the three-dimensional structure of crystallized SF-1 or LRH-1 ligand binding domain polypeptide complexed with one or more of a ligand and a co-activator polypeptide, and synthesizing or selecting a compound based on the three-dimensional structure of the crystal complex that will bind to the polypeptide. Optionally, such a compound binds to the polypeptide as a potential modulator. The method can also involve determining whether the compound modulates the activity of a SF-1 or LRH-1; such determination can include determination of specificity (e.g., specificity between SF-1 and LRH-1, or specificity between SF-1 or LRH-1 and other members of the NR5A nuclear receptor family, or between SF-1 or LRH-1 and other nuclear receptors.

In another aspect, the invention concerns a method of screening for a modulator of SF-1 or LRH-1. The method involves contacting SF-1 or LRH-1 ligand binding domain polypeptide with a plurality of test compounds and determining whether any of the compounds bind with the ligand binding domain polypeptide. The method can also involve determining whether the compound binds in a LBD phospholipid binding pocket or at one or both of the coactivator binding surfaces as identified herein. Such a binding determination can be carried out as a direct binding assay or as a competitive assay in which the test compound competes for binding with a known binding compound, e.g., a phospholipid as identified herein. Test compounds that bind with SF-1 or LRH-1 can also be assayed for ability to modulate SF-1 or LRH-1 activity.

Additional variants of methods for identifying nuclear receptor modulators that can be applied to SF-1 and LRH-1 are described in Bledsoe et al., U.S. Pat. Pub. No. 2004/0018560, application Ser. No. 10/418,007, which is incorporated herein by reference in its entirety.

In another aspect, the invention provides a protein crystal comprising a substantially pure SF1 ligand binding domain polypeptide optionally comprising a ligand, or a LRH-1 ligand binding domain optionally comprising a ligand. In further embodiments of this aspect, the ligand is a phospholipid ligand.

Preferably, the crystalline form has lattice constants as shown in Table 1 and/or has coordinates as specified in Table 2 or Table 3. In certain embodiments, the ligand is a phospholipid.

The invention also provides a method for obtaining a crystal of SF-1 or LRH-1 ligand binding domain by subjecting substantially pure SF-1 or LRH-1 in the presence of a coactivator peptide and/or a ligand (e.g., a phospholipid ligand as described herein) under conditions substantially equivalent to the crystallization conditions described in the Examples herein.

A related aspect concerns a method for determining the three-dimensional structure of a crystallized SF-1 or LRH-1 ligand binding domain polypeptide in complex with one or more of a ligand and a coactivator polypeptide to a resolution of about 2.8 angstroms or better. In certain embodiments, the method includes: (a) crystallizing a SF-1 or LRH-1 ligand binding domain polypeptide in complex with one or more of a ligand and a coactivator polypeptide to form a crystallized complex; and (b) analyzing the crystallized complex to determine the three-dimensional structure of the SF-1 or LRH-1 ligand binding domain polypeptide in complex with one or more of a ligand and a coactivator polypeptide, whereby the three-dimensional structure of a crystallized SF-1 or LRH-1 ligand binding domain polypeptide in complex with one or more of a ligand and a coactivator polypeptide is determined to a resolution of about 2.8 angstroms or better. It is also preferable that the ligand is a phospholipid, e.g., as described herein.

The invention also provides a modified SF-1 or LRH-1 ligand binding domain, e.g., a domain which is modified as described in the Examples herein. In particular embodiments, the domain is SF-1 ligand binding domain which is modified by substitution or deletion of surface cysteines, C247 and/or C412. The modification can be substitution by serine residues.

As is conventional, the terms “a” and “an” mean “one or more” when used herein, including in the claims.

As used herein, the term “expression” generally refers to the cellular processes by which a polypeptide is produced from RNA.

As used herein, the term “transcription factor” means a cytoplasmic or nuclear protein which binds to a gene, or binds to an RNA transcript of a gene, or binds to another protein which binds to a gene or an RNA transcript or another protein which in turn binds to a gene or an RNA transcript, so as to thereby modulate expression of the gene. Such modulation can additionally be achieved by other mechanisms; the essence of a “transcription factor for a gene” pertains to a factor that alters the level of transcription of the gene in some way.

As used herein in connection with polynucleotides and polypeptides, the term “isolated” means that the molecule is separated from a substantial amount of other nucleic acids, proteins, lipids, carbohydrates or other materials with which they associate, such association being either in cellular material or in a synthesis medium. For example, the polynucleotide or polypeptide can be separated from 50, 60, 70, 80, 90, 95, 97, 98, 99% or more of such other materials.

As used herein, the term “substantially pure” means that the polynucleotide or polypeptide is substantially free of other polynucleotides and/or polypeptides, and thus constitutes at least 50, 60, 70, 80, 90, 95, 97, 98, 99% or more of a sample or preparation as the substantially pure polynucleotide or polypeptide.

As used herein, the term “modified” means an alteration from an entity's normally occurring state. An entity can be modified by removing discrete chemical units or by adding discrete chemical units. The term “modified” encompasses detectable labels as well as those entities added as aids in purification and entities added or removed as aids in crystallization.

As used herein, the terms “structure coordinates” and “structural coordinates” mean mathematical coordinates derived from mathematical equations related to the patterns obtained on diffraction of a monochromatic beam of X-rays by the atoms (scattering centers) of a molecule in crystal form. The diffraction data are used to calculate an electron density map of the repeating unit of the crystal. The electron density maps are used to establish the positions of the individual atoms within the unit cell of the crystal.

As used herein, the term “space group” means the arrangement of symmetry elements of a crystal.

As used herein, the term “molecular replacement” means a method that involves generating a preliminary model of, for example, the wild-type SF-1 ligand binding domain, or a SF-1 mutant crystal whose structure coordinates are unknown, by orienting and positioning a molecule whose structure coordinates are known within the unit cell of the unknown crystal so as best to account for the observed diffraction pattern of the unknown crystal. Phases can then be calculated from this model and combined with the observed amplitudes to give an approximate Fourier synthesis of the structure whose coordinates are unknown. This, in turn, can be subject to any of the several forms of refinement to provide a final, accurate structure of the unknown crystal. See, e.g., Lattman, 1985, Method Enzymol., 115: 55-77; Rossmann (ed.), 1972, The Molecular Replacement Method, Gordon & Breach, New York. Using the structure coordinates of a SF-1 or LRH-1 ligand binding domain provided by the present invention, molecular replacement can be used to determine the structure coordinates of a crystalline mutant or homologue of a SF-1 or LRH-1 ligand binding domain, or of a different crystal form of the SF-1 or LRH-1 ligand binding domain.

As used herein, the term “isomorphous replacement” means a method of using heavy atom derivative crystals to obtain the phase information necessary to elucidate the three-dimensional structure of a native crystal (Blundell et al., Protein Crystallography, 1976, Academic Press; Otwinowski, in Isomorphous Replacement and Anomalous Scattering, (Evans & Leslie, eds.), 1991, 80-86, Daresbury Laboratory, Daresbury, United Kingdom). The phrase “heavy-atom derivatization” is synonymous with the term “isomorphous replacement.”

As used herein, the term “polypeptide” means a polymer of amino acids, regardless of its size. Although “protein” is often used in reference to relatively large polypeptides, and “peptide” is often used in reference to small polypeptides, usage of these terms in the art overlaps and varies. The term “polypeptide” as used herein refers to peptides, polypeptides and proteins, unless clearly indicated to the contrary. As used herein, the terms “protein”, “polypeptide” and “peptide” are used interchangeably herein when referring to a gene product.

As used herein, the term “modulate” means an increase, decrease, or other alteration of any, or all, chemical and biological activities or properties of a wild-type or mutant SF-1 or LRH-1 polypeptide. The term “modulation” as used herein refers to both upregulation (i.e., activation or stimulation) and downregulation (i.e. inhibition or suppression) of a response. Thus a modulator may be either an agonist or an antagonist.

As used herein, the term “gene” is used for simplicity to refer to a functional protein, polypeptide or peptide encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences and cDNA sequences.

As used herein, the term “intron” means a DNA sequence present in a given gene that is not translated into protein.

As used herein, the term “agonist” means an agent that increases, supplements, or potentiates the bioactivity of a functional gene or protein, e.g., SF-1 or LRH-1.

As used herein, the term “antagonist” means an agent that decreases or inhibits the bioactivity of a functional gene or protein, e.g., SF-1 or LRH-1.

As used herein in connection with SF-1 and LRH-1 modulating compounds, binding compounds or ligands, the term “specific for SF-1”, “specific for LRH-1” and terms of like import mean that a particular compound binds to the specified receptor to a statistically greater extent than to other biomolecules that may be present in a particular organism, e.g., at least 2, 3, 4, 5, 10, 20, 50, 100, or 1000-fold. Also, where biological activity other than binding is indicated, the term “specific for SF-1” or “specific for LRH-1” indicates that a particular compound has greater biological activity associated with binding to the specified receptor than to other biomolecules (e.g., at a level as indicated for binding specificity). Similarly, the specificity can be for the specific receptor with respect to other nuclear receptors that may be present from an organism. In particular embodiments, the specificity is between SF-1 and LRH-1.

As used herein, the terms “ligand” and “modulator” are used equivalently to refer to a compound that alters the activity of a target biomolecule, e.g., SF-1 or LRH-1. Generally a ligand or modulator will be a small molecule, where “small molecule refers to a compound with a molecular weight of 1500 daltons or less, or preferably 1000 daltons or less, 800 daltons or less, or 600 daltons or less. Thus, an “improved ligand” is one that possesses better pharmacological and/or pharmacokinetic properties than a reference compound, where “better” can be defined by a person for a particular biological system or therapeutic use. In terms of the development of ligands from scaffolds, a ligand is a derivative of a molecular scaffold that has been chemically modified at one or more chemically tractable structures to bind to the target molecule with altered or changed binding affinity or binding specificity relative to the molecular scaffold. The ligand can bind with a greater specificity and/or affinity for a member of the molecular family relative to the molecular scaffold. A ligand binds non-covalently to a target molecule, which can preferably be a protein or enzyme.

In the context of binding compounds, molecular scaffolds, and ligands, the term “derivative” or “derivative compound” refers to a compound having a common core chemical structure relative to a parent or reference compound, but differs by having at least one structural difference, e.g., by having one or more substituents added and/or removed and/or substituted, and/or by having one or more atoms substituted with different atoms. Unless clearly indicated to the contrary, the term “derivative” does not mean that the derivative is synthesized using the parent compound as a starting material or as an intermediate, although in some cases, the derivative may be synthesized from the parent.

Thus, the term “parent compound” refers to a reference compound for another compound, having structural features also present in the derivative compound. Often but not always, a parent compound has a simpler chemical structure than the derivative.

Also in the context of compounds binding to a biomolecular target, the term “greater specificity” indicates that a compound binds to a specified target to a greater extent than to another biomolecule or biomolecules that may be present under relevant binding conditions, where binding to such other biomolecules produces a different biological activity than binding to the specified target. In some cases, the specificity is with reference to a limited set of other biomolecules, e.g., in the case of SF-1 and LRH-1, in some cases the reference may be other nuclear receptors, or for SF-1 it may be LRH-1 and for LRH-1 it may be SF-1. In particular embodiments, the greater specificity is at least 2, 3, 4, 5, 8, 10, 50, 100, 200, 400, 500, or 1000-fold greater specificity.

Another aspect of the invention concerns novel compounds that bind to a ligand binding domain of SF-1 or LRH-1 and make interactions with amino acids in the ligand binding domain pocket that interact with the phospholipids identified herein.

A related aspect of this invention concerns pharmaceutical compositions that include such a binding compound and at least one pharmaceutically acceptable carrier, excipient, or diluent. The composition can include a plurality of different pharmacologically active compounds.

As used herein, the term “pharmaceutical composition” refers to a preparation that includes a therapeutically significant quantity of an active agent, that is prepared in a form adapted for administration to a subject. Thus, the preparation does not include any component or components in such quantity that a reasonably prudent medical practitioner would find the preparation unsuitable for administration to a normal subject. In many cases, such a pharmaceutical composition is a sterile preparation.

In a related aspect, the invention provides kits that include a pharmaceutical composition as described herein. In particular embodiments, the pharmaceutical composition is packaged, e.g., in a vial, bottle, flask, which may be further packaged, e.g., within a box, envelope, or bag; the pharmaceutical composition is approved by the U.S. Food and Drug Administration or similar regulatory agency for administration to a mammal, e.g., a human; the pharmaceutical composition is approved for administration to a mammal, e.g., a human for a SF-1- or LRH-1-mediated disease or condition; the kit includes written instructions or other indication that the composition is suitable or approved for administration to a mammal, e.g., a human, for a SF-1- or LRH-1-mediated disease or condition; the pharmaceutical composition is packaged in unit dose or single dose form, e.g., single dose pills, capsules, or the like.

In another related aspect, such binding compounds can be used in the preparation of a medicament for the treatment of a SF-1- or LRH-1-mediated disease or condition or a disease or condition in which modulation of one of those nuclear receptors provides a therapeutic benefit.

In another aspect, the invention concerns a method of treating or prophylaxis of a disease or condition in a mammal, e.g., a SF-1- or LRH-1-mediated disease or condition or a disease or condition in which modulation of one of those receptors provides a therapeutic benefit, by administering to the mammal a therapeutically effective amount of a compound that binds in the ligand binding domain pocket, a prodrug of such compound, or a pharmaceutically acceptable salt of such compound or prodrug. The compound can be alone or can be part of a pharmaceutical composition. In a further embodiment, the invention provides a method of treating or prophylaxis of a disease or condition in a mammal, e.g., a SF-1- or LRH-1-mediated disease or condition or a disease or condition in which modulation of one of those receptors provides a therapeutic benefit, by administering to the mammal a therapeutically effective amount of a compound that modulates the activity of SF-1 or LRH-1, a prodrug of such compound, or a pharmaceutically acceptable salt of such compound or prodrug. In a preferred embodiment, the SF-1 or LRH-1 modulator is designed according to a method for designing a ligand that binds to SF-1 or LRH-1 as described herein.

In aspects and embodiments involving treatment or prophylaxis of a disease or conditions, the disease or condition includes without limitation elevated cholesterol level, cancer, hepatitis virus infection, improper or risk of improper development.

As used herein, the terms “SF-1-mediated” and “LRH-1-mediated” disease or condition and like terms refer to a disease or condition in which the biological function of the specified receptor affects the development and/or course of the disease or condition, and/or in which modulation of the receptor alters the development, course, and/or symptoms of the disease or condition. Similarly, the phrases “SF-1 modulation provides a therapeutic benefit” and “LRH-1 modulation provides a therapeutic benefit” and the like indicate that modulation of the level of activity of the specified receptor in a subject indicates that such modulation reduces the severity and/or duration of the disease, reduces the likelihood or delays the onset of the disease or condition, and/or causes an improvement in one or more symptoms of the disease or condition.

In the present context, the term “therapeutically effective” indicates that the materials or amount of material are effective to prevent, alleviate, or ameliorate one or more symptoms of a disease or medical condition, and/or to prolong the survival of the subject being treated.

The term “pharmaceutically acceptable” indicates that the indicated material does not have properties that would cause a reasonably prudent medical practitioner to avoid administration of the material to a patient, taking into consideration the disease or conditions to be treated and the respective route of administration. For example, it is commonly required that such a material be essentially sterile, e.g., for injectibles.

“A pharmaceutically acceptable salt” is intended to mean a salt that retains the biological effectiveness of the free acids and bases of the specified compound and that is not biologically or otherwise unacceptable. A compound of the invention may possess a sufficiently acidic, a sufficiently basic, or both functional groups, and accordingly react with any of a number of inorganic or organic bases, and inorganic and organic acids, to form a pharmaceutically acceptable salt. Exemplary pharmaceutically acceptable salts include those salts prepared by reaction of the compounds of the present invention with a mineral or organic acid or an inorganic base, such as salts including sodium, chloride, sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, monohydrogenphosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates, butyne-1,4 dioates, hexyne-1,6-dioates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, hydroxybenzoates, methoxybenzoates, phthalates, sulfonates, xylenesulfonates, phenylacetates, phenylpropionates, phenylbutyrates, citrates, lactates, .gamma.-hydroxybutyrates, glycollates, tartrates, methane-sulfonates, propanesulfonates, naphthalene-1 -sulfonates, naphthalene-2-sulfonates, and mandelates.

The term “pharmaceutically acceptable metabolite” refers to a pharmacologically acceptable product, which may be an active product, produced through metabolism of a specified compound (or salt thereof) in the body of a subject or patient. Metabolites of a compound may be identified using routine techniques known in the art, and their activities determined using tests such as those described herein. For example, in some compounds, one or more alkoxy groups can be metabolized to hydroxyl groups while retaining pharmacologic activity and/or carboxyl groups can be esterified, e.g., glucuronidation. In some cases, there can be more than one metabolite, where an intermediate metabolite(s) is further metabolized to provide an active metabolite. For example, in some cases a derivative compound resulting from metabolic glucuronidation may be inactive or of low activity, and can be further metabolized to provide an active metabolite.

In another aspect, the invention provides a method for identifying structurally and energetically allowed sites on a binding compound for attachment of an additional component(s) by analyzing the orientation of the binding compound(s) in a SF-1 or LRH-1 binding site (e.g., by analyzing co-crystal structures), thereby identifying accessible sites on the compound for attachment of the additional component. In particular embodiments, the binding compound is a phospholipid, e.g., as described herein.

In various embodiments, the method involves calculating the change in binding energy on attachment of the additional component at one or more of the accessible sites; the orientation is determined by co-crystallography; the additional component includes a linker, a label such as a fluorophore, a solid phase material such as a gel, bead, plate, chip, or well.

In a related aspect, the invention provides a method for attaching a SF-1 or LRH-1 binding compound to an attachment component(s) without substantially altering the ability of the SF-1 or LRH-1 binding compound to bind SF-1 or LRH-1, by identifying energetically allowed sites for attachment of such an attachment component on a binding compound (e.g., as described for the preceding aspect), and attaching the binding compound or derivative thereof to the attachment component(s) at the energetically allowed site(s). In particular embodiments, the binding compound is a phospholipid as identified herein.

In various embodiments, the attachment component is a linker (which can be a traceless linker) for attachment to a solid phase medium, and the method also involves attaching the binding compound or derivative to a solid phase medium through the linker attached at the energetically allowed site; the binding compound or derivative thereof is synthesized on a linker attached to the solid phase medium; a plurality of compounds or derivatives are synthesized in combinatorial synthesis; the attachment of the compound(s) to the solid phase medium provides an affinity medium

In a related aspect, the invention provides a method for making an affinity matrix for SF-1 or LRH-1, where the method involves identifying energetically allowed sites on a SF-1 or LRH-1 binding compound for attachment to a solid phase matrix without substantially altering the ability of the SF-1 or LRH-1 binding compound to bind SF-1 or LRH-1; and attaching the binding compound to the solid phase matrix through the energetically allowed site. In particular embodiments, the binding compound is a phospholipid, e.g., as described herein.

Various embodiments are as described for attachment of an additional component above; identifying energetically allowed sites for attachment to a solid phase matrix is performed for at least 5, 10, 20, 30, 50, 80, or 100 different compounds; identifying energetically allowed sites is performed for molecular scaffolds or other SF-1 or LRH-1 binding compounds.

SF-1 homologs can be identified by their sequences, where exemplary reference sequence accession numbers are NM_—004959 (cDNA sequence for hSF-1) (SEQ ID NO:______) and NP_—004950 (protein sequence for hSF-1) (SEQ ID NO:______). One of ordinary skill in the art will recognize that sequence differences will exist due to allelic variation, and will also recognize that other animals, particularly other mammals, have corresponding receptors, which have been identified or can be readily identified using sequence alignment and confirmation of activity, which can also be used. A number of such sequences are readily available from GenBank. One of ordinary skill in the art will also recognize that modifications can be introduced in a SF-1 sequence without destroying receptor activity. Such modified receptors can also be used in the present invention, e.g., if the modifications do not alter the binding site conformation to the extent that the modified receptor lacks substantially normal ligand binding.

As used herein, the terms “steroidogenic factor 1 ligand binding domain polypeptide”, “SF-1 ligand binding domain polypeptide”, and “SF-1 LBD polypeptide” (and like terms) refer to a polypeptide that contains the site where phospholipid binding as identified herein occurs. For human SF-1, such domain generally includes residues P221 through T461 of NP_—004950. An exemplary such domain polypeptide is the polypeptide used for crystallization herein consisting of residues G219 to T461 of NP_—004950; additional examples include homologs and variants thereof.

LRH-1 homologs can be identified by their sequences, where exemplary reference sequence accession numbers are NM_—003822 (cDNA sequence for hLRH-1 isoform 2) (SEQ ID NO:______), NP_—003813 (protein sequence for HLRH-1 isoform 2) (SEQ ID NO:______), NM_—205860 (cDNA sequence for hLRH-1 isoform 1) (SEQ ID NO:______), and NP_—995582 (protein sequence for hLRH-1 isoform 1) (SEQ ID NO:______). One of ordinary skill in the art will recognize that sequence differences will exist due to allelic variation, and will also recognize that other animals, particularly other mammals, have corresponding receptors, which have been identified or can be readily identified using sequence alignment and confirmation of activity, which can also be used. A number of such sequences are readily available from GenBank. One of ordinary skill in the art will also recognize that modifications can be introduced in a LRH-1 sequence without destroying receptor activity. Such modified receptors can also be used in the present invention, e.g., if the modifications do not alter the binding site conformation to the extent that the modified receptor lacks substantially normal ligand binding.

As used herein, the terms “liver receptor homolog 1 ligand binding domain polypeptide”, “LRH-1 ligand binding domain polypeptide”, and “LRH-1 LBD polypeptide” (and like terms) refer to a polypeptide that contains the site where phospholipid binding as identified herein occurs. For human LRH-1, such domain generally includes residues A253 through A495 of NP_—003813 encoded by NM_—003822 (supra). For mouse LRH-1, such sequence generally extends from A318 through A560 of the protein encoded by NM_—030676 (SEQ ID NO:______). An exemplary such human domain polypeptide is the polypeptide used for crystallization herein consisting of residues S251-A495 of NP_—003822 (supra); additional examples include homologs and variants thereof.

As used herein in connection with the design or development of ligands, the term “bind” and “binding” and like terms refer to a non-covalent energetically favorable association between the specified molecules (i.e., the bound state has a lower free energy than the separated state, which can be measured calorimetrically). For binding to a target, the binding is at least selective, that is, the compound binds preferentially to a particular target or to members of a target family at a binding site, as compared to non-specific binding to unrelated proteins not having a similar binding site. For example, BSA is often used for evaluating or controlling non-specific binding. In addition, for an association to be regarded as binding, the decrease in free energy going from a separated state to the bound state must be sufficient so that the association is detectable in a biochemical assay suitable for the molecules involved.

By “assaying” is meant the creation of experimental conditions and the gathering of data regarding a particular result of the experimental conditions. For example, enzymes can be assayed based on their ability to act upon a detectable substrate. Likewise, for example, a compound or ligand can be assayed based on its ability to bind to a particular target molecule or molecules and/or to modulate an activity of a target molecule.

By “background signal” in reference to a binding assay is meant the signal that is recorded under standard conditions for the particular assay in the absence of a test compound, molecular scaffold, or ligand that binds to the target molecule. Persons of ordinary skill in the art will realize that accepted methods exist and are widely available for determining background signal.

When a decision is described as “based on” particular criteria, it is meant that the criteria selected are parameters of the decision and guide its outcome. A substantial change in the parameters is likely to result in a change in the decision.

By “binding site” is meant an area of a target molecule to which a ligand can bind non-covalently. Binding sites embody particular shapes and often contain multiple binding pockets present within the binding site. The particular shapes are often conserved within a class of molecules, such as a molecular family. Binding sites within a class also can contain conserved structures such as, for example, chemical moieties, the presence of a binding pocket, and/or an electrostatic charge at the binding site or some portion of the binding site, all of which can influence the shape of the binding site.

By “binding pocket” is meant a specific region of space within a binding site. A binding pocket is a particular space within a binding site at least partially bounded by target molecule atoms. Thus a binding pocket is a particular shape, indentation, or cavity in the binding site. Binding pockets can contain particular chemical groups or structures that are important in the non-covalent binding of another molecule such as, for example, groups that contribute to ionic, hydrogen bonding, van der Waals, or hydrophobic interactions between the molecules.

By “chemical structure” or “chemical substructure” is meant any definable atom or group of atoms that constitute a part of a molecule. Normally, chemical substructures of a scaffold or ligand can have a role in binding of the scaffold or ligand to a target molecule, or can influence the three-dimensional shape, electrostatic charge, and/or conformational properties of the scaffold or ligand.

By “orientation” in reference to a binding compound bound to a target molecule is meant the spatial relationship of the binding compound and at least some of its constituent atoms to the binding pocket and/or atoms of the target molecule at least partially defining the binding pocket.

In the context of target molecules in the present invention, the term “crystal” refers to an ordered complex of target molecule, such that the complex produces an X-ray diffraction pattern when placed in an X-ray beam. Thus, a “crystal” is distinguished from a disordered or partially ordered complex or aggregate of molecules that do not produce such a diffraction pattern. Preferably a crystal is of sufficient order and size to be useful for X-ray crystallography. A crystal may be formed only of target molecule (with solvent and ions) or may be a co-crystal of more than one molecule, for example, as a co-crystal of target molecule and binding compound, and/or of a complex of proteins (such as a holoenzyme).

In the context of this invention, unless otherwise specified, by “co-crystals” is meant an ordered complex of the compound, molecular scaffold, or ligand bound non-covalently to the target molecule that produces a diffraction pattern when placed in an X-ray beam. Preferably the co-crystal is in a form appropriate for analysis by X-ray or protein crystallography. In preferred embodiments the target molecule-ligand complex can be a protein-ligand complex.

By “clogP” is meant the calculated log P of a compound, “P” referring to the partition coefficient of the compound between a lipophilic and an aqueous phase, usually between octanol and water.

By “chemically tractable structures” is meant chemical structures, sub-structures, or sites on a molecule that can be covalently modified to produce a ligand with a more desirable property. The desirable property will depend on the needs of the particular situation. The property can be, for example, that the ligand binds with greater affinity to a target molecule, binds with more specificity, or binds to a larger or smaller number of target molecules in a molecular family, or other desirable properties as needs require.

In the context of compounds binding to a target, the term “greater affinity” indicates that the compound binds more tightly than a reference compound, or than the same compound in a reference condition, i.e., with a lower dissociation constant. In particular embodiments, the greater affinity is at least 2, 3, 4, 5, 8, 10, 50, 100, 200, 400, 500, 1000, or 10,000-fold greater affinity.

By “designing a ligand,” “preparing a ligand,” “discovering a ligand,” and like phrases is meant the process of considering relevant data (especially, but not limited to, any individual or combination of binding data, X-ray co-crystallography data, molecular weight, clogP, and the number of hydrogen bond donors and acceptors) and making decisions about advantages that can be achieved as a result of specific structural modifications to a molecule, and implementing those decisions. This process of gathering data and making decisions about structural modifications that can be advantageous, implementing those decisions, and determining the result can be repeated as many times as necessary to obtain a ligand with desired properties.

By “docking” is meant the process of attempting to fit a three-dimensional configuration of a binding pair member into a three-dimensional configuration of the binding site or binding pocket of the partner binding pair member, which can be a protein, and determining the extent to which a fit is obtained. The extent to which a fit is obtained can depend on the amount of void volume in the resulting binding pair complex (or target molecule-ligand complex). The configuration can be physical or a representative configuration of the binding pair member, e.g., an in silico representation or other model.

By binding with “low affinity” is meant binding to the target molecule with a dissociation constant (K_D) of greater than 1 μM under standard conditions. In particular cases, low affinity binding is in a range of 1 μM-10 mM, 1 μM-1 mM, 1 μM-500 μM, 1 μM-200 μM, 1 μM-100 μM. By binding with “very low affinity” is meant binding with a K_D of above about 100 μM under standard conditions, e.g., in a range of 100 μM-1 mM, 100 μM-500 μM, 100 μM-200 μM. By binding with “extremely low affinity” is meant binding at a K_D of above about 1 mM under standard conditions. By “moderate affinity” is meant binding with a K_D of from about 200 nM to about 1 μM under standard conditions. By “moderately high affinity” is meant binding at a K_D of from about 1 nM to about 200 nM. By binding at “high affinity” is meant binding at a K_D of below about 1 nM under standard conditions. For example, low affinity binding can occur because of a poorer fit into the binding site of the target molecule or because of a smaller number of non-covalent bonds, or weaker covalent bonds present to cause binding of the scaffold or ligand to the binding site of the target molecule relative to instances where higher affinity binding occurs. The standard conditions for binding are at pH 7.2 at 37° C. for one hour. For example, 100 μl/well can be used in HEPES 50 mM buffer at pH 7.2, NaCl 15 mM, ATP 2 μM, and bovine serum albumin 1 ug/well, 37° C. for one hour.

Binding compounds can also be characterized by their effect on the activity of the target molecule. Thus, a “low activity” compound has an inhibitory concentration (IC₅₀) (for inhibitors or antagonists) or effective concentration (EC₅₀) (applicable to agonists) of greater than 1 μM under standard conditions. By “very low activity” is meant an IC₅₀ or EC₅₀ of above 100 μM under standard conditions. By “extremely low activity” is meant an IC₅₀ or EC₅₀ of above 1 mM under standard conditions. By “moderate activity” is meant an IC₅₀ or EC₅₀ of 200 nM to 1 μM under standard conditions. By “moderately high activity” is meant an IC₅₀ or EC₅₀ of 1 nM to 200 nM. By “high activity” is meant an IC₅₀ or EC₅₀ of below 1 nM under standard conditions. The IC₅₀ (or EC₅₀) is defined as the concentration of compound at which 50% of the activity of the target molecule (e.g., enzyme or other protein) activity being measured is lost (or gained) relative to activity when no compound is present. Activity can be measured using methods known to those of ordinary skill in the art, e.g., by measuring any detectable product or signal produced by occurrence of an enzymatic reaction, or other activity by a protein being measured. For SF-1 and LRH-1 agonists and antagonists, activities can be determined as described in the Examples, or using other such assay methods as described herein or known in the art.

By “molecular scaffold” or “scaffold” is meant a small target binding molecule to which one or more additional chemical moieties can be covalently attached, modified, or eliminated to form a plurality of molecules with common structural elements. The moieties can include, but are not limited to, a halogen atom, a hydroxyl group, a methyl group, a nitro group, a carboxyl group, or any other type of molecular group including, but not limited to, those recited in this application. Molecular scaffolds bind to at least one target molecule with low or very low affinity and/or bind to a plurality of molecules in a target family (e.g., protein family), and the target molecule is preferably an enzyme, receptor, or other protein. Preferred characteristics of a scaffold include molecular weight of less than about 350 daltons; binding at a target molecule binding site such that one or more substituents on the scaffold are situated in binding pockets in the target molecule binding site; having chemically tractable structures that can be chemically modified, particularly by synthetic reactions, so that a combinatorial library can be easily constructed; having chemical positions where moieties can be attached that do not interfere with binding of the scaffold to a protein binding site, such that the scaffold or library members can be modified to form ligands, to achieve additional desirable characteristics, e.g., enabling the ligand to be actively transported into cells and/or to specific organs, or enabling the ligand to be attached to a chromatography column for additional analysis. Thus, a molecular scaffold is a small, identified target binding molecule prior to modification to improve binding affinity and/or specificity, or other pharmacalogic properties.

The term “scaffold core” refers to the core structure of a molecular scaffold onto which various substituents can be attached. Thus, for a number of scaffold molecules of a particular chemical class, the scaffold core is common to all the scaffold molecules. In many cases, the scaffold core will consist of or include one or more ring structures.

The term “scaffold group” refers to a set of compounds that share a scaffold core and thus can all be regarded as derivatives of one scaffold molecule.

By “molecular family” is meant groups of molecules classed together based on structural and/or functional similarities. Examples of molecular families include proteins, enzymes, polypeptides, receptor molecules, oligosaccharides, nucleic acids, DNA, RNA, etc. Thus, for example, a protein family is a molecular family. Molecules can also be classed together into a family based on, for example, homology. The person of ordinary skill in the art will realize many other molecules that can be classified as members of a molecular family based on similarities in chemical structure or biological function.

By “protein-ligand complex” or “co-complex” is meant a protein and ligand bound non-covalently together.

By “protein” is meant a polymer of amino acids. The amino acids can be naturally or non-naturally occurring. Proteins can also contain adaptations, such as being glycosylated, phosphorylated, or other common modifications.

By “protein family” is meant a classification of proteins based on structural and/or functional similarities. For example, kinases, phosphatases, proteases, and similar groupings of proteins are protein families. Proteins can be grouped into a protein family based on having one or more protein folds in common, a substantial similarity in shape among folds of the proteins, homology, or based on having a common function. In many cases, smaller families will be specified, e.g., the nuclear receptor family or the NR5A nuclear receptor family.

“Protein folds” are 3-dimensional shapes exhibited by the protein and defined by the existence, number, and location in the protein of alpha helices, beta-sheets, and loops, i.e., the basic secondary structures of protein molecules. Folds can be, for example, domains or partial domains of a particular protein.

By “ring structure” is meant a molecule having a chemical ring or sub-structure that is a chemical ring. In most cases, ring structures will be carbocyclic or heterocyclic rings. The chemical ring may be, but is not limited to, a phenyl ring, aryl ring, pyrrole ring, imidazole, pyridine, purine, or any ring structure.

By “specific biochemical effect” is meant a therapeutically significant biochemical change in a biological system causing a detectable result. This specific biochemical effect can be, for example, the inhibition or activation of an enzyme, the inhibition or activation of a protein that binds to a desired target, or similar types of changes in the body's biochemistry. The specific biochemical effect can cause alleviation of symptoms of a disease or condition or another desirable effect. The detectable result can also be detected through an intermediate step.

By “standard conditions” is meant conditions under which an assay is performed to obtain scientifically meaningful data. Standard conditions are dependent on the particular assay, and can be generally subjective. Normally the standard conditions of an assay will be those conditions that are optimal for obtaining useful data from the particular assay. The standard conditions will generally minimize background signal and maximize the signal sought to be detected.

By “standard deviation” is meant the square root of the variance. The variance is a measure of how spread out a distribution is. It is computed as the average squared deviation of each number from its mean. For example, for the numbers 1, 2, and 3, the mean is 2 and the variance is 0.667; viz, ${\sigma }^2=\frac{{\left(1-2\right)}^2+{\left(2-2\right)}^2+{\left(3-2\right)}^2}{3}=0.667.$

By a “set” of compounds is meant a collection of compounds. The compounds may or may not be structurally related.

In the context of this invention, by “target molecule” is meant a molecule that a compound, molecular scaffold, or ligand is being assayed for binding to. The target molecule has an activity that binding of the molecular scaffold or ligand to the target molecule will alter or change. The binding of the compound, scaffold, or ligand to the target molecule can preferably cause a specific biochemical effect when it occurs in a biological system. A “biological system” includes, but is not limited to, a living system such as a human, animal, plant, or insect. In most but not all cases, the target molecule will be a protein or nucleic acid molecule.

By “pharmacophore” is meant a representation of molecular features that are considered to be responsible for a desired activity, such as interacting or binding with a receptor. A pharmacophore can include 3-dimensional (hydrophobic groups, charged/ionizable groups, hydrogen bond donors/acceptors), 2D (substructures), and ID (physical or biological) properties.

As used herein in connection with numerical values, the terms “approximately” and “about” mean ±10% of the indicated value.

Additional aspects and embodiments will be apparent from the following Detailed Description and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A-1D schematically shows the human SF-1 and LRH-1 LBD structures complexed with phospholipid and coactivator peptide. A) The human SF-1 LBD (ribbon model), with phospholipid ligand (spherical model), and NCoA-2 coactivator peptide (ribbon model, dark, surrounded by H3, H4 and H12). B) The human LRH-1 LBD, with phospholipid ligand and NCoA-2 coactivator peptides (coded as in (A)). Note that two NCoA-2 peptides bind to each human LRH-1 molecule, one at the canonical activation function surface (H3, H4 and H12), and the other at the site formed by H2, H3 and the β-sheet (lower right corner of figure). C) Residues of the human SF-1 ligand binding pocket (stick models), showing salt-bridge and hydrogen-bonds (dotted lines) to the PE (stick models). The mesh indicates an unbiased 2Fo-Fc map covering the ligand. H2 and H3 are truncated to show the pocket features. D) Residues of the human LRH-1 ligand binding pocket, depicted as in (C), showing interactions with the PG.

FIGS. 2A-2B schematically shows LBD binding pocket residues that interact with ligand for human SF-1 and LRH-1. Residues making hydrophobic contacts are selected generally using a 4.1 A distance cutoff between carbon atoms. A) human SF-1 contacting PE. B) human LRH-1 contacting PG.

FIGS. 3A-3B shows that the human SF-1 and LRH-1 LBD pocket contours filled with ligand, except for a conserved polar pocket. A) The human SF-1 LBD pocket surface contour (represented by the mesh), calculated using a 1.4A radius ball (Kleywegt, 1994, Acta Crystallogr D Biol Crystallogr 50, 178-85), with a volume of ˜550 ų. Shown are the SF-1 LBD and coactivator peptide mainchains (ribbon), and the PE molecule (molecular surface). The amine of the PE extends toward the exterior of the pocket, and thus extends outside the mesh. Water molecules (dark spheres) are present in a polar pocket. B) The human LRH-1 ligand pocket surface contour, with a volume of 510 ų, with PG molecule, depicted as in (A).

FIGS. 4A-4C compares the human SF-1 and LRH-1 structures with the mouse LRH-1 structure. A) The phosphate group of PE interacts with K440, Y436, and G341 of the KYG triad in human SF-1. B) The phosphate group of PG interacts with K474, Y470, and G375 of the KYG triad in human LHR-1. C) E440 in the apo mouse LRH-1 mimics the phosphate group interactions. Only the residues of the phosphate-binding triad and the polar portions of the phospholipids are shown (sticks).

FIG. 5 shows an alignment of various NR5A subfamily LBD sequences. The human SF-1 sequence extends from P221 through T461 [NP_—004950 (SEQ ID NO:______) encoded by NM_—004959 (SEQ ID NO:______)]; the human LRH-1 sequence extends from A253 through A495 [NP_—003813 (SEQ ID NO:______) encoded by NM_—003822 (SEQ ID NO:______)]; and the mouse LRH-1 sequence extends from A318 through A560 [encoded by NM_—030676 (SEQ ID NO:______)]. The secondary structure features are indicated above the sequences. Shading indicates residues identical in at least 11 of 12 aligned sequences. The pocket residues contacting the ligands are indicated by asterisk. The surface residues constituting the canonical AF-2 surface are indicated by the number 1, and the novel second coactivator-binding site by the number 2. The four phosphate-nucleating residues are indicated by rectangles.

FIGS. 6A-6D shows mass spectral analysis of lipids bound to human SF-1 and LRH-1 LBD proteins purified from E. coli: A) wild-type SF-1, B) SF-1/Y436F-K440A, C) wild-type LRH-1, and D) LRH-1/Y470F-K474A. The analyses were performed in negative mode. PE-12:0 (50 pmol) was mixed with 50 pmol of each LBD protein before extraction, giving the m/z=578 standard peak.

FIGS. 7A-7B shows PE dose-dependent increase in coactivator recruitment to the human SF-1 in vitro. A) PE-18:3 (50 μM 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine) but not palmitic acid (50 μM) activates wild-type SF-1 to bind NCoA1 as measured by AlphaScreen. B) Dose-dependent NCoA1 recruitment to SF-1 by PE-18:3. Error bars indicate the standard deviations. The graphs shown are representative of three experiments.

FIGS. 8A-8D shows the effects of pocket residue mutations on human SF-1 and LRH-1 functions in HEK293T cells. A) LRH-1 LBD activity tested as GAL4-DBD fusions acting at a GAL4-responsive LUC reporter gene. The mutations tested include residues A303, L378, A467, Y470 and K474. B) SF-1 LBD activity tested as GAL4-DBD fusions. The mutations tested include residues A269, G341, L344, A433, Y436, and K440. C) Western blot analysis of cells after transfection with vectors encoding GAL4-DBD-LRH-1-LBD fusion proteins using anti-GAL4-DBD antibody. D) Western blot analysis of GAL4-DBD-SF-1-LBD fusion proteins. Error bars indicate the standard deviations. The graphs shown are representative of three independent experiments

DETAILED DESCRIPTION OF THE INVENTION

Table 1 provides crystal properties for SF-1 and LRH-1 determined as described in the Examples.

Table 2 provides atomic coordinates for SF1 ligand binding domain polypeptide crystal co-crystallized with a phospholipid ligand as described herein. In this table, the various columns have the following content, beginning with the left-most column:

• • ATOM: Refers to the relevant moiety for the table row.
  • Atom number: Refers to the arbitrary atom number designation within the coordinate table.
  • Atom Name: Identifier for the atom present at the particular coordinates.
  • Residue Name: Identifier for the residue of the atom for the table row.
  • Chain ID: Chain ID refers to one monomer of the protein in the crystal, e.g., chain “A”, or to other compound present in the crystal, e.g., HOH for water, and L for a ligand or binding compound. Multiple copies of the protein monomers will have different chain Ids.
  • Residue Number: The amino acid residue number in the chain.
  • X, Y, Z: Respectively are the X, Y, and Z coordinate values.
  • Occupancy: Describes the fraction of time the atom is observed in the crystal. For example, occupancy=1 means that the atom is present all the time; occupancy=0.5 indicates that the atom is present in the location 50% of the time.
  • B-factor: A measure of the thermal motion of the atom.
  • Element: Identifier for the element.

Table 3 provides atomic coordinates for LRH1 ligand binding domain polypeptide crystal co-crystallized with a phospholipid ligand as described herein. Table entries are as in Table 2.

Table 4 provides the reference nucleotide sequence for human SF-1 cDNA and the amino acid sequence of the encoded SF-1 polypeptide.

Table 5 provides the reference nucleotide sequence for human LRH-1 cDNA isoform 2 and the corresponding amino acid sequence of the encoded LRH-1 polypeptide, and the reference nucleotide sequence for human LRH-1 cDNA isoform 1 and the encoded amino sequence of the corresponding LRH-1 polypeptide. Additionally, Table 5 provides the nucleotide sequence of mouse LRH-1.

I. General

Steroidogenic factor-1 (SF-1, ADFBP, ELP, NR5A1) and liver receptor homologue-1 (LRH-1, FTF, HB1F, CPF, NR5A2) are ‘orphan’ members of the nuclear receptor family for which no natural ligands have been identified (Fayard et al., Trends Cell Biol., 2004, 14, 250-60; Val et al., Nucl Recept. 2003, 1, 8. These two factors are related to fushi tarazu factor-1 (FTZ-F1) of Drosophila, and comprise the NR5A branch of the nuclear receptor gene family in man. Functional similarities follow their sequence similarities, as SF-1 and LRH-1 both function as monomers (Li et al., J. Biol. Chem., 1998, 273:29022-29031) to regulate genes at similar response elements.

However, SF-1 is expressed predominantly in the adrenals, testis, ventromedial hypothalamus, and pituitary, and regulates genes coordinating adrenal and sex steroid syntheses (Val et al., Nucl. Recept., 2003, 1:8), while LRH-1 is expressed in liver, intestine, and pancreas, and act on genes coordinating bile acid synthesis, enterohepatic circulation, and absorption. (Fayard et al., Trends Cell Biol., 2004, 14:250-260.) Gene knockout and heterozygous loss-of-function studies show that both SF-1 and LRH-1 are essential during embryogenesis for normal development of the organs in which they are expressed and mammalian cell transfection experiments indicate that SF-1 and LRH-1 function as obligate factors for their target genes, acting apparently constitutively. (Pare et al., J. Biol. Chem., 2004, 279, 21206-21216; Zhao et al., Mol. Cell Endocrinol., 2001, 185:27-32; Sadovsky et al., Proc. Natl. Acad. Sci. USA, 1995, 92:10939-10943; Shinoda et al., Dev. Dyn., 1995, 204:22-29; Luo et al., Cell, 1994, 77:481-490; Achermann et al., J. Clin. Endocrinol Metab., 2002, 87:1829-1833.) The mouse LRH-1 structure contains a cavity available for potential ligands, but mutations to fill this cavity did not diminish activity, supporting a model of constitutive, ligand-independent function. (Sablin et al., Mol. Cell, 2003, 11:1575-1585.)

X-ray structures of the ligand-binding domains of human SF-1 and human LRH-1 have been determined. Additionally, it has been discovered that each structure includes a phospholipid ligand. The receptor-ligand interactions indicate that as a class, phospholipids are well-suited as ligands to stabilize the active conformation, a conclusion supported by specific structure-guided mutational analyses. Coactivator-derived peptides included in the co-crystallization experiments bind not only to the canonical activation-function (AF-2) surface of both SF-1 and LRH-1, but in the case of the LRH-1, also to a novel second site. These structures indicate a link between phospholipids and cholesterol regulation, and further, introduce possible new modes of co-regulator recruitment unique to the NR5A branch of the nuclear receptor superfamily.

The SF-1 and LRH-1 LBD structures adopt an α-helical sandwich architecture composed of 12 α-helices and one β-hairpin (FIGS. 1A and 1B; Table 1). This protein fold is prototypical of the nuclear receptor superfamily, enclosing a cavity surrounded by several helices and the β-hairpin. (Wurtz et al., Nat. Struct. Biol., 1996, 3, 87-94; Wagner et al., Nature, 1995, 378:690-7.) As observed in mouse LRH-1 (Sablin et al., Mol. Cell, 2003, 11:1575-85.), both the human SF-1 and LRH-1 structures contain a H2 that forms an additional sandwich layer unique to the NR5A family, following a path across and outside of H3 (FIG. 1). This outside path creates an opening to the pocket through a channel formed by H3, H6, H11, and the β-hairpin.

In the SF-1 crystal there are two molecules in the crystallographic asymmetric unit, each delineating residues P221 through K459, one completely and the other incompletely, lacking residues Q249 through R255 in the flexible loop after H2. In the LRH-1 crystal there is one molecule in the asymmetric unit, delineating residues A253 through Q284 and K292 through A492, but also lacking residues 285-291 in the loop after H2. Consistent with reports that SF-1 and LRH-1 function as monomers, none of the crystallization contacts form through the canonical H10 dimerization surface used by other NRs. (Gampe et al., 2000, Mol Cell 5, 545-55; Bourguet et al., 2000, Mol Cell 5, 289-98.)

Strikingly, as indicated above, both structures reveal buried phospholipid molecules derived from the E. coli expression host. Based on well-defined electron density, the molecule in SF-1 can be identified as a phosphatidylethanolamine, and in LRH-1, as a phosphatidylglycerol-phosphoglycerol. In each structure the two acyl chains consist of a palmitic acid (16:0) attached to C1 and apalmitoleic acid (16:1,Δ9) to C2 of the glycerol backbone. The Δ9-cis unsaturation of the palmitoleic acid causes a bend that allows the lipid tails to compact around each other. The polar headgroups of the bound phospholipids reach outside the pocket through the channel formed by H3, H6, H11, and the β-hairpin. In the SF-1 structure the ethanolamine interacts through water molecules to E445 in the loop between H11 and H12. In the LRH-1 structure the glycerol-phosphoglycerol headgroup wraps between the N-terminal end of H7 and the C-terminal end of H11, with the glycerol and phosphate oxygen atoms forming hydrogen bonds with A366 and T377 (H7) and Y473 (H11).

Ligands derived from the expression host have been observed previously in other orphan nuclear receptor structures. In some cases the ligand appears to fill the ligand-binding pocket, making multiple interactions with the protein, suggesting biological relevance. (Kallen et al., 2002, Structure (Camb) 10, 1697-707; Dhe-Paganon et al., 2002, J. Biol. Chem. 277, 37973-6; Wisely et al., 2002, Structure (Camb) 10, 1225-34.) In other cases the ligand is loosely-fit, making interactions with nonconserved residues within the pocket, suggesting these as possible pseudo-ligands. (Stehlin et al., 2001, Embo J. 20, 5822-31.) Phosphatidylethanolamine has also been observed in the structures of the insect nuclear receptor, ultraspiracle, adopting the inactive conformation. (Clayton et al., 2001, Proc Natl Acad Sci USA 98, 1549-54; Billas et al., 2003, Nature 426, 91-6.) The lipids extracted from SF-1 and LRH-1 proteins used here contain several mass spectral peaks that can be interpreted as phosphatidylethanolamine and phosphatidylglycerol, with acyl chain lengths varying from 14 to 18, and of varying saturation. However, the glycerolipid tails of the ligands observed in both the SF-1 and LRH-1 crystal structures are the same, and make extensive van der Waals contacts with hydrophobic residues lining the inside wall of the pocket (FIGS. 1C,D and 2A,B), stabilizing these proteins in the active conformation directly though contacts with the C-terminal activation helix, H12, as well as through hydrophobic interactions with H3 and H 11 that support H12. The total volumes of the LRH-1 and SF-1 cavities are 510 and 550 ų respectively (FIG. 3A,B), and with the exception of a polar corner (˜25 ų ) that the ligand does not enter, most of the remaining cavity volumes are occupied by the phospholipid ligands.

Both SF-1 and LRH-1 make interactions with the phosphate group of the phospholipid that appear likely to affect both ligand affinity and selectivity, and receptor activation. The phosphate lies partially buried, stabilized by forming a salt bridge with a Lys from H11 (K440 in SF-1; K474 in LRH-1), and a hydrogen bond with a Tyr from H 11 (Y436 in SF-1; Y470 in LRH-1) (FIG. 2A,B). The phosphate also makes a hydrogen bond with the backbone amide nitrogen of a Gly from H6 (G341 in SF-1; G375 in LRH-1), thus serving to nucleate the C-terminal ends of H6 and H11 and close off the pocket (FIG. 4A, left and middle). This specific phosphate-binding triad of residues, together with the pocket residues contacting the lipid tails, are highly conserved comparing human LRH-1 and human SF-1, with nineteen of the twenty-two residues identical (FIG. 4B, asterisks). This conservation extends to other species, with seventeen of the twenty-two residues identical comparing the sequences of SF-1 from human, mouse, kangaroo, chicken, turtle, and frog, and LRH-1 from human, chicken, and frog (FIG. 4B), suggesting that SF-1 and LRH-1 from these species recognize similar ligands, and supporting a role for phospholipids as a relevant class of ligand.

Curiously, in the mouse LRH-1 sequence a Glu (residue 440 in mouse) replaces the Gly of the phosphate-binding triad of human LRH-1. In the structure of the mouse LRH-1 this Glu mimics the nucleating interactions with the Lys and Tyr of H11 that the phospholipid phosphorous group makes in other structures of human LRH-1 and SF-1 (FIG. 4C). Just inside the pocket of the human structures a conserved Leu (L344 in SF-1; L378 in LRH-1) exists as Phe in mouse LRH-1 (F443 in mouse LRH-1), helping to bring the N-terminal end of H3 close to H6 and H11 (FIG. 4B,C). Together these two residue changes in the mouse LRH-1 appear to maintain the pocket in a more closed conformation, less able to recognize phospholipid ligands. Of the seventeen residues identical comparing most of the branches of SF-1 and LRH-1, three are changed in the mouse, suggesting mouse is an outlier in its mode of ligand recognition (FIG. 4D). Regulation of bile metabolism differs in man and rodents, that can be partly explained by differences in regulation of CYP7A by the liver-X receptor; the structural differences between mouse and human LRH-1 may also contribute to the species differences. (Goodwin et al., 2003, Mol Endocrinol 17, 386-94.)

When tested for coactivator binding in vitro, both SF-1 and LRH-1 proteins made in E. coli demonstrated constitutive activity for coactivator recruitment. Addition of phospholipids to these preparations showed little increase in signal, consistent with the preexisting binding of phospholipids. However, the lipids binding SF-1 could be partially extracted by washing the proteins with liposomes prepared using phosphatidylcholine (C22 acyl chain length). It was reasoned that such liposomes with long acyl chains could act as a sink for extracted lipids, without binding the receptors themselves. After such washing the coactivator binding by SF-1 was diminished, but could be activated by the addition of phosphatidylethanolamine (FIG. 5A). The PE 16:0 16:1 observed in the crystal structure is unavailable commercially, so it could not be readily obtained. However PE 18:3 18:3 gave a dose-dependent increase in binding of SRC1. The calculated EC₅₀ in this experiment was 30 μM, comparable to that reported for association of bile acids to their cognate nuclear receptor, FXR. (Parks et al., Science, 1999, 284:1365-8; Makishima et al., Science, 1999, 284:1362-5.)

A selection of structure-guided mutations of SF-1 and LRH-1 pockets were constructed (FIG. 5B) to test their effects on function of these receptors in transfected mammalian cells. When the SF-1 or LRH-1 LBDs were fused to the DNA-binding domain (DBD) of GAL4, strong activation in transfected cells of a reporter gene containing GAL4-responsive elements was observed (FIG. 5C). Mutations of the SF-1 ligand binding pocket, including A269F, G341E, L344F, G341E/L344F and A433F, diminished this activity 68-97% (FIG. 5C) indicating that ligands likely are required for full activation of human SF-1. Mutations of the phosphate-binding residues Y436 and K440 in SF-1 showed the most dramatic lowering effect on activity (99%, FIG. 5C), which is the most suggestive that phospholipids likely act as ligands for SF-1. These mutations are located in the channel to the pocket, and therefore would not interfere with ligands that bind more deeply in the pocket.

Six pocket mutations, A303F, A303M, L378F, A467F, A467M, and Y470F/K474A were tested in LRH-1 (FIG. 5D), and found to diminish activity 16-42% (FIG. 5D), indicating that ligands are likely also required for full activation of human LRH-1. However the equivalent mutations were weaker comparing human LRH-1 and SF-1, suggesting human LRH-1 has a more pronounced apparent constitutive activity, as observed with the mouse LRH-1. The pocket mutants of SF-1 were not observed to alter the expression or stability of these LBDs when tested in E. coli; the expression of each was the same as WT (˜20 mg per liter culture). These data indicate that SF-1 and LRH-1 do not require ligands as constitutive structural cofactors, as has been suggested for another nuclear receptor, HNF4, but rather behave as expected for ligand-regulated receptors.

Both the SF-1 and LRH-1 structures were obtained as complexes with a peptide matching the NR-box 3 of the coactivator NCOA2 (TIF2). The coactivator peptide bound the canonical AF-2 surface through specific sidechain interactions (FIG. 1A,B). (Feng et al., Science, 1998, 280:1747-9; Nolte et al., Nature, 1998, 395:137-43; Marimuthu et al., Mol. Endocrinol., 2002, 16:271-86.) H12 adopts the active AF-2 conformation, and hydrophobic residues from H3 (SF-1: F273, 1274, V277 and LRH-1: L307, F308, V311), H4 (SF-1: V291, M295, L298 and LRH-1:V325, M329, L332 ), and H12 (SF-1: L451, M455 and LRH-1: L485, M489), form a grooved binding surface complementary to the hydrophobic LXXLL motif of NCOA2. Charged residues from H3 (SF-1:R281 and LRH-1: R315) and H12 (SF-1:E454 and LRH-1: E488) form a charge-clamp with the bound peptide backbone. In other crystallization experiments, a synthetic peptide matching the NR-box 2 peptide from another coactivator NCOA1 (SRC-1) was co-crystallized with the SF-1, and found to interact with the same surface.

Surprisingly, in the LRH-1 structure a coactivator peptide was also bound to a novel second site on the surface formed by residues of H2 (M277, L280), H3 (T295, L298, M299, and M302), the β-hairpin (V365), and H6 (1369) that form a hydrophobic patch complementary to the LRYLL motif of the peptide. The hydrophobic patch also includes atoms of the C1 acyl chain of the phospholipid, in coordination with the methyl group of T295, suggesting a direct participation by the ligand in recruitment of coactivator to this site. Unlike the canonical binding site, there is no strong charge-clamp to the coactivator peptide dipole in the second binding site. However the Tyr of the peptide forms a hydrogen bond with D366 of the β-hairpin, suggesting the residue at the second X of the LXXLL motif will influence the coactivator selectivity. Although no second peptide was bound in the SF-1 crystal, the surface features of SF-1 are similar enough with LRH-1 to suggest that SF-1 could also bind coactivators at this site. The difference in results may be due to crystal packing differences; in the LRH-1 crystal the second peptide is located at a favorable crystal packing interface, but in the SF-1 crystal the packing interferes with peptide binding to this site.

Mutated forms of LRH-1 were engineered for analysis of the novel second coactivator binding site observed in the structure (FIG. 5E,F). Binding of coactivator fragments to LRH-1 is strong enough to observe easily through co-expression of the two proteins in E. coli, followed by metal affinity purification of the His-tagged LRH-1 (FIG. 5G,H)). Compared to the LRH-1-WT protein, a mutation of the canonical coactivator site, E488K, caused 70% decrease in coactivator fragment binding (FIG. 5G). However, secondary mutations of the residues that define the novel coactivator-binding surface (D366A, and 1369Y) blocked the remainder of the binding (FIG. 5H). When tested singly, the mutations of the second site were weaker than the mutation of the canonical site in lowering coactivator binding (FIG. 5G). The coactivator site mutants of SF-1 and LRH-1 LBDs were tested as GAL4 DBD fusions in mammalian transfection experiments, with results supporting a functional participation of the novel site to recruit coactivators.

In LRH-1 mutation of the canonical site gave strong reductions in activity (96%), suggesting that under these conditions the canonical site is dominant (FIG. 5I). However mutations of the novel site, M277K and D366A, also lowered activity (40%, FIG. 5I). In SF-1 mutation of the canonical site gave a partial lowering (48%, FIG. 5J); mutations of the novel site, L245K and E332A, gave similar reductions in activity (50% and 41%, FIG. 5J), suggesting a secondary coactivator-binding site also functions on SF-1. It has been reported that some co-regulators, including DAX1 and PROX1, are relatively independent of the canonical coactivator site on the NR5A sub-family. (Marimuthu et al., 2002, Mol Endocrinol 16, 271-86; Crawford et al., Mol. Endocrinol., 1997, 11:1626-35; Suzuki et al., Mol. Cell Biol., 2003, 23:238-49; Qin et al., Mol Endocrinol., 2004, 18:2424-2439.) This novel second site may be a site of binding inferred by these studies. Thus, the NR5A subfamily, functioning as monomers, may require two coactivator-binding sites, compared to other NRs that function as homo- or hetero-dimers, requiring one each. Alternatively, the two sites may bind independently to two coregulators, thereby integrating multiple signals.

In addition to the structural and functional analysis indicated above, phospholipids as ligands for SF-1 and LRH-1 is also reasonable based on mechanistic rationale. Both receptors regulate genes important for cholesterol metabolism. Phospholipid composition must be balanced with cholesterol content in membranes to maintain proper membrane fluidity, and therefore regulation of genes for cholesterol metabolism by a phospholipid signal makes sense. (McConnell & Radhakrishnan, Biochim Biophys Acta 2003, 1610:159-73; Quinn, Prog. Biophys. Mol. Biol., 1981, 38:1-104.) This may be especially true for cells of the adrenal and liver that are specialized for high flux and turnover of cholesterol. (Jefcoate, J. Clin Invest., 2002, 110:881-90.) In fact, a major source of phospholipid in such cells derives from the blood lipoprotein particles, that are known to carry large amounts of phospholipid in addition to cholesterol, so a source of phospholipid signals may derive from these particles. (Vance & Vance, J. Biol. Chem., 1986, 261:4486-91; Wang et al., J. Biol. Chem., 2003, 278:42906-12.) Whether derived from the blood or from intracellular synthesis, phospholipid composition is known to vary with nutrition, exercise, pregnancy, and other metabolic and hormonal status, and such changes could lead to variable NR5A activation, or conceivably, inhibition. (Clamp et al., Lipids, 1997, 32:179-84; Tranquilli et al., Acta Obstet. Gynec., Scand., 2004, 83:443-8; Imai et al., Biochem. Pharmacol., 1999, 58:925-33; Lin et al., J. Lipid Res., 2004, 45:529-35; Andersson et al., Am. J Physiol., 1998, 274:E432-8.) Therefore ligand regulation of these receptors should be considered within a general context of lipid homeostasis. It is noteworthy that cholesterol and phosphatidylethanolamine have been documented to regulate, in mammals and insects respectively, the post-translational processing of the nuclear factor, SREBP, that is important in the regulation of many genes of lipid homeostasis, in some cases cooperating with SF-1. (Wang et al., Cell, 1994, 77:53-62; Dobrosotskaya et al., Science, 2002, 296:879-83; Lopez & McLean, Endocrinology, 1999, 140:5669-81.) Thus the identification of phospholipid as a class of molecule regulating SF-1 and LRH-1, provided by the current X-ray structures provides target structures and allows the identification and development of modulators of these receptors.

II. Applications of SF1 and LRH1 Modulators and Exemplary Assay Methods

A. LRH-1

Compounds that modulate LRH-1 activity can have beneficial effects in the management of cholesterol excess. Thus, activators of LRH-1 would lower circulating cholesterol levels. This is because LRH-1 regulates several genes involved in cholesterol homeostasis, including: CYP7A1, the rate-limiting enzyme for conversion of cholesterol to bile acids (Wang et al., J. Lipid Res., 1996, 37:1831-41; Nitta et al., Proc. Natl. Acad. Sci. USA, 1999, 96:6660-5), the scavenger receptor class B type I (SR-BI), that mediates selective cellular cholesterol uptake from high-density lipoproteins (HDLs) (Schoonjans et al., EMBO Rep., 2002, 3:1181-7), and cholesterol ester transfer protein (CETP), important for remodeling of HDL particles (Luo et al., J. Biol. Chem. , 2001, 276:24767-73).

A second indication for LRH-1 modulators is in treatment or management of hepatitis virus infection. Hepatitis B virus is the major cause of acute and chronic hepatitis, and is associated with development of hepatocellular carcinoma. Certain hepatitus virus genes are stimulated by LRH-1. (Li et al., J. Biol. Chem., 1998, 273, 29022-31; (Gilbert et al., J. Virol., 2000, 74, 5032-9.) Thus inhibitors or modulators of LRH-1 would limit the functions of the hepatitis virus, with beneficial effects on infected individuals.

LRH-1 also regulates other genes important for cholesterol homeostasis, including:

• • Apical sodium-dependent bile acid transporter (ASBT), important for bile acid recycling (Chen, F., et al., J. Biol. Chem., 2003. 278:19909-19916);
  • Sterol 12alpha-hydroxylase (CYP8B), involved in synthesis of the more polar bile acids, such as cholic acid (del Castillo-Olivares, A. & G. Gil, J. Biol. Chem., 2000. 275:17793-17799);
  • Scavenger receptor class B type I (SR-BI), mediates selective cellular cholesterol uptake from high-density lipoproteins (HDLs), important in the reverse cholesterol transport process (Schoonjans, K., et al., EMBO Rep, 2002., 3:1181-1187);
  • Alpha-fetoprotein, an early marker of fetal liver development, and steroid-binding protein (Galarneau, L., et al., Mol Cell Biol, 1996., 16:3853-3865);
  • Cholesterol ester transfer protein (CETP), involved in reverse cholesterol transport, and in remodeling of HDL particles (Luo, Y., et al., J. Biol. Chem., 2001, 276:24767-24773);
  • Carboxyl ester lipase (CEL), made in the pancreas, important for hydrolysis of dietary cholesterol esters (Fayard, E., et al., J. Biol. Chem., 2003, 278:35725-35731);
  • Multidrug resistance protein (MRP3), a transporter that likely functions to export bile salts from hepatocytes and enterocytes (Inokuchi, A., et al., J. Biol. Chem., 2001, 276:46822-46829);
  • Short heterodimer partner (SHP), a protein that regulates LRH-1 and other nuclear receptors (Lee, Y. K., et al., J. Biol. Chem., 1999, 274:20869-20873.)

Other targets of LRH-1 include:

• • Hepatocyte nuclear factor 4 alpha (HNF4α), a nuclear receptor important in regulation by fatty acids. Also, HNF3β and HNF1α two other liver-specific transcription regulators (Pare, J. F., et al., J. Biol. Chem., 2001, 276:13136-13144);
  • Aromatase cytochrome P450 (CYP19), that catalyzes estrogen syntheseis in adipose tissue, and may contribute to the severity of breast cancer. (Clyne, C. D., et al., J. Biol. Chem., 2002, 277:20591-20597.)

Thus, such additional LRH-1 targets can also be used for assaying or screening for modulators of LRH-1. Such modulators can then be used for treatment of diseases or conditions associated with those additional LRH-1 target genes.

B. SF-1

Compounds that modulate SF-1 can have desireable effects on sexual function and sex-related phenotypic aspects. SF-1 is very important during prenatal development of the sexual anatomy. In conjunction with a genetic screening protocol, in situations that are expected to lead to phenotypic development unsupportive of the primary sexual genotype could be corrected, at least in part, by modulation of SF-1.

SF-1 also functions after birth to regulate genes involved in sex hormone synthesis in the testis or ovaries. Thus modulation of SF-1 should assist in the maintenance of sexual function or of sex-related phenotypic appearance.

SF-1 also regulates genes important for the synthesis of adrenal steroids. Thus it controls the levels of a set of very potent hormone regulators of lipid and carbohydrate metabolism (glucocorticoids), and hypertension (mineralocorticoids). SF-1 is a key regulator in the hypothalamic-pituitary-adrenal axis through which environmental factors such as stress, or physiological factors such as starvation, have effects on overall physiology and metabolism. Pharmaceutical modulators of SF-1 can assist in maintaining a normal physiological balance in situations where the unassisted organs are over-reacting to environmental effects (such as too much stress) or medical procedures (such as surgery or other interventional procedures), or drug-induced manipulations intended to intervene in a subset of the normal metabolic regulatory mechanisms.

Pharmaceutical modulators of SF-1 can also be used in the management of ectopic tumors that produce steroid hormones. Initially modulators of SF-1 can be useful in the diagnosis of abnormal steroid production. Once a diagnosis of steroid-producing tumors is established but before surgical procedures are implemented, normal (or closer to normal) physiological tone can be produced with inhibitors of SF-1. In the case of brain or other tumor locations or conditions in which surgery is difficult, longer-term treatment with SF-1 modulators would be valuable.

Modulators of SF-1 would also be useful for treatment of conditions of poisoning with endocrine-disrupting agents, such as pesticides and polychlorinated biphenyls (PCBs), known to interfere with normal endocrine function. But certainly these agents interfere with the normal production of hormones regulated by SF-1 function, and some may interfere directly with SF-1 function. Thus modulators of SF-1 can reverse the negative effects by such compounds.

SF-1 regulates most of the genes encoding enzymes catalyzing the synthesis of steroid hormones, including P450 cholesterol sidechain cleavage enzyme (CYP11A1) (Hu, M. C., et al., Mol. Endocrinol., 2001, 15:812-818), 11-b-hydroxylase (CYP11B1), aldosterone synthase (CYP11B2), CYP17, CYP19; see, e.g., Mascaro, C., et al., Biochem J., 2000. 350 (Pt 3):785-790, for review.

SF-1 also regulates the gene encoding steroidogenic acute regulatory (StAR) protein, that transports cholesterol into the mitochondria where steroids are synthesized. This transport is the rate-limiting step for steroidogenesis.

Other target genes of SF-1 include, for example:

• • 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase, that catalyses an early step in the synthesis of cholesterol (Mascaro, C., et al., Biochem .J, 2000. 350 (Pt 3):785-790);
  • Scavenger receptor class B type I (SR-BI), mediates selective cellular cholesterol uptake from high-density lipoproteins (HDLs), important in the reverse cholesterol transport process (Lopez et al., Endocrinology, 1999, 140:3034-3044; Cao, G., et al., J. Biol. Chem., 1997. 272: 33068-33076);
  • Sterol carrier protein-2 (SCP-2) that mediates intracellular cholesterol transport in steroidogenic tissues;
  • Adrenocorticotropin receptor, that transmits the signal to activate adrenal steroidogenesis from the pituitary hormone, adrenocorticotropin;
  • Follicle stimulating hormone and leutinizing hormone receptors, that transmits the signal to activate the gonadal steroidogenesis from the pituitary hormone.

Thus, such additional SF-1 targets can also be used for assaying or screening for modulators of SF-1. Such modulators can then be used for treatment of diseases or conditions associated with those additional SF-1 target genes.

Nuclear receptors that are highly structurally related to SF-1 are present in most insects, as SF-1 (and LRH-1) comprise the members of the nuclear receptors in man that are most related to the FTZ-F1 receptors in insects. Thus, modulators of SF-1 could serve as effective insecticides through actions on an insect receptor related to SF-1, or as molecular scaffolds or reference compounds for developing effective insecticides. Such development can be carried out as described herein for development of modulators of SF-1 and LRH-1 using the respective insect FTZ-F1 receptor, or by using conventional medicinal chemistry to select and test derivatives of the SF-1 or LRH-1 active compounds.

For example, sequence alignments of all 48 human nuclear receptors indicate that SF-1 and LRH-1 are highly related: these receptors are within the NR5 subfamily of the nuclear receptor (NR) superfamily. When the SF-1 and LRH-1 sequences are compared to all currently known sequences from all species, it is observed that the NR5 subfamily also includes the FTZ-F1 gene from Drosophila. Because Drosophila is a member of the Insect class of eukaryotes, it is likely that inhibitors of SF-1 and LRH-1 as provided herein will have insecticidal properties or inhibit insect development. Thus, compounds provided by the present invention can be used to target many diverse insect pests such as flies, gnats, and fleas among many other types. Furthermore, compounds provided by the invention that bind to SF-1 and LRH-1 can be used to refine other compounds that bind to FTZ-F1. Also, the crystal structures of SF-1 and LRH-1 provided by the invention can be used to make models of FTZ-F1 to predict how one or a series of potential ligands for FTZ-F1 will bind to that target; thereby facilitating development of FTZ-F1-inhibiting compounds.

Screening for molecules, e.g., small molecules, that bind to and modulate the SF-1 and LRH-1 receptors can be accomplished using in vitro assays that quantify the amount of binding of co-regulatory proteins with the SF-1 or LRH-1 receptor proteins. Several co-regulatory proteins have been documented to bind to these receptors, including SRC-1, TReP-132, DAX-1, and SHP. The receptor proteins can be produced in E. coli or other convenient expression system. The co-regulatory proteins are typically too large to be conveniently made as full-length proteins; however the relevant receptor-binding motifs can be produced in E. coli. Alternatively, peptides can be chemically synthesized that contain these co-regulator motifs and used in the assays.

A variety of different methods for detecting molecular interactions can be used. For example, Alpha Screen technology (Perkin Elmer) is suitable to detect the interaction of the receptor with the coactivator fragment. In this case it is suitable to engineer the ligand-binding domain of the SF-1 and LRH-1 as an N-terminally HIS-tagged protein that can bind the acceptor bead (containing Nickel moieties that will bind the HIS tag). The coactivator fragment can be synthesized containing a biotin moiety that will bind the donor bead. In the presence of ‘activating’ compounds the association of the receptor with the co-regulator may be strengthened, whereas the presence of ‘inhibitory’ compounds may destabilize this interaction. Libraries of chemicals, or derivatives, can be quantified for their effects on co-regulator binding.

Thus, in an exemplary implementation, the Alpha Screen Histidine detection (Nickel chelate) kit (Perkin Elmer) is used to detect binding between His-tagged receptor LBD and biotinylated coactivator peptides or fragments. The assay is performed in Costar 384-well white polystyrene plates (Coming Inc.), in a total volume of 20 μL. Compounds to be tested for their abilities to modulate the interaction of nuclear receptor with coactivator are added to the 384-well plate in 1 μL of DMSO or buffer in advance of addition of the receptor and coactivator proteins.

Reactions are initiated in 15 μl containing 50 nM His-tagged nuclear receptor and 50 mM biotin-tagged coactivator fragment, using buffer containing 50 mM Bis-tris HCl (pH 7.0), 50 mM KCl, 0.05% Tween 20, 1 mM DTT, 0.1% BSA. Other buffer variations can be tested to optimize the largest difference in signals obtained using the apo receptor and receptor bound to compounds already determined to bind and activate the receptor. After the protein solutions are added to the compounds, the plate is sealed and incubated at room temp for 2 hours. After incubation, a 5 μL mixture containing streptavidin donor beads (15 μg/ml) and Ni-chelate acceptor beads (15 μg/ml) are added from the Nickel chelate kit. Plates are resealed and incubated in the dark for 2 hours at room temperature and then read in an AlphaFusion reader set at a read time of 1 s/well.

A signal is produced by the binding of coactivator to nuclear receptor that can be detected by the AlphaFusion reader (the binding brings the acceptor beads into close proximity of the donor beads, which allows the acceptor beads to detect the singlet oxygens produced by the donor beads, causing them to emit a light detected by the instrument). Data analysis can be performed using GraphPad Prism (GraphPad Software, Inc.). The relative abilities of many compounds to activate the receptor can be assessed by calculating and comparing each of their EC₅₀ values (i.e., the concentration of compound that causes 50% of the maximal effect, interpolated from the results of a series of tests with varying concentrations of each compound).

C. Assaying the Effects of Ligands in Cell Culture

Ligands that modulate the interaction of SF-1 or LRH-1 with co-regulators will affect the expression of genes that are targets of these receptors. Thus assays of the levels of expression of these genes will indicate the effect such compounds are having. For SF-1 an exemplary suitable cell type is the H-295R human adrenal cell. This cell expresses the enzymes, transport proteins, and receptors required for steroid hormone synthesis, and in fact makes the steroid hormone, progesterone, in assayable amounts. After treatment with a ligand, the levels of mRNA encoding these proteins can be quantified by QPCR methods. Alternatively the levels of progesterone can be assayed.

In the case of LRH-1, an exemplary suitable cell type is the HepG2 human liver cell. This cell expresses enzymes, receptors, and transporters important for bile acid synthesis. After treatment with a ligand, the levels of mRNA encoding one or more of these proteins can be quantified by QPCR methods as indicators of the effects of LRH-1 modulation.

III. Development of SF-1 and LRH-1 Active Compounds

A. Modulator Identification and Design

A large number of different methods can be used to identify modulators and to design improved modulators. Some useful methods involve structure-based design.

Structure-based modulator design and identification methods are powerful techniques that can involve searches of computer databases containing a wide variety of potential modulators and chemical functional groups. The computerized design and identification of modulators is useful as the computer databases contain more compounds than the chemical libraries, often by an order of magnitude. For reviews of structure-based drug design and identification (see Kuntz et al., Acc. Chem. Res., 1994, 27:117; Guida Current Opinion in Struc. Biol., 1994, 4:777; Cohnan, Current Opinion in Struc. Biol., 1994, 4: 868).

The three dimensional structure of a polypeptide defined by structural coordinates can be utilized by these design methods, for example, the structural coordinates of SF-1 or LRH-1. In addition, the three dimensional structures of SF-1 or LRH-1 determined by the homology, molecular replacement, and NMR techniques can also be applied to modulator design and identification methods.

For identifying modulators, structural information for SF-1 or LRH-1, in particular, structural information for the active site of the SF-1 or LRH-1, can be used. However, it may be advantageous to utilize structural information from one or more co-crystals of the receptor with one or more binding compounds. It can also be advantageous if the binding compound has a structural core in common with test compounds.

1. Design by Searching Molecular Data Bases

One method of rational design searches for modulators by docking the computer representations of compounds from a database of molecules. Publicly available databases include, for example:

a) ACD from Molecular Designs Limited

b) NCI from National Cancer Institute

c) CCDC from Cambridge Crystallographic Data Center

d) CAST from Chemical Abstract Service

e) Derwent from Derwent Information Limited

f) Maybridge from Maybridge Chemical Company LTD

g) Aldrich from Aldrich Chemical Company

h) Directory of Natural Products from Chapman & Hall

One such data base (ACD distributed by Molecular Designs Limited Information Systems) contains compounds that are synthetically derived or are natural products. Methods available to those skilled in the art can convert a data set represented in two dimensions to one represented in three dimensions. These methods can be carried out using such computer programs as CONCORD from Tripos Associates or DE-Converter from Molecular Simulations Limited.

Multiple methods of structure-based modulator design are known to those in the art. (Kuntz et al., J. Mol. Biol., 1982, 162:269; Kuntz et al., Acc. Chem. Res., 1994, 27:117; Meng et al., J. Comp. Chem., 1992, 13: 505; Bohm, J. Comp. Aided Molec. Design, 1994, 8: 623.)

A computer program widely utilized by those skilled in the art of rational modulator design is DOCK from the University of California in San Francisco. The general methods utilized by this computer program and programs like it are described in three applications below. More detailed information regarding some of these techniques can be found in the Accelrys User Guide, 1995 (Accelrys, San Diego, Calif.) A typical computer program used for this purpose can perform a process comprising the following steps or functions:

• • a) remove the existing compound from the protein;
  • b) dock the structure of another compound into the active-site using the computer program (such as DOCK) or by interactively moving the compound into the active-site;
  • c) characterize the space between the compound and the active-site atoms;
  • d) search libraries for molecular fragments which (i) can fit into the empty space between the compound and the active-site, and (ii) can be linked to the compound; and
  • e) link the fragments found above to the compound and evaluate the new modified compound.

Part (c) refers to characterizing the geometry and the complementary interactions formed between the atoms of the active site and the compounds. A favorable geometric fit is attained when a significant surface area is shared between the compound and active-site atoms without forming unfavorable steric interactions. One skilled in the art would note that the method can be performed by skipping parts (d) and (e) and screening a database of many compounds.

Structure-based design and identification of modulators of SF-1 and LRH-1 function can be used in conjunction with assay screening. As large computer databases of compounds (around 10,000 compounds) can be searched in a matter of hours or even less, the computer-based method can narrow the compounds tested as potential modulators of SF-1 or LRH-1 function in biochemical or cellular assays.

The above descriptions of structure-based modulator design are not all encompassing and other methods are reported in the literature and can be used, e.g.:

• • a) CAVEAT: Bartlett et al., in Chemical and Biological Problems in Molecular Recognition, Roberts, S. M.; Ley, S. V.; Campbell, M. M. eds.; Royal Society of Chemistry, 1989, Cambridge, pp. 182-196.
  • b) FLOG: Miller et al., J. Comp. Aided Molec. Design, 1994, 8:153.
  • c) PRO Modulator: Clark et al., J. Comp. Aided Molec. Design, 1995, 9:13.
  • c) MCSS: Miranker and Karplus, Proteins: Structure, Function, and Genetics, 1991, 11:29.
  • e) AUTODOCK: Goodsell & Olson, Proteins: Structure, Function, and Genetics, 1990, 8:195.
  • f) GRID: Goodford, J. Med. Chem., 1985, 28:849.

2. Design by Modifying Compounds in Complex with SF-1 and LRH-1

Another way of identifying compounds as potential modulators is to modify an existing modulator in the polypeptide active site. For example, the computer representation of modulators can be modified within the computer representation of a SF-1 or LRH-1 active site (e.g., LBD pocket). betailed instructions for this technique can be found, for example, in the Accelrys User Manual, 1995 in LUDI. The computer representation of the modulator is typically modified by the deletion of a chemical group or groups or by the addition of a chemical group or groups.

Upon each modification to the compound, the atoms of the modified compound and active site can be shifted in conformation and the distance between the modulator and the active-site atoms may be scored along with any complementary interactions formed between the two molecules. Scoring can be complete when a favorable geometric fit and favorable complementary interactions are attained. Compounds that have favorable scores are potential modulators.

3. Design by Modifying the Structure of Compounds that Bind SF-1 or LRH-1

A third method of structure-based modulator design is to screen compounds designed by a modulator building or modulator searching computer program. Examples of these types of programs can be found in the Molecular Simulations Package, Catalyst. Descriptions for using this program are documented in the Molecular Simulations User Guide (1995). Other computer programs used in this application are ISIS/HOST, ISIS/BASE, ISIS/DRAW) from Molecular Designs Limited and UNITY from Tripos Associates.

These programs can be operated on the structure of a compound that has been removed from the active site of the three dimensional structure of a compound-receptor complex. Operating the program on such a compound is preferable since it is in a biologically active conformation.

A modulator construction computer program is a computer program that may be used to replace computer representations of chemical groups in a compound complexed with a receptor or other biomolecule with groups from a computer database. A modulator searching computer program is a computer program that may be used to search computer representations of compounds from a computer data base that have similar three dimensional structures and similar chemical groups as compound bound to a particular biomolecule.

A typical program can operate by using the following general steps:

• • a) map the compounds by chemical features such as by hydrogen bond donors or acceptors, hydrophobic/lipophilic sites, positively ionizable sites, or negatively ionizable sites;
  • b) add geometric constraints to the mapped features; and
  • c) search databases with the model generated in (b).

Those skilled in the art also recognize that not all of the possible chemical features of the compound need be present in the model of (b). One can use any subset of the model to generate different models for data base searches.

B. Identification of Active Compounds Using SF-1 or LRH-1 Structure and Molecular Scaffolds

In addition to the methods described above that are normally applied based on screening hits that have a substantial level of activity, the availability of crystal structures that include ligand binding sites for SF-1 and LRH-1 enables application of a scaffold method for identifying and developing additional active compounds.

Thus, the present invention also concerns methods for designing ligands active on SF-1 or LRH-1 by using structural information about the respective ligand binding sites and identified binding compounds. While such methods can be implemented in many ways (e.g., as described above), advantageously the process utilizes molecular scaffolds. Such development processes and related methods are described generally below, and can, as indicated, be applied to SF-1 and LRH-1, individually or as a family.

Molecular scaffolds as discussed herein are low molecular weight molecules that bind with low or very low affinity to the target and typically have low or very low activity on that target and/or act broadly across families of target molecules. The ability of a scaffold or other compound to act broadly across multiple members of a target family is advantageous in developing ligands. For example, a scaffold or set of scaffolds can serve as starting compounds for developing ligands with desired specificity or with desired cross-activity on a selected subset of members of a target family. Further, identification of a set of scaffolds that each bind with members of a target family provides an advantageous basis for selecting a starting point for ligand development for a particular target or subset of targets. In many cases, the ability of a scaffold to bind to and/or have activity on multiple members of a target family is related to active site or binding site homology that exists across the target family.

A scaffold active across multiple members of the target family interacts with surfaces or residues of relatively high homology, i.e., binds to conserved regions of the binding pockets. Scaffolds that bind with multiple members can be modified to provide greater specificity or to have a particular cross-reactivity, e.g., by exploiting differences between target binding sites to provide specificity, and exploiting similarities to design in cross-reactivities. Adding substituents that provide attractive interactions with the particular target typically increases the binding affinity, often increasing the activity. The various parts of the ligand development process are described in more detail in following sections, but the following describes an advantageous approach for scaffold-based ligand development.

Scaffold-based ligand development (scaffold-based drug discovery) can be implemented in a variety of ways, but large scale expression of protein is useful to provide material for crystallization, co-crystallization, and biochemical screening (e.g., binding and activity assays). For crystallization, crystallization conditions can be established for apo protein and a structure determined from those crystals. For screening, preferably a biased library selected for the particular target family is screened for binding and/or activity on the target. Highly preferably a plurality of members from the target family is screened. Such screening, whether on a single target or on multiple members of a target family provides screening hits. Low affinity and/or low activity hits are selected. Such low affinity hits can either identify a scaffold molecule, or allow identification of a scaffold molecule by analyzing common features between binding molecules. Simpler molecules containing the common features can then be tested to determine if they retain binding and/or activity, thereby allowing identification of a scaffold molecule.

When multiple members of a particular target family are used for screening, the overlap in binding and/or activity of compounds can provide a useful selection for compounds that will be subjected to crystallization. For example, for 3 target molecules from a target family, if each target has about 200-500 hits in screening of a particular library, much smaller subsets of those hits will be common to any 2 of the 3 targets, and a still smaller subset will be common to all 3 targets, e.g., 100-300. In many.cases, compounds in the subset common to all 3 targets will be selected for co-crystallography, as they provide the broadest potential for ligand development.

Once compounds for co-crystallography are selected, conditions for forming co-crystals are determined, allowing determination of co-crystal structure, and the orientation of binding compound in the binding site of the target is determined by solving the structure (this can be highly assisted if an apo protein crystal structure has been determined or if the structure of a close homolog is available for use in a homology model.) Preferably the co-crystals are formed by direct co-crystallization rather than by soaking the compound into crystals of apo protein.

From the co-crystals and knowledge of the structure of the binding compounds, additional selection of scaffolds or other binding compounds can be made by applying selection filters, e.g., for (1) binding mode, (2) multiple sites for substitution, and/or (3) tractable chemistry. A binding mode filter can, for example, be based on the demonstration of a dominant binding mode. That is, a scaffold or compounds of a scaffold group bind with a consistent orientation, preferably a consistent orientation across multiple members of a target family. Filtering scaffolds for multiple sites for substitution provides greater potential for developing ligands for specific targets due to the greater capacity for appropriately modifying the structure of the scaffold. Filtering for tractable chemistry also facilitates preparation of ligands derived from a scaffold because the synthetic paths for making derivative compounds are available. Carrying out such a process of development provides scaffolds, preferably of divergent structure.

In some cases, it may be impractical or undesirable to work with a particular target for some or all of the development process. For example, a particular target may be difficult to express, by easily degraded, or be difficult to crystallize. In these cases, a surrogate target from the target family can be used. It is desirable to have the surrogate be as similar as possible to the desired target, thus a family member that has high homology in the binding site should be used, or the binding site can be modified to be more similar to that of the desired target, or part of the sequence of the desired target can be inserted in the family member replacing the corresponding part of the sequence of the family member.

Once one or more scaffolds are identified for a target family, the scaffolds can be used to develop multiple products directed at specific members of the family, or at specific subsets of family members. Thus, starting from a scaffold that acts on multiple member of the target family, derivative compounds (ligands) can be designed and tested that have increasing selectivity. In addition, such ligands are typically developed to have greater activity, and will also typically have greater binding affinity. In this process, starting with the broadly acting scaffold, ligands are developed that have improved selectivity and activity profiles, leading to identification of lead compounds for drug development, leading to drug candidates, and final drug products.

C. Scaffolds

Typically it is advantageous to select scaffolds (and/or compound sets or libraries for scaffold or binding compound identification) with particular types of characteristics, e.g., to select compounds that are more likely to bind to a particular target and/or to select compounds that have physical and/or synthetic properties to simplify preparation of derivatives, to be drug-like, and/or to provide convenient sites and chemistry for modification or synthesis.

Useful chemical properties of molecular scaffolds can include one or more of the following characteristics, but are not limited thereto: an average molecular weight below about 350 daltons, or between from about 150 to about 350 daltons, or from about 150 to about 300 daltons; having a clogP below 3; a number of rotatable bonds of less than 4; a number of hydrogen bond donors and acceptors below 5 or below 4; a Polar Surface Area of less than 100 Ų.; binding at protein binding sites in an orientation so that chemical substituents from a combinatorial library that are attached to the scaffold can be projected into pockets in the protein binding site; and possessing chemically tractable structures at its substituent attachment points that can be modified, thereby enabling rapid library construction.

The term “Molecular Polar Surface Area (PSA)” refers to the sum of surface contributions of polar atoms (usually oxygens, nitrogens and attached hydrogens) in a molecule. The polar surface area has been shown to correlate well with drug transport properties, such as intestinal absorption, or blood-brain barrier penetration.

Additional useful chemical properties of distinct compounds for inclusion in a combinatorial library include the ability to attach chemical moieties to the compound that will not interfere with binding of the compound to at least one protein of interest, and that will impart desirable properties to the library members, for example, causing the library members to be actively transported to cells and/or organs of interest, or the ability to attach to a device such as a chromatography column (e.g., a streptavidin column through a molecule such as biotin) for uses such as tissue and proteomics profiling purposes.

A person of ordinary skill in the art will realize other properties that can be desirable for the scaffold or library members to have depending on the particular requirements of the use, and that compounds with these properties can also be sought and identified in like manner. Methods of selecting compounds for assay are known to those of ordinary skill in the art, for example, methods and compounds described in U.S. Pat. Nos. 6,288,234, 6,090,912, and 5,840,485, each of which is hereby incorporated by reference in its entirety, including all charts and drawings.

In various embodiments, the present invention provides methods of designing ligands that bind to a plurality of members of a molecular family, where the ligands contain a common molecular scaffold. Thus, a compound set can be assayed for binding to a plurality of members of a molecular family, e.g., a protein family. One or more compounds that bind to a plurality of family members can be identified as molecular scaffolds. When the orientation of the scaffold at the binding site of the target molecules has been determined and chemically tractable structures have been identified, a set of ligands can be synthesized starting with one or a few molecular scaffolds to arrive at a plurality of ligands, wherein each ligand binds to a separate target molecule of the molecular family with altered or changed binding affinity or binding specificity relative to the scaffold. Thus, a plurality of drug lead molecules can be designed to individually target members of a molecular family based on the same molecular scaffold, and act on them in a specific manner.

D. Binding Assays

1. Use of Binding Assays

The methods of the present invention can involve assays that are able to detect the binding of compounds to a target molecule at a signal of at least about three times the standard deviation of the background signal, or at least about four times the standard deviation of the background signal. The assays can also include assaying compounds for low affinity binding to the target molecule. A large variety of assays indicative of binding are known for different target types and can be used for this invention. Compounds that act broadly across protein families are not likely to have a high affinity against individual targets, due to the broad nature of their binding. Thus, assays (e.g., as described herein) highly preferably allow for the identification of compounds that bind with low affinity, very low affinity, and extremely low affinity. Therefore, potency (or binding affinity) is not the primary, nor even the most important, indicia of identification of a potentially useful binding compound. Rather, even those compounds that bind with low affinity, very low affinity, or extremely low affinity can be considered as molecular scaffolds that can continue to the next phase of the ligand design process.

As indicated above, to design or discover scaffolds that act broadly across protein families, proteins of interest can be assayed against a compound collection or set. The assays can preferably be enzymatic or binding assays. In some embodiments it may be desirable to enhance the solubility of the compounds being screened and then analyze all compounds that show activity in the assay, including those that bind with low affinity or produce a signal with greater than about three times the standard deviation of the background signal. These assays can be any suitable assay such as, for example, binding assays that measure the binding affinity between two binding partners. Various types of screening assays that can be useful in the practice of the present invention are known in the art, such as those described in U.S. Pat. Nos. 5,763,198, 5,747,276, 5,877,007, 6,243,980, 6,294,330, and 6,294,330, each of which is hereby incorporated by reference in its entirety, including all charts and drawings.

In various embodiments of the assays at least one compound, at least about 5%, at least about 10%, at least about 15%, at least about 20%, or at least about 25% of the compounds can bind with low affinity. In many cases, up to about 20% of the compounds can show activity in the screening assay and these compounds can then be analyzed directly with high-throughput co-crystallography, computational analysis to group the compounds into classes with common structural properties (e.g., structural core and/or shape and polarity characteristics), and the identification of common chemical structures between compounds that show activity.

The person of ordinary skill in the art will realize that decisions can be based on criteria that are appropriate for the needs of the particular situation, and that the decisions can be made by computer software programs. Classes can be created containing almost any number of scaffolds, and the criteria selected can be based on increasingly exacting criteria until an arbitrary number of scaffolds is arrived at for each class that is deemed to be advantageous.

2. Surface Plasmon Resonance

Binding parameters can be measured using surface plasmon resonance, for example, with a BIAcore® chip (Biacore, Japan) coated with immobilized binding components. Surface plasmon resonance is used to characterize the microscopic association and dissociation constants of reaction between an sFv or other ligand directed against target molecules. Such methods are generally described in the following references which are incorporated herein by reference: Vely F. et al., Methods in Molecular Biology., 2000, 121:313-21; Liparoto et al., J. Molecular Recognition., 1999, 12:316-21; Lipschultz et al., Methods. 2000, 20:310-8; Malmqvist., Biochemical Society Transactions, 1999, 27:335-40; Alfthan, 1998, Biosensors & Bioelectronics. 13:653-63; Fivash et al., Current Opinion in Biotechnology, 1998, 9:97-101; Price et al., 1998, Tumour Biology 19 Suppl 1:1-20; Malmqvist et al., Current Opinion in Chemical Biology., 1997, 1:378-83; O'Shannessy et al., Analytical Biochemistry. 1996, 236:275-83; Malmborg et al., 1995, J. Immunological Methods. 183:7-13; Van Regenmortel, Developments in Biological Standardization., 1994, 83:143-51; and O'Shannessy, Current Opinions in Biotechnology., 1994, 5:65-71.

BIAcore® uses the optical properties of surface plasmon resonance (SPR) to detect alterations in protein concentration bound to a dextran matrix lying on the surface of a gold/glass sensor chip interface, a dextran biosensor matrix. In brief, proteins are covalently bound to the dextran matrix at a known concentration and a ligand for the protein is injected through the dextran matrix. Near infrared light, directed onto the opposite side of the sensor chip surface is reflected and also induces an evanescent wave in the gold film, which in turn, causes an intensity dip in the reflected light at a particular angle known as the resonance angle. If the refractive index of the sensor chip surface is altered (e.g., by ligand binding to the bound protein) a shift occurs in the resonance angle. This angle shift can be measured and is expressed as resonance units (RUs) such that 1000 RUs is equivalent to a change in surface protein concentration of 1 ng/mm². These changes are displayed with respect to time along the y-axis of a sensorgram, which depicts the association and dissociation of any biological reaction.

E. High Throughput Screening (HTS) Assays

HTS typically uses automated assays to search through large numbers of compounds for a desired activity. Typically HTS assays are used to find new drugs by screening for chemicals that act on a particular enzyme or molecule. For example, if a chemical inactivates an enzyme it might prove to be effective in preventing a process in a cell which causes a disease. High throughput methods enable researchers to assay thousands of different chemicals against each target molecule very quickly using robotic handling systems and automated analysis of results.

As used herein, “high throughput screening” or “HTS” refers to the rapid in vitro screening of large numbers of compounds (libraries); generally tens to hundreds of thousands of compounds, using robotic screening assays. Ultra high-throughput Screening (uHTS) generally refers to the high-throughput screening accelerated to greater than 100,000 tests per day.

To achieve high-throughput screening, it is advantageous to house samples on a multicontainer carrier or platform. A multicontainer carrier facilitates measuring reactions of a plurality of candidate compounds simultaneously. Multi-well microplates may be used as the carrier. Such multi-well microplates, and methods for their use in numerous assays, are both known in the art and commercially available.

Screening assays may include controls for purposes of calibration and confirmation of proper manipulation of the components of the assay. Blank wells that contain all of the reactants but no member of the chemical library are usually included. As another example, a known inhibitor (or activator) of an enzyme for which modulators are sought, can be incubated with one sample of the assay, and the resulting decrease (or increase) in the enzyme activity used as a comparator or control. It will be appreciated that modulators can also be combined with the enzyme activators or inhibitors to find modulators which inhibit the enzyme activation or repression that is otherwise caused by the presence of the known enzyme modulator. Similarly, when ligands to a target are sought, known ligands of the target can be present in control/calibration assay wells.

F. Measuring Enzymatic and Binding Reactions During Screening Assays

Techniques for measuring the progression of enzymatic and binding reactions, e.g., in multicontainer carriers, are known in the art and include, but are not limited to, the following.

Spectrophotometric and spectrofluorometric assays are well known in the art. Examples of such assays include the use of colorimetric assays for the detection of peroxides, as described in Gordon, A. J. and Ford, R. A., The Chemist's Companion: A Handbook Of Practical Data, Techniques, And References, John Wiley and Sons, N.Y., 1972, Page 437.

Fluorescence spectrometry may be used to monitor the generation of reaction products. Fluorescence methodology is generally more sensitive than the absorption methodology. The use of fluorescent probes is well known to those skilled in the art. For reviews, see Bashford et al., Spectrophotometry and Spectrofluorometry: A Practical Approach, pp. 91-114, IRL Press Ltd. (1987); and Bell, Spectroscopy In Biochemistry, Vol. 1, pp. 155-194, CRC Press (1981).

In spectrofluorometric methods, enzymes are exposed to substrates that change their intrinsic fluorescence when processed by the target enzyme. Typically, the substrate is nonfluorescent and is converted to a fluorophore through one or more reactions. As a non-limiting example, SMase activity can be detected using the Amplex® Red reagent (Molecular Probes, Eugene, Oreg.). In order to measure sphingomyelinase activity using Amplex® Red, the following reactions occur. First, SMase hydrolyzes sphingomyelin to yield ceramide and phosphorylcholine. Second, alkaline phosphatase hydrolyzes phosphorylcholine to yield choline. Third, choline is oxidized by choline oxidase to betaine. Finally, H₂O₂, in the presence of horseradish peroxidase, reacts with Amplex® Red to produce the fluorescent product, Resorufin, and the signal therefrom is detected using spectrofluorometry.

Fluorescence polarization (FP) is based on a decrease in the speed of molecular rotation of a fluorophore that occurs upon binding to a larger molecule, such as a receptor protein, allowing for polarized fluorescent emission by the bound ligand. FP is empirically determined by measuring the vertical and horizontal components of fluorophore emission following excitation with plane polarized light. Polarized emission is increased when the molecular rotation of a fluorophore is reduced. A fluorophore produces a larger polarized signal when it is bound to a larger molecule (i.e. a receptor), slowing molecular rotation of the fluorophore. The magnitude of the polarized signal relates quantitatively to the extent of fluorescent ligand binding. Accordingly, polarization of the “bound” signal depends on maintenance of high affinity binding.

FP is a homogeneous technology and reactions are very rapid, taking seconds to minutes to reach equilibrium. The reagents are stable, and large batches may be prepared, resulting in high reproducibility. Because of these properties, FP has proven to be highly automatable, often performed with a single incubation with a single, premixed, tracer-receptor reagent. For a review, see Owickiet al., Application ofFluorescence Polarization Assays in High-Throughput Screening, in Genetic Engineering News, 1997, 17:27.

FP is particularly desirable since its readout is independent of the emission intensity (Checovich, W. J., et al., Nature 1995, 375:254-256; Dandliker, W. B., et al., Methods in Enzymology 1981, 74:3-28) and is thus insensitive to the presence of colored compounds that quench fluorescence emission. FP and FRET (see below) are well-suited for identifying compounds that block interactions between sphingolipid receptors and their ligands. See, for example, Parker et al., Development of high throughput screening assays using fluorescence polarization: nuclear receptor-ligand-binding and kinase/phosphatase assays, J. Biomol Screen, 2000, 5:77-88.

Fluorophores derived from sphingolipids that may be used in FP assays are commercially available. For example, Molecular Probes (Eugene, Oreg.) currently sells sphingomyelin and one ceramide flurophores. These are, respectively, N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)sphingosyl phosphocholine (BODIPY® FL C5-sphingomyelin); N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoyl)sphingosyl phosphocholine (BODIPY® FL C12-sphingomyelin); and N-(4,4-difluoro-5,7-dimethyl-4-bora-3 a,4a-diaza-s-indacene-3 -pentanoyl)sphingosine (BODIPY® FL C5-ceramide). U.S. Pat. No. 4,150,949, (Immunoassay for gentamicin), discloses fluorescein-labelled gentamicins, including fluoresceinthiocarbanyl gentamicin. Additional fluorophores may be prepared using methods well known to the skilled artisan.

Exemplary normal-and-polarized fluorescence readers include the POLARION® fluorescence polarization system (Tecan AG, Hombrechtikon, Switzerland). General multiwell plate readers for other assays are available, such as the VERSAMAX® reader and the SPECTRAMAX® multiwell plate spectrophotometer (both from Molecular Devices).

Fluorescence resonance energy transfer (FRET) is another useful assay for detecting interaction and has been described. See, e.g., Heim et al., Curr. Biol. 1996, 6:178-182; Mitra et al., Gene, 1996, 173:13-17; and Selvin et al., Meth. Enzymol., 1995, 246:300-345. FRET detects the transfer of energy between two fluorescent substances in close proximity, having known excitation and emission wavelengths. As an example, a protein can be expressed as a fusion protein with green fluorescent protein (GFP). When two fluorescent proteins are in proximity, such as when a protein specifically interacts with a target molecule, the resonance energy can be transferred from one excited molecule to the other. As a result, the emission spectrum of the sample shifts, which can be measured by a fluorometer, such as a fMAX multiwell fluorometer (Molecular Devices, Sunnyvale Calif.).

Scintillation proximity assay (SPA) is a particularly useful assay for detecting an interaction with the target molecule. SPA is widely used in the pharmaceutical industry and has been described (Hanselman et al., J. Lipid Res., 1997, 38:2365-2373; Kahl et al., Anal. Biochem., 1996, 243:282-283; Undenfriend et al., Anal. Biochem., 1987, 161:494-500). See also U.S. Pat. Nos. 4,626,513 and 4,568,649, and European Patent No. 0,154,734. One commercially available system uses FLASHPLATE® scintillant-coated plates (NEN Life Science Products, Boston, Mass.).

The target molecule can be bound to the scintillator plates by a variety of well known means. Scintillant plates are available that are derivatized to bind to fusion proteins such as GST, His6 or Flag fusion proteins. Where the target molecule is a protein complex or a multimer, one protein or subunit can be attached to the plate first, then the other components of the complex added later under binding conditions, resulting in a bound complex.

In a typical SPA assay, the gene products in the expression pool will have been radiolabeled and added to the wells, and allowed to interact with the solid phase, which is the immobilized target molecule and scintillant coating in the wells. The assay can be measured immediately or allowed to reach equilibrium. Either way, when a radiolabel becomes sufficiently close to the scintillant coating, it produces a signal detectable by a device such as a TOPCOUNT NXT® microplate scintillation counter (Packard BioScience Co., Meriden Conn.). If a radiolabeled expression product binds to the target molecule, the radiolabel remains in proximity to the scintillant long enough to produce a detectable signal.

In contrast, the labeled proteins that do not bind to the target molecule, or bind only briefly, will not remain near the scintillant long enough to produce a signal above background. Any time spent near the scintillant caused by random Brownian motion will also not result in a significant amount of signal. Likewise, residual unincorporated radiolabel used during the expression step may be present, but will not generate significant signal because it will be in solution rather than interacting with the target molecule. These non-binding interactions will therefore cause a certain level of background signal that can be mathematically removed. If too many signals are obtained, salt or other modifiers can be added directly to the assay plates until the desired specificity is obtained (Nichols et al., Anal. Biochem., 1998, 257:112-119).

Additionally, the assay can utilize AlphaScreen (amplified luminescent proximity homogeneous assay) format, e.g., AlphaScreening system (Packard BioScience). AlphaScreen is generally described in Seethala and Prabhavathi, Homogenous Assays: AlphaScreen, Handbook of Drug Screening, Marcel Dekkar Pub., 2001, pp. 106-110.

G. Assay Compounds and Molecular Scaffolds

As described above, preferred characteristics of a scaffold include being of low molecular weight (e.g., less than 350 daltons, or from about 100 to about 350 daltons, or from about 150 to about 300 daltons). Preferably clogP of a scaffold is from -1 to 8, more preferably less than 6, 5, or 4, most preferably less than 3. In particular embodiments the clogP is in a range −1 to an upper limit of 2, 3, 4, 5, 6, or 8; or is in a range of 0 to an upper limit of 2, 3, 4, 5, 6, or 8. Preferably the number of rotatable bonds is less than 5, more preferably less than 4. Preferably the number of hydrogen bond donors and acceptors is below 6, more preferably below 5. An additional criterion that can be useful is a Polar Surface Area of less than 100. Guidance that can be useful in identifying criteria for a particular application can be found in Lipinski et al., Advanced Drug Delivery Reviews, 1997, 23:3-25, which is hereby incorporated by reference in its entirety.

A scaffold will preferably bind to a given protein binding site in a configuration that causes substituent moieties of the scaffold to be situated in pockets of the protein binding site. Also, possessing chemically tractable groups that can be chemically modified, particularly through synthetic reactions, to easily create a combinatorial library can be a preferred characteristic of the scaffold. Also preferred can be having positions on the scaffold to which other moieties can be attached, which do not interfere with binding of the scaffold to the protein(s) of interest but do cause the scaffold to achieve a desirable property, for example, active transport of the scaffold to cells and/or organs, enabling the scaffold to be attached to a chromatographic column to facilitate analysis, or another desirable property. A molecular scaffold can bind to a target molecule with any affinity, such as binding with an affinity measurable as about three times the standard deviation of the background signal, or at high affinity, moderate affinity, low affinity, very low affinity, or extremely low affinity.

Thus, the above criteria can be utilized to select many compounds for testing that have the desired attributes. Many compounds having the criteria described are available in the commercial market, and may be selected for assaying depending on the specific needs to which the methods are to be applied. In some cases sufficiently large numbers of compounds may meet specific criteria that additional methods to group similar compounds may be helpful. A variety of methods to assess molecular similarity, such as the Tanimoto coefficient have been used, see Willett et al., J. Chemical Information and Computer Science, 1998, 38:983-996. These can be used to select a smaller subset of a group of highly structurally redundant compounds. In addition, cluster analysis based on relationships between the compounds, or structural components of the compound, can also be carried out to the same end; see Lance & Williams, Computer J., 1967, 9:373-380, Jarvis & Patrick IEEE Transactions in Computers, 1973, C-22:1025-1034 for clustering algorithms, and Downs et al. J. Chemical Information and Computer Sciences, 1994, 34:1094-1102 for a review of these methods applied to chemical problems. One method of deriving the chemical components of a large group of potential scaffolds is to virtually break up the compound at rotatable bonds so as to yield components of no less than 10 atoms. The resulting components may be clustered based on some measure of similarity, e.g. the Tanimoto coefficient, to yield the common component groups in the original collection of compounds. For each component group, all compounds containing that component may be clustered, and the resulting clusters used to select a diverse set of compounds containing a common chemical core structure. In this fashion, a useful library of scaffolds may be derived even from millions of commercial compounds.

A “compound library” or “library” is a collection of different compounds having different chemical structures. A compound library is screenable, that is, the compound library members therein may be subject to screening assays. In preferred embodiments, the library members can have a molecular weight of from about 100 to about 350 daltons, or from about 150 to about 350 daltons.

Libraries can contain at least one compound that binds to the target molecule at low affinity. Libraries of candidate compounds can be assayed by many different assays, such as those described above, e.g., a fluorescence polarization assay. Libraries may consist of chemically synthesized peptides, peptidomimetics, or arrays of combinatorial chemicals that are large or small, focused or nonfocused. By “focused” it is meant that the collection of compounds is prepared using the structure of previously characterized compounds and/or pharmacophores.

Compound libraries may contain molecules isolated from natural sources, artificially synthesized molecules, or molecules synthesized, isolated, or otherwise prepared in such a manner so as to have one or more moieties variable, e.g., moieties that are independently isolated or randomly synthesized. Types of molecules in compound libraries include but are not limited to organic compounds, polypeptides and nucleic acids as those terms are used herein, and derivatives, conjugates and mixtures thereof.

Compound libraries useful for the invention may be purchased on the commercial market or prepared or obtained by any means including, but not limited to, combinatorial chemistry techniques, fermentation methods, plant and cellular extraction procedures and the like (see, e.g., Cwirla et al., Biochemistry, 1990, 87:6378-6382; Houghten et al., Nature, 1991, 354:84-86; Lam et al., Nature, 1991, 354:82-84; Brenner et al., Proc. Natl. Acad. Sci. USA, 1992, 89:5381-5383; R. A. Houghten, Trends Genet., 1993, 9:235-239; E. R. Felder, Chimia, 1994, 48:512-541; Gallop et al., J. Med. Chem., 1994, 37:1233-1251; Gordon et al., J. Med. Chem., 1994, 37:1385-1401; Carell et al., Chem. Biol., 1995,3:171-183; Madden et al., Perspectives in Drug Discovery and Design 2:269-282; Lebl et al., Biopolymers, 1995, 37:177-198); small molecules assembled around a shared molecular structure; collections of chemicals that have been assembled by various commercial and noncommercial groups, natural products; extracts of marine organisms, fungi, bacteria, and plants.

Preferred libraries can be prepared in a homogenous reaction mixture, and separation of unreacted reagents from members of the library is not required prior to screening. Although many combinatorial chemistry approaches are based on solid state chemistry, liquid phase combinatorial chemistry is capable of generating libraries (Sun C M., Recent advances in liquid-phase combinatorial chemistry, Combinatorial Chemistry & High Throughput Screening, 1999, 2:299-318).

Libraries of a variety of types of molecules can be prepared in order to obtain members therefrom having one or more preselected attributes that can be prepared by a variety of techniques, including but not limited to parallel array synthesis (Houghton, Ann. Rev. Pharmacol. Toxicol., 2000, 40:273-82); solution-phase combinatorial chemistry (Merritt, Comb Chem High Throughput Screen, 1998, 1:57-72; Coe et al., Mol. Divers, 1998-99, 4:31-38; Sun, Comb Chem High Throughput Screenm, 1999, 2:299-318); synthesis on soluble polymer (Gravert et al., Curr Opin Chem Biol., 1997, 1:107-13); and the like. See, e.g., Dolle etal., J. Comb Chem., 1999, 1:235-82; and Kundu et al., Prog Drug Res., 1999, 53:89-156, Combinatorial chemistry: polymer supported synthesis of peptide and non-peptide libraries). Compounds may be clinically tagged for ease of identification (Chabala, Curr Opin Biotechnol., 1995 6:633-9, Solid-phase combinatorial chemistry and novel tagging methods for identifying leads).

The combinatorial synthesis of carbohydrates and libraries containing oligosaccharides has been described (Schweizer et al., Curr. Opin. Chem. Biol., 1999, 3:291-8, Combinatorial synthesis of carbohydrates). The synthesis of natural-product based compound libraries has been described (Wessjohann, Curr. Opin. Chem. Biol., 2000, 4:303-9).

Libraries of nucleic acids are prepared by various techniques, including by way of non-limiting example the ones described herein, for the isolation of aptamers. Libraries that include oligonucleotides and polyaminooligonucleotides (Markiewicz et al., Farmaco., 2000, 55:174-7) displayed on streptavidin magnetic beads are known. Nucleic acid libraries are known that can be coupled to parallel sampling and be deconvoluted without complex procedures such as automated mass spectrometry (Enjalbal et al., Mass Spectrometry Reviews., 2000, 19:139-61) and parallel tagging. (Perrin D M., Combinatorial Chemistry & High Throughput Screening, 3:243-69).

Peptidomimetics are identified using combinatorial chemistry and solid phase synthesis (Kim H O. Kahn M., Combinatorial Chemistry & High Throughput Screening, 2000, 3:167-83; al-Obeidi, Mol Biotechnol., 1998, 9:205-23). The synthesis may be entirely random or based in part on a known polypeptide.

Polypeptide libraries can be prepared according to various techniques. In brief, phage display techniques can be used to produce polypeptide ligands (Gram H., Combinatorial Chemistry & High Throughput Screening, 1999, 2:19-28) that may be used as the basis for synthesis of peptidomimetics. Polypeptides, constrained peptides, proteins, protein domains, antibodies, single chain antibody fragments, antibody fragments, and antibody combining regions are displayed on filamentous phage for selection.

Large libraries of individual variants of human single chain Fv antibodies have been produced. See, e.g., Siegel et al., J. Molecular Biology 2000, 302:285-93; Poul et al., J. Molecular Biology. 2000, 301:1149-61; Amersdorfer et al., Methods in Molecular Biology. 2001, 145:219-40; Hughes-Jones et al., British J. Haematology., 1999, 105:811-6; McCall et al., Immunotechnology. 1998, 4:71-87; Sheets et al., (published erratum appears in Proc Natl Acad Sci USA 1999 96:795), 1998, Proc Natl Acad Sci USA 95:6157-62).

Focused or smart chemical and pharmacophore libraries can be designed with the help of sophisticated strategies involving computational chemistry (e.g., Kundu et al., Progress in Drug Research 1999, 53:89-156) and the use of structure-based ligands using database searching and docking, de novo drug design and estimation of ligand binding affinities (Joseph-McCarthy D., Pharmacology & Therapeutics 1999, 84:179-91; Kirkpatrick et al., Combinatorial Chemistry & High Throughput Screening., 1999, 2:211-21; Eliseev & Lehn, Current Topics in Microbiology & Immunology, 1999, 243:159-72; Bolger et al., Methods Enz. 1991, 203:21-45; Martin, Methods Enz. 1991, 203:587-613; Neidle et al., Methods Enz. 1991, 203:433-458; U.S. Pat. No. 6,178,384).

Selecting a library of potential scaffolds and a set of assays measuring binding to representative target molecules which are in a particular protein family thus allows the creation of a data set profiling binding of the library to the target protein family. Groups of scaffolds with different sets of binding properties can be identified using the information within this dataset. Thus, groups of scaffolds binding to one, two or three members of the family may be selected for particular applications.

In many cases, a group of scaffolds exhibiting binding to two or more members of a target protein family will contain scaffolds with a greater likelihood that such binding results from specific interactions with the individual target proteins. This would be expected to substantially reduce the effect of so-called “promiscuous inhibitors” which severely complicate the interpretation of screening assays (see McGovern et al., J. Med. Chem. 2002, 45:1712-22). Thus, in many preferred applications the property of displaying binding to multiple target molecules in a protein family may be used as a selection criteria to identify molecules with desirable properties. In addition, groups of scaffolds binding to specific subsets of a set of potential target molecules may be selected. Such a case would include the subset of scaffolds that bind to any two of three or three of five members of a target protein family.

Such subsets may also be used in combination or opposition to further define a group of scaffolds that have additional desirable properties. This would be of significant utility in cases where inhibiting some members of a protein family had known desirable effects, such as inhibiting tumor growth, whereas inhibiting other members of the protein family which were found to be essential for normal cell function would have undesirable effects. A criteria that would be useful in such a case includes selecting the subset of scaffolds binding to any two of three desirable target molecules and eliminating from this group any that bound to more than one of any three undesirable target molecules.

Representative molecular scaffolds of the invention include, but are not limited to compounds of Formula I: A-L¹-B-L²-C   Formula I wherein:

• • A is optional, and if present is selected from the group consisting of aryl, heteroaryl, and derivatives thereof optionally substituted with one, two, or three substituents as defined in [0287] and [02881 attached at any available atom to produce a stable compound;
  • L¹ is optional, and if present is a divalent C_1-3 alkylene radical;
  • B is selected from the group consisting of aryl, heteroaryl, and derivatives thereof optionally substituted with one, two, or three substituents as defined in [0287] and [0288] attached at any available atom to produce a stable compound;
  • L² is optional, and if present is selected from the group consisting of divalent C_1-3 alkylene radical and —C_1-3 alkylene-O-; and
  • C is optional, and if present is selected from the group consisting of aryl, heteroaryl, and derivatives thereof optionally substituted with one, two, or three substituents as defined in [0287] and [0288] attached at any available atom to produce a stable compound.

The following compound obtained from Chembridge (San Diego, Calif.), 5-(4-chloro-3-methyl-phenoxymethyl)-3-thiophen-2-ylmethyl-[1,2,4]oxadiazole, is an example of a possible molecular scaffold compound for development of ligands that bind to SF-1 or LRH-1:

H. Crystallography

After binding compounds have been determined, the orientation of compound bound to target is determined. Preferably this determination involves crystallography on co-crystals of molecular scaffold compounds with target. Most protein crystallographic platforms can preferably be designed to analyze up to about 500 co-complexes of compounds, ligands, or molecular scaffolds bound to protein targets due to the physical parameters of the instruments and convenience of operation.

If the number of scaffolds that have binding activity exceeds a number convenient for the application of crystallography methods, the scaffolds can be placed into groups based on having at least one common chemical structure or other desirable characteristics, and representative compounds can be selected from one or more of the classes. Classes can be made with increasingly exacting criteria until a desired number of classes (e.g., 10, 20, 50, 100, 200, 300, 400, 500) is obtained. The classes can be based on chemical structure similarities between molecular scaffolds in the class, e.g., all possess a pyrrole ring, benzene ring, or other chemical feature. Likewise, classes can be based on shape characteristics, e.g., space-filling characteristics.

The co-crystallography analysis can be performed by co-complexing each scaffold with its target, e.g., at concentrations of the scaffold that showed activity in the screening assay. This co-complexing can, for example, be accomplished with the use of low percentage organic solvents with the target molecule and then concentrating the target with each of the scaffolds. In preferred embodiments these solvents are less than 5% organic solvent such as dimethyl sulfoxide (DMSO), ethanol, methanol, or ethylene glycol in water or another aqueous solvent.

Each scaffold complexed to the target molecule can then be screened with a suitable number of crystallization screening conditions at appropriate temperature, e.g., both 4 and 20 degrees. In preferred embodiments, about 96 crystallization screening conditions can be performed in order to obtain sufficient information about the co-complexation and crystallization conditions, and the orientation of the scaffold at the binding site of the target molecule. Crystal structures can then be analyzed to determine how the bound scaffold is oriented physically within the binding site or within one or more binding pockets of the molecular family member.

It is desirable to determine the atomic coordinates of the compounds bound to the target proteins in order to determine which is a most suitable scaffold for the protein family. X-ray crystallographic analysis is therefore most preferable for determining the atomic coordinates. Those compounds selected can be further tested with the application of medicinal chemistry. Compounds can be selected for medicinal chemistry testing based on their binding position in the target molecule. For example, when the compound binds at a binding site, the compound's binding position in the binding site of the target molecule can be considered with respect to the chemistry that can be performed on chemically tractable structures or sub-structures of the compound, and how such modifications on the compound are expected to interact with structures or sub-structures on the binding site of the target. Thus, one can explore the binding site of the target and the chemistry of the scaffold in order to make decisions on how to modify the scaffold to arrive at a ligand with higher potency and/or selectivity.

The structure of the target molecule bound to the compound may also be superimposed or aligned with other structures of members of the same protein family. In this way modifications of the scaffold can be made to enhance the binding to members of the target family in general, thus enhancing the utility of the scaffold library. Different useful alignments may be generated, using a variety of criteria such as minimal RMSD superposition of alpha-carbons or backbone atoms of homologous or structurally related regions of the proteins.

These processes allow for more direct design of ligands, by utilizing structural and chemical information obtained directly from the co-complex, thereby enabling one to more efficiently and quickly design lead compounds that are likely to lead to beneficial drug products. In various embodiments it may be desirable to perform co-crystallography on all scaffolds that bind, or only those that bind with a particular affinity, for example, only those that bind with high affinity, moderate affinity, low affinity, very low affinity, or extremely low affinity. It may also be advantageous to perform co-crystallography on a selection of scaffolds that bind with any combination of affinities.

Standard X-ray protein diffraction studies such as by using a Rigaku RU-200® (Rigaku, Tokyo, Japan) with an X-ray imaging plate detector or a synchrotron beam-line can be performed on co-crystals and the diffraction data measured on a standard X-ray detector, such as a CCD detector or an X-ray imaging plate detector.

Performing X-ray crystallography on about 200 co-crystals should generally lead to about 50 co-crystal structures, which should provide about 10 scaffolds for validation in chemistry, which should finally result in about 5 selective leads for target molecules.

Additives that promote co-crystallization can of course be included in the target molecule formulation in order to enhance the formation of co-crystals. In the case of proteins or enzymes, the scaffold to be tested can be added to the protein formulation, which is preferably present at a concentration of approximately 1 mg/ml. The formulation can also contain between 0%-10% (v/v) organic solvent, e.g. DMSO, methanol, ethanol, propane diol, or 1,3 dimethyl propane diol (MPD) or some combination of those organic solvents. Compounds are preferably solubilized in the organic solvent at a concentration of about 100 mM and added to the protein sample at a concentration of about 1-10 mM. The protein-compound complex is then concentrated to a final concentration of protein of from about 5 to about 20 mg/ml. The complexation and concentration steps can conveniently be performed using a 96 well formatted concentration apparatus (e.g., Amicon Inc., Piscataway, N.J.). Buffers and other reagents present in the formulation being crystallized can contain other components that promote crystallization or are compatible with crystallization conditions, such as DTT, propane diol, glycerol.

The crystallization experiment can be set-up by placing small aliquots of the concentrated protein-compound complex (e.g., 1 μl) in a 96 well format and sampling under 96 crystallization conditions. (Other formats can also be used, for example, plates with fewer or more wells.) Crystals can typically be obtained using standard crystallization protocols that can involve the 96 well crystallization plate being placed at different temperatures. Co-crystallization varying factors other than temperature can also be considered for each protein-compound complex if desirable. For example, atmospheric pressure, the presence or absence of light or oxygen, a change in gravity, and many other variables can all be tested. The person of ordinary skill in the art will realize other variables that can advantageously be varied and considered. Conveniently, commercially available crystal screening plates with specified conditions in individual wells can be utilized.

I. Virtual Assays

As described above, virtual assays or compound design techniques are useful for identification and design of modulators; such techniques are also applicable to a molecular scaffold method. Commercially available software that generates three-dimensional graphical representations of the complexed target and compound from a set of coordinates provided can be used to illustrate and study how a compound is oriented when bound to a target. (e.g., InsightII®, Accelrys, San Diego, Calif.; or Sybyl®, Tripos Associates, St. Louis, Mo.). Thus, the existence of binding pockets at the binding site of the targets can be particularly useful in the present invention. These binding pockets are revealed by the crystallographic structure determination and show the precise chemical interactions involved in binding the compound to the binding site of the target. The person of ordinary skill will realize that the illustrations can also be used to decide where chemical groups might be added, substituted, modified, or deleted from the scaffold to enhance binding or another desirable effect, by considering where unoccupied space is located in the complex and which chemical substructures might have suitable size and/or charge characteristics to fill it. The person of ordinary skill will also realize that regions within the binding site can be flexible and its properties can change as a result of scaffold binding, and that chemical groups can be specifically targeted to those regions to achieve a desired effect. Specific locations on the molecular scaffold can be considered with reference to where a suitable chemical substructure can be attached and in which conformation, and which site has the most advantageous chemistry available.

An understanding of the forces that bind the compounds to the target proteins reveals which compounds can most advantageously be used as scaffolds, and which properties can most effectively be manipulated in the design of ligands. The person of ordinary skill will realize that steric, ionic, polar, hydrogen bond, and other forces can be considered for their contribution to the maintenance or enhancement of the target-compound complex. Additional data can be obtained with automated computational methods, such as docking and/or molecular dynamics simulations, which can afford a measure of the energy of binding. In addition, to account for other effects such as entropies of binding and desolvation penalties, methods which provide a measure of these effects can be integrated into the automated computational approach. The compounds selected can be used to generate information about the chemical interactions with the target or for elucidating chemical modifications that can enhance selectivity of binding of the compound.

An exemplary calculation of binding energies between protein-ligand complexes can be obtained using the FlexX score (an implementation of the Bohm scoring function) within the Tripos software suite (Tripos Associates, St. Louis, Mo.). The form for that equation is shown below: ΔGbind=ΔGtr+ΔGhb+ΔGion+ΔGlipo+ΔGarom+ΔGrot where: ΔGtr is a constant term that accounts for the overall loss of rotational and translational entropy of the ligand, ΔGhb accounts for hydrogen bonds formed between the ligand and protein, ΔGion accounts for the ionic interactions between the ligand and protein, ΔGlipo accounts for the lipophilic interaction that corresponds to the protein-ligand contact surface, ΔGarom accounts for interactions between aromatic rings in the protein and ligand, and ΔGrot accounts for the entropic penalty of restricting rotatable bonds in the ligand upon binding. The calculated binding energy for compounds that bind strongly to a given target will likely be lower than −25 kcal/mol, while the calculated binding affinity for a good scaffold or an unoptimized compound will generally be in the range of −15 to −20. The penalty for restricting a linker such as the ethylene glycol or hexatriene is estimated as typically being in the range of +5 to +15.

This method estimates the free energy of binding that a lead compound should have to a target protein for which there is a crystal structure, and it accounts for the entropic penalty of flexible linkers. It can therefore be used to estimate the penalty incurred by attaching linkers to molecules being screened and the binding energy that a lead compound must attain in order to overcome the penalty of the linker. The method does not account for solvation, and the entropic penalty is likely overestimated when the linkers are bound to the solid phase through an additional binding complex, e.g., a biotin:streptavidin complex.

Another exemplary method for calculating binding energies is the MM-PBSA technique (Massova & Kollman, J. Amer. Chem. Soc., 1999, 121:8133-43; Chong et al., Proc. of the Natl. Acad. of Sci. USA, 1999, 96:14330-5; Donini & Kollman, J. Med. Chem. 2000, 43:4180-8). This method uses a Molecular Dynamics approach to generate many sample configurations of the compound and complexed target molecule, then calculates an interaction energy using the well-known AMBER force field (Cornell, et al., J. Amer. Chem. Soc., 1995, 117:5179-97) with corrections for desolvation and entropy of binding from the ensemble.

Use of this method yields binding energies highly correlated with those found experimentally. The absolute binding energies calculated with this method are reasonably accurate, and the variation of binding energies is approximately linear with a slope of 1±0.5. Thus, the binding energies of compounds interacting strongly with a given target will be lower than about −8 kcal/mol, while a binding energy of a good scaffold or unoptimized compound will be in the range of −3 to −7 kcal/mol.

Computer models, such as homology models (i.e., based on a known, experimentally derived structure) can be constructed using data from the co-crystal structures. A computer program such as Modeller (Accelrys, San Diego Calif.) may be used to assign the three dimensional coordinates to a protein sequence using an alignment of sequences and a set or sets of template coordinates. When the target molecule is a protein or enzyme, preferred co-crystal structures for making homology models contain high sequence identity in the binding site of the protein sequence being modeled, and the proteins will preferentially also be within the same class and/or fold family. Knowledge of conserved residues in active sites of a protein class can be used to select homology models that accurately represent the binding site. Homology models can also be used to map structural information from a surrogate protein where an apo or co-crystal structure exists to the target protein.

Virtual screening methods, such as docking, can also be used to predict the binding configuration and affinity of scaffolds, compounds, and/or combinatorial library members to homology models. Using this data, and carrying out “virtual experiments” using computer software can save substantial resources and allow the person of ordinary skill to make decisions about which compounds can be suitable scaffolds or ligands, without having to actually synthesize the ligand and perform co-crystallization. Decisions thus can be made about which compounds merit actual synthesis and co-crystallization. An understanding of such chemical interactions aids in the discovery and design of drugs that interact more advantageously with target proteins and/or are more selective for one protein family member over others. Thus, applying these principles, compounds with superior properties can be discovered.

Another commonly-used virtual screening method is pharmacophore-based search. Crystal structures of a target protein allow the identification of pharmacophore features in the three-dimensional space using programs such as Catalyst (Accelrys, San Diego Calif.) or MOE (CCG, Montreal, Canada). Programs such as Catalyst and MOE can be used to search a large collection of existing compounds or virtual compounds that satisfy all or a subset of the defined pharmacophore features. Use of these data allows the person of ordinary skill to make decisions about which compounds may have activity for the target. These compounds and the binding hypothesis generated by using pharmacophore-based methods can then be used as a starting point to design compounds with better properties.

J. Ligand Design and Preparation

The design and preparation of ligands can be performed with or without structural and/or co-crystallization data by considering the chemical structures in common between the active scaffolds of a set. In this process structure-activity hypotheses can be formed and those chemical structures found to be present in a substantial number of the scaffolds, including those that bind with low affinity, can be presumed to have some effect on the binding of the scaffold. This binding can be presumed to induce a desired biochemical effect when it occurs in a biological system (e.g., a treated mammal). New or modified scaffolds or combinatorial libraries derived from scaffolds can be tested to disprove the maximum number of binding and/or structure-activity hypotheses. The remaining hypotheses can then be used to design ligands that achieve a desired binding and biochemical effect.

But in many cases it will be preferred to have co-crystallography data for consideration of how to modify the scaffold to achieve the desired binding effect (e.g., binding at higher affinity or with higher selectivity). Using the case of proteins and enzymes, co-crystallography data shows the binding pocket of the protein with the molecular scaffold bound to the binding site, and it will be apparent that a modification can be made to a chemically tractable group on the scaffold. For example, a small volume of space at a protein binding site or pocket might be filled by modifying the scaffold to include a small chemical group that fills the volume. Filling the void volume can be expected to result in a greater binding affinity, or the loss of undesirable binding to another member of the protein family. Similarly, the co-crystallography data may show that deletion of a chemical group on the scaffold may decrease a hindrance to binding and result in greater binding affinity or specificity.

Various software packages have implemented techniques which facilitate the identification and characterization of interactions of potential binding sites from complex structure, or from an apo structure of a target molecule, i.e. one without a compound bound (e.g. SiteID, Tripos Associates, St. Louis Mo. and SiteFinder, Chemical Computing Group, Montreal Canada, GRID, Molecular Discovery Ltd., London UK). Such techniques can be used with the coordinates of a complex between the scaffold of interest and a target molecule, or these data in conjunction with data for a suitably aligned or superimposed related target molecule, in order to evaluate changes to the scaffold that would enhance binding to the desired target molecule structure or structures. Molecular Interaction Field-computing techniques, such as those implemented in the program GRID, result in energy data for particular positive and negative binding interactions of different computational chemical probes being mapped to the vertices of a matrix in the coordinate space of the target molecule. These data can then be analyzed for areas of substitution around the scaffold binding site which are predicted to have a favorable interaction for a particular target molecule. Compatible chemical substitution on the scaffold e.g. a methyl, ethyl or phenyl group in a favorable interaction region computed from a hydrophobic probe, would be expected to result in an improvement in affinity of the scaffold. Conversely, a scaffold could be made more selective for a particular target molecule by making such a substitution in a region predicted to have an unfavorable hydrophobic interaction in a second, related undesirable target molecule.

It can be desirable to take advantage of the presence of a charged chemical group located at the binding site or pocket of the protein. For example, a positively charged group can be complemented with a negatively charged group introduced on the molecular scaffold. This can be expected to increase binding affinity or binding specificity, thereby resulting in a more desirable ligand. In many cases, regions of protein binding sites or pockets are known to vary from one family member to another based on the amino acid differences in those regions. Chemical additions in such regions can result in the creation or elimination of certain interactions (e.g., hydrophobic, electrostatic, or entropic) that allow a compound to be more specific for one protein target over another or to bind with greater affinity, thereby enabling one to synthesize a compound with greater selectivity or affinity for a particular family member. Additionally, certain regions can contain amino acids that are known to be more flexible than others. This often occurs in amino acids contained in loops connecting elements of the secondary structure of the protein, such as alpha helices or beta strands. Additions of chemical moieties can also be directed to these flexible regions in order to increase the likelihood of a specific interaction occurring between the protein target of interest and the compound. Virtual screening methods can also be conducted in silico to assess the effect of chemical additions, subtractions, modifications, and/or substitutions on compounds with respect to members of a protein family or class.

The addition, subtraction, or modification of a chemical structure or sub-structure to a scaffold can be performed with any suitable chemical moiety. For example the following moieties, which are provided by way of example and are not intended to be limiting, can be utilized: hydrogen, alkyl, alkoxy, phenoxy, alkenyl, alkynyl, phenylalkyl, hydroxyalkyl, haloalkyl, aryl, arylalkyl, alkyloxy, alkylthio, alkenylthio, phenyl, phenylalkyl, phenylalkylthio, hydroxyalkyl-thio, alkylthiocarbbamylthio, cyclohexyl, pyridyl, piperidinyl, alkylamino, amino, nitro, mercapto, cyano, hydroxyl, a halogen atom, halomethyl, an oxygen atom (e.g., forming a ketone or N-oxide) or a sulphur atom (e.g., forming a thiol, thione, di-alkylsulfoxide or sulfone) are all examples of moieties that can be utilized.

Additional examples of structures or sub-structures that may be utilized are an aryl optionally substituted with one, two, or three substituents independently selected from the group consisting of alkyl, alkoxy, halogen, trihalomethyl, carboxylate, nitro, and ester moieties; an amine of formula —NX₂X₃, where X₂ and X₃ are independently selected from the group consisting of hydrogen, saturated or unsaturated alkyl, and homocyclic or heterocyclic ring moieties; halogen or trihalomethyl; a ketone of formula —COX₄, where X₄ is selected from the group consisting of alkyl and homocyclic or heterocyclic ring moieties; a carboxylic acid of formula —(X₅)_nCOOH or ester of formula (X₆)_nCOOX₇, where X₅, X₆, and X₇ and are independently selected from the group consisting of alkyl and homocyclic or heterocyclic ring moieties and where n is 0 or 1; an alcohol of formula (X₈)_nOH or an alkoxy moiety of formula —(X₈)_nOX₉, where X₈ and X₉ are independently selected from the group consisting of saturated or unsaturated alkyl and homocyclic or heterocyclic ring moieties, wherein said ring is optionally substituted with one or more substituents independently selected from the group consisting of alkyl, alkoxy, halogen, trihalomethyl, carboxylate, nitro, and ester and where n is 0 or 1; an amide of formula NHCOX₁₀, where X₁₀ is selected from the group consisting of alkyl, hydroxyl, and homocyclic or heterocyclic ring moieties, wherein said ring is optionally substituted with one or more substituents independently selected from the group consisting of alkyl, alkoxy, halogen, trihalomethyl, carboxylate, nitro, and ester; SO₂, NX₁₁, X₁₂, where X₁₁ and X₁₂ are selected from the group consisting of hydrogen, alkyl, and homocyclic or heterocyclic ring moieties; a homocyclic or heterocyclic ring moiety optionally substituted with one, two, or three substituents independently selected from the group consisting of alkyl, alkoxy, halogen, trihalomethyl, carboxylate, nitro, and ester moieties; an aldehyde of formula —COH; a sulfone of formula —SO₂X₁₃, where X₁₃ is selected from the group consisting of saturated or unsaturated alkyl and homocyclic or heterocyclic ring moieties; and a nitro of formula —NO₂.

K. Identification of Binding Characteristics of Binding Compounds

It can also be beneficial in selecting compounds for testing to first identify binding characteristics that a ligand should advantageously possess. This can be accomplished by analyzing the interactions that a plurality of different binding compounds have with a particular target, e.g., interactions with one or more conserved residues in the binding site. These interactions are identified by considering the nature of the interacting moieties. In this way, atoms or groups that can participate in hydrogen bonding, polar interactions, charge-charge interactions, and the like are identified based on known structural and electronic factors.

L. Identification of Energetically Allowed Sites for Attachment

In addition to the identification and development of ligands, determination of the orientation of a molecular scaffold or other binding compound in a binding site allows identification of energetically allowed sites for attachment of the binding molecule to another component. For such sites, any free energy change associated with the presence of the attached component should not destablize the binding of the compound to the target to an extent that will disrupt the binding. Preferably, the binding energy with the attachment should be at least 4 kcal/mol., more preferably at least 6, 8, 10, 12, 15, or 20 kcal/mol. Preferably, the presence of the attachment at the particular site reduces binding energy by no more than 3, 4, 5, 8, 10, 12, or 15 kcal/mol.

In many cases, suitable attachment sites will be those that are exposed to solvent when the binding compound is bound in the binding site. In some cases, attachment sites can be used that will result in small displacements of a portion of the enzyme without an excessive energetic cost. Exposed sites can be identified in various ways. For example, exposed sites can be identified using a graphic display or 3-dimensional model. In a graphic display, such as a computer display, an image of a compound bound in a binding site can be visually inspected to reveal atoms or groups on the compound that are exposed to solvent and oriented such that attachment at such atom or group would not preclude binding of the enzyme and binding compound. Energetic costs of attachment can be calculated based on changes or distortions that would be caused by the attachment as well as entropic changes.

Many different types of components can be attached. Persons with skill are familiar with the chemistries used for various attachments. Examples of components that can be attached include, without limitation: solid phase components such as beads, plates, chips, and wells; a direct or indirect label; a linker, which may be a traceless linker; among others. Such linkers can themselves be attached to other components, e.g., to solid phase media, labels, and/or binding moieties.

The binding energy of a compound and the effects on binding energy for attaching the molecule to another component can be calculated approximately by manual calculation, or by using any of a variety of available computational virtual assay techniques, such as docking or molecular dynamics simulations. A virtual library of compounds derived from the attachment of components to a particular scaffold can be assembled using a variety of software programs (such as Afferent, MDL Information Systems, San Leandro, Calif. or CombiLibMaker, Tripos Associates, St. Louis, Mo.). This virtual library can be assigned appropriate three dimensional coordinates using software programs (such as Concord, Tripos Associates, St. Louis, Mo. or Omega, Openeye Scientific Software, Santa Fe, N.Mex.). These structures may then be submitted to the appropriate computational technique for evaluation of binding energy to a particular target molecule. This information can be used for purposes of prioritizing compounds for synthesis, for selecting a subset of chemically tractable compounds for synthesis, and for providing data to correlate with the experimentally determined binding energies for the synthesized compounds.

The crystallographic determination of the orientation of the scaffold in the binding site specifically enables more productive methods of assessing the likelihood of the attachment of a particular component resulting in an improvement in binding energy. Such an example is shown for a docking-based strategy in Haque et al., (J. Med. Chem. 1999, 42:1428-40), wherein an “Anchor and Grow” technique which relied on a crystallographically determined fragment of a larger molecule, potent and selective inhibitors were rapidly created. The use of a crystallographically characterized small molecule fragment in guiding the selection of productive compounds for synthesis has also been demonstrated in Boehm et al., J. Med. Chem. 2000, 43:2664-74. An illustration of the use of crystallographic data and molecular dynamics simulations in the prospective assessment of inhibitor binding energies can be found in Pearlman and Charifson, J. Med. Chem. 2001, 44, 3417-23. Another important class of techniques which rely on a well defined structural starting point for computational design is the combinatorial growth algorithm based systems, such as the GrowMol program (Bohacek & McMartin, J. Amer. Chem. Soc., 1994, 116:5560-71. These techniques have been used to enable the rapid computational evolution of virtual inhibitor computed binding energies, and directly led to more potent synthesized compounds whose binding mode was validated crystallographically (see Organic Letters, 2001, 3:2309-2312).

1. Linkers

Linkers suitable for use in the invention can be of many different types. Linkers can be selected for particular applications based on factors such as linker chemistry compatible for attachment to a binding compound and to another component utilized in the particular application. Additional factors can include, without limitation, linker length, linker stability, and ability to remove the linker at an appropriate time. Exemplary linkers include, but are not limited to, hexenyl, hexatrienyl, ethylene glycol, and peptide linkers. Traceless linkers can also be used, e.g., as described in Plunkett & Ellman., J. Org. Chem., 1995, 60:6006.

Typical functional groups, that are utilized to link binding compound(s), include, but not limited to, carboxylic acid, amine, hydroxyl, and thiol. (Examples can be found in Solid-supported combinatorial and parallel synthesis of small molecular weight compound libraries; Tetrahedron Organic Chemistry Series 1998, Vol.17:85; Pergamon).

2. Labels

As indicated above, labels can also be attached to a binding compound or to a linker attached to a binding compound. Such attachment may be direct (attached directly to the binding compound) or indirect (attached to a component that is directly or indirectly attached to the binding compound). Such labels allow detection of the compound either directly or indirectly. Attachment of labels can be performed using conventional chemistries. Labels can include, for example, fluorescent labels, radiolabels, light scattering particles, light absorbent particles, magnetic particles, enzymes, and specific binding agents (e.g., biotin or an antibody target moiety).

3. Solid Phase Media

Additional examples of components that can be attached directly or indirectly to a binding compound include various solid phase media. Similar to attachment of linkers and labels, attachment to solid phase media can be performed using conventional chemistries. Such solid phase media can include, for example, small components such as beads, nanoparticles, and fibers (e.g., in suspension or in a gel or chromatographic matrix). Likewise, solid phase media can include larger objects such as plates, chips, slides, and tubes. In many cases, the binding compound will be attached in only a portion of such an objects, e.g., in a spot or other local element on a generally flat surface or in a well or portion of a well.

IV. Organic Synthetic Techniques

The versatility of computer-based modulator design and identification lies in the diversity of structures screened by the computer programs. The computer programs can search databases that contain very large numbers of molecules and can modify modulators already complexed with the enzyme with a wide variety of chemical functional groups. A consequence of this chemical diversity is that a potential modulator of a biomolecular function may take a chemical form that is not predictable. A wide array of organic synthetic techniques exist in the art to meet the challenge of constructing these potential modulators. Many of these organic synthetic methods are described in detail in standard reference sources utilized by those skilled in the art. One example of such a reference is March, 1994, Advanced Organic Chemistry; Reactions, Mechanisms and Structure, New York, McGraw Hill. Thus, the techniques useful to synthesize a potential modulator of biomolecular function identified by computer-based methods are readily available to those skilled in the art of organic chemical synthesis.

V. Isomers, Prodrugs, and Active Metabolites

The present invention concerns compounds that can be describes with generic formulas and specific compounds. In addition, such compounds may exist in a number of different forms or derivatives, all within the scope of the present invention. These include, for example, tautomers, stereoisomers, racemic mixtures, regioisomers, salts, prodrugs (e.g., carboxylic acid esters), solvated forms, different crystal forms or polymorphs, and active metabolites.

A. Tautomers, Stereoisomers, Regioisomers, and Solvated Forms

It is understood that certain compounds may exhibit tautomerism. In such cases, the formula drawings within this specification expressly depict only one of the possible tautomeric forms It is therefore to be understood that within the invention the formulas are intended to represent any tautomeric form of the depicted compounds and are not to be limited merely to the specific tautomeric form depicted by the formula drawings.

Likewise, some of the compounds according to the present invention may exist as stereoisomers, i.e. they have the same sequence of covalently bonded atoms and differ in the spatial orientation of the atoms. For example, the compounds may be optical stereoisomers, which contain one or more chiral centers, and therefore, may exist in two or more stereoisomeric forms (e.g. entantiomers or diastereomers). Thus, such compounds may be present as single stereoisomers (i.e., essentially free of other stereoisomers), racemates, and/or mixtures of enantiomers and/or diastereomers. As another example, stereoisomers include geometric isomers, such as cis- or trans-orientation of substituents on adjacent carbons of a double bond. All such single stereoisomers, racemates and mixtures thereof are intended to be within the scope of the present invention. Unless specified to the contrary, all such steroisomeric forms are included within the formulas provided herein.

In certain embodiments, a chiral compound of the present invention is in a form that contains at least 80% of a single isomer (60% enantiomeric excess (“e.e.”) or diastereomeric excess (“d.e.”)), or at least 85% (70% e.e. or d.e.), 90% (80% e.e. or d.e.), 95% (90% e.e. or d.e.), 97.5% (95% e.e. or d.e.), or 99% (98% e.e. or d.e.). As generally understood by those skilled in the art, an optically pure compound having one chiral center is one that consists essentially of one of the two possible enantiomers (i.e., is enantiomerically pure), and an optically pure compound having more than one chiral center is one that is both diastereomerically pure and enantiomerically pure. In certain embodiments, the compound is present in optically pure form.

For compounds in which synthesis involves addition of a single group at a double bond, particularly a carbon-carbon double bond, the addition may occur at either of the double bond-linked atoms. For such compounds, the present invention includes both such regioisomers.

Additionally, the formulas are intended to cover solvated as well as unsolvated forms of the identified structures. For example, the indicated structures include both hydrated and non-hydrated forms. Other examples of solvates include the structures in combination with isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine.

B. Prodrugs and Metabolites

For compounds useful in the present invention, the invention also includes prodrugs (generally pharmaceutically acceptable prodrugs), active metabolic derivatives (active metabolites), and their pharmaceutically acceptable salts.

In this context, prodrugs are compounds or pharmaceutically acceptable salts thereof which, when metabolized under physiological conditions or when converted by solvolysis, yield the desired active compound. Typically, the prodrug is inactive, or less active than the active compound, but may provide advantageous handling, administration, or metabolic properties. For example, some prodrugs are esters of the active compound; during metabolysis, the ester group is cleaved to yield the active drug. Also, some prodrugs are activated enzymatically to yield the active compound, or a compound which, upon further chemical reaction, yields the active compound. A common example is an alkyl ester of a carboxylic acid.

As described in The Practice ofMedicinal Chemistry, Ch. 31-32 (Ed. Wermuth, Academic Press, San Diego, Calif., 2001), prodrugs can be conceptually divided into two non-exclusive categories, bioprecursor prodrugs and carrier prodrugs. Generally, bioprecursor prodrugs are compounds that are inactive or have low activity compared to the corresponding active drug compound, that contain one or more protective groups and are converted to an active form by metabolism or solvolysis. Both the active drug form and any released metabolic products should have acceptably low toxicity. Typically, the formation of active drug compound involves a metabolic process or reaction that is one of the follow types:

Oxidative reactions: Oxidative reactions are exemplified without limitation to reactions such as oxidation of alcohol, carbonyl, and acid functions, hydroxylation of aliphatic carbons, hydroxylation of alicyclic carbon atoms, oxidation of aromatic carbon atoms, oxidation of carbon-carbon double bonds, oxidation of nitrogen-containing functional groups, oxidation of silicon, phosphorus, arsenic, and sulfur, oxidative N-dealkylation, oxidative O- and S-dealkylation, oxidative deamination, as well as other oxidative reactions.

Reductive reactions: Reductive reactions are exemplified without limitation to reactions such as reduction of carbonyl groups, reduction of alcoholic groups and carbon-carbon double bonds, reduction of nitrogen-containing functions groups, and other reduction reactions.

Reactions without change in the state of oxidation: Reactions without change in the state of oxidation are exemplified without limitation to reactions such as hydrolysis of esters and ethers, hydrolytic cleavage of carbon-nitrogen single bonds, hydrolytic cleavage of non-aromatic heterocycles, hydration and dehydration at multiple bonds, new atomic linkages resulting from dehydration reactions, hydrolytic dehalogenation, removal of hydrogen halide molecule, and other such reactions.

Carrier prodrugs are drug compounds that contain a transport moiety, e.g., that improves uptake and/or localized delivery to a site(s) of action. Desirably for such a carrier prodrug, the linkage between the drug moiety and the transport moiety is a covalent bond, the prodrug is inactive or less active than the drug compound, the prodrug and any release transport moiety are acceptably non-toxic. For prodrugs where the transport moiety is intended to enhance uptake, typically the release of the transport moiety should be rapid. In other cases, it is desirable to utilize a moiety that provides slow release, e.g., certain polymers or other moieties, such as cyclodextrins. (See, e.g., Cheng et al., U.S. Pat. Pub. No. 2004/0077595, U.S. Ser. No. 10/656,838, incorporated herein by reference.) Such carrier prodrugs are often advantageous for orally administered drugs. Carrier prodrugs can, for example, be used to improve one or more of the following properties: increased lipophilicity, increased duration of pharmacological effects, increased site-specificity, decreased toxicity and adverse reactions, and/or improvement in drug formulation (e.g., stability, water solubility, suppression of an undesirable organoleptic or physiochemical property). For example, lipophilicity can be increased by esterification of hydroxyl groups with lipophilic carboxylic acids, or of carboxylic acid groups with alcohols, e.g., aliphatic alcohols. Wermuth, The Practice ofMedicinal Chemistry, Ch. 31-32, Ed. Wermuth, Academic Press, San Diego, Calif., 2001.

Prodrugs may proceed from prodrug form to active form in a single step or may have one or more intermediate forms which may themselves have activity or may be inactive.

Metabolites, e.g., active metabolites overlap with prodrugs as described above, e.g., bioprecursor prodrugs. Thus, such metabolites are pharmacologically active compounds or compounds that further metabolize to pharmacologically active compounds that are derivatives resulting from metabolic process in the body of a subject or patient. Of these, active metabolites are such pharmacologically active derivative compounds. For prodrugs, the prodrug compounds is generally inactive or of lower activity than the metabolic product. For active metabolites, the parent compound may be either an active compound or may be an inactive prodrug.

Prodrugs and active metabolites may be identified using routine techniques know in the art. See, e.g., Bertolini et al., J. Med Chem., 1997, 40:2011-2016; Shan et al., J. Pharm Sci 86:756-757; Bagshawe, Drug Dev Res., 1995, 34:220-230; Wermuth, (supra).

C. Pharmaceutically Acceptable Salts

Compounds can be formulated as or be in the form of pharmaceutically acceptable salts. Pharmaceutically acceptable salts are non-toxic salts in the amounts and concentrations at which they are administered. The preparation of such salts can facilitate the pharmacological use by altering the physical characteristics of a compound without preventing it from exerting its physiological effect. Useful alterations in physical properties include lowering the melting point to facilitate transmucosal administration and increasing the solubility to facilitate administering higher concentrations of the drug.

Pharmaceutically acceptable salts include acid addition salts such as those containing sulfate, chloride, hydrochloride, fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexylsulfamate and quinate. Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclohexylsulfamic acid, fumaric acid, and quinic acid.

Pharmaceutically acceptable salts also include basic addition salts such as those containing benzathine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, sodium, ammonium, alkylamine, and zinc, when acidic functional groups, such as carboxylic acid or phenol are present. For example, see Remington's Pharmaceutical Sciences, 19^th ed., Mack Publishing Co., Easton, Pa., Vol. 2, p. 1457, 1995. Such salts can be prepared using the appropriate corresponding bases.

Pharmaceutically acceptable salts can be prepared by standard techniques. For example, the free-base form of a compound can be dissolved in a suitable solvent, such as an aqueous or aqueous-alcohol solution containing the appropriate acid and then isolated by evaporating the solution. In another example, a salt can be prepared by reacting the free base and acid in an organic solvent.

Thus, for example, if the particular compound is a base, the desired pharmaceutically acceptable salt may be prepared by any suitable method available in the art, for example, treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, or with an organic acid, such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, a pyranosidyl acid, such as glucuronic acid or galacturonic acid, an alpha-hydroxy acid, such as citric acid or tartaric acid, an amino acid, such as aspartic acid or glutamic acid, an aromatic acid, such as benzoic acid or cinnamic acid, a sulfonic acid, such as p-toluenesulfonic acid or ethanesulfonic acid, or the like.

Similarly, if the particular compound is an acid, the desired pharmaceutically acceptable salt may be prepared by any suitable method, for example, treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary or tertiary), an alkali metal hydroxide or alkaline earth metal hydroxide, or the like. Illustrative examples of suitable salts include organic salts derived from amino acids, such as glycine and arginine, ammonia, primary, secondary, and tertiary amines, and cyclic amines, such as piperidine, morpholine and piperazine, and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium.

The pharmaceutically acceptable salt of the different compounds may be present as a complex. Examples of complexes include 8-chlorotheophylline complex (analogous to, e.g., dimenhydrinate: diphenhydramine 8-chlorotheophylline (1:1) complex; Dramamine) and various cyclodextrin inclusion complexes.

Unless specified to the contrary, specification of a compound herein includes pharmaceutically acceptable salts of such compound.

D. Polymorphic forms

In the case of agents that are solids, it is understood by those skilled in the art that the compounds and salts may exist in different crystal or polymorphic forms, all of which are intended to be within the scope of the present invention and specified formulas.

VI. Administration

The methods and compounds will typically be used in therapy for human patients. However, they may also be used to treat similar or identical diseases in other vertebrates, e.g., mammals such as other primates, sports animals, bovines, equines, porcines, ovines, and pets such as dogs and cats.

Suitable dosage forms, in part, depend upon the use or the route of administration, for example, oral, transdermal, transmucosal, or by injection (parenteral). Such dosage forms should allow the compound to reach target cells. Other factors are well known in the art, and include considerations such as toxicity and dosage forms that retard the compound or composition from exerting its effects. Techniques and formulations generally may be found in Remington: The Science and Practice of Pharmacy, 21^st edition, Lippincott, Williams and Wilkins, Philadelphia, Pa., 2005 (hereby incorporated by reference herein).

Carriers or excipients can be used to produce pharmaceutical compositions. The carriers or excipients can be chosen to facilitate administration of the compound. Examples of carriers include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose, or sucrose, or types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile solutions of water for injection (WFI), saline solution, and dextrose.

The compounds can be administered by different routes including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, transmucosal, rectal, or transdermal. Oral administration is preferred. For oral administration, for example, the compounds can be formulated into conventional oral dosage forms such as capsules, tablets, and liquid preparations such as syrups, elixirs, and concentrated drops.

Pharmaceutical preparations for oral use can be obtained, for example, by combining the active compounds with solid excipients, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose (CMC), and/or polyvinylpyrrolidone (PVP: povidone). If desired, disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid, or a salt thereof such as sodium alginate.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain, for example, gum arabic, talc, poly-vinylpyrrolidone, carbopol gel, polyethylene glycol (PEG), and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dye-stuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin (“gelcaps”), as well as soft, sealed capsules made of gelatin, and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols (PEGs). In addition, stabilizers may be added.

Alternatively, injection (parenteral administration) may be used, e.g., intramuscular, intravenous, intraperitoneal, and/orsubcutaneous. For injection, the compounds of the invention are formulated in sterile liquid solutions, preferably in physiologically compatible buffers or solutions, such as saline solution, Hank's solution, or Ringer's solution. In addition, the compounds may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms can also be produced.

Administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration, for example, may be through nasal sprays or suppositories (rectal or vaginal).

The amounts of various compound to be administered can be determined by standard procedures taking into account factors such as the compound IC₅₀, the biological half-life of the compound, the age, size, and weight of the patient, and the disorder associated with the patient. The importance of these and other factors are well known to those of ordinary skill in the art. Generally, a dose will be between about 0.01 and 50 mg/kg, preferably 0.1 and 20 mg/kg of the patient being treated. Multiple doses may be used.

EXAMPLES

A number of examples involved in the present invention are described below. In most cases, alternative techniques could also be used. The examples are intended to be illustrative and are not limiting or restrictive to the scope of the invention.

Example 1

Plasmid Construction

Human SF-1 and LRH-1 constructs were obtained by PCR amplification of cDNA (BD Biosciences). For E. coli expression the SF-1 G219-T461 insert was cloned into a modified pET vector (Novagen) encoding an N-terminal hexa-HIS tag, cleavable using TEV protease. The SF-1 LBD primer containing a BamHI cloning site and a TEV protease recognition site before residue G219 was:

(SEQ ID NO:_)
5′-GCTGGATCCGAAAACCTGTACTTCCAGGGAGGCCCCAACGTGCCT.

The non-coding strand primer, adding a stop codon and a SalI cloning site, was

(SEQ ID NO:_)
5′-GGATCCATGTCGACTCAAGTCTGCTTGGCTTGCAGCATTT.

An analogous strategy was used for expression of the LRH-1 S25 1 -A495 (see below, SEQ ID NO:______) using the coding-strand primer,

(SEQ ID NO:_)
5′-GCTGGATCCGAAAACCTGTACTTCCAGGGTTCTCCAGCAAGCATCCC
ACAT,

and the non-coding strand primer,

(SEQ ID NO:_)
5′-GTTCTTGTCGACTTATGCTCTTTTGGCATGCAAC.

From structure-based alignment with the mouse LRH-1 structure (1PK5) it was obvious that human SF-1 would have surface-exposed Cys residues at positions 247 and 412. For crystallography of SF-1 these Cys were removed by mutagenesis of the SF-1 DNA using Quick-change protocols (Stratagene) with complementary primers (see below, SEQ ID NO______). The coding-strand primers used were:

SF-1-C247S:
5′-CGCATCTTGGGCTCTCTGCAGGAGCCCAC (SEQ ID NO:_)
SF-1-C412S:
5′-CACTACCCGCACTCCGGGGACAAATTCC. (SEQ ID NO:_)

For analysis in mammalian cell culture, transient transfection vectors encoding the LBDs of SF-1 and LRH-1 were cloned as fusion proteins with the GAL4 DBD into a modified SG5-GAL4 vector. The SF-1 G219-T461 LBD primer containing an NdeI cloning site before residue G219 was:

5′-GTTCTTCATATGGGAGGCCCCAACGTGCCT. (SEQ ID NO:_)

The LRH-1 S251-A495 LBD primer containing an NdeI site before S251 was

5′-GTTCTTCATATGTCTCCAGCAAGCATCCCACAT. (SEQ ID NO:_)

Coding-strand primers for mutations of SF-1 and LRH-1 to test ligand binding and coactivator binding using Quick-change protocols were:

SF-1 L245K
5′-CGGGCCCGCATCAAGGGCTGCCTGCAG   (SEQ ID NO:_)
SF-1 A269F
5′-CTCCTGTGCAGAATGTTCGACCAGACCTTC (SEQ ID NO:_)
SF-1 E332A
5′-GGCAGGAGGTGGCACTGACCACAGTGG   (SEQ ID NO:_)
SF-1 G340E
5′-CACAGTGGCCACCCAGGCGGAGTCGCTGCTGCACAGC (SEQ ID NO:_)
SF-1 L344F
5′-GCGGGCTCGCTGTTCCACAGCCTGGTGTTG (SEQ ID NO:_)
SF-1 A433F
5′-CCTGAGCATGCAGTTCAAGGAGTACCTGTAC (SEQ ID NO:_)
SF-1 Y436M
5′-GCAGGCCAAGGAGATGCTGTACCACAAGC (SEQ ID NO:_)
SF-1 K440M
5′-GTACCTGTACCACATGCACCTGGGCAAC  (SEQ ID NO:_)
SF-1 Y436FK440M
5′-GCAGGCCAAGGAGATGCTGTACCACATGCACCTGGGCAAC (SEQ ID NO:_)
SF-1 Y436FK440A
5′-GCAGGCCAAGGAGTTCCTGTACCACGCGCACCTGGGCAAC (SEQ ID NO:_)
SF-1 E454K
5′-GCAACAACCTGCTCATCAAGATGCTGCAAGCCAAG (SEQ ID NO:_)
LRH-1 M277K
5′-GTCCAGGCTAAAATCAAGGCCTATTTGCAGC (SEQ ID NO:_)
LRH-1 L298Y
5′-GAGCACCTTTGGGTACATGTGCAAAATGGCAG (SEQ ID NO:_)
LRH-1 A303F
5′-CTTATGTGCAAAATGTTCGATCAAACTCTCTTC (SEQ ID NO:_)
LRH-1 A303M
5′-CTTATGTGCAAAATGATGGATCAAACTCTCTTC (SEQ ID NO:_)
LRH-1 D366A
5′-CTGGGCAACAAGTGGCATATTCCATAATAGCATC (SEQ ID NO:_)
LRH-1 I369Y
5′-CAAGTGGACTATTCCTACATAGCATCACAAGC (SEQ ID NO:_)
LRH-1 L378F
5′-GCCGGAGCCACCTTCAACAACCTCATGAG (SEQ ID NO:_)
LRH-1 A467F
5′-CCATCAGTATGCAGTTCGAAGAATACCTCTAC (SEQ ID NO:_)
LRH-1 A467M
5′-CCATCAGTATGCAGATGGAAGAATACCTCTAC (SEQ ID NO:_)
LRH-1 Y470FK474A
5′-GCAGGCTGAAGAATTCCTCTACTACGCGCACCTGAACGG (SEQ ID NO:_)
LRH-1 E488K
5′-CTATAATAACCTTCTCATTAAGATGTTGCATGCCAAAAG (SEQ ID NO:_)

E. coli expression vectors for GST fusion proteins with SRC-1 (residues M595-Q780, containing NR-boxes I, II and III) were made as described (Marimuthu et al., Mol. Endocrinol., 2002, 16:271-86) except a modified pGEX-2T vector (Amersham) was engineered to encode a C-terminal fusion peptide,

VDLNDIFEAQKIEWHR, (SEQ ID NO:_)

with a biotinylation site (Kim & McHenry, J. Biol. Chem., 1996, 271:20690-20698.) The insert encoding a NR-binding site from the coactivator TReP (Gizard et al., J. Biol. Chem., 2002, 277, 39144-39155), M173-P192, encoding residues

MDGAPDSALRQLLSQKPMEP (SEQ ID NO:_)

was engineered by gene synthesis, and cloned into the N-terminal GST/C-terminal biotinylation site vector. All constructs were sequenced (DavisSequencing, Inc.).

SF-1 G219-T461 with Cys 247 and 412 Removed:

P1098. pET-SPEC SF1 G219-T461-X C247S, C412S
taatacgactcactataggggaattgt
gagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatatacc
atgaaaaaaggtcaccaccatcaccatcacggatccgaaaacctgtacttccagggaggc
M  K  K  G  H  H  H  H  H  H  G  S  E  N  L  Y  F  Q  G  G
cccaacgtgcctgagctcatcctgcagctgctgcagctggagccggatgaggaccaggtg
P  N  V  P  E  L  I  L  Q  L  L  Q  L  E  P  D  E  D  Q  V
cgggcccgcatcttgggctctctgcaggagcccaccaaaagccgccccgaccagccggcg
R  A  R  I  L  G  S  L  Q  E  P  T  K  S  R  P  D  Q  P  A
gccttcggcctcctgtgcagaatggccgaccagaccttcatctccatcgtggactgggca
A  F  G  L  L  C  R  M  A  D  Q  T  F  I  S  I  V  D  W  A
cgcaggtgcatggtcttcaaggagctggaggtggccgaccagatgacgctgctgcagaac
R  R  C  M  V  F  K  E  L  E  V  A  D  Q  M  T  L  L  Q  N
tgctggagcgagctgctggtgttcgaccacatctaccgccaggtccagcacggcaaggag
C  W  S  E  L  L  V  F  D  H  I  Y  R  Q  V  Q  H  G  K  E
ggcagcatcctgctggtcaccgggcaggaggtggagctgaccacagtggccacccaggcg
G  S  I  L  L  V  T  G  Q  E  V  E  L  T  T  V  A  T  Q  A
ggctcgctgctgcacagcctggtgttgcgggcgcaggagctggtgctgcagctgcttgcg
G  S  L  L  H  S  L  V  L  R  A  Q  E  L  V  L  Q  L  L  A
ctgcagctggaccggcaggagtttgtctgcctcaagttcatcatcctcttcagcctggat
L  Q  L  D  R  Q  E  F  V  C  L  K  F  I  I  L  F  S  L  D
ttgaagttcctgaataaccacatcctggtgaaagacgctcaggagaaggccaacgccgcc
L  K  F  L  N  N  H  I  L  V  K  D  A  Q  E  K  A  N  A  A
ctgcttgactacaccctgtgccactacccgcactccggggacaaattccagcagctactg
L  L  D  Y  T  L  C  H  Y  P  H  S  G  D  K  F  Q  Q  L  L
ctgtgcctggtggaggtgcgggccctgagcatgcaggccaaggagtacctgtaccacaag
L  C  L  V  E  V  R  A  L  S  M  Q  A  K  E  Y  L  Y  H  K
cacctgggcaacgagatgccccgcaacaacctgctcatcgaaatgctgcaagccaagcag
H  L  G  N  E  M  P  R  N  N  L  L  I  E  M  L  Q  A  K  Q
acttgagtcgaccaccaccaccaccaccactgagatccggctggccctactggccgaaag
T  -
gaattcgaggccagcagggccaccgctgagcaataactagcataaccccttggggcctct
aaacgggtcttgaggggttttttg

Nucleic acid(SEQ ID NO: ______)

Encoded protein (SEQ ID NO: ______)

LRH-1 S251-A495 with Cys 247 and 412 Removed:

P1515. pET-SPEC LRH-1 GS251-A495-X
taatacgactcactataggggaattgt
gagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatatacc
atgaaaaaaggtcaccaccatcaccatcacggatccgaaaacctgtacttccagggttct
M  K  K  G  H  H  H  H  H  H  G  S  E  N  L  Y  F  Q  G  S
ccagcaagcatcccacatctgatactggaacttttgaagtgtgagccagatgagcctcaa
P  A  S  I  P  H  L  I  L  E  L  L  K  C  E  P  D  E  P  Q
gtccaggctaaaatcatggcctatttgcagcaagagcaggctaaccgaagcaagcacgaa
V  Q  A  K  I  M  A  Y  L  Q  Q  E  Q  A  N  R  S  K  H  E
aagctgagcacctttgggcttatgtgcaaaatggcagatcaaactctcttctccattgtc
K  L  S  T  F  G  L  M  C  K  M  A  D  Q  T  L  F  S  I  V
gagtgggccaggagtagtatcttcttcagagaacttaaggttgatgaccaaatgaagctg
E  W  A  R  S  S  I  F  F  R  E  L  K  V  D  D  Q  M  K  L
cttcagaactgctggagtgagctcttaatcctcgaccacatttaccgacaagtggtacat
L  Q  N  C  W  S  E  L  L  I  L  D  H  I  Y  R  Q  V  V  H
ggaaaggaaggatccatcttcctggttactgggcaacaagtggactattccataatagca
G  K  E  G  S  I  F  L  V  T  G  Q  Q  V  D  Y  S  I  I  A
tcacaagccggagccaccctcaacaacctcatgagtcatgcacaggagttagtggcaaaa
S  Q  A  G  A  T  L  N  N  L  M  S  H  A  Q  E  L  V  A  K
cttcgttctctccagtttgatcaacgagagttcgtatgtctgaaattcttggtgctcttt
L  R  S  L  Q  F  D  Q  R  E  F  V  C  L  K  F  L  V  L  F
agtttagatgtcaaaaaccttgaaaacttccagctggtagaaggtgtccaggaacaagtc
S  L  D  V  K  N  L  E  N  F  Q  L  V  E  G  V  Q  E  Q  V
aatgccgccctgctggactacacaatgtgtaactacccgcagcagacagagaaatttgga
N  A  A  L  L  D  Y  T  M  C  N  Y  P  Q  Q  T  E  K  F  G
cagctacttcttcgactacccgaaatccgggccatcagtatgcaggctgaagaatacctc
Q  L  L  L  R  L  P  E  I  R  A  I  S  M  Q  A  E  E  Y  L
tactacaagcacctgaacggggatgtgccctataataaccttctcattgaaatgttgcat
Y  Y  K  H  L  N  G  D  V  P  Y  N  N  L  L  I  E  M  L  H
gccaaaagagcataagtcgaccaccaccaccaccaccactgagatccggctggccctact
A  K  R  A  -
ggccgaaaggaattcgaggccagcagggccaccgctgagcaataactagcataacccctt
ggggcctctaaacgggtcttgaggggttttttg

Nucleic acid(SEQ ID NO: ______)

Encoded protein (SEQ ID NO: ______)

Example 2

Protein Expression and Purification

The SF-1 LBD (G219-T416 with C247S/C412S mutations) and the LRH-1 LBD (S251 -A495) used for crystallography were produced as TEV-cleavable N-terminally HIS-tagged proteins in E. coli strain BL21(DE3) RIL (Stratagene). Single colonies were grown for 4 hrs at 37° C. in 2 separate 200 mL Luria broth (LB) media containing kanamycin (30 μg/mL) and chloramphenicol (15 μg/mL). 400 mL culture was transferred to a 45 L Bioreactor containing 30 L Terrific Broth (TB) media also supplemented with kanamycin and chloramphenicol. Cultures were allowed to grow at 37° C. until reaching an OD₆₀₀ of 2.0-2.5 OD then grown at 20° C., with 0.5 mM IPTG added for continued growth for 15 hrs at 20° C. Cells were harvested using a continuous flow centrifuge and paste frozen at −80° C.

Cell pastes with SF-1 or LRH-1 were resuspended with 40 mL lysis buffer (50 mM Na/K Phosphate [pH 8.0], 250 mM NaCl, 5% glycerol) per liter of cells, and lysed using a microfluidizer (Microfluidics M-110H) at 18,000 psi. Lysate was clarified by centrifugation at 15,000 g at 4° C. for 2 hrs. Imidazole was added to the clarified lysate to a final concentration of 15 mM, and then loaded onto a 50 ml Ni-Chelating Sepharose (AP Biotech) column. The column was washed with 500 mL of buffer A (20 mM HEPES [pH8.0], 250 mM NaCl, 5% glycerol) containing 15 mM imidazole, and eluted with a 100 mL gradient to 100% buffer B (20 mM HEPES [pH8.0], 250 mM imidazole, 250 mM NaCl, 5% glycerol). Eluted LBDs were diluted six-fold with buffer C (20 mM Tris [pH 8.0]) and loaded onto a 75 mL Source 30Q (AP Biotech) column. The column was washed with 100 mL buffer C containing 20 mM NaCl and eluted with a fifteen column volume linear gradient from 2 to 25% buffer D (20 mM Tris [pH 8.0], 1 M NaCl). The LBD proteins, which eluted between 50 mM and 150 mM NaCl, were analyzed using native and SDS-PAGE, and tested for coactivator-binding activity. Pooled fractions were incubated with TEV protease at 50 μg/mg overnight at 4° C. for removal of the N-terminal tag. The sequence removed is:

MKKGHHHHHHGSENLYFQ (SEQ ID NO:_)

The cleaved protein was re-purified using a Source30Q column, and eluted with an eight column volume gradient from 2 to 25% buffer D. At this stage, the proteins were >95% pure as determined by SDS-PAGE analysis. Prior to concentration, beta-mercaptoethanol was added to 14 mM final concentration, and the proteins concentrated to 20 mg/mL and stored at −80° C.

Coactivator N-terminal GST/C-terminal biotinylation site fusion proteins were produced in E. coli strain BL21(DE3) RIL (Stratagene). Shaker cultures (750 ml 2× LB) were grown at 37° C. until an OD₆₀₀ of 1.2. Then, 0.5 mM IPTG was added and cultures were cooled to 15° C. with continued shaking overnight. Cells were harvested by centrifugation, frozen in liquid N₂ and stored at −80° C. Cell pastes (5 gm) were suspended in 50 mL extraction buffer (50 mM Tris pH 8.0,250 mM NaCl, 0.1% Triton X-100). Lysozyme (0.5 mL of 20 mg/mL, Sigma) was added and left on ice 15-30 min., followed by sonication (1.5 min on ice) using flat-tip probe and setting 6 of model 550-sonic dismembranator (Fisher). The prep was checked for loss of DNA viscosity, then centrifuged at 17,000 rpm for 30 min. at 4° C. in a SA-600 rotor (Beckman). Supernatant was recovered and mixed with 0.5 mL buffer-washed slurry of Glutathione-Sepharose beads (Amersham) continuously for 1 hr at 4° C. Beads were centrifuged at low speed and washed once with 20 mL extraction buffer, and twice with 50 mM Tris pH 8.0. GST protein was recovered by elution with 3-5 ml elution buffer (50 mM Tris pH 8.0, 6.5 mg/ml glutathione (Sigma).

For co-expression studies, the ampicillin-resistant GST-coactivator fusion plasmids were co-introduced with the kanamycin-resistant HIS-tagged LRH-1 or SF-1 plasmids. Growth and extraction was the same as for GST-tagged coactivators, above. To the centrifuged prep from 750 mL culture was added imidazole to a final 10 mM, and 1.0 mL buffer-washed slurry of Talon cobalt affinity resin (BD Biosciences), stirring continuously for 1 hr at 4° C. Beads were centrifuged at low speed and washed once with 20 mL extraction buffer containing 10 mM imidazole, and twice with cobalt wash buffer (20 mM Tris pH 8.0, 100 mM NaCl, 10% glycerol) also with 10 mM imidazole. HIS-tagged protein was recovered by elution with 3-5 ml cobalt wash buffer with 200 mM imidazole.

For liposome washing of HIS-tagged SF-1 protein, 20 mg was extracted from a 750 mL culture, bound to cobalt affinity resin, and washed as above. While remaining bound to the resin, two sequential 30 minute, 5 mL washes in cobalt wash buffer containing sonicated 100 μM 1,2-didodecanoyl-sn-glycero-3-phosphocholine (Sigma) were applied, followed by two final washes in cobalt wash buffer. The HIS-tagged protein was recovered in 3 mL cobalt wash buffer with 200 mM imidazole.

Example 3

Crystallization

Initial crystallization of human SF-1 and LRH-1 were observed in sparse-matrix screens using Hampton Index screen kits (Hampton Research). Human SF-1 protein was diluted to 15 mg/ml in 20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 10 mM DTT with a 2× molar excess of the peptides NCOA1 (SRC-1) NID-2

CPSSHSSLTERHKILHRLLQEGSPS (SEQ ID NO:_)

and/or NCOA2 (TIF2, GRIP1) NID-3

KENALLRYLLDKD. (SEQ ID NO:_)

Crystals were grown by sitting drop vapor diffusion at 4° C., mixing equal volumes of protein/peptide sample with reservoir solution containing 18% polyethylene glycol (PEG) 3350, 0.2M ammonium sulfate, 0.1M BisTris pH 5.5, and 2.5% sucrose. Crystals grew to a size of 0.6 mm×0.3 mm×0.3 mm in 5-8 days. For cryo-protection sucrose was added to SF-1 crystals prior to freezing.

Human LRH-1 protein was diluted to 10 mg/ml in 20 mMTris/HCl, pH 7.5, 62 mM NaCl, 100 mM ammonium acetate, 2 mM CHAPS with 2× molar excess of the peptide NCOA2 NID-3

KENALLRYLLDKD. (SEQ ID NO:_)

Crystals were grown by sitting drop vapor diffusion at 20° C., mixing equal volumes of protein/peptide sample with reservoir solution containing 0.9M NaH₂PO₄, 0.1 M K₂HPO₄ (Hampton Index screen #17). Crystals grew to a size of 0.13 mm×0.03 mm×0.03 mm in 2 weeks. Glycerol was used for cryo-protection.

Example 4

Crystal Data Collection and Structure Determination

The X-ray diffraction data of both human SF-1 and human LRH-1 were collected at the Advanced Light Source (ALS) beam line 8.3.1 using a Quantum 210 CCD detector. Data collection was performed under cryogenic temperature. The diffraction data were integrated and scaled using programs Mosflm and SCALA (Table 1). (Leslie, Acta Crystallogr. D Biol Crystallogr., 1999, 55 (Pt 10):1696-1702.)

To solve the SF-1 structure, a homology model was generated based on the crystal structure of mouse LRH-1 (1PK5). (Sablin et al., Mol. Cell, 2003, 11:1575-1585.) Molecular replacement of the data up to 3.5 Å was carried out using EPMR (Kissinger et al., Acta Crystallogr. D Biol Crystallogr., 1999, 55 (Pt 2):484-91) obtaining a solution in space group P3₁21. Two molecules related by non-crystallographic symmetry were determined in each asymmetric unit. The electron density map calculated with the initial phases revealed the majority of the structure. An initial model was obtained manually using program O. (Jones et al., Acta Crystallogr A, 1991, 47 ( Pt 2):110-9.) The initial model was then subject to refinement using program CNX (Brunger et al., Acta Crystallogr D Biol Crystallogr., 1998, 54 (Pt 5):905-21) with least square minimization on the maximum likelihood target functions, simulated annealing and torsion angle dynamics. Subsequent interactive model building and refinement were performed against 2.1 Å data with least square refinement, individual B-factor refinement, and TLS refinement using programs CNX and REFMAC5. (Brunger et al., Acta Crystallogr D Biol Crystallogr., 1998, 54 (Pt 5):905-21.) Well-defined election density indicated one NCOA2 NID-3 peptide bound to the surface and the unexpected PE ligand bound inside the ligand pocket.

The human LRH-1 structure determination and refinement was similar to that for SF-1. A homology model was generated based on the crystal structure of mouse LRH-1 (1PK5). (Sablin et al., Mol. Cell, 2003, 11, 1575-85.) It was then used as the search model for molecular replacement using program EPMR. (Kissinger et al., Acta Crystallogr D Biol Crystallogr., 1999, 55 ( Pt 2):484-91.) The crystal is in space group P2₁2₁2₁ with one molecule in each asymmetric unit. The initial molecular replacement solution was then subject to iterative refinement against data up to 2.5 Å. At a late stage of refinement, some electron density appeared in the ligand binding pocket representing a phospholipid molecule. The shape of the electron density suggested the structure of a phosphatidylglycerol-phosphoglycerol, confirmed by further refinement. NCOA2 NID-3 peptide was found to bind at two sites on the molecular surface.

Example 5

Biochemical Protein Interaction Assay

The Alpha Screen Histidine detection (Nickel chelate) kit (Perkin Elmer) was used to detect binding between His-tagged SF-1 LBD and biotinylated GST-SRC-1 fragments. The assay was performed in Costar 384-well white polystyrene plates (Coming Inc.) in a total volume of 20 μL using buffer containing 50 mM Bis-tris HCl (pH 7.5), 50 mM KCl, 0.05% Tween 20, 1 mM DTT, 0.1% BSA. Reactions were initiated in 15 μL containing 50 nM His-tagged SF-1 receptor and 50 nM biotin-tagged SRC-1 fragment. Phospholipid was included as indicated. PE 18:3 (1,2-Dilinolenoyl-sn-glycero-3-phosphoethanolamine) was from Avanti Polar Lipids. The plate was sealed and incubated at room temp for 2 hours. After incubation, 5 μL containing streptavidin donor beads (15 μg/ml) and Ni-chelate acceptor beads (15 μg/ml) was added from the Nickel chelate kit. Plates were resealed and incubated in the dark for 2 hours at room temperature and then read in a Fusion Alpha reader set at a read time of 1 s/well. Data analysis was done using GraphPad Prism (GraphPad Software, Inc.).

Example 6

Cell Culture

HEK293T cells were cultured at 37° C. in Dulbecco's modified Eagle's medium(DMEM) with penicillin(100 U/ml), streptomycin (100 U/ml) and 10% heat-inactivated fetal calf serum (Invitrogen). For transient transfection HEK293T cells were grown to 80% confluency in 96-well plates, and medium exchanged for 100 μl serum-free medium before addition of 100 ng pSG-GAL4-SF-1 -LBD or pSG-GAL4-LRH-1 -LBD expression vector, 40 ng pFR-Luc reporter gene (Stratagene), and 12 ng pRL-TK transfection control plasmids (Promega) mixed with 0.5 μl Metafectene (Biontex). After 4 hours serum-containing medium was added. After 24 hrs medium was removed and cells were lysed in Renilla luciferase assay lysis buffer (Promega). Firefly luciferase was measured using Luciferase Reporter Gene Assay kit (Roche) and Renilla luciferase was measured using Renilla Luciferase Assay System (Promega).

All patents and other references cited in the specification are indicative of the level of skill of those skilled in the art to which the invention pertains, and are incorporated by reference in their entireties, including any tables and figures, to the same extent as if each reference had been incorporated by reference in its entirety individually.

One skilled in the art would readily appreciate that the present invention is well adapted to obtain the ends and advantages mentioned, as well as those inherent therein. The methods, variances, and compositions described herein as presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art, which are encompassed within the spirit of the invention, are defined by the scope of the claims.

It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. For example, variations can be made in the method for identifying modulators and/or various methods of administration can be used. Thus, such additional embodiments are within the scope of the present invention and the following claims.

The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of” and “consisting of” may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.

In addition, where features or aspects of the invention are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.

Also, unless indicated to the contrary, where various numerical values are provided for embodiments, additional embodiments are described by taking any 2 different values as the endpoints of a range. Such ranges are also within the scope of the described invention.

Thus, additional embodiments are within the scope of the invention and within the following claims.

TABLE 1
Statistics of crystallographic data and refinement.
Crystallization and data collection	Refinement
	SF-1	LRH-1		SF-1	LRH-1
Unit cell	a = b = 73.6,	a = 61.0, b = 67.0,	Resolution	50-2.1	50-2.5
dimensions (Å)	c = 195.7	c = 78.2	range (Å)
Space group	P3121	P212121	σ cut off	none	none
Solvent content	49%	53%	Total non-	4342	2172
			hydrogen
			atoms
Resolution range	50-2.1	50-2.5	Average B	22.6	33.6
(Å)			factor (Å2),
			Main chain
Unique reflections	36333	10899	Average B	24.0	34.2
			factor (Å2),
			Side chain
Data redundancy	4.2	4.6	Average B	24.89	32.2
			factor (Å2),
			Solvent
Completeness (%)	98.7	99.4	Rcryst/Rfree	21.6/	23.9/
			(%)b	26.5	28.1
<I/σ(I)>	6.9	10.0	r.m.s.d.c	0.012	0.008
			bond
			lengths (Å)
Rsym (%)a	11.2	4.9	r.m.s.d.c	1.449	1.034
			bond
			angles (°)
aRsym = Σ|Iavg − Ij|/ΣIj.
bRcryst = Σ|Fo − Fc|/ΣFo, where Fo and Fc are observed and calculated structure factors, respectively, Rfree was calculated from a randomly chosen 5% of reflections excluded form the refinement, and Rcryst was calculated from the remaining 95% of reflections.
r.m.s.d. is the root-mean-square deviation from ideal geometry. Numbers in parentheses are for the highest resolution shell.

TABLE 2
Atomic coordinates for SF1 crystal
HEADER	---                 XX-XXX-XX WWAN
COMPND	SF-1, APO, with phospholipid
REMARK	3
REMARK	3	REFINEMENT.
REMARK	3	PROGRAM	: REFMAC 5.1.25
REMARK	3	AUTHORS	: MURSHUDOV, VAGIN, DODSON
REMARK	3
REMARK	3	REFINEMENT TARGET: MAXIMUM LIKELIHOOD
REMARK	3
REMARK	3	DATA USED IN REFINEMENT.
REMARK	3	RESOLUTION RANGE HIGH	(ANGSTROMS) :	2.10
REMARK	3	RESOLUTION RANGE LOW	(ANGSTROMS) :	50.00
REMARK	3	DATA CUTOFF	(SIGMA(F)) :	NONE
REMARK	3	COMPLETENESS FOR RANGE	(%) :	99.31
REMARK	3	NUMBER OF REFLECTIONS	:	34644
REMARK	3
REMARK	3	FIT TO DATA USED IN REFINEMENT.
REMARK	3	CROSS-VALIDATION METHOD	:	THROUGHOUT
REMARK	3	FREE R VALUE TEST SET SELECTION	:	RANDOM
REMARK	3	R VALUE	(WORKING + TEST SET)	:	0.21823
REMARK	3	R VALUE	(WORKING SET)	:	0.21597
REMARK	3	FREE R VALUE	:	0.26532
REMARK	3	FREE R VALUE TEST SET SIZE	(%)	:	4.3
REMARK	3	FREE R VALUE TEST SET COUNT		:	1565
REMARK	3
REMARK	3	FIT IN THE HIGHEST RESOLUTION BIN.
REMARK	3	TOTAL NUMBER OF BINS USED	:	20
REMARK	3	BIN RESOLUTION RANGE HIGH	:	2.100
REMARK	3	BIN RESOLUTION RANGE LOW	:	2.155
REMARK	3	REFLECTION IN BIN	(WORKING SET)	:	2494
REMARK	3	BIN R VALUE	(WORKING SET)	:	0.335
REMARK	3	BIN FREE R VALUE SET COUNT	:	0
REMARK	3	BIN FREE R VALUE	:	−999.000
REMARK	3
REMARK	3	NUMBER OF NON-HYDROGEN ATOMS USED IN REFINEMENT.
REMARK	3	ALL ATOMS	:	4324
REMARK	3
REMARK	3	B VALUES.
REMARK	3	FROM WILSON PLOT	(A**2) :	NULL
REMARK	3	MEAN B VALUE	(OVERALL, A**2) :	21.368
REMARK	3	OVERALL ANISOTROPIC B VALUE.
REMARK	3	B11 (A**2) :	1.34
REMARK	3	B22 (A**2) :	1.34
REMARK	3	B33 (A**2) :	−2.01
REMARK	3	B12 (A**2) :	0.67
REMARK	3	B13 (A**2) :	0.00
REMARK	3	B23 (A**2) :	0.00
REMARK	3
REMARK	3	ESTIMATED OVERALL COORDINATE ERROR.
REMARK	3	ESU BASED ON R VALUE	(A) :	0.230
REMARK	3	ESU BASED ON FREE R VALUE	(A) :	0.200
REMARK	3	ESU BASED ON MAXIMUM LIKELIHOOD	(A) :	0.205
REMARK	3	ESU FOR B VALUES BASED ON MAXIMUM LIKELIHOOD	(A**2) :	8.778
REMARK	3
REMARK	3	CORRELATION COEFFICIENTS.
REMARK	3	CORRELATION COEFFICIENT FO-FC	: 0.951
REMARK	3	CORRELATION COEFFICIENT FO-FC FREE	: 0.926
REMARK	3
REMARK	3	RMS DEVIATIONS FROM IDEAL VALUES	COUNT RMS WEIGHT
REMARK	3	BOND LENGTHS REFINED ATOMS	(A):	4150 ; 0.014 ; 0.021
REMARK	3	BOND LENGTHS OTHERS	(A):	3959 ; 0.002 ; 0.020
REMARK	3	BOND ANGLES REFINED ATOMS	(DEGREES):	5585 ; 1.449 ; 1.999
REMARK	3	BOND ANGLES OTHERS	(DEGREES):	9218 ; 0.870 ; 3.000
REMARK	3	TORSION ANGLES, PERIOD 1	(DEGREES):	489 ; 6.106 ; 5.000
REMARK	3	CHIRAL-CENTER RESTRAINTS	(A**3):	648 ; 0.083 ; 0.200
REMARK	3	GENERAL PLANES REFINED ATOMS	(A):	4450 ; 0.004 ; 0.020
REMARK	3	GENERAL PLANES OTHERS	(A):	771 ; 0.003 ; 0.020
REMARK	3	NON-BONDED CONTACTS REFINED ATOMS	(A):	1036 ; 0.204 ; 0.200
REMARK	3	NON-BONDED CONTACTS OTHERS	(A):	4476 ; 0.222 ; 0.200
REMARK	3	NON-BONDED TORSION OTHERS	(A):	2537 ; 0.095 ; 0.200
REMARK	3	H-BOND (X...Y) REFINED ATOMS	(A):	190 ; 0.216 ; 0.200
REMARK	3	SYMMETRY VDW REFINED ATOMS	(A):	19 ; 0.195 ; 0.200
REMARK	3	SYMMETRY VDW OTHERS	(A):	74 ; 0.202 ; 0.200
REMARK	3	SYMMETRY H-BOND REFINED ATOMS	(A):	14 ; 0.283 ; 0.200
REMARK	3
REMARK	3	ISOTROPIC THERMAL FACTOR RESTRAINTS.	COUNT RMS WEIGHT
REMARK	3	MAIN-CHAIN BOND REFINED ATOMS	(A**2):	2472 ; 0.483 ; 1.500
REMARK	3	MAIN-CHAIN ANGLE REFINED ATOMS	(A**2):	3971 ; 0.939 ; 2.000
REMARK	3	SIDE-CHAIN BOND REFINED ATOMS	(A**2):	1678 ; 1.532 ; 3.000
REMARK	3	SIDE-CHAIN ANGLE REFINED ATOMS	(A**2):	1614 ; 2.579 ; 4.500
REMARK	3
REMARK	3	NCS RESTRAINTS STATISTICS
REMARK	3	NUMBER OF NCS GROUPS: NULL
REMARK	3
REMARK	3
REMARK	3	TLS DETAILS
REMARK	3	NUMBER OF TLS GROUPS  :  5
REMARK	3
REMARK	3	TLS GROUP:   1
REMARK	3	NUMBER OF COMPONENTS GROUP:   4
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE:	A	221		A	248
REMARK	3	RESIDUE RANGE:	A	256		A	460
REMARK	3	RESIDUE RANGE:	L	1		L	1
REMARK	3	RESIDUE RANGE:	S	1		S	96
REMARK	3	ORIGIN FOR THE GROUP (A):	4.6333	15.7404	77.4678
REMARK	3	T TENSOR
REMARK	3	T11:	0.1475	T22:	0.0430
REMARK	3	T33:	0.0966	T12:	0.0424
REMARK	3	T13:	0.0394	T23:	−0.0073
REMARK	3	L TENSOR
REMARK	3	L11:	3.9798	L22:	1.1850
REMARK	3	L33:	3.8661	L12:	1.0540
REMARK	3	L13:	−1.4853	L23:	−0.7088
REMARK	3	S TENSOR
REMARK	3	S11:	−0.2073	S12:	0.0305	S13:	−0.2304
REMARK	3	S21:	−0.1365	S22:	0.1174	S23:	−0.1467
REMARK	3	S31:	0.4625	S32:	0.1031	S33:	0.0899
REMARK	3
REMARK	3	TLS GROUP:  2
REMARK	3	NUMBER OF COMPONENTS GROUP:   3
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE:	B	221		B	459
REMARK	3	RESIDUE RANGE:	L	2		L	2
REMARK	3	RESIDUE RANGE:	S	97		S	189
REMARK	3	ORIGIN FOR THE GROUP (A):	13.8346	−26.5101	96.2497
REMARK	3	T TENSOR
REMARK	3	T11:	0.0364	T22:	0.0642
REMARK	3	T33:	0.1365	T12:	−0.0393
REMARK	3	T13:	−0.0407	T23:	0.0165
REMARK	3	L TENSOR
REMARK	3	L11:	2.3171	L22:	2.3418
REMARK	3	L33:	4.7606	L12:	−0.1019
REMARK	3	L13:	−0.9180	L23:	0.1451
REMARK	3	S TENSOR
REMARK	3	S11:	0.0958	S12:	−0.0670	S13:	−0.0457
REMARK	3	S21:	0.1480	S22:	−0.1934	S23:	−0.0795
REMARK	3	S31:	−0.1881	S32:	0.4297	S33:	0.0975
REMARK	3
REMARK	3	TLS GROUP:  3
REMARK	3	NUMBER OF COMPONENTS GROUP:   1
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE:	S	190		S	229
REMARK	3	ORIGIN FOR THE GROUP (A):	3.9384	−7.1494	86.0037
REMARK	3	T TENSOR
REMARK	3	T11:	0.1945	T22:	0.2987
REMARK	3	T33:	0.1919	T12:	−0.0351
REMARK	3	T13:	0.0624	T23:	−0.0477
REMARK	3	L TENSOR
REMARK	3	L11:	0.1838	L22:	0.9466
REMARK	3	L33:	0.1083	L12:	−0.1097
REMARK	3	L13:	0.2112	L23:	−0.3093
REMARK	3	S TENSOR
REMARK	3	S11:	−0.0201	S12:	0.0012	S13:	−0.0369
REMARK	3	S21:	0.0032	S22:	0.0667	S23:	−0.1284
REMARK	3	S31:	−0.0260	S32:	−0.0310	S33:	−0.0465
REMARK	3
REMARK	3	TLS GROUP:  4
REMARK	3	NUMBER OF COMPONENTS GROUP:   2
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE:	P	741		P	752
REMARK	3	RESIDUE RANGE:	S	230		S	232
REMARK	3	ORIGIN FOR THE GROUP (A):	12.8434	22.0178	93.3912
REMARK	3	T TENSOR
REMARK	3	T11:	0.1206	T22:	0.2030
REMARK	3	T33:	0.0632	T12:	0.0220
REMARK	3	T13:	0.0091	T23:	−0.0144
REMARK	3	L TENSOR
REMARK	3	L11:	28.8425	L22:	4.4555
REMARK	3	L33:	26.0428	L12:	7.0765
REMARK	3	L13:	1.3623	L23:	−4.4463
REMARK	3	S TENSOR
REMARK	3	S11:	−0.3451	S12:	0.0365	S13:	−0.0457
REMARK	3	S21:	0.2228	S22:	0.0521	S23:	−0.7244
REMARK	3	S31:	−0.4484	S32:	1.1557	S33:	0.2930
REMARK	3
REMARK	3	TLS GROUP:  5
REMARK	3	NUMBER OF COMPONENTS GROUP:   2
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE:	Q	741		Q	751
REMARK	3	RESIDUE RANGE:	S	233		S	235
REMARK	3	ORIGIN FOR THE GROUP (A):	29.1754	−18.1701	101.3310
REMARK	3	T TENSOR
REMARK	3	T11:	0.5240	T22:	0.5317
REMARK	3	T33:	0.5700	T12:	−0.3155
REMARK	3	T13:	−0.0879	T23:	0.1024
REMARK	3	L TENSOR
REMARK	3	L11:	20.5790	L22:	−4.0154
REMARK	3	L33:	4.2051	L12:	−1.1596
REMARK	3	L13:	6.8311	L23:	−2.6023
REMARK	3	S TENSOR
REMARK	3	S11:	0.2938	S12:	−0.6226	S13:	1.0566
REMARK	3	S21:	0.3209	S22:	−0.7442	S23:	−1.7446
REMARK	3	S31:	−0.1387	S32:	0.6812	S33:	0.4504
REMARK	3
REMARK	3
REMARK	3	BULK SOLVENT MODELLING.
REMARK	3	METHOD USED: BABINET MODEL WITH MASK
REMARK	3	PARAMETERS FOR MASK CALCULATION
REMARK	3	VDW PROBE RADIUS	:	1.40
REMARK	3	ION PROBE RADIUS	:	0.80
REMARK	3	SHRINKAGE RADIUS	:	0.80
REMARK	3
REMARK	3	OTHER REFINEMENT REMARKS:
REMARK	3	HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS
REMARK	3
LINK	LEU A 248	PRO A 256	gap
CRYST1	73.601  73.601  195.678  90.00  90.00  120.00  P  31  2  1      0
SCALE1	0.013587 0.007844 0.000000  0.00000
SCALE2	0.000000 0.015689 0.000000  0.00000
SCALE3	0.000000 0.000000 0.005110  0.00000
ATOM	1	N	PRO	A	221	19.749	11.027	56.510	1.00	31.78	N
ATOM	2	CA	PRO	A	221	20.828	10.210	57.147	1.00	31.53	C
ATOM	3	CB	PRO	A	221	21.683	9.741	55.947	1.00	31.42	C
ATOM	4	CG	PRO	A	221	21.395	10.756	54.830	1.00	31.70	C
ATOM	5	CD	PRO	A	221	20.091	11.446	55.134	1.00	31.30	C
ATOM	6	C	PRO	A	221	21.630	11.069	58.108	1.00	31.12	C
ATOM	7	O	PRO	A	221	21.845	10.667	59.260	1.00	31.71	O
ATOM	15	N	ASN	A	222	22.025	12.248	57.626	1.00	30.29	N
ATOM	16	CA	ASN	A	222	22.886	13.170	58.351	1.00	29.66	C
ATOM	17	CB	ASN	A	222	23.483	14.136	57.322	1.00	29.96	C
ATOM	18	CG	ASN	A	222	24.696	14.891	57.842	1.00	31.45	C
ATOM	19	OD1	ASN	A	222	25.860	14.636	57.242	1.00	33.52	O
ATOM	20	ND2	ASN	A	222	24.582	15.714	58.759	1.00	30.80	N
ATOM	21	C	ASN	A	222	22.102	13.906	59.456	1.00	28.68	C
ATOM	22	O	ASN	A	222	21.881	15.118	59.381	1.00	29.00	O
ATOM	29	N	VAL	A	223	21.695	13.175	60.495	1.00	27.20	N
ATOM	30	CA	VAL	A	223	20.790	13.709	61.523	1.00	26.08	C
ATOM	31	CB	VAL	A	223	20.417	12.627	62.577	1.00	25.67	C
ATOM	32	CG1	VAL	A	223	19.438	13.173	63.626	1.00	25.61	C
ATOM	33	CG2	VAL	A	223	19.817	11.394	61.912	1.00	25.52	C
ATOM	34	C	VAL	A	223	21.443	14.917	62.220	1.00	25.68	C
ATOM	35	O	VAL	A	223	22.627	14.842	62.558	1.00	25.95	O
ATOM	45	N	PRO	A	224	20.708	16.020	62.431	1.00	24.97	N
ATOM	46	CA	PRO	A	224	21.288	17.199	63.098	1.00	25.02	C
ATOM	47	CB	PRO	A	224	20.083	18.146	63.301	1.00	24.79	C
ATOM	48	CG	PRO	A	224	19.016	17.666	62.370	1.00	24.66	C
ATOM	49	CD	PRO	A	224	19.291	16.231	62.074	1.00	24.65	C
ATOM	50	C	PRO	A	224	21.921	16.834	64.453	1.00	25.14	C
ATOM	51	O	PRO	A	224	21.413	15.963	65.171	1.00	25.35	O
ATOM	59	N	GLU	A	225	23.010	17.498	64.805	1.00	24.91	N
ATOM	60	CA	GLU	A	225	23.758	17.098	65.978	1.00	25.05	C
ATOM	61	CB	GLU	A	225	25.147	17.761	65.999	1.00	25.46	C
ATOM	62	CG	GLU	A	225	25.251	19.065	66.756	1.00	28.01	C
ATOM	63	CD	GLU	A	225	26.592	19.739	66.534	1.00	32.26	C
ATOM	64	OE1	GLU	A	225	26.950	20.003	65.348	1.00	34.55	O
ATOM	65	OE2	GLU	A	225	27.292	20.003	67.553	1.00	35.66	O
ATOM	66	C	GLU	A	225	22.959	17.319	67.264	1.00	24.27	C
ATOM	67	O	GLU	A	225	23.053	16.518	68.186	1.00	24.47	O
ATOM	74	N	LEU	A	226	22.147	18.373	67.326	1.00	23.39	N
ATOM	75	CA	LEU	A	226	21.289	18.584	68.490	1.00	22.56	C
ATOM	76	CB	LEU	A	226	20.429	19.851	68.344	1.00	22.49	C
ATOM	77	CG	LEU	A	226	19.457	20.187	69.484	1.00	23.72	C
ATOM	78	CD1	LEU	A	226	20.154	20.655	70.761	1.00	23.89	C
ATOM	79	CD2	LEU	A	226	18.461	21.248	69.038	1.00	25.85	C
ATOM	80	C	LEU	A	226	20.374	17.404	68.729	1.00	21.80	C
ATOM	81	O	LEU	A	226	20.141	17.017	69.876	1.00	20.65	O
ATOM	93	N	ILE	A	227	19.821	16.860	67.653	1.00	21.23	N
ATOM	94	CA	ILE	A	227	18.926	15.719	67.793	1.00	21.38	C
ATOM	95	CB	ILE	A	227	18.129	15.445	66.480	1.00	21.29	C
ATOM	96	CG1	ILE	A	227	17.113	16.580	66.256	1.00	21.81	C
ATOM	97	CD1	ILE	A	227	16.198	16.411	65.050	1.00	19.55	C
ATOM	98	CG2	ILE	A	227	17.391	14.085	66.555	1.00	20.57	C
ATOM	99	C	ILE	A	227	19.706	14.495	68.277	1.00	21.27	C
ATOM	100	O	ILE	A	227	19.210	13.721	69.093	1.00	20.95	O
ATOM	112	N	LEU	A	228	20.933	14.348	67.794	1.00	21.59	N
ATOM	113	CA	LEU	A	228	21.781	13.237	68.211	1.00	21.96	C
ATOM	114	CB	LEU	A	228	23.087	13.187	67.394	1.00	21.90	C
ATOM	115	CG	LEU	A	228	22.985	12.753	65.927	1.00	22.19	C
ATOM	116	CD1	LEU	A	228	24.330	12.847	65.243	1.00	22.53	C
ATOM	117	CD2	LEU	A	228	22.460	11.333	65.797	1.00	22.94	C
ATOM	118	C	LEU	A	228	22.074	13.327	69.705	1.00	21.76	C
ATOM	119	O	LEU	A	228	21.982	12.333	70.410	1.00	21.30	O
ATOM	131	N	GLN	A	229	22.385	14.530	70.179	1.00	22.09	N
ATOM	132	CA	GLN	A	229	22.735	14.735	71.577	1.00	22.37	C
ATOM	133	CB	GLN	A	229	23.291	16.136	71.828	1.00	22.62	C
ATOM	134	CG	GLN	A	229	24.781	16.290	71.481	1.00	24.53	C
ATOM	135	CD	GLN	A	229	25.113	17.591	70.747	1.00	26.83	C
ATOM	136	OE1	GLN	A	229	24.389	18.585	70.866	1.00	30.47	O
ATOM	137	NE2	GLN	A	229	26.215	17.586	69.991	1.00	29.75	N
ATOM	138	C	GLN	A	229	21.529	14.488	72.437	1.00	22.36	C
ATOM	139	O	GLN	A	229	21.664	13.927	73.509	1.00	23.16	O
ATOM	148	N	LEU	A	230	20.344	14.872	71.967	1.00	22.17	N
ATOM	149	CA	LEU	A	230	19.117	14.611	72.713	1.00	21.90	C
ATOM	150	CB	LEU	A	230	17.939	15.378	72.112	1.00	22.12	C
ATOM	151	CG	LEU	A	230	17.860	16.871	72.402	1.00	21.33	C
ATOM	152	CD1	LEU	A	230	16.820	17.501	71.498	1.00	21.43	C
ATOM	153	CD2	LEU	A	230	17.530	17.115	73.837	1.00	22.18	C
ATOM	154	C	LEU	A	230	18.729	13.131	72.835	1.00	21.94	C
ATOM	155	O	LEU	A	230	18.129	12.737	73.820	1.00	22.23	O
ATOM	167	N	LEU	A	231	19.030	12.320	71.832	1.00	22.27	N
ATOM	168	CA	LEU	A	231	18.751	10.881	71.900	1.00	22.30	C
ATOM	169	CB	LEU	A	231	19.030	10.208	70.564	1.00	22.03	C
ATOM	170	CG	LEU	A	231	18.053	10.602	69.467	1.00	21.89	C
ATOM	171	CD1	LEU	A	231	18.669	10.297	68.104	1.00	21.46	C
ATOM	172	CD2	LEU	A	231	16.693	9.904	69.676	1.00	20.61	C
ATOM	173	C	LEU	A	231	19.615	10.219	72.934	1.00	22.38	C
ATOM	174	O	LEU	A	231	19.179	9.295	73.599	1.00	22.35	O
ATOM	186	N	GLN	A	232	20.853	10.683	73.036	1.00	22.90	N
ATOM	187	CA	GLN	A	232	21.783	10.170	74.026	1.00	23.81	C
ATOM	188	CB	GLN	A	232	23.197	10.691	73.746	1.00	23.79	C
ATOM	189	CG	GLN	A	232	23.824	10.126	72.475	1.00	25.25	C
ATOM	190	CD	GLN	A	232	24.105	8.618	72.540	1.00	27.46	C
ATOM	191	OE1	GLN	A	232	23.187	7.818	72.743	1.00	30.46	O
ATOM	192	NE2	GLN	A	232	25.366	8.231	72.346	1.00	28.30	N
ATOM	193	C	GLN	A	232	21.356	10.495	75.460	1.00	24.17	C
ATOM	194	O	GLN	A	232	21.738	9.799	76.382	1.00	23.68	O
ATOM	203	N	LEU	A	233	20.565	11.551	75.641	1.00	25.36	N
ATOM	204	CA	LEU	A	233	20.042	11.902	76.955	1.00	26.29	C
ATOM	205	CB	LEU	A	233	19.756	13.401	77.063	1.00	26.37	C
ATOM	206	CG	LEU	A	233	20.852	14.374	76.621	1.00	26.99	C
ATOM	207	CD1	LEU	A	233	20.430	15.790	76.932	1.00	27.20	C
ATOM	208	CD2	LEU	A	233	22.191	14.079	77.258	1.00	28.29	C
ATOM	209	C	LEU	A	233	18.765	11.158	77.264	1.00	27.41	C
ATOM	210	O	LEU	A	233	18.374	11.053	78.419	1.00	27.54	O
ATOM	222	N	GLU	A	234	18.089	10.665	76.238	1.00	28.81	N
ATOM	223	CA	GLU	A	234	16.796	10.017	76.438	1.00	29.95	C
ATOM	224	CB	GLU	A	234	16.184	9.618	75.082	1.00	30.25	C
ATOM	225	CG	GLU	A	234	14.673	9.383	75.062	1.00	31.11	C
ATOM	226	CD	GLU	A	234	13.859	10.567	75.503	1.00	32.15	C
ATOM	227	OE1	GLU	A	234	14.296	11.709	75.284	1.00	34.81	O
ATOM	228	OE2	GLU	A	234	12.775	10.359	76.088	1.00	36.52	O
ATOM	229	C	GLU	A	234	17.022	8.809	77.359	1.00	30.87	C
ATOM	230	O	GLU	A	234	17.825	7.928	77.039	1.00	31.32	O
ATOM	237	N	PRO	A	235	16.366	8.791	78.522	1.00	32.07	N
ATOM	238	CA	PRO	A	235	16.629	7.759	79.536	1.00	33.02	C
ATOM	239	CB	PRO	A	235	15.935	8.318	80.787	1.00	32.52	C
ATOM	240	CG	PRO	A	235	14.817	9.079	80.254	1.00	32.38	C
ATOM	241	CD	PRO	A	235	15.327	9.731	78.981	1.00	32.22	C
ATOM	242	C	PRO	A	235	16.027	6.403	79.187	1.00	34.42	C
ATOM	243	O	PRO	A	235	16.532	5.369	79.667	1.00	34.42	O
ATOM	251	N	ASP	A	236	14.960	6.407	78.381	1.00	35.62	N
ATOM	252	CA	ASP	A	236	14.255	5.161	78.110	1.00	36.30	C
ATOM	253	CB	ASP	A	236	13.056	5.358	77.167	1.00	37.21	C
ATOM	254	CG	ASP	A	236	11.998	4.244	77.309	1.00	38.47	C
ATOM	255	OD1	ASP	A	236	12.046	3.477	78.310	1.00	39.87	O
ATOM	256	OD2	ASP	A	236	11.082	4.074	76.464	1.00	39.46	O
ATOM	257	C	ASP	A	236	15.196	4.130	77.529	1.00	36.11	C
ATOM	258	O	ASP	A	236	15.715	4.285	76.411	1.00	36.58	O
ATOM	263	N	GLU	A	237	15.461	3.127	78.365	1.00	35.63	N
ATOM	264	CA	GLU	A	237	15.920	1.815	77.958	1.00	34.76	C
ATOM	265	CB	GLU	A	237	17.452	1.749	78.016	1.00	34.92	C
ATOM	266	CG	GLU	A	237	18.059	0.386	77.654	1.00	34.72	C
ATOM	267	CD	GLU	A	237	19.339	0.480	76.821	1.00	35.23	C
ATOM	268	OE1	GLU	A	237	19.647	1.600	76.316	1.00	35.31	O
ATOM	269	OE2	GLU	A	237	20.029	−0.573	76.675	1.00	33.17	O
ATOM	270	C	GLU	A	237	15.233	0.802	78.920	1.00	34.49	C
ATOM	271	O	GLU	A	237	15.843	−0.207	79.342	1.00	34.67	O
ATOM	278	N	ASP	A	238	13.954	1.093	79.237	1.00	33.68	N
ATOM	279	CA	ASP	A	238	13.111	0.357	80.218	1.00	33.04	C
ATOM	280	CB	ASP	A	238	13.355	−1.173	80.194	1.00	32.75	C
ATOM	281	CG	ASP	A	238	12.956	−1.815	78.862	1.00	32.38	C
ATOM	282	OD1	ASP	A	238	12.070	−1.262	78.185	1.00	32.82	O
ATOM	283	OD2	ASP	A	238	13.452	−2.871	78.407	1.00	32.13	O
ATOM	284	C	ASP	A	238	13.241	0.914	81.643	1.00	32.79	C
ATOM	285	O	ASP	A	238	12.569	0.466	82.582	1.00	32.38	O
ATOM	290	N	GLN	A	239	14.073	1.938	81.769	1.00	32.60	N
ATOM	291	CA	GLN	A	239	14.556	2.396	83.057	1.00	32.49	C
ATOM	292	CB	GLN	A	239	15.908	3.089	82.875	1.00	32.72	C
ATOM	293	CG	GLN	A	239	16.749	3.167	84.139	1.00	34.14	C
ATOM	294	CD	GLN	A	239	17.662	4.394	84.162	1.00	36.23	C
ATOM	295	OE1	GLN	A	239	18.906	4.259	84.069	1.00	37.18	O
ATOM	296	NE2	GLN	A	239	17.054	5.593	84.285	1.00	36.31	N
ATOM	297	C	GLN	A	239	13.563	3.346	83.691	1.00	31.96	C
ATOM	298	O	GLN	A	239	13.450	3.386	84.897	1.00	32.02	O
ATOM	307	N	VAL	A	240	12.850	4.113	82.871	1.00	31.79	N
ATOM	308	CA	VAL	A	240	11.807	5.026	83.354	1.00	31.21	C
ATOM	309	CB	VAL	A	240	11.184	5.791	82.162	1.00	31.13	C
ATOM	310	CG1	VAL	A	240	9.960	6.646	82.573	1.00	30.83	C
ATOM	311	CG2	VAL	A	240	12.248	6.693	81.525	1.00	31.08	C
ATOM	312	C	VAL	A	240	10.759	4.230	84.165	1.00	31.32	C
ATOM	313	O	VAL	A	240	10.496	4.530	85.345	1.00	31.45	O
ATOM	323	N	ARG	A	241	10.218	3.186	83.538	1.00	30.93	N
ATOM	324	CA	ARG	A	241	9.259	2.273	84.162	1.00	30.60	C
ATOM	325	CB	ARG	A	241	8.899	1.183	83.159	1.00	30.71	C
ATOM	326	CG	ARG	A	241	7.929	0.147	83.673	1.00	31.52	C
ATOM	327	CD	ARG	A	241	7.162	−0.579	82.572	1.00	33.05	C
ATOM	328	NE	ARG	A	241	7.949	−0.690	81.339	1.00	34.64	N
ATOM	329	CZ	ARG	A	241	7.511	−0.408	80.105	1.00	35.34	C
ATOM	330	NH1	ARG	A	241	6.257	0.006	79.887	1.00	36.86	N
ATOM	331	NH2	ARG	A	241	8.343	−0.545	79.071	1.00	35.17	N
ATOM	332	C	ARG	A	241	9.740	1.613	85.457	1.00	30.38	C
ATOM	333	O	ARG	A	241	8.975	1.503	86.420	1.00	31.06	O
ATOM	347	N	ALA	A	242	10.978	1.135	85.474	1.00	29.97	N
ATOM	348	CA	ALA	A	242	11.552	0.553	86.688	1.00	29.74	C
ATOM	349	CB	ALA	A	242	12.966	0.046	86.410	1.00	29.59	C
ATOM	350	C	ALA	A	242	11.575	1.600	87.804	1.00	29.95	C
ATOM	351	O	ALA	A	242	11.000	1.413	88.881	1.00	29.83	O
ATOM	357	N	ARG	A	243	12.224	2.720	87.508	1.00	30.42	N
ATOM	358	CA	ARG	A	243	12.383	3.819	88.455	1.00	30.93	C
ATOM	359	CB	ARG	A	243	13.206	4.997	87.848	1.00	30.98	C
ATOM	360	CG	ARG	A	243	14.530	4.597	87.092	1.00	31.63	C
ATOM	361	CD	ARG	A	243	15.868	5.112	87.683	1.00	32.42	C
ATOM	362	NE	ARG	A	243	16.781	4.037	88.116	1.00	33.83	N
ATOM	363	CZ	ARG	A	243	18.020	4.230	88.600	1.00	33.23	C
ATOM	364	NH1	ARG	A	243	18.522	5.465	88.720	1.00	33.18	N
ATOM	365	NH2	ARG	A	243	18.758	3.184	88.974	1.00	32.26	N
ATOM	366	C	ARG	A	243	11.027	4.328	88.979	1.00	31.35	C
ATOM	367	O	ARG	A	243	10.981	4.837	90.093	1.00	32.37	O
ATOM	381	N	ILE	A	244	9.928	4.190	88.224	1.00	31.35	N
ATOM	382	CA	ILE	A	244	8.628	4.722	88.691	1.00	31.19	C
ATOM	383	CB	ILE	A	244	7.633	4.951	87.490	1.00	30.92	C
ATOM	384	CG1	ILE	A	244	8.198	6.084	86.606	1.00	30.47	C
ATOM	385	CD1	ILE	A	244	7.202	7.094	86.014	1.00	30.15	C
ATOM	386	CG2	ILE	A	244	6.189	5.234	87.978	1.00	30.30	C
ATOM	387	C	ILE	A	244	8.078	3.876	89.855	1.00	31.38	C
ATOM	388	O	ILE	A	244	8.013	2.650	89.760	1.00	31.07	O
ATOM	400	N	LEU	A	245	7.693	4.581	90.938	1.00	32.28	N
ATOM	401	CA	LEU	A	245	7.757	4.086	92.358	1.00	32.82	C
ATOM	402	CB	LEU	A	245	8.495	5.111	93.248	1.00	32.92	C
ATOM	403	CG	LEU	A	245	10.022	5.177	93.220	1.00	33.54	C
ATOM	404	CD1	LEU	A	245	10.522	6.580	93.642	1.00	33.91	C
ATOM	405	CD2	LEU	A	245	10.653	4.071	94.098	1.00	34.68	C
ATOM	406	C	LEU	A	245	6.448	3.780	93.120	1.00	32.99	C
ATOM	407	O	LEU	A	245	6.519	3.314	94.270	1.00	33.20	O
ATOM	419	N	GLY	A	246	5.276	4.085	92.556	1.00	33.22	N
ATOM	420	CA	GLY	A	246	4.055	3.519	93.118	1.00	33.39	C
ATOM	421	C	GLY	A	246	4.295	2.012	93.198	1.00	33.55	C
ATOM	422	O	GLY	A	246	4.530	1.350	92.176	1.00	34.19	O
ATOM	426	N	SER	A	247	4.275	1.452	94.399	1.00	33.28	N
ATOM	427	CA	SER	A	247	4.957	0.182	94.587	1.00	33.23	C
ATOM	428	CB	SER	A	247	5.817	0.245	95.869	1.00	33.55	C
ATOM	429	OG	SER	A	247	6.769	1.308	95.766	1.00	33.87	O
ATOM	430	C	SER	A	247	4.075	−1.099	94.507	1.00	33.03	C
ATOM	431	O	SER	A	247	4.097	−1.944	95.419	1.00	32.95	O
ATOM	437	N	LEU	A	248	3.335	−1.234	93.393	1.00	32.48	N
ATOM	438	CA	LEU	A	248	2.766	−2.530	92.935	1.00	31.66	C
ATOM	439	CB	LEU	A	248	3.829	−3.361	92.163	1.00	31.38	C
ATOM	440	CG	LEU	A	248	4.535	−2.785	90.915	1.00	29.42	C
ATOM	441	CD1	LEU	A	248	5.668	−3.701	90.410	1.00	27.71	C
ATOM	442	CD2	LEU	A	248	3.535	−2.534	89.795	1.00	28.74	C
ATOM	443	C	LEU	A	248	2.168	−3.390	94.057	1.00	31.65	C
ATOM	444	O	LEU	A	248	2.636	−4.502	94.334	1.00	31.42	O
ATOM	456	N	PRO	A	256	−13.963	−10.661	86.340	1.00	29.31	N
ATOM	457	CA	PRO	A	256	−14.062	−9.960	87.630	1.00	29.13	C
ATOM	458	CB	PRO	A	256	−13.772	−11.084	88.652	1.00	29.36	C
ATOM	459	CG	PRO	A	256	−14.306	−12.402	87.954	1.00	29.16	C
ATOM	460	CD	PRO	A	256	−14.415	−12.067	86.451	1.00	29.39	C
ATOM	461	C	PRO	A	256	−13.064	−8.811	87.770	1.00	29.05	C
ATOM	462	O	PRO	A	256	−12.108	−8.943	88.543	1.00	29.49	O
ATOM	470	N	ASP	A	257	−13.281	−7.706	87.049	1.00	28.58	N
ATOM	471	CA	ASP	A	257	−12.420	−6.522	87.195	1.00	28.52	C
ATOM	472	CB	ASP	A	257	−11.670	−6.216	85.891	1.00	28.59	C
ATOM	473	CG	ASP	A	257	−10.181	−6.549	85.993	1.00	29.04	C
ATOM	474	OD1	ASP	A	257	−9.844	−7.668	86.472	1.00	29.76	O
ATOM	475	OD2	ASP	A	257	−9.284	−5.752	85.636	1.00	29.42	O
ATOM	476	C	ASP	A	257	−13.145	−5.283	87.763	1.00	28.19	C
ATOM	477	O	ASP	A	257	−14.358	−5.306	87.956	1.00	28.40	O
ATOM	482	N	GLN	A	258	−12.384	−4.213	88.022	1.00	27.26	N
ATOM	483	CA	GLN	A	258	−12.690	−3.303	89.135	1.00	26.55	C
ATOM	484	CB	GLN	A	258	−11.721	−3.555	90.322	1.00	27.13	C
ATOM	485	CG	GLN	A	258	−10.625	−4.625	90.132	1.00	29.11	C
ATOM	486	CD	GLN	A	258	−9.278	−4.059	89.669	1.00	31.47	C
ATOM	487	OE1	GLN	A	258	−9.160	−2.877	89.309	1.00	34.18	O
ATOM	488	NE2	GLN	A	258	−8.256	−4.915	89.677	1.00	33.92	N
ATOM	489	C	GLN	A	258	−12.675	−1.821	88.784	1.00	25.03	C
ATOM	490	O	GLN	A	258	−12.436	−1.460	87.643	1.00	24.89	O
ATOM	499	N	PRO	A	259	−12.964	−0.958	89.759	1.00	23.54	N
ATOM	500	CA	PRO	A	259	−12.810	0.489	89.557	1.00	22.95	C
ATOM	501	CB	PRO	A	259	−13.391	1.081	90.854	1.00	22.93	C
ATOM	502	CG	PRO	A	259	−14.229	−0.017	91.459	1.00	22.46	C
ATOM	503	CD	PRO	A	259	−13.508	−1.260	91.102	1.00	23.17	C
ATOM	504	C	PRO	A	259	−11.352	0.956	89.334	1.00	22.51	C
ATOM	505	O	PRO	A	259	−10.404	0.315	89.775	1.00	21.72	O
ATOM	513	N	ALA	A	260	−11.190	2.077	88.635	1.00	22.85	N
ATOM	514	CA	ALA	A	260	−9.867	2.686	88.417	1.00	22.95	C
ATOM	515	CB	ALA	A	260	−9.980	3.975	87.616	1.00	22.96	C
ATOM	516	C	ALA	A	260	−9.180	2.961	89.747	1.00	23.03	C
ATOM	517	O	ALA	A	260	−9.820	3.398	90.708	1.00	23.27	O
ATOM	523	N	ALA	A	261	−7.883	2.682	89.797	1.00	22.89	N
ATOM	524	CA	ALA	A	261	−7.069	2.951	90.980	1.00	22.55	C
ATOM	525	CB	ALA	A	261	−5.858	2.019	90.985	1.00	22.54	C
ATOM	526	C	ALA	A	261	−6.628	4.422	91.000	1.00	22.31	C
ATOM	527	O	ALA	A	261	−5.475	4.724	90.727	1.00	22.45	O
ATOM	533	N	PHE	A	262	−7.553	5.323	91.335	1.00	21.98	N
ATOM	534	CA	PHE	A	262	−7.343	6.772	91.242	1.00	21.66	C
ATOM	535	CB	PHE	A	262	−8.564	7.536	91.792	1.00	21.62	C
ATOM	536	CG	PHE	A	262	−8.531	9.028	91.514	1.00	22.25	C
ATOM	537	CD1	PHE	A	262	−8.998	9.538	90.316	1.00	24.99	C
ATOM	538	CE1	PHE	A	262	−8.956	10.927	90.054	1.00	24.78	C
ATOM	539	CZ	PHE	A	262	−8.454	11.796	90.998	1.00	23.51	C
ATOM	540	CE2	PHE	A	262	−7.985	11.308	92.182	1.00	22.70	C
ATOM	541	CD2	PHE	A	262	−8.030	9.922	92.447	1.00	23.43	C
ATOM	542	C	PHE	A	262	−6.059	7.289	91.905	1.00	21.42	C
ATOM	543	O	PHE	A	262	−5.257	7.939	91.240	1.00	22.01	O
ATOM	553	N	GLY	A	263	−5.874	7.031	93.196	1.00	21.28	N
ATOM	554	CA	GLY	A	263	−4.713	7.536	93.919	1.00	21.27	C
ATOM	555	C	GLY	A	263	−3.387	7.088	93.320	1.00	21.23	C
ATOM	556	O	GLY	A	263	−2.401	7.809	93.311	1.00	21.23	O
ATOM	560	N	LEU	A	264	−3.377	5.869	92.819	1.00	21.13	N
ATOM	561	CA	LEU	A	264	−2.192	5.261	92.264	1.00	21.46	C
ATOM	562	CB	LEU	A	264	−2.413	3.743	92.184	1.00	21.82	C
ATOM	563	CG	LEU	A	264	−1.217	2.831	92.344	1.00	23.71	C
ATOM	564	CD1	LEU	A	264	−0.232	3.001	91.177	1.00	25.37	C
ATOM	565	CD2	LEU	A	264	−0.551	3.055	93.723	1.00	26.08	C
ATOM	566	C	LEU	A	264	−1.916	5.853	90.895	1.00	20.85	C
ATOM	567	O	LEU	A	264	−0.783	6.068	90.527	1.00	20.79	O
ATOM	579	N	LEU	A	265	−2.972	6.134	90.149	1.00	20.83	N
ATOM	580	CA	LEU	A	265	−2.842	6.800	88.862	1.00	20.82	C
ATOM	581	CB	LEU	A	265	−4.197	6.840	88.126	1.00	20.71	C
ATOM	582	CG	LEU	A	265	−4.706	5.460	87.649	1.00	20.97	C
ATOM	583	CD1	LEU	A	265	−6.140	5.511	87.155	1.00	19.98	C
ATOM	584	CD2	LEU	A	265	−3.787	4.908	86.583	1.00	20.44	C
ATOM	585	C	LEU	A	265	−2.278	8.190	89.048	1.00	20.79	C
ATOM	586	O	LEU	A	265	−1.487	8.646	88.235	1.00	20.83	O
ATOM	598	N	CYS	A	266	−2.687	8.848	90.128	1.00	21.00	N
ATOM	599	CA	CYS	A	266	−2.173	10.165	90.495	1.00	21.27	C
ATOM	600	CB	CYS	A	266	−2.921	10.730	91.704	1.00	20.77	C
ATOM	601	SG	CYS	A	266	−4.608	11.260	91.325	1.00	22.47	S
ATOM	602	C	CYS	A	266	−0.697	10.084	90.810	1.00	21.11	C
ATOM	603	O	CYS	A	266	0.076	10.860	90.304	1.00	20.94	O
ATOM	609	N	ARG	A	267	−0.340	9.129	91.649	1.00	21.40	N
ATOM	610	CA	ARG	A	267	1.040	8.855	92.026	1.00	22.25	C
ATOM	611	CB	ARG	A	267	1.096	7.599	92.907	1.00	22.94	C
ATOM	612	CG	ARG	A	267	1.828	7.725	94.225	1.00	25.90	C
ATOM	613	CD	ARG	A	267	1.088	7.037	95.385	1.00	29.27	C
ATOM	614	NE	ARG	A	267	−0.120	7.794	95.747	1.00	32.39	N
ATOM	615	CZ	ARG	A	267	−1.275	7.279	96.222	1.00	34.13	C
ATOM	616	NH1	ARG	A	267	−1.442	5.960	96.419	1.00	34.21	N
ATOM	617	NH2	ARG	A	267	−2.285	8.106	96.512	1.00	34.21	N
ATOM	618	C	ARG	A	267	1.918	8.622	90.807	1.00	21.47	C
ATOM	619	O	ARG	A	267	3.024	9.113	90.734	1.00	21.61	O
ATOM	633	N	MET	A	268	1.401	7.853	89.863	1.00	21.10	N
ATOM	634	CA	MET	A	268	2.111	7.499	88.645	1.00	20.53	C
ATOM	635	CB	MET	A	268	1.264	6.522	87.832	1.00	20.55	C
ATOM	636	CG	MET	A	268	1.774	6.208	86.454	1.00	20.15	C
ATOM	637	SD	MET	A	268	0.536	5.334	85.500	1.00	20.07	S
ATOM	638	CE	MET	A	268	−0.412	6.684	84.990	1.00	20.41	C
ATOM	639	C	MET	A	268	2.416	8.717	87.825	1.00	19.68	C
ATOM	640	O	MET	A	268	3.487	8.823	87.273	1.00	19.96	O
ATOM	650	N	ALA	A	269	1.458	9.630	87.749	1.00	19.50	N
ATOM	651	CA	ALA	A	269	1.600	10.873	86.989	1.00	19.16	C
ATOM	652	CB	ALA	A	269	0.243	11.562	86.815	1.00	18.96	C
ATOM	653	C	ALA	A	269	2.602	11.825	87.635	1.00	18.77	C
ATOM	654	O	ALA	A	269	3.337	12.530	86.935	1.00	17.62	O
ATOM	660	N	ASP	A	270	2.630	11.806	88.965	1.00	18.70	N
ATOM	661	CA	ASP	A	270	3.518	12.642	89.759	1.00	19.28	C
ATOM	662	CB	ASP	A	270	3.197	12.497	91.256	1.00	19.29	C
ATOM	663	CG	ASP	A	270	2.056	13.400	91.721	1.00	20.26	C
ATOM	664	OD1	ASP	A	270	1.536	14.198	90.895	1.00	20.42	O
ATOM	665	OD2	ASP	A	270	1.623	13.368	92.912	1.00	19.70	O
ATOM	666	C	ASP	A	270	4.949	12.209	89.543	1.00	19.62	C
ATOM	667	O	ASP	A	270	5.840	13.037	89.447	1.00	19.68	O
ATOM	672	N	GLN	A	271	5.158	10.899	89.493	1.00	19.39	N
ATOM	673	CA	GLN	A	271	6.478	10.337	89.297	1.00	19.83	C
ATOM	674	CB	GLN	A	271	6.469	8.827	89.587	1.00	20.42	C
ATOM	675	CG	GLN	A	271	6.333	8.468	91.036	1.00	21.69	C
ATOM	676	CD	GLN	A	271	7.444	9.071	91.878	1.00	24.42	C
ATOM	677	OE1	GLN	A	271	8.633	8.932	91.549	1.00	26.23	O
ATOM	678	NE2	GLN	A	271	7.066	9.756	92.958	1.00	25.76	N
ATOM	679	C	GLN	A	271	6.967	10.572	87.887	1.00	19.13	C
ATOM	680	O	GLN	A	271	8.142	10.684	87.659	1.00	18.69	O
ATOM	689	N	THR	A	272	6.045	10.609	86.943	1.00	19.15	N
ATOM	690	CA	THR	A	272	6.358	10.933	85.568	1.00	19.05	C
ATOM	691	CB	THR	A	272	5.160	10.696	84.651	1.00	18.45	C
ATOM	692	OG1	THR	A	272	4.728	9.345	84.760	1.00	19.57	O
ATOM	693	CG2	THR	A	272	5.549	10.821	83.220	1.00	19.11	C
ATOM	694	C	THR	A	272	6.769	12.380	85.501	1.00	19.13	C
ATOM	695	O	THR	A	272	7.673	12.731	84.751	1.00	19.69	O
ATOM	703	N	PHE	A	273	6.137	13.231	86.293	1.00	18.74	N
ATOM	704	CA	PHE	A	273	6.549	14.612	86.273	1.00	19.24	C
ATOM	705	CB	PHE	A	273	5.619	15.477	87.115	1.00	19.99	C
ATOM	706	CG	PHE	A	273	6.081	16.899	87.248	1.00	20.55	C
ATOM	707	CD1	PHE	A	273	6.379	17.430	88.487	1.00	21.35	C
ATOM	708	CE1	PHE	A	273	6.819	18.731	88.589	1.00	22.29	C
ATOM	709	CZ	PHE	A	273	6.973	19.506	87.470	1.00	21.03	C
ATOM	710	CE2	PHE	A	273	6.702	18.987	86.242	1.00	23.16	C
ATOM	711	CD2	PHE	A	273	6.256	17.688	86.125	1.00	22.85	C
ATOM	712	C	PHE	A	273	7.973	14.695	86.771	1.00	18.84	C
ATOM	713	O	PHE	A	273	8.797	15.384	86.203	1.00	18.95	O
ATOM	723	N	ILE	A	274	8.255	13.965	87.832	1.00	19.04	N
ATOM	724	CA	ILE	A	274	9.578	13.922	88.407	1.00	19.10	C
ATOM	725	CB	ILE	A	274	9.622	12.888	89.547	1.00	19.68	C
ATOM	726	CG1	ILE	A	274	8.636	13.277	90.660	1.00	20.59	C
ATOM	727	CD1	ILE	A	274	9.213	13.614	92.013	1.00	21.59	C
ATOM	728	CG2	ILE	A	274	11.075	12.671	90.017	1.00	19.28	C
ATOM	729	C	ILE	A	274	10.622	13.570	87.375	1.00	18.68	C
ATOM	730	O	ILE	A	274	11.663	14.214	87.301	1.00	17.59	O
ATOM	742	N	SER	A	275	10.329	12.546	86.583	1.00	18.85	N
ATOM	743	CA	SER	A	275	11.261	12.053	85.586	1.00	19.69	C
ATOM	744	CB	SER	A	275	10.813	10.674	85.087	1.00	19.86	C
ATOM	745	OG	SER	A	275	9.782	10.787	84.126	1.00	22.52	O
ATOM	746	C	SER	A	275	11.468	13.038	84.426	1.00	19.56	C
ATOM	747	O	SER	A	275	12.525	13.097	83.822	1.00	19.81	O
ATOM	753	N	ILE	A	276	10.447	13.829	84.136	1.00	20.02	N
ATOM	754	CA	ILE	A	276	10.526	14.877	83.129	1.00	19.85	C
ATOM	755	CB	ILE	A	276	9.094	15.357	82.795	1.00	19.90	C
ATOM	756	CG1	ILE	A	276	8.375	14.317	81.945	1.00	19.96	C
ATOM	757	CD1	ILE	A	276	6.916	14.616	81.763	1.00	19.95	C
ATOM	758	CG2	ILE	A	276	9.096	16.663	82.073	1.00	20.64	C
ATOM	759	C	ILE	A	276	11.433	16.037	83.590	1.00	19.46	C
ATOM	760	O	ILE	A	276	12.130	16.622	82.784	1.00	19.34	O
ATOM	772	N	VAL	A	277	11.406	16.371	84.877	1.00	19.28	N
ATOM	773	CA	VAL	A	277	12.287	17.398	85.430	1.00	19.33	C
ATOM	774	CB	VAL	A	277	11.848	17.834	86.852	1.00	19.58	C
ATOM	775	CG1	VAL	A	277	12.831	18.822	87.471	1.00	19.89	C
ATOM	776	CG2	VAL	A	277	10.486	18.432	86.813	1.00	20.27	C
ATOM	777	C	VAL	A	277	13.726	16.899	85.472	1.00	18.91	C
ATOM	778	O	VAL	A	277	14.635	17.663	85.221	1.00	18.14	O
ATOM	788	N	ASP	A	278	13.906	15.615	85.780	1.00	19.35	N
ATOM	789	CA	ASP	A	278	15.200	14.934	85.684	1.00	20.07	C
ATOM	790	CB	ASP	A	278	15.064	13.456	86.088	1.00	20.68	C
ATOM	791	CG	ASP	A	278	15.143	13.241	87.600	1.00	24.73	C
ATOM	792	OD1	ASP	A	278	15.755	14.103	88.288	1.00	30.88	O
ATOM	793	OD2	ASP	A	278	14.654	12.229	88.202	1.00	28.68	O
ATOM	794	C	ASP	A	278	15.776	15.024	84.263	1.00	19.75	C
ATOM	795	O	ASP	A	278	16.946	15.313	84.073	1.00	19.22	O
ATOM	800	N	TRP	A	279	14.919	14.811	83.279	1.00	19.61	N
ATOM	801	CA	TRP	A	279	15.292	14.915	81.897	1.00	19.84	C
ATOM	802	CB	TRP	A	279	14.113	14.521	81.008	1.00	19.87	C
ATOM	803	CG	TRP	A	279	14.319	14.966	79.617	1.00	20.67	C
ATOM	804	CD1	TRP	A	279	15.162	14.405	78.700	1.00	20.09	C
ATOM	805	NE1	TRP	A	279	15.115	15.116	77.528	1.00	21.43	N
ATOM	806	CE2	TRP	A	279	14.228	16.152	77.660	1.00	22.16	C
ATOM	807	CD2	TRP	A	279	13.718	16.099	78.973	1.00	22.49	C
ATOM	808	CE3	TRP	A	279	12.778	17.064	79.365	1.00	22.52	C
ATOM	809	CZ3	TRP	A	279	12.396	18.037	78.454	1.00	22.49	C
ATOM	810	CH2	TRP	A	279	12.930	18.068	77.164	1.00	23.82	C
ATOM	811	CZ2	TRP	A	279	13.848	17.135	76.745	1.00	23.11	C
ATOM	812	C	TRP	A	279	15.740	16.327	81.556	1.00	20.28	C
ATOM	813	O	TRP	A	279	16.804	16.513	80.981	1.00	19.67	O
ATOM	824	N	ALA	A	280	14.921	17.312	81.929	1.00	20.87	N
ATOM	825	CA	ALA	A	280	15.156	18.699	81.570	1.00	21.43	C
ATOM	826	CB	ALA	A	280	13.983	19.575	81.988	1.00	21.77	C
ATOM	827	C	ALA	A	280	16.427	19.209	82.200	1.00	22.16	C
ATOM	828	O	ALA	A	280	17.153	19.977	81.572	1.00	22.26	O
ATOM	834	N	ARG	A	281	16.720	18.789	83.427	1.00	22.71	N
ATOM	835	CA	ARG	A	281	17.922	19.300	84.081	1.00	23.53	C
ATOM	836	CB	ARG	A	281	17.836	19.216	85.606	1.00	23.92	C
ATOM	837	CG	ARG	A	281	18.104	17.884	86.239	1.00	25.66	C
ATOM	838	CD	ARG	A	281	17.866	17.909	87.747	1.00	26.18	C
ATOM	839	NE	ARG	A	281	18.914	17.205	88.486	1.00	28.32	N
ATOM	840	CZ	ARG	A	281	18.938	17.057	89.815	1.00	29.33	C
ATOM	841	NH1	ARG	A	281	17.964	17.557	90.574	1.00	28.91	N
ATOM	842	NH2	ARG	A	281	19.941	16.393	90.391	1.00	29.91	N
ATOM	843	C	ARG	A	281	19.226	18.727	83.502	1.00	23.49	C
ATOM	844	O	ARG	A	281	20.281	19.333	83.647	1.00	23.19	O
ATOM	858	N	ARG	A	282	19.124	17.608	82.791	1.00	23.61	N
ATOM	859	CA	ARG	A	282	20.238	17.063	82.025	1.00	23.57	C
ATOM	860	CB	ARG	A	282	20.114	15.537	81.916	1.00	23.90	C
ATOM	861	CG	ARG	A	282	20.216	14.774	83.240	1.00	24.46	C
ATOM	862	CD	ARG	A	282	20.272	13.235	83.069	1.00	26.55	C
ATOM	863	NE	ARG	A	282	18.943	12.616	83.098	1.00	29.91	N
ATOM	864	CZ	ARG	A	282	18.131	12.434	82.034	1.00	31.88	C
ATOM	865	NH1	ARG	A	282	18.504	12.815	80.815	1.00	33.77	N
ATOM	866	NH2	ARG	A	282	16.925	11.867	82.187	1.00	30.91	N
ATOM	867	C	ARG	A	282	20.375	17.655	80.608	1.00	22.91	C
ATOM	868	O	ARG	A	282	21.405	17.460	79.995	1.00	23.29	O
ATOM	882	N	CYS	A	283	19.357	18.351	80.094	1.00	22.32	N
ATOM	883	CA	CYS	A	283	19.380	18.877	78.719	1.00	22.08	C
ATOM	884	CB	CYS	A	283	18.069	19.510	78.299	1.00	21.67	C
ATOM	885	SG	CYS	A	283	16.828	18.355	77.775	1.00	22.32	S
ATOM	886	C	CYS	A	283	20.417	19.946	78.524	1.00	22.31	C
ATOM	887	O	CYS	A	283	20.618	20.777	79.406	1.00	22.76	O
ATOM	893	N	MET	A	284	21.040	19.931	77.343	1.00	21.98	N
ATOM	894	CA	MET	A	284	21.910	20.999	76.907	1.00	21.87	C
ATOM	895	CB	MET	A	284	22.466	20.734	75.492	1.00	22.32	C
ATOM	896	CG	MET	A	284	21.449	20.730	74.308	1.00	24.04	C
ATOM	897	SD	MET	A	284	20.225	19.312	74.237	1.00	25.84	S
ATOM	898	CE	MET	A	284	21.401	18.025	73.776	1.00	22.40	C
ATOM	899	C	MET	A	284	21.143	22.302	76.972	1.00	21.33	C
ATOM	900	O	MET	A	284	19.927	22.320	76.853	1.00	20.48	O
ATOM	910	N	VAL	A	285	21.892	23.380	77.176	1.00	21.35	N
ATOM	911	CA	VAL	A	285	21.386	24.750	77.325	1.00	20.78	C
ATOM	912	CB	VAL	A	285	20.481	25.197	76.165	1.00	20.95	C
ATOM	913	CG1	VAL	A	285	20.141	26.687	76.313	1.00	21.40	C
ATOM	914	CG2	VAL	A	285	21.163	24.934	74.806	1.00	20.78	C
ATOM	915	C	VAL	A	285	20.723	24.988	78.671	1.00	20.34	C
ATOM	916	O	VAL	A	285	21.141	25.883	79.400	1.00	19.80	O
ATOM	926	N	PHE	A	286	19.694	24.187	78.971	1.00	20.24	N
ATOM	927	CA	PHE	A	286	18.949	24.220	80.217	1.00	19.94	C
ATOM	928	CB	PHE	A	286	17.871	23.121	80.226	1.00	19.80	C
ATOM	929	CG	PHE	A	286	16.852	23.293	81.326	1.00	20.12	C
ATOM	930	CD1	PHE	A	286	15.677	24.026	81.105	1.00	19.76	C
ATOM	931	CE1	PHE	A	286	14.765	24.199	82.109	1.00	18.63	C
ATOM	932	CZ	PHE	A	286	14.994	23.663	83.355	1.00	19.66	C
ATOM	933	CE2	PHE	A	286	16.159	22.953	83.607	1.00	19.43	C
ATOM	934	CD2	PHE	A	286	17.081	22.776	82.598	1.00	19.92	C
ATOM	935	C	PHE	A	286	19.846	24.070	81.451	1.00	20.29	C
ATOM	936	O	PHE	A	286	19.726	24.822	82.421	1.00	20.06	O
ATOM	946	N	LYS	A	287	20.735	23.092	81.415	1.00	20.09	N
ATOM	947	CA	LYS	A	287	21.634	22.856	82.519	1.00	20.34	C
ATOM	948	CB	LYS	A	287	22.356	21.539	82.297	1.00	20.86	C
ATOM	949	CG	LYS	A	287	23.286	21.528	81.099	1.00	21.59	C
ATOM	950	CD	LYS	A	287	23.758	20.111	80.846	1.00	23.05	C
ATOM	951	CE	LYS	A	287	24.755	20.044	79.733	1.00	23.01	C
ATOM	952	NZ	LYS	A	287	25.659	18.915	79.951	1.00	23.69	N
ATOM	953	C	LYS	A	287	22.662	23.965	82.707	1.00	20.04	C
ATOM	954	O	LYS	A	287	23.381	23.980	83.683	1.00	20.78	O
ATOM	968	N	GLU	A	288	22.743	24.877	81.764	1.00	19.81	N
ATOM	969	CA	GLU	A	288	23.633	26.017	81.871	1.00	20.20	C
ATOM	970	CB	GLU	A	288	24.203	26.328	80.489	1.00	20.41	C
ATOM	971	CG	GLU	A	288	25.680	26.039	80.413	1.00	22.77	C
ATOM	972	CD	GLU	A	288	25.992	24.574	80.230	1.00	24.05	C
ATOM	973	OE1	GLU	A	288	25.508	24.003	79.236	1.00	25.33	O
ATOM	974	OE2	GLU	A	288	26.735	24.015	81.065	1.00	24.36	O
ATOM	975	C	GLU	A	288	22.961	27.260	82.461	1.00	19.97	C
ATOM	976	O	GLU	A	288	23.617	28.150	82.967	1.00	19.12	O
ATOM	983	N	LEU	A	289	21.644	27.317	82.366	1.00	20.59	N
ATOM	984	CA	LEU	A	289	20.865	28.403	82.940	1.00	20.93	C
ATOM	985	CB	LEU	A	289	19.422	28.302	82.468	1.00	21.39	C
ATOM	986	CG	LEU	A	289	18.916	28.990	81.202	1.00	21.83	C
ATOM	987	CD1	LEU	A	289	20.009	29.368	80.239	1.00	23.86	C
ATOM	988	CD2	LEU	A	289	17.850	28.090	80.569	1.00	21.58	C
ATOM	989	C	LEU	A	289	20.840	28.319	84.456	1.00	21.04	C
ATOM	990	O	LEU	A	289	21.008	27.238	85.036	1.00	21.18	O
ATOM	1002	N	GLU	A	290	20.575	29.457	85.097	1.00	20.72	N
ATOM	1003	CA	GLU	A	290	20.499	29.507	86.549	1.00	20.91	C
ATOM	1004	CB	GLU	A	290	20.790	30.920	87.078	1.00	21.22	C
ATOM	1005	CG	GLU	A	290	22.197	31.429	86.772	1.00	23.17	C
ATOM	1006	CD	GLU	A	290	23.319	30.556	87.353	1.00	26.43	C
ATOM	1007	OE1	GLU	A	290	23.204	30.106	88.517	1.00	27.12	O
ATOM	1008	OE2	GLU	A	290	24.333	30.322	86.643	1.00	29.25	O
ATOM	1009	C	GLU	A	290	19.128	29.033	86.966	1.00	20.16	C
ATOM	1010	O	GLU	A	290	18.209	28.997	86.163	1.00	20.19	O
ATOM	1017	N	VAL	A	291	18.992	28.695	88.233	1.00	19.77	N
ATOM	1018	CA	VAL	A	291	17.815	27.997	88.700	1.00	20.14	C
ATOM	1019	CB	VAL	A	291	17.981	27.550	90.188	1.00	20.82	C
ATOM	1020	CG1	VAL	A	291	16.675	27.504	90.939	1.00	22.12	C
ATOM	1021	CG2	VAL	A	291	18.611	26.157	90.239	1.00	22.69	C
ATOM	1022	C	VAL	A	291	16.525	28.769	88.462	1.00	18.96	C
ATOM	1023	O	VAL	A	291	15.508	28.169	88.185	1.00	18.59	O
ATOM	1033	N	ALA	A	292	16.587	30.092	88.536	1.00	18.33	N
ATOM	1034	CA	ALA	A	292	15.400	30.928	88.404	1.00	17.83	C
ATOM	1035	CB	ALA	A	292	15.735	32.391	88.720	1.00	17.74	C
ATOM	1036	C	ALA	A	292	14.789	30.791	87.022	1.00	17.16	C
ATOM	1037	O	ALA	A	292	13.584	30.595	86.885	1.00	16.13	O
ATOM	1043	N	ASP	A	293	15.641	30.845	86.008	1.00	17.07	N
ATOM	1044	CA	ASP	A	293	15.215	30.638	84.622	1.00	17.08	C
ATOM	1045	CB	ASP	A	293	16.343	30.948	83.645	1.00	16.87	C
ATOM	1046	CG	ASP	A	293	16.479	32.426	83.366	1.00	17.26	C
ATOM	1047	OD1	ASP	A	293	15.637	33.217	83.840	1.00	19.82	O
ATOM	1048	OD2	ASP	A	293	17.399	32.892	82.677	1.00	17.49	O
ATOM	1049	C	ASP	A	293	14.719	29.233	84.380	1.00	17.08	C
ATOM	1050	O	ASP	A	293	13.724	29.035	83.683	1.00	16.29	O
ATOM	1055	N	GLN	A	294	15.409	28.260	84.965	1.00	17.58	N
ATOM	1056	CA	GLN	A	294	14.999	26.858	84.849	1.00	17.68	C
ATOM	1057	CB	GLN	A	294	15.976	25.953	85.599	1.00	18.00	C
ATOM	1058	CG	GLN	A	294	17.365	25.943	84.988	1.00	17.89	C
ATOM	1059	CD	GLN	A	294	18.309	24.999	85.680	1.00	18.77	C
ATOM	1060	OE1	GLN	A	294	18.176	24.878	86.972	1.00	21.65	O
ATOM	1061	NE2	GLN	A	294	19.148	24.380	85.040	1.00	17.02	N
ATOM	1062	C	GLN	A	294	13.600	26.672	85.381	1.00	17.26	C
ATOM	1063	O	GLN	A	294	12.818	25.912	84.834	1.00	16.86	O
ATOM	1072	N	MET	A	295	13.293	27.390	86.452	1.00	17.75	N
ATOM	1073	CA	MET	A	295	12.004	27.263	87.092	1.00	18.05	C
ATOM	1074	CB	MET	A	295	12.034	27.887	88.483	1.00	18.42	C
ATOM	1075	CG	MET	A	295	12.702	27.000	89.551	1.00	19.98	C
ATOM	1076	SD	MET	A	295	12.655	27.635	91.234	1.00	22.36	S
ATOM	1077	CE	MET	A	295	13.326	29.324	91.082	1.00	22.53	C
ATOM	1078	C	MET	A	295	10.909	27.882	86.227	1.00	17.10	C
ATOM	1079	O	MET	A	295	9.860	27.278	86.029	1.00	16.20	O
ATOM	1089	N	THR	A	296	11.166	29.064	85.698	1.00	16.63	N
ATOM	1090	CA	THR	A	296	10.203	29.730	84.816	1.00	16.78	C
ATOM	1091	CB	THR	A	296	10.761	31.073	84.333	1.00	16.68	C
ATOM	1092	OG1	THR	A	296	11.259	31.787	85.452	1.00	16.15	O
ATOM	1093	CG2	THR	A	296	9.676	31.969	83.782	1.00	16.05	C
ATOM	1094	C	THR	A	296	9.833	28.871	83.623	1.00	16.80	C
ATOM	1095	O	THR	A	296	8.650	28.694	83.314	1.00	16.59	O
ATOM	1103	N	LEU	A	297	10.854	28.328	82.970	1.00	17.38	N
ATOM	1104	CA	LEU	A	297	10.680	27.486	81.798	1.00	17.65	C
ATOM	1105	CB	LEU	A	297	12.025	27.002	81.297	1.00	18.16	C
ATOM	1106	CG	LEU	A	297	12.962	27.998	80.623	1.00	18.62	C
ATOM	1107	CD1	LEU	A	297	14.275	27.323	80.349	1.00	19.93	C
ATOM	1108	CD2	LEU	A	297	12.355	28.481	79.347	1.00	20.09	C
ATOM	1109	C	LEU	A	297	9.832	26.276	82.088	1.00	18.35	C
ATOM	1110	O	LEU	A	297	8.915	25.962	81.329	1.00	19.02	O
ATOM	1122	N	LEU	A	298	10.142	25.599	83.189	1.00	18.67	N
ATOM	1123	CA	LEU	A	298	9.397	24.419	83.616	1.00	19.13	C
ATOM	1124	CB	LEU	A	298	10.178	23.634	84.664	1.00	19.15	C
ATOM	1125	CG	LEU	A	298	11.265	22.722	84.080	1.00	18.78	C
ATOM	1126	CD1	LEU	A	298	12.047	22.108	85.222	1.00	19.04	C
ATOM	1127	CD2	LEU	A	298	10.676	21.659	83.196	1.00	17.14	C
ATOM	1128	C	LEU	A	298	7.995	24.730	84.134	1.00	19.11	C
ATOM	1129	O	LEU	A	298	7.082	23.934	83.908	1.00	18.71	O
ATOM	1141	N	GLN	A	299	7.853	25.868	84.825	1.00	19.24	N
ATOM	1142	CA	GLN	A	299	6.554	26.427	85.209	1.00	19.28	C
ATOM	1143	CB	GLN	A	299	6.739	27.671	86.094	1.00	19.30	C
ATOM	1144	CG	GLN	A	299	5.502	28.155	86.860	1.00	20.58	C
ATOM	1145	CD	GLN	A	299	4.979	27.176	87.966	1.00	23.78	C
ATOM	1146	OE1	GLN	A	299	5.757	26.994	89.041	1.00	25.06	O
ATOM	1147	NE2	GLN	A	299	3.873	26.632	87.849	1.00	24.01	N
ATOM	1148	C	GLN	A	299	5.673	26.737	83.979	1.00	19.23	C
ATOM	1149	O	GLN	A	299	4.472	26.540	84.018	1.00	19.08	O
ATOM	1158	N	ASN	A	300	6.281	27.140	82.877	1.00	19.52	N
ATOM	1159	CA	ASN	A	300	5.558	27.383	81.638	1.00	19.92	C
ATOM	1160	CB	ASN	A	300	6.390	28.268	80.717	1.00	20.02	C
ATOM	1161	CG	ASN	A	300	5.666	28.610	79.428	1.00	22.82	C
ATOM	1162	OD1	ASN	A	300	4.638	29.280	79.465	1.00	26.46	O
ATOM	1163	ND2	ASN	A	300	6.203	28.154	78.273	1.00	23.27	N
ATOM	1164	C	ASN	A	300	5.132	26.126	80.878	1.00	20.03	C
ATOM	1165	O	ASN	A	300	4.150	26.156	80.172	1.00	19.93	O
ATOM	1172	N	CYS	A	301	5.854	25.023	81.010	1.00	20.59	N
ATOM	1173	CA	CYS	A	301	5.672	23.913	80.087	1.00	21.15	C
ATOM	1174	CB	CYS	A	301	6.894	23.801	79.168	1.00	20.97	C
ATOM	1175	SG	CYS	A	301	8.353	23.046	79.875	1.00	21.58	S
ATOM	1176	C	CYS	A	301	5.349	22.560	80.694	1.00	21.23	C
ATOM	1177	O	CYS	A	301	5.186	21.592	79.965	1.00	22.06	O
ATOM	1183	N	TRP	A	302	5.220	22.489	82.009	1.00	21.11	N
ATOM	1184	CA	TRP	A	302	5.165	21.196	82.678	1.00	20.70	C
ATOM	1185	CB	TRP	A	302	5.130	21.360	84.208	1.00	20.50	C
ATOM	1186	CG	TRP	A	302	3.951	22.097	84.721	1.00	19.38	C
ATOM	1187	CD1	TRP	A	302	3.830	23.440	84.864	1.00	18.06	C
ATOM	1188	NE1	TRP	A	302	2.597	23.747	85.365	1.00	16.25	N
ATOM	1189	CE2	TRP	A	302	1.888	22.594	85.562	1.00	17.26	C
ATOM	1190	CD2	TRP	A	302	2.719	21.529	85.192	1.00	17.84	C
ATOM	1191	CE3	TRP	A	302	2.226	20.217	85.309	1.00	18.15	C
ATOM	1192	CZ3	TRP	A	302	0.959	20.026	85.793	1.00	17.88	C
ATOM	1193	CH2	TRP	A	302	0.167	21.115	86.171	1.00	19.50	C
ATOM	1194	CZ2	TRP	A	302	0.616	22.404	86.069	1.00	17.35	C
ATOM	1195	C	TRP	A	302	3.979	20.355	82.221	1.00	20.85	C
ATOM	1196	O	TRP	A	302	4.110	19.150	82.056	1.00	20.52	O
ATOM	1207	N	SER	A	303	2.826	20.985	82.010	1.00	20.60	N
ATOM	1208	CA	SER	A	303	1.637	20.237	81.637	1.00	20.95	C
ATOM	1209	CB	SER	A	303	0.350	21.037	81.924	1.00	20.45	C
ATOM	1210	OG	SER	A	303	0.293	22.224	81.170	1.00	22.98	O
ATOM	1211	C	SER	A	303	1.721	19.775	80.182	1.00	20.51	C
ATOM	1212	O	SER	A	303	1.297	18.675	79.850	1.00	20.40	O
ATOM	1218	N	GLU	A	304	2.314	20.613	79.338	1.00	20.46	N
ATOM	1219	CA	GLU	A	304	2.607	20.288	77.936	1.00	20.75	C
ATOM	1220	CB	GLU	A	304	3.217	21.495	77.216	1.00	21.39	C
ATOM	1221	CG	GLU	A	304	2.241	22.636	77.022	1.00	24.42	C
ATOM	1222	CD	GLU	A	304	2.145	23.630	78.193	1.00	30.67	C
ATOM	1223	OE1	GLU	A	304	2.592	23.352	79.347	1.00	32.15	O
ATOM	1224	OE2	GLU	A	304	1.549	24.715	77.975	1.00	35.31	O
ATOM	1225	C	GLU	A	304	3.553	19.121	77.813	1.00	19.84	C
ATOM	1226	O	GLU	A	304	3.320	18.225	77.032	1.00	19.95	O
ATOM	1233	N	LEU	A	305	4.606	19.102	78.617	1.00	20.17	N
ATOM	1234	CA	LEU	A	305	5.529	17.980	78.593	1.00	20.25	C
ATOM	1235	CB	LEU	A	305	6.766	18.294	79.438	1.00	20.34	C
ATOM	1236	CG	LEU	A	305	7.777	19.285	78.844	1.00	20.25	C
ATOM	1237	CD1	LEU	A	305	8.844	19.587	79.833	1.00	20.74	C
ATOM	1238	CD2	LEU	A	305	8.404	18.759	77.591	1.00	21.19	C
ATOM	1239	C	LEU	A	305	4.894	16.645	79.029	1.00	20.69	C
ATOM	1240	O	LEU	A	305	5.220	15.591	78.483	1.00	20.86	O
ATOM	1252	N	LEU	A	306	4.020	16.696	80.028	1.00	21.12	N
ATOM	1253	CA	LEU	A	306	3.309	15.519	80.499	1.00	21.35	C
ATOM	1254	CB	LEU	A	306	2.593	15.835	81.803	1.00	21.80	C
ATOM	1255	CG	LEU	A	306	3.372	15.569	83.092	1.00	23.77	C
ATOM	1256	CD1	LEU	A	306	2.756	16.346	84.260	1.00	24.44	C
ATOM	1257	CD2	LEU	A	306	3.455	14.057	83.423	1.00	23.19	C
ATOM	1258	C	LEU	A	306	2.299	14.994	79.484	1.00	21.24	C
ATOM	1259	O	LEU	A	306	2.223	13.799	79.239	1.00	21.44	O
ATOM	1271	N	VAL	A	307	1.514	15.890	78.904	1.00	21.57	N
ATOM	1272	CA	VAL	A	307	0.588	15.530	77.822	1.00	21.86	C
ATOM	1273	CB	VAL	A	307	−0.268	16.784	77.355	1.00	22.01	C
ATOM	1274	CG1	VAL	A	307	−0.963	16.532	76.027	1.00	21.89	C
ATOM	1275	CG2	VAL	A	307	−1.281	17.208	78.413	1.00	22.12	C
ATOM	1276	C	VAL	A	307	1.348	14.936	76.617	1.00	21.69	C
ATOM	1277	O	VAL	A	307	0.987	13.881	76.094	1.00	21.37	O
ATOM	1287	N	PHE	A	308	2.409	15.614	76.196	1.00	21.54	N
ATOM	1288	CA	PHE	A	308	3.206	15.138	75.096	1.00	21.47	C
ATOM	1289	CB	PHE	A	308	4.268	16.163	74.685	1.00	21.49	C
ATOM	1290	CG	PHE	A	308	4.924	15.862	73.334	1.00	21.66	C
ATOM	1291	CD1	PHE	A	308	6.321	15.852	73.198	1.00	21.16	C
ATOM	1292	CE1	PHE	A	308	6.929	15.612	71.992	1.00	21.59	C
ATOM	1293	CZ	PHE	A	308	6.164	15.366	70.870	1.00	21.69	C
ATOM	1294	CE2	PHE	A	308	4.768	15.363	70.973	1.00	23.31	C
ATOM	1295	CD2	PHE	A	308	4.150	15.608	72.203	1.00	22.65	C
ATOM	1296	C	PHE	A	308	3.854	13.807	75.434	1.00	21.64	C
ATOM	1297	O	PHE	A	308	3.973	12.942	74.574	1.00	22.04	O
ATOM	1307	N	ASP	A	309	4.257	13.626	76.681	1.00	21.68	N
ATOM	1308	CA	ASP	A	309	4.782	12.350	77.103	1.00	21.58	C
ATOM	1309	CB	ASP	A	309	5.241	12.414	78.555	1.00	22.13	C
ATOM	1310	CG	ASP	A	309	5.889	11.124	79.003	1.00	23.04	C
ATOM	1311	OD1	ASP	A	309	5.239	10.310	79.730	1.00	24.78	O
ATOM	1312	OD2	ASP	A	309	7.042	10.834	78.625	1.00	26.05	O
ATOM	1313	C	ASP	A	309	3.741	11.233	76.942	1.00	21.24	C
ATOM	1314	O	ASP	A	309	4.056	10.118	76.481	1.00	21.30	O
ATOM	1319	N	HIS	A	310	2.513	11.533	77.332	1.00	20.67	N
ATOM	1320	CA	HIS	A	310	1.438	10.569	77.254	1.00	20.41	C
ATOM	1321	CB	HIS	A	310	0.230	11.073	78.071	1.00	20.28	C
ATOM	1322	CG	HIS	A	310	−1.065	10.444	77.687	1.00	21.06	C
ATOM	1323	ND1	HIS	A	310	−1.279	9.085	77.748	1.00	22.09	N
ATOM	1324	CE1	HIS	A	310	−2.497	8.812	77.315	1.00	22.28	C
ATOM	1325	NE2	HIS	A	310	−3.082	9.943	76.974	1.00	22.19	N
ATOM	1326	CD2	HIS	A	310	−2.207	10.981	77.201	1.00	22.28	C
ATOM	1327	C	HIS	A	310	1.099	10.270	75.790	1.00	20.35	C
ATOM	1328	O	HIS	A	310	1.022	9.104	75.408	1.00	20.75	O
ATOM	1337	N	ILE	A	311	0.945	11.317	74.981	1.00	20.51	N
ATOM	1338	CA	ILE	A	311	0.706	11.225	73.525	1.00	20.82	C
ATOM	1339	CB	ILE	A	311	0.764	12.646	72.884	1.00	21.25	C
ATOM	1340	CG1	ILE	A	311	−0.381	13.560	73.368	1.00	22.39	C
ATOM	1341	CD1	ILE	A	311	−1.777	13.051	73.060	1.00	24.52	C
ATOM	1342	CG2	ILE	A	311	0.752	12.576	71.374	1.00	20.33	C
ATOM	1343	C	ILE	A	311	1.713	10.325	72.780	1.00	21.18	C
ATOM	1344	O	ILE	A	311	1.326	9.410	72.040	1.00	20.68	O
ATOM	1356	N	TYR	A	312	3.004	10.584	72.970	1.00	21.76	N
ATOM	1357	CA	TYR	A	312	4.028	9.813	72.276	1.00	22.63	C
ATOM	1358	CB	TYR	A	312	5.437	10.389	72.473	1.00	22.96	C
ATOM	1359	CG	TYR	A	312	6.451	9.638	71.629	1.00	22.71	C
ATOM	1360	CD1	TYR	A	312	6.299	9.559	70.267	1.00	22.87	C
ATOM	1361	CE1	TYR	A	312	7.199	8.868	69.477	1.00	23.85	C
ATOM	1362	CZ	TYR	A	312	8.269	8.217	70.049	1.00	24.74	C
ATOM	1363	OH	TYR	A	312	9.139	7.517	69.215	1.00	26.56	O
ATOM	1364	CE2	TYR	A	312	8.444	8.260	71.425	1.00	23.16	C
ATOM	1365	CD2	TYR	A	312	7.532	8.970	72.204	1.00	24.17	C
ATOM	1366	C	TYR	A	312	4.018	8.351	72.686	1.00	23.09	C
ATOM	1367	O	TYR	A	312	4.278	7.470	71.854	1.00	23.34	O
ATOM	1377	N	ARG	A	313	3.711	8.100	73.959	1.00	23.46	N
ATOM	1378	CA	ARG	A	313	3.463	6.745	74.440	1.00	23.34	C
ATOM	1379	CB	ARG	A	313	3.058	6.758	75.918	1.00	23.46	C
ATOM	1380	CG	ARG	A	313	2.996	5.368	76.573	1.00	22.66	C
ATOM	1381	CD	ARG	A	313	3.005	5.399	78.082	1.00	20.99	C
ATOM	1382	NE	ARG	A	313	4.263	5.946	78.577	1.00	21.01	N
ATOM	1383	CZ	ARG	A	313	4.458	7.168	79.086	1.00	20.05	C
ATOM	1384	NH1	ARG	A	313	3.468	8.039	79.218	1.00	18.83	N
ATOM	1385	NH2	ARG	A	313	5.687	7.503	79.473	1.00	21.35	N
ATOM	1386	C	ARG	A	313	2.374	6.053	73.630	1.00	23.31	C
ATOM	1387	O	ARG	A	313	2.478	4.853	73.340	1.00	23.93	O
ATOM	1401	N	GLN	A	314	1.340	6.804	73.268	1.00	23.29	N
ATOM	1402	CA	GLN	A	314	0.239	6.258	72.480	1.00	23.40	C
ATOM	1403	CB	GLN	A	314	−0.998	7.169	72.526	1.00	23.36	C
ATOM	1404	CG	GLN	A	314	−1.562	7.494	73.918	1.00	22.48	C
ATOM	1405	CD	GLN	A	314	−1.328	6.407	74.925	1.00	20.80	C
ATOM	1406	OE1	GLN	A	314	−1.853	5.232	74.649	1.00	21.43	O
ATOM	1407	NE2	GLN	A	314	−0.676	6.628	75.942	1.00	19.01	N
ATOM	1408	C	GLN	A	314	0.618	6.026	71.033	1.00	23.80	C
ATOM	1409	O	GLN	A	314	0.028	5.165	70.394	1.00	24.46	O
ATOM	1418	N	VAL	A	315	1.572	6.775	70.488	1.00	23.99	N
ATOM	1419	CA	VAL	A	315	1.980	6.489	69.110	1.00	24.72	C
ATOM	1420	CB	VAL	A	315	2.621	7.719	68.306	1.00	24.77	C
ATOM	1421	CG1	VAL	A	315	2.059	9.047	68.744	1.00	23.75	C
ATOM	1422	CG2	VAL	A	315	4.164	7.696	68.319	1.00	25.94	C
ATOM	1423	C	VAL	A	315	2.853	5.219	69.097	1.00	24.57	C
ATOM	1424	O	VAL	A	315	2.744	4.401	68.192	1.00	24.65	O
ATOM	1434	N	GLN	A	316	3.664	5.052	70.143	1.00	24.61	N
ATOM	1435	CA	GLN	A	316	4.443	3.834	70.368	1.00	24.30	C
ATOM	1436	CB	GLN	A	316	5.307	3.997	71.605	1.00	24.38	C
ATOM	1437	CG	GLN	A	316	6.499	4.860	71.385	1.00	25.28	C
ATOM	1438	CD	GLN	A	316	7.358	4.988	72.630	1.00	27.40	C
ATOM	1439	OE1	GLN	A	316	6.872	5.435	73.690	1.00	29.49	O
ATOM	1440	NE2	GLN	A	316	8.640	4.605	72.515	1.00	26.39	N
ATOM	1441	C	GLN	A	316	3.585	2.604	70.578	1.00	24.20	C
ATOM	1442	O	GLN	A	316	4.026	1.492	70.320	1.00	24.57	O
ATOM	1451	N	HIS	A	317	2.370	2.810	71.075	1.00	24.08	N
ATOM	1452	CA	HIS	A	317	1.456	1.732	71.448	1.00	23.73	C
ATOM	1453	CB	HIS	A	317	0.416	2.304	72.421	1.00	23.53	C
ATOM	1454	CG	HIS	A	317	−0.573	1.302	72.926	1.00	23.31	C
ATOM	1455	ND1	HIS	A	317	−0.444	−0.009	73.236	1.00	23.30	N
ATOM	1456	CE1	HIS	A	317	−1.671	−0.444	73.664	1.00	21.87	C
ATOM	1457	NE2	HIS	A	317	−2.523	0.562	73.625	1.00	21.83	N
ATOM	1458	CD2	HIS	A	317	−1.884	1.631	73.191	1.00	22.24	C
ATOM	1459	C	HIS	A	317	0.789	1.156	70.188	1.00	23.84	C
ATOM	1460	O	HIS	A	317	0.771	−0.070	69.948	1.00	23.41	O
ATOM	1469	N	GLY	A	318	0.259	2.075	69.384	1.00	24.10	N
ATOM	1470	CA	GLY	A	318	−0.301	1.759	68.092	1.00	24.13	C
ATOM	1471	C	GLY	A	318	−1.578	0.962	68.186	1.00	24.12	C
ATOM	1472	O	GLY	A	318	−1.838	0.134	67.304	1.00	24.08	O
ATOM	1476	N	LYS	A	319	−2.363	1.200	69.244	1.00	24.19	N
ATOM	1477	CA	LYS	A	319	−3.687	0.580	69.393	1.00	24.31	C
ATOM	1478	CB	LYS	A	319	−3.700	−0.473	70.504	1.00	24.38	C
ATOM	1479	CG	LYS	A	319	−2.494	−1.401	70.532	1.00	24.18	C
ATOM	1480	CD	LYS	A	319	−2.727	−2.546	71.507	1.00	24.92	C
ATOM	1481	CE	LYS	A	319	−1.430	−3.266	71.900	1.00	25.47	C
ATOM	1482	NZ	LYS	A	319	−1.709	−4.534	72.674	1.00	25.92	N
ATOM	1483	C	LYS	A	319	−4.774	1.623	69.665	1.00	24.39	C
ATOM	1484	O	LYS	A	319	−4.726	2.352	70.652	1.00	24.14	O
ATOM	1498	N	GLU	A	320	−5.759	1.667	68.775	1.00	24.48	N
ATOM	1499	CA	GLU	A	320	−6.871	2.604	68.879	1.00	24.63	C
ATOM	1500	CB	GLU	A	320	−7.634	2.651	67.540	1.00	24.85	C
ATOM	1501	CG	GLU	A	320	−8.295	3.998	67.275	1.00	26.39	C
ATOM	1502	CD	GLU	A	320	−8.683	4.215	65.834	1.00	27.60	C
ATOM	1503	OE1	GLU	A	320	−8.842	3.211	65.111	1.00	30.80	O
ATOM	1504	OE2	GLU	A	320	−8.833	5.388	65.431	1.00	27.73	O
ATOM	1505	C	GLU	A	320	−7.847	2.262	70.020	1.00	24.25	C
ATOM	1506	O	GLU	A	320	−8.579	3.140	70.507	1.00	24.05	O
ATOM	1513	N	GLY	A	321	−7.839	0.996	70.445	1.00	23.69	N
ATOM	1514	CA	GLY	A	321	−8.807	0.496	71.403	1.00	23.31	C
ATOM	1515	C	GLY	A	321	−8.430	0.663	72.863	1.00	22.99	C
ATOM	1516	O	GLY	A	321	−9.261	0.418	73.721	1.00	22.56	O
ATOM	1520	N	SER	A	322	−7.193	1.075	73.147	1.00	23.06	N
ATOM	1521	CA	SER	A	322	−6.719	1.202	74.526	1.00	22.78	C
ATOM	1522	CB	SER	A	322	−6.270	−0.155	75.068	1.00	22.77	C
ATOM	1523	OG	SER	A	322	−5.114	−0.629	74.412	1.00	22.08	O
ATOM	1524	C	SER	A	322	−5.590	2.203	74.701	1.00	23.07	C
ATOM	1525	O	SER	A	322	−4.966	2.651	73.723	1.00	23.00	O
ATOM	1531	N	ILE	A	323	−5.336	2.537	75.963	1.00	23.05	N
ATOM	1532	CA	ILE	A	323	−4.311	3.507	76.353	1.00	23.52	C
ATOM	1533	CB	ILE	A	323	−4.886	4.577	77.318	1.00	24.12	C
ATOM	1534	CG1	ILE	A	323	−5.976	5.409	76.648	1.00	24.89	C
ATOM	1535	CD1	ILE	A	323	−5.496	6.209	75.497	1.00	24.58	C
ATOM	1536	CG2	ILE	A	323	−3.801	5.498	77.810	1.00	26.10	C
ATOM	1537	C	ILE	A	323	−3.207	2.766	77.073	1.00	22.71	C
ATOM	1538	O	ILE	A	323	−3.467	1.914	77.898	1.00	21.81	O
ATOM	1550	N	LEU	A	324	−1.972	3.124	76.765	1.00	22.29	N
ATOM	1551	CA	LEU	A	324	−0.822	2.597	77.460	1.00	21.87	C
ATOM	1552	CB	LEU	A	324	0.312	2.327	76.469	1.00	21.84	C
ATOM	1553	CG	LEU	A	324	1.278	1.155	76.651	1.00	22.02	C
ATOM	1554	CD1	LEU	A	324	2.677	1.682	76.882	1.00	23.05	C
ATOM	1555	CD2	LEU	A	324	0.895	0.218	77.770	1.00	21.56	C
ATOM	1556	C	LEU	A	324	−0.394	3.619	78.507	1.00	21.45	C
ATOM	1557	O	LEU	A	324	−0.317	4.835	78.246	1.00	21.42	O
ATOM	1569	N	LEU	A	325	−0.124	3.101	79.698	1.00	21.12	N
ATOM	1570	CA	LEU	A	325	0.419	3.882	80.773	1.00	20.88	C
ATOM	1571	CB	LEU	A	325	−0.301	3.577	82.069	1.00	21.12	C
ATOM	1572	CG	LEU	A	325	−1.820	3.613	82.049	1.00	21.55	C
ATOM	1573	CD1	LEU	A	325	−2.332	3.276	83.439	1.00	20.62	C
ATOM	1574	CD2	LEU	A	325	−2.308	4.977	81.611	1.00	21.94	C
ATOM	1575	C	LEU	A	325	1.871	3.528	80.935	1.00	20.52	C
ATOM	1576	O	LEU	A	325	2.323	2.470	80.508	1.00	19.16	O
ATOM	1588	N	VAL	A	326	2.578	4.441	81.586	1.00	20.80	N
ATOM	1589	CA	VAL	A	326	4.003	4.326	81.809	1.00	21.24	C
ATOM	1590	CB	VAL	A	326	4.526	5.631	82.452	1.00	21.24	C
ATOM	1591	CG1	VAL	A	326	3.965	5.829	83.848	1.00	21.63	C
ATOM	1592	CG2	VAL	A	326	6.057	5.667	82.442	1.00	22.07	C
ATOM	1593	C	VAL	A	326	4.395	3.054	82.612	1.00	21.65	C
ATOM	1594	O	VAL	A	326	5.506	2.502	82.448	1.00	21.72	O
ATOM	1604	N	THR	A	327	3.454	2.573	83.431	1.00	21.61	N
ATOM	1605	CA	THR	A	327	3.605	1.333	84.187	1.00	21.24	C
ATOM	1606	CB	THR	A	327	2.472	1.191	85.244	1.00	21.56	C
ATOM	1607	OG1	THR	A	327	1.195	1.095	84.595	1.00	20.95	O
ATOM	1608	CG2	THR	A	327	2.373	2.427	86.153	1.00	21.07	C
ATOM	1609	C	THR	A	327	3.572	0.073	83.334	1.00	21.09	C
ATOM	1610	O	THR	A	327	3.859	−0.991	83.835	1.00	21.10	O
ATOM	1618	N	GLY	A	328	3.192	0.189	82.069	1.00	21.05	N
ATOM	1619	CA	GLY	A	328	2.989	−0.956	81.209	1.00	21.08	C
ATOM	1620	C	GLY	A	328	1.537	−1.369	81.115	1.00	21.18	C
ATOM	1621	O	GLY	A	328	1.188	−2.259	80.359	1.00	21.32	O
ATOM	1625	N	GLN	A	329	0.680	−0.707	81.868	1.00	21.78	N
ATOM	1626	CA	GLN	A	329	−0.715	−1.092	81.955	1.00	22.16	C
ATOM	1627	CB	GLN	A	329	−1.289	−0.585	83.272	1.00	22.57	C
ATOM	1628	CG	GLN	A	329	−2.614	−1.200	83.659	1.00	23.66	C
ATOM	1629	CD	GLN	A	329	−3.370	−0.371	84.695	1.00	25.91	C
ATOM	1630	OE1	GLN	A	329	−2.797	0.514	85.366	1.00	27.12	O
ATOM	1631	NE2	GLN	A	329	−4.659	−0.652	84.829	1.00	26.09	N
ATOM	1632	C	GLN	A	329	−1.485	−0.485	80.811	1.00	22.00	C
ATOM	1633	O	GLN	A	329	−1.285	0.662	80.502	1.00	22.16	O
ATOM	1642	N	GLU	A	330	−2.368	−1.256	80.188	1.00	22.41	N
ATOM	1643	CA	GLU	A	330	−3.260	−0.751	79.143	1.00	22.85	C
ATOM	1644	CB	GLU	A	330	−3.288	−1.686	77.922	1.00	22.97	C
ATOM	1645	CG	GLU	A	330	−1.916	−2.100	77.400	1.00	23.69	C
ATOM	1646	CD	GLU	A	330	−1.968	−2.989	76.170	1.00	24.58	C
ATOM	1647	OE1	GLU	A	330	−0.872	−3.365	75.697	1.00	26.90	O
ATOM	1648	OE2	GLU	A	330	−3.077	−3.319	75.676	1.00	24.34	O
ATOM	1649	C	GLU	A	330	−4.686	−0.597	79.672	1.00	22.92	C
ATOM	1650	O	GLU	A	330	−5.180	−1.461	80.393	1.00	24.06	O
ATOM	1657	N	VAL	A	331	−5.346	0.493	79.298	1.00	22.81	N
ATOM	1658	CA	VAL	A	331	−6.732	0.756	79.671	1.00	22.45	C
ATOM	1659	CB	VAL	A	331	−6.900	2.110	80.423	1.00	22.50	C
ATOM	1660	CG1	VAL	A	331	−8.363	2.317	80.838	1.00	21.93	C
ATOM	1661	CG2	VAL	A	331	−5.957	2.191	81.626	1.00	22.88	C
ATOM	1662	C	VAL	A	331	−7.549	0.863	78.408	1.00	21.85	C
ATOM	1663	O	VAL	A	331	−7.352	1.772	77.623	1.00	21.61	O
ATOM	1673	N	GLU	A	332	−8.495	−0.038	78.238	1.00	21.24	N
ATOM	1674	CA	GLU	A	332	−9.425	0.048	77.132	1.00	20.97	C
ATOM	1675	CB	GLU	A	332	−10.418	−1.104	77.176	1.00	21.12	C
ATOM	1676	CG	GLU	A	332	−9.776	−2.477	77.121	1.00	23.19	C
ATOM	1677	CD	GLU	A	332	−8.993	−2.703	75.848	1.00	26.02	C
ATOM	1678	OE1	GLU	A	332	−7.785	−3.016	75.949	1.00	28.28	O
ATOM	1679	OE2	GLU	A	332	−9.590	−2.570	74.754	1.00	27.84	O
ATOM	1680	C	GLU	A	332	−10.187	1.348	77.165	1.00	19.96	C
ATOM	1681	O	GLU	A	332	−10.504	1.879	78.218	1.00	19.72	O
ATOM	1688	N	LEU	A	333	−10.488	1.858	75.988	1.00	19.44	N
ATOM	1689	CA	LEU	A	333	−11.242	3.088	75.877	1.00	19.28	C
ATOM	1690	CB	LEU	A	333	−11.165	3.638	74.453	1.00	19.01	C
ATOM	1691	CG	LEU	A	333	−10.055	4.664	74.200	1.00	20.67	C
ATOM	1692	CD1	LEU	A	333	−10.074	5.756	75.269	1.00	22.16	C
ATOM	1693	CD2	LEU	A	333	−8.680	4.026	74.125	1.00	20.93	C
ATOM	1694	C	LEU	A	333	−12.695	2.904	76.317	1.00	18.82	C
ATOM	1695	O	LEU	A	333	−13.313	3.853	76.766	1.00	18.43	O
ATOM	1707	N	THR	A	334	−13.237	1.694	76.170	1.00	18.80	N
ATOM	1708	CA	THR	A	334	−14.569	1.396	76.689	1.00	18.74	C
ATOM	1709	CB	THR	A	334	−15.049	−0.030	76.296	1.00	18.98	C
ATOM	1710	OG1	THR	A	334	−14.020	−0.987	76.558	1.00	19.88	O
ATOM	1711	CG2	THR	A	334	−15.301	−0.143	74.801	1.00	19.02	C
ATOM	1712	C	THR	A	334	−14.612	1.548	78.209	1.00	18.22	C
ATOM	1713	O	THR	A	334	−15.624	1.962	78.754	1.00	18.16	O
ATOM	1721	N	THR	A	335	−13.516	1.213	78.879	1.00	17.54	N
ATOM	1722	CA	THR	A	335	−13.408	1.401	80.318	1.00	17.39	C
ATOM	1723	CB	THR	A	335	−12.059	0.856	80.811	1.00	17.47	C
ATOM	1724	OG1	THR	A	335	−12.048	−0.569	80.708	1.00	16.53	O
ATOM	1725	CG2	THR	A	335	−11.839	1.137	82.292	1.00	17.84	C
ATOM	1726	C	THR	A	335	−13.553	2.861	80.728	1.00	17.36	C
ATOM	1727	O	THR	A	335	−14.264	3.176	81.680	1.00	16.74	O
ATOM	1735	N	VAL	A	336	−12.868	3.751	80.010	1.00	17.95	N
ATOM	1736	CA	VAL	A	336	−12.927	5.176	80.333	1.00	17.80	C
ATOM	1737	CB	VAL	A	336	−11.632	6.009	79.835	1.00	18.15	C
ATOM	1738	CG1	VAL	A	336	−10.501	5.119	79.332	1.00	17.46	C
ATOM	1739	CG2	VAL	A	336	−11.965	7.078	78.851	1.00	18.06	C
ATOM	1740	C	VAL	A	336	−14.310	5.755	79.937	1.00	17.85	C
ATOM	1741	O	VAL	A	336	−14.849	6.636	80.597	1.00	16.84	O
ATOM	1751	N	ALA	A	337	−14.924	5.198	78.903	1.00	18.24	N
ATOM	1752	CA	ALA	A	337	−16.296	5.563	78.594	1.00	18.38	C
ATOM	1753	CB	ALA	A	337	−16.741	4.939	77.282	1.00	18.32	C
ATOM	1754	C	ALA	A	337	−17.254	5.215	79.737	1.00	18.28	C
ATOM	1755	O	ALA	A	337	−18.167	5.989	80.006	1.00	18.22	O
ATOM	1761	N	THR	A	338	−17.039	4.090	80.434	1.00	18.47	N
ATOM	1762	CA	THR	A	338	−17.950	3.708	81.530	1.00	18.54	C
ATOM	1763	CB	THR	A	338	−18.113	2.124	81.746	1.00	18.74	C
ATOM	1764	OG1	THR	A	338	−17.141	1.589	82.648	1.00	20.83	O
ATOM	1765	CG2	THR	A	338	−17.884	1.348	80.507	1.00	18.10	C
ATOM	1766	C	THR	A	338	−17.695	4.442	82.860	1.00	18.24	C
ATOM	1767	O	THR	A	338	−18.647	4.712	83.591	1.00	17.57	O
ATOM	1775	N	GLN	A	339	−16.451	4.823	83.130	1.00	18.24	N
ATOM	1776	CA	GLN	A	339	−16.070	5.392	84.426	1.00	19.20	C
ATOM	1777	CB	GLN	A	339	−14.820	4.684	84.943	1.00	19.05	C
ATOM	1778	CG	GLN	A	339	−15.078	3.240	85.322	1.00	20.19	C
ATOM	1779	CD	GLN	A	339	−13.879	2.590	85.945	1.00	21.10	C
ATOM	1780	OE1	GLN	A	339	−13.344	3.098	86.920	1.00	22.83	O
ATOM	1781	NE2	GLN	A	339	−13.448	1.463	85.387	1.00	21.99	N
ATOM	1782	C	GLN	A	339	−15.840	6.907	84.489	1.00	19.73	C
ATOM	1783	O	GLN	A	339	−16.204	7.553	85.465	1.00	19.19	O
ATOM	1792	N	ALA	A	340	−15.222	7.462	83.454	1.00	21.16	N
ATOM	1793	CA	ALA	A	340	−14.806	8.873	83.430	1.00	22.03	C
ATOM	1794	CB	ALA	A	340	−13.871	9.125	82.253	1.00	21.95	C
ATOM	1795	C	ALA	A	340	−15.988	9.821	83.347	1.00	22.76	C
ATOM	1796	O	ALA	A	340	−16.978	9.523	82.682	1.00	23.46	O
ATOM	1802	N	GLY	A	341	−15.877	10.961	84.021	1.00	23.53	N
ATOM	1803	CA	GLY	A	341	−16.838	12.044	83.895	1.00	24.13	C
ATOM	1804	C	GLY	A	341	−16.775	12.754	82.550	1.00	24.34	C
ATOM	1805	O	GLY	A	341	−16.014	12.380	81.668	1.00	24.94	O
ATOM	1809	N	SER	A	342	−17.570	13.806	82.399	1.00	24.92	N
ATOM	1810	CA	SER	A	342	−17.614	14.566	81.143	1.00	25.19	C
ATOM	1811	CB	SER	A	342	−18.543	15.784	81.265	1.00	25.60	C
ATOM	1812	OG	SER	A	342	−19.575	15.568	82.227	1.00	28.38	O
ATOM	1813	C	SER	A	342	−16.227	15.048	80.749	1.00	24.46	C
ATOM	1814	O	SER	A	342	−15.784	14.815	79.633	1.00	24.97	O
ATOM	1820	N	LEU	A	343	−15.550	15.693	81.692	1.00	23.79	N
ATOM	1821	CA	LEU	A	343	−14.278	16.351	81.437	1.00	23.55	C
ATOM	1822	CB	LEU	A	343	−13.844	17.182	82.644	1.00	23.52	C
ATOM	1823	CG	LEU	A	343	−14.600	18.480	82.897	1.00	24.00	C
ATOM	1824	CD1	LEU	A	343	−13.956	19.204	84.067	1.00	24.78	C
ATOM	1825	CD2	LEU	A	343	−14.620	19.364	81.653	1.00	25.15	C
ATOM	1826	C	LEU	A	343	−13.165	15.395	81.083	1.00	23.06	C
ATOM	1827	O	LEU	A	343	−12.433	15.616	80.118	1.00	23.38	O
ATOM	1839	N	LEU	A	344	−13.022	14.340	81.863	1.00	22.69	N
ATOM	1840	CA	LEU	A	344	−11.921	13.424	81.645	1.00	22.40	C
ATOM	1841	CB	LEU	A	344	−11.818	12.411	82.780	1.00	22.47	C
ATOM	1842	CG	LEU	A	344	−10.700	11.354	82.661	1.00	22.32	C
ATOM	1843	CD1	LEU	A	344	−9.268	11.970	82.503	1.00	21.58	C
ATOM	1844	CD2	LEU	A	344	−10.756	10.389	83.825	1.00	22.06	C
ATOM	1845	C	LEU	A	344	−12.115	12.725	80.322	1.00	22.77	C
ATOM	1846	O	LEU	A	344	−11.164	12.542	79.571	1.00	22.48	O
ATOM	1858	N	HIS	A	345	−13.356	12.351	80.026	1.00	23.19	N
ATOM	1859	CA	HIS	A	345	−13.638	11.614	78.807	1.00	23.36	C
ATOM	1860	CB	HIS	A	345	−15.097	11.119	78.790	1.00	23.31	C
ATOM	1861	CG	HIS	A	345	−15.318	9.950	77.878	1.00	22.34	C
ATOM	1862	ND1	HIS	A	345	−16.559	9.603	77.401	1.00	22.38	N
ATOM	1863	CE1	HIS	A	345	−16.444	8.552	76.609	1.00	22.26	C
ATOM	1864	NE2	HIS	A	345	−15.170	8.212	76.549	1.00	21.16	N
ATOM	1865	CD2	HIS	A	345	−14.447	9.066	77.339	1.00	21.74	C
ATOM	1866	C	HIS	A	345	−13.305	12.438	77.557	1.00	23.50	C
ATOM	1867	O	HIS	A	345	−12.677	11.938	76.627	1.00	23.36	O
ATOM	1876	N	SER	A	346	−13.694	13.713	77.559	1.00	24.22	N
ATOM	1877	CA	SER	A	346	−13.375	14.645	76.461	1.00	24.23	C
ATOM	1878	CB	SER	A	346	−13.820	16.089	76.751	1.00	24.19	C
ATOM	1879	OG	SER	A	346	−15.085	16.161	77.385	1.00	26.68	O
ATOM	1880	C	SER	A	346	−11.896	14.693	76.240	1.00	23.63	C
ATOM	1881	O	SER	A	346	−11.427	14.631	75.118	1.00	24.30	O
ATOM	1887	N	LEU	A	347	−11.175	14.799	77.340	1.00	23.56	N
ATOM	1888	CA	LEU	A	347	−9.743	15.024	77.324	1.00	23.54	C
ATOM	1889	CB	LEU	A	347	−9.236	15.149	78.747	1.00	23.76	C
ATOM	1890	CG	LEU	A	347	−8.484	16.408	79.117	1.00	23.71	C
ATOM	1891	CD1	LEU	A	347	−7.814	16.164	80.452	1.00	23.50	C
ATOM	1892	CD2	LEU	A	347	−7.482	16.795	78.038	1.00	25.09	C
ATOM	1893	C	LEU	A	347	−9.018	13.882	76.665	1.00	23.32	C
ATOM	1894	O	LEU	A	347	−8.153	14.074	75.824	1.00	23.62	O
ATOM	1906	N	VAL	A	348	−9.387	12.688	77.096	1.00	23.36	N
ATOM	1907	CA	VAL	A	348	−8.800	11.445	76.630	1.00	23.16	C
ATOM	1908	CB	VAL	A	348	−9.413	10.240	77.391	1.00	23.13	C
ATOM	1909	CG1	VAL	A	348	−9.129	8.883	76.682	1.00	22.86	C
ATOM	1910	CG2	VAL	A	348	−8.898	10.227	78.829	1.00	23.03	C
ATOM	1911	C	VAL	A	348	−9.014	11.269	75.141	1.00	22.68	C
ATOM	1912	O	VAL	A	348	−8.082	10.883	74.416	1.00	22.01	O
ATOM	1922	N	LEU	A	349	−10.239	11.551	74.713	1.00	22.18	N
ATOM	1923	CA	LEU	A	349	−10.636	11.365	73.325	1.00	22.29	C
ATOM	1924	CB	LEU	A	349	−12.169	11.505	73.202	1.00	22.40	C
ATOM	1925	CG	LEU	A	349	−13.042	10.231	73.140	1.00	22.26	C
ATOM	1926	CD1	LEU	A	349	−12.383	9.018	73.745	1.00	22.59	C
ATOM	1927	CD2	LEU	A	349	−14.412	10.459	73.771	1.00	21.68	C
ATOM	1928	C	LEU	A	349	−9.914	12.355	72.408	1.00	21.94	C
ATOM	1929	O	LEU	A	349	−9.426	11.988	71.340	1.00	20.92	O
ATOM	1941	N	ARG	A	350	−9.831	13.605	72.864	1.00	22.19	N
ATOM	1942	CA	ARG	A	350	−9.199	14.656	72.106	1.00	22.13	C
ATOM	1943	CB	ARG	A	350	−9.381	16.009	72.778	1.00	22.59	C
ATOM	1944	CG	ARG	A	350	−9.178	17.203	71.837	1.00	24.07	C
ATOM	1945	CD	ARG	A	350	−9.318	18.616	72.504	1.00	27.29	C
ATOM	1946	NE	ARG	A	350	−8.912	19.683	71.578	1.00	29.98	N
ATOM	1947	CZ	ARG	A	350	−8.714	20.966	71.887	1.00	29.24	C
ATOM	1948	NH1	ARG	A	350	−8.890	21.409	73.109	1.00	31.36	N
ATOM	1949	NH2	ARG	A	350	−8.356	21.820	70.943	1.00	28.95	N
ATOM	1950	C	ARG	A	350	−7.750	14.313	71.967	1.00	22.02	C
ATOM	1951	O	ARG	A	350	−7.182	14.474	70.901	1.00	22.49	O
ATOM	1965	N	ALA	A	351	−7.150	13.812	73.039	1.00	22.06	N
ATOM	1966	CA	ALA	A	351	−5.769	13.341	72.994	1.00	21.85	C
ATOM	1967	CB	ALA	A	351	−5.328	12.896	74.380	1.00	21.83	C
ATOM	1968	C	ALA	A	351	−5.547	12.227	71.960	1.00	22.06	C
ATOM	1969	O	ALA	A	351	−4.539	12.221	71.240	1.00	22.56	O
ATOM	1975	N	GLN	A	352	−6.493	11.307	71.849	1.00	22.06	N
ATOM	1976	CA	GLN	A	352	−6.337	10.190	70.924	1.00	22.40	C
ATOM	1977	CB	GLN	A	352	−7.387	9.090	71.181	1.00	22.43	C
ATOM	1978	CG	GLN	A	352	−7.176	8.293	72.477	1.00	21.35	C
ATOM	1979	CD	GLN	A	352	−5.899	7.507	72.470	1.00	19.06	C
ATOM	1980	OE1	GLN	A	352	−4.886	8.005	73.158	1.00	20.41	O
ATOM	1981	NE2	GLN	A	352	−5.824	6.467	71.841	1.00	18.10	N
ATOM	1982	C	GLN	A	352	−6.398	10.639	69.483	1.00	22.76	C
ATOM	1983	O	GLN	A	352	−5.761	10.033	68.623	1.00	23.61	O
ATOM	1992	N	GLU	A	353	−7.159	11.696	69.220	1.00	23.08	N
ATOM	1993	CA	GLU	A	353	−7.217	12.292	67.887	1.00	23.32	C
ATOM	1994	CB	GLU	A	353	−8.176	13.449	67.885	1.00	23.35	C
ATOM	1995	CG	GLU	A	353	−9.584	13.049	68.224	1.00	24.44	C
ATOM	1996	CD	GLU	A	353	−10.539	14.154	67.904	1.00	26.39	C
ATOM	1997	OE1	GLU	A	353	−10.961	14.890	68.825	1.00	28.35	O
ATOM	1998	OE2	GLU	A	353	−10.831	14.292	66.708	1.00	29.40	O
ATOM	1999	C	GLU	A	353	−5.866	12.818	67.458	1.00	23.60	C
ATOM	2000	O	GLU	A	353	−5.440	12.638	66.315	1.00	24.20	O
ATOM	2007	N	LEU	A	354	−5.204	13.467	68.399	1.00	23.71	N
ATOM	2008	CA	LEU	A	354	−3.849	13.932	68.228	1.00	24.09	C
ATOM	2009	CB	LEU	A	354	−3.464	14.800	69.430	1.00	24.13	C
ATOM	2010	CG	LEU	A	354	−2.112	15.477	69.243	1.00	26.09	C
ATOM	2011	CD1	LEU	A	354	−2.152	16.359	67.957	1.00	28.57	C
ATOM	2012	CD2	LEU	A	354	−1.651	16.269	70.454	1.00	26.57	C
ATOM	2013	C	LEU	A	354	−2.839	12.795	68.040	1.00	23.91	C
ATOM	2014	O	LEU	A	354	−1.865	12.935	67.306	1.00	24.26	O
ATOM	2026	N	VAL	A	355	−3.066	11.667	68.698	1.00	24.35	N
ATOM	2027	CA	VAL	A	355	−2.215	10.493	68.503	1.00	24.18	C
ATOM	2028	CB	VAL	A	355	−2.624	9.365	69.489	1.00	24.01	C
ATOM	2029	CG1	VAL	A	355	−1.894	8.060	69.196	1.00	24.42	C
ATOM	2030	CG2	VAL	A	355	−2.347	9.769	70.892	1.00	24.75	C
ATOM	2031	C	VAL	A	355	−2.317	10.005	67.024	1.00	24.31	C
ATOM	2032	O	VAL	A	355	−1.323	9.634	66.370	1.00	23.40	O
ATOM	2042	N	LEU	A	356	−3.544	10.040	66.524	1.00	24.17	N
ATOM	2043	CA	LEU	A	356	−3.874	9.570	65.213	1.00	24.28	C
ATOM	2044	CB	LEU	A	356	−5.395	9.606	65.054	1.00	24.58	C
ATOM	2045	CG	LEU	A	356	−6.088	8.520	64.232	1.00	24.94	C
ATOM	2046	CD1	LEU	A	356	−5.483	7.125	64.437	1.00	25.65	C
ATOM	2047	CD2	LEU	A	356	−7.579	8.518	64.562	1.00	24.91	C
ATOM	2048	C	LEU	A	356	−3.203	10.447	64.169	1.00	24.53	C
ATOM	2049	O	LEU	A	356	−2.713	9.953	63.138	1.00	24.41	O
ATOM	2061	N	GLN	A	357	−3.179	11.745	64.445	1.00	24.33	N
ATOM	2062	CA	GLN	A	357	−2.534	12.727	63.579	1.00	24.45	C
ATOM	2063	CB	GLN	A	357	−2.777	14.125	64.138	1.00	25.09	C
ATOM	2064	CG	GLN	A	357	−4.066	14.750	63.666	1.00	28.14	C
ATOM	2065	CD	GLN	A	357	−3.798	15.997	62.851	1.00	32.13	C
ATOM	2066	OE1	GLN	A	357	−4.095	15.955	61.539	1.00	35.00	O
ATOM	2067	NE2	GLN	A	357	−3.299	16.981	63.399	1.00	32.18	N
ATOM	2068	C	GLN	A	357	−1.032	12.517	63.464	1.00	23.60	C
ATOM	2069	O	GLN	A	357	−0.473	12.590	62.375	1.00	23.35	O
ATOM	2078	N	LEU	A	358	−0.390	12.266	64.600	1.00	22.82	N
ATOM	2079	CA	LEU	A	358	1.049	12.092	64.640	1.00	22.51	C
ATOM	2080	CB	LEU	A	358	1.562	12.179	66.069	1.00	22.81	C
ATOM	2081	CG	LEU	A	358	1.443	13.586	66.659	1.00	23.01	C
ATOM	2082	CD1	LEU	A	358	1.601	13.593	68.160	1.00	24.29	C
ATOM	2083	CD2	LEU	A	358	2.473	14.479	66.052	1.00	23.76	C
ATOM	2084	C	LEU	A	358	1.455	10.779	64.019	1.00	22.50	C
ATOM	2085	O	LEU	A	358	2.538	10.670	63.465	1.00	22.59	O
ATOM	2097	N	LEU	A	359	0.575	9.790	64.088	1.00	22.25	N
ATOM	2098	CA	LEU	A	359	0.796	8.521	63.407	1.00	22.01	C
ATOM	2099	CB	LEU	A	359	−0.194	7.446	63.906	1.00	22.06	C
ATOM	2100	CG	LEU	A	359	0.156	6.779	65.246	1.00	21.59	C
ATOM	2101	CD1	LEU	A	359	−1.011	5.953	65.726	1.00	21.97	C
ATOM	2102	CD2	LEU	A	359	1.396	5.896	65.134	1.00	21.34	C
ATOM	2103	C	LEU	A	359	0.694	8.680	61.890	1.00	21.75	C
ATOM	2104	O	LEU	A	359	1.442	8.044	61.162	1.00	20.95	O
ATOM	2116	N	ALA	A	360	−0.214	9.535	61.424	1.00	21.71	N
ATOM	2117	CA	ALA	A	360	−0.355	9.785	59.996	1.00	21.95	C
ATOM	2118	CB	ALA	A	360	−1.653	10.489	59.709	1.00	21.96	C
ATOM	2119	C	ALA	A	360	0.833	10.588	59.449	1.00	22.18	C
ATOM	2120	O	ALA	A	360	1.124	10.537	58.255	1.00	23.10	O
ATOM	2126	N	LEU	A	361	1.532	11.304	60.323	1.00	21.79	N
ATOM	2127	CA	LEU	A	361	2.734	12.029	59.953	1.00	21.59	C
ATOM	2128	CB	LEU	A	361	2.882	13.282	60.814	1.00	21.35	C
ATOM	2129	CG	LEU	A	361	1.787	14.312	60.582	1.00	21.58	C
ATOM	2130	CD1	LEU	A	361	1.823	15.349	61.641	1.00	22.85	C
ATOM	2131	CD2	LEU	A	361	1.929	14.940	59.210	1.00	23.29	C
ATOM	2132	C	LEU	A	361	3.970	11.168	60.124	1.00	21.89	C
ATOM	2133	O	LEU	A	361	5.082	11.632	59.888	1.00	22.06	O
ATOM	2145	N	GLN	A	362	3.780	9.925	60.548	1.00	22.19	N
ATOM	2146	CA	GLN	A	362	4.872	8.978	60.751	1.00	22.51	C
ATOM	2147	CB	GLN	A	362	5.539	8.613	59.421	1.00	22.99	C
ATOM	2148	CG	GLN	A	362	4.593	8.134	58.311	1.00	24.14	C
ATOM	2149	CD	GLN	A	362	5.357	7.747	57.061	1.00	26.67	C
ATOM	2150	OE1	GLN	A	362	5.269	8.416	56.020	1.00	29.67	O
ATOM	2151	NE2	GLN	A	362	6.124	6.670	57.158	1.00	28.21	N
ATOM	2152	C	GLN	A	362	5.904	9.522	61.725	1.00	22.18	C
ATOM	2153	O	GLN	A	362	7.114	9.498	61.463	1.00	22.36	O
ATOM	2162	N	LEU	A	363	5.402	10.024	62.845	1.00	22.16	N
ATOM	2163	CA	LEU	A	363	6.215	10.644	63.899	1.00	22.18	C
ATOM	2164	CB	LEU	A	363	5.309	11.051	65.061	1.00	22.05	C
ATOM	2165	CG	LEU	A	363	5.640	12.107	66.122	1.00	22.81	C
ATOM	2166	CD1	LEU	A	363	5.555	11.496	67.535	1.00	22.62	C
ATOM	2167	CD2	LEU	A	363	6.955	12.822	65.926	1.00	23.42	C
ATOM	2168	C	LEU	A	363	7.243	9.631	64.371	1.00	22.00	C
ATOM	2169	O	LEU	A	363	6.896	8.475	64.607	1.00	22.21	O
ATOM	2181	N	ASP	A	364	8.503	10.042	64.478	1.00	21.65	N
ATOM	2182	CA	ASP	A	364	9.537	9.149	64.985	1.00	21.27	C
ATOM	2183	CB	ASP	A	364	10.499	8.712	63.858	1.00	21.21	C
ATOM	2184	CG	ASP	A	364	11.354	9.836	63.320	1.00	21.38	C
ATOM	2185	OD1	ASP	A	364	11.606	10.791	64.059	1.00	22.38	O
ATOM	2186	OD2	ASP	A	364	11.837	9.845	62.161	1.00	22.50	O
ATOM	2187	C	ASP	A	364	10.247	9.721	66.229	1.00	21.01	C
ATOM	2188	O	ASP	A	364	9.990	10.846	66.644	1.00	20.30	O
ATOM	2193	N	ARG	A	365	11.105	8.907	66.830	1.00	21.05	N
ATOM	2194	CA	ARG	A	365	11.795	9.229	68.078	1.00	21.57	C
ATOM	2195	CB	ARG	A	365	12.621	8.013	68.524	1.00	22.05	C
ATOM	2196	CG	ARG	A	365	13.409	8.152	69.843	1.00	24.28	C
ATOM	2197	CD	ARG	A	365	14.001	6.793	70.358	1.00	26.84	C
ATOM	2198	NE	ARG	A	365	14.229	6.735	71.813	1.00	29.63	N
ATOM	2199	CZ	ARG	A	365	13.268	6.761	72.761	1.00	31.96	C
ATOM	2200	NH1	ARG	A	365	11.974	6.858	72.443	1.00	33.32	N
ATOM	2201	NH2	ARG	A	365	13.601	6.699	74.051	1.00	32.82	N
ATOM	2202	C	ARG	A	365	12.704	10.454	67.945	1.00	21.29	C
ATOM	2203	O	ARG	A	365	12.928	11.177	68.908	1.00	20.92	O
ATOM	2217	N	GLN	A	366	13.237	10.668	66.745	1.00	20.91	N
ATOM	2218	CA	GLN	A	366	14.111	11.806	66.479	1.00	20.19	C
ATOM	2219	CB	GLN	A	366	14.733	11.705	65.083	1.00	20.55	C
ATOM	2220	CG	GLN	A	366	15.916	10.766	64.976	1.00	20.66	C
ATOM	2221	CD	GLN	A	366	15.560	9.303	65.001	1.00	21.12	C
ATOM	2222	OE1	GLN	A	366	14.295	8.973	64.793	1.00	25.33	O
ATOM	2223	NE2	GLN	A	366	16.446	8.472	65.184	1.00	20.14	N
ATOM	2224	C	GLN	A	366	13.304	13.077	66.554	1.00	19.24	C
ATOM	2225	O	GLN	A	366	13.751	14.082	67.091	1.00	18.56	O
ATOM	2234	N	GLU	A	367	12.118	13.017	65.978	1.00	18.48	N
ATOM	2235	CA	GLU	A	367	11.237	14.143	65.960	1.00	19.03	C
ATOM	2236	CB	GLU	A	367	10.118	13.897	64.969	1.00	19.13	C
ATOM	2237	CG	GLU	A	367	10.588	14.102	63.532	1.00	20.28	C
ATOM	2238	CD	GLU	A	367	9.763	13.378	62.492	1.00	19.78	C
ATOM	2239	OE1	GLU	A	367	8.766	12.740	62.851	1.00	21.59	O
ATOM	2240	OE2	GLU	A	367	10.115	13.458	61.303	1.00	22.21	O
ATOM	2241	C	GLU	A	367	10.710	14.356	67.345	1.00	19.37	C
ATOM	2242	O	GLU	A	367	10.595	15.481	67.815	1.00	19.16	O
ATOM	2249	N	PHE	A	368	10.452	13.251	68.026	1.00	20.19	N
ATOM	2250	CA	PHE	A	368	9.898	13.289	69.370	1.00	20.38	C
ATOM	2251	CB	PHE	A	368	9.657	11.869	69.887	1.00	20.68	C
ATOM	2252	CG	PHE	A	368	9.538	11.769	71.377	1.00	20.49	C
ATOM	2253	CD1	PHE	A	368	8.445	12.294	72.033	1.00	20.62	C
ATOM	2254	CE1	PHE	A	368	8.323	12.181	73.421	1.00	21.22	C
ATOM	2255	CZ	PHE	A	368	9.303	11.527	74.143	1.00	21.40	C
ATOM	2256	CE2	PHE	A	368	10.395	10.994	73.497	1.00	21.17	C
ATOM	2257	CD2	PHE	A	368	10.513	11.109	72.117	1.00	21.52	C
ATOM	2258	C	PHE	A	368	10.805	14.075	70.293	1.00	19.99	C
ATOM	2259	O	PHE	A	368	10.362	15.023	70.895	1.00	21.04	O
ATOM	2269	N	VAL	A	369	12.075	13.729	70.378	1.00	19.92	N
ATOM	2270	CA	VAL	A	369	12.944	14.425	71.318	1.00	20.08	C
ATOM	2271	CB	VAL	A	369	14.292	13.700	71.587	1.00	20.31	C
ATOM	2272	CG1	VAL	A	369	14.045	12.261	72.035	1.00	20.80	C
ATOM	2273	CG2	VAL	A	369	15.241	13.745	70.381	1.00	21.33	C
ATOM	2274	C	VAL	A	369	13.197	15.869	70.930	1.00	20.34	C
ATOM	2275	O	VAL	A	369	13.441	16.685	71.808	1.00	20.38	O
ATOM	2285	N	CYS	A	370	13.148	16.187	69.627	1.00	20.31	N
ATOM	2286	CA	CYS	A	370	13.322	17.558	69.166	1.00	19.84	C
ATOM	2287	CB	CYS	A	370	13.453	17.605	67.646	1.00	19.99	C
ATOM	2288	SG	CYS	A	370	14.158	19.145	67.022	1.00	19.10	S
ATOM	2289	C	CYS	A	370	12.146	18.407	69.594	1.00	19.85	C
ATOM	2290	O	CYS	A	370	12.282	19.551	70.009	1.00	19.53	O
ATOM	2296	N	LEU	A	371	10.977	17.823	69.468	1.00	20.22	N
ATOM	2297	CA	LEU	A	371	9.740	18.509	69.760	1.00	20.66	C
ATOM	2298	CB	LEU	A	371	8.577	17.642	69.276	1.00	20.45	C
ATOM	2299	CG	LEU	A	371	7.778	17.912	67.995	1.00	20.58	C
ATOM	2300	CD1	LEU	A	371	8.258	19.027	67.150	1.00	21.11	C
ATOM	2301	CD2	LEU	A	371	7.627	16.631	67.175	1.00	20.00	C
ATOM	2302	C	LEU	A	371	9.619	18.783	71.278	1.00	20.85	C
ATOM	2303	O	LEU	A	371	9.131	19.825	71.695	1.00	20.85	O
ATOM	2315	N	LYS	A	372	10.074	17.856	72.109	1.00	20.71	N
ATOM	2316	CA	LYS	A	372	10.015	18.089	73.527	1.00	20.77	C
ATOM	2317	CB	LYS	A	372	9.928	16.775	74.298	1.00	21.39	C
ATOM	2318	CG	LYS	A	372	11.137	15.961	74.569	1.00	24.12	C
ATOM	2319	CD	LYS	A	372	10.653	14.549	75.043	1.00	25.22	C
ATOM	2320	CE	LYS	A	372	11.720	13.715	75.709	1.00	25.11	C
ATOM	2321	NZ	LYS	A	372	11.622	13.897	77.187	1.00	27.63	N
ATOM	2322	C	LYS	A	372	11.049	19.081	74.036	1.00	20.17	C
ATOM	2323	O	LYS	A	372	10.791	19.780	74.990	1.00	19.82	O
ATOM	2337	N	PHE	A	373	12.170	19.220	73.340	1.00	19.81	N
ATOM	2338	CA	PHE	A	373	13.108	20.283	73.610	1.00	18.91	C
ATOM	2339	CB	PHE	A	373	14.414	19.991	72.858	1.00	19.08	C
ATOM	2340	CG	PHE	A	373	15.546	20.973	73.141	1.00	19.84	C
ATOM	2341	CD1	PHE	A	373	16.382	20.808	74.240	1.00	20.35	C
ATOM	2342	CE1	PHE	A	373	17.418	21.707	74.491	1.00	20.35	C
ATOM	2343	CZ	PHE	A	373	17.625	22.778	73.646	1.00	19.59	C
ATOM	2344	CE2	PHE	A	373	16.802	22.959	72.547	1.00	20.08	C
ATOM	2345	CD2	PHE	A	373	15.776	22.057	72.298	1.00	20.40	C
ATOM	2346	C	PHE	A	373	12.472	21.602	73.189	1.00	18.33	C
ATOM	2347	O	PHE	A	373	12.602	22.613	73.844	1.00	18.29	O
ATOM	2357	N	ILE	A	374	11.743	21.595	72.097	1.00	18.65	N
ATOM	2358	CA	ILE	A	374	11.085	22.813	71.625	1.00	18.60	C
ATOM	2359	CB	ILE	A	374	10.464	22.589	70.235	1.00	17.68	C
ATOM	2360	CG1	ILE	A	374	11.575	22.499	69.199	1.00	19.05	C
ATOM	2361	CD1	ILE	A	374	11.147	21.952	67.845	1.00	18.93	C
ATOM	2362	CG2	ILE	A	374	9.515	23.714	69.902	1.00	17.52	C
ATOM	2363	C	ILE	A	374	10.054	23.327	72.628	1.00	18.48	C
ATOM	2364	O	ILE	A	374	9.962	24.538	72.883	1.00	18.47	O
ATOM	2376	N	ILE	A	375	9.294	22.395	73.185	1.00	18.87	N
ATOM	2377	CA	ILE	A	375	8.283	22.685	74.194	1.00	19.24	C
ATOM	2378	CB	ILE	A	375	7.510	21.416	74.574	1.00	19.70	C
ATOM	2379	CG1	ILE	A	375	6.640	20.963	73.410	1.00	20.22	C
ATOM	2380	CD1	ILE	A	375	6.171	19.550	73.506	1.00	20.12	C
ATOM	2381	CG2	ILE	A	375	6.642	21.649	75.843	1.00	19.82	C
ATOM	2382	C	ILE	A	375	8.921	23.248	75.423	1.00	19.45	C
ATOM	2383	O	ILE	A	375	8.429	24.206	75.970	1.00	20.14	O
ATOM	2395	N	LEU	A	376	10.011	22.632	75.859	1.00	20.03	N
ATOM	2396	CA	LEU	A	376	10.800	23.110	76.981	1.00	20.50	C
ATOM	2397	CB	LEU	A	376	12.063	22.248	77.155	1.00	20.96	C
ATOM	2398	CG	LEU	A	376	13.000	22.498	78.339	1.00	20.06	C
ATOM	2399	CD1	LEU	A	376	12.269	22.400	79.639	1.00	20.14	C
ATOM	2400	CD2	LEU	A	376	14.158	21.499	78.306	1.00	21.22	C
ATOM	2401	C	LEU	A	376	11.187	24.577	76.852	1.00	21.18	C
ATOM	2402	O	LEU	A	376	11.048	25.340	77.819	1.00	20.99	O
ATOM	2414	N	PHE	A	377	11.625	24.977	75.658	1.00	22.12	N
ATOM	2415	CA	PHE	A	377	12.079	26.348	75.402	1.00	22.30	C
ATOM	2416	CB	PHE	A	377	13.364	26.308	74.613	1.00	22.04	C
ATOM	2417	CG	PHE	A	377	14.563	26.016	75.454	1.00	22.67	C
ATOM	2418	CD1	PHE	A	377	15.022	24.719	75.601	1.00	22.00	C
ATOM	2419	CE1	PHE	A	377	16.152	24.446	76.400	1.00	23.73	C
ATOM	2420	CZ	PHE	A	377	16.807	25.473	77.065	1.00	22.98	C
ATOM	2421	CE2	PHE	A	377	16.329	26.778	76.946	1.00	23.96	C
ATOM	2422	CD2	PHE	A	377	15.215	27.042	76.137	1.00	22.40	C
ATOM	2423	C	PHE	A	377	11.057	27.240	74.701	1.00	22.99	C
ATOM	2424	O	PHE	A	377	11.397	28.302	74.212	1.00	22.76	O
ATOM	2434	N	SER	A	378	9.805	26.797	74.677	1.00	24.46	N
ATOM	2435	CA	SER	A	378	8.680	27.561	74.109	1.00	25.71	C
ATOM	2436	CB	SER	A	378	7.520	26.611	73.793	1.00	25.76	C
ATOM	2437	OG	SER	A	378	6.941	26.085	75.008	1.00	26.75	O
ATOM	2438	C	SER	A	378	8.159	28.623	75.076	1.00	25.99	C
ATOM	2439	O	SER	A	378	7.001	28.586	75.475	1.00	28.05	O
ATOM	2445	N	LEU	A	379	9.023	29.519	75.509	1.00	25.62	N
ATOM	2446	CA	LEU	A	379	8.643	30.602	76.366	1.00	25.17	C
ATOM	2447	CB	LEU	A	379	9.149	30.390	77.805	1.00	24.81	C
ATOM	2448	CG	LEU	A	379	8.933	31.569	78.791	1.00	24.46	C
ATOM	2449	CD1	LEU	A	379	7.476	31.769	79.192	1.00	24.12	C
ATOM	2450	CD2	LEU	A	379	9.758	31.419	80.044	1.00	24.30	C
ATOM	2451	C	LEU	A	379	9.269	31.826	75.725	1.00	25.14	C
ATOM	2452	O	LEU	A	379	10.381	31.757	75.206	1.00	24.89	O
ATOM	2464	N	ASP	A	380	8.538	32.935	75.745	1.00	25.27	N
ATOM	2465	CA	ASP	A	380	9.042	34.174	75.205	1.00	25.53	C
ATOM	2466	CB	ASP	A	380	7.964	35.240	75.171	1.00	25.99	C
ATOM	2467	CG	ASP	A	380	8.321	36.366	74.235	1.00	28.41	C
ATOM	2468	OD1	ASP	A	380	8.046	37.545	74.552	1.00	31.53	O
ATOM	2469	OD2	ASP	A	380	8.900	36.154	73.149	1.00	33.00	O
ATOM	2470	C	ASP	A	380	10.189	34.657	76.044	1.00	25.32	C
ATOM	2471	O	ASP	A	380	10.118	34.646	77.270	1.00	24.98	O
ATOM	2476	N	LEU	A	381	11.228	35.104	75.353	1.00	25.71	N
ATOM	2477	CA	LEU	A	381	12.499	35.509	75.944	1.00	25.96	C
ATOM	2478	CB	LEU	A	381	13.375	36.194	74.892	1.00	26.37	C
ATOM	2479	CG	LEU	A	381	13.928	35.316	73.783	1.00	27.97	C
ATOM	2480	CD1	LEU	A	381	14.812	36.130	72.837	1.00	28.28	C
ATOM	2481	CD2	LEU	A	381	14.692	34.159	74.411	1.00	29.64	C
ATOM	2482	C	LEU	A	381	12.375	36.494	77.061	1.00	25.39	C
ATOM	2483	O	LEU	A	381	13.193	36.495	77.968	1.00	24.91	O
ATOM	2495	N	LYS	A	382	11.390	37.374	76.943	1.00	25.24	N
ATOM	2496	CA	LYS	A	382	11.233	38.487	77.866	1.00	25.01	C
ATOM	2497	CB	LYS	A	382	10.076	39.409	77.435	1.00	25.08	C
ATOM	2498	CG	LYS	A	382	8.691	38.771	77.455	1.00	26.26	C
ATOM	2499	CD	LYS	A	382	7.690	39.643	76.695	1.00	27.61	C
ATOM	2500	CE	LYS	A	382	6.274	39.059	76.699	1.00	28.85	C
ATOM	2501	NZ	LYS	A	382	5.364	39.885	75.833	1.00	30.23	N
ATOM	2502	C	LYS	A	382	11.067	38.031	79.309	1.00	24.44	C
ATOM	2503	O	LYS	A	382	11.492	38.722	80.221	1.00	24.43	O
ATOM	2517	N	PHE	A	383	10.502	36.845	79.513	1.00	23.99	N
ATOM	2518	CA	PHE	A	383	10.249	36.324	80.862	1.00	23.57	C
ATOM	2519	CB	PHE	A	383	9.141	35.268	80.793	1.00	23.87	C
ATOM	2520	CG	PHE	A	383	7.837	35.791	80.243	1.00	25.00	C
ATOM	2521	CD1	PHE	A	383	7.333	35.324	79.039	1.00	26.66	C
ATOM	2522	CE1	PHE	A	383	6.114	35.815	78.526	1.00	27.19	C
ATOM	2523	CZ	PHE	A	383	5.406	36.778	79.220	1.00	27.54	C
ATOM	2524	CE2	PHE	A	383	5.908	37.266	80.417	1.00	27.62	C
ATOM	2525	CD2	PHE	A	383	7.122	36.766	80.925	1.00	26.88	C
ATOM	2526	C	PHE	A	383	11.489	35.769	81.599	1.00	22.90	C
ATOM	2527	O	PHE	A	383	11.402	35.350	82.742	1.00	23.03	O
ATOM	2537	N	LEU	A	384	12.646	35.815	80.964	1.00	22.63	N
ATOM	2538	CA	LEU	A	384	13.868	35.216	81.490	1.00	22.66	C
ATOM	2539	CB	LEU	A	384	14.286	34.058	80.581	1.00	22.60	C
ATOM	2540	CG	LEU	A	384	13.219	32.984	80.437	1.00	23.54	C
ATOM	2541	CD1	LEU	A	384	13.544	32.029	79.311	1.00	25.61	C
ATOM	2542	CD2	LEU	A	384	13.057	32.232	81.736	1.00	23.44	C
ATOM	2543	C	LEU	A	384	15.009	36.221	81.551	1.00	22.32	C
ATOM	2544	O	LEU	A	384	14.980	37.250	80.863	1.00	22.67	O
ATOM	2556	N	ASN	A	385	16.013	35.907	82.369	1.00	22.09	N
ATOM	2557	CA	ASN	A	385	17.223	36.714	82.480	1.00	21.97	C
ATOM	2558	CB	ASN	A	385	18.057	36.291	83.678	1.00	21.83	C
ATOM	2559	CG	ASN	A	385	17.345	36.465	84.974	1.00	21.43	C
ATOM	2560	OD1	ASN	A	385	16.868	37.552	85.307	1.00	21.64	O
ATOM	2561	ND2	ASN	A	385	17.307	35.398	85.749	1.00	20.32	N
ATOM	2562	C	ASN	A	385	18.099	36.535	81.273	1.00	21.97	C
ATOM	2563	O	ASN	A	385	18.561	37.492	80.661	1.00	21.84	O
ATOM	2570	N	ASN	A	386	18.355	35.281	80.957	1.00	22.62	N
ATOM	2571	CA	ASN	A	386	19.271	34.946	79.888	1.00	23.32	C
ATOM	2572	CB	ASN	A	386	19.996	33.636	80.219	1.00	23.43	C
ATOM	2573	CG	ASN	A	386	21.243	33.430	79.384	1.00	23.81	C
ATOM	2574	OD1	ASN	A	386	21.267	33.764	78.211	1.00	26.86	O
ATOM	2575	ND2	ASN	A	386	22.280	32.885	79.987	1.00	22.52	N
ATOM	2576	C	ASN	A	386	18.548	34.851	78.551	1.00	23.68	C
ATOM	2577	O	ASN	A	386	18.037	33.806	78.202	1.00	24.08	O
ATOM	2584	N	HIS	A	387	18.520	35.951	77.806	1.00	24.33	N
ATOM	2585	CA	HIS	A	387	17.990	35.944	76.440	1.00	24.77	C
ATOM	2586	CB	HIS	A	387	17.830	37.363	75.858	1.00	24.89	C
ATOM	2587	CG	HIS	A	387	17.144	38.314	76.773	1.00	24.42	C
ATOM	2588	ND1	HIS	A	387	17.457	39.574	77.145	1.00	25.80	N
ATOM	2589	CE1	HIS	A	387	16.495	39.982	78.032	1.00	26.12	C
ATOM	2590	NE2	HIS	A	387	15.626	39.002	78.203	1.00	25.87	N
ATOM	2591	CD2	HIS	A	387	16.007	37.977	77.466	1.00	24.97	C
ATOM	2592	C	HIS	A	387	18.911	35.193	75.503	1.00	25.04	C
ATOM	2593	O	HIS	A	387	18.458	34.328	74.780	1.00	25.70	O
ATOM	2602	N	ILE	A	388	20.191	35.553	75.504	1.00	25.09	N
ATOM	2603	CA	ILE	A	388	21.114	35.091	74.473	1.00	25.53	C
ATOM	2604	CB	ILE	A	388	22.581	35.577	74.749	1.00	25.64	C
ATOM	2605	CG1	ILE	A	388	23.563	34.990	73.736	1.00	25.89	C
ATOM	2606	CD1	ILE	A	388	24.894	35.787	73.619	1.00	26.15	C
ATOM	2607	CG2	ILE	A	388	23.064	35.214	76.172	1.00	26.98	C
ATOM	2608	C	ILE	A	388	21.058	33.578	74.256	1.00	25.27	C
ATOM	2609	O	ILE	A	388	20.988	33.112	73.126	1.00	25.36	O
ATOM	2621	N	LEU	A	389	21.072	32.814	75.330	1.00	25.17	N
ATOM	2622	CA	LEU	A	389	21.192	31.365	75.206	1.00	25.46	C
ATOM	2623	CB	LEU	A	389	21.740	30.749	76.490	1.00	25.78	C
ATOM	2624	CG	LEU	A	389	23.206	31.085	76.744	1.00	26.48	C
ATOM	2625	CD1	LEU	A	389	23.589	30.466	78.080	1.00	27.92	C
ATOM	2626	CD2	LEU	A	389	24.111	30.583	75.627	1.00	27.22	C
ATOM	2627	C	LEU	A	389	19.883	30.700	74.866	1.00	25.08	C
ATOM	2628	O	LEU	A	389	19.868	29.733	74.103	1.00	24.94	O
ATOM	2640	N	VAL	A	390	18.798	31.217	75.432	1.00	24.57	N
ATOM	2641	CA	VAL	A	390	17.477	30.683	75.150	1.00	24.63	C
ATOM	2642	CB	VAL	A	390	16.415	31.265	76.105	1.00	24.41	C
ATOM	2643	CG1	VAL	A	390	15.015	30.843	75.693	1.00	24.69	C
ATOM	2644	CG2	VAL	A	390	16.681	30.827	77.529	1.00	24.67	C
ATOM	2645	C	VAL	A	390	17.055	30.928	73.690	1.00	24.69	C
ATOM	2646	O	VAL	A	390	16.381	30.085	73.091	1.00	25.10	O
ATOM	2656	N	LYS	A	391	17.424	32.079	73.133	1.00	24.43	N
ATOM	2657	CA	LYS	A	391	17.092	32.418	71.756	1.00	24.07	C
ATOM	2658	CB	LYS	A	391	17.530	33.852	71.455	1.00	24.46	C
ATOM	2659	CG	LYS	A	391	17.271	34.337	70.018	1.00	24.30	C
ATOM	2660	CD	LYS	A	391	17.460	35.837	69.938	1.00	24.65	C
ATOM	2661	CE	LYS	A	391	17.039	36.405	68.592	1.00	25.13	C
ATOM	2662	NZ	LYS	A	391	18.147	37.127	67.942	1.00	24.33	N
ATOM	2663	C	LYS	A	391	17.816	31.484	70.815	1.00	24.11	C
ATOM	2664	O	LYS	A	391	17.262	31.039	69.821	1.00	23.59	O
ATOM	2678	N	ASP	A	392	19.072	31.216	71.136	1.00	24.20	N
ATOM	2679	CA	ASP	A	392	19.885	30.330	70.349	1.00	24.86	C
ATOM	2680	CB	ASP	A	392	21.311	30.318	70.877	1.00	25.07	C
ATOM	2681	CG	ASP	A	392	22.235	29.503	70.008	1.00	27.58	C
ATOM	2682	OD1	ASP	A	392	22.239	29.713	68.769	1.00	29.43	O
ATOM	2683	OD2	ASP	A	392	22.997	28.622	70.469	1.00	32.58	O
ATOM	2684	C	ASP	A	392	19.302	28.919	70.359	1.00	24.69	C
ATOM	2685	O	ASP	A	392	19.244	28.256	69.327	1.00	25.06	O
ATOM	2690	N	ALA	A	393	18.873	28.467	71.528	1.00	24.15	N
ATOM	2691	CA	ALA	A	393	18.264	27.152	71.667	1.00	23.68	C
ATOM	2692	CB	ALA	A	393	18.013	26.852	73.114	1.00	23.83	C
ATOM	2693	C	ALA	A	393	16.966	27.070	70.900	1.00	23.18	C
ATOM	2694	O	ALA	A	393	16.696	26.085	70.262	1.00	23.38	O
ATOM	2700	N	GLN	A	394	16.166	28.119	70.958	1.00	22.93	N
ATOM	2701	CA	GLN	A	394	14.878	28.138	70.272	1.00	22.68	C
ATOM	2702	CB	GLN	A	394	14.124	29.422	70.594	1.00	22.83	C
ATOM	2703	CG	GLN	A	394	13.471	29.451	71.969	1.00	24.07	C
ATOM	2704	CD	GLN	A	394	13.039	30.845	72.399	1.00	24.29	C
ATOM	2705	OE1	GLN	A	394	13.276	31.833	71.689	1.00	26.27	O
ATOM	2706	NE2	GLN	A	394	12.398	30.927	73.556	1.00	24.58	N
ATOM	2707	C	GLN	A	394	15.060	28.057	68.775	1.00	22.11	C
ATOM	2708	O	GLN	A	394	14.291	27.396	68.095	1.00	21.72	O
ATOM	2717	N	GLU	A	395	16.067	28.771	68.285	1.00	21.76	N
ATOM	2718	CA	GLU	A	395	16.373	28.856	66.860	1.00	21.91	C
ATOM	2719	CB	GLU	A	395	17.295	30.058	66.573	1.00	21.92	C
ATOM	2720	CG	GLU	A	395	16.626	31.410	66.790	1.00	22.49	C
ATOM	2721	CD	GLU	A	395	17.539	32.586	66.475	1.00	23.61	C
ATOM	2722	OE1	GLU	A	395	18.774	32.421	66.502	1.00	24.02	O
ATOM	2723	OE2	GLU	A	395	17.019	33.689	66.207	1.00	25.17	O
ATOM	2724	C	GLU	A	395	17.017	27.559	66.330	1.00	21.70	C
ATOM	2725	O	GLU	A	395	16.610	27.039	65.294	1.00	19.95	O
ATOM	2732	N	LYS	A	396	18.018	27.069	67.062	1.00	21.77	N
ATOM	2733	CA	LYS	A	396	18.705	25.838	66.729	1.00	22.42	C
ATOM	2734	CB	LYS	A	396	19.849	25.598	67.710	1.00	22.60	C
ATOM	2735	CG	LYS	A	396	20.969	26.637	67.627	1.00	24.93	C
ATOM	2736	CD	LYS	A	396	22.153	26.195	66.756	1.00	26.69	C
ATOM	2737	CE	LYS	A	396	23.325	27.195	66.832	1.00	27.39	C
ATOM	2738	NZ	LYS	A	396	24.249	26.967	67.995	1.00	27.30	N
ATOM	2739	C	LYS	A	396	17.758	24.629	66.745	1.00	22.38	C
ATOM	2740	O	LYS	A	396	17.947	23.681	65.974	1.00	22.88	O
ATOM	2754	N	ALA	A	397	16.748	24.664	67.613	1.00	21.70	N
ATOM	2755	CA	ALA	A	397	15.843	23.534	67.766	1.00	21.29	C
ATOM	2756	CB	ALA	A	397	15.116	23.609	69.092	1.00	21.44	C
ATOM	2757	C	ALA	A	397	14.856	23.437	66.606	1.00	20.75	C
ATOM	2758	O	ALA	A	397	14.562	22.352	66.125	1.00	19.34	O
ATOM	2764	N	ASN	A	398	14.351	24.580	66.167	1.00	20.73	N
ATOM	2765	CA	ASN	A	398	13.471	24.638	65.014	1.00	21.27	C
ATOM	2766	CB	ASN	A	398	12.882	26.044	64.875	1.00	22.09	C
ATOM	2767	CG	ASN	A	398	11.553	26.197	65.588	1.00	24.23	C
ATOM	2768	OD1	ASN	A	398	11.019	25.254	66.196	1.00	26.64	O
ATOM	2769	ND2	ASN	A	398	11.012	27.402	65.530	1.00	27.30	N
ATOM	2770	C	ASN	A	398	14.184	24.306	63.712	1.00	20.32	C
ATOM	2771	O	ASN	A	398	13.632	23.614	62.847	1.00	19.91	O
ATOM	2778	N	ALA	A	399	15.399	24.831	63.573	1.00	19.59	N
ATOM	2779	CA	ALA	A	399	16.232	24.568	62.411	1.00	19.30	C
ATOM	2780	CB	ALA	A	399	17.545	25.348	62.498	1.00	19.12	C
ATOM	2781	C	ALA	A	399	16.522	23.084	62.288	1.00	18.71	C
ATOM	2782	O	ALA	A	399	16.544	22.541	61.190	1.00	18.75	O
ATOM	2788	N	ALA	A	400	16.759	22.455	63.429	1.00	18.21	N
ATOM	2789	CA	ALA	A	400	17.028	21.030	63.494	1.00	18.38	C
ATOM	2790	CB	ALA	A	400	17.444	20.610	64.910	1.00	18.33	C
ATOM	2791	C	ALA	A	400	15.838	20.228	63.044	1.00	17.84	C
ATOM	2792	O	ALA	A	400	16.004	19.277	62.279	1.00	18.31	O
ATOM	2798	N	LEU	A	401	14.649	20.627	63.481	1.00	17.21	N
ATOM	2799	CA	LEU	A	401	13.437	19.901	63.127	1.00	17.33	C
ATOM	2800	CB	LEU	A	401	12.235	20.409	63.933	1.00	17.09	C
ATOM	2801	CG	LEU	A	401	10.889	19.694	63.729	1.00	17.94	C
ATOM	2802	CD1	LEU	A	401	10.898	18.250	64.242	1.00	19.26	C
ATOM	2803	CD2	LEU	A	401	9.715	20.449	64.330	1.00	17.99	C
ATOM	2804	C	LEU	A	401	13.175	19.995	61.621	1.00	17.31	C
ATOM	2805	O	LEU	A	401	12.845	19.011	60.983	1.00	17.20	O
ATOM	2817	N	LEU	A	402	13.353	21.186	61.060	1.00	17.89	N
ATOM	2818	CA	LEU	A	402	13.138	21.429	59.647	1.00	17.74	C
ATOM	2819	CB	LEU	A	402	13.366	22.909	59.338	1.00	17.93	C
ATOM	2820	CG	LEU	A	402	12.796	23.495	58.025	1.00	18.15	C
ATOM	2821	CD1	LEU	A	402	13.859	23.991	57.118	1.00	18.39	C
ATOM	2822	CD2	LEU	A	402	11.850	22.560	57.267	1.00	17.97	C
ATOM	2823	C	LEU	A	402	14.096	20.627	58.802	1.00	17.79	C
ATOM	2824	O	LEU	A	402	13.729	20.012	57.817	1.00	17.11	O
ATOM	2836	N	ASP	A	403	15.347	20.662	59.206	1.00	18.07	N
ATOM	2837	CA	ASP	A	403	16.389	19.985	58.491	1.00	18.39	C
ATOM	2838	CB	ASP	A	403	17.726	20.243	59.166	1.00	18.69	C
ATOM	2839	CG	ASP	A	403	18.865	19.843	58.322	1.00	19.23	C
ATOM	2840	OD1	ASP	A	403	19.400	18.731	58.534	1.00	21.05	O
ATOM	2841	OD2	ASP	A	403	19.278	20.582	57.407	1.00	21.58	O
ATOM	2842	C	ASP	A	403	16.093	18.505	58.457	1.00	18.36	C
ATOM	2843	O	ASP	A	403	16.226	17.893	57.410	1.00	18.43	O
ATOM	2848	N	TYR	A	404	15.660	17.944	59.587	1.00	18.19	N
ATOM	2849	CA	TYR	A	404	15.412	16.503	59.686	1.00	18.39	C
ATOM	2850	CB	TYR	A	404	15.291	16.067	61.153	1.00	18.42	C
ATOM	2851	CG	TYR	A	404	14.993	14.599	61.323	1.00	17.30	C
ATOM	2852	CD1	TYR	A	404	16.018	13.675	61.430	1.00	16.30	C
ATOM	2853	CE1	TYR	A	404	15.754	12.333	61.563	1.00	16.45	C
ATOM	2854	CZ	TYR	A	404	14.449	11.907	61.595	1.00	17.69	C
ATOM	2855	OH	TYR	A	404	14.178	10.577	61.721	1.00	19.68	O
ATOM	2856	CE2	TYR	A	404	13.408	12.810	61.494	1.00	18.10	C
ATOM	2857	CD2	TYR	A	404	13.688	14.142	61.359	1.00	17.53	C
ATOM	2858	C	TYR	A	404	14.180	16.063	58.879	1.00	18.55	C
ATOM	2859	O	TYR	A	404	14.241	15.109	58.128	1.00	18.35	O
ATOM	2869	N	THR	A	405	13.081	16.789	59.013	1.00	19.24	N
ATOM	2870	CA	THR	A	405	11.823	16.464	58.327	1.00	19.72	C
ATOM	2871	CB	THR	A	405	10.674	17.383	58.811	1.00	19.76	C
ATOM	2872	OG1	THR	A	405	11.060	18.763	58.729	1.00	20.43	O
ATOM	2873	CG2	THR	A	405	10.380	17.167	60.266	1.00	20.30	C
ATOM	2874	C	THR	A	405	11.952	16.623	56.843	1.00	19.76	C
ATOM	2875	O	THR	A	405	11.335	15.907	56.079	1.00	20.31	O
ATOM	2883	N	LEU	A	406	12.754	17.589	56.435	1.00	20.28	N
ATOM	2884	CA	LEU	A	406	12.972	17.871	55.028	1.00	20.72	C
ATOM	2885	CB	LEU	A	406	13.685	19.219	54.898	1.00	20.95	C
ATOM	2886	CG	LEU	A	406	13.165	20.295	53.943	1.00	21.77	C
ATOM	2887	CD1	LEU	A	406	11.660	20.374	53.914	1.00	22.46	C
ATOM	2888	CD2	LEU	A	406	13.785	21.648	54.309	1.00	21.82	C
ATOM	2889	C	LEU	A	406	13.773	16.737	54.339	1.00	20.73	C
ATOM	2890	O	LEU	A	406	13.492	16.379	53.205	1.00	19.98	O
ATOM	2902	N	CYS	A	407	14.722	16.162	55.073	1.00	21.27	N
ATOM	2903	CA	CYS	A	407	15.601	15.104	54.604	1.00	21.98	C
ATOM	2904	CB	CYS	A	407	16.898	15.147	55.405	1.00	21.71	C
ATOM	2905	SG	CYS	A	407	17.979	16.555	55.037	1.00	22.56	S
ATOM	2906	C	CYS	A	407	15.022	13.694	54.729	1.00	22.93	C
ATOM	2907	O	CYS	A	407	15.429	12.783	54.009	1.00	23.48	O
ATOM	2913	N	HIS	A	408	14.091	13.507	55.649	1.00	24.40	N
ATOM	2914	CA	HIS	A	408	13.660	12.167	56.059	1.00	25.54	C
ATOM	2915	CB	HIS	A	408	13.881	11.969	57.575	1.00	25.12	C
ATOM	2916	CG	HIS	A	408	15.330	11.945	57.942	1.00	24.87	C
ATOM	2917	ND1	HIS	A	408	16.181	12.938	58.302	1.00	25.13	N
ATOM	2918	CE1	HIS	A	408	17.424	12.374	58.448	1.00	25.95	C
ATOM	2919	NE2	HIS	A	408	17.347	11.088	58.151	1.00	25.53	N
ATOM	2920	CD2	HIS	A	408	16.098	10.809	57.822	1.00	24.61	C
ATOM	2921	C	HIS	A	408	12.231	11.878	55.651	1.00	26.80	C
ATOM	2922	O	HIS	A	408	11.852	10.717	55.491	1.00	27.52	O
ATOM	2931	N	TYR	A	409	11.464	12.939	55.440	1.00	28.12	N
ATOM	2932	CA	TYR	A	409	10.076	12.853	55.017	1.00	29.13	C
ATOM	2933	CB	TYR	A	409	9.177	13.456	56.096	1.00	29.19	C
ATOM	2934	CG	TYR	A	409	7.680	13.168	55.993	1.00	30.74	C
ATOM	2935	CD1	TYR	A	409	7.118	12.099	56.689	1.00	31.34	C
ATOM	2936	CE1	TYR	A	409	5.742	11.848	56.642	1.00	32.04	C
ATOM	2937	CZ	TYR	A	409	4.895	12.676	55.902	1.00	32.68	C
ATOM	2938	OH	TYR	A	409	3.532	12.380	55.889	1.00	34.50	O
ATOM	2939	CE2	TYR	A	409	5.419	13.764	55.203	1.00	31.24	C
ATOM	2940	CD2	TYR	A	409	6.810	14.010	55.255	1.00	31.82	C
ATOM	2941	C	TYR	A	409	9.988	13.644	53.717	1.00	29.66	C
ATOM	2942	O	TYR	A	409	9.519	14.789	53.709	1.00	30.19	O
ATOM	2952	N	PRO	A	410	10.446	13.046	52.618	1.00	30.13	N
ATOM	2953	CA	PRO	A	410	10.390	13.722	51.309	1.00	30.52	C
ATOM	2954	CB	PRO	A	410	11.524	13.050	50.515	1.00	30.48	C
ATOM	2955	CG	PRO	A	410	11.640	11.643	51.130	1.00	30.57	C
ATOM	2956	CD	PRO	A	410	11.014	11.687	52.511	1.00	30.11	C
ATOM	2957	C	PRO	A	410	9.005	13.539	50.657	1.00	30.55	C
ATOM	2958	O	PRO	A	410	8.822	13.620	49.433	1.00	31.52	O
ATOM	2966	N	HIS	A	411	8.019	13.341	51.523	1.00	30.50	N
ATOM	2967	CA	HIS	A	411	6.654	13.089	51.133	1.00	30.19	C
ATOM	2968	CB	HIS	A	411	6.090	12.060	52.109	1.00	30.33	C
ATOM	2969	CG	HIS	A	411	6.903	10.803	52.148	1.00	32.02	C
ATOM	2970	ND1	HIS	A	411	6.796	9.866	53.156	1.00	33.58	N
ATOM	2971	CE1	HIS	A	411	7.626	8.866	52.905	1.00	33.80	C
ATOM	2972	NE2	HIS	A	411	8.277	9.128	51.783	1.00	32.45	N
ATOM	2973	CD2	HIS	A	411	7.844	10.332	51.288	1.00	31.89	C
ATOM	2974	C	HIS	A	411	5.845	14.387	51.092	1.00	29.33	C
ATOM	2975	O	HIS	A	411	6.358	15.476	51.385	1.00	29.45	O
ATOM	2984	N	SER	A	412	4.585	14.272	50.691	1.00	28.16	N
ATOM	2985	CA	SER	A	412	3.746	15.446	50.516	1.00	26.61	C
ATOM	2986	CB	SER	A	412	2.498	15.126	49.667	1.00	26.56	C
ATOM	2987	OG	SER	A	412	1.342	15.028	50.475	1.00	26.34	O
ATOM	2988	C	SER	A	412	3.390	15.976	51.895	1.00	24.90	C
ATOM	2989	O	SER	A	412	3.464	15.263	52.906	1.00	25.13	O
ATOM	2995	N	GLY	A	413	3.038	17.251	51.921	1.00	22.83	N
ATOM	2996	CA	GLY	A	413	2.794	17.964	53.149	1.00	20.85	C
ATOM	2997	C	GLY	A	413	4.098	18.488	53.688	1.00	19.27	C
ATOM	2998	O	GLY	A	413	5.114	17.801	53.684	1.00	18.32	O
ATOM	3002	N	ASP	A	414	4.046	19.705	54.203	1.00	18.12	N
ATOM	3003	CA	ASP	A	414	5.158	20.293	54.947	1.00	17.08	C
ATOM	3004	CB	ASP	A	414	5.057	21.810	54.833	1.00	16.59	C
ATOM	3005	CG	ASP	A	414	6.122	22.525	55.574	1.00	15.14	C
ATOM	3006	OD1	ASP	A	414	6.745	21.940	56.472	1.00	13.97	O
ATOM	3007	OD2	ASP	A	414	6.402	23.707	55.332	1.00	15.29	O
ATOM	3008	C	ASP	A	414	5.121	19.773	56.403	1.00	17.21	C
ATOM	3009	O	ASP	A	414	4.345	20.238	57.251	1.00	16.62	O
ATOM	3014	N	LYS	A	415	5.974	18.792	56.677	1.00	17.29	N
ATOM	3015	CA	LYS	A	415	5.931	18.060	57.936	1.00	17.45	C
ATOM	3016	CB	LYS	A	415	6.730	16.748	57.863	1.00	17.29	C
ATOM	3017	CG	LYS	A	415	6.694	15.963	59.167	1.00	17.76	C
ATOM	3018	CD	LYS	A	415	6.885	14.488	58.983	1.00	18.61	C
ATOM	3019	CE	LYS	A	415	7.034	13.772	60.331	1.00	19.03	C
ATOM	3020	NZ	LYS	A	415	7.674	12.427	60.235	1.00	17.38	N
ATOM	3021	C	LYS	A	415	6.387	18.893	59.123	1.00	17.45	C
ATOM	3022	O	LYS	A	415	5.871	18.737	60.207	1.00	17.58	O
ATOM	3036	N	PHE	A	416	7.371	19.747	58.913	1.00	17.58	N
ATOM	3037	CA	PHE	A	416	7.787	20.721	59.897	1.00	18.01	C
ATOM	3038	CB	PHE	A	416	8.830	21.632	59.259	1.00	17.90	C
ATOM	3039	CG	PHE	A	416	9.221	22.817	60.098	1.00	17.94	C
ATOM	3040	CD1	PHE	A	416	10.047	22.656	61.223	1.00	17.60	C
ATOM	3041	CE1	PHE	A	416	10.433	23.744	61.991	1.00	17.05	C
ATOM	3042	CZ	PHE	A	416	10.007	25.030	61.631	1.00	17.24	C
ATOM	3043	CE2	PHE	A	416	9.179	25.214	60.513	1.00	16.33	C
ATOM	3044	CD2	PHE	A	416	8.796	24.104	59.745	1.00	17.04	C
ATOM	3045	C	PHE	A	416	6.604	21.547	60.404	1.00	18.34	C
ATOM	3046	O	PHE	A	416	6.376	21.641	61.589	1.00	18.38	O
ATOM	3056	N	GLN	A	417	5.872	22.137	59.478	1.00	19.03	N
ATOM	3057	CA	GLN	A	417	4.755	22.986	59.793	1.00	19.91	C
ATOM	3058	CB	GLN	A	417	4.287	23.643	58.498	1.00	20.13	C
ATOM	3059	CG	GLN	A	417	3.310	24.770	58.664	1.00	22.66	C
ATOM	3060	CD	GLN	A	417	3.649	25.669	59.847	1.00	26.76	C
ATOM	3061	OE1	GLN	A	417	4.724	26.290	59.865	1.00	28.30	O
ATOM	3062	NE2	GLN	A	417	2.745	25.715	60.856	1.00	30.74	N
ATOM	3063	C	GLN	A	417	3.594	22.220	60.460	1.00	20.39	C
ATOM	3064	O	GLN	A	417	2.947	22.720	61.396	1.00	20.50	O
ATOM	3073	N	GLN	A	418	3.344	21.002	59.984	1.00	20.56	N
ATOM	3074	CA	GLN	A	418	2.287	20.143	60.507	1.00	20.58	C
ATOM	3075	CB	GLN	A	418	2.161	18.881	59.654	1.00	20.94	C
ATOM	3076	CG	GLN	A	418	1.547	19.118	58.268	1.00	24.25	C
ATOM	3077	CD	GLN	A	418	1.649	17.894	57.319	1.00	29.18	C
ATOM	3078	OE1	GLN	A	418	2.665	17.190	57.296	1.00	33.32	O
ATOM	3079	NE2	GLN	A	418	0.598	17.661	56.531	1.00	31.50	N
ATOM	3080	C	GLN	A	418	2.567	19.763	61.950	1.00	20.44	C
ATOM	3081	O	GLN	A	418	1.670	19.755	62.769	1.00	20.10	O
ATOM	3090	N	LEU	A	419	3.824	19.461	62.252	1.00	20.18	N
ATOM	3091	CA	LEU	A	419	4.250	19.159	63.605	1.00	20.32	C
ATOM	3092	CB	LEU	A	419	5.690	18.617	63.627	1.00	19.76	C
ATOM	3093	CG	LEU	A	419	5.892	17.220	63.023	1.00	19.28	C
ATOM	3094	CD1	LEU	A	419	7.355	16.823	63.058	1.00	18.25	C
ATOM	3095	CD2	LEU	A	419	5.045	16.175	63.730	1.00	20.07	C
ATOM	3096	C	LEU	A	419	4.130	20.365	64.539	1.00	20.91	C
ATOM	3097	O	LEU	A	419	3.780	20.201	65.693	1.00	20.09	O
ATOM	3109	N	LEU	A	420	4.428	21.562	64.037	1.00	21.53	N
ATOM	3110	CA	LEU	A	420	4.214	22.780	64.812	1.00	22.24	C
ATOM	3111	CB	LEU	A	420	4.778	24.005	64.088	1.00	22.10	C
ATOM	3112	CG	LEU	A	420	6.295	24.048	63.918	1.00	23.12	C
ATOM	3113	CD1	LEU	A	420	6.739	25.397	63.360	1.00	24.11	C
ATOM	3114	CD2	LEU	A	420	7.028	23.743	65.231	1.00	23.78	C
ATOM	3115	C	LEU	A	420	2.731	22.988	65.133	1.00	22.74	C
ATOM	3116	O	LEU	A	420	2.385	23.408	66.239	1.00	22.80	O
ATOM	3128	N	LEU	A	421	1.867	22.664	64.182	1.00	22.92	N
ATOM	3129	CA	LEU	A	421	0.439	22.745	64.400	1.00	23.62	C
ATOM	3130	CB	LEU	A	421	−0.277	22.410	63.106	1.00	24.23	C
ATOM	3131	CG	LEU	A	421	−1.434	23.291	62.674	1.00	25.57	C
ATOM	3132	CD1	LEU	A	421	−1.065	24.775	62.729	1.00	26.71	C
ATOM	3133	CD2	LEU	A	421	−1.814	22.881	61.260	1.00	25.87	C
ATOM	3134	C	LEU	A	421	−0.018	21.775	65.491	1.00	23.45	C
ATOM	3135	O	LEU	A	421	−0.964	22.048	66.229	1.00	23.05	O
ATOM	3147	N	CYS	A	422	0.660	20.631	65.557	1.00	23.26	N
ATOM	3148	CA	CYS	A	422	0.427	19.637	66.573	1.00	23.18	C
ATOM	3149	CB	CYS	A	422	1.278	18.412	66.323	1.00	23.22	C
ATOM	3150	SG	CYS	A	422	0.586	17.316	65.109	1.00	26.71	S
ATOM	3151	C	CYS	A	422	0.789	20.136	67.942	1.00	22.63	C
ATOM	3152	O	CYS	A	422	0.133	19.789	68.909	1.00	21.99	O
ATOM	3158	N	LEU	A	423	1.874	20.888	68.025	1.00	22.02	N
ATOM	3159	CA	LEU	A	423	2.281	21.498	69.274	1.00	22.11	C
ATOM	3160	CB	LEU	A	423	3.644	22.167	69.114	1.00	22.19	C
ATOM	3161	CG	LEU	A	423	4.857	21.403	69.682	1.00	22.64	C
ATOM	3162	CD1	LEU	A	423	4.761	19.886	69.585	1.00	23.66	C
ATOM	3163	CD2	LEU	A	423	6.163	21.851	69.082	1.00	23.15	C
ATOM	3164	C	LEU	A	423	1.234	22.489	69.788	1.00	22.00	C
ATOM	3165	O	LEU	A	423	1.042	22.613	70.974	1.00	22.66	O
ATOM	3177	N	VAL	A	424	0.544	23.166	68.889	1.00	21.95	N
ATOM	3178	CA	VAL	A	424	−0.517	24.076	69.261	1.00	22.08	C
ATOM	3179	CB	VAL	A	424	−1.028	24.876	68.045	1.00	22.12	C
ATOM	3180	CG1	VAL	A	424	−2.294	25.649	68.356	1.00	22.02	C
ATOM	3181	CG2	VAL	A	424	0.056	25.860	67.549	1.00	23.78	C
ATOM	3182	C	VAL	A	424	−1.618	23.282	69.922	1.00	21.76	C
ATOM	3183	O	VAL	A	424	−2.159	23.692	70.948	1.00	22.10	O
ATOM	3193	N	GLU	A	425	−1.909	22.119	69.368	1.00	21.82	N
ATOM	3194	CA	GLU	A	425	−2.895	21.219	69.947	1.00	21.50	C
ATOM	3195	CB	GLU	A	425	−3.188	20.096	68.971	1.00	21.50	C
ATOM	3196	CG	GLU	A	425	−4.113	19.040	69.536	1.00	23.59	C
ATOM	3197	CD	GLU	A	425	−5.475	19.597	69.907	1.00	25.13	C
ATOM	3198	OE1	GLU	A	425	−5.775	20.738	69.496	1.00	29.93	O
ATOM	3199	OE2	GLU	A	425	−6.242	18.899	70.583	1.00	24.97	O
ATOM	3200	C	GLU	A	425	−2.470	20.626	71.281	1.00	21.37	C
ATOM	3201	O	GLU	A	425	−3.279	20.419	72.139	1.00	20.52	O
ATOM	3208	N	VAL	A	426	−1.189	20.342	71.452	1.00	21.91	N
ATOM	3209	CA	VAL	A	426	−0.667	19.846	72.709	1.00	22.12	C
ATOM	3210	CB	VAL	A	426	0.841	19.537	72.617	1.00	22.40	C
ATOM	3211	CG1	VAL	A	426	1.500	19.561	73.995	1.00	22.16	C
ATOM	3212	CG2	VAL	A	426	1.074	18.220	71.935	1.00	23.67	C
ATOM	3213	C	VAL	A	426	−0.870	20.905	73.782	1.00	22.38	C
ATOM	3214	O	VAL	A	426	−1.193	20.592	74.908	1.00	22.52	O
ATOM	3224	N	ARG	A	427	−0.673	22.156	73.428	1.00	22.52	N
ATOM	3225	CA	ARG	A	427	−0.875	23.225	74.370	1.00	23.14	C
ATOM	3226	CB	ARG	A	427	−0.296	24.502	73.761	1.00	23.80	C
ATOM	3227	CG	ARG	A	427	−0.552	25.723	74.591	1.00	28.07	C
ATOM	3228	CD	ARG	A	427	0.366	26.946	74.314	1.00	32.33	C
ATOM	3229	NE	ARG	A	427	0.073	28.002	75.306	1.00	35.62	N
ATOM	3230	CZ	ARG	A	427	−0.951	28.900	75.256	1.00	37.93	C
ATOM	3231	NH1	ARG	A	427	−1.814	28.958	74.226	1.00	36.94	N
ATOM	3232	NH2	ARG	A	427	−1.089	29.784	76.257	1.00	38.53	N
ATOM	3233	C	ARG	A	427	−2.377	23.383	74.773	1.00	22.48	C
ATOM	3234	O	ARG	A	427	−2.721	23.672	75.931	1.00	22.08	O
ATOM	3248	N	ALA	A	428	−3.268	23.164	73.823	1.00	22.07	N
ATOM	3249	CA	ALA	A	428	−4.685	23.348	74.056	1.00	22.12	C
ATOM	3250	CB	ALA	A	428	−5.449	23.406	72.741	1.00	22.06	C
ATOM	3251	C	ALA	A	428	−5.200	22.226	74.926	1.00	22.29	C
ATOM	3252	O	ALA	A	428	−5.998	22.458	75.828	1.00	22.78	O
ATOM	3258	N	LEU	A	429	−4.714	21.024	74.663	1.00	22.14	N
ATOM	3259	CA	LEU	A	429	−4.971	19.852	75.483	1.00	22.59	C
ATOM	3260	CB	LEU	A	429	−4.249	18.666	74.881	1.00	22.98	C
ATOM	3261	CG	LEU	A	429	−4.986	17.393	74.493	1.00	25.32	C
ATOM	3262	CD1	LEU	A	429	−6.415	17.583	74.080	1.00	26.29	C
ATOM	3263	CD2	LEU	A	429	−4.200	16.753	73.362	1.00	27.92	C
ATOM	3264	C	LEU	A	429	−4.488	19.994	76.917	1.00	22.44	C
ATOM	3265	O	LEU	A	429	−5.155	19.584	77.858	1.00	21.62	O
ATOM	3277	N	SER	A	430	−3.307	20.564	77.078	1.00	22.14	N
ATOM	3278	CA	SER	A	430	−2.726	20.707	78.393	1.00	22.01	C
ATOM	3279	CB	SER	A	430	−1.227	20.976	78.282	1.00	22.24	C
ATOM	3280	OG	SER	A	430	−0.971	22.351	78.119	1.00	25.47	O
ATOM	3281	C	SER	A	430	−3.468	21.736	79.242	1.00	21.52	C
ATOM	3282	O	SER	A	430	−3.521	21.610	80.448	1.00	21.05	O
ATOM	3288	N	MET	A	431	−4.081	22.715	78.595	1.00	21.64	N
ATOM	3289	CA	MET	A	431	−4.979	23.654	79.236	1.00	21.88	C
ATOM	3290	CB	MET	A	431	−5.324	24.752	78.236	1.00	22.82	C
ATOM	3291	CG	MET	A	431	−5.955	25.980	78.843	1.00	26.42	C
ATOM	3292	SD	MET	A	431	−6.381	27.348	77.679	1.00	34.08	S
ATOM	3293	CE	MET	A	431	−8.031	27.647	78.149	1.00	31.99	C
ATOM	3294	C	MET	A	431	−6.270	22.969	79.758	1.00	21.17	C
ATOM	3295	O	MET	A	431	−6.660	23.168	80.902	1.00	19.28	O
ATOM	3305	N	GLN	A	432	−6.902	22.148	78.920	1.00	21.13	N
ATOM	3306	CA	GLN	A	432	−8.015	21.310	79.350	1.00	21.64	C
ATOM	3307	CB	GLN	A	432	−8.595	20.439	78.232	1.00	21.71	C
ATOM	3308	CG	GLN	A	432	−8.838	21.141	76.918	1.00	25.51	C
ATOM	3309	CD	GLN	A	432	−10.029	20.584	76.163	1.00	27.85	C
ATOM	3310	OE1	GLN	A	432	−10.183	19.365	76.011	1.00	30.10	O
ATOM	3311	NE2	GLN	A	432	−10.890	21.479	75.708	1.00	30.95	N
ATOM	3312	C	GLN	A	432	−7.605	20.390	80.480	1.00	20.60	C
ATOM	3313	O	GLN	A	432	−8.407	20.099	81.324	1.00	21.14	O
ATOM	3322	N	ALA	A	433	−6.366	19.937	80.491	1.00	20.19	N
ATOM	3323	CA	ALA	A	433	−5.885	19.056	81.543	1.00	20.11	C
ATOM	3324	CB	ALA	A	433	−4.532	18.390	81.137	1.00	19.80	C
ATOM	3325	C	ALA	A	433	−5.780	19.744	82.902	1.00	19.69	C
ATOM	3326	O	ALA	A	433	−6.185	19.174	83.914	1.00	19.36	O
ATOM	3332	N	LYS	A	434	−5.228	20.956	82.918	1.00	19.12	N
ATOM	3333	CA	LYS	A	434	−5.181	21.774	84.134	1.00	19.41	C
ATOM	3334	CB	LYS	A	434	−4.479	23.081	83.847	1.00	19.36	C
ATOM	3335	CG	LYS	A	434	−3.001	22.980	83.614	1.00	21.64	C
ATOM	3336	CD	LYS	A	434	−2.527	24.334	83.135	1.00	22.59	C
ATOM	3337	CE	LYS	A	434	−1.098	24.624	83.379	1.00	23.44	C
ATOM	3338	NZ	LYS	A	434	−1.001	26.090	83.688	1.00	25.51	N
ATOM	3339	C	LYS	A	434	−6.564	22.120	84.696	1.00	18.85	C
ATOM	3340	O	LYS	A	434	−6.726	22.257	85.877	1.00	19.53	O
ATOM	3354	N	GLU	A	435	−7.539	22.291	83.820	1.00	18.64	N
ATOM	3355	CA	GLU	A	435	−8.895	22.591	84.195	1.00	18.22	C
ATOM	3356	CB	GLU	A	435	−9.656	23.099	82.954	1.00	18.24	C
ATOM	3357	CG	GLU	A	435	−9.142	24.445	82.447	1.00	19.28	C
ATOM	3358	CD	GLU	A	435	−9.757	24.916	81.127	1.00	21.29	C
ATOM	3359	OE1	GLU	A	435	−9.426	26.023	80.682	1.00	22.03	O
ATOM	3360	OE2	GLU	A	435	−10.584	24.221	80.524	1.00	24.43	O
ATOM	3361	C	GLU	A	435	−9.568	21.361	84.806	1.00	18.08	C
ATOM	3362	O	GLU	A	435	−10.323	21.482	85.771	1.00	17.60	O
ATOM	3369	N	TYR	A	436	−9.280	20.178	84.263	1.00	18.46	N
ATOM	3370	CA	TYR	A	436	−9.705	18.909	84.871	1.00	18.96	C
ATOM	3371	CB	TYR	A	436	−9.261	17.696	84.046	1.00	19.26	C
ATOM	3372	CG	TYR	A	436	−9.386	16.356	84.793	1.00	20.38	C
ATOM	3373	CD1	TYR	A	436	−10.632	15.718	84.961	1.00	19.35	C
ATOM	3374	CE1	TYR	A	436	−10.735	14.496	85.654	1.00	18.63	C
ATOM	3375	CZ	TYR	A	436	−9.596	13.911	86.191	1.00	18.69	C
ATOM	3376	OH	TYR	A	436	−9.657	12.721	86.877	1.00	17.66	O
ATOM	3377	CE2	TYR	A	436	−8.367	14.518	86.035	1.00	20.19	C
ATOM	3378	CD2	TYR	A	436	−8.263	15.731	85.337	1.00	20.27	C
ATOM	3379	C	TYR	A	436	−9.118	18.787	86.249	1.00	19.34	C
ATOM	3380	O	TYR	A	436	−9.828	18.535	87.194	1.00	19.29	O
ATOM	3390	N	LEU	A	437	−7.810	18.996	86.349	1.00	19.64	N
ATOM	3391	CA	LEU	A	437	−7.112	19.060	87.635	1.00	19.87	C
ATOM	3392	CB	LEU	A	437	−5.657	19.463	87.424	1.00	20.12	C
ATOM	3393	CG	LEU	A	437	−4.533	18.431	87.561	1.00	22.65	C
ATOM	3394	CD1	LEU	A	437	−4.965	16.968	87.674	1.00	24.13	C
ATOM	3395	CD2	LEU	A	437	−3.523	18.605	86.433	1.00	23.71	C
ATOM	3396	C	LEU	A	437	−7.716	20.034	88.626	1.00	18.85	C
ATOM	3397	O	LEU	A	437	−7.891	19.702	89.782	1.00	18.16	O
ATOM	3409	N	TYR	A	438	−8.021	21.236	88.170	1.00	17.93	N
ATOM	3410	CA	TYR	A	438	−8.580	22.263	89.034	1.00	17.38	C
ATOM	3411	CB	TYR	A	438	−8.583	23.581	88.280	1.00	16.90	C
ATOM	3412	CG	TYR	A	438	−9.069	24.767	89.069	1.00	17.24	C
ATOM	3413	CD1	TYR	A	438	−8.266	25.360	90.044	1.00	17.55	C
ATOM	3414	CE1	TYR	A	438	−8.702	26.440	90.776	1.00	15.15	C
ATOM	3415	CZ	TYR	A	438	−9.936	26.981	90.518	1.00	16.02	C
ATOM	3416	OH	TYR	A	438	−10.363	28.067	91.233	1.00	14.28	O
ATOM	3417	CE2	TYR	A	438	−10.763	26.418	89.551	1.00	16.67	C
ATOM	3418	CD2	TYR	A	438	−10.329	25.320	88.833	1.00	16.48	C
ATOM	3419	C	TYR	A	438	−9.988	21.886	89.535	1.00	16.97	C
ATOM	3420	O	TYR	A	438	−10.349	22.138	90.680	1.00	16.23	O
ATOM	3430	N	HIS	A	439	−10.764	21.256	88.663	1.00	16.84	N
ATOM	3431	CA	HIS	A	439	−12.044	20.697	89.023	1.00	16.24	C
ATOM	3432	CB	HIS	A	439	−12.662	20.075	87.787	1.00	16.41	C
ATOM	3433	CG	HIS	A	439	−13.940	19.362	88.050	1.00	17.16	C
ATOM	3434	ND1	HIS	A	439	−15.089	20.019	88.429	1.00	19.56	N
ATOM	3435	CE1	HIS	A	439	−16.053	19.135	88.620	1.00	18.80	C
ATOM	3436	NE2	HIS	A	439	−15.561	17.931	88.393	1.00	18.39	N
ATOM	3437	CD2	HIS	A	439	−14.241	18.043	88.041	1.00	17.24	C
ATOM	3438	C	HIS	A	439	−11.922	19.687	90.167	1.00	15.77	C
ATOM	3439	O	HIS	A	439	−12.604	19.810	91.163	1.00	15.02	O
ATOM	3448	N	LYS	A	440	−11.017	18.719	90.045	1.00	16.25	N
ATOM	3449	CA	LYS	A	440	−10.769	17.713	91.099	1.00	16.49	C
ATOM	3450	CB	LYS	A	440	−9.698	16.704	90.683	1.00	16.38	C
ATOM	3451	CG	LYS	A	440	−9.955	15.960	89.382	1.00	17.80	C
ATOM	3452	CD	LYS	A	440	−11.308	15.227	89.324	1.00	19.43	C
ATOM	3453	CE	LYS	A	440	−11.317	13.973	90.160	1.00	20.78	C
ATOM	3454	NZ	LYS	A	440	−12.522	13.172	89.858	1.00	21.15	N
ATOM	3455	C	LYS	A	440	−10.346	18.333	92.420	1.00	16.31	C
ATOM	3456	O	LYS	A	440	−10.779	17.919	93.479	1.00	15.33	O
ATOM	3470	N	HIS	A	441	−9.511	19.357	92.320	1.00	17.08	N
ATOM	3471	CA	HIS	A	441	−8.972	20.066	93.458	1.00	17.11	C
ATOM	3472	CB	HIS	A	441	−7.863	21.040	92.981	1.00	17.64	C
ATOM	3473	CG	HIS	A	441	−7.518	22.103	93.982	1.00	18.38	C
ATOM	3474	ND1	HIS	A	441	−6.758	21.852	95.104	1.00	20.55	N
ATOM	3475	CE1	HIS	A	441	−6.652	22.957	95.820	1.00	21.85	C
ATOM	3476	NE2	HIS	A	441	−7.332	23.912	95.208	1.00	22.54	N
ATOM	3477	CD2	HIS	A	441	−7.887	23.401	94.060	1.00	19.63	C
ATOM	3478	C	HIS	A	441	−10.057	20.796	94.244	1.00	16.93	C
ATOM	3479	O	HIS	A	441	−10.047	20.771	95.462	1.00	17.41	O
ATOM	3488	N	LEU	A	442	−10.984	21.445	93.551	1.00	17.18	N
ATOM	3489	CA	LEU	A	442	−12.047	22.185	94.210	1.00	17.67	C
ATOM	3490	CB	LEU	A	442	−12.800	23.055	93.209	1.00	17.57	C
ATOM	3491	CG	LEU	A	442	−12.105	24.319	92.690	1.00	18.90	C
ATOM	3492	CD1	LEU	A	442	−13.127	25.131	91.904	1.00	20.19	C
ATOM	3493	CD2	LEU	A	442	−11.471	25.184	93.785	1.00	18.70	C
ATOM	3494	C	LEU	A	442	−13.028	21.257	94.949	1.00	17.99	C
ATOM	3495	O	LEU	A	442	−13.580	21.631	95.958	1.00	17.24	O
ATOM	3507	N	GLY	A	443	−13.213	20.046	94.439	1.00	19.06	N
ATOM	3508	CA	GLY	A	443	−14.031	19.043	95.083	1.00	19.99	C
ATOM	3509	C	GLY	A	443	−13.265	18.152	96.048	1.00	21.13	C
ATOM	3510	O	GLY	A	443	−13.752	17.092	96.432	1.00	21.16	O
ATOM	3514	N	ASN	A	444	−12.075	18.590	96.448	1.00	22.73	N
ATOM	3515	CA	ASN	A	444	−11.206	17.844	97.365	1.00	23.90	C
ATOM	3516	CB	ASN	A	444	−11.714	17.995	98.812	1.00	23.88	C
ATOM	3517	CG	ASN	A	444	−10.582	18.034	99.831	1.00	26.27	C
ATOM	3518	OD1	ASN	A	444	−9.478	18.485	99.522	1.00	32.29	O
ATOM	3519	ND2	ASN	A	444	−10.847	17.567	101.051	1.00	27.48	N
ATOM	3520	C	ASN	A	444	−10.997	16.350	97.001	1.00	24.01	C
ATOM	3521	O	ASN	A	444	−10.868	15.509	97.888	1.00	24.08	O
ATOM	3528	N	GLU	A	445	−10.930	16.051	95.700	1.00	24.16	N
ATOM	3529	CA	GLU	A	445	−10.796	14.670	95.184	1.00	24.21	C
ATOM	3530	CB	GLU	A	445	−11.645	14.506	93.913	1.00	23.91	C
ATOM	3531	CG	GLU	A	445	−13.121	14.317	94.233	1.00	25.54	C
ATOM	3532	CD	GLU	A	445	−14.082	14.870	93.194	1.00	26.62	C
ATOM	3533	OE1	GLU	A	445	−15.297	14.945	93.494	1.00	30.08	O
ATOM	3534	OE2	GLU	A	445	−13.654	15.226	92.087	1.00	28.63	O
ATOM	3535	C	GLU	A	445	−9.342	14.207	94.918	1.00	23.92	C
ATOM	3536	O	GLU	A	445	−9.100	13.029	94.664	1.00	23.88	O
ATOM	3543	N	MET	A	446	−8.388	15.127	94.982	1.00	23.69	N
ATOM	3544	CA	MET	A	446	−6.992	14.791	94.740	1.00	23.62	C
ATOM	3545	CB	MET	A	446	−6.250	15.976	94.099	1.00	23.35	C
ATOM	3546	CG	MET	A	446	−6.784	16.449	92.771	1.00	22.16	C
ATOM	3547	SD	MET	A	446	−6.763	15.187	91.490	1.00	22.14	S
ATOM	3548	CE	MET	A	446	−5.016	15.109	91.079	1.00	21.86	C
ATOM	3549	C	MET	A	446	−6.270	14.396	96.024	1.00	23.74	C
ATOM	3550	O	MET	A	446	−6.569	14.912	97.092	1.00	24.01	O
ATOM	3560	N	PRO	A	447	−5.286	13.504	95.918	1.00	24.34	N
ATOM	3561	CA	PRO	A	447	−4.416	13.186	97.055	1.00	24.52	C
ATOM	3562	CB	PRO	A	447	−3.321	12.329	96.427	1.00	24.38	C
ATOM	3563	CG	PRO	A	447	−3.890	11.778	95.221	1.00	23.68	C
ATOM	3564	CD	PRO	A	447	−4.917	12.732	94.718	1.00	24.29	C
ATOM	3565	C	PRO	A	447	−3.820	14.452	97.652	1.00	25.05	C
ATOM	3566	O	PRO	A	447	−3.561	15.408	96.926	1.00	25.52	O
ATOM	3574	N	PRO	A	448	−3.608	14.445	98.957	1.00	25.61	N
ATOM	3575	CA	PRO	A	448	−3.270	15.660	99.707	1.00	26.15	C
ATOM	3576	CB	ARG	A	448	−3.287	15.374	101.212	1.00	26.49	C
ATOM	3577	CG	ARG	A	448	−4.133	16.340	102.041	1.00	29.42	C
ATOM	3578	CD	ARG	A	448	−4.001	16.153	103.587	1.00	31.87	C
ATOM	3579	NE	ARG	A	448	−2.591	16.166	104.016	1.00	34.77	N
ATOM	3580	CZ	ARG	A	448	−1.777	15.097	104.058	1.00	35.53	C
ATOM	3581	NH1	ARG	A	448	−2.225	13.886	103.705	1.00	36.15	N
ATOM	3582	NH2	ARG	A	448	−0.509	15.242	104.458	1.00	34.42	N
ATOM	3583	C	ARG	A	448	−1.911	16.240	99.347	1.00	25.78	C
ATOM	3584	O	ARG	A	448	−1.657	17.427	99.570	1.00	26.34	O
ATOM	3598	N	ASN	A	449	−1.012	15.418	98.842	1.00	24.73	N
ATOM	3599	CA	ASN	A	449	0.298	15.938	98.574	1.00	24.59	C
ATOM	3600	CB	ASN	A	449	1.287	15.326	99.569	1.00	25.27	C
ATOM	3601	CG	ASN	A	449	1.389	16.153	100.868	1.00	28.02	C
ATOM	3602	OD1	ASN	A	449	1.002	15.705	101.965	1.00	29.49	O
ATOM	3603	ND2	ASN	A	449	1.901	17.383	100.737	1.00	31.03	N
ATOM	3604	C	ASN	A	449	0.688	15.756	97.102	1.00	23.59	C
ATOM	3605	O	ASN	A	449	1.870	15.652	96.771	1.00	23.24	O
ATOM	3612	N	ASN	A	450	−0.334	15.800	96.235	1.00	21.88	N
ATOM	3613	CA	ASN	A	450	−0.176	15.680	94.806	1.00	21.08	C
ATOM	3614	CB	ASN	A	450	−1.547	15.744	94.142	1.00	21.25	C
ATOM	3615	CG	ASN	A	450	−1.516	15.421	92.690	1.00	19.62	C
ATOM	3616	OD1	ASN	A	450	−1.457	16.302	91.863	1.00	18.95	O
ATOM	3617	ND2	ASN	A	450	−1.593	14.145	92.364	1.00	22.27	N
ATOM	3618	C	ASN	A	450	0.741	16.770	94.252	1.00	20.62	C
ATOM	3619	O	ASN	A	450	0.613	17.951	94.593	1.00	20.11	O
ATOM	3626	N	LEU	A	451	1.679	16.343	93.406	1.00	19.70	N
ATOM	3627	CA	LEU	A	451	2.646	17.234	92.800	1.00	18.92	C
ATOM	3628	CB	LEU	A	451	3.845	16.442	92.281	1.00	18.93	C
ATOM	3629	CG	LEU	A	451	4.580	15.564	93.311	1.00	18.03	C
ATOM	3630	CD1	LEU	A	451	5.864	15.065	92.722	1.00	16.94	C
ATOM	3631	CD2	LEU	A	451	4.867	16.251	94.646	1.00	18.18	C
ATOM	3632	C	LEU	A	451	2.051	18.075	91.691	1.00	18.24	C
ATOM	3633	O	LEU	A	451	2.413	19.237	91.535	1.00	17.33	O
ATOM	3645	N	LEU	A	452	1.120	17.512	90.934	1.00	18.42	N
ATOM	3646	CA	LEU	A	452	0.528	18.276	89.834	1.00	18.97	C
ATOM	3647	CB	LEU	A	452	−0.249	17.387	88.850	1.00	19.13	C
ATOM	3648	CG	LEU	A	452	0.471	16.176	88.254	1.00	18.55	C
ATOM	3649	CD1	LEU	A	452	−0.357	15.616	87.148	1.00	18.89	C
ATOM	3650	CD2	LEU	A	452	1.876	16.459	87.760	1.00	18.82	C
ATOM	3651	C	LEU	A	452	−0.311	19.443	90.354	1.00	19.05	C
ATOM	3652	O	LEU	A	452	−0.304	20.504	89.757	1.00	18.60	O
ATOM	3664	N	ILE	A	453	−0.947	19.261	91.512	1.00	19.14	N
ATOM	3665	CA	ILE	A	453	−1.729	20.321	92.136	1.00	19.46	C
ATOM	3666	CB	ILE	A	453	−2.659	19.753	93.256	1.00	19.21	C
ATOM	3667	CG1	ILE	A	453	−3.702	18.795	92.671	1.00	19.29	C
ATOM	3668	CD1	ILE	A	453	−4.629	19.427	91.644	1.00	19.78	C
ATOM	3669	CG2	ILE	A	453	−3.325	20.875	94.028	1.00	19.64	C
ATOM	3670	C	ILE	A	453	−0.816	21.411	92.678	1.00	19.12	C
ATOM	3671	O	ILE	A	453	−1.128	22.573	92.588	1.00	18.36	O
ATOM	3683	N	GLU	A	454	0.307	21.024	93.248	1.00	19.27	N
ATOM	3684	CA	GLU	A	454	1.275	21.986	93.716	1.00	19.99	C
ATOM	3685	CB	GLU	A	454	2.379	21.275	94.504	1.00	20.28	C
ATOM	3686	CG	GLU	A	454	3.556	22.151	94.870	1.00	22.28	C
ATOM	3687	CD	GLU	A	454	4.412	21.584	96.006	1.00	24.40	C
ATOM	3688	OE1	GLU	A	454	4.325	20.349	96.311	1.00	23.52	O
ATOM	3689	OE2	GLU	A	454	5.174	22.406	96.581	1.00	24.50	O
ATOM	3690	C	GLU	A	454	1.838	22.802	92.567	1.00	20.15	C
ATOM	3691	O	GLU	A	454	2.115	23.970	92.750	1.00	20.41	O
ATOM	3698	N	MET	A	455	1.990	22.198	91.392	1.00	20.68	N
ATOM	3699	CA	MET	A	455	2.458	22.905	90.183	1.00	21.84	C
ATOM	3700	CB	MET	A	455	2.872	21.904	89.104	1.00	22.12	C
ATOM	3701	CG	MET	A	455	4.132	21.097	89.446	1.00	22.21	C
ATOM	3702	SD	MET	A	455	5.554	22.148	89.621	1.00	21.64	S
ATOM	3703	CE	MET	A	455	5.546	22.999	88.110	1.00	21.41	C
ATOM	3704	C	MET	A	455	1.422	23.857	89.588	1.00	22.47	C
ATOM	3705	O	MET	A	455	1.757	24.916	89.078	1.00	22.12	O
ATOM	3715	N	LEU	A	456	0.168	23.442	89.679	1.00	23.51	N
ATOM	3716	CA	LEU	A	456	−0.994	24.202	89.255	1.00	24.84	C
ATOM	3717	CB	LEU	A	456	−2.234	23.326	89.463	1.00	24.74	C
ATOM	3718	CG	LEU	A	456	−3.514	23.598	88.687	1.00	25.88	C
ATOM	3719	CD1	LEU	A	456	−3.407	23.131	87.267	1.00	27.08	C
ATOM	3720	CD2	LEU	A	456	−4.675	22.887	89.366	1.00	27.47	C
ATOM	3721	C	LEU	A	456	−1.129	25.499	90.057	1.00	26.00	C
ATOM	3722	O	LEU	A	456	−1.456	26.557	89.510	1.00	25.65	O
ATOM	3734	N	GLN	A	457	−0.831	25.421	91.349	1.00	27.59	N
ATOM	3735	CA	GLN	A	457	−1.184	26.491	92.268	1.00	29.35	C
ATOM	3736	CB	GLN	A	457	−1.459	25.970	93.691	1.00	29.84	C
ATOM	3737	CG	GLN	A	457	−2.283	24.723	93.794	1.00	31.50	C
ATOM	3738	CD	GLN	A	457	−3.759	24.992	93.792	1.00	34.74	C
ATOM	3739	OE1	GLN	A	457	−4.364	25.065	92.706	1.00	38.46	O
ATOM	3740	NE2	GLN	A	457	−4.369	25.123	94.992	1.00	34.45	N
ATOM	3741	C	GLN	A	457	−0.109	27.564	92.367	1.00	29.98	C
ATOM	3742	O	GLN	A	457	−0.322	28.566	93.064	1.00	29.59	O
ATOM	3751	N	ALA	A	458	1.025	27.351	91.701	1.00	31.10	N
ATOM	3752	CA	ALA	A	458	2.163	28.273	91.774	1.00	32.37	C
ATOM	3753	CB	ALA	A	458	3.445	27.483	92.026	1.00	32.18	C
ATOM	3754	C	ALA	A	458	2.328	29.165	90.523	1.00	33.97	C
ATOM	3755	O	ALA	A	458	3.175	28.880	89.668	1.00	34.67	O
ATOM	3761	N	LYS	A	459	1.508	30.220	90.447	1.00	35.40	N
ATOM	3762	CA	LYS	A	459	1.638	31.393	89.531	1.00	36.40	C
ATOM	3763	CB	LYS	A	459	2.193	32.609	90.292	1.00	36.16	C
ATOM	3764	CG	LYS	A	459	1.184	33.188	91.284	1.00	35.23	C
ATOM	3765	CD	LYS	A	459	1.743	34.410	92.062	1.00	34.96	C
ATOM	3766	CE	LYS	A	459	0.793	34.852	93.236	1.00	34.01	C
ATOM	3767	NZ	LYS	A	459	1.397	35.897	94.195	1.00	32.95	N
ATOM	3768	C	LYS	A	459	2.314	31.221	88.134	1.00	38.21	C
ATOM	3769	O	LYS	A	459	3.499	31.557	87.870	1.00	38.13	O
ATOM	3783	N	GLN	A	460	1.491	30.645	87.265	1.00	40.18	N
ATOM	3784	CA	GLN	A	460	1.552	30.840	85.829	1.00	41.41	C
ATOM	3785	CB	GLN	A	460	1.320	29.495	85.095	1.00	41.20	C
ATOM	3786	CG	GLN	A	460	2.033	28.276	85.723	1.00	41.20	C
ATOM	3787	CD	GLN	A	460	1.076	27.176	86.239	1.00	42.91	C
ATOM	3788	OE1	GLN	A	460	1.596	25.977	86.390	1.00	46.44	O
ATOM	3789	NE2	GLN	A	460	−0.102	27.423	86.513	1.00	41.96	N
ATOM	3790	C	GLN	A	460	0.434	31.874	85.503	1.00	42.41	C
ATOM	3791	O	GLN	A	460	−0.117	32.573	86.385	1.00	43.76	O
ATOM	3792	OXT	GLN	A	460	−0.116	32.572	86.386	1.00	43.75	O
ATOM	3801	N	PRO	B	221	−6.216	−19.409	113.153	1.00	30.56	N
ATOM	3802	CA	PRO	B	221	−5.628	−19.881	114.445	1.00	30.36	C
ATOM	3803	CB	PRO	B	221	−6.714	−19.520	115.471	1.00	30.42	C
ATOM	3804	CG	PRO	B	221	−7.330	−18.245	114.917	1.00	30.92	C
ATOM	3805	CD	PRO	B	221	−7.259	−18.388	113.383	1.00	30.88	C
ATOM	3806	C	PRO	B	221	−5.321	−21.384	114.496	1.00	30.10	C
ATOM	3807	O	PRO	B	221	−5.570	−22.117	113.520	1.00	29.92	O
ATOM	3815	N	ASN	B	222	−4.810	−21.813	115.660	1.00	29.52	N
ATOM	3816	CA	ASN	B	222	−4.258	−23.148	115.863	1.00	28.81	C
ATOM	3817	CB	ASN	B	222	−5.348	−24.241	115.778	1.00	29.24	C
ATOM	3818	CG	ASN	B	222	−6.781	−23.684	115.837	1.00	30.75	C
ATOM	3819	OD1	ASN	B	222	−7.532	−23.764	114.854	1.00	32.35	O
ATOM	3820	ND2	ASN	B	222	−7.169	−23.141	116.996	1.00	32.77	N
ATOM	3821	C	ASN	B	222	−3.126	−23.396	114.851	1.00	27.38	C
ATOM	3822	O	ASN	B	222	−3.180	−24.345	114.062	1.00	27.55	O
ATOM	3829	N	VAL	B	223	−2.129	−22.508	114.848	1.00	25.83	N
ATOM	3830	CA	VAL	B	223	−0.978	−22.637	113.951	1.00	24.40	C
ATOM	3831	CB	VAL	B	223	−0.911	−21.547	112.851	1.00	24.21	C
ATOM	3832	CG1	VAL	B	223	0.244	−21.857	111.868	1.00	23.35	C
ATOM	3833	CG2	VAL	B	223	−2.225	−21.427	112.085	1.00	24.00	C
ATOM	3834	C	VAL	B	223	0.293	−22.553	114.767	1.00	23.64	C
ATOM	3835	O	VAL	B	223	0.526	−21.542	115.413	1.00	23.55	O
ATOM	3845	N	PRO	B	224	1.124	−23.597	114.728	1.00	22.92	N
ATOM	3846	CA	PRO	B	224	2.374	−23.618	115.506	1.00	22.54	C
ATOM	3847	CB	PRO	B	224	3.022	−24.955	115.115	1.00	22.12	C
ATOM	3848	CG	PRO	B	224	1.935	−25.780	114.588	1.00	22.30	C
ATOM	3849	CD	PRO	B	224	0.934	−24.850	113.975	1.00	22.61	C
ATOM	3850	C	PRO	B	224	3.317	−22.458	115.202	1.00	22.24	C
ATOM	3851	O	PRO	B	224	3.530	−22.119	114.052	1.00	21.75	O
ATOM	3859	N	GLU	B	225	3.876	−21.873	116.247	1.00	22.61	N
ATOM	3860	CA	GLU	B	225	4.769	−20.728	116.120	1.00	23.07	C
ATOM	3861	CB	GLU	B	225	5.391	−20.366	117.492	1.00	23.28	C
ATOM	3862	CG	GLU	B	225	6.430	−19.216	117.523	1.00	24.29	C
ATOM	3863	CD	GLU	B	225	5.929	−17.828	117.073	1.00	26.09	C
ATOM	3864	OE1	GLU	B	225	4.736	−17.662	116.718	1.00	26.54	O
ATOM	3865	OE2	GLU	B	225	6.755	−16.873	117.082	1.00	26.90	O
ATOM	3866	C	GLU	B	225	5.839	−20.947	115.052	1.00	22.83	C
ATOM	3867	O	GLU	B	225	6.101	−20.047	114.268	1.00	23.16	O
ATOM	3874	N	LEU	B	226	6.420	−22.145	114.998	1.00	22.42	N
ATOM	3875	CA	LEU	B	226	7.460	−22.458	114.019	1.00	21.93	C
ATOM	3876	CB	LEU	B	226	7.798	−23.954	114.086	1.00	21.87	C
ATOM	3877	CG	LEU	B	226	9.212	−24.480	113.849	1.00	22.15	C
ATOM	3878	CD1	LEU	B	226	9.244	−25.574	112.811	1.00	21.70	C
ATOM	3879	CD2	LEU	B	226	10.207	−23.378	113.493	1.00	24.88	C
ATOM	3880	C	LEU	B	226	6.986	−22.101	112.601	1.00	21.69	C
ATOM	3881	O	LEU	B	226	7.636	−21.370	111.857	1.00	21.00	O
ATOM	3893	N	ILE	B	227	5.815	−22.620	112.262	1.00	21.20	N
ATOM	3894	CA	ILE	B	227	5.225	−22.383	110.973	1.00	20.78	C
ATOM	3895	CB	ILE	B	227	3.966	−23.245	110.829	1.00	20.21	C
ATOM	3896	CG1	ILE	B	227	4.396	−24.708	110.714	1.00	20.55	C
ATOM	3897	CD1	ILE	B	227	3.260	−25.739	110.608	1.00	20.83	C
ATOM	3898	CG2	ILE	B	227	3.174	−22.815	109.627	1.00	19.79	C
ATOM	3899	C	ILE	B	227	4.951	−20.890	110.734	1.00	20.95	C
ATOM	3900	O	ILE	B	227	5.220	−20.381	109.645	1.00	20.68	O
ATOM	3912	N	LEU	B	228	4.410	−20.201	111.734	1.00	20.97	N
ATOM	3913	CA	LEU	B	228	4.124	−18.769	111.621	1.00	21.18	C
ATOM	3914	CB	LEU	B	228	3.437	−18.247	112.891	1.00	21.32	C
ATOM	3915	CG	LEU	B	228	2.015	−18.760	113.123	1.00	21.81	C
ATOM	3916	CD1	LEU	B	228	1.618	−18.507	114.542	1.00	22.11	C
ATOM	3917	CD2	LEU	B	228	1.029	−18.114	112.175	1.00	22.53	C
ATOM	3918	C	LEU	B	228	5.406	−17.975	111.365	1.00	21.08	C
ATOM	3919	O	LEU	B	228	5.407	−17.011	110.609	1.00	20.95	O
ATOM	3931	N	GLN	B	229	6.486	−18.408	112.007	1.00	21.01	N
ATOM	3932	CA	GLN	B	229	7.803	−17.833	111.821	1.00	20.47	C
ATOM	3933	CB	GLN	B	229	8.787	−18.389	112.857	1.00	20.71	C
ATOM	3934	CG	GLN	B	229	8.431	−18.160	114.332	1.00	20.12	C
ATOM	3935	CD	GLN	B	229	9.484	−18.711	115.268	1.00	19.11	C
ATOM	3936	OE1	GLN	B	229	9.476	−20.017	115.482	1.00	20.97	O
ATOM	3937	NE2	GLN	B	229	10.303	−17.962	115.782	1.00	19.52	N
ATOM	3938	C	GLN	B	229	8.335	−18.126	110.429	1.00	20.33	C
ATOM	3939	O	GLN	B	229	8.962	−17.266	109.815	1.00	20.59	O
ATOM	3948	N	LEU	B	230	8.105	−19.336	109.930	1.00	19.99	N
ATOM	3949	CA	LEU	B	230	8.521	−19.696	108.577	1.00	20.01	C
ATOM	3950	CB	LEU	B	230	8.398	−21.207	108.357	1.00	20.29	C
ATOM	3951	CG	LEU	B	230	9.404	−22.015	109.176	1.00	21.64	C
ATOM	3952	CD1	LEU	B	230	9.083	−23.542	109.233	1.00	21.25	C
ATOM	3953	CD2	LEU	B	230	10.800	−21.764	108.624	1.00	22.88	C
ATOM	3954	C	LEU	B	230	7.757	−18.932	107.498	1.00	19.57	C
ATOM	3955	O	LEU	B	230	8.309	−18.614	106.448	1.00	19.66	O
ATOM	3967	N	LEU	B	231	6.498	−18.626	107.755	1.00	19.07	N
ATOM	3968	CA	LEU	B	231	5.738	−17.786	106.853	1.00	19.31	C
ATOM	3969	CB	LEU	B	231	4.279	−17.775	107.266	1.00	19.21	C
ATOM	3970	CG	LEU	B	231	3.478	−19.056	107.003	1.00	20.38	C
ATOM	3971	CD1	LEU	B	231	2.139	−18.987	107.764	1.00	21.29	C
ATOM	3972	CD2	LEU	B	231	3.225	−19.243	105.528	1.00	18.94	C
ATOM	3973	C	LEU	B	231	6.278	−16.339	106.822	1.00	19.20	C
ATOM	3974	O	LEU	B	231	6.230	−15.680	105.799	1.00	19.30	O
ATOM	3986	N	GLN	B	232	6.785	−15.855	107.948	1.00	19.16	N
ATOM	3987	CA	GLN	B	232	7.335	−14.496	108.050	1.00	19.26	C
ATOM	3988	CB	GLN	B	232	7.579	−14.127	109.521	1.00	19.24	C
ATOM	3989	CG	GLN	B	232	6.354	−13.818	110.373	1.00	18.42	C
ATOM	3990	CD	GLN	B	232	6.735	−13.686	111.835	1.00	18.98	C
ATOM	3991	OE1	GLN	B	232	7.601	−12.888	112.169	1.00	17.49	O
ATOM	3992	NE2	GLN	B	232	6.106	−14.476	112.704	1.00	18.53	N
ATOM	3993	C	GLN	B	232	8.656	−14.364	107.295	1.00	19.31	C
ATOM	3994	O	GLN	B	232	9.044	−13.278	106.864	1.00	19.08	O
ATOM	4003	N	LEU	B	233	9.337	−15.490	107.157	1.00	20.16	N
ATOM	4004	CA	LEU	B	233	10.654	−15.558	106.552	1.00	20.76	C
ATOM	4005	CB	LEU	B	233	11.523	−16.497	107.387	1.00	20.78	C
ATOM	4006	CG	LEU	B	233	11.889	−16.001	108.787	1.00	20.72	C
ATOM	4007	CD1	LEU	B	233	12.789	−16.996	109.505	1.00	20.02	C
ATOM	4008	CD2	LEU	B	233	12.563	−14.644	108.720	1.00	21.85	C
ATOM	4009	C	LEU	B	233	10.637	−16.007	105.076	1.00	21.49	C
ATOM	4010	O	LEU	B	233	11.672	−15.937	104.389	1.00	21.23	O
ATOM	4022	N	GLU	B	234	9.463	−16.419	104.587	1.00	22.11	N
ATOM	4023	CA	GLU	B	234	9.336	−16.900	103.222	1.00	22.65	C
ATOM	4024	CB	GLU	B	234	7.984	−17.599	103.016	1.00	22.60	C
ATOM	4025	CG	GLU	B	234	7.835	−18.457	101.748	1.00	22.92	C
ATOM	4026	CD	GLU	B	234	9.022	−19.341	101.425	1.00	24.14	C
ATOM	4027	OE1	GLU	B	234	9.699	−19.814	102.364	1.00	24.85	O
ATOM	4028	OE2	GLU	B	234	9.273	−19.589	100.211	1.00	26.66	O
ATOM	4029	C	GLU	B	234	9.512	−15.742	102.244	1.00	23.50	C
ATOM	4030	O	GLU	B	234	8.795	−14.729	102.320	1.00	23.59	O
ATOM	4037	N	PRO	B	235	10.487	−15.865	101.343	1.00	24.14	N
ATOM	4038	CA	PRO	B	235	10.666	−14.850	100.295	1.00	24.80	C
ATOM	4039	CB	PRO	B	235	11.736	−15.467	99.369	1.00	24.74	C
ATOM	4040	CG	PRO	B	235	12.490	−16.429	100.239	1.00	24.98	C
ATOM	4041	CD	PRO	B	235	11.503	−16.934	101.260	1.00	24.00	C
ATOM	4042	C	PRO	B	235	9.357	−14.603	99.541	1.00	24.93	C
ATOM	4043	O	PRO	B	235	8.651	−15.555	99.258	1.00	24.27	O
ATOM	4051	N	ASP	B	236	9.038	−13.347	99.266	1.00	25.53	N
ATOM	4052	CA	ASP	B	236	7.915	−13.023	98.403	1.00	26.48	C
ATOM	4053	CB	ASP	B	236	7.587	−11.536	98.496	1.00	26.83	C
ATOM	4054	CG	ASP	B	236	6.460	−11.140	97.574	1.00	29.05	C
ATOM	4055	OD1	ASP	B	236	6.504	−10.027	97.012	1.00	32.21	O
ATOM	4056	OD2	ASP	B	236	5.480	−11.884	97.351	1.00	33.83	O
ATOM	4057	C	ASP	B	236	8.223	−13.389	96.941	1.00	26.70	C
ATOM	4058	O	ASP	B	236	9.216	−12.921	96.377	1.00	25.63	O
ATOM	4063	N	GLU	B	237	7.331	−14.190	96.344	1.00	27.18	N
ATOM	4064	CA	GLU	B	237	7.522	−14.770	95.001	1.00	28.02	C
ATOM	4065	CB	GLU	B	237	6.417	−15.826	94.688	1.00	28.48	C
ATOM	4066	CG	GLU	B	237	6.364	−16.373	93.248	1.00	31.64	C
ATOM	4067	CD	GLU	B	237	7.329	−17.546	92.915	1.00	34.68	C
ATOM	4068	OE1	GLU	B	237	8.134	−17.985	93.784	1.00	36.95	O
ATOM	4069	OE2	GLU	B	237	7.268	−18.042	91.745	1.00	35.77	O
ATOM	4070	C	GLU	B	237	7.646	−13.676	93.930	1.00	27.06	C
ATOM	4071	O	GLU	B	237	8.453	−13.794	93.015	1.00	26.28	O
ATOM	4078	N	ASP	B	238	6.879	−12.601	94.092	1.00	26.82	N
ATOM	4079	CA	ASP	B	238	6.953	−11.443	93.208	1.00	26.64	C
ATOM	4080	CB	ASP	B	238	5.791	−10.495	93.465	1.00	26.93	C
ATOM	4081	CG	ASP	B	238	4.453	−11.091	93.063	1.00	28.54	C
ATOM	4082	OD1	ASP	B	238	4.407	−12.022	92.225	1.00	29.27	O
ATOM	4083	OD2	ASP	B	238	3.379	−10.688	93.545	1.00	33.04	O
ATOM	4084	C	ASP	B	238	8.244	−10.664	93.343	1.00	26.18	C
ATOM	4085	O	ASP	B	238	8.759	−10.154	92.352	1.00	26.26	O
ATOM	4090	N	GLN	B	239	8.757	−10.556	94.560	1.00	25.72	N
ATOM	4091	CA	GLN	B	239	10.064	−9.938	94.782	1.00	25.93	C
ATOM	4092	CB	GLN	B	239	10.295	−9.653	96.268	1.00	25.95	C
ATOM	4093	CG	GLN	B	239	9.386	−8.587	96.835	1.00	25.99	C
ATOM	4094	CD	GLN	B	239	9.748	−8.254	98.248	1.00	26.98	C
ATOM	4095	OE1	GLN	B	239	10.007	−9.152	99.052	1.00	27.22	O
ATOM	4096	NE2	GLN	B	239	9.817	−6.965	98.554	1.00	27.89	N
ATOM	4097	C	GLN	B	239	11.224	−10.784	94.270	1.00	26.07	C
ATOM	4098	O	GLN	B	239	12.159	−10.256	93.663	1.00	26.46	O
ATOM	4107	N	VAL	B	240	11.191	−12.082	94.538	1.00	26.27	N
ATOM	4108	CA	VAL	B	240	12.240	−12.951	94.028	1.00	26.69	C
ATOM	4109	CB	VAL	B	240	12.248	−14.387	94.673	1.00	26.92	C
ATOM	4110	CG1	VAL	B	240	10.897	−14.839	95.030	1.00	29.16	C
ATOM	4111	CG2	VAL	B	240	12.905	−15.439	93.750	1.00	26.94	C
ATOM	4112	C	VAL	B	240	12.227	−12.933	92.486	1.00	26.20	C
ATOM	4113	O	VAL	B	240	13.283	−12.999	91.871	1.00	26.29	O
ATOM	4123	N	ARG	B	241	11.057	−12.770	91.874	1.00	25.75	N
ATOM	4124	CA	ARG	B	241	10.959	−12.734	90.412	1.00	25.67	C
ATOM	4125	CB	ARG	B	241	9.494	−12.731	89.960	1.00	25.76	C
ATOM	4126	CG	ARG	B	241	9.271	−12.724	88.449	1.00	26.11	C
ATOM	4127	CD	ARG	B	241	7.814	−12.465	87.997	1.00	27.93	C
ATOM	4128	NE	ARG	B	241	6.821	−12.689	89.049	1.00	30.76	N
ATOM	4129	CZ	ARG	B	241	6.506	−13.897	89.556	1.00	34.28	C
ATOM	4130	NH1	ARG	B	241	7.097	−15.017	89.113	1.00	36.71	N
ATOM	4131	NH2	ARG	B	241	5.602	−14.001	90.527	1.00	34.68	N
ATOM	4132	C	ARG	B	241	11.679	−11.518	89.866	1.00	25.51	C
ATOM	4133	O	ARG	B	241	12.516	−11.639	88.977	1.00	25.81	O
ATOM	4147	N	ALA	B	242	11.364	−10.346	90.415	1.00	25.33	N
ATOM	4148	CA	ALA	B	242	11.949	−9.083	89.965	1.00	25.05	C
ATOM	4149	CB	ALA	B	242	11.292	−7.913	90.689	1.00	24.75	C
ATOM	4150	C	ALA	B	242	13.465	−9.051	90.168	1.00	25.00	C
ATOM	4151	O	ALA	B	242	14.211	−8.578	89.315	1.00	25.04	O
ATOM	4157	N	ARG	B	243	13.901	−9.552	91.311	1.00	24.95	N
ATOM	4158	CA	ARG	B	243	15.311	−9.680	91.628	1.00	25.22	C
ATOM	4159	CB	ARG	B	243	15.409	−10.298	93.016	1.00	25.32	C
ATOM	4160	CG	ARG	B	243	16.733	−10.147	93.696	1.00	26.31	C
ATOM	4161	CD	ARG	B	243	16.621	−10.291	95.220	1.00	28.18	C
ATOM	4162	NE	ARG	B	243	16.664	−8.989	95.904	1.00	29.87	N
ATOM	4163	CZ	ARG	B	243	16.338	−8.776	97.186	1.00	30.13	C
ATOM	4164	NH1	ARG	B	243	15.930	−9.779	97.973	1.00	30.42	N
ATOM	4165	NH2	ARG	B	243	16.417	−7.539	97.680	1.00	30.30	N
ATOM	4166	C	ARG	B	243	16.065	−10.541	90.581	1.00	25.49	C
ATOM	4167	O	ARG	B	243	17.077	−10.113	90.011	1.00	25.81	O
ATOM	4181	N	ILE	B	244	15.536	−11.736	90.307	1.00	25.78	N
ATOM	4182	CA	ILE	B	244	16.163	−12.696	89.380	1.00	25.53	C
ATOM	4183	CB	ILE	B	244	15.458	−14.065	89.489	1.00	25.26	C
ATOM	4184	CG1	ILE	B	244	15.813	−14.692	90.831	1.00	25.22	C
ATOM	4185	CD1	ILE	B	244	15.135	−16.015	91.141	1.00	25.46	C
ATOM	4186	CG2	ILE	B	244	15.849	−14.989	88.339	1.00	24.80	C
ATOM	4187	C	ILE	B	244	16.153	−12.176	87.930	1.00	25.79	C
ATOM	4188	O	ILE	B	244	17.169	−12.243	87.226	1.00	25.26	O
ATOM	4200	N	LEU	B	245	14.987	−11.677	87.512	1.00	25.76	N
ATOM	4201	CA	LEU	B	245	14.799	−11.006	86.235	1.00	25.85	C
ATOM	4202	CB	LEU	B	245	13.393	−10.405	86.181	1.00	26.41	C
ATOM	4203	CG	LEU	B	245	12.350	−10.979	85.208	1.00	26.92	C
ATOM	4204	CD1	LEU	B	245	12.548	−12.451	84.952	1.00	27.67	C
ATOM	4205	CD2	LEU	B	245	10.912	−10.684	85.705	1.00	26.22	C
ATOM	4206	C	LEU	B	245	15.820	−9.895	86.023	1.00	25.80	C
ATOM	4207	O	LEU	B	245	16.411	−9.767	84.947	1.00	25.15	O
ATOM	4219	N	GLY	B	246	16.028	−9.107	87.074	1.00	25.97	N
ATOM	4220	CA	GLY	B	246	17.008	−8.035	87.072	1.00	25.92	C
ATOM	4221	C	GLY	B	246	18.441	−8.534	87.052	1.00	25.78	C
ATOM	4222	O	GLY	B	246	19.299	−7.921	86.428	1.00	25.80	O
ATOM	4226	N	SER	B	247	18.705	−9.650	87.724	1.00	25.86	N
ATOM	4227	CA	SER	B	247	20.010	−10.282	87.608	1.00	26.04	C
ATOM	4228	CB	SER	B	247	20.172	−11.388	88.624	1.00	26.06	C
ATOM	4229	OG	SER	B	247	21.495	−11.882	88.547	1.00	26.68	O
ATOM	4230	C	SER	B	247	20.270	−10.850	86.207	1.00	26.14	C
ATOM	4231	O	SER	B	247	21.403	−10.828	85.718	1.00	26.35	O
ATOM	4237	N	LEU	B	248	19.225	−11.327	85.544	1.00	26.41	N
ATOM	4238	CA	LEU	B	248	19.384	−11.906	84.211	1.00	26.78	C
ATOM	4239	CB	LEU	B	248	18.210	−12.838	83.870	1.00	26.62	C
ATOM	4240	CG	LEU	B	248	18.071	−14.089	84.758	1.00	25.74	C
ATOM	4241	CD1	LEU	B	248	16.844	−14.895	84.349	1.00	25.23	C
ATOM	4242	CD2	LEU	B	248	19.350	−14.938	84.729	1.00	24.89	C
ATOM	4243	C	LEU	B	248	19.553	−10.838	83.140	1.00	27.21	C
ATOM	4244	O	LEU	B	248	19.745	−11.169	81.974	1.00	27.26	O
ATOM	4256	N	GLN	B	249	19.497	−9.569	83.546	1.00	28.10	N
ATOM	4257	CA	GLN	B	249	19.713	−8.433	82.645	1.00	28.88	C
ATOM	4258	CB	GLN	B	249	18.745	−7.288	82.998	1.00	29.21	C
ATOM	4259	CG	GLN	B	249	17.311	−7.503	82.458	1.00	30.45	C
ATOM	4260	CD	GLN	B	249	17.294	−7.928	80.981	1.00	31.79	C
ATOM	4261	OE1	GLN	B	249	17.483	−7.094	80.085	1.00	34.35	O
ATOM	4262	NE2	GLN	B	249	17.092	−9.223	80.732	1.00	31.33	N
ATOM	4263	C	GLN	B	249	21.158	−7.906	82.597	1.00	29.18	C
ATOM	4264	O	GLN	B	249	21.516	−7.172	81.674	1.00	28.86	O
ATOM	4273	N	GLU	B	250	21.976	−8.277	83.581	1.00	29.76	N
ATOM	4274	CA	GLU	B	250	23.415	−7.966	83.564	1.00	30.10	C
ATOM	4275	CB	GLU	B	250	24.058	−8.418	84.888	1.00	30.29	C
ATOM	4276	CG	GLU	B	250	23.585	−7.630	86.105	1.00	30.79	C
ATOM	4277	CD	GLU	B	250	23.689	−8.393	87.420	1.00	33.08	C
ATOM	4278	OE1	GLU	B	250	23.865	−9.636	87.435	1.00	34.21	O
ATOM	4279	OE2	GLU	B	250	23.573	−7.733	88.469	1.00	35.79	O
ATOM	4280	C	GLU	B	250	24.107	−8.664	82.369	1.00	30.16	C
ATOM	4281	O	GLU	B	250	23.740	−9.796	82.034	1.00	30.25	O
ATOM	4288	N	PRO	B	251	25.090	−8.022	81.726	1.00	30.59	N
ATOM	4289	CA	PRO	B	251	25.752	−8.638	80.561	1.00	30.87	C
ATOM	4290	CB	PRO	B	251	26.604	−7.500	79.992	1.00	30.78	C
ATOM	4291	CG	PRO	B	251	26.175	−6.258	80.726	1.00	30.53	C
ATOM	4292	CD	PRO	B	251	25.664	−6.698	82.040	1.00	30.32	C
ATOM	4293	C	PRO	B	251	26.639	−9.841	80.940	1.00	31.51	C
ATOM	4294	O	PRO	B	251	27.405	−9.750	81.911	1.00	32.17	O
ATOM	4302	N	THR	B	252	26.512	−10.954	80.214	1.00	31.67	N
ATOM	4303	CA	THR	B	252	27.392	−12.108	80.411	1.00	31.74	C
ATOM	4304	CB	THR	B	252	26.605	−13.427	80.286	1.00	31.77	C
ATOM	4305	OG1	THR	B	252	25.979	−13.713	81.541	1.00	32.51	O
ATOM	4306	CG2	THR	B	252	27.533	−14.653	80.043	1.00	31.27	C
ATOM	4307	C	THR	B	252	28.511	−12.020	79.384	1.00	32.04	C
ATOM	4308	O	THR	B	252	29.630	−11.559	79.698	1.00	32.32	O
ATOM	4316	N	LYS	B	253	28.197	−12.437	78.151	1.00	32.10	N
ATOM	4317	CA	LYS	B	253	29.122	−12.315	77.019	1.00	31.72	C
ATOM	4318	CB	LYS	B	253	30.291	−13.309	77.185	1.00	31.78	C
ATOM	4319	CG	LYS	B	253	31.667	−12.749	76.816	1.00	30.29	C
ATOM	4320	CD	LYS	B	253	32.462	−13.703	75.916	1.00	29.61	C
ATOM	4321	CE	LYS	B	253	33.966	−13.500	76.093	1.00	29.68	C
ATOM	4322	NZ	LYS	B	253	34.733	−13.530	74.815	1.00	30.02	N
ATOM	4323	C	LYS	B	253	28.448	−12.560	75.657	1.00	31.80	C
ATOM	4324	O	LYS	B	253	27.229	−12.819	75.556	1.00	31.64	O
ATOM	4338	N	SER	B	254	29.270	−12.459	74.614	1.00	31.73	N
ATOM	4339	CA	SER	B	254	28.935	−12.967	73.289	1.00	31.86	C
ATOM	4340	CB	SER	B	254	29.317	−11.949	72.204	1.00	31.96	C
ATOM	4341	OG	SER	B	254	29.110	−12.473	70.896	1.00	33.14	O
ATOM	4342	C	SER	B	254	29.671	−14.288	73.078	1.00	31.76	C
ATOM	4343	O	SER	B	254	30.772	−14.309	72.524	1.00	31.94	O
ATOM	4349	N	ARG	B	255	29.085	−15.380	73.569	1.00	31.90	N
ATOM	4350	CA	ARG	B	255	29.529	−16.722	73.188	1.00	31.79	C
ATOM	4351	CB	ARG	B	255	29.758	−17.617	74.422	1.00	31.63	C
ATOM	4352	CG	ARG	B	255	31.254	−17.913	74.687	1.00	31.94	C
ATOM	4353	CD	ARG	B	255	31.500	−19.125	75.587	1.00	32.68	C
ATOM	4354	NE	ARG	B	255	32.458	−18.879	76.680	1.00	33.33	N
ATOM	4355	CZ	ARG	B	255	32.238	−19.120	77.997	1.00	32.79	C
ATOM	4356	NH1	ARG	B	255	31.074	−19.622	78.454	1.00	32.41	N
ATOM	4357	NH2	ARG	B	255	33.210	−18.852	78.875	1.00	32.93	N
ATOM	4358	C	ARG	B	255	28.484	−17.321	72.234	1.00	31.84	C
ATOM	4359	O	ARG	B	255	27.565	−18.014	72.704	1.00	31.90	O
ATOM	4373	N	PRO	B	256	28.622	−17.045	70.914	1.00	31.79	N
ATOM	4374	CA	PRO	B	256	27.676	−17.532	69.882	1.00	31.85	C
ATOM	4375	CB	PRO	B	256	27.965	−16.599	68.683	1.00	31.56	C
ATOM	4376	CG	PRO	B	256	29.434	−16.268	68.798	1.00	31.38	C
ATOM	4377	CD	PRO	B	256	29.704	−16.240	70.295	1.00	31.59	C
ATOM	4378	C	PRO	B	256	27.858	−19.026	69.485	1.00	32.20	C
ATOM	4379	O	PRO	B	256	27.878	−19.350	68.288	1.00	32.00	O
ATOM	4387	N	ASP	B	257	27.963	−19.903	70.495	1.00	32.63	N
ATOM	4388	CA	ASP	B	257	28.268	−21.333	70.316	1.00	33.05	C
ATOM	4389	CB	ASP	B	257	29.732	−21.709	70.691	1.00	33.60	C
ATOM	4390	CG	ASP	B	257	30.508	−20.591	71.444	1.00	35.52	C
ATOM	4391	OD1	ASP	B	257	30.423	−19.395	71.047	1.00	37.38	O
ATOM	4392	OD2	ASP	B	257	31.276	−20.834	72.431	1.00	38.32	O
ATOM	4393	C	ASP	B	257	27.311	−22.161	71.157	1.00	32.77	C
ATOM	4394	O	ASP	B	257	26.663	−23.093	70.667	1.00	33.06	O
ATOM	4399	N	GLN	B	258	27.252	−21.828	72.441	1.00	32.31	N
ATOM	4400	CA	GLN	B	258	26.251	−22.396	73.325	1.00	31.68	C
ATOM	4401	CB	GLN	B	258	26.753	−22.450	74.776	1.00	31.98	C
ATOM	4402	CG	GLN	B	258	27.931	−23.456	75.022	1.00	32.49	C
ATOM	4403	CD	GLN	B	258	27.462	−24.917	75.227	1.00	33.03	C
ATOM	4404	OE1	GLN	B	258	26.432	−25.175	75.893	1.00	32.90	O
ATOM	4405	NE2	GLN	B	258	28.217	−25.867	74.653	1.00	32.76	N
ATOM	4406	C	GLN	B	258	24.943	−21.592	73.235	1.00	30.93	C
ATOM	4407	O	GLN	B	258	24.958	−20.360	73.019	1.00	30.52	O
ATOM	4416	N	PRO	B	259	23.818	−22.295	73.412	1.00	29.83	N
ATOM	4417	CA	PRO	B	259	22.490	−21.666	73.338	1.00	28.91	C
ATOM	4418	CB	PRO	B	259	21.508	−22.821	73.571	1.00	29.03	C
ATOM	4419	CG	PRO	B	259	22.303	−24.074	73.427	1.00	29.43	C
ATOM	4420	CD	PRO	B	259	23.735	−23.735	73.720	1.00	29.67	C
ATOM	4421	C	PRO	B	259	22.354	−20.651	74.435	1.00	28.06	C
ATOM	4422	O	PRO	B	259	22.611	−20.970	75.598	1.00	28.12	O
ATOM	4430	N	ALA	B	260	21.985	−19.438	74.052	1.00	27.13	N
ATOM	4431	CA	ALA	B	260	21.848	−18.339	74.986	1.00	26.40	C
ATOM	4432	CB	ALA	B	260	21.372	−17.088	74.252	1.00	26.54	C
ATOM	4433	C	ALA	B	260	20.899	−18.700	76.116	1.00	25.81	C
ATOM	4434	O	ALA	B	260	21.194	−18.439	77.278	1.00	26.30	O
ATOM	4440	N	ALA	B	261	19.784	−19.332	75.778	1.00	25.02	N
ATOM	4441	CA	ALA	B	261	18.767	−19.680	76.765	1.00	24.72	C
ATOM	4442	CB	ALA	B	261	17.485	−20.139	76.074	1.00	24.62	C
ATOM	4443	C	ALA	B	261	19.216	−20.738	77.771	1.00	24.72	C
ATOM	4444	O	ALA	B	261	18.689	−20.802	78.881	1.00	24.97	O
ATOM	4450	N	PHE	B	262	20.160	−21.593	77.407	1.00	24.33	N
ATOM	4451	CA	PHE	B	262	20.663	−22.546	78.384	1.00	23.79	C
ATOM	4452	CB	PHE	B	262	21.550	−23.604	77.739	1.00	23.95	C
ATOM	4453	CG	PHE	B	262	22.042	−24.609	78.719	1.00	24.92	C
ATOM	4454	CD1	PHE	B	262	21.216	−25.642	79.132	1.00	25.79	C
ATOM	4455	CE1	PHE	B	262	21.655	−26.557	80.076	1.00	26.48	C
ATOM	4456	CZ	PHE	B	262	22.920	−26.435	80.630	1.00	25.35	C
ATOM	4457	CE2	PHE	B	262	23.744	−25.402	80.237	1.00	25.60	C
ATOM	4458	CD2	PHE	B	262	23.305	−24.486	79.294	1.00	25.44	C
ATOM	4459	C	PHE	B	262	21.426	−21.836	79.516	1.00	23.18	C
ATOM	4460	O	PHE	B	262	21.218	−22.122	80.678	1.00	21.96	O
ATOM	4470	N	GLY	B	263	22.302	−20.895	79.172	1.00	23.10	N
ATOM	4471	CA	GLY	B	263	23.004	−20.124	80.192	1.00	22.98	C
ATOM	4472	C	GLY	B	263	22.056	−19.312	81.068	1.00	22.85	C
ATOM	4473	O	GLY	B	263	22.218	−19.202	82.284	1.00	22.43	O
ATOM	4477	N	LEU	B	264	21.057	−18.749	80.408	1.00	22.77	N
ATOM	4478	CA	LEU	B	264	20.025	−17.948	81.026	1.00	22.80	C
ATOM	4479	CB	LEU	B	264	19.038	−17.532	79.926	1.00	23.46	C
ATOM	4480	CG	LEU	B	264	17.982	−16.455	80.174	1.00	25.74	C
ATOM	4481	CD1	LEU	B	264	16.650	−17.072	80.600	1.00	27.18	C
ATOM	4482	CD2	LEU	B	264	18.472	−15.427	81.203	1.00	27.38	C
ATOM	4483	C	LEU	B	264	19.299	−18.714	82.129	1.00	22.14	C
ATOM	4484	O	LEU	B	264	19.129	−18.215	83.233	1.00	21.59	O
ATOM	4496	N	LEU	B	265	18.875	−19.926	81.819	1.00	21.31	N
ATOM	4497	CA	LEU	B	265	18.162	−20.756	82.762	1.00	21.53	C
ATOM	4498	CB	LEU	B	265	17.541	−21.938	82.038	1.00	22.06	C
ATOM	4499	CG	LEU	B	265	16.464	−21.551	81.030	1.00	24.04	C
ATOM	4500	CD1	LEU	B	265	16.233	−22.671	79.989	1.00	24.63	C
ATOM	4501	CD2	LEU	B	265	15.186	−21.197	81.781	1.00	25.12	C
ATOM	4502	C	LEU	B	265	19.061	−21.296	83.861	1.00	20.95	C
ATOM	4503	O	LEU	B	265	18.632	−21.505	84.974	1.00	20.80	O
ATOM	4515	N	CYS	B	266	20.303	−21.568	83.513	1.00	21.01	N
ATOM	4516	CA	CYS	B	266	21.334	−21.879	84.483	1.00	21.08	C
ATOM	4517	CB	CYS	B	266	22.656	−22.159	83.770	1.00	21.01	C
ATOM	4518	SG	CYS	B	266	22.743	−23.763	82.953	1.00	22.23	S
ATOM	4519	C	CYS	B	266	21.512	−20.723	85.469	1.00	20.65	C
ATOM	4520	O	CYS	B	266	21.617	−20.947	86.654	1.00	20.45	O
ATOM	4526	N	ARG	B	267	21.519	−19.491	84.979	1.00	20.57	N
ATOM	4527	CA	ARG	B	267	21.673	−18.336	85.864	1.00	20.75	C
ATOM	4528	CB	ARG	B	267	21.913	−17.056	85.088	1.00	20.51	C
ATOM	4529	CG	ARG	B	267	23.341	−16.948	84.666	1.00	22.77	C
ATOM	4530	CD	ARG	B	267	23.698	−15.646	84.008	1.00	25.81	C
ATOM	4531	NE	ARG	B	267	23.247	−15.635	82.628	1.00	29.25	N
ATOM	4532	CZ	ARG	B	267	23.061	−14.543	81.906	1.00	31.89	C
ATOM	4533	NH1	ARG	B	267	23.287	−13.329	82.430	1.00	32.32	N
ATOM	4534	NH2	ARG	B	267	22.643	−14.671	80.646	1.00	33.23	N
ATOM	4535	C	ARG	B	267	20.497	−18.165	86.750	1.00	20.44	C
ATOM	4536	O	ARG	B	267	20.648	−17.828	87.900	1.00	20.41	O
ATOM	4550	N	MET	B	268	19.323	−18.420	86.196	1.00	20.87	N
ATOM	4551	CA	MET	B	268	18.049	−18.304	86.896	1.00	20.78	C
ATOM	4552	CB	MET	B	268	16.910	−18.557	85.899	1.00	20.72	C
ATOM	4553	CG	MET	B	268	15.541	−18.773	86.512	1.00	21.70	C
ATOM	4554	SD	MET	B	268	14.329	−19.464	85.345	1.00	21.30	S
ATOM	4555	CE	MET	B	268	14.718	−21.205	85.689	1.00	21.55	C
ATOM	4556	C	MET	B	268	17.952	−19.255	88.091	1.00	20.46	C
ATOM	4557	O	MET	B	268	17.405	−18.898	89.134	1.00	19.88	O
ATOM	4567	N	ALA	B	269	18.466	−20.470	87.921	1.00	20.66	N
ATOM	4568	CA	ALA	B	269	18.458	−21.467	88.971	1.00	20.74	C
ATOM	4569	CB	ALA	B	269	18.678	−22.832	88.390	1.00	21.23	C
ATOM	4570	C	ALA	B	269	19.534	−21.170	90.018	1.00	20.85	C
ATOM	4571	O	ALA	B	269	19.358	−21.475	91.183	1.00	21.64	O
ATOM	4577	N	ASP	B	270	20.648	−20.602	89.587	1.00	20.75	N
ATOM	4578	CA	ASP	B	270	21.683	−20.128	90.477	1.00	21.05	C
ATOM	4579	CB	ASP	B	270	22.843	−19.503	89.668	1.00	21.42	C
ATOM	4580	CG	ASP	B	270	23.945	−20.491	89.328	1.00	21.19	C
ATOM	4581	OD1	ASP	B	270	23.745	−21.703	89.517	1.00	20.42	O
ATOM	4582	OD2	ASP	B	270	25.047	−20.130	88.856	1.00	21.50	O
ATOM	4583	C	ASP	B	270	21.108	−19.059	91.397	1.00	20.84	C
ATOM	4584	O	ASP	B	270	21.316	−19.076	92.596	1.00	20.99	O
ATOM	4589	N	GLN	B	271	20.388	−18.121	90.821	1.00	20.68	N
ATOM	4590	CA	GLN	B	271	19.858	−17.002	91.569	1.00	20.63	C
ATOM	4591	CB	GLN	B	271	19.355	−15.925	90.608	1.00	20.67	C
ATOM	4592	CG	GLN	B	271	20.437	−15.150	89.898	1.00	20.94	C
ATOM	4593	CD	GLN	B	271	21.456	−14.543	90.867	1.00	21.35	C
ATOM	4594	OE1	GLN	B	271	22.659	−14.652	90.645	1.00	21.04	O
ATOM	4595	NE2	GLN	B	271	20.972	−13.933	91.946	1.00	20.11	N
ATOM	4596	C	GLN	B	271	18.739	−17.444	92.488	1.00	20.52	C
ATOM	4597	O	GLN	B	271	18.476	−16.802	93.505	1.00	20.27	O
ATOM	4606	N	THR	B	272	18.082	−18.544	92.134	1.00	20.47	N
ATOM	4607	CA	THR	B	272	17.007	−19.097	92.952	1.00	20.43	C
ATOM	4608	CB	THR	B	272	16.229	−20.243	92.209	1.00	20.20	C
ATOM	4609	OG1	THR	B	272	15.725	−19.788	90.943	1.00	20.34	O
ATOM	4610	CG2	THR	B	272	14.995	−20.634	92.979	1.00	19.22	C
ATOM	4611	C	THR	B	272	17.646	−19.667	94.189	1.00	20.68	C
ATOM	4612	O	THR	B	272	17.159	−19.507	95.306	1.00	20.86	O
ATOM	4620	N	PHE	B	273	18.759	−20.350	93.964	1.00	20.91	N
ATOM	4621	CA	PHE	B	273	19.492	−20.963	95.040	1.00	20.80	C
ATOM	4622	CB	PHE	B	273	20.555	−21.928	94.513	1.00	20.56	C
ATOM	4623	CG	PHE	B	273	21.254	−22.652	95.608	1.00	21.32	C
ATOM	4624	CD1	PHE	B	273	20.551	−23.531	96.410	1.00	20.50	C
ATOM	4625	CE1	PHE	B	273	21.171	−24.156	97.462	1.00	21.33	C
ATOM	4626	CZ	PHE	B	273	22.500	−23.907	97.724	1.00	20.08	C
ATOM	4627	CE2	PHE	B	273	23.203	−23.006	96.939	1.00	20.71	C
ATOM	4628	CD2	PHE	B	273	22.583	−22.385	95.901	1.00	19.85	C
ATOM	4629	C	PHE	B	273	20.101	−19.915	95.965	1.00	20.36	C
ATOM	4630	O	PHE	B	273	20.071	−20.083	97.173	1.00	20.94	O
ATOM	4640	N	ILE	B	274	20.648	−18.838	95.417	1.00	19.99	N
ATOM	4641	CA	ILE	B	274	21.098	−17.724	96.242	1.00	20.19	C
ATOM	4642	CB	ILE	B	274	21.673	−16.597	95.348	1.00	19.88	C
ATOM	4643	CG1	ILE	B	274	23.068	−16.996	94.845	1.00	19.71	C
ATOM	4644	CD1	ILE	B	274	23.530	−16.255	93.625	1.00	18.67	C
ATOM	4645	CG2	ILE	B	274	21.719	−15.291	96.095	1.00	19.32	C
ATOM	4646	C	ILE	B	274	19.989	−17.193	97.176	1.00	20.64	C
ATOM	4647	O	ILE	B	274	20.231	−16.901	98.340	1.00	20.78	O
ATOM	4659	N	SER	B	275	18.776	−17.089	96.655	1.00	21.52	N
ATOM	4660	CA	SER	B	275	17.635	−16.620	97.416	1.00	22.24	C
ATOM	4661	CB	SER	B	275	16.448	−16.396	96.481	1.00	22.89	C
ATOM	4662	OG	SER	B	275	15.230	−16.441	97.210	1.00	25.58	O
ATOM	4663	C	SER	B	275	17.250	−17.606	98.511	1.00	22.16	C
ATOM	4664	O	SER	B	275	16.795	−17.202	99.586	1.00	22.60	O
ATOM	4670	N	ILE	B	276	17.437	−18.891	98.228	1.00	21.61	N
ATOM	4671	CA	ILE	B	276	17.204	−19.946	99.192	1.00	21.64	C
ATOM	4672	CB	ILE	B	276	17.191	−21.330	98.492	1.00	21.18	C
ATOM	4673	CG1	ILE	B	276	15.855	−21.514	97.784	1.00	21.72	C
ATOM	4674	CD1	ILE	B	276	15.844	−22.615	96.736	1.00	21.24	C
ATOM	4675	CG2	ILE	B	276	17.480	−22.455	99.487	1.00	19.73	C
ATOM	4676	C	ILE	B	276	18.230	−19.908	100.309	1.00	21.79	C
ATOM	4677	O	ILE	B	276	17.887	−20.111	101.463	1.00	22.32	O
ATOM	4689	N	VAL	B	277	19.487	−19.644	99.974	1.00	21.96	N
ATOM	4690	CA	VAL	B	277	20.521	−19.464	100.984	1.00	21.75	C
ATOM	4691	CB	VAL	B	277	21.927	−19.313	100.353	1.00	21.45	C
ATOM	4692	CG1	VAL	B	277	22.969	−18.930	101.394	1.00	21.31	C
ATOM	4693	CG2	VAL	B	277	22.336	−20.600	99.703	1.00	21.22	C
ATOM	4694	C	VAL	B	277	20.213	−18.258	101.884	1.00	22.23	C
ATOM	4695	O	VAL	B	277	20.414	−18.335	103.088	1.00	21.91	O
ATOM	4705	N	ASP	B	278	19.752	−17.148	101.306	1.00	22.32	N
ATOM	4706	CA	ASP	B	278	19.381	−15.988	102.110	1.00	22.49	C
ATOM	4707	CB	ASP	B	278	19.058	−14.753	101.235	1.00	22.89	C
ATOM	4708	CG	ASP	B	278	18.665	−13.519	102.076	1.00	25.45	C
ATOM	4709	OD1	ASP	B	278	17.465	−13.139	102.107	1.00	28.79	O
ATOM	4710	OD2	ASP	B	278	19.487	−12.868	102.763	1.00	27.03	O
ATOM	4711	C	ASP	B	278	18.215	−16.334	103.058	1.00	21.82	C
ATOM	4712	O	ASP	B	278	18.211	−15.898	104.202	1.00	21.62	O
ATOM	4717	N	TRP	B	279	17.251	−17.130	102.600	1.00	21.23	N
ATOM	4718	CA	TRP	B	279	16.153	−17.602	103.471	1.00	20.95	C
ATOM	4719	CB	TRP	B	279	15.183	−18.473	102.685	1.00	20.76	C
ATOM	4720	CG	TRP	B	279	14.348	−19.383	103.519	1.00	19.54	C
ATOM	4721	CD1	TRP	B	279	13.234	−19.053	104.227	1.00	19.44	C
ATOM	4722	NE1	TRP	B	279	12.725	−20.165	104.857	1.00	19.44	N
ATOM	4723	CE2	TRP	B	279	13.504	−21.249	104.550	1.00	19.20	C
ATOM	4724	CD2	TRP	B	279	14.535	−20.796	103.705	1.00	20.07	C
ATOM	4725	CE3	TRP	B	279	15.472	−21.730	103.237	1.00	19.96	C
ATOM	4726	CZ3	TRP	B	279	15.357	−23.060	103.647	1.00	21.50	C
ATOM	4727	CH2	TRP	B	279	14.318	−23.474	104.488	1.00	20.86	C
ATOM	4728	CZ2	TRP	B	279	13.380	−22.594	104.939	1.00	20.44	C
ATOM	4729	C	TRP	B	279	16.659	−18.402	104.680	1.00	21.06	C
ATOM	4730	O	TRP	B	279	16.266	−18.162	105.817	1.00	20.73	O
ATOM	4741	N	ALA	B	280	17.545	−19.348	104.406	1.00	21.12	N
ATOM	4742	CA	ALA	B	280	18.095	−20.227	105.415	1.00	21.36	C
ATOM	4743	CB	ALA	B	280	18.945	−21.287	104.764	1.00	21.57	C
ATOM	4744	C	ALA	B	280	18.909	−19.494	106.469	1.00	21.17	C
ATOM	4745	O	ALA	B	280	18.727	−19.749	107.655	1.00	20.74	O
ATOM	4751	N	ARG	B	281	19.789	−18.581	106.055	1.00	21.41	N
ATOM	4752	CA	ARG	B	281	20.649	−17.893	107.009	1.00	21.77	C
ATOM	4753	CB	ARG	B	281	21.742	−17.063	106.324	1.00	22.12	C
ATOM	4754	CG	ARG	B	281	21.255	−15.934	105.466	1.00	23.17	C
ATOM	4755	CD	ARG	B	281	22.092	−14.642	105.554	1.00	24.68	C
ATOM	4756	NE	ARG	B	281	21.245	−13.492	105.210	1.00	26.13	N
ATOM	4757	CZ	ARG	B	281	20.990	−12.446	106.002	1.00	27.24	C
ATOM	4758	NH1	ARG	B	281	21.552	−12.346	107.201	1.00	27.57	N
ATOM	4759	NH2	ARG	B	281	20.178	−11.472	105.575	1.00	27.88	N
ATOM	4760	C	ARG	B	281	19.855	−17.058	108.017	1.00	21.86	C
ATOM	4761	O	ARG	B	281	20.345	−16.785	109.108	1.00	21.98	O
ATOM	4775	N	ARG	B	282	18.629	−16.687	107.652	1.00	22.24	N
ATOM	4776	CA	ARG	B	282	17.715	−15.969	108.539	1.00	22.38	C
ATOM	4777	CB	ARG	B	282	16.739	−15.152	107.712	1.00	22.31	C
ATOM	4778	CG	ARG	B	282	17.384	−14.070	106.899	1.00	22.57	C
ATOM	4779	CD	ARG	B	282	16.384	−13.389	106.002	1.00	22.90	C
ATOM	4780	NE	ARG	B	282	15.679	−12.326	106.730	1.00	24.48	N
ATOM	4781	CZ	ARG	B	282	14.354	−12.149	106.763	1.00	23.61	C
ATOM	4782	NH1	ARG	B	282	13.545	−12.975	106.093	1.00	23.21	N
ATOM	4783	NH2	ARG	B	282	13.842	−11.120	107.457	1.00	20.80	N
ATOM	4784	C	ARG	B	282	16.884	−16.867	109.433	1.00	22.43	C
ATOM	4785	O	ARG	B	282	16.316	−16.380	110.414	1.00	22.84	O
ATOM	4799	N	CYS	B	283	16.769	−18.144	109.081	1.00	22.29	N
ATOM	4800	CA	CYS	B	283	15.891	−19.070	109.821	1.00	22.73	C
ATOM	4801	CB	CYS	B	283	15.754	−20.437	109.130	1.00	22.69	C
ATOM	4802	SG	CYS	B	283	14.571	−20.498	107.793	1.00	22.22	S
ATOM	4803	C	CYS	B	283	16.334	−19.327	111.238	1.00	22.77	C
ATOM	4804	O	CYS	B	283	17.513	−19.262	111.559	1.00	22.82	O
ATOM	4810	N	MET	B	284	15.348	−19.653	112.062	1.00	23.22	N
ATOM	4811	CA	MET	B	284	15.550	−20.064	113.442	1.00	23.63	C
ATOM	4812	CB	MET	B	284	14.214	−20.406	114.116	1.00	24.07	C
ATOM	4813	CG	MET	B	284	13.198	−19.271	114.111	1.00	24.96	C
ATOM	4814	SD	MET	B	284	12.335	−19.065	112.528	1.00	27.35	S
ATOM	4815	CE	MET	B	284	11.934	−20.767	112.068	1.00	25.81	C
ATOM	4816	C	MET	B	284	16.428	−21.299	113.480	1.00	23.32	C
ATOM	4817	O	MET	B	284	16.368	−22.130	112.582	1.00	23.31	O
ATOM	4827	N	VAL	B	285	17.234	−21.389	114.533	1.00	23.26	N
ATOM	4828	CA	VAL	B	285	18.192	−22.469	114.740	1.00	22.92	C
ATOM	4829	CB	VAL	B	285	17.526	−23.874	114.731	1.00	22.83	C
ATOM	4830	CG1	VAL	B	285	18.584	−24.953	114.959	1.00	23.23	C
ATOM	4831	CG2	VAL	B	285	16.482	−23.945	115.810	1.00	22.39	C
ATOM	4832	C	VAL	B	285	19.368	−22.379	113.761	1.00	22.38	C
ATOM	4833	O	VAL	B	285	20.503	−22.176	114.178	1.00	22.60	O
ATOM	4843	N	PHE	B	286	19.104	−22.526	112.473	1.00	21.64	N
ATOM	4844	CA	PHE	B	286	20.137	−22.356	111.466	1.00	21.39	C
ATOM	4845	CB	PHE	B	286	19.502	−22.327	110.064	1.00	21.00	C
ATOM	4846	CG	PHE	B	286	20.496	−22.517	108.951	1.00	20.08	C
ATOM	4847	CD1	PHE	B	286	20.719	−23.772	108.413	1.00	18.72	C
ATOM	4848	CE1	PHE	B	286	21.633	−23.941	107.412	1.00	19.77	C
ATOM	4849	CZ	PHE	B	286	22.363	−22.833	106.935	1.00	19.66	C
ATOM	4850	CE2	PHE	B	286	22.161	−21.587	107.476	1.00	17.57	C
ATOM	4851	CD2	PHE	B	286	21.237	−21.430	108.471	1.00	18.42	C
ATOM	4852	C	PHE	B	286	21.021	−21.104	111.712	1.00	21.71	C
ATOM	4853	O	PHE	B	286	22.249	−21.170	111.566	1.00	21.83	O
ATOM	4863	N	LYS	B	287	20.410	−19.983	112.098	1.00	21.75	N
ATOM	4864	CA	LYS	B	287	21.158	−18.730	112.339	1.00	21.95	C
ATOM	4865	CB	LYS	B	287	20.196	−17.533	112.410	1.00	21.82	C
ATOM	4866	CG	LYS	B	287	19.233	−17.553	113.570	1.00	21.85	C
ATOM	4867	CD	LYS	B	287	18.315	−16.356	113.550	1.00	22.26	C
ATOM	4868	CE	LYS	B	287	17.148	−16.564	114.520	1.00	23.12	C
ATOM	4869	NZ	LYS	B	287	16.770	−15.317	115.262	1.00	23.87	N
ATOM	4870	C	LYS	B	287	22.080	−18.746	113.578	1.00	22.07	C
ATOM	4871	O	LYS	B	287	22.992	−17.913	113.715	1.00	21.88	O
ATOM	4885	N	GLU	B	288	21.834	−19.672	114.494	1.00	22.31	N
ATOM	4886	CA	GLU	B	288	22.687	−19.804	115.670	1.00	22.72	C
ATOM	4887	CB	GLU	B	288	21.867	−20.164	116.924	1.00	22.76	C
ATOM	4888	CG	GLU	B	288	20.543	−19.421	117.084	1.00	23.78	C
ATOM	4889	CD	GLU	B	288	20.697	−17.952	117.465	1.00	26.00	C
ATOM	4890	OE1	GLU	B	288	19.703	−17.201	117.307	1.00	27.85	O
ATOM	4891	OE2	GLU	B	288	21.787	−17.533	117.939	1.00	27.27	O
ATOM	4892	C	GLU	B	288	23.773	−20.851	115.420	1.00	22.64	C
ATOM	4893	O	GLU	B	288	24.701	−20.981	116.211	1.00	22.97	O
ATOM	4900	N	LEU	B	289	23.637	−21.616	114.343	1.00	22.85	N
ATOM	4901	CA	LEU	B	289	24.675	−22.560	113.944	1.00	23.32	C
ATOM	4902	CB	LEU	B	289	24.175	−23.509	112.841	1.00	23.61	C
ATOM	4903	CG	LEU	B	289	23.522	−24.858	113.206	1.00	24.52	C
ATOM	4904	CD1	LEU	B	289	22.450	−24.738	114.256	1.00	24.97	C
ATOM	4905	CD2	LEU	B	289	22.943	−25.531	111.972	1.00	24.62	C
ATOM	4906	C	LEU	B	289	25.866	−21.763	113.425	1.00	23.52	C
ATOM	4907	O	LEU	B	289	25.686	−20.714	112.788	1.00	23.37	O
ATOM	4919	N	GLU	B	290	27.081	−22.237	113.691	1.00	23.70	N
ATOM	4920	CA	GLU	B	290	28.245	−21.591	113.086	1.00	24.18	C
ATOM	4921	CB	GLU	B	290	29.555	−21.840	113.858	1.00	24.72	C
ATOM	4922	CG	GLU	B	290	30.035	−23.283	113.924	1.00	26.12	C
ATOM	4923	CD	GLU	B	290	30.590	−23.657	115.289	1.00	28.89	C
ATOM	4924	OE1	GLU	B	290	31.449	−24.570	115.342	1.00	31.77	O
ATOM	4925	OE2	GLU	B	290	30.176	−23.046	116.311	1.00	29.77	O
ATOM	4926	C	GLU	B	290	28.348	−21.996	111.624	1.00	23.92	C
ATOM	4927	O	GLU	B	290	27.724	−22.973	111.190	1.00	24.08	O
ATOM	4934	N	VAL	B	291	29.115	−21.219	110.866	1.00	23.42	N
ATOM	4935	CA	VAL	B	291	29.116	−21.321	109.412	1.00	23.20	C
ATOM	4936	CB	VAL	B	291	30.079	−20.259	108.740	1.00	23.54	C
ATOM	4937	CG1	VAL	B	291	30.321	−20.553	107.244	1.00	23.73	C
ATOM	4938	CG2	VAL	B	291	29.520	−18.840	108.903	1.00	24.07	C
ATOM	4939	C	VAL	B	291	29.437	−22.750	108.968	1.00	22.55	C
ATOM	4940	O	VAL	B	291	28.892	−23.209	107.980	1.00	22.73	O
ATOM	4950	N	ALA	B	292	30.296	−23.466	109.692	1.00	21.85	N
ATOM	4951	CA	ALA	B	292	30.643	−24.828	109.278	1.00	21.49	C
ATOM	4952	CB	ALA	B	292	31.696	−25.434	110.207	1.00	21.37	C
ATOM	4953	C	ALA	B	292	29.396	−25.735	109.178	1.00	21.05	C
ATOM	4954	O	ALA	B	292	29.201	−26.416	108.178	1.00	20.32	O
ATOM	4960	N	ASP	B	293	28.557	−25.726	110.205	1.00	20.81	N
ATOM	4961	CA	ASP	B	293	27.364	−26.563	110.198	1.00	21.03	C
ATOM	4962	CB	ASP	B	293	26.698	−26.582	111.572	1.00	20.84	C
ATOM	4963	CG	ASP	B	293	27.249	−27.657	112.467	1.00	20.66	C
ATOM	4964	OD1	ASP	B	293	27.789	−28.661	111.947	1.00	19.06	O
ATOM	4965	OD2	ASP	B	293	27.184	−27.564	113.712	1.00	20.70	O
ATOM	4966	C	ASP	B	293	26.357	−26.102	109.166	1.00	21.01	C
ATOM	4967	O	ASP	B	293	25.696	−26.917	108.529	1.00	21.20	O
ATOM	4972	N	GLN	B	294	26.234	−24.788	109.025	1.00	21.06	N
ATOM	4973	CA	GLN	B	294	25.370	−24.186	108.023	1.00	20.59	C
ATOM	4974	CB	GLN	B	294	25.508	−22.676	108.092	1.00	20.60	C
ATOM	4975	CG	GLN	B	294	24.788	−22.053	109.257	1.00	20.21	C
ATOM	4976	CD	GLN	B	294	24.765	−20.553	109.166	1.00	20.67	C
ATOM	4977	OE1	GLN	B	294	25.562	−19.996	108.260	1.00	22.24	O
ATOM	4978	NE2	GLN	B	294	24.076	−19.899	109.939	1.00	21.98	N
ATOM	4979	C	GLN	B	294	25.724	−24.672	106.618	1.00	20.45	C
ATOM	4980	O	GLN	B	294	24.841	−24.955	105.821	1.00	20.19	O
ATOM	4989	N	MET	B	295	27.015	−24.791	106.326	1.00	20.27	N
ATOM	4990	CA	MET	B	295	27.462	−25.238	105.010	1.00	20.39	C
ATOM	4991	CB	MET	B	295	28.955	−24.963	104.846	1.00	20.36	C
ATOM	4992	CG	MET	B	295	29.294	−23.480	104.824	1.00	21.58	C
ATOM	4993	SD	MET	B	295	31.075	−23.126	104.729	1.00	26.19	S
ATOM	4994	CE	MET	B	295	31.281	−23.322	103.006	1.00	26.02	C
ATOM	4995	C	MET	B	295	27.162	−26.718	104.779	1.00	20.13	C
ATOM	4996	O	MET	B	295	26.797	−27.119	103.695	1.00	20.41	O
ATOM	5006	N	THR	B	296	27.310	−27.511	105.825	1.00	20.34	N
ATOM	5007	CA	THR	B	296	27.135	−28.953	105.776	1.00	20.32	C
ATOM	5008	CB	THR	B	296	27.548	−29.572	107.164	1.00	20.31	C
ATOM	5009	OG1	THR	B	296	28.966	−29.446	107.372	1.00	19.78	O
ATOM	5010	CG2	THR	B	296	27.290	−31.077	107.229	1.00	19.90	C
ATOM	5011	C	THR	B	296	25.694	−29.303	105.441	1.00	20.29	C
ATOM	5012	O	THR	B	296	25.442	−30.164	104.603	1.00	20.47	O
ATOM	5020	N	LEU	B	297	24.756	−28.635	106.111	1.00	20.31	N
ATOM	5021	CA	LEU	B	297	23.321	−28.819	105.872	1.00	20.34	C
ATOM	5022	CB	LEU	B	297	22.519	−27.933	106.812	1.00	20.37	C
ATOM	5023	CG	LEU	B	297	22.520	−28.330	108.273	1.00	20.70	C
ATOM	5024	CD1	LEU	B	297	21.731	−27.291	109.069	1.00	21.32	C
ATOM	5025	CD2	LEU	B	297	21.946	−29.750	108.451	1.00	20.56	C
ATOM	5026	C	LEU	B	297	22.934	−28.468	104.463	1.00	20.22	C
ATOM	5027	O	LEU	B	297	22.314	−29.255	103.758	1.00	20.93	O
ATOM	5039	N	LEU	B	298	23.299	−27.259	104.067	1.00	20.30	N
ATOM	5040	CA	LEU	B	298	23.092	−26.780	102.713	1.00	19.83	C
ATOM	5041	CB	LEU	B	298	23.526	−25.318	102.587	1.00	19.73	C
ATOM	5042	CG	LEU	B	298	22.615	−24.275	103.243	1.00	19.57	C
ATOM	5043	CD1	LEU	B	298	23.317	−22.950	103.331	1.00	20.68	C
ATOM	5044	CD2	LEU	B	298	21.279	−24.124	102.520	1.00	19.62	C
ATOM	5045	C	LEU	B	298	23.792	−27.627	101.659	1.00	20.04	C
ATOM	5046	O	LEU	B	298	23.277	−27.773	100.584	1.00	19.76	O
ATOM	5058	N	GLN	B	299	24.951	−28.200	101.964	1.00	21.20	N
ATOM	5059	CA	GLN	B	299	25.628	−29.079	101.002	1.00	21.72	C
ATOM	5060	CB	GLN	B	299	27.059	−29.402	101.446	1.00	22.32	C
ATOM	5061	CG	GLN	B	299	28.126	−28.470	100.872	1.00	23.94	C
ATOM	5062	CD	GLN	B	299	29.454	−28.516	101.632	1.00	27.45	C
ATOM	5063	OE1	GLN	B	299	30.321	−27.665	101.418	1.00	28.07	O
ATOM	5064	NE2	GLN	B	299	29.618	−29.509	102.515	1.00	30.84	N
ATOM	5065	C	GLN	B	299	24.819	−30.362	100.804	1.00	21.88	C
ATOM	5066	O	GLN	B	299	24.829	−30.940	99.730	1.00	22.34	O
ATOM	5075	N	ASN	B	300	24.094	−30.777	101.835	1.00	21.96	N
ATOM	5076	CA	ASN	B	300	23.299	−32.000	101.800	1.00	22.38	C
ATOM	5077	CB	ASN	B	300	23.065	−32.499	103.238	1.00	23.00	C
ATOM	5078	CG	ASN	B	300	22.013	−33.608	103.328	1.00	25.15	C
ATOM	5079	OD1	ASN	B	300	22.296	−34.765	102.982	1.00	28.54	O
ATOM	5080	ND2	ASN	B	300	20.795	−33.265	103.808	1.00	24.65	N
ATOM	5081	C	ASN	B	300	21.959	−31.870	101.076	1.00	21.83	C
ATOM	5082	O	ASN	B	300	21.467	−32.846	100.514	1.00	21.54	O
ATOM	5089	N	CYS	B	301	21.387	−30.670	101.070	1.00	21.46	N
ATOM	5090	CA	CYS	B	301	20.003	−30.471	100.633	1.00	21.54	C
ATOM	5091	CB	CYS	B	301	19.126	−30.080	101.840	1.00	21.45	C
ATOM	5092	SG	CYS	B	301	19.477	−28.428	102.440	1.00	22.49	S
ATOM	5093	C	CYS	B	301	19.804	−29.438	99.540	1.00	20.51	C
ATOM	5094	O	CYS	B	301	18.676	−29.092	99.262	1.00	20.64	O
ATOM	5100	N	TRP	B	302	20.882	−28.934	98.935	1.00	20.27	N
ATOM	5101	CA	TRP	B	302	20.759	−27.853	97.958	1.00	19.67	C
ATOM	5102	CB	TRP	B	302	22.137	−27.364	97.458	1.00	19.77	C
ATOM	5103	CG	TRP	B	302	22.926	−28.383	96.721	1.00	18.99	C
ATOM	5104	CD1	TRP	B	302	23.750	−29.312	97.264	1.00	17.57	C
ATOM	5105	NE1	TRP	B	302	24.266	−30.114	96.279	1.00	16.02	N
ATOM	5106	CE2	TRP	B	302	23.784	−29.710	95.069	1.00	15.34	C
ATOM	5107	CD2	TRP	B	302	22.934	−28.614	95.308	1.00	16.64	C
ATOM	5108	CE3	TRP	B	302	22.287	−28.021	94.217	1.00	15.05	C
ATOM	5109	CZ3	TRP	B	302	22.521	−28.523	92.956	1.00	14.93	C
ATOM	5110	CH2	TRP	B	302	23.377	−29.610	92.754	1.00	16.76	C
ATOM	5111	CZ2	TRP	B	302	24.025	−30.211	93.796	1.00	16.30	C
ATOM	5112	C	TRP	B	302	19.818	−28.234	96.786	1.00	19.44	C
ATOM	5113	O	TRP	B	302	18.952	−27.462	96.414	1.00	18.38	O
ATOM	5124	N	SER	B	303	19.982	−29.439	96.248	1.00	19.51	N
ATOM	5125	CA	SER	B	303	19.195	−29.907	95.120	1.00	19.82	C
ATOM	5126	CB	SER	B	303	19.869	−31.113	94.460	1.00	19.56	C
ATOM	5127	OG	SER	B	303	20.086	−32.137	95.387	1.00	20.85	O
ATOM	5128	C	SER	B	303	17.723	−30.220	95.490	1.00	19.83	C
ATOM	5129	O	SER	B	303	16.809	−29.987	94.696	1.00	18.13	O
ATOM	5135	N	GLU	B	304	17.514	−30.711	96.705	1.00	19.98	N
ATOM	5136	CA	GLU	B	304	16.165	−30.950	97.213	1.00	20.80	C
ATOM	5137	CB	GLU	B	304	16.239	−31.727	98.532	1.00	21.27	C
ATOM	5138	CG	GLU	B	304	16.641	−33.205	98.395	1.00	24.23	C
ATOM	5139	CD	GLU	B	304	18.159	−33.451	98.398	1.00	29.84	C
ATOM	5140	OE1	GLU	B	304	18.928	−32.457	98.230	1.00	33.46	O
ATOM	5141	OE2	GLU	B	304	18.602	−34.641	98.555	1.00	31.69	O
ATOM	5142	C	GLU	B	304	15.345	−29.645	97.360	1.00	20.45	C
ATOM	5143	O	GLU	B	304	14.178	−29.579	97.002	1.00	19.98	O
ATOM	5150	N	LEU	B	305	15.981	−28.595	97.841	1.00	20.78	N
ATOM	5151	CA	LEU	B	305	15.314	−27.326	98.038	1.00	21.70	C
ATOM	5152	CB	LEU	B	305	16.228	−26.379	98.829	1.00	22.34	C
ATOM	5153	CG	LEU	B	305	15.980	−26.075	100.314	1.00	23.87	C
ATOM	5154	CD1	LEU	B	305	14.969	−26.950	101.059	1.00	23.15	C
ATOM	5155	CD2	LEU	B	305	17.342	−26.100	101.007	1.00	25.21	C
ATOM	5156	C	LEU	B	305	14.938	−26.677	96.721	1.00	21.77	C
ATOM	5157	O	LEU	B	305	13.867	−26.110	96.597	1.00	21.41	O
ATOM	5169	N	LEU	B	306	15.841	−26.755	95.743	1.00	22.26	N
ATOM	5170	CA	LEU	B	306	15.574	−26.265	94.392	1.00	22.10	C
ATOM	5171	CB	LEU	B	306	16.820	−26.376	93.542	1.00	22.42	C
ATOM	5172	CG	LEU	B	306	17.771	−25.239	93.824	1.00	23.36	C
ATOM	5173	CD1	LEU	B	306	19.197	−25.638	93.387	1.00	24.98	C
ATOM	5174	CD2	LEU	B	306	17.262	−23.966	93.156	1.00	22.31	C
ATOM	5175	C	LEU	B	306	14.455	−27.008	93.695	1.00	21.82	C
ATOM	5176	O	LEU	B	306	13.597	−26.397	93.086	1.00	21.87	O
ATOM	5188	N	VAL	B	307	14.470	−28.327	93.797	1.00	21.88	N
ATOM	5189	CA	VAL	B	307	13.410	−29.166	93.241	1.00	22.05	C
ATOM	5190	CB	VAL	B	307	13.761	−30.673	93.432	1.00	21.75	C
ATOM	5191	CG1	VAL	B	307	12.565	−31.595	93.128	1.00	22.21	C
ATOM	5192	CG2	VAL	B	307	14.925	−31.043	92.562	1.00	21.95	C
ATOM	5193	C	VAL	B	307	12.044	−28.831	93.841	1.00	21.41	C
ATOM	5194	O	VAL	B	307	11.078	−28.601	93.148	1.00	21.08	O
ATOM	5204	N	PHE	B	308	12.001	−28.799	95.153	1.00	21.79	N
ATOM	5205	CA	PHE	B	308	10.781	−28.546	95.897	1.00	22.11	C
ATOM	5206	CB	PHE	B	308	11.055	−28.760	97.390	1.00	22.05	C
ATOM	5207	CG	PHE	B	308	9.820	−28.877	98.235	1.00	22.51	C
ATOM	5208	CD1	PHE	B	308	9.644	−28.060	99.349	1.00	22.64	C
ATOM	5209	CE1	PHE	B	308	8.510	−28.180	100.166	1.00	22.90	C
ATOM	5210	CZ	PHE	B	308	7.557	−29.127	99.874	1.00	22.77	C
ATOM	5211	CE2	PHE	B	308	7.724	−29.962	98.767	1.00	22.96	C
ATOM	5212	CD2	PHE	B	308	8.863	−29.832	97.955	1.00	22.95	C
ATOM	5213	C	PHE	B	308	10.273	−27.140	95.630	1.00	21.44	C
ATOM	5214	O	PHE	B	308	9.088	−26.912	95.555	1.00	21.90	O
ATOM	5224	N	ASP	B	309	11.187	−26.200	95.474	1.00	21.39	N
ATOM	5225	CA	ASP	B	309	10.834	−24.848	95.057	1.00	21.05	C
ATOM	5226	CB	ASP	B	309	12.088	−23.970	95.004	1.00	21.59	C
ATOM	5227	CG	ASP	B	309	11.802	−22.578	94.493	1.00	21.57	C
ATOM	5228	OD1	ASP	B	309	12.098	−22.287	93.329	1.00	21.09	O
ATOM	5229	OD2	ASP	B	309	11.259	−21.712	95.180	1.00	26.55	O
ATOM	5230	C	ASP	B	309	10.133	−24.854	93.709	1.00	20.83	C
ATOM	5231	O	ASP	B	309	9.072	−24.274	93.564	1.00	20.35	O
ATOM	5236	N	HIS	B	310	10.721	−25.541	92.739	1.00	21.00	N
ATOM	5237	CA	HIS	B	310	10.103	−25.747	91.429	1.00	21.25	C
ATOM	5238	CB	HIS	B	310	11.040	−26.574	90.522	1.00	21.15	C
ATOM	5239	CG	HIS	B	310	10.402	−27.069	89.257	1.00	19.60	C
ATOM	5240	ND1	HIS	B	310	10.144	−26.249	88.182	1.00	19.91	N
ATOM	5241	CE1	HIS	B	310	9.579	−26.956	87.219	1.00	19.44	C
ATOM	5242	NE2	HIS	B	310	9.466	−28.205	87.630	1.00	18.08	N
ATOM	5243	CD2	HIS	B	310	9.971	−28.302	88.899	1.00	18.53	C
ATOM	5244	C	HIS	B	310	8.755	−26.436	91.536	1.00	21.32	C
ATOM	5245	O	HIS	B	310	7.797	−26.013	90.910	1.00	21.75	O
ATOM	5254	N	ILE	B	311	8.695	−27.486	92.343	1.00	21.88	N
ATOM	5255	CA	ILE	B	311	7.499	−28.300	92.498	1.00	21.49	C
ATOM	5256	CB	ILE	B	311	7.763	−29.461	93.484	1.00	22.24	C
ATOM	5257	CG1	ILE	B	311	8.726	−30.493	92.901	1.00	22.50	C
ATOM	5258	CD1	ILE	B	311	8.122	−31.324	91.859	1.00	24.07	C
ATOM	5259	CG2	ILE	B	311	6.479	−30.147	93.903	1.00	22.13	C
ATOM	5260	C	ILE	B	311	6.390	−27.424	93.037	1.00	21.50	C
ATOM	5261	O	ILE	B	311	5.269	−27.464	92.550	1.00	20.80	O
ATOM	5273	N	TYR	B	312	6.699	−26.613	94.043	1.00	21.46	N
ATOM	5274	CA	TYR	B	312	5.654	−25.836	94.689	1.00	21.05	C
ATOM	5275	CB	TYR	B	312	6.105	−25.266	96.045	1.00	21.15	C
ATOM	5276	CG	TYR	B	312	4.966	−24.603	96.809	1.00	21.33	C
ATOM	5277	CD1	TYR	B	312	3.875	−25.340	97.234	1.00	20.83	C
ATOM	5278	CE1	TYR	B	312	2.833	−24.748	97.909	1.00	20.35	C
ATOM	5279	CZ	TYR	B	312	2.849	−23.412	98.141	1.00	20.63	C
ATOM	5280	OH	TYR	B	312	1.775	−22.811	98.800	1.00	21.74	O
ATOM	5281	CE2	TYR	B	312	3.907	−22.647	97.692	1.00	20.69	C
ATOM	5282	CD2	TYR	B	312	4.947	−23.239	97.035	1.00	20.68	C
ATOM	5283	C	TYR	B	312	5.163	−24.722	93.786	1.00	20.94	C
ATOM	5284	O	TYR	B	312	4.004	−24.386	93.846	1.00	21.75	O
ATOM	5294	N	ARG	B	313	6.039	−24.153	92.955	1.00	20.48	N
ATOM	5295	CA	ARG	B	313	5.649	−23.153	91.980	1.00	20.05	C
ATOM	5296	CB	ARG	B	313	6.876	−22.680	91.207	1.00	20.14	C
ATOM	5297	CG	ARG	B	313	6.609	−21.665	90.143	1.00	19.58	C
ATOM	5298	CD	ARG	B	313	7.840	−20.897	89.669	1.00	20.44	C
ATOM	5299	NE	ARG	B	313	8.596	−20.313	90.778	1.00	20.86	N
ATOM	5300	CZ	ARG	B	313	9.670	−20.859	91.365	1.00	18.45	C
ATOM	5301	NH1	ARG	B	313	10.201	−21.977	90.946	1.00	19.23	N
ATOM	5302	NH2	ARG	B	313	10.238	−20.243	92.361	1.00	19.38	N
ATOM	5303	C	ARG	B	313	4.628	−23.712	91.018	1.00	19.80	C
ATOM	5304	O	ARG	B	313	3.760	−22.983	90.546	1.00	19.89	O
ATOM	5318	N	GLN	B	314	4.745	−25.007	90.733	1.00	20.11	N
ATOM	5319	CA	GLN	B	314	3.838	−25.721	89.833	1.00	20.74	C
ATOM	5320	CB	GLN	B	314	4.444	−27.044	89.332	1.00	20.80	C
ATOM	5321	CG	GLN	B	314	5.752	−27.018	88.510	1.00	20.83	C
ATOM	5322	CD	GLN	B	314	5.951	−25.764	87.709	1.00	20.62	C
ATOM	5323	OE1	GLN	B	314	5.058	−25.504	86.771	1.00	23.09	O
ATOM	5324	NE2	GLN	B	314	6.905	−25.027	87.951	1.00	20.26	N
ATOM	5325	C	GLN	B	314	2.504	−26.035	90.496	1.00	20.93	C
ATOM	5326	O	GLN	B	314	1.461	−26.074	89.834	1.00	21.31	O
ATOM	5335	N	VAL	B	315	2.545	−26.287	91.792	1.00	21.47	N
ATOM	5336	CA	VAL	B	315	1.339	−26.477	92.588	1.00	21.86	C
ATOM	5337	CB	VAL	B	315	1.695	−26.874	94.042	1.00	21.90	C
ATOM	5338	CG1	VAL	B	315	0.452	−26.870	94.944	1.00	21.57	C
ATOM	5339	CG2	VAL	B	315	2.389	−28.246	94.093	1.00	22.69	C
ATOM	5340	C	VAL	B	315	0.515	−25.184	92.587	1.00	22.33	C
ATOM	5341	O	VAL	B	315	−0.684	−25.206	92.394	1.00	22.71	O
ATOM	5351	N	GLN	B	316	1.178	−24.059	92.816	1.00	22.87	N
ATOM	5352	CA	GLN	B	316	0.579	−22.747	92.676	1.00	23.16	C
ATOM	5353	CB	GLN	B	316	1.617	−21.714	93.064	1.00	23.70	C
ATOM	5354	CG	GLN	B	316	1.939	−21.660	94.544	1.00	25.96	C
ATOM	5355	CD	GLN	B	316	2.938	−20.545	94.866	1.00	29.62	C
ATOM	5356	OE1	GLN	B	316	4.023	−20.466	94.251	1.00	29.77	O
ATOM	5357	NE2	GLN	B	316	2.569	−19.668	95.810	1.00	31.49	N
ATOM	5358	C	GLN	B	316	0.045	−22.405	91.264	1.00	22.88	C
ATOM	5359	O	GLN	B	316	−0.976	−21.764	91.139	1.00	22.62	O
ATOM	5368	N	HIS	B	317	0.774	−22.819	90.228	1.00	22.96	N
ATOM	5369	CA	HIS	B	317	0.440	−22.619	88.800	1.00	22.71	C
ATOM	5370	CB	HIS	B	317	1.624	−23.147	87.977	1.00	22.82	C
ATOM	5371	CG	HIS	B	317	1.516	−22.925	86.505	1.00	22.98	C
ATOM	5372	ND1	HIS	B	317	1.188	−21.829	85.787	1.00	23.02	N
ATOM	5373	CE1	HIS	B	317	1.298	−22.170	84.461	1.00	20.97	C
ATOM	5374	NE2	HIS	B	317	1.688	−23.427	84.368	1.00	22.88	N
ATOM	5375	CD2	HIS	B	317	1.833	−23.905	85.588	1.00	21.70	C
ATOM	5376	C	HIS	B	317	−0.840	−23.364	88.389	1.00	22.46	C
ATOM	5377	O	HIS	B	317	−1.677	−22.812	87.707	1.00	22.08	O
ATOM	5386	N	GLY	B	318	−0.971	−24.614	88.827	1.00	22.55	N
ATOM	5387	CA	GLY	B	318	−2.170	−25.409	88.643	1.00	22.69	C
ATOM	5388	C	GLY	B	318	−2.602	−25.526	87.190	1.00	23.03	C
ATOM	5389	O	GLY	B	318	−3.760	−25.291	86.873	1.00	22.58	O
ATOM	5393	N	LYS	B	319	−1.650	−25.824	86.305	1.00	23.49	N
ATOM	5394	CA	LYS	B	319	−1.922	−26.083	84.891	1.00	23.20	C
ATOM	5395	CB	LYS	B	319	−1.556	−24.894	84.002	1.00	23.43	C
ATOM	5396	CG	LYS	B	319	−2.234	−23.561	84.313	1.00	24.64	C
ATOM	5397	CD	LYS	B	319	−2.180	−22.590	83.084	1.00	26.59	C
ATOM	5398	CE	LYS	B	319	−2.124	−21.076	83.466	1.00	27.34	C
ATOM	5399	NZ	LYS	B	319	−3.265	−20.259	82.933	1.00	28.68	N
ATOM	5400	C	LYS	B	319	−1.038	−27.232	84.500	1.00	23.02	C
ATOM	5401	O	LYS	B	319	0.167	−27.115	84.545	1.00	23.76	O
ATOM	5415	N	GLU	B	320	−1.631	−28.344	84.110	1.00	22.79	N
ATOM	5416	CA	GLU	B	320	−0.873	−29.524	83.708	1.00	22.90	C
ATOM	5417	CB	GLU	B	320	−1.824	−30.707	83.582	1.00	23.42	C
ATOM	5418	CG	GLU	B	320	−2.188	−31.317	84.910	1.00	25.32	C
ATOM	5419	CD	GLU	B	320	−2.927	−32.596	84.700	1.00	27.91	C
ATOM	5420	OE1	GLU	B	320	−4.130	−32.648	85.061	1.00	31.19	O
ATOM	5421	OE2	GLU	B	320	−2.303	−33.526	84.126	1.00	30.61	O
ATOM	5422	C	GLU	B	320	−0.103	−29.411	82.381	1.00	21.87	C
ATOM	5423	O	GLU	B	320	0.910	−30.085	82.217	1.00	22.12	O
ATOM	5430	N	GLY	B	321	−0.581	−28.581	81.456	1.00	20.73	N
ATOM	5431	CA	GLY	B	321	0.006	−28.441	80.132	1.00	20.44	C
ATOM	5432	C	GLY	B	321	1.298	−27.635	80.010	1.00	20.18	C
ATOM	5433	O	GLY	B	321	1.944	−27.678	78.965	1.00	20.14	O
ATOM	5437	N	SER	B	322	1.668	−26.893	81.046	1.00	20.00	N
ATOM	5438	CA	SER	B	322	2.902	−26.123	81.027	1.00	20.11	C
ATOM	5439	CB	SER	B	322	2.679	−24.693	80.513	1.00	19.76	C
ATOM	5440	OG	SER	B	322	1.809	−23.969	81.355	1.00	20.88	O
ATOM	5441	C	SER	B	322	3.541	−26.076	82.393	1.00	19.98	C
ATOM	5442	O	SER	B	322	2.881	−26.298	83.405	1.00	20.62	O
ATOM	5448	N	ILE	B	323	4.842	−25.802	82.398	1.00	19.67	N
ATOM	5449	CA	ILE	B	323	5.581	−25.499	83.607	1.00	19.58	C
ATOM	5450	CB	ILE	B	323	6.847	−26.406	83.733	1.00	20.06	C
ATOM	5451	CG1	ILE	B	323	7.831	−26.185	82.573	1.00	20.96	C
ATOM	5452	CD1	ILE	B	323	9.245	−26.517	82.893	1.00	21.82	C
ATOM	5453	CG2	ILE	B	323	6.403	−27.889	83.816	1.00	19.02	C
ATOM	5454	C	ILE	B	323	5.877	−24.004	83.705	1.00	18.66	C
ATOM	5455	O	ILE	B	323	6.011	−23.320	82.723	1.00	17.59	O
ATOM	5467	N	LEU	B	324	5.871	−23.505	84.925	1.00	19.02	N
ATOM	5468	CA	LEU	B	324	6.091	−22.093	85.222	1.00	18.94	C
ATOM	5469	CB	LEU	B	324	4.984	−21.593	86.147	1.00	18.81	C
ATOM	5470	CG	LEU	B	324	4.998	−20.106	86.509	1.00	18.54	C
ATOM	5471	CD1	LEU	B	324	4.604	−19.260	85.355	1.00	19.16	C
ATOM	5472	CD2	LEU	B	324	4.074	−19.889	87.670	1.00	18.76	C
ATOM	5473	C	LEU	B	324	7.472	−21.918	85.867	1.00	18.41	C
ATOM	5474	O	LEU	B	324	7.808	−22.590	86.815	1.00	18.18	O
ATOM	5486	N	LEU	B	325	8.274	−21.025	85.314	1.00	19.31	N
ATOM	5487	CA	LEU	B	325	9.587	−20.713	85.866	1.00	20.23	C
ATOM	5488	CB	LEU	B	325	10.613	−20.481	84.759	1.00	20.48	C
ATOM	5489	CG	LEU	B	325	10.568	−21.506	83.604	1.00	20.83	C
ATOM	5490	CD1	LEU	B	325	11.655	−21.277	82.628	1.00	21.68	C
ATOM	5491	CD2	LEU	B	325	10.651	−22.913	84.097	1.00	21.82	C
ATOM	5492	C	LEU	B	325	9.472	−19.519	86.791	1.00	20.95	C
ATOM	5493	O	LEU	B	325	8.467	−18.817	86.804	1.00	20.70	O
ATOM	5505	N	VAL	B	326	10.490	−19.329	87.612	1.00	22.23	N
ATOM	5506	CA	VAL	B	326	10.458	−18.278	88.626	1.00	23.07	C
ATOM	5507	CB	VAL	B	326	11.611	−18.411	89.673	1.00	23.46	C
ATOM	5508	CG1	VAL	B	326	13.003	−18.179	89.026	1.00	24.79	C
ATOM	5509	CG2	VAL	B	326	11.397	−17.435	90.840	1.00	23.97	C
ATOM	5510	C	VAL	B	326	10.509	−16.897	87.994	1.00	23.05	C
ATOM	5511	O	VAL	B	326	10.133	−15.918	88.641	1.00	23.38	O
ATOM	5521	N	THR	B	327	10.984	−16.828	86.754	1.00	22.52	N
ATOM	5522	CA	THR	B	327	10.954	−15.594	85.986	1.00	22.89	C
ATOM	5523	CB	THR	B	327	11.784	−15.715	84.699	1.00	23.11	C
ATOM	5524	OG1	THR	B	327	11.386	−16.890	83.968	1.00	22.59	O
ATOM	5525	CG2	THR	B	327	13.277	−15.870	85.036	1.00	23.51	C
ATOM	5526	C	THR	B	327	9.562	−15.189	85.557	1.00	22.77	C
ATOM	5527	O	THR	B	327	9.361	−14.042	85.182	1.00	22.67	O
ATOM	5535	N	GLY	B	328	8.639	−16.144	85.552	1.00	22.68	N
ATOM	5536	CA	GLY	B	328	7.284	−15.923	85.129	1.00	22.64	C
ATOM	5537	C	GLY	B	328	7.031	−16.505	83.761	1.00	23.07	C
ATOM	5538	O	GLY	B	328	5.893	−16.531	83.302	1.00	23.49	O
ATOM	5542	N	GLN	B	329	8.069	−16.971	83.086	1.00	23.52	N
ATOM	5543	CA	GLN	B	329	7.860	−17.539	81.761	1.00	23.91	C
ATOM	5544	CB	GLN	B	329	9.094	−17.351	80.842	1.00	24.51	C
ATOM	5545	CG	GLN	B	329	10.367	−18.083	81.191	1.00	26.54	C
ATOM	5546	CD	GLN	B	329	11.668	−17.273	80.852	1.00	30.05	C
ATOM	5547	OE1	GLN	B	329	12.667	−17.343	81.747	1.00	33.63	O
ATOM	5548	NE2	GLN	B	329	11.755	−16.609	79.804	1.00	30.94	N
ATOM	5549	C	GLN	B	329	7.337	−18.986	81.814	1.00	22.90	C
ATOM	5550	O	GLN	B	329	7.708	−19.764	82.676	1.00	22.66	O
ATOM	5559	N	GLU	B	330	6.424	−19.287	80.894	1.00	22.31	N
ATOM	5560	CA	GLU	B	330	5.735	−20.571	80.791	1.00	21.68	C
ATOM	5561	CB	GLU	B	330	4.264	−20.339	80.435	1.00	21.82	C
ATOM	5562	CG	GLU	B	330	3.252	−20.645	81.527	1.00	23.21	C
ATOM	5563	CD	GLU	B	330	1.930	−19.910	81.338	1.00	24.77	C
ATOM	5564	OE1	GLU	B	330	1.321	−19.443	82.329	1.00	27.79	O
ATOM	5565	OE2	GLU	B	330	1.483	−19.769	80.195	1.00	26.18	O
ATOM	5566	C	GLU	B	330	6.378	−21.386	79.678	1.00	20.95	C
ATOM	5567	O	GLU	B	330	6.739	−20.845	78.636	1.00	21.08	O
ATOM	5574	N	VAL	B	331	6.523	−22.684	79.890	1.00	19.80	N
ATOM	5575	CA	VAL	B	331	6.989	−23.587	78.858	1.00	19.11	C
ATOM	5576	CB	VAL	B	331	8.383	−24.160	79.178	1.00	19.27	C
ATOM	5577	CG1	VAL	B	331	8.922	−24.967	78.029	1.00	19.53	C
ATOM	5578	CG2	VAL	B	331	9.366	−23.044	79.543	1.00	19.22	C
ATOM	5579	C	VAL	B	331	6.005	−24.725	78.758	1.00	18.56	C
ATOM	5580	O	VAL	B	331	5.759	−25.432	79.707	1.00	17.52	O
ATOM	5590	N	GLU	B	332	5.449	−24.904	77.578	1.00	19.06	N
ATOM	5591	CA	GLU	B	332	4.551	−26.009	77.336	1.00	19.31	C
ATOM	5592	CB	GLU	B	332	3.840	−25.869	75.995	1.00	19.80	C
ATOM	5593	CG	GLU	B	332	2.340	−25.703	76.147	1.00	22.70	C
ATOM	5594	CD	GLU	B	332	1.886	−24.280	75.955	1.00	26.13	C
ATOM	5595	OE1	GLU	B	332	1.550	−23.942	74.787	1.00	27.53	O
ATOM	5596	OE2	GLU	B	332	1.851	−23.514	76.960	1.00	28.01	O
ATOM	5597	C	GLU	B	332	5.310	−27.297	77.390	1.00	18.70	C
ATOM	5598	O	GLU	B	332	6.478	−27.356	77.066	1.00	17.93	O
ATOM	5605	N	LEU	B	333	4.618	−28.326	77.829	1.00	18.85	N
ATOM	5606	CA	LEU	B	333	5.184	−29.644	77.943	1.00	19.01	C
ATOM	5607	CB	LEU	B	333	4.239	−30.574	78.724	1.00	19.51	C
ATOM	5608	CG	LEU	B	333	4.390	−30.820	80.237	1.00	20.04	C
ATOM	5609	CD1	LEU	B	333	5.841	−30.774	80.667	1.00	21.65	C
ATOM	5610	CD2	LEU	B	333	3.603	−29.881	81.039	1.00	20.78	C
ATOM	5611	C	LEU	B	333	5.441	−30.192	76.557	1.00	18.61	C
ATOM	5612	O	LEU	B	333	6.283	−31.053	76.396	1.00	18.43	O
ATOM	5624	N	THR	B	334	4.709	−29.694	75.561	1.00	18.86	N
ATOM	5625	CA	THR	B	334	4.971	−30.047	74.166	1.00	18.83	C
ATOM	5626	CB	THR	B	334	3.900	−29.487	73.189	1.00	18.90	C
ATOM	5627	OG1	THR	B	334	3.645	−28.106	73.470	1.00	20.09	O
ATOM	5628	CG2	THR	B	334	2.559	−30.159	73.366	1.00	18.44	C
ATOM	5629	C	THR	B	334	6.347	−29.552	73.732	1.00	18.70	C
ATOM	5630	O	THR	B	334	7.040	−30.216	72.968	1.00	18.50	O
ATOM	5638	N	THR	B	335	6.719	−28.372	74.203	1.00	18.43	N
ATOM	5639	CA	THR	B	335	7.993	−27.792	73.866	1.00	18.47	C
ATOM	5640	CB	THR	B	335	8.080	−26.358	74.356	1.00	18.29	C
ATOM	5641	OG1	THR	B	335	7.134	−25.556	73.662	1.00	16.43	O
ATOM	5642	CG2	THR	B	335	9.428	−25.741	73.968	1.00	18.60	C
ATOM	5643	C	THR	B	335	9.110	−28.611	74.466	1.00	19.38	C
ATOM	5644	O	THR	B	335	10.135	−28.837	73.816	1.00	19.78	O
ATOM	5652	N	VAL	B	336	8.918	−29.081	75.687	1.00	19.76	N
ATOM	5653	CA	VAL	B	336	9.937	−29.918	76.284	1.00	20.75	C
ATOM	5654	CB	VAL	B	336	9.949	−29.929	77.859	1.00	21.14	C
ATOM	5655	CG1	VAL	B	336	8.935	−28.983	78.467	1.00	22.56	C
ATOM	5656	CG2	VAL	B	336	9.816	−31.314	78.427	1.00	22.19	C
ATOM	5657	C	VAL	B	336	9.956	−31.325	75.674	1.00	20.72	C
ATOM	5658	O	VAL	B	336	11.028	−31.896	75.518	1.00	20.49	O
ATOM	5668	N	ALA	B	337	8.793	−31.860	75.292	1.00	20.96	N
ATOM	5669	CA	ALA	B	337	8.729	−33.199	74.689	1.00	21.04	C
ATOM	5670	CB	ALA	B	337	7.281	−33.597	74.383	1.00	21.17	C
ATOM	5671	C	ALA	B	337	9.564	−33.238	73.416	1.00	21.02	C
ATOM	5672	O	ALA	B	337	10.128	−34.261	73.049	1.00	21.74	O
ATOM	5678	N	THR	B	338	9.683	−32.086	72.783	1.00	20.62	N
ATOM	5679	CA	THR	B	338	10.217	−31.968	71.454	1.00	20.13	C
ATOM	5680	CB	THR	B	338	9.172	−31.145	70.678	1.00	20.15	C
ATOM	5681	OG1	THR	B	338	8.789	−31.854	69.499	1.00	20.52	O
ATOM	5682	CG2	THR	B	338	9.675	−29.800	70.231	1.00	19.18	C
ATOM	5683	C	THR	B	338	11.658	−31.380	71.421	1.00	19.85	C
ATOM	5684	O	THR	B	338	12.463	−31.765	70.581	1.00	19.91	O
ATOM	5692	N	GLN	B	339	11.987	−30.498	72.362	1.00	19.44	N
ATOM	5693	CA	GLN	B	339	13.287	−29.815	72.386	1.00	19.33	C
ATOM	5694	CB	GLN	B	339	13.064	−28.315	72.643	1.00	19.34	C
ATOM	5695	CG	GLN	B	339	12.191	−27.605	71.630	1.00	19.69	C
ATOM	5696	CD	GLN	B	339	12.613	−27.836	70.188	1.00	19.13	C
ATOM	5697	OE1	GLN	B	339	11.688	−28.311	69.380	1.00	20.42	O
ATOM	5698	NE2	GLN	B	339	13.758	−27.576	69.809	1.00	18.11	N
ATOM	5699	C	GLN	B	339	14.308	−30.361	73.414	1.00	18.84	C
ATOM	5700	O	GLN	B	339	15.504	−30.179	73.269	1.00	18.94	O
ATOM	5709	N	ALA	B	340	13.823	−31.003	74.461	1.00	19.15	N
ATOM	5710	CA	ALA	B	340	14.683	−31.523	75.515	1.00	19.55	C
ATOM	5711	CB	ALA	B	340	13.956	−31.519	76.845	1.00	19.34	C
ATOM	5712	C	ALA	B	340	15.121	−32.932	75.179	1.00	19.63	C
ATOM	5713	O	ALA	B	340	14.483	−33.615	74.386	1.00	19.73	O
ATOM	5719	N	GLY	B	341	16.214	−33.363	75.791	1.00	20.00	N
ATOM	5720	CA	GLY	B	341	16.676	−34.723	75.649	1.00	20.38	C
ATOM	5721	C	GLY	B	341	15.957	−35.656	76.599	1.00	20.77	C
ATOM	5722	O	GLY	B	341	15.116	−35.236	77.376	1.00	20.80	O
ATOM	5726	N	SER	B	342	16.326	−36.930	76.513	1.00	21.87	N
ATOM	5727	CA	SER	B	342	15.827	−38.023	77.348	1.00	22.21	C
ATOM	5728	CB	SER	B	342	16.716	−39.254	77.163	1.00	21.97	C
ATOM	5729	OG	SER	B	342	16.513	−39.828	75.909	1.00	23.35	O
ATOM	5730	C	SER	B	342	15.812	−37.731	78.829	1.00	22.52	C
ATOM	5731	O	SER	B	342	14.778	−37.878	79.477	1.00	22.89	O
ATOM	5737	N	LEU	B	343	16.982	−37.384	79.360	1.00	22.84	N
ATOM	5738	CA	LEU	B	343	17.155	−37.151	80.783	1.00	23.34	C
ATOM	5739	CB	LEU	B	343	18.622	−36.791	81.102	1.00	23.95	C
ATOM	5740	CG	LEU	B	343	19.726	−37.873	81.105	1.00	26.27	C
ATOM	5741	CD1	LEU	B	343	19.174	−39.261	81.461	1.00	28.04	C
ATOM	5742	CD2	LEU	B	343	20.512	−37.981	79.777	1.00	28.14	C
ATOM	5743	C	LEU	B	343	16.232	−36.037	81.263	1.00	22.93	C
ATOM	5744	O	LEU	B	343	15.420	−36.244	82.168	1.00	23.32	O
ATOM	5756	N	LEU	B	344	16.341	−34.872	80.634	1.00	22.28	N
ATOM	5757	CA	LEU	B	344	15.598	−33.696	81.053	1.00	22.08	C
ATOM	5758	CB	LEU	B	344	16.066	−32.454	80.286	1.00	21.40	C
ATOM	5759	CG	LEU	B	344	15.341	−31.183	80.709	1.00	21.75	C
ATOM	5760	CD1	LEU	B	344	15.549	−30.958	82.222	1.00	21.88	C
ATOM	5761	CD2	LEU	B	344	15.755	−29.958	79.897	1.00	21.56	C
ATOM	5762	C	LEU	B	344	14.084	−33.886	80.886	1.00	22.46	C
ATOM	5763	O	LEU	B	344	13.303	−33.521	81.759	1.00	22.54	O
ATOM	5775	N	HIS	B	345	13.685	−34.424	79.747	1.00	22.89	N
ATOM	5776	CA	HIS	B	345	12.299	−34.732	79.493	1.00	23.28	C
ATOM	5777	CB	HIS	B	345	12.161	−35.460	78.161	1.00	23.38	C
ATOM	5778	CG	HIS	B	345	10.741	−35.692	77.737	1.00	23.67	C
ATOM	5779	ND1	HIS	B	345	10.181	−36.660	76.974	1.00	23.76	N
ATOM	5780	CE1	HIS	B	345	8.837	−36.386	76.891	1.00	24.30	C
ATOM	5781	NE2	HIS	B	345	8.583	−35.287	77.573	1.00	23.65	N
ATOM	5782	CD2	HIS	B	345	9.715	−34.851	78.097	1.00	24.06	C
ATOM	5783	C	HIS	B	345	11.714	−35.588	80.616	1.00	23.75	C
ATOM	5784	O	HIS	B	345	10.665	−35.240	81.166	1.00	23.59	O
ATOM	5793	N	SER	B	346	12.403	−36.685	80.948	1.00	23.97	N
ATOM	5794	CA	SER	B	346	11.962	−37.627	81.982	1.00	24.68	C
ATOM	5795	CB	SER	B	346	12.893	−38.856	82.032	1.00	25.22	C
ATOM	5796	OG	SER	B	346	13.070	−39.328	83.373	1.00	27.97	O
ATOM	5797	C	SER	B	346	11.884	−36.999	83.365	1.00	24.28	C
ATOM	5798	O	SER	B	346	10.986	−37.258	84.127	1.00	24.46	O
ATOM	5804	N	LEU	B	347	12.846	−36.162	83.677	1.00	24.40	N
ATOM	5805	CA	LEU	B	347	12.877	−35.436	84.939	1.00	24.27	C
ATOM	5806	CB	LEU	B	347	14.182	−34.655	84.962	1.00	23.88	C
ATOM	5807	CG	LEU	B	347	14.828	−34.173	86.239	1.00	26.27	C
ATOM	5808	CD1	LEU	B	347	14.833	−35.213	87.387	1.00	26.65	C
ATOM	5809	CD2	LEU	B	347	16.245	−33.727	85.882	1.00	26.86	C
ATOM	5810	C	LEU	B	347	11.665	−34.492	85.089	1.00	24.01	C
ATOM	5811	O	LEU	B	347	10.999	−34.457	86.106	1.00	24.10	O
ATOM	5823	N	VAL	B	348	11.384	−33.728	84.052	1.00	23.56	N
ATOM	5824	CA	VAL	B	348	10.302	−32.772	84.085	1.00	23.17	C
ATOM	5825	CB	VAL	B	348	10.284	−31.928	82.789	1.00	23.27	C
ATOM	5826	CG1	VAL	B	348	9.008	−31.093	82.667	1.00	23.23	C
ATOM	5827	CG2	VAL	B	348	11.513	−31.042	82.720	1.00	23.56	C
ATOM	5828	C	VAL	B	348	8.986	−33.508	84.309	1.00	23.05	C
ATOM	5829	O	VAL	B	348	8.209	−33.108	85.153	1.00	23.12	O
ATOM	5839	N	LEU	B	349	8.763	−34.595	83.576	1.00	22.99	N
ATOM	5840	CA	LEU	B	349	7.536	−35.397	83.710	1.00	23.25	C
ATOM	5841	CB	LEU	B	349	7.501	−36.503	82.659	1.00	23.12	C
ATOM	5842	CG	LEU	B	349	6.752	−36.233	81.360	1.00	24.30	C
ATOM	5843	CD1	LEU	B	349	6.615	−34.749	81.020	1.00	25.05	C
ATOM	5844	CD2	LEU	B	349	7.424	−37.015	80.217	1.00	25.07	C
ATOM	5845	C	LEU	B	349	7.331	−36.029	85.086	1.00	23.43	C
ATOM	5846	O	LEU	B	349	6.208	−36.078	85.573	1.00	23.00	O
ATOM	5858	N	ARG	B	350	8.422	−36.501	85.692	1.00	23.93	N
ATOM	5859	CA	ARG	B	350	8.395	−37.140	86.995	1.00	24.51	C
ATOM	5860	CB	ARG	B	350	9.756	−37.766	87.342	1.00	25.37	C
ATOM	5861	CG	ARG	B	350	9.713	−38.938	88.345	1.00	28.59	C
ATOM	5862	CD	ARG	B	350	10.758	−40.042	88.015	1.00	33.51	C
ATOM	5863	NE	ARG	B	350	11.034	−41.071	89.054	1.00	37.55	N
ATOM	5864	CZ	ARG	B	350	11.576	−40.840	90.272	1.00	38.97	C
ATOM	5865	NH1	ARG	B	350	11.878	−39.603	90.669	1.00	39.59	N
ATOM	5866	NH2	ARG	B	350	11.797	−41.854	91.113	1.00	39.17	N
ATOM	5867	C	ARG	B	350	8.027	−36.118	88.028	1.00	24.08	C
ATOM	5868	O	ARG	B	350	7.204	−36.394	88.903	1.00	24.39	O
ATOM	5882	N	ALA	B	351	8.629	−34.932	87.913	1.00	23.55	N
ATOM	5883	CA	ALA	B	351	8.323	−33.802	88.785	1.00	22.95	C
ATOM	5884	CB	ALA	B	351	9.197	−32.621	88.440	1.00	22.93	C
ATOM	5885	C	ALA	B	351	6.853	−33.410	88.718	1.00	22.23	C
ATOM	5886	O	ALA	B	351	6.224	−33.172	89.737	1.00	21.92	O
ATOM	5892	N	GLN	B	352	6.326	−33.359	87.506	1.00	21.95	N
ATOM	5893	CA	GLN	B	352	4.924	−33.032	87.262	1.00	21.67	C
ATOM	5894	CB	GLN	B	352	4.651	−32.970	85.755	1.00	21.25	C
ATOM	5895	CG	GLN	B	352	5.097	−31.711	85.044	1.00	21.07	C
ATOM	5896	CD	GLN	B	352	4.677	−30.432	85.744	1.00	20.58	C
ATOM	5897	OE1	GLN	B	352	5.571	−29.907	86.555	1.00	20.58	O
ATOM	5898	NE2	GLN	B	352	3.563	−29.914	85.542	1.00	20.12	N
ATOM	5899	C	GLN	B	352	3.960	−34.040	87.921	1.00	21.82	C
ATOM	5900	O	GLN	B	352	2.884	−33.673	88.338	1.00	21.80	O
ATOM	5909	N	GLU	B	353	4.344	−35.309	87.989	1.00	22.34	N
ATOM	5910	CA	GLU	B	353	3.566	−36.319	88.697	1.00	22.67	C
ATOM	5911	CB	GLU	B	353	4.143	−37.713	88.475	1.00	23.12	C
ATOM	5912	CG	GLU	B	353	4.103	−38.213	87.045	1.00	23.86	C
ATOM	5913	CD	GLU	B	353	4.609	−39.636	86.929	1.00	27.46	C
ATOM	5914	OE1	GLU	B	353	5.790	−39.899	87.297	1.00	29.56	O
ATOM	5915	OE2	GLU	B	353	3.824	−40.507	86.479	1.00	29.46	O
ATOM	5916	C	GLU	B	353	3.509	−36.080	90.188	1.00	22.32	C
ATOM	5917	O	GLU	B	353	2.510	−36.336	90.795	1.00	23.45	O
ATOM	5924	N	LEU	B	354	4.594	−35.619	90.775	1.00	22.08	N
ATOM	5925	CA	LEU	B	354	4.625	−35.260	92.180	1.00	22.11	C
ATOM	5926	CB	LEU	B	354	6.085	−35.105	92.602	1.00	22.17	C
ATOM	5927	CG	LEU	B	354	6.391	−34.597	94.005	1.00	23.43	C
ATOM	5928	CD1	LEU	B	354	5.860	−35.556	95.001	1.00	24.79	C
ATOM	5929	CD2	LEU	B	354	7.861	−34.445	94.224	1.00	25.27	C
ATOM	5930	C	LEU	B	354	3.826	−33.972	92.482	1.00	21.79	C
ATOM	5931	O	LEU	B	354	3.291	−33.797	93.573	1.00	20.59	O
ATOM	5943	N	VAL	B	355	3.784	−33.066	91.511	1.00	21.88	N
ATOM	5944	CA	VAL	B	355	2.921	−31.897	91.574	1.00	21.58	C
ATOM	5945	CB	VAL	B	355	3.154	−30.977	90.350	1.00	21.33	C
ATOM	5946	CG1	VAL	B	355	2.109	−29.825	90.271	1.00	20.89	C
ATOM	5947	CG2	VAL	B	355	4.529	−30.388	90.425	1.00	21.73	C
ATOM	5948	C	VAL	B	355	1.467	−32.353	91.677	1.00	21.27	C
ATOM	5949	O	VAL	B	355	0.688	−31.797	92.430	1.00	20.90	O
ATOM	5959	N	LEU	B	356	1.126	−33.399	90.949	1.00	21.33	N
ATOM	5960	CA	LEU	B	356	−0.231	−33.918	90.931	1.00	21.93	C
ATOM	5961	CB	LEU	B	356	−0.380	−34.934	89.799	1.00	22.39	C
ATOM	5962	CG	LEU	B	356	−1.514	−34.808	88.772	1.00	24.08	C
ATOM	5963	CD1	LEU	B	356	−1.837	−33.364	88.291	1.00	24.27	C
ATOM	5964	CD2	LEU	B	356	−1.168	−35.709	87.600	1.00	24.55	C
ATOM	5965	C	LEU	B	356	−0.635	−34.535	92.278	1.00	22.05	C
ATOM	5966	O	LEU	B	356	−1.746	−34.280	92.764	1.00	21.37	O
ATOM	5978	N	GLN	B	357	0.273	−35.324	92.869	1.00	22.25	N
ATOM	5979	CA	GLN	B	357	0.149	−35.840	94.231	1.00	22.55	C
ATOM	5980	CB	GLN	B	357	1.439	−36.540	94.673	1.00	23.08	C
ATOM	5981	CG	GLN	B	357	1.778	−37.817	94.002	1.00	26.83	C
ATOM	5982	CD	GLN	B	357	3.092	−38.448	94.565	1.00	32.10	C
ATOM	5983	OE1	GLN	B	357	3.253	−38.591	95.801	1.00	35.37	O
ATOM	5984	NE2	GLN	B	357	4.019	−38.830	93.655	1.00	31.88	N
ATOM	5985	C	GLN	B	357	−0.093	−34.735	95.250	1.00	21.89	C
ATOM	5986	O	GLN	B	357	−0.989	−34.820	96.050	1.00	21.86	O
ATOM	5995	N	LEU	B	358	0.770	−33.727	95.248	1.00	22.32	N
ATOM	5996	CA	LEU	B	358	0.676	−32.613	96.184	1.00	22.25	C
ATOM	5997	CB	LEU	B	358	1.927	−31.699	96.100	1.00	22.07	C
ATOM	5998	CG	LEU	B	358	3.197	−32.384	96.640	1.00	23.22	C
ATOM	5999	CD1	LEU	B	358	4.486	−31.681	96.197	1.00	24.57	C
ATOM	6000	CD2	LEU	B	358	3.185	−32.503	98.168	1.00	23.31	C
ATOM	6001	C	LEU	B	358	−0.639	−31.840	96.029	1.00	21.90	C
ATOM	6002	O	LEU	B	358	−1.201	−31.409	97.020	1.00	21.81	O
ATOM	6014	N	LEU	B	359	−1.148	−31.703	94.808	1.00	22.03	N
ATOM	6015	CA	LEU	B	359	−2.484	−31.100	94.578	1.00	21.79	C
ATOM	6016	CB	LEU	B	359	−2.752	−30.812	93.088	1.00	21.49	C
ATOM	6017	CG	LEU	B	359	−1.950	−29.654	92.483	1.00	21.57	C
ATOM	6018	CD1	LEU	B	359	−1.958	−29.728	90.975	1.00	22.48	C
ATOM	6019	CD2	LEU	B	359	−2.477	−28.317	92.947	1.00	21.25	C
ATOM	6020	C	LEU	B	359	−3.604	−31.988	95.120	1.00	21.66	C
ATOM	6021	O	LEU	B	359	−4.583	−31.491	95.672	1.00	21.05	O
ATOM	6033	N	ALA	B	360	−3.437	−33.296	94.968	1.00	21.68	N
ATOM	6034	CA	ALA	B	360	−4.397	−34.250	95.478	1.00	22.04	C
ATOM	6035	CB	ALA	B	360	−4.157	−35.648	94.858	1.00	22.02	C
ATOM	6036	C	ALA	B	360	−4.407	−34.292	97.016	1.00	22.38	C
ATOM	6037	O	ALA	B	360	−5.460	−34.442	97.613	1.00	22.99	O
ATOM	6043	N	LEU	B	361	−3.255	−34.108	97.650	1.00	22.87	N
ATOM	6044	CA	LEU	B	361	−3.144	−34.041	99.116	1.00	23.18	C
ATOM	6045	CB	LEU	B	361	−1.707	−34.358	99.551	1.00	23.45	C
ATOM	6046	CG	LEU	B	361	−1.172	−35.738	99.213	1.00	23.32	C
ATOM	6047	CD1	LEU	B	361	0.324	−35.801	99.442	1.00	22.44	C
ATOM	6048	CD2	LEU	B	361	−1.924	−36.771	100.065	1.00	23.84	C
ATOM	6049	C	LEU	B	361	−3.456	−32.649	99.659	1.00	23.57	C
ATOM	6050	O	LEU	B	361	−3.393	−32.427	100.865	1.00	23.93	O
ATOM	6062	N	GLN	B	362	−3.726	−31.702	98.769	1.00	23.71	N
ATOM	6063	CA	GLN	B	362	−4.104	−30.343	99.153	1.00	23.59	C
ATOM	6064	CB	GLN	B	362	−5.407	−30.323	99.965	1.00	23.92	C
ATOM	6065	CG	GLN	B	362	−6.619	−30.595	99.145	1.00	25.78	C
ATOM	6066	CD	GLN	B	362	−7.741	−31.106	99.998	1.00	29.85	C
ATOM	6067	OE1	GLN	B	362	−8.091	−32.286	99.915	1.00	33.74	O
ATOM	6068	NE2	GLN	B	362	−8.297	−30.238	100.850	1.00	31.65	N
ATOM	6069	C	GLN	B	362	−3.032	−29.646	99.926	1.00	22.72	C
ATOM	6070	O	GLN	B	362	−3.311	−29.043	100.958	1.00	23.20	O
ATOM	6079	N	LEU	B	363	−1.808	−29.709	99.425	1.00	22.13	N
ATOM	6080	CA	LEU	B	363	−0.698	−28.974	100.025	1.00	21.58	C
ATOM	6081	CB	LEU	B	363	0.596	−29.233	99.242	1.00	21.22	C
ATOM	6082	CG	LEU	B	363	1.847	−28.485	99.721	1.00	21.10	C
ATOM	6083	CD1	LEU	B	363	2.469	−29.087	100.968	1.00	20.20	C
ATOM	6084	CD2	LEU	B	363	2.837	−28.462	98.603	1.00	21.96	C
ATOM	6085	C	LEU	B	363	−0.977	−27.463	100.095	1.00	21.21	C
ATOM	6086	O	LEU	B	363	−1.315	−26.848	99.088	1.00	20.77	O
ATOM	6098	N	ASP	B	364	−0.816	−26.883	101.284	1.00	21.16	N
ATOM	6099	CA	ASP	B	364	−0.986	−25.446	101.481	1.00	21.13	C
ATOM	6100	CB	ASP	B	364	−2.158	−25.136	102.438	1.00	21.52	C
ATOM	6101	CG	ASP	B	364	−1.879	−25.510	103.881	1.00	21.50	C
ATOM	6102	OD1	ASP	B	364	−0.725	−25.818	104.233	1.00	20.48	O
ATOM	6103	OD2	ASP	B	364	−2.780	−25.485	104.738	1.00	22.01	O
ATOM	6104	C	ASP	B	364	0.317	−24.814	101.925	1.00	20.71	C
ATOM	6105	O	ASP	B	364	1.288	−25.510	102.166	1.00	21.50	O
ATOM	6110	N	ARG	B	365	0.339	−23.497	102.027	1.00	20.55	N
ATOM	6111	CA	ARG	B	365	1.590	−22.754	102.219	1.00	20.47	C
ATOM	6112	CB	ARG	B	365	1.341	−21.267	102.085	1.00	20.98	C
ATOM	6113	CG	ARG	B	365	2.615	−20.434	101.922	1.00	22.30	C
ATOM	6114	CD	ARG	B	365	2.297	−18.953	101.742	1.00	23.78	C
ATOM	6115	NE	ARG	B	365	3.450	−18.068	101.575	1.00	24.72	N
ATOM	6116	CZ	ARG	B	365	4.252	−18.042	100.508	1.00	26.85	C
ATOM	6117	NH1	ARG	B	365	4.076	−18.874	99.482	1.00	28.00	N
ATOM	6118	NH2	ARG	B	365	5.250	−17.164	100.456	1.00	27.80	N
ATOM	6119	C	ARG	B	365	2.265	−23.029	103.548	1.00	20.21	C
ATOM	6120	O	ARG	B	365	3.485	−22.979	103.629	1.00	19.68	O
ATOM	6134	N	GLN	B	366	1.453	−23.315	104.567	1.00	20.52	N
ATOM	6135	CA	GLN	B	366	1.893	−23.691	105.909	1.00	20.24	C
ATOM	6136	CB	GLN	B	366	0.675	−23.868	106.819	1.00	20.43	C
ATOM	6137	CG	GLN	B	366	−0.015	−22.576	107.275	1.00	21.31	C
ATOM	6138	CD	GLN	B	366	−0.887	−21.892	106.208	1.00	21.89	C
ATOM	6139	OE1	GLN	B	366	−1.449	−22.644	105.298	1.00	26.18	O
ATOM	6140	NE2	GLN	B	366	−1.047	−20.692	106.247	1.00	20.22	N
ATOM	6141	C	GLN	B	366	2.693	−25.003	105.891	1.00	20.06	C
ATOM	6142	O	GLN	B	366	3.761	−25.113	106.501	1.00	19.35	O
ATOM	6151	N	GLU	B	367	2.157	−25.995	105.190	1.00	20.36	N
ATOM	6152	CA	GLU	B	367	2.846	−27.267	105.011	1.00	20.59	C
ATOM	6153	CB	GLU	B	367	1.892	−28.308	104.410	1.00	20.23	C
ATOM	6154	CG	GLU	B	367	0.767	−28.689	105.352	1.00	20.47	C
ATOM	6155	CD	GLU	B	367	−0.540	−28.989	104.658	1.00	19.18	C
ATOM	6156	OE1	GLU	B	367	−0.583	−28.880	103.416	1.00	19.11	O
ATOM	6157	OE2	GLU	B	367	−1.520	−29.329	105.363	1.00	18.42	O
ATOM	6158	C	GLU	B	367	4.097	−27.097	104.137	1.00	20.64	C
ATOM	6159	O	GLU	B	367	5.151	−27.637	104.455	1.00	22.04	O
ATOM	6166	N	PHE	B	368	3.978	−26.333	103.058	1.00	20.10	N
ATOM	6167	CA	PHE	B	368	5.101	−26.038	102.194	1.00	20.21	C
ATOM	6168	CB	PHE	B	368	4.706	−25.047	101.090	1.00	20.31	C
ATOM	6169	CG	PHE	B	368	5.881	−24.502	100.344	1.00	20.83	C
ATOM	6170	CD1	PHE	B	368	6.695	−25.351	99.600	1.00	21.73	C
ATOM	6171	CE1	PHE	B	368	7.787	−24.872	98.952	1.00	21.46	C
ATOM	6172	CZ	PHE	B	368	8.105	−23.519	99.022	1.00	21.70	C
ATOM	6173	CE2	PHE	B	368	7.311	−22.657	99.744	1.00	21.28	C
ATOM	6174	CD2	PHE	B	368	6.203	−23.149	100.412	1.00	21.89	C
ATOM	6175	C	PHE	B	368	6.290	−25.496	102.956	1.00	19.85	C
ATOM	6176	O	PHE	B	368	7.373	−26.026	102.851	1.00	19.48	O
ATOM	6186	N	VAL	B	369	6.088	−24.430	103.716	1.00	20.23	N
ATOM	6187	CA	VAL	B	369	7.199	−23.783	104.389	1.00	20.13	C
ATOM	6188	CB	VAL	B	369	6.864	−22.360	104.958	1.00	20.25	C
ATOM	6189	CG1	VAL	B	369	6.477	−21.385	103.842	1.00	20.69	C
ATOM	6190	CG2	VAL	B	369	5.822	−22.386	106.090	1.00	20.83	C
ATOM	6191	C	VAL	B	369	7.787	−24.667	105.479	1.00	20.45	C
ATOM	6192	O	VAL	B	369	8.992	−24.602	105.747	1.00	20.34	O
ATOM	6202	N	CYS	B	370	6.950	−25.508	106.091	1.00	20.80	N
ATOM	6203	CA	CYS	B	370	7.420	−26.397	107.153	1.00	20.77	C
ATOM	6204	CB	CYS	B	370	6.264	−27.006	107.940	1.00	21.11	C
ATOM	6205	SG	CYS	B	370	6.773	−27.757	109.500	1.00	20.59	S
ATOM	6206	C	CYS	B	370	8.271	−27.497	106.578	1.00	20.20	C
ATOM	6207	O	CYS	B	370	9.309	−27.814	107.125	1.00	19.56	O
ATOM	6213	N	LEU	B	371	7.803	−28.056	105.469	1.00	20.92	N
ATOM	6214	CA	LEU	B	371	8.539	−29.049	104.687	1.00	21.60	C
ATOM	6215	CB	LEU	B	371	7.677	−29.557	103.540	1.00	21.77	C
ATOM	6216	CG	LEU	B	371	6.513	−30.454	103.984	1.00	21.18	C
ATOM	6217	CD1	LEU	B	371	5.506	−30.539	102.876	1.00	22.84	C
ATOM	6218	CD2	LEU	B	371	6.964	−31.867	104.379	1.00	20.73	C
ATOM	6219	C	LEU	B	371	9.878	−28.572	104.143	1.00	22.28	C
ATOM	6220	O	LEU	B	371	10.822	−29.331	104.132	1.00	22.85	O
ATOM	6232	N	LYS	B	372	9.954	−27.323	103.695	1.00	22.83	N
ATOM	6233	CA	LYS	B	372	11.227	−26.698	103.307	1.00	23.30	C
ATOM	6234	CB	LYS	B	372	11.009	−25.223	102.901	1.00	24.00	C
ATOM	6235	CG	LYS	B	372	11.086	−24.886	101.456	1.00	24.89	C
ATOM	6236	CD	LYS	B	372	10.746	−23.409	101.260	1.00	26.29	C
ATOM	6237	CE	LYS	B	372	11.815	−22.520	101.826	1.00	28.79	C
ATOM	6238	NZ	LYS	B	372	12.282	−21.355	100.973	1.00	32.44	N
ATOM	6239	C	LYS	B	372	12.222	−26.703	104.475	1.00	22.50	C
ATOM	6240	O	LYS	B	372	13.410	−26.928	104.283	1.00	21.79	O
ATOM	6254	N	PHE	B	373	11.720	−26.411	105.675	1.00	21.75	N
ATOM	6255	CA	PHE	B	373	12.538	−26.397	106.881	1.00	21.48	C
ATOM	6256	CB	PHE	B	373	11.752	−25.711	108.006	1.00	21.59	C
ATOM	6257	CG	PHE	B	373	12.568	−25.400	109.234	1.00	22.30	C
ATOM	6258	CD1	PHE	B	373	13.254	−24.182	109.352	1.00	23.47	C
ATOM	6259	CE1	PHE	B	373	13.988	−23.875	110.519	1.00	23.22	C
ATOM	6260	CZ	PHE	B	373	14.046	−24.791	111.572	1.00	22.77	C
ATOM	6261	CE2	PHE	B	373	13.364	−26.010	111.453	1.00	22.66	C
ATOM	6262	CD2	PHE	B	373	12.630	−26.305	110.294	1.00	22.09	C
ATOM	6263	C	PHE	B	373	13.013	−27.796	107.317	1.00	21.12	C
ATOM	6264	O	PHE	B	373	14.158	−27.994	107.775	1.00	20.29	O
ATOM	6274	N	ILE	B	374	12.105	−28.751	107.197	1.00	20.74	N
ATOM	6275	CA	ILE	B	374	12.425	−30.145	107.402	1.00	20.61	C
ATOM	6276	CB	ILE	B	374	11.153	−31.001	107.227	1.00	20.39	C
ATOM	6277	CG1	ILE	B	374	10.213	−30.798	108.438	1.00	20.30	C
ATOM	6278	CD1	ILE	B	374	8.746	−31.217	108.223	1.00	19.72	C
ATOM	6279	CG2	ILE	B	374	11.512	−32.485	107.049	1.00	20.70	C
ATOM	6280	C	ILE	B	374	13.545	−30.619	106.469	1.00	20.48	C
ATOM	6281	O	ILE	B	374	14.441	−31.322	106.904	1.00	20.58	O
ATOM	6293	N	ILE	B	375	13.476	−30.251	105.200	1.00	20.37	N
ATOM	6294	CA	ILE	B	375	14.477	−30.667	104.233	1.00	20.81	C
ATOM	6295	CB	ILE	B	375	14.116	−30.171	102.795	1.00	20.54	C
ATOM	6296	CG1	ILE	B	375	12.958	−30.976	102.224	1.00	20.00	C
ATOM	6297	CD1	ILE	B	375	12.338	−30.334	100.985	1.00	19.63	C
ATOM	6298	CG2	ILE	B	375	15.370	−30.176	101.819	1.00	21.08	C
ATOM	6299	C	ILE	B	375	15.820	−30.087	104.646	1.00	21.03	C
ATOM	6300	O	ILE	B	375	16.849	−30.772	104.601	1.00	20.52	O
ATOM	6312	N	LEU	B	376	15.786	−28.810	105.016	1.00	21.04	N
ATOM	6313	CA	LEU	B	376	16.960	−28.085	105.434	1.00	21.32	C
ATOM	6314	CB	LEU	B	376	16.567	−26.669	105.892	1.00	21.62	C
ATOM	6315	CG	LEU	B	376	17.668	−25.769	106.479	1.00	22.29	C
ATOM	6316	CD1	LEU	B	376	18.818	−25.620	105.506	1.00	23.14	C
ATOM	6317	CD2	LEU	B	376	17.127	−24.389	106.897	1.00	22.61	C
ATOM	6318	C	LEU	B	376	17.704	−28.863	106.536	1.00	21.60	C
ATOM	6319	O	LEU	B	376	18.919	−29.071	106.442	1.00	20.65	O
ATOM	6331	N	PHE	B	377	16.966	−29.334	107.544	1.00	21.48	N
ATOM	6332	CA	PHE	B	377	17.571	−30.010	108.681	1.00	21.51	C
ATOM	6333	CB	PHE	B	377	16.918	−29.529	109.980	1.00	21.37	C
ATOM	6334	CG	PHE	B	377	17.438	−28.198	110.463	1.00	21.13	C
ATOM	6335	CD1	PHE	B	377	16.814	−27.012	110.107	1.00	20.61	C
ATOM	6336	CE1	PHE	B	377	17.299	−25.775	110.576	1.00	20.67	C
ATOM	6337	CZ	PHE	B	377	18.409	−25.734	111.378	1.00	20.49	C
ATOM	6338	CE2	PHE	B	377	19.042	−26.908	111.745	1.00	21.35	C
ATOM	6339	CD2	PHE	B	377	18.559	−28.130	111.279	1.00	21.81	C
ATOM	6340	C	PHE	B	377	17.535	−31.538	108.584	1.00	22.05	C
ATOM	6341	O	PHE	B	377	17.823	−32.214	109.543	1.00	22.25	O
ATOM	6351	N	SER	B	378	17.225	−32.083	107.413	1.00	23.24	N
ATOM	6352	CA	SER	B	378	17.149	−33.532	107.212	1.00	23.97	C
ATOM	6353	CB	SER	B	378	16.253	−33.854	106.031	1.00	23.80	C
ATOM	6354	OG	SER	B	378	16.701	−33.159	104.859	1.00	26.53	O
ATOM	6355	C	SER	B	378	18.523	−34.065	106.921	1.00	24.41	C
ATOM	6356	O	SER	B	378	18.851	−34.325	105.776	1.00	25.79	O
ATOM	6362	N	LEU	B	379	19.349	−34.164	107.944	1.00	24.72	N
ATOM	6363	CA	LEU	B	379	20.692	−34.706	107.803	1.00	24.56	C
ATOM	6364	CB	LEU	B	379	21.736	−33.611	107.606	1.00	24.22	C
ATOM	6365	CG	LEU	B	379	23.177	−34.096	107.371	1.00	22.91	C
ATOM	6366	CD1	LEU	B	379	23.307	−35.123	106.239	1.00	22.01	C
ATOM	6367	CD2	LEU	B	379	24.080	−32.919	107.097	1.00	22.89	C
ATOM	6368	C	LEU	B	379	20.998	−35.454	109.063	1.00	25.35	C
ATOM	6369	O	LEU	B	379	20.855	−34.913	110.160	1.00	25.39	O
ATOM	6381	N	ASP	B	380	21.427	−36.702	108.916	1.00	26.30	N
ATOM	6382	CA	ASP	B	380	21.766	−37.495	110.080	1.00	26.69	C
ATOM	6383	CB	ASP	B	380	22.405	−38.832	109.705	1.00	26.94	C
ATOM	6384	CG	ASP	B	380	22.343	−39.827	110.839	1.00	28.24	C
ATOM	6385	OD1	ASP	B	380	21.298	−39.835	111.542	1.00	30.15	O
ATOM	6386	OD2	ASP	B	380	23.277	−40.623	111.118	1.00	29.59	O
ATOM	6387	C	ASP	B	380	22.712	−36.705	110.954	1.00	26.83	C
ATOM	6388	O	ASP	B	380	23.650	−36.068	110.455	1.00	26.94	O
ATOM	6393	N	LEU	B	381	22.448	−36.772	112.259	1.00	26.95	N
ATOM	6394	CA	LEU	B	381	23.122	−35.958	113.272	1.00	26.72	C
ATOM	6395	CB	LEU	B	381	22.480	−36.172	114.648	1.00	26.90	C
ATOM	6396	CG	LEU	B	381	21.569	−35.075	115.200	1.00	26.71	C
ATOM	6397	CD1	LEU	B	381	20.429	−34.799	114.274	1.00	26.78	C
ATOM	6398	CD2	LEU	B	381	21.046	−35.500	116.557	1.00	26.73	C
ATOM	6399	C	LEU	B	381	24.578	−36.325	113.369	1.00	26.82	C
ATOM	6400	O	LEU	B	381	25.409	−35.482	113.693	1.00	26.46	O
ATOM	6412	N	LYS	B	382	24.856	−37.600	113.095	1.00	27.09	N
ATOM	6413	CA	LYS	B	382	26.202	−38.181	113.120	1.00	27.16	C
ATOM	6414	CB	LYS	B	382	26.148	−39.644	112.593	1.00	27.31	C
ATOM	6415	CG	LYS	B	382	27.392	−40.181	111.841	1.00	27.83	C
ATOM	6416	CD	LYS	B	382	27.058	−41.351	110.886	1.00	28.33	C
ATOM	6417	CE	LYS	B	382	27.868	−41.262	109.580	1.00	28.67	C
ATOM	6418	NZ	LYS	B	382	27.961	−42.547	108.823	1.00	28.78	N
ATOM	6419	C	LYS	B	382	27.274	−37.343	112.395	1.00	27.03	C
ATOM	6420	O	LYS	B	382	28.462	−37.489	112.704	1.00	27.15	O
ATOM	6434	N	PHE	B	383	26.890	−36.473	111.453	1.00	26.97	N
ATOM	6435	CA	PHE	B	383	27.896	−35.577	110.852	1.00	27.01	C
ATOM	6436	CB	PHE	B	383	28.407	−36.026	109.448	1.00	27.55	C
ATOM	6437	CG	PHE	B	383	27.382	−36.673	108.549	1.00	28.72	C
ATOM	6438	CD1	PHE	B	383	27.171	−36.165	107.274	1.00	31.72	C
ATOM	6439	CE1	PHE	B	383	26.254	−36.770	106.405	1.00	33.05	C
ATOM	6440	CZ	PHE	B	383	25.570	−37.921	106.823	1.00	32.42	C
ATOM	6441	CE2	PHE	B	383	25.807	−38.445	108.081	1.00	30.18	C
ATOM	6442	CD2	PHE	B	383	26.715	−37.833	108.924	1.00	29.87	C
ATOM	6443	C	PHE	B	383	27.628	−34.066	110.909	1.00	25.92	C
ATOM	6444	O	PHE	B	383	27.923	−33.341	109.971	1.00	25.81	O
ATOM	6454	N	LEU	B	384	27.142	−33.605	112.053	1.00	25.16	N
ATOM	6455	CA	LEU	B	384	27.258	−32.203	112.432	1.00	24.71	C
ATOM	6456	CB	LEU	B	384	25.883	−31.556	112.525	1.00	24.63	C
ATOM	6457	CG	LEU	B	384	25.175	−31.470	111.167	1.00	24.97	C
ATOM	6458	CD1	LEU	B	384	23.750	−31.977	111.293	1.00	25.36	C
ATOM	6459	CD2	LEU	B	384	25.221	−30.069	110.545	1.00	24.62	C
ATOM	6460	C	LEU	B	384	27.989	−32.078	113.761	1.00	24.36	C
ATOM	6461	O	LEU	B	384	28.133	−33.037	114.506	1.00	24.77	O
ATOM	6473	N	ASN	B	385	28.475	−30.885	114.045	1.00	23.95	N
ATOM	6474	CA	ASN	B	385	29.093	−30.605	115.316	1.00	23.43	C
ATOM	6475	CB	ASN	B	385	29.884	−29.303	115.241	1.00	23.49	C
ATOM	6476	CG	ASN	B	385	30.973	−29.334	114.180	1.00	24.09	C
ATOM	6477	OD1	ASN	B	385	31.633	−30.484	114.029	1.00	24.69	O
ATOM	6478	ND2	ASN	B	385	31.221	−28.333	113.506	1.00	24.86	N
ATOM	6479	C	ASN	B	385	28.022	−30.496	116.375	1.00	23.20	C
ATOM	6480	O	ASN	B	385	28.058	−31.206	117.374	1.00	23.23	O
ATOM	6487	N	ASN	B	386	27.062	−29.608	116.136	1.00	23.03	N
ATOM	6488	CA	ASN	B	386	26.027	−29.285	117.108	1.00	23.15	C
ATOM	6489	CB	ASN	B	386	25.682	−27.788	117.053	1.00	23.30	C
ATOM	6490	CG	ASN	B	386	24.910	−27.309	118.284	1.00	23.81	C
ATOM	6491	OD1	ASN	B	386	24.112	−28.039	118.844	1.00	24.01	O
ATOM	6492	ND2	ASN	B	386	25.166	−26.075	118.711	1.00	25.49	N
ATOM	6493	C	ASN	B	386	24.778	−30.117	116.905	1.00	23.00	C
ATOM	6494	O	ASN	B	386	23.776	−29.634	116.404	1.00	23.29	O
ATOM	6501	N	HIS	B	387	24.852	−31.370	117.335	1.00	23.13	N
ATOM	6502	CA	HIS	B	387	23.706	−32.273	117.380	1.00	23.03	C
ATOM	6503	CB	HIS	B	387	24.101	−33.593	118.061	1.00	23.23	C
ATOM	6504	CG	HIS	B	387	25.414	−34.141	117.607	1.00	23.26	C
ATOM	6505	ND1	HIS	B	387	25.677	−34.451	116.291	1.00	24.07	N
ATOM	6506	CE1	HIS	B	387	26.913	−34.906	116.186	1.00	23.05	C
ATOM	6507	NE2	HIS	B	387	27.468	−34.876	117.380	1.00	23.67	N
ATOM	6508	CD2	HIS	B	387	26.551	−34.403	118.289	1.00	24.20	C
ATOM	6509	C	HIS	B	387	22.518	−31.690	118.145	1.00	22.88	C
ATOM	6510	O	HIS	B	387	21.380	−32.006	117.847	1.00	23.07	O
ATOM	6519	N	ILE	B	388	22.775	−30.863	119.148	1.00	22.86	N
ATOM	6520	CA	ILE	B	388	21.705	−30.440	120.047	1.00	23.14	C
ATOM	6521	CB	ILE	B	388	22.279	−29.988	121.461	1.00	23.40	C
ATOM	6522	CG1	ILE	B	388	21.158	−29.728	122.464	1.00	23.09	C
ATOM	6523	CD1	ILE	B	388	21.612	−29.788	123.872	1.00	23.90	C
ATOM	6524	CG2	ILE	B	388	23.186	−28.765	121.379	1.00	24.25	C
ATOM	6525	C	ILE	B	388	20.742	−29.434	119.385	1.00	23.07	C
ATOM	6526	O	ILE	B	388	19.525	−29.619	119.424	1.00	22.78	O
ATOM	6538	N	LEU	B	389	21.278	−28.415	118.730	1.00	23.05	N
ATOM	6539	CA	LEU	B	389	20.436	−27.420	118.063	1.00	23.18	C
ATOM	6540	CB	LEU	B	389	21.264	−26.242	117.534	1.00	23.08	C
ATOM	6541	CG	LEU	B	389	21.149	−24.909	118.281	1.00	23.42	C
ATOM	6542	CD1	LEU	B	389	21.217	−25.086	119.795	1.00	23.09	C
ATOM	6543	CD2	LEU	B	389	22.246	−23.946	117.801	1.00	24.17	C
ATOM	6544	C	LEU	B	389	19.696	−28.052	116.911	1.00	23.20	C
ATOM	6545	O	LEU	B	389	18.552	−27.715	116.643	1.00	23.38	O
ATOM	6557	N	VAL	B	390	20.374	−28.964	116.228	1.00	23.24	N
ATOM	6558	CA	VAL	B	390	19.841	−29.618	115.046	1.00	23.18	C
ATOM	6559	CB	VAL	B	390	20.968	−30.338	114.302	1.00	23.10	C
ATOM	6560	CG1	VAL	B	390	20.417	−31.332	113.284	1.00	23.45	C
ATOM	6561	CG2	VAL	B	390	21.887	−29.292	113.639	1.00	23.10	C
ATOM	6562	C	VAL	B	390	18.733	−30.595	115.395	1.00	23.39	C
ATOM	6563	O	VAL	B	390	17.710	−30.615	114.744	1.00	23.16	O
ATOM	6573	N	LYS	B	391	18.958	−31.404	116.422	1.00	24.08	N
ATOM	6574	CA	LYS	B	391	17.966	−32.347	116.918	1.00	24.62	C
ATOM	6575	CB	LYS	B	391	18.548	−33.125	118.087	1.00	24.73	C
ATOM	6576	CG	LYS	B	391	17.776	−34.377	118.453	1.00	25.84	C
ATOM	6577	CD	LYS	B	391	18.317	−34.982	119.760	1.00	26.49	C
ATOM	6578	CE	LYS	B	391	17.519	−34.555	121.015	1.00	26.94	C
ATOM	6579	NZ	LYS	B	391	17.125	−35.746	121.827	1.00	26.96	N
ATOM	6580	C	LYS	B	391	16.687	−31.625	117.346	1.00	24.82	C
ATOM	6581	O	LYS	B	391	15.599	−32.005	116.930	1.00	24.88	O
ATOM	6595	N	ASP	B	392	16.836	−30.588	118.175	1.00	25.21	N
ATOM	6596	CA	ASP	B	392	15.739	−29.671	118.548	1.00	25.44	C
ATOM	6597	CB	ASP	B	392	16.291	−28.502	119.394	1.00	25.44	C
ATOM	6598	CG	ASP	B	392	15.306	−27.327	119.528	1.00	25.66	C
ATOM	6599	OD1	ASP	B	392	14.331	−27.446	120.301	1.00	27.05	O
ATOM	6600	OD2	ASP	B	392	15.435	−26.240	118.917	1.00	25.54	O
ATOM	6601	C	ASP	B	392	14.979	−29.139	117.315	1.00	25.52	C
ATOM	6602	O	ASP	B	392	13.748	−29.162	117.286	1.00	26.32	O
ATOM	6607	N	ALA	B	393	15.721	−28.677	116.305	1.00	25.09	N
ATOM	6608	CA	ALA	B	393	15.147	−28.181	115.061	1.00	24.72	C
ATOM	6609	CB	ALA	B	393	16.229	−27.571	114.188	1.00	24.90	C
ATOM	6610	C	ALA	B	393	14.403	−29.263	114.280	1.00	24.18	C
ATOM	6611	O	ALA	B	393	13.329	−29.003	113.752	1.00	24.12	O
ATOM	6617	N	GLN	B	394	14.995	−30.456	114.201	1.00	23.48	N
ATOM	6618	CA	GLN	B	394	14.409	−31.598	113.497	1.00	23.18	C
ATOM	6619	CB	GLN	B	394	15.394	−32.791	113.483	1.00	22.91	C
ATOM	6620	CG	GLN	B	394	16.508	−32.706	112.433	1.00	22.04	C
ATOM	6621	CD	GLN	B	394	17.537	−33.848	112.487	1.00	21.23	C
ATOM	6622	OE1	GLN	B	394	17.528	−34.668	113.397	1.00	21.48	O
ATOM	6623	NE2	GLN	B	394	18.424	−33.887	111.501	1.00	20.15	N
ATOM	6624	C	GLN	B	394	13.095	−32.017	114.176	1.00	23.38	C
ATOM	6625	O	GLN	B	394	12.052	−32.172	113.531	1.00	23.34	O
ATOM	6634	N	GLU	B	395	13.168	−32.166	115.493	1.00	23.47	N
ATOM	6635	CA	GLU	B	395	12.030	−32.546	116.316	1.00	23.62	C
ATOM	6636	CB	GLU	B	395	12.510	−32.778	117.762	1.00	23.68	C
ATOM	6637	CG	GLU	B	395	13.409	−34.001	117.884	1.00	24.92	C
ATOM	6638	CD	GLU	B	395	14.178	−34.109	119.203	1.00	27.89	C
ATOM	6639	OE1	GLU	B	395	14.335	−33.091	119.941	1.00	29.21	O
ATOM	6640	OE2	GLU	B	395	14.642	−35.241	119.493	1.00	27.49	O
ATOM	6641	C	GLU	B	395	10.894	−31.511	116.280	1.00	23.16	C
ATOM	6642	O	GLU	B	395	9.734	−31.868	116.154	1.00	22.93	O
ATOM	6649	N	LYS	B	396	11.238	−30.237	116.393	1.00	23.08	N
ATOM	6650	CA	LYS	B	396	10.244	−29.170	116.355	1.00	23.50	C
ATOM	6651	CB	LYS	B	396	10.914	−27.816	116.625	1.00	23.66	C
ATOM	6652	CG	LYS	B	396	11.014	−27.457	118.083	1.00	24.10	C
ATOM	6653	CD	LYS	B	396	12.056	−26.372	118.335	1.00	25.74	C
ATOM	6654	CE	LYS	B	396	11.478	−24.958	118.345	1.00	26.64	C
ATOM	6655	NZ	LYS	B	396	12.356	−24.037	119.166	1.00	26.34	N
ATOM	6656	C	LYS	B	396	9.459	−29.088	115.021	1.00	23.19	C
ATOM	6657	O	LYS	B	396	8.248	−28.881	115.023	1.00	23.10	O
ATOM	6671	N	ALA	B	397	10.168	−29.223	113.897	1.00	23.00	N
ATOM	6672	CA	ALA	B	397	9.568	−29.128	112.561	1.00	22.47	C
ATOM	6673	CB	ALA	B	397	10.649	−28.963	111.498	1.00	22.10	C
ATOM	6674	C	ALA	B	397	8.689	−30.336	112.245	1.00	22.41	C
ATOM	6675	O	ALA	B	397	7.653	−30.208	111.617	1.00	21.88	O
ATOM	6681	N	ASN	B	398	9.127	−31.511	112.670	1.00	22.66	N
ATOM	6682	CA	ASN	B	398	8.338	−32.718	112.539	1.00	23.18	C
ATOM	6683	CB	ASN	B	398	9.231	−33.904	112.890	1.00	23.88	C
ATOM	6684	CG	ASN	B	398	8.564	−35.231	112.689	1.00	26.26	C
ATOM	6685	OD1	ASN	B	398	7.609	−35.553	113.559	1.00	31.29	O
ATOM	6686	ND2	ASN	B	398	8.922	−35.987	111.780	1.00	29.41	N
ATOM	6687	C	ASN	B	398	7.088	−32.636	113.446	1.00	22.52	C
ATOM	6688	O	ASN	B	398	5.996	−33.031	113.045	1.00	22.40	O
ATOM	6695	N	ALA	B	399	7.243	−32.079	114.646	1.00	22.04	N
ATOM	6696	CA	ALA	B	399	6.117	−31.903	115.561	1.00	21.71	C
ATOM	6697	CB	ALA	B	399	6.609	−31.600	116.967	1.00	21.86	C
ATOM	6698	C	ALA	B	399	5.153	−30.814	115.097	1.00	21.68	C
ATOM	6699	O	ALA	B	399	3.955	−30.965	115.230	1.00	21.61	O
ATOM	6705	N	ALA	B	400	5.676	−29.720	114.551	1.00	21.65	N
ATOM	6706	CA	ALA	B	400	4.846	−28.622	114.034	1.00	21.60	C
ATOM	6707	CB	ALA	B	400	5.722	−27.425	113.605	1.00	22.00	C
ATOM	6708	C	ALA	B	400	3.971	−29.065	112.872	1.00	21.44	C
ATOM	6709	O	ALA	B	400	2.784	−28.735	112.808	1.00	20.65	O
ATOM	6715	N	LEU	B	401	4.568	−29.812	111.952	1.00	21.36	N
ATOM	6716	CA	LEU	B	401	3.838	−30.338	110.804	1.00	21.80	C
ATOM	6717	CB	LEU	B	401	4.789	−30.966	109.780	1.00	21.64	C
ATOM	6718	CG	LEU	B	401	4.116	−31.348	108.460	1.00	22.07	C
ATOM	6719	CD1	LEU	B	401	3.762	−30.114	107.614	1.00	22.71	C
ATOM	6720	CD2	LEU	B	401	4.985	−32.325	107.679	1.00	22.26	C
ATOM	6721	C	LEU	B	401	2.786	−31.353	111.231	1.00	21.48	C
ATOM	6722	O	LEU	B	401	1.656	−31.295	110.769	1.00	21.87	O
ATOM	6734	N	LEU	B	402	3.139	−32.271	112.117	1.00	21.42	N
ATOM	6735	CA	LEU	B	402	2.172	−33.271	112.527	1.00	21.58	C
ATOM	6736	CB	LEU	B	402	2.776	−34.299	113.512	1.00	21.77	C
ATOM	6737	CG	LEU	B	402	1.825	−35.348	114.146	1.00	21.18	C
ATOM	6738	CD1	LEU	B	402	1.328	−36.362	113.143	1.00	21.50	C
ATOM	6739	CD2	LEU	B	402	2.484	−36.064	115.270	1.00	19.93	C
ATOM	6740	C	LEU	B	402	0.973	−32.557	113.132	1.00	21.32	C
ATOM	6741	O	LEU	B	402	−0.149	−32.804	112.735	1.00	21.16	O
ATOM	6753	N	ASP	B	403	1.232	−31.663	114.079	1.00	21.07	N
ATOM	6754	CA	ASP	B	403	0.181	−30.930	114.763	1.00	21.02	C
ATOM	6755	CB	ASP	B	403	0.774	−29.940	115.763	1.00	21.36	C
ATOM	6756	CG	ASP	B	403	−0.294	−29.222	116.564	1.00	22.91	C
ATOM	6757	OD1	ASP	B	403	−0.742	−28.135	116.137	1.00	25.78	O
ATOM	6758	OD2	ASP	B	403	−0.765	−29.670	117.630	1.00	25.66	O
ATOM	6759	C	ASP	B	403	−0.686	−30.175	113.772	1.00	20.33	C
ATOM	6760	O	ASP	B	403	−1.914	−30.243	113.806	1.00	20.42	O
ATOM	6765	N	TYR	B	404	−0.024	−29.465	112.884	1.00	19.56	N
ATOM	6766	CA	TYR	B	404	−0.702	−28.596	111.963	1.00	19.32	C
ATOM	6767	CB	TYR	B	404	0.300	−27.758	111.114	1.00	18.97	C
ATOM	6768	CG	TYR	B	404	−0.423	−26.955	110.067	1.00	17.95	C
ATOM	6769	CD1	TYR	B	404	−1.013	−25.737	110.388	1.00	16.65	C
ATOM	6770	CE1	TYR	B	404	−1.738	−25.019	109.425	1.00	16.18	C
ATOM	6771	CZ	TYR	B	404	−1.881	−25.534	108.148	1.00	15.09	C
ATOM	6772	OH	TYR	B	404	−2.589	−24.821	107.207	1.00	14.54	O
ATOM	6773	CE2	TYR	B	404	−1.314	−26.751	107.827	1.00	15.16	C
ATOM	6774	CD2	TYR	B	404	−0.602	−27.452	108.777	1.00	14.95	C
ATOM	6775	C	TYR	B	404	−1.645	−29.424	111.091	1.00	19.08	C
ATOM	6776	O	TYR	B	404	−2.800	−29.079	110.940	1.00	18.67	O
ATOM	6786	N	THR	B	405	−1.153	−30.526	110.540	1.00	19.41	N
ATOM	6787	CA	THR	B	405	−1.936	−31.303	109.577	1.00	19.66	C
ATOM	6788	CB	THR	B	405	−1.078	−32.365	108.829	1.00	19.37	C
ATOM	6789	OG1	THR	B	405	−0.309	−33.155	109.748	1.00	20.23	O
ATOM	6790	CG2	THR	B	405	−0.039	−31.699	107.991	1.00	19.49	C
ATOM	6791	C	THR	B	405	−3.166	−31.947	110.217	1.00	19.90	C
ATOM	6792	O	THR	B	405	−4.242	−31.978	109.625	1.00	19.53	O
ATOM	6800	N	LEU	B	406	−3.038	−32.454	111.429	1.00	20.50	N
ATOM	6801	CA	LEU	B	406	−4.206	−33.104	112.015	1.00	21.01	C
ATOM	6802	CB	LEU	B	406	−3.840	−34.319	112.878	1.00	21.44	C
ATOM	6803	CG	LEU	B	406	−3.152	−34.324	114.237	1.00	21.95	C
ATOM	6804	CD1	LEU	B	406	−2.159	−35.471	114.248	1.00	22.14	C
ATOM	6805	CD2	LEU	B	406	−2.497	−33.048	114.606	1.00	23.36	C
ATOM	6806	C	LEU	B	406	−5.172	−32.158	112.674	1.00	20.62	C
ATOM	6807	O	LEU	B	406	−6.318	−32.505	112.835	1.00	20.88	O
ATOM	6819	N	CYS	B	407	−4.734	−30.939	112.983	1.00	21.02	N
ATOM	6820	CA	CYS	B	407	−5.629	−29.918	113.533	1.00	21.06	C
ATOM	6821	CB	CYS	B	407	−4.862	−28.866	114.346	1.00	21.54	C
ATOM	6822	SG	CYS	B	407	−4.329	−29.426	116.000	1.00	25.17	S
ATOM	6823	C	CYS	B	407	−6.384	−29.216	112.435	1.00	20.23	C
ATOM	6824	O	CYS	B	407	−7.530	−28.847	112.628	1.00	19.72	O
ATOM	6830	N	HIS	B	408	−5.728	−29.015	111.292	1.00	20.11	N
ATOM	6831	CA	HIS	B	408	−6.307	−28.271	110.162	1.00	19.76	C
ATOM	6832	CB	HIS	B	408	−5.253	−27.361	109.528	1.00	19.87	C
ATOM	6833	CG	HIS	B	408	−5.058	−26.078	110.258	1.00	20.31	C
ATOM	6834	ND1	HIS	B	408	−5.567	−24.884	109.803	1.00	22.45	N
ATOM	6835	CE1	HIS	B	408	−5.252	−23.921	110.652	1.00	23.12	C
ATOM	6836	NE2	HIS	B	408	−4.560	−24.450	111.646	1.00	22.32	N
ATOM	6837	CD2	HIS	B	408	−4.423	−25.799	111.420	1.00	22.36	C
ATOM	6838	C	HIS	B	408	−6.928	−29.168	109.084	1.00	19.20	C
ATOM	6839	O	HIS	B	408	−7.720	−28.697	108.258	1.00	18.68	O
ATOM	6848	N	TYR	B	409	−6.554	−30.444	109.085	1.00	18.81	N
ATOM	6849	CA	TYR	B	409	−7.075	−31.413	108.120	1.00	18.74	C
ATOM	6850	CB	TYR	B	409	−6.096	−31.618	106.946	1.00	18.84	C
ATOM	6851	CG	TYR	B	409	−5.734	−30.338	106.199	1.00	19.99	C
ATOM	6852	CD1	TYR	B	409	−4.689	−29.501	106.647	1.00	19.57	C
ATOM	6853	CE1	TYR	B	409	−4.368	−28.326	105.974	1.00	19.09	C
ATOM	6854	CZ	TYR	B	409	−5.085	−27.970	104.845	1.00	19.76	C
ATOM	6855	OH	TYR	B	409	−4.780	−26.821	104.167	1.00	20.38	O
ATOM	6856	CE2	TYR	B	409	−6.113	−28.786	104.368	1.00	20.83	C
ATOM	6857	CD2	TYR	B	409	−6.432	−29.960	105.046	1.00	20.35	C
ATOM	6858	C	TYR	B	409	−7.328	−32.728	108.851	1.00	18.24	C
ATOM	6859	O	TYR	B	409	−6.709	−33.748	108.532	1.00	17.30	O
ATOM	6869	N	PRO	B	410	−8.225	−32.698	109.839	1.00	18.31	N
ATOM	6870	CA	PRO	B	410	−8.457	−33.860	110.712	1.00	18.54	C
ATOM	6871	CB	PRO	B	410	−9.461	−33.331	111.754	1.00	18.58	C
ATOM	6872	CG	PRO	B	410	−10.159	−32.187	111.087	1.00	18.74	C
ATOM	6873	CD	PRO	B	410	−9.098	−31.565	110.208	1.00	18.41	C
ATOM	6874	C	PRO	B	410	−9.033	−35.075	109.982	1.00	18.41	C
ATOM	6875	O	PRO	B	410	−8.958	−36.187	110.503	1.00	18.32	O
ATOM	6883	N	HIS	B	411	−9.585	−34.856	108.796	1.00	18.30	N
ATOM	6884	CA	HIS	B	411	−10.212	−35.918	108.038	1.00	18.54	C
ATOM	6885	CB	HIS	B	411	−11.488	−35.386	107.412	1.00	18.24	C
ATOM	6886	CG	HIS	B	411	−12.570	−35.143	108.402	1.00	16.79	C
ATOM	6887	ND1	HIS	B	411	−13.419	−34.068	108.322	1.00	15.46	N
ATOM	6888	CE1	HIS	B	411	−14.282	−34.120	109.317	1.00	17.37	C
ATOM	6889	NE2	HIS	B	411	−14.016	−35.186	110.046	1.00	17.99	N
ATOM	6890	CD2	HIS	B	411	−12.946	−35.842	109.493	1.00	16.72	C
ATOM	6891	C	HIS	B	411	−9.306	−36.527	106.974	1.00	19.31	C
ATOM	6892	O	HIS	B	411	−9.725	−37.418	106.241	1.00	19.35	O
ATOM	6901	N	SER	B	412	−8.078	−36.026	106.868	1.00	20.42	N
ATOM	6902	CA	SER	B	412	−6.981	−36.798	106.263	1.00	21.12	C
ATOM	6903	CB	SER	B	412	−6.277	−36.034	105.122	1.00	21.16	C
ATOM	6904	OG	SER	B	412	−6.639	−34.668	105.044	1.00	21.16	O
ATOM	6905	C	SER	B	412	−6.000	−37.214	107.382	1.00	21.39	C
ATOM	6906	O	SER	B	412	−5.051	−36.497	107.691	1.00	21.39	O
ATOM	6912	N	GLY	B	413	−6.254	−38.375	107.990	1.00	21.90	N
ATOM	6913	CA	GLY	B	413	−5.530	−38.799	109.183	1.00	22.37	C
ATOM	6914	C	GLY	B	413	−4.092	−39.228	108.927	1.00	22.44	C
ATOM	6915	O	GLY	B	413	−3.331	−39.513	109.857	1.00	22.29	O
ATOM	6919	N	ASP	B	414	−3.733	−39.253	107.648	1.00	22.70	N
ATOM	6920	CA	ASP	B	414	−2.446	−39.725	107.169	1.00	22.79	C
ATOM	6921	CB	ASP	B	414	−2.708	−40.861	106.184	1.00	23.34	C
ATOM	6922	CG	ASP	B	414	−1.904	−42.081	106.492	1.00	25.72	C
ATOM	6923	OD1	ASP	B	414	−0.677	−41.927	106.757	1.00	25.79	O
ATOM	6924	OD2	ASP	B	414	−2.442	−43.233	106.503	1.00	30.96	O
ATOM	6925	C	ASP	B	414	−1.648	−38.652	106.449	1.00	21.59	C
ATOM	6926	O	ASP	B	414	−0.622	−38.947	105.869	1.00	20.93	O
ATOM	6931	N	LYS	B	415	−2.131	−37.419	106.484	1.00	20.94	N
ATOM	6932	CA	LYS	B	415	−1.593	−36.366	105.650	1.00	20.82	C
ATOM	6933	CB	LYS	B	415	−2.384	−35.063	105.855	1.00	20.88	C
ATOM	6934	CG	LYS	B	415	−1.814	−33.818	105.138	1.00	22.14	C
ATOM	6935	CD	LYS	B	415	−2.731	−33.229	104.066	1.00	23.16	C
ATOM	6936	CE	LYS	B	415	−3.147	−31.794	104.345	1.00	22.70	C
ATOM	6937	NZ	LYS	B	415	−2.831	−30.825	103.256	1.00	20.39	N
ATOM	6938	C	LYS	B	415	−0.106	−36.169	105.960	1.00	20.56	C
ATOM	6939	O	LYS	B	415	0.697	−36.004	105.064	1.00	19.34	O
ATOM	6953	N	PHE	B	416	0.233	−36.195	107.242	1.00	20.78	N
ATOM	6954	CA	PHE	B	416	1.593	−35.999	107.695	1.00	20.83	C
ATOM	6955	CB	PHE	B	416	1.650	−36.191	109.204	1.00	20.97	C
ATOM	6956	CG	PHE	B	416	3.024	−36.143	109.759	1.00	20.30	C
ATOM	6957	CD1	PHE	B	416	3.746	−34.967	109.729	1.00	20.06	C
ATOM	6958	CE1	PHE	B	416	5.024	−34.907	110.229	1.00	21.54	C
ATOM	6959	CZ	PHE	B	416	5.595	−36.043	110.790	1.00	24.11	C
ATOM	6960	CE2	PHE	B	416	4.871	−37.236	110.833	1.00	22.95	C
ATOM	6961	CD2	PHE	B	416	3.598	−37.276	110.308	1.00	21.71	C
ATOM	6962	C	PHE	B	416	2.523	−37.002	107.041	1.00	21.35	C
ATOM	6963	O	PHE	B	416	3.546	−36.634	106.474	1.00	20.47	O
ATOM	6973	N	GLN	B	417	2.159	−38.275	107.135	1.00	21.61	N
ATOM	6974	CA	GLN	B	417	2.978	−39.329	106.555	1.00	22.38	C
ATOM	6975	CB	GLN	B	417	2.482	−40.713	106.983	1.00	22.46	C
ATOM	6976	CG	GLN	B	417	3.524	−41.511	107.759	1.00	25.00	C
ATOM	6977	CD	GLN	B	417	3.746	−41.019	109.213	1.00	27.27	C
ATOM	6978	OE1	GLN	B	417	2.998	−41.407	110.138	1.00	26.95	O
ATOM	6979	NE2	GLN	B	417	4.784	−40.187	109.412	1.00	26.51	N
ATOM	6980	C	GLN	B	417	3.052	−39.255	105.030	1.00	22.54	C
ATOM	6981	O	GLN	B	417	4.107	−39.500	104.446	1.00	23.17	O
ATOM	6990	N	GLN	B	418	1.932	−38.942	104.385	1.00	22.40	N
ATOM	6991	CA	GLN	B	418	1.885	−38.827	102.931	1.00	22.19	C
ATOM	6992	CB	GLN	B	418	0.435	−38.629	102.464	1.00	22.16	C
ATOM	6993	CG	GLN	B	418	−0.476	−39.856	102.700	1.00	24.07	C
ATOM	6994	CD	GLN	B	418	0.136	−41.194	102.215	1.00	27.05	C
ATOM	6995	OE1	GLN	B	418	0.512	−41.327	101.032	1.00	28.99	O
ATOM	6996	NE2	GLN	B	418	0.220	−42.185	103.121	1.00	26.31	N
ATOM	6997	C	GLN	B	418	2.784	−37.688	102.443	1.00	21.63	C
ATOM	6998	O	GLN	B	418	3.389	−37.780	101.402	1.00	21.00	O
ATOM	7007	N	LEU	B	419	2.879	−36.630	103.230	1.00	21.62	N
ATOM	7008	CA	LEU	B	419	3.716	−35.480	102.899	1.00	21.95	C
ATOM	7009	CB	LEU	B	419	3.324	−34.260	103.755	1.00	21.35	C
ATOM	7010	CG	LEU	B	419	2.034	−33.521	103.379	1.00	20.69	C
ATOM	7011	CD1	LEU	B	419	1.764	−32.388	104.401	1.00	20.62	C
ATOM	7012	CD2	LEU	B	419	2.085	−32.968	101.955	1.00	19.91	C
ATOM	7013	C	LEU	B	419	5.207	−35.808	103.055	1.00	22.13	C
ATOM	7014	O	LEU	B	419	6.030	−35.384	102.249	1.00	22.28	O
ATOM	7026	N	LEU	B	420	5.540	−36.552	104.099	1.00	22.38	N
ATOM	7027	CA	LEU	B	420	6.895	−37.028	104.301	1.00	22.58	C
ATOM	7028	CB	LEU	B	420	7.008	−37.730	105.650	1.00	22.77	C
ATOM	7029	CG	LEU	B	420	6.987	−36.848	106.898	1.00	22.87	C
ATOM	7030	CD1	LEU	B	420	7.395	−37.687	108.084	1.00	22.76	C
ATOM	7031	CD2	LEU	B	420	7.888	−35.606	106.768	1.00	22.43	C
ATOM	7032	C	LEU	B	420	7.328	−37.983	103.195	1.00	22.86	C
ATOM	7033	O	LEU	B	420	8.488	−37.985	102.809	1.00	23.16	O
ATOM	7045	N	LEU	B	421	6.401	−38.800	102.694	1.00	22.70	N
ATOM	7046	CA	LEU	B	421	6.693	−39.703	101.584	1.00	22.68	C
ATOM	7047	CB	LEU	B	421	5.518	−40.669	101.379	1.00	22.74	C
ATOM	7048	CG	LEU	B	421	5.511	−41.608	100.162	1.00	23.68	C
ATOM	7049	CD1	LEU	B	421	6.720	−42.543	100.190	1.00	24.19	C
ATOM	7050	CD2	LEU	B	421	4.208	−42.439	100.090	1.00	23.40	C
ATOM	7051	C	LEU	B	421	7.012	−38.893	100.306	1.00	22.82	C
ATOM	7052	O	LEU	B	421	7.884	−39.256	99.506	1.00	22.49	O
ATOM	7064	N	CYS	B	422	6.320	−37.773	100.137	1.00	22.82	N
ATOM	7065	CA	CYS	B	422	6.593	−36.874	99.027	1.00	22.67	C
ATOM	7066	CB	CYS	B	422	5.595	−35.716	99.018	1.00	22.94	C
ATOM	7067	SG	CYS	B	422	3.923	−36.151	98.517	1.00	20.83	S
ATOM	7068	C	CYS	B	422	8.024	−36.332	99.079	1.00	22.51	C
ATOM	7069	O	CYS	B	422	8.622	−36.081	98.050	1.00	22.33	O
ATOM	7075	N	LEU	B	423	8.532	−36.136	100.288	1.00	22.32	N
ATOM	7076	CA	LEU	B	423	9.907	−35.736	100.517	1.00	22.50	C
ATOM	7077	CB	LEU	B	423	10.120	−35.401	101.998	1.00	22.66	C
ATOM	7078	CG	LEU	B	423	10.104	−33.929	102.403	1.00	23.93	C
ATOM	7079	CD1	LEU	B	423	9.182	−33.051	101.514	1.00	25.23	C
ATOM	7080	CD2	LEU	B	423	9.770	−33.770	103.879	1.00	23.91	C
ATOM	7081	C	LEU	B	423	10.894	−36.821	100.074	1.00	22.59	C
ATOM	7082	O	LEU	B	423	11.970	−36.511	99.575	1.00	22.73	O
ATOM	7094	N	VAL	B	424	10.532	−38.086	100.232	1.00	22.19	N
ATOM	7095	CA	VAL	B	424	11.363	−39.169	99.732	1.00	22.31	C
ATOM	7096	CB	VAL	B	424	10.786	−40.558	100.100	1.00	22.12	C
ATOM	7097	CG1	VAL	B	424	11.561	−41.678	99.434	1.00	22.07	C
ATOM	7098	CG2	VAL	B	424	10.785	−40.769	101.612	1.00	22.49	C
ATOM	7099	C	VAL	B	424	11.495	−39.020	98.215	1.00	22.77	C
ATOM	7100	O	VAL	B	424	12.580	−39.155	97.648	1.00	22.70	O
ATOM	7110	N	GLU	B	425	10.379	−38.708	97.574	1.00	23.11	N
ATOM	7111	CA	GLU	B	425	10.335	−38.580	96.138	1.00	23.64	C
ATOM	7112	CB	GLU	B	425	8.874	−38.558	95.626	1.00	24.51	C
ATOM	7113	CG	GLU	B	425	8.692	−38.352	94.103	1.00	27.05	C
ATOM	7114	CD	GLU	B	425	9.340	−39.443	93.216	1.00	30.11	C
ATOM	7115	OE1	GLU	B	425	9.811	−40.489	93.741	1.00	31.04	O
ATOM	7116	OE2	GLU	B	425	9.383	−39.252	91.972	1.00	31.28	O
ATOM	7117	C	GLU	B	425	11.090	−37.362	95.674	1.00	22.54	C
ATOM	7118	O	GLU	B	425	11.609	−37.375	94.593	1.00	22.71	O
ATOM	7125	N	VAL	B	426	11.145	−36.315	96.481	1.00	22.34	N
ATOM	7126	CA	VAL	B	426	11.919	−35.123	96.147	1.00	22.46	C
ATOM	7127	CB	VAL	B	426	11.626	−33.942	97.096	1.00	22.32	C
ATOM	7128	CG1	VAL	B	426	12.675	−32.826	96.968	1.00	21.39	C
ATOM	7129	CG2	VAL	B	426	10.226	−33.409	96.851	1.00	23.48	C
ATOM	7130	C	VAL	B	426	13.405	−35.447	96.189	1.00	22.58	C
ATOM	7131	O	VAL	B	426	14.163	−34.940	95.372	1.00	23.48	O
ATOM	7141	N	ARG	B	427	13.816	−36.286	97.129	1.00	22.61	N
ATOM	7142	CA	ARG	B	427	15.193	−36.762	97.177	1.00	23.27	C
ATOM	7143	CB	ARG	B	427	15.458	−37.517	98.485	1.00	23.29	C
ATOM	7144	CG	ARG	B	427	16.939	−37.668	98.832	1.00	27.00	C
ATOM	7145	CD	ARG	B	427	17.282	−38.927	99.634	1.00	30.09	C
ATOM	7146	NE	ARG	B	427	18.693	−39.019	100.042	1.00	32.26	N
ATOM	7147	CZ	ARG	B	427	19.714	−39.352	99.241	1.00	33.99	C
ATOM	7148	NH1	ARG	B	427	19.516	−39.612	97.948	1.00	35.23	N
ATOM	7149	NH2	ARG	B	427	20.956	−39.407	99.732	1.00	34.24	N
ATOM	7150	C	ARG	B	427	15.575	−37.603	95.919	1.00	22.55	C
ATOM	7151	O	ARG	B	427	16.640	−37.408	95.366	1.00	21.84	O
ATOM	7165	N	ALA	B	428	14.689	−38.488	95.465	1.00	22.27	N
ATOM	7166	CA	ALA	B	428	14.887	−39.271	94.239	1.00	22.31	C
ATOM	7167	CB	ALA	B	428	13.740	−40.261	94.074	1.00	22.19	C
ATOM	7168	C	ALA	B	428	15.006	−38.401	92.969	1.00	22.76	C
ATOM	7169	O	ALA	B	428	15.850	−38.639	92.106	1.00	22.20	O
ATOM	7175	N	LEU	B	429	14.129	−37.403	92.878	1.00	23.53	N
ATOM	7176	CA	LEU	B	429	14.125	−36.412	91.819	1.00	23.79	C
ATOM	7177	CB	LEU	B	429	13.000	−35.408	92.028	1.00	23.98	C
ATOM	7178	CG	LEU	B	429	11.689	−35.789	91.375	1.00	25.98	C
ATOM	7179	CD1	LEU	B	429	10.590	−34.845	91.818	1.00	26.36	C
ATOM	7180	CD2	LEU	B	429	11.870	−35.763	89.852	1.00	28.45	C
ATOM	7181	C	LEU	B	429	15.394	−35.629	91.818	1.00	23.51	C
ATOM	7182	O	LEU	B	429	15.915	−35.309	90.757	1.00	23.86	O
ATOM	7194	N	SER	B	430	15.853	−35.284	93.014	1.00	23.31	N
ATOM	7195	CA	SER	B	430	17.080	−34.512	93.214	1.00	23.04	C
ATOM	7196	CB	SER	B	430	17.259	−34.189	94.674	1.00	22.85	C
ATOM	7197	OG	SER	B	430	16.253	−33.262	94.991	1.00	26.94	O
ATOM	7198	C	SER	B	430	18.313	−35.209	92.749	1.00	22.50	C
ATOM	7199	O	SER	B	430	19.239	−34.564	92.300	1.00	22.33	O
ATOM	7205	N	MET	B	431	18.327	−36.525	92.872	1.00	22.75	N
ATOM	7206	CA	MET	B	431	19.450	−37.310	92.418	1.00	23.05	C
ATOM	7207	CB	MET	B	431	19.480	−38.704	93.055	1.00	23.86	C
ATOM	7208	CG	MET	B	431	19.618	−38.729	94.603	1.00	27.56	C
ATOM	7209	SD	MET	B	431	21.120	−37.925	95.389	1.00	35.11	S
ATOM	7210	CE	MET	B	431	20.084	−36.525	96.354	1.00	32.67	C
ATOM	7211	C	MET	B	431	19.453	−37.370	90.897	1.00	22.10	C
ATOM	7212	O	MET	B	431	20.498	−37.184	90.304	1.00	21.56	O
ATOM	7222	N	GLN	B	432	18.302	−37.587	90.261	1.00	21.51	N
ATOM	7223	CA	GLN	B	432	18.236	−37.563	88.792	1.00	21.34	C
ATOM	7224	CB	GLN	B	432	16.811	−37.783	88.298	1.00	22.12	C
ATOM	7225	CG	GLN	B	432	16.379	−39.214	88.008	1.00	24.82	C
ATOM	7226	CD	GLN	B	432	14.895	−39.261	87.673	1.00	27.87	C
ATOM	7227	OE1	GLN	B	432	14.107	−39.859	88.570	1.00	29.87	O
ATOM	7228	NE2	GLN	B	432	14.460	−38.736	86.622	1.00	30.12	N
ATOM	7229	C	GLN	B	432	18.663	−36.217	88.227	1.00	20.10	C
ATOM	7230	O	GLN	B	432	19.226	−36.145	87.154	1.00	20.01	O
ATOM	7239	N	ALA	B	433	18.305	−35.154	88.926	1.00	19.02	N
ATOM	7240	CA	ALA	B	433	18.659	−33.802	88.546	1.00	18.88	C
ATOM	7241	CB	ALA	B	433	17.923	−32.774	89.432	1.00	18.80	C
ATOM	7242	C	ALA	B	433	20.149	−33.595	88.637	1.00	18.10	C
ATOM	7243	O	ALA	B	433	20.723	−32.985	87.772	1.00	18.11	O
ATOM	7249	N	LYS	B	434	20.762	−34.079	89.708	1.00	17.95	N
ATOM	7250	CA	LYS	B	434	22.208	−34.084	89.842	1.00	17.73	C
ATOM	7251	CB	LYS	B	434	22.616	−34.783	91.134	1.00	18.12	C
ATOM	7252	CG	LYS	B	434	22.520	−33.926	92.368	1.00	20.50	C
ATOM	7253	CD	LYS	B	434	22.868	−34.756	93.584	1.00	23.01	C
ATOM	7254	CE	LYS	B	434	23.195	−33.910	94.765	1.00	25.51	C
ATOM	7255	NZ	LYS	B	434	23.192	−34.712	96.017	1.00	27.93	N
ATOM	7256	C	LYS	B	434	22.887	−34.797	88.685	1.00	16.47	C
ATOM	7257	O	LYS	B	434	23.922	−34.369	88.232	1.00	15.82	O
ATOM	7271	N	GLU	B	435	22.313	−35.902	88.244	1.00	15.85	N
ATOM	7272	CA	GLU	B	435	22.839	−36.657	87.127	1.00	15.85	C
ATOM	7273	CB	GLU	B	435	22.143	−38.009	87.025	1.00	15.55	C
ATOM	7274	CG	GLU	B	435	22.351	−38.843	88.253	1.00	15.98	C
ATOM	7275	CD	GLU	B	435	21.851	−40.243	88.091	1.00	17.57	C
ATOM	7276	OE1	GLU	B	435	21.214	−40.733	88.996	1.00	20.15	O
ATOM	7277	OE2	GLU	B	435	22.141	−40.888	87.082	1.00	23.10	O
ATOM	7278	C	GLU	B	435	22.719	−35.897	85.803	1.00	15.78	C
ATOM	7279	O	GLU	B	435	23.583	−36.028	84.943	1.00	15.95	O
ATOM	7286	N	TYR	B	436	21.659	−35.108	85.660	1.00	16.29	N
ATOM	7287	CA	TYR	B	436	21.477	−34.231	84.514	1.00	16.80	C
ATOM	7288	CB	TYR	B	436	20.115	−33.530	84.574	1.00	16.95	C
ATOM	7289	CG	TYR	B	436	19.949	−32.462	83.512	1.00	17.51	C
ATOM	7290	CD1	TYR	B	436	19.787	−32.797	82.177	1.00	17.21	C
ATOM	7291	CE1	TYR	B	436	19.655	−31.808	81.204	1.00	17.44	C
ATOM	7292	CZ	TYR	B	436	19.691	−30.479	81.564	1.00	15.57	C
ATOM	7293	OH	TYR	B	436	19.578	−29.493	80.622	1.00	11.65	O
ATOM	7294	CE2	TYR	B	436	19.861	−30.136	82.869	1.00	17.56	C
ATOM	7295	CD2	TYR	B	436	19.990	−31.121	83.839	1.00	17.47	C
ATOM	7296	C	TYR	B	436	22.583	−33.194	84.465	1.00	16.61	C
ATOM	7297	O	TYR	B	436	23.205	−32.999	83.440	1.00	15.88	O
ATOM	7307	N	LEU	B	437	22.807	−32.537	85.597	1.00	16.76	N
ATOM	7308	CA	LEU	B	437	23.881	−31.562	85.760	1.00	17.13	C
ATOM	7309	CB	LEU	B	437	23.883	−31.019	87.188	1.00	17.44	C
ATOM	7310	CG	LEU	B	437	22.784	−30.035	87.506	1.00	20.73	C
ATOM	7311	CD1	LEU	B	437	22.836	−29.720	88.995	1.00	23.50	C
ATOM	7312	CD2	LEU	B	437	22.939	−28.764	86.653	1.00	22.47	C
ATOM	7313	C	LEU	B	437	25.259	−32.107	85.490	1.00	16.11	C
ATOM	7314	O	LEU	B	437	26.078	−31.416	84.921	1.00	16.51	O
ATOM	7326	N	TYR	B	438	25.529	−33.323	85.947	1.00	15.30	N
ATOM	7327	CA	TYR	B	438	26.831	−33.948	85.752	1.00	14.80	C
ATOM	7328	CB	TYR	B	438	26.927	−35.233	86.578	1.00	14.49	C
ATOM	7329	CG	TYR	B	438	28.236	−35.957	86.479	1.00	11.52	C
ATOM	7330	CD1	TYR	B	438	29.379	−35.454	87.075	1.00	9.80	C
ATOM	7331	CE1	TYR	B	438	30.584	−36.119	86.988	1.00	8.50	C
ATOM	7332	CZ	TYR	B	438	30.657	−37.314	86.315	1.00	7.69	C
ATOM	7333	OH	TYR	B	438	31.826	−37.989	86.237	1.00	4.74	O
ATOM	7334	CE2	TYR	B	438	29.544	−37.836	85.719	1.00	9.89	C
ATOM	7335	CD2	TYR	B	438	28.329	−37.153	85.807	1.00	10.18	C
ATOM	7336	C	TYR	B	438	27.076	−34.229	84.266	1.00	14.44	C
ATOM	7337	O	TYR	B	438	28.175	−34.005	83.766	1.00	13.05	O
ATOM	7347	N	HIS	B	439	26.036	−34.701	83.583	1.00	14.58	N
ATOM	7348	CA	HIS	B	439	26.062	−34.912	82.132	1.00	15.49	C
ATOM	7349	CB	HIS	B	439	24.714	−35.455	81.637	1.00	15.49	C
ATOM	7350	CG	HIS	B	439	24.567	−35.424	80.153	1.00	16.84	C
ATOM	7351	ND1	HIS	B	439	25.173	−36.345	79.327	1.00	19.78	N
ATOM	7352	CE1	HIS	B	439	24.887	−36.061	78.069	1.00	21.07	C
ATOM	7353	NE2	HIS	B	439	24.120	−34.984	78.050	1.00	20.71	N
ATOM	7354	CD2	HIS	B	439	23.912	−34.562	79.342	1.00	19.48	C
ATOM	7355	C	HIS	B	439	26.404	−33.631	81.364	1.00	15.61	C
ATOM	7356	O	HIS	B	439	27.259	−33.638	80.483	1.00	15.55	O
ATOM	7365	N	LYS	B	440	25.712	−32.557	81.721	1.00	15.84	N
ATOM	7366	CA	LYS	B	440	25.914	−31.235	81.148	1.00	16.87	C
ATOM	7367	CB	LYS	B	440	24.929	−30.262	81.777	1.00	16.99	C
ATOM	7368	CG	LYS	B	440	23.563	−30.082	81.138	1.00	18.92	C
ATOM	7369	CD	LYS	B	440	23.194	−30.887	79.889	1.00	21.22	C
ATOM	7370	CE	LYS	B	440	22.590	−29.936	78.838	1.00	22.38	C
ATOM	7371	NZ	LYS	B	440	22.180	−30.579	77.547	1.00	23.99	N
ATOM	7372	C	LYS	B	440	27.320	−30.724	81.410	1.00	16.85	C
ATOM	7373	O	LYS	B	440	27.990	−30.207	80.527	1.00	16.61	O
ATOM	7387	N	HIS	B	441	27.752	−30.891	82.647	1.00	17.02	N
ATOM	7388	CA	HIS	B	441	29.100	−30.563	83.076	1.00	17.03	C
ATOM	7389	CB	HIS	B	441	29.228	−30.921	84.560	1.00	17.15	C
ATOM	7390	CG	HIS	B	441	30.628	−30.922	85.050	1.00	16.74	C
ATOM	7391	ND1	HIS	B	441	31.277	−29.770	85.428	1.00	17.40	N
ATOM	7392	CE1	HIS	B	441	32.510	−30.070	85.801	1.00	18.55	C
ATOM	7393	NE2	HIS	B	441	32.687	−31.372	85.659	1.00	18.05	N
ATOM	7394	CD2	HIS	B	441	31.521	−31.929	85.196	1.00	18.60	C
ATOM	7395	C	HIS	B	441	30.217	−31.261	82.284	1.00	17.10	C
ATOM	7396	O	HIS	B	441	31.256	−30.646	81.989	1.00	16.96	O
ATOM	7405	N	LEU	B	442	30.028	−32.543	81.968	1.00	16.97	N
ATOM	7406	CA	LEU	B	442	31.078	−33.323	81.309	1.00	17.19	C
ATOM	7407	CB	LEU	B	442	30.836	−34.838	81.416	1.00	16.69	C
ATOM	7408	CG	LEU	B	442	31.123	−35.537	82.742	1.00	15.56	C
ATOM	7409	CD1	LEU	B	442	30.754	−36.989	82.597	1.00	15.35	C
ATOM	7410	CD2	LEU	B	442	32.562	−35.397	83.173	1.00	14.70	C
ATOM	7411	C	LEU	B	442	31.167	−32.907	79.848	1.00	17.78	C
ATOM	7412	O	LEU	B	442	32.244	−32.924	79.263	1.00	17.31	O
ATOM	7424	N	GLY	B	443	30.023	−32.517	79.286	1.00	19.00	N
ATOM	7425	CA	GLY	B	443	29.939	−32.036	77.920	1.00	19.92	C
ATOM	7426	C	GLY	B	443	30.392	−30.599	77.774	1.00	20.64	C
ATOM	7427	O	GLY	B	443	30.306	−30.049	76.685	1.00	20.88	O
ATOM	7431	N	ASN	B	444	30.867	−30.010	78.872	1.00	21.66	N
ATOM	7432	CA	ASN	B	444	31.364	−28.636	78.935	1.00	22.75	C
ATOM	7433	CB	ASN	B	444	32.661	−28.480	78.126	1.00	23.21	C
ATOM	7434	CG	ASN	B	444	33.860	−28.232	79.014	1.00	25.30	C
ATOM	7435	OD1	ASN	B	444	33.759	−27.521	80.027	1.00	28.04	O
ATOM	7436	ND2	ASN	B	444	35.007	−28.818	78.651	1.00	27.89	N
ATOM	7437	C	ASN	B	444	30.326	−27.589	78.541	1.00	22.95	C
ATOM	7438	O	ASN	B	444	30.648	−26.532	78.011	1.00	23.14	O
ATOM	7445	N	GLU	B	445	29.080	−27.889	78.862	1.00	23.41	N
ATOM	7446	CA	GLU	B	445	27.931	−27.101	78.432	1.00	23.88	C
ATOM	7447	CB	GLU	B	445	26.800	−28.049	78.022	1.00	24.02	C
ATOM	7448	CG	GLU	B	445	27.298	−29.218	77.178	1.00	25.96	C
ATOM	7449	CD	GLU	B	445	26.219	−29.911	76.365	1.00	29.01	C
ATOM	7450	OE1	GLU	B	445	25.403	−30.668	76.950	1.00	29.85	O
ATOM	7451	OE2	GLU	B	445	26.212	−29.717	75.127	1.00	32.33	O
ATOM	7452	C	GLU	B	445	27.459	−26.120	79.505	1.00	23.74	C
ATOM	7453	O	GLU	B	445	26.709	−25.191	79.202	1.00	24.18	O
ATOM	7460	N	MET	B	446	27.893	−26.326	80.749	1.00	23.56	N
ATOM	7461	CA	MET	B	446	27.545	−25.419	81.845	1.00	23.61	C
ATOM	7462	CB	MET	B	446	27.745	−26.071	83.223	1.00	23.35	C
ATOM	7463	CG	MET	B	446	26.910	−27.314	83.476	1.00	22.74	C
ATOM	7464	SD	MET	B	446	25.147	−27.053	83.444	1.00	23.47	S
ATOM	7465	CE	MET	B	446	24.926	−26.049	84.899	1.00	23.47	C
ATOM	7466	C	MET	B	446	28.384	−24.158	81.789	1.00	23.64	C
ATOM	7467	O	MET	B	446	29.538	−24.204	81.381	1.00	23.28	O
ATOM	7477	N	PRO	B	447	27.805	−23.037	82.213	1.00	24.28	N
ATOM	7478	CA	PRO	B	447	28.568	−21.798	82.413	1.00	24.88	C
ATOM	7479	CB	PRO	B	447	27.531	−20.855	83.023	1.00	24.82	C
ATOM	7480	CG	PRO	B	447	26.228	−21.362	82.532	1.00	24.37	C
ATOM	7481	CD	PRO	B	447	26.376	−22.847	82.519	1.00	24.16	C
ATOM	7482	C	PRO	B	447	29.713	−22.007	83.393	1.00	25.43	C
ATOM	7483	O	PRO	B	447	29.571	−22.812	84.316	1.00	25.71	O
ATOM	7491	N	ARG	B	448	30.817	−21.291	83.212	1.00	26.30	N
ATOM	7492	CA	ARG	B	448	31.995	−21.513	84.056	1.00	26.79	C
ATOM	7493	CB	ARG	B	448	33.284	−20.978	83.393	1.00	27.35	C
ATOM	7494	CG	ARG	B	448	34.559	−21.889	83.596	1.00	29.10	C
ATOM	7495	CD	ARG	B	448	34.620	−22.642	84.983	1.00	31.72	C
ATOM	7496	NE	ARG	B	448	35.755	−23.567	85.180	1.00	33.20	N
ATOM	7497	CZ	ARG	B	448	35.858	−24.459	86.198	1.00	32.57	C
ATOM	7498	NH1	ARG	B	448	34.909	−24.564	87.135	1.00	30.34	N
ATOM	7499	NH2	ARG	B	448	36.934	−25.247	86.276	1.00	33.54	N
ATOM	7500	C	ARG	B	448	31.795	−20.971	85.484	1.00	26.72	C
ATOM	7501	O	ARG	B	448	32.376	−21.499	86.437	1.00	26.88	O
ATOM	7515	N	ASN	B	449	30.925	−19.973	85.651	1.00	26.59	N
ATOM	7516	CA	ASN	B	449	30.643	−19.430	86.996	1.00	26.57	C
ATOM	7517	CB	ASN	B	449	30.387	−17.920	86.911	1.00	27.04	C
ATOM	7518	CG	ASN	B	449	31.634	−17.118	87.223	1.00	28.38	C
ATOM	7519	OD1	ASN	B	449	32.519	−16.953	86.369	1.00	30.50	O
ATOM	7520	ND2	ASN	B	449	31.739	−16.653	88.467	1.00	30.31	N
ATOM	7521	C	ASN	B	449	29.514	−20.123	87.774	1.00	25.66	C
ATOM	7522	O	ASN	B	449	29.040	−19.621	88.811	1.00	25.95	O
ATOM	7529	N	ASN	B	450	29.133	−21.309	87.311	1.00	24.51	N
ATOM	7530	CA	ASN	B	450	27.921	−21.953	87.789	1.00	23.46	C
ATOM	7531	CB	ASN	B	450	27.566	−23.112	86.867	1.00	23.16	C
ATOM	7532	CG	ASN	B	450	26.163	−23.560	87.050	1.00	21.23	C
ATOM	7533	OD1	ASN	B	450	25.901	−24.444	87.831	1.00	18.82	O
ATOM	7534	ND2	ASN	B	450	25.237	−22.917	86.353	1.00	19.39	N
ATOM	7535	C	ASN	B	450	28.046	−22.446	89.216	1.00	23.09	C
ATOM	7536	O	ASN	B	450	28.915	−23.259	89.502	1.00	22.55	O
ATOM	7543	N	LEU	B	451	27.187	−21.962	90.116	1.00	23.13	N
ATOM	7544	CA	LEU	B	451	27.264	−22.420	91.506	1.00	23.28	C
ATOM	7545	CB	LEU	B	451	26.837	−21.367	92.535	1.00	23.63	C
ATOM	7546	CG	LEU	B	451	25.457	−20.737	92.564	1.00	24.59	C
ATOM	7547	CD1	LEU	B	451	24.963	−20.581	93.997	1.00	24.29	C
ATOM	7548	CD2	LEU	B	451	25.542	−19.373	91.905	1.00	27.31	C
ATOM	7549	C	LEU	B	451	26.578	−23.724	91.805	1.00	22.46	C
ATOM	7550	O	LEU	B	451	26.918	−24.358	92.801	1.00	22.86	O
ATOM	7562	N	LEU	B	452	25.644	−24.158	90.972	1.00	21.82	N
ATOM	7563	CA	LEU	B	452	25.055	−25.473	91.196	1.00	21.41	C
ATOM	7564	CB	LEU	B	452	23.912	−25.747	90.232	1.00	21.14	C
ATOM	7565	CG	LEU	B	452	22.669	−24.881	90.413	1.00	21.92	C
ATOM	7566	CD1	LEU	B	452	21.509	−25.614	89.784	1.00	21.80	C
ATOM	7567	CD2	LEU	B	452	22.367	−24.518	91.888	1.00	21.48	C
ATOM	7568	C	LEU	B	452	26.129	−26.542	91.043	1.00	21.09	C
ATOM	7569	O	LEU	B	452	26.102	−27.558	91.734	1.00	20.40	O
ATOM	7581	N	ILE	B	453	27.065	−26.281	90.130	1.00	21.24	N
ATOM	7582	CA	ILE	B	453	28.201	−27.156	89.856	1.00	21.38	C
ATOM	7583	CB	ILE	B	453	28.848	−26.778	88.501	1.00	21.33	C
ATOM	7584	CG1	ILE	B	453	27.872	−27.039	87.348	1.00	21.30	C
ATOM	7585	CD1	ILE	B	453	27.339	−28.437	87.257	1.00	21.17	C
ATOM	7586	CG2	ILE	B	453	30.173	−27.505	88.289	1.00	21.81	C
ATOM	7587	C	ILE	B	453	29.209	−27.097	90.996	1.00	21.22	C
ATOM	7588	O	ILE	B	453	29.785	−28.112	91.344	1.00	20.85	O
ATOM	7600	N	GLU	B	454	29.405	−25.924	91.590	1.00	21.64	N
ATOM	7601	CA	GLU	B	454	30.193	−25.836	92.828	1.00	22.36	C
ATOM	7602	CB	GLU	B	454	30.256	−24.411	93.385	1.00	22.90	C
ATOM	7603	CG	GLU	B	454	31.015	−23.416	92.529	1.00	25.00	C
ATOM	7604	CD	GLU	B	454	32.498	−23.455	92.771	1.00	28.01	C
ATOM	7605	OE1	GLU	B	454	32.915	−23.479	93.961	1.00	31.23	O
ATOM	7606	OE2	GLU	B	454	33.248	−23.459	91.764	1.00	29.63	O
ATOM	7607	C	GLU	B	454	29.568	−26.705	93.894	1.00	21.83	C
ATOM	7608	O	GLU	B	454	30.261	−27.434	94.580	1.00	21.68	O
ATOM	7615	N	MET	B	455	28.254	−26.588	94.052	1.00	21.87	N
ATOM	7616	CA	MET	B	455	27.525	−27.413	94.999	1.00	21.89	C
ATOM	7617	CB	MET	B	455	26.039	−27.029	95.064	1.00	21.83	C
ATOM	7618	CG	MET	B	455	25.766	−25.613	95.603	1.00	21.77	C
ATOM	7619	SD	MET	B	455	26.597	−25.187	97.143	1.00	22.46	S
ATOM	7620	CE	MET	B	455	25.732	−26.266	98.335	1.00	21.63	C
ATOM	7621	C	MET	B	455	27.670	−28.883	94.641	1.00	22.11	C
ATOM	7622	O	MET	B	455	27.910	−29.693	95.518	1.00	21.96	O
ATOM	7632	N	LEU	B	456	27.566	−29.220	93.360	1.00	22.74	N
ATOM	7633	CA	LEU	B	456	27.618	−30.616	92.916	1.00	23.40	C
ATOM	7634	CB	LEU	B	456	27.273	−30.693	91.433	1.00	23.45	C
ATOM	7635	CG	LEU	B	456	27.045	−32.087	90.842	1.00	24.35	C
ATOM	7636	CD1	LEU	B	456	25.627	−32.582	91.106	1.00	24.33	C
ATOM	7637	CD2	LEU	B	456	27.338	−32.091	89.346	1.00	24.45	C
ATOM	7638	C	LEU	B	456	28.990	−31.250	93.160	1.00	24.19	C
ATOM	7639	O	LEU	B	456	29.086	−32.421	93.513	1.00	23.84	O
ATOM	7651	N	GLN	B	457	30.039	−30.448	93.009	1.00	25.41	N
ATOM	7652	CA	GLN	B	457	31.417	−30.911	93.077	1.00	26.93	C
ATOM	7653	CB	GLN	B	457	32.258	−30.204	92.015	1.00	26.95	C
ATOM	7654	CG	GLN	B	457	32.009	−30.696	90.601	1.00	27.52	C
ATOM	7655	CD	GLN	B	457	33.220	−30.482	89.730	1.00	28.65	C
ATOM	7656	OE1	GLN	B	457	33.340	−29.448	89.077	1.00	30.29	O
ATOM	7657	NE2	GLN	B	457	34.145	−31.439	89.745	1.00	30.23	N
ATOM	7658	C	GLN	B	457	32.042	−30.675	94.456	1.00	28.35	C
ATOM	7659	O	GLN	B	457	33.252	−30.448	94.579	1.00	28.63	O
ATOM	7668	N	ALA	B	458	31.207	−30.707	95.485	1.00	29.95	N
ATOM	7669	CA	ALA	B	458	31.683	−30.782	96.852	1.00	31.48	C
ATOM	7670	CB	ALA	B	458	30.931	−29.774	97.723	1.00	31.49	C
ATOM	7671	C	ALA	B	458	31.428	−32.221	97.312	1.00	32.83	C
ATOM	7672	O	ALA	B	458	30.765	−32.989	96.599	1.00	33.11	O
ATOM	7678	N	LYS	B	459	31.977	−32.571	98.479	1.00	34.31	N
ATOM	7679	CA	LYS	B	459	31.629	−33.793	99.256	1.00	35.60	C
ATOM	7680	CB	LYS	B	459	30.359	−34.516	98.736	1.00	35.65	C
ATOM	7681	CG	LYS	B	459	29.669	−35.449	99.755	1.00	35.40	C
ATOM	7682	CD	LYS	B	459	30.062	−36.930	99.555	1.00	36.33	C
ATOM	7683	CE	LYS	B	459	28.917	−37.885	99.923	1.00	37.28	C
ATOM	7684	NZ	LYS	B	459	28.376	−37.655	101.317	1.00	38.97	N
ATOM	7685	C	LYS	B	459	32.804	−34.781	99.346	1.00	36.63	C
ATOM	7686	O	LYS	B	459	33.657	−34.811	98.438	1.00	37.92	O
ATOM	7687	OXT	LYS	B	459	33.694	−34.880	98.481	1.00	37.82	O
ATOM	7701	N	GLU	P	741	7.583	31.933	94.328	1.00	22.27	N
ATOM	7702	CA	GLU	P	741	8.478	30.965	93.616	1.00	22.83	C
ATOM	7703	CB	GLU	P	741	9.939	31.320	93.884	1.00	22.92	C
ATOM	7704	CG	GLU	P	741	10.426	30.946	95.275	1.00	24.13	C
ATOM	7705	CD	GLU	P	741	11.609	30.002	95.240	1.00	25.50	C
ATOM	7706	OE1	GLU	P	741	11.429	28.757	95.371	1.00	25.82	O
ATOM	7707	OE2	GLU	P	741	12.729	30.536	95.079	1.00	27.09	O
ATOM	7708	C	GLU	P	741	8.179	29.508	94.018	1.00	22.38	C
ATOM	7709	O	GLU	P	741	7.774	29.254	95.145	1.00	22.01	O
ATOM	7715	N	ASN	P	742	8.392	28.565	93.097	1.00	22.40	N
ATOM	7716	CA	ASN	P	742	7.913	27.181	93.267	1.00	22.52	C
ATOM	7717	CB	ASN	P	742	7.629	26.524	91.902	1.00	22.87	C
ATOM	7718	CG	ASN	P	742	6.694	25.302	91.998	1.00	22.97	C
ATOM	7719	OD1	ASN	P	742	6.702	24.557	92.978	1.00	23.50	O
ATOM	7720	ND2	ASN	P	742	5.871	25.116	90.966	1.00	23.35	N
ATOM	7721	C	ASN	P	742	8.895	26.339	94.052	1.00	22.21	C
ATOM	7722	O	ASN	P	742	9.969	26.021	93.556	1.00	21.92	O
ATOM	7729	N	ALA	P	743	8.510	25.982	95.276	1.00	22.04	N
ATOM	7730	CA	ALA	P	743	9.395	25.272	96.192	1.00	21.92	C
ATOM	7731	CB	ALA	P	743	8.795	25.219	97.591	1.00	21.54	C
ATOM	7732	C	ALA	P	743	9.668	23.881	95.685	1.00	22.04	C
ATOM	7733	O	ALA	P	743	10.739	23.360	95.886	1.00	22.41	O
ATOM	7739	N	LEU	P	744	8.692	23.297	95.011	1.00	22.75	N
ATOM	7740	CA	LEU	P	744	8.828	21.973	94.421	1.00	23.19	C
ATOM	7741	CB	LEU	P	744	7.463	21.455	93.936	1.00	23.29	C
ATOM	7742	CG	LEU	P	744	7.386	20.069	93.284	1.00	22.36	C
ATOM	7743	CD1	LEU	P	744	7.749	18.975	94.243	1.00	20.47	C
ATOM	7744	CD2	LEU	P	744	5.998	19.827	92.701	1.00	23.32	C
ATOM	7745	C	LEU	P	744	9.819	21.958	93.278	1.00	23.49	C
ATOM	7746	O	LEU	P	744	10.649	21.069	93.193	1.00	24.84	O
ATOM	7758	N	LEU	P	745	9.729	22.927	92.384	1.00	23.13	N
ATOM	7759	CA	LEU	P	745	10.666	23.010	91.286	1.00	22.64	C
ATOM	7760	CB	LEU	P	745	10.291	24.093	90.274	1.00	22.23	C
ATOM	7761	CG	LEU	P	745	9.109	23.848	89.355	1.00	21.35	C
ATOM	7762	CD1	LEU	P	745	8.913	25.045	88.488	1.00	19.96	C
ATOM	7763	CD2	LEU	P	745	9.325	22.600	88.496	1.00	22.35	C
ATOM	7764	C	LEU	P	745	12.061	23.257	91.791	1.00	22.33	C
ATOM	7765	O	LEU	P	745	12.982	22.653	91.294	1.00	23.00	O
ATOM	7777	N	ARG	P	746	12.243	24.132	92.768	1.00	21.95	N
ATOM	7778	CA	ARG	P	746	13.588	24.317	93.310	1.00	21.74	C
ATOM	7779	CB	ARG	P	746	13.640	25.397	94.393	1.00	22.00	C
ATOM	7780	CG	ARG	P	746	15.082	25.748	94.785	1.00	23.05	C
ATOM	7781	CD	ARG	P	746	15.255	26.771	95.872	1.00	24.65	C
ATOM	7782	NE	ARG	P	746	16.072	27.907	95.421	1.00	26.68	N
ATOM	7783	CZ	ARG	P	746	15.605	28.901	94.667	1.00	26.31	C
ATOM	7784	NH1	ARG	P	746	14.346	28.890	94.263	1.00	26.42	N
ATOM	7785	NH2	ARG	P	746	16.397	29.904	94.301	1.00	26.05	N
ATOM	7786	C	ARG	P	746	14.135	23.011	93.883	1.00	20.96	C
ATOM	7787	O	ARG	P	746	15.311	22.688	93.716	1.00	20.34	O
ATOM	7801	N	TYR	P	747	13.271	22.271	94.562	1.00	20.56	N
ATOM	7802	CA	TYR	P	747	13.671	21.021	95.191	1.00	20.31	C
ATOM	7803	CB	TYR	P	747	12.539	20.489	96.088	1.00	19.69	C
ATOM	7804	CG	TYR	P	747	12.758	19.080	96.618	1.00	16.87	C
ATOM	7805	CD1	TYR	P	747	13.858	18.760	97.400	1.00	13.85	C
ATOM	7806	CE1	TYR	P	747	14.052	17.469	97.870	1.00	11.93	C
ATOM	7807	CZ	TYR	P	747	13.141	16.492	97.564	1.00	11.67	C
ATOM	7808	OH	TYR	P	747	13.284	15.208	98.001	1.00	9.56	O
ATOM	7809	CE2	TYR	P	747	12.045	16.789	96.793	1.00	13.94	C
ATOM	7810	CD2	TYR	P	747	11.857	18.071	96.324	1.00	15.63	C
ATOM	7811	C	TYR	P	747	14.102	19.975	94.150	1.00	20.33	C
ATOM	7812	O	TYR	P	747	15.086	19.298	94.327	1.00	19.89	O
ATOM	7822	N	LEU	P	748	13.359	19.874	93.057	1.00	20.86	N
ATOM	7823	CA	LEU	P	748	13.593	18.836	92.078	1.00	20.79	C
ATOM	7824	CB	LEU	P	748	12.361	18.662	91.215	1.00	20.83	C
ATOM	7825	CG	LEU	P	748	11.096	18.248	91.956	1.00	21.06	C
ATOM	7826	CD1	LEU	P	748	9.961	18.231	90.935	1.00	21.29	C
ATOM	7827	CD2	LEU	P	748	11.250	16.876	92.645	1.00	20.53	C
ATOM	7828	C	LEU	P	748	14.801	19.155	91.214	1.00	21.05	C
ATOM	7829	O	LEU	P	748	15.431	18.261	90.663	1.00	19.63	O
ATOM	7841	N	LEU	P	749	15.109	20.443	91.131	1.00	21.63	N
ATOM	7842	CA	LEU	P	749	16.232	20.933	90.377	1.00	22.48	C
ATOM	7843	CB	LEU	P	749	15.933	22.342	89.857	1.00	22.82	C
ATOM	7844	CG	LEU	P	749	14.927	22.499	88.709	1.00	21.55	C
ATOM	7845	CD1	LEU	P	749	14.506	23.954	88.626	1.00	21.81	C
ATOM	7846	CD2	LEU	P	749	15.527	22.048	87.381	1.00	20.78	C
ATOM	7847	C	LEU	P	749	17.501	20.969	91.213	1.00	23.25	C
ATOM	7848	O	LEU	P	749	18.578	20.833	90.669	1.00	23.26	O
ATOM	7860	N	ASP	P	750	17.371	21.159	92.525	1.00	24.72	N
ATOM	7861	CA	ASP	P	750	18.534	21.318	93.413	1.00	25.72	C
ATOM	7862	CB	ASP	P	750	18.211	22.199	94.633	1.00	26.16	C
ATOM	7863	CG	ASP	P	750	18.238	23.715	94.305	1.00	27.16	C
ATOM	7864	OD1	ASP	P	750	18.566	24.110	93.156	1.00	28.19	O
ATOM	7865	OD2	ASP	P	750	17.944	24.588	95.148	1.00	28.34	O
ATOM	7866	C	ASP	P	750	19.058	19.946	93.826	1.00	26.28	C
ATOM	7867	O	ASP	P	750	20.218	19.604	93.554	1.00	26.58	O
ATOM	7872	N	LYS	P	751	18.217	19.137	94.446	1.00	26.38	N
ATOM	7873	CA	LYS	P	751	18.450	17.698	94.345	1.00	27.07	C
ATOM	7874	CB	LYS	P	751	19.556	17.203	95.286	1.00	27.10	C
ATOM	7875	CG	LYS	P	751	19.799	15.668	95.285	1.00	26.43	C
ATOM	7876	CD	LYS	P	751	20.136	15.110	93.903	1.00	25.89	C
ATOM	7877	CE	LYS	P	751	19.840	13.621	93.804	1.00	25.20	C
ATOM	7878	NZ	LYS	P	751	18.467	13.367	93.275	1.00	24.62	N
ATOM	7879	C	LYS	P	751	17.163	16.919	94.534	1.00	27.56	C
ATOM	7880	O	LYS	P	751	16.379	17.102	95.457	1.00	27.49	O
ATOM	7881	OXT	LYS	P	751	16.887	16.067	93.692	1.00	28.85	O
ATOM	7895	N	ASP	P	752	14.845	15.866	93.845	1.00	35.80	N
ATOM	7896	CA	ASP	P	752	14.670	14.462	94.206	1.00	36.05	C
ATOM	7897	CB	ASP	P	752	15.191	14.228	95.637	1.00	35.76	C
ATOM	7898	CG	ASP	P	752	15.232	12.751	96.043	1.00	35.84	C
ATOM	7899	OD1	ASP	P	752	14.176	12.200	96.431	1.00	36.42	O
ATOM	7900	OD2	ASP	P	752	16.282	12.070	96.062	1.00	34.75	O
ATOM	7901	C	ASP	P	752	13.171	14.134	94.079	1.00	36.56	C
ATOM	7902	O	ASP	P	752	12.785	13.311	93.197	1.00	37.05	O
ATOM	7906	N	GLU	Q	741	38.045	−24.398	99.950	1.00	25.99	N
ATOM	7907	CA	GLU	Q	741	37.135	−25.566	99.745	1.00	25.78	C
ATOM	7908	CB	GLU	Q	741	36.917	−26.330	101.063	1.00	25.87	C
ATOM	7909	CG	GLU	Q	741	36.705	−25.451	102.299	1.00	26.45	C
ATOM	7910	CD	GLU	Q	741	35.331	−25.623	102.946	1.00	27.21	C
ATOM	7911	OE1	GLU	Q	741	35.264	−26.213	104.052	1.00	27.93	O
ATOM	7912	OE2	GLU	Q	741	34.319	−25.162	102.361	1.00	27.00	O
ATOM	7913	C	GLU	Q	741	35.790	−25.165	99.118	1.00	25.63	C
ATOM	7914	O	GLU	Q	741	35.438	−25.677	98.054	1.00	25.74	O
ATOM	7920	N	ASN	Q	742	35.045	−24.262	99.766	1.00	25.32	N
ATOM	7921	CA	ASN	Q	742	33.708	−23.855	99.284	1.00	25.13	C
ATOM	7922	CB	ASN	Q	742	32.607	−24.798	99.821	1.00	25.21	C
ATOM	7923	CG	ASN	Q	742	31.309	−24.741	98.987	1.00	27.06	C
ATOM	7924	OD1	ASN	Q	742	31.028	−23.747	98.298	1.00	29.42	O
ATOM	7925	ND2	ASN	Q	742	30.517	−25.813	99.047	1.00	29.32	N
ATOM	7926	C	ASN	Q	742	33.404	−22.377	99.616	1.00	24.48	C
ATOM	7927	O	ASN	Q	742	32.407	−22.058	100.270	1.00	23.87	O
ATOM	7934	N	ALA	Q	743	34.271	−21.490	99.116	1.00	23.91	N
ATOM	7935	CA	ALA	Q	743	34.260	−20.060	99.459	1.00	23.32	C
ATOM	7936	CB	ALA	Q	743	35.622	−19.409	99.095	1.00	23.24	C
ATOM	7937	C	ALA	Q	743	33.101	−19.257	98.846	1.00	22.56	C
ATOM	7938	O	ALA	Q	743	32.793	−18.164	99.316	1.00	22.52	O
ATOM	7944	N	LEU	Q	744	32.465	−19.779	97.803	1.00	21.98	N
ATOM	7945	CA	LEU	Q	744	31.279	−19.120	97.243	1.00	21.60	C
ATOM	7946	CB	LEU	Q	744	30.949	−19.669	95.846	1.00	21.85	C
ATOM	7947	CG	LEU	Q	744	29.983	−18.892	94.916	1.00	23.13	C
ATOM	7948	CD1	LEU	Q	744	29.721	−17.437	95.364	1.00	23.26	C
ATOM	7949	CD2	LEU	Q	744	30.463	−18.925	93.429	1.00	23.57	C
ATOM	7950	C	LEU	Q	744	30.080	−19.273	98.186	1.00	20.71	C
ATOM	7951	O	LEU	Q	744	29.380	−18.303	98.461	1.00	20.33	O
ATOM	7963	N	LEU	Q	745	29.869	−20.484	98.691	1.00	19.83	N
ATOM	7964	CA	LEU	Q	745	28.816	−20.743	99.683	1.00	19.67	C
ATOM	7965	CB	LEU	Q	745	28.708	−22.249	99.948	1.00	19.59	C
ATOM	7966	CG	LEU	Q	745	27.380	−22.895	100.363	1.00	19.72	C
ATOM	7967	CD1	LEU	Q	745	27.643	−24.069	101.299	1.00	19.23	C
ATOM	7968	CD2	LEU	Q	745	26.372	−21.934	100.977	1.00	19.90	C
ATOM	7969	C	LEU	Q	745	29.057	−20.011	101.013	1.00	19.51	C
ATOM	7970	O	LEU	Q	745	28.121	−19.537	101.656	1.00	18.85	O
ATOM	7982	N	ARG	Q	746	30.327	−19.942	101.413	1.00	19.67	N
ATOM	7983	CA	ARG	Q	746	30.746	−19.241	102.627	1.00	19.59	C
ATOM	7984	CB	ARG	Q	746	32.254	−19.411	102.857	1.00	19.83	C
ATOM	7985	CG	ARG	Q	746	32.684	−19.212	104.302	1.00	20.54	C
ATOM	7986	CD	ARG	Q	746	34.138	−19.572	104.574	1.00	21.57	C
ATOM	7987	NE	ARG	Q	746	34.276	−20.619	105.602	1.00	21.15	N
ATOM	7988	CZ	ARG	Q	746	34.544	−21.909	105.369	1.00	20.65	C
ATOM	7989	NH1	ARG	Q	746	34.704	−22.384	104.131	1.00	20.65	N
ATOM	7990	NH2	ARG	Q	746	34.647	−22.741	106.394	1.00	20.71	N
ATOM	7991	C	ARG	Q	746	30.406	−17.762	102.566	1.00	19.23	C
ATOM	7992	O	ARG	Q	746	29.868	−17.212	103.518	1.00	19.25	O
ATOM	8006	N	TYR	Q	747	30.713	−17.129	101.442	1.00	19.07	N
ATOM	8007	CA	TYR	Q	747	30.428	−15.714	101.254	1.00	19.43	C
ATOM	8008	CB	TYR	Q	747	30.884	−15.263	99.862	1.00	19.40	C
ATOM	8009	CG	TYR	Q	747	30.492	−13.834	99.561	1.00	20.10	C
ATOM	8010	CD1	TYR	Q	747	31.145	−12.776	100.200	1.00	21.02	C
ATOM	8011	CE1	TYR	Q	747	30.800	−11.456	99.954	1.00	20.26	C
ATOM	8012	CZ	TYR	Q	747	29.780	−11.174	99.072	1.00	20.07	C
ATOM	8013	OH	TYR	Q	747	29.460	−9.860	98.856	1.00	19.67	O
ATOM	8014	CE2	TYR	Q	747	29.089	−12.206	98.423	1.00	20.56	C
ATOM	8015	CD2	TYR	Q	747	29.450	−13.531	98.672	1.00	20.17	C
ATOM	8016	C	TYR	Q	747	28.939	−15.429	101.435	1.00	19.55	C
ATOM	8017	O	TYR	Q	747	28.542	−14.456	102.075	1.00	19.32	O
ATOM	8027	N	LEU	Q	748	28.133	−16.308	100.851	1.00	20.30	N
ATOM	8028	CA	LEU	Q	748	26.675	−16.235	100.884	1.00	20.81	C
ATOM	8029	CB	LEU	Q	748	26.076	−17.406	100.074	1.00	20.89	C
ATOM	8030	CG	LEU	Q	748	25.648	−17.246	98.597	1.00	21.19	C
ATOM	8031	CD1	LEU	Q	748	26.554	−16.394	97.776	1.00	21.30	C
ATOM	8032	CD2	LEU	Q	748	25.513	−18.620	97.927	1.00	21.92	C
ATOM	8033	C	LEU	Q	748	26.121	−16.243	102.317	1.00	21.05	C
ATOM	8034	O	LEU	Q	748	25.164	−15.540	102.620	1.00	21.22	O
ATOM	8046	N	LEU	Q	749	26.732	−17.030	103.192	1.00	21.60	N
ATOM	8047	CA	LEU	Q	749	26.287	−17.134	104.585	1.00	22.24	C
ATOM	8048	CB	LEU	Q	749	26.724	−18.481	105.153	1.00	22.05	C
ATOM	8049	CG	LEU	Q	749	26.048	−19.682	104.488	1.00	21.89	C
ATOM	8050	CD1	LEU	Q	749	26.846	−20.949	104.723	1.00	21.72	C
ATOM	8051	CD2	LEU	Q	749	24.632	−19.838	105.017	1.00	21.90	C
ATOM	8052	C	LEU	Q	749	26.771	−15.999	105.512	1.00	22.98	C
ATOM	8053	O	LEU	Q	749	26.154	−15.721	106.544	1.00	23.04	O
ATOM	8065	N	ASP	Q	750	27.858	−15.333	105.138	1.00	23.89	N
ATOM	8066	CA	ASP	Q	750	28.469	−14.324	106.002	1.00	24.77	C
ATOM	8067	CB	ASP	Q	750	29.979	−14.185	105.688	1.00	24.95	C
ATOM	8068	CG	ASP	Q	750	30.838	−15.210	106.429	1.00	25.43	C
ATOM	8069	OD1	ASP	Q	750	30.280	−16.188	106.996	1.00	26.05	O
ATOM	8070	OD2	ASP	Q	750	32.084	−15.114	106.488	1.00	25.58	O
ATOM	8071	C	ASP	Q	750	27.798	−12.959	105.907	1.00	25.17	C
ATOM	8072	O	ASP	Q	750	28.300	−12.005	106.478	1.00	25.49	O
ATOM	8077	N	LYS	Q	751	26.668	−12.869	105.217	1.00	25.94	N
ATOM	8078	CA	LYS	Q	751	26.010	−11.590	104.948	1.00	26.70	C
ATOM	8079	CB	LYS	Q	751	24.570	−11.589	105.485	1.00	26.72	C
ATOM	8080	CG	LYS	Q	751	23.671	−10.502	104.856	1.00	26.43	C
ATOM	8081	CD	LYS	Q	751	23.726	−9.156	105.624	1.00	26.00	C
ATOM	8082	CE	LYS	Q	751	23.156	−9.277	107.040	1.00	25.72	C
ATOM	8083	NZ	LYS	Q	751	24.042	−8.735	108.112	1.00	25.70	N
ATOM	8084	C	LYS	Q	751	26.789	−10.389	105.490	1.00	27.21	C
ATOM	8085	O	LYS	Q	751	27.723	−9.909	104.844	1.00	28.04	O
ATOM	8086	OXT	LYS	Q	751	26.561	−9.833	106.576	1.00	27.92	O
ATOM	8100	O30	LIG	L	1	−11.719	5.990	83.371	1.00	19.90	O
ATOM	8101	C30	LIG	L	1	−10.759	5.840	84.111	1.00	21.00	C
ATOM	8102	C31	LIG	L	1	−9.377	5.322	83.689	1.00	21.65	C
ATOM	8103	C32	LIG	L	1	−8.502	6.522	83.304	1.00	22.04	C
ATOM	8104	C33	LIG	L	1	−6.988	6.306	83.257	1.00	23.71	C
ATOM	8105	C34	LIG	L	1	−6.310	7.488	82.530	1.00	24.65	C
ATOM	8106	C35	LIG	L	1	−4.876	7.836	82.977	1.00	24.95	C
ATOM	8107	C36	LIG	L	1	−4.183	8.860	82.059	1.00	24.27	C
ATOM	8108	C37	LIG	L	1	−2.858	9.326	82.686	1.00	25.39	C
ATOM	8109	C38	LIG	L	1	−1.882	10.020	81.726	1.00	24.22	C
ATOM	8110	C39	LIG	L	1	−0.815	10.753	82.528	1.00	23.94	C
ATOM	8111	C40	LIG	L	1	−0.204	11.922	81.782	1.00	24.72	C
ATOM	8112	C41	LIG	L	1	−1.053	13.197	81.645	1.00	24.94	C
ATOM	8113	C42	LIG	L	1	−0.757	14.203	82.744	1.00	24.72	C
ATOM	8114	C43	LIG	L	1	−1.207	15.593	82.371	1.00	25.68	C
ATOM	8115	C44	LIG	L	1	−1.057	16.556	83.289	1.00	27.06	C
ATOM	8116	C45	LIG	L	1	−1.459	18.004	83.072	1.00	28.47	C
ATOM	8117	O4	LIG	L	1	−10.953	6.216	85.486	1.00	21.73	O
ATOM	8118	C1	LIG	L	1	−11.942	7.145	85.912	1.00	21.64	C
ATOM	8119	C6	LIG	L	1	−11.356	7.940	87.074	1.00	21.28	C
ATOM	8120	C5	LIG	L	1	−12.442	8.804	87.667	1.00	20.25	C
ATOM	8121	O14	LIG	L	1	−12.814	9.692	86.637	1.00	20.59	O
ATOM	8122	P1	LIG	L	1	−13.186	11.198	86.946	1.00	20.27	P
ATOM	8123	O12	LIG	L	1	−13.815	11.704	85.695	1.00	20.89	O
ATOM	8124	O13	LIG	L	1	−11.976	11.849	87.565	1.00	21.92	O
ATOM	8125	O11	LIG	L	1	−14.315	11.130	88.079	1.00	22.86	O
ATOM	8126	C3	LIG	L	1	−15.594	10.495	87.925	1.00	23.76	C
ATOM	8127	C2	LIG	L	1	−16.251	10.361	89.290	1.00	25.14	C
ATOM	8128	N1	LIG	L	1	−16.706	11.388	89.880	1.00	26.74	N
ATOM	8129	O7	LIG	L	1	−10.341	8.793	86.562	1.00	21.42	O
ATOM	8130	C8	LIG	L	1	−8.967	8.455	86.820	1.00	20.71	C
ATOM	8131	O10	LIG	L	1	−8.667	7.496	87.521	1.00	22.43	O
ATOM	8132	C11	LIG	L	1	−7.950	9.359	86.188	1.00	21.34	C
ATOM	8133	C12	LIG	L	1	−6.793	9.562	87.140	1.00	22.63	C
ATOM	8134	C13	LIG	L	1	−5.731	10.441	86.506	1.00	24.25	C
ATOM	8135	C14	LIG	L	1	−4.892	11.007	87.627	1.00	24.96	C
ATOM	8136	C15	LIG	L	1	−3.658	11.753	87.182	1.00	25.07	C
ATOM	8137	C16	LIG	L	1	−3.992	13.177	86.847	1.00	26.47	C
ATOM	8138	C17	LIG	L	1	−3.607	13.412	85.401	1.00	26.01	C
ATOM	8139	C18	LIG	L	1	−4.223	14.691	84.828	1.00	25.09	C
ATOM	8140	C19	LIG	L	1	−5.068	14.626	83.685	1.00	25.18	C
ATOM	8141	C20	LIG	L	1	−5.349	13.247	83.119	1.00	25.99	C
ATOM	8142	C21	LIG	L	1	−5.951	13.287	81.737	1.00	26.69	C
ATOM	8143	C22	LIG	L	1	−4.898	13.037	80.700	1.00	26.38	C
ATOM	8144	C23	LIG	L	1	−5.505	12.537	79.406	1.00	27.17	C
ATOM	8145	C24	LIG	L	1	−4.493	12.818	78.329	1.00	27.54	C
ATOM	8146	C25	LIG	L	1	−4.425	14.297	77.966	1.00	28.07	C
ATOM	8147	O30	LIG	L	2	12.865	−28.246	76.567	1.00	22.60	O
ATOM	8148	C30	LIG	L	2	13.249	−27.091	76.564	1.00	20.95	C
ATOM	8149	C31	LIG	L	2	12.369	−25.951	76.971	1.00	19.52	C
ATOM	8150	C32	LIG	L	2	12.941	−25.325	78.236	1.00	19.87	C
ATOM	8151	C33	LIG	L	2	12.866	−26.265	79.437	1.00	20.50	C
ATOM	8152	C34	LIG	L	2	13.219	−25.522	80.709	1.00	21.93	C
ATOM	8153	C35	LIG	L	2	13.165	−26.404	81.953	1.00	23.06	C
ATOM	8154	C36	LIG	L	2	13.436	−25.497	83.158	1.00	24.57	C
ATOM	8155	C37	LIG	L	2	13.404	−26.201	84.516	1.00	24.64	C
ATOM	8156	C38	LIG	L	2	14.295	−25.465	85.509	1.00	25.45	C
ATOM	8157	C39	LIG	L	2	13.748	−25.553	86.943	1.00	27.56	C
ATOM	8158	C40	LIG	L	2	14.700	−24.900	87.959	1.00	26.53	C
ATOM	8159	C41	LIG	L	2	14.848	−25.648	89.286	1.00	27.39	C
ATOM	8160	C42	LIG	L	2	15.478	−27.032	89.170	1.00	26.94	C
ATOM	8161	C43	LIG	L	2	16.867	−27.143	89.754	1.00	24.66	C
ATOM	8162	C44	LIG	L	2	17.144	−28.317	90.331	1.00	25.04	C
ATOM	8163	C45	LIG	L	2	18.479	−28.648	90.970	1.00	26.26	C
ATOM	8164	O4	LIG	L	2	14.600	−26.827	76.168	1.00	20.74	O
ATOM	8165	C1	LIG	L	2	15.525	−27.882	76.002	1.00	22.20	C
ATOM	8166	C6	LIG	L	2	16.793	−27.428	76.686	1.00	22.13	C
ATOM	8167	C5	LIG	L	2	17.935	−28.406	76.388	1.00	22.38	C
ATOM	8168	O14	LIG	L	2	17.593	−29.755	76.719	1.00	21.10	O
ATOM	8169	P1	LIG	L	2	18.734	−30.792	77.099	1.00	19.19	P
ATOM	8170	O12	LIG	L	2	18.149	−32.154	77.332	1.00	19.54	O
ATOM	8171	O13	LIG	L	2	19.600	−30.138	78.128	1.00	21.51	O
ATOM	8172	O11	LIG	L	2	19.591	−30.853	75.760	1.00	22.08	O
ATOM	8173	C3	LIG	L	2	18.984	−31.205	74.513	1.00	23.80	C
ATOM	8174	C2	LIG	L	2	19.844	−30.734	73.378	1.00	23.47	C
ATOM	8175	N1	LIG	L	2	20.461	−31.595	72.698	1.00	24.47	N
ATOM	8176	O7	LIG	L	2	16.431	−27.385	78.060	1.00	24.25	O
ATOM	8177	C8	LIG	L	2	17.211	−26.542	78.917	1.00	23.54	C
ATOM	8178	O10	LIG	L	2	17.946	−25.736	78.410	1.00	23.62	O
ATOM	8179	C11	LIG	L	2	17.051	−26.712	80.405	1.00	25.02	C
ATOM	8180	C12	LIG	L	2	18.040	−25.862	81.184	1.00	24.97	C
ATOM	8181	C13	LIG	L	2	17.811	−25.994	82.680	1.00	24.63	C
ATOM	8182	C14	LIG	L	2	18.968	−25.304	83.386	1.00	25.31	C
ATOM	8183	C15	LIG	L	2	18.789	−25.296	84.909	1.00	26.01	C
ATOM	8184	C16	LIG	L	2	19.618	−26.369	85.610	1.00	25.86	C
ATOM	8185	C17	LIG	L	2	18.766	−27.155	86.600	1.00	26.05	C
ATOM	8186	C18	LIG	L	2	19.083	−28.652	86.717	1.00	25.23	C
ATOM	8187	C19	LIG	L	2	18.078	−29.612	86.430	1.00	23.96	C
ATOM	8188	C20	LIG	L	2	16.738	−29.098	85.971	1.00	25.75	C
ATOM	8189	C21	LIG	L	2	15.647	−30.143	86.017	1.00	27.27	C
ATOM	8190	C22	LIG	L	2	14.377	−29.553	86.596	1.00	27.53	C
ATOM	8191	C23	LIG	L	2	13.151	−30.396	86.274	1.00	28.74	C
ATOM	8192	C24	LIG	L	2	12.201	−30.494	87.453	1.00	29.15	C
ATOM	8193	C25	LIG	L	2	12.751	−31.301	88.599	1.00	29.35	C
ATOM	8194	O	HOH	S	1	−11.848	0.045	73.744	1.00	6.41	O
ATOM	8195	O	HOH	S	2	21.576	28.395	89.940	1.00	28.18	O
ATOM	8196	O	HOH	S	3	−2.496	−4.035	81.610	1.00	12.19	O
ATOM	8197	O	HOH	S	4	−12.110	18.170	79.275	1.00	21.34	O
ATOM	8198	O	HOH	S	5	14.541	34.073	66.873	1.00	30.52	O
ATOM	8199	O	HOH	S	6	−3.878	17.940	96.398	1.00	20.59	O
ATOM	8200	O	HOH	S	7	−11.366	24.254	77.896	1.00	31.35	O
ATOM	8201	O	HOH	S	8	8.608	10.615	95.038	1.00	25.93	O
ATOM	8202	O	HOH	S	9	−6.633	16.553	69.383	1.00	24.92	O
ATOM	8203	O	HOH	S	10	6.518	−26.501	71.593	1.00	31.61	O
ATOM	8204	O	HOH	S	11	17.529	22.711	56.913	1.00	20.73	O
ATOM	8205	O	HOH	S	12	6.497	30.502	83.315	1.00	24.76	O
ATOM	8206	O	HOH	S	13	6.423	9.243	76.156	1.00	21.99	O
ATOM	8207	O	HOH	S	14	−13.750	4.877	88.801	1.00	20.07	O
ATOM	8208	O	HOH	S	15	13.687	40.062	80.451	1.00	18.74	O
ATOM	8209	O	HOH	S	16	7.918	5.797	78.272	1.00	30.80	O
ATOM	8210	O	HOH	S	17	11.093	5.849	65.735	1.00	24.49	O
ATOM	8211	O	HOH	S	18	0.335	7.306	79.139	1.00	19.00	O
ATOM	8212	O	HOH	S	19	5.772	32.988	76.726	1.00	29.37	O
ATOM	8213	O	HOH	S	20	21.341	37.526	78.216	1.00	24.14	O
ATOM	8214	O	HOH	S	21	25.119	14.785	62.332	1.00	25.59	O
ATOM	8215	O	HOH	S	22	1.070	26.163	64.252	1.00	29.08	O
ATOM	8216	O	HOH	S	23	−5.577	9.663	75.298	1.00	19.04	O
ATOM	8217	O	HOH	S	24	17.283	24.160	58.969	1.00	22.51	O
ATOM	8218	O	HOH	S	25	10.486	1.320	79.206	1.00	37.34	O
ATOM	8219	O	HOH	S	26	7.855	14.982	77.472	1.00	23.64	O
ATOM	8220	O	HOH	S	27	−8.160	−1.021	68.907	1.00	23.10	O
ATOM	8221	O	HOH	S	28	24.046	19.142	62.678	1.00	31.48	O
ATOM	8222	O	HOH	S	29	−14.326	14.259	84.635	1.00	19.68	O
ATOM	8223	O	HOH	S	30	−8.102	6.987	67.685	1.00	22.49	O
ATOM	8224	O	HOH	S	31	26.692	15.403	64.996	1.00	26.67	O
ATOM	8225	O	HOH	S	32	−7.898	5.568	70.330	1.00	28.68	O
ATOM	8226	O	HOH	S	33	−1.085	19.111	96.380	1.00	21.49	O
ATOM	8227	O	HOH	S	34	3.380	24.556	75.151	1.00	43.72	O
ATOM	8228	O	HOH	S	35	27.739	27.252	82.058	1.00	38.98	O
ATOM	8229	O	HOH	S	36	19.112	15.192	58.685	1.00	19.63	O
ATOM	8230	O	HOH	S	37	−2.911	26.134	71.807	1.00	28.60	O
ATOM	8231	O	HOH	S	38	7.559	0.608	89.004	1.00	25.81	O
ATOM	8232	O	HOH	S	39	−11.195	19.801	81.326	1.00	22.02	O
ATOM	8233	O	HOH	S	40	−0.690	13.278	89.901	1.00	27.83	O
ATOM	8234	O	HOH	S	41	−9.569	16.425	65.308	1.00	35.44	O
ATOM	8235	O	HOH	S	42	−2.051	15.092	60.530	1.00	33.27	O
ATOM	8236	O	HOH	S	43	−8.203	13.529	99.160	1.00	32.28	O
ATOM	8237	O	HOH	S	44	−4.814	8.626	97.478	1.00	25.22	O
ATOM	8238	O	HOH	S	45	7.913	39.628	72.687	1.00	34.13	O
ATOM	8239	O	HOH	S	46	−5.692	7.101	68.121	1.00	23.77	O
ATOM	8240	O	HOH	S	47	3.350	4.337	90.405	1.00	29.34	O
ATOM	8241	O	HOH	S	48	−0.647	24.199	79.409	1.00	42.40	O
ATOM	8242	O	HOH	S	49	2.430	9.235	83.252	1.00	24.84	O
ATOM	8243	O	HOH	S	50	1.833	25.905	82.808	1.00	35.93	O
ATOM	8244	O	HOH	S	51	4.202	9.699	93.766	1.00	31.21	O
ATOM	8245	O	HOH	S	52	24.929	33.687	78.248	1.00	33.27	O
ATOM	8246	O	HOH	S	53	−12.909	13.827	70.633	1.00	29.29	O
ATOM	8247	O	HOH	S	54	1.099	6.980	81.982	1.00	16.07	O
ATOM	8248	O	HOH	S	55	18.076	14.482	86.944	1.00	25.16	O
ATOM	8249	O	HOH	S	56	15.837	13.743	74.988	1.00	14.80	O
ATOM	8250	O	HOH	S	57	−6.914	−2.601	72.504	1.00	24.99	O
ATOM	8251	O	HOH	S	58	10.407	12.014	59.007	1.00	22.51	O
ATOM	8252	O	HOH	S	59	−10.634	9.895	69.885	1.00	27.70	O
ATOM	8253	O	HOH	S	60	24.600	22.845	77.427	1.00	19.23	O
ATOM	8254	O	HOH	S	61	−5.381	23.053	68.143	1.00	20.02	O
ATOM	8255	O	HOH	S	62	−7.874	17.568	96.874	1.00	16.75	O
ATOM	8256	O	HOH	S	63	−14.724	18.040	91.770	1.00	24.86	O
ATOM	8257	O	HOH	S	64	3.772	25.380	67.441	1.00	20.01	O
ATOM	8258	O	HOH	S	65	−13.116	15.350	72.940	1.00	30.75	O
ATOM	8259	O	HOH	S	66	−10.109	6.778	63.300	1.00	28.25	O
ATOM	8260	O	HOH	S	67	3.285	11.943	94.844	1.00	24.18	O
ATOM	8261	O	HOH	S	68	12.154	6.604	61.460	1.00	20.68	O
ATOM	8262	O	HOH	S	69	7.496	6.724	75.616	1.00	32.39	O
ATOM	8263	O	HOH	S	70	10.233	9.332	88.642	1.00	29.72	O
ATOM	8264	O	HOH	S	71	−9.454	−1.504	80.672	1.00	10.90	O
ATOM	8265	O	HOH	S	72	20.166	23.032	64.629	1.00	24.63	O
ATOM	8266	O	HOH	S	73	−18.791	7.731	82.550	1.00	17.95	O
ATOM	8267	O	HOH	S	74	2.666	11.033	80.786	1.00	23.16	O
ATOM	8268	O	HOH	S	75	−18.404	2.018	77.603	1.00	6.45	O
ATOM	8269	O	HOH	S	76	−7.109	13.236	64.292	1.00	22.10	O
ATOM	8270	O	HOH	S	77	8.180	26.356	67.308	1.00	25.74	O
ATOM	8271	O	HOH	S	78	3.053	22.573	73.022	1.00	36.70	O
ATOM	8272	O	HOH	S	79	−7.584	24.463	75.954	1.00	25.35	O
ATOM	8273	O	HOH	S	80	22.147	7.393	76.175	1.00	30.54	O
ATOM	8274	O	HOH	S	81	8.766	12.582	77.945	1.00	25.36	O
ATOM	8275	O	HOH	S	82	7.722	28.541	89.456	1.00	34.45	O
ATOM	8276	O	HOH	S	83	19.692	32.076	83.533	1.00	19.66	O
ATOM	8277	O	HOH	S	84	23.730	16.044	81.113	1.00	23.60	O
ATOM	8278	O	HOH	S	85	11.361	−1.523	83.138	1.00	33.59	O
ATOM	8279	O	HOH	S	86	11.020	26.643	71.517	1.00	17.48	O
ATOM	8280	O	HOH	S	87	13.993	11.203	83.138	1.00	22.45	O
ATOM	8281	O	HOH	S	88	−0.647	11.959	93.928	1.00	20.40	O
ATOM	8282	O	HOH	S	89	−6.158	19.109	95.982	1.00	15.52	O
ATOM	8283	O	HOH	S	90	10.105	4.971	70.240	1.00	32.18	O
ATOM	8284	O	HOH	S	91	−3.240	4.402	72.816	1.00	26.21	O
ATOM	8285	O	HOH	S	92	−14.385	−1.695	79.207	1.00	9.75	O
ATOM	8286	O	HOH	S	93	−2.498	4.193	69.718	1.00	18.69	O
ATOM	8287	O	HOH	S	94	8.795	26.670	78.625	1.00	13.34	O
ATOM	8288	O	HOH	S	95	2.256	24.010	81.688	1.00	20.63	O
ATOM	8289	O	HOH	S	96	12.188	26.263	68.871	1.00	20.08	O
ATOM	8290	O	HOH	S	97	9.827	−21.901	117.485	1.00	22.08	O
ATOM	8291	O	HOH	S	98	24.936	−38.085	84.324	1.00	7.67	O
ATOM	8292	O	HOH	S	99	0.643	−27.106	87.354	1.00	19.89	O
ATOM	8293	O	HOH	S	100	10.132	−23.404	88.290	1.00	17.09	O
ATOM	8294	O	HOH	S	101	12.180	−21.693	87.878	1.00	15.75	O
ATOM	8295	O	HOH	S	102	14.536	−32.296	109.447	1.00	19.31	O
ATOM	8296	O	HOH	S	103	4.032	−36.034	84.112	1.00	19.63	O
ATOM	8297	O	HOH	S	104	25.344	−19.909	85.942	1.00	20.10	O
ATOM	8298	O	HOH	S	105	8.107	−30.337	86.204	1.00	18.04	O
ATOM	8299	O	HOH	S	106	13.407	−23.569	91.389	1.00	20.83	O
ATOM	8300	O	HOH	S	107	−7.362	−25.880	113.607	1.00	20.66	O
ATOM	8301	O	HOH	S	108	23.600	−33.313	97.913	1.00	25.74	O
ATOM	8302	O	HOH	S	109	1.602	−28.712	76.418	1.00	16.79	O
ATOM	8303	O	HOH	S	110	21.274	−31.951	97.554	1.00	23.33	O
ATOM	8304	O	HOH	S	111	9.761	−20.076	105.094	1.00	18.09	O
ATOM	8305	O	HOH	S	112	14.144	−21.859	89.703	1.00	24.29	O
ATOM	8306	O	HOH	S	113	8.228	−22.274	95.106	1.00	20.83	O
ATOM	8307	O	HOH	S	114	−1.733	−35.448	109.541	1.00	19.44	O
ATOM	8308	O	HOH	S	115	0.950	−31.639	87.039	1.00	29.68	O
ATOM	8309	O	HOH	S	116	3.016	−27.124	85.974	1.00	18.53	O
ATOM	8310	O	HOH	S	117	1.188	−20.360	98.505	1.00	24.05	O
ATOM	8311	O	HOH	S	118	20.678	−30.912	105.042	1.00	19.24	O
ATOM	8312	O	HOH	S	119	21.881	−15.407	100.051	1.00	24.46	O
ATOM	8313	O	HOH	S	120	20.398	−41.513	93.566	1.00	27.05	O
ATOM	8314	O	HOH	S	121	26.862	−33.196	77.865	1.00	28.47	O
ATOM	8315	O	HOH	S	122	8.471	−20.256	77.121	1.00	18.54	O
ATOM	8316	O	HOH	S	123	3.212	−23.199	118.642	1.00	15.93	O
ATOM	8317	O	HOH	S	124	0.344	−19.356	86.925	1.00	32.96	O
ATOM	8318	O	HOH	S	125	6.529	−20.257	94.347	1.00	32.96	O
ATOM	8319	O	HOH	S	126	9.771	−39.430	84.144	1.00	29.29	O
ATOM	8320	O	HOH	S	127	9.644	−5.104	96.772	1.00	31.77	O
ATOM	8321	O	HOH	S	128	−5.490	−23.914	88.430	1.00	30.08	O
ATOM	8322	O	HOH	S	129	30.742	−27.366	81.823	1.00	16.78	O
ATOM	8323	O	HOH	S	130	−4.096	−33.781	91.498	1.00	22.19	O
ATOM	8324	O	HOH	S	131	10.256	−12.592	102.662	1.00	29.97	O
ATOM	8325	O	HOH	S	132	1.678	−32.162	83.900	1.00	25.75	O
ATOM	8326	O	HOH	S	133	1.027	−38.289	90.469	1.00	27.43	O
ATOM	8327	O	HOH	S	134	19.461	−36.807	77.186	1.00	23.03	O
ATOM	8328	O	HOH	S	135	10.293	−34.855	109.783	1.00	32.29	O
ATOM	8329	O	HOH	S	136	−2.291	−26.507	114.519	1.00	24.94	O
ATOM	8330	O	HOH	S	137	6.934	−27.525	117.115	1.00	19.61	O
ATOM	8331	O	HOH	S	138	6.502	−14.639	101.725	1.00	25.27	O
ATOM	8332	O	HOH	S	139	13.860	−18.446	97.192	1.00	35.04	O
ATOM	8333	O	HOH	S	140	−4.133	−34.900	109.273	1.00	20.34	O
ATOM	8334	O	HOH	S	141	−5.112	−39.092	104.886	1.00	24.25	O
ATOM	8335	O	HOH	S	142	12.552	−21.978	117.503	1.00	22.22	O
ATOM	8336	O	HOH	S	143	18.402	−34.335	78.672	1.00	19.40	O
ATOM	8337	O	HOH	S	144	−0.680	−24.384	98.333	1.00	25.65	O
ATOM	8338	O	HOH	S	145	12.625	−39.013	77.626	1.00	28.34	O
ATOM	8339	O	HOH	S	146	23.449	−32.596	76.198	1.00	26.56	O
ATOM	8340	O	HOH	S	147	29.807	−26.312	112.933	1.00	20.01	O
ATOM	8341	O	HOH	S	148	27.464	−25.196	115.005	1.00	9.28	O
ATOM	8342	O	HOH	S	149	29.431	−29.639	110.502	1.00	13.94	O
ATOM	8343	O	HOH	S	150	4.221	−13.079	95.584	1.00	42.41	O
ATOM	8344	O	HOH	S	151	−1.468	−38.162	111.032	1.00	23.14	O
ATOM	8345	O	HOH	S	152	15.434	−14.452	99.287	1.00	38.95	O
ATOM	8346	O	HOH	S	153	29.033	−20.734	75.583	1.00	27.52	O
ATOM	8347	O	HOH	S	154	11.741	−22.156	98.104	1.00	25.70	O
ATOM	8348	O	HOH	S	155	16.481	−13.784	111.145	1.00	24.65	O
ATOM	8349	O	HOH	S	156	11.911	−19.101	95.524	1.00	28.66	O
ATOM	8350	O	HOH	S	157	−0.223	−23.159	95.736	1.00	32.23	O
ATOM	8351	O	HOH	S	158	18.416	−14.199	93.943	1.00	26.35	O
ATOM	8352	O	HOH	S	159	−2.647	−27.525	96.727	1.00	31.45	O
ATOM	8353	O	HOH	S	160	17.051	−40.632	96.780	1.00	31.25	O
ATOM	8354	O	HOH	S	161	11.471	−11.535	99.068	1.00	29.83	O
ATOM	8355	O	HOH	S	162	24.932	−17.040	88.452	1.00	22.29	O
ATOM	8356	O	HOH	S	163	27.184	−23.674	117.108	1.00	24.41	O
ATOM	8357	O	HOH	S	164	23.078	−16.700	77.901	1.00	22.70	O
ATOM	8358	O	HOH	S	165	−2.643	−21.416	103.436	1.00	32.18	O
ATOM	8359	O	HOH	S	166	5.768	−36.309	76.898	1.00	26.30	O
ATOM	8360	O	HOH	S	167	9.935	−17.735	95.615	1.00	44.63	O
ATOM	8361	O	HOH	S	168	−0.262	−25.700	117.449	1.00	21.14	O
ATOM	8362	O	HOH	S	169	12.179	−35.090	74.455	1.00	28.62	O
ATOM	8363	O	HOH	S	170	16.543	−10.871	103.291	1.00	20.50	O
ATOM	8364	O	HOH	S	171	16.641	−37.012	101.670	1.00	34.66	O
ATOM	8365	O	HOH	S	172	−0.773	−29.882	87.429	1.00	23.92	O
ATOM	8366	O	HOH	S	173	−2.179	−22.054	100.847	1.00	21.00	O
ATOM	8367	O	HOH	S	174	4.053	−16.182	104.427	1.00	50.25	O
ATOM	8368	O	HOH	S	175	10.766	−12.156	105.410	1.00	19.60	O
ATOM	8369	O	HOH	S	176	16.889	−19.664	117.027	1.00	23.06	O
ATOM	8370	O	HOH	S	177	−0.689	−24.536	79.431	1.00	25.78	O
ATOM	8371	O	HOH	S	178	−5.326	−28.870	96.514	1.00	33.20	O
ATOM	8372	O	HOH	S	179	4.908	−15.704	103.038	1.00	47.77	O
ATOM	8373	O	HOH	S	180	4.993	−15.341	97.968	1.00	30.21	O
ATOM	8374	O	HOH	S	181	31.405	−33.192	112.823	1.00	34.15	O
ATOM	8375	O	HOH	S	182	24.408	−30.477	72.907	1.00	25.60	O
ATOM	8376	O	HOH	S	183	14.020	−14.569	103.616	1.00	22.92	O
ATOM	8377	O	HOH	S	184	21.258	−15.129	116.030	1.00	13.23	O
ATOM	8378	O	HOH	S	185	26.478	−32.419	103.620	1.00	24.83	O
ATOM	8379	O	HOH	S	186	10.460	−38.043	104.325	1.00	26.05	O
ATOM	8380	O	HOH	S	187	−5.404	−26.834	101.195	1.00	25.30	O
ATOM	8381	O	HOH	S	188	18.956	−37.230	84.815	1.00	25.97	O
ATOM	8382	O	HOH	S	189	−1.319	−37.828	96.344	1.00	27.71	O
ATOM	8383	O	HOH	S	190	−4.388	−35.434	102.281	1.00	26.23	O
ATOM	8384	O	HOH	S	191	7.118	−14.775	115.570	1.00	18.18	O
ATOM	8385	O	HOH	S	192	1.261	−21.092	76.141	1.00	29.68	O
ATOM	8386	O	HOH	S	193	12.356	−38.022	75.284	1.00	26.81	O
ATOM	8387	O	HOH	S	194	6.301	3.453	78.830	1.00	35.93	O
ATOM	8388	O	HOH	S	195	−16.503	16.080	84.965	1.00	25.88	O
ATOM	8389	O	HOH	S	196	−1.221	−21.095	95.587	1.00	25.85	O
ATOM	8390	O	HOH	S	197	3.995	−27.947	117.147	1.00	20.63	O
ATOM	8391	O	HOH	S	198	1.906	−36.042	85.629	1.00	20.49	O
ATOM	8392	O	HOH	S	199	30.633	−7.979	97.903	1.00	12.48	O
ATOM	8393	O	HOH	S	200	−3.672	−23.554	99.216	1.00	31.50	O
ATOM	8394	O	HOH	S	201	34.085	−36.889	86.839	1.00	15.05	O
ATOM	8395	O	HOH	S	202	9.304	35.547	84.371	1.00	25.53	O
ATOM	8396	O	HOH	S	203	4.831	−33.963	77.745	1.00	25.01	O
ATOM	8397	O	HOH	S	204	3.361	−34.091	82.648	1.00	19.63	O
ATOM	8398	O	HOH	S	205	18.977	−37.610	74.409	1.00	25.39	O
ATOM	8399	O	HOH	S	206	−11.991	23.416	86.183	1.00	12.11	O
ATOM	8400	O	HOH	S	207	−21.118	4.569	83.181	1.00	17.78	O
ATOM	8401	O	HOH	S	208	14.988	−28.059	67.041	1.00	14.52	O
ATOM	8402	O	HOH	S	209	2.814	25.911	70.291	1.00	19.94	O
ATOM	8403	O	HOH	S	210	−3.477	−37.642	103.241	1.00	26.47	O
ATOM	8404	O	HOH	S	211	−9.339	9.207	67.701	1.00	22.43	O
ATOM	8405	O	HOH	S	212	7.036	34.814	83.987	1.00	25.13	O
ATOM	8406	O	HOH	S	213	−14.042	19.252	78.099	1.00	30.33	O
ATOM	8407	O	HOH	S	214	6.739	−24.867	117.142	1.00	18.15	O
ATOM	8408	O	HOH	S	215	5.947	28.859	70.765	1.00	31.06	O
ATOM	8409	O	HOH	S	216	−2.701	26.463	79.845	1.00	20.12	O
ATOM	8410	O	HOH	S	217	14.326	8.724	84.446	1.00	30.71	O
ATOM	8411	O	HOH	S	218	−18.120	8.896	86.200	1.00	21.72	O
ATOM	8412	O	HOH	S	219	−3.364	−29.297	87.731	1.00	21.43	O
ATOM	8413	O	HOH	S	220	6.151	25.819	70.332	1.00	31.90	O
ATOM	8414	O	HOH	S	221	6.226	12.552	95.790	1.00	24.36	O
ATOM	8415	O	HOH	S	222	−2.950	−25.055	95.340	1.00	25.30	O
ATOM	8416	O	HOH	S	223	6.124	−0.314	87.042	1.00	39.45	O
ATOM	8417	O	HOH	S	224	25.865	−34.275	101.945	1.00	28.79	O
ATOM	8418	O	HOH	S	225	14.968	−41.154	100.575	1.00	24.20	O
ATOM	8419	O	HOH	S	226	22.534	−30.563	74.493	1.00	29.80	O
ATOM	8420	O	HOH	S	227	9.898	9.739	59.451	1.00	23.89	O
ATOM	8421	O	HOH	S	228	−18.450	11.391	87.308	1.00	35.35	O
ATOM	8422	O	HOH	S	229	11.020	29.183	68.361	1.00	25.29	O
ATOM	8423	O	HOH	S	230	12.401	24.227	97.943	1.00	13.15	O
ATOM	8424	O	HOH	S	231	17.174	23.709	97.668	1.00	16.32	O
ATOM	8425	O	HOH	S	232	15.430	29.366	98.099	1.00	19.40	O
ATOM	8426	O	HOH	S	233	8.062	−42.720	92.132	1.00	33.03	O
ATOM	8427	O	HOH	S	234	−18.362	14.035	86.404	1.00	17.97	O
ATOM	8428	O	HOH	S	235	−17.088	16.268	88.540	1.00	28.91	O

TABLE 3
Atomic coordinates for LRH crystal
HEADER	---	XX-XXX-XX xxxx
COMPND	HUMAN LRH-1, LBD, CADIOLIPIN bouond, TWO GRIP-1 NB3 BOUND
REMARK	3
REMARK	3	REFINEMENT.
REMARK	3	PROGRAM	: REFMAC 5.1.25
REMARK	3	AUTHORS	: MURSHUDOV, VAGIN, DODSON
REMARK	3
REMARK	3	REFINEMENT TARGET: MAXIMUM LIKELIHOOD
REMARK	3
REMARK	3	DATA USED IN REFINEMENT.
REMARK	3	RESOLUTION RANGE HIGH	(ANGSTROMS) :	2.50
REMARK	3	RESOLUTION RANGE LOW	(ANGSTROMS) :	50.00
REMARK	3	DATA CUTOFF	(SIGMA(F)) :	NONE
REMARK	3	COMPLETENESS FOR RANGE	(%) :	99.37
REMARK	3	NUMBER OF REFLECTIONS	:	10899
REMARK	3
REMARK	3	FIT TO DATA USED IN REFINEMENT.
REMARK	3	CROSS-VALIDATION METHOD	: THROUGHOUT
REMARK	3	FREE R VALUE TEST SET SELECTION	: RANDOM
REMARK	3	R VALUE	(WORKING + TEST SET)	: 0.24161
REMARK	3	R VALUE	(WORKING SET)	:  0.23942
REMARK	3	FREE R VALUE	:  0.28129
REMARK	3	FREE R VALUE TEST SET SIZE	(%)	:  5.2
REMARK	3	FREE R VALUE TEST SET COUNT	:  595
REMARK	3
REMARK	3	FIT IN THE HIGHEST RESOLUTION BIN.
REMARK	3	TOTAL NUMBER OF BINS USED	:    20
REMARK	3	BIN RESOLUTION RANGE HIGH	:  2.500
REMARK	3	BIN RESOLUTION RANGE LOW	:  2.565
REMARK	3	REFLECTION IN BIN	(WORKING SET)	:    777
REMARK	3	BIN R VALUE	(WORKING SET)	:  0.331
REMARK	3	BIN FREE R VALUE SET COUNT	:    32
REMARK	3	BIN FREE R VALUE	:  0.349
REMARK	3
REMARK	3	NUMBER OF NON-HYDROGEN ATOMS USED IN REFINEMENT.
REMARK	3	ALL ATOMS	:   2169
REMARK	3
REMARK	3	B VALUES.
REMARK	3	FROM WILSON PLOT	(A**2)	: NULL
REMARK	3	MEAN B VALUE	(OVERALL, A**2)	:  32.206
REMARK	3	OVERALL ANISOTROPIC B VALUE.
REMARK	3	B11 (A**2) :   −1.28
REMARK	3	B22 (A**2) :   −2.04
REMARK	3	B33 (A**2) :     3.32
REMARK	3	B12 (A**2) :     0.00
REMARK	3	B13 (A**2) :     0.00
REMARK	3	B23 (A**2) :     0.00
REMARK	3
REMARK	3	ESTIMATED OVERALL COORDINATE ERROR.
REMARK	3	ESU BASED ON R VALUE	(A) :	0.603
REMARK	3	ESU BASED ON FREE R VALUE	(A) :	0.320
REMARK	3	ESU BASED ON MAXIMUM LIKELIHOOD	(A) :	0.272
REMARK	3	ESU FOR B VALUES BASED ON MAXIMUM LIKELIHOOD	(A**2) :	12.874
REMARK	3
REMARK	3	CORRELATION COEFFICIENTS.
REMARK	3	CORRELATION COEFFICIENT FO-FC	:  0.937
REMARK	3	CORRELATION COEFFICIENT FO-FC FREE	:  0.924
REMARK	3
REMARK	3	RMS DEVIATIONS FROM IDEAL VALUES	COUNT	RMS	WEIGHT
REMARK	3	BOND LENGTHS REFINED ATOMS	(A):	2167 ;	0.008 ;	0.022
REMARK	3	BOND LENGTHS OTHERS	(A):	2021 ;	0.002 ;	0.020
REMARK	3	BOND ANGLES REFINED ATOMS	(DEGREES):	2913 ;	1.034 ;	1.999
REMARK	3	BOND ANGLES OTHERS	(DEGREES):	4722 ;	0.722 ;	3.000
REMARK	3	TORSION ANGLES, PERIOD 1	(DEGREES):	250 ;	5.261 ;	5.000
REMARK	3	CHIRAL-CENTER RESTRAINTS	(A**3):	328 ;	0.053 ;	0.200
REMARK	3	GENERAL PLANES REFINED ATOMS	(A):	2298 ;	0.003 ;	0.020
REMARK	3	GENERAL PLANES OTHERS	(A):	405 ;	0.001 ;	0.020
REMARK	3	NON-BONDED CONTACTS REFINED ATOMS	(A):	507 ;	0.179 ;	0.200
REMARK	3	NON-BONDED CONTACTS OTHERS	(A):	2284 ;	0.192 ;	0.200
REMARK	3	NON-BONDED TORSION OTHERS	(A):	1324 ;	0.087 ;	0.200
REMARK	3	H-BOND (X...Y) REFINED ATOMS	(A):	39 ;	0.164 ;	0.200
REMARK	3	SYMMETRY VDW REFINED ATOMS	(A):	10 ;	0.153 ;	0.200
REMARK	3	SYMMETRY VDW OTHERS	(A):	53 ;	0.136 ;	0.200
REMARK	3	SYMMETRY H-BOND REFINED ATOMS	(A):	4 ;	0.372 ;	0.200
REMARK	3
REMARK	3	ISOTROPIC THERMAL FACTOR RESTRAINTS.	COUNT	RMS	WEIGHT
REMARK	3	MAIN-CHAIN BOND REFINED ATOMS	(A**2):	1268 ;	0.203 ;	1.500
REMARK	3	MAIN-CHAIN ANGLE REFINED ATOMS	(A**2):	2037 ;	0.396 ;	2.000
REMARK	3	SIDE-CHAIN BOND REFINED ATOMS	(A**2):	899 ;	0.729 ;	3.000
REMARK	3	SIDE-CHAIN ANGLE REFINED ATOMS	(A**2):	876 ;	1.213 ;	4.500
REMARK	3
REMARK	3	NCS RESTRAINTS STATISTICS
REMARK	3	NUMBER OF NCS GROUPS : NULL
REMARK	3
REMARK	3
REMARK	3	TLS DETAILS
REMARK	3	NUMBER OF TLS GROUPS :  4
REMARK	3
REMARK	3	TLS GROUP :   1
REMARK	3	NUMBER OF COMPONENTS GROUP :    5
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE :	A	253		A	284
REMARK	3	RESIDUE RANGE :	A	292		A	492
REMARK	3	RESIDUE RANGE :	L	1		L	1
REMARK	3	RESIDUE RANGE :	L	3		L	3
REMARK	3	RESIDUE RANGE :	S	1		S	26
REMARK	3	ORIGIN FOR THE GROUP (A):  6.5570  28.9030  9.4730
REMARK	3	T TENSOR
REMARK	3	T11:	0.2196 T22:	0.2025
REMARK	3	T33:	0.1271 T12:	−0.1156
REMARK	3	T13:	0.0150 T23:	−0.0164
REMARK	3	L TENSOR
REMARK	3	L11:	4.1042 L22:	4.8604
REMARK	3	L33:	3.3226 L12:	−1.0404
REMARK	3	L13:	−1.2019 L23:	2.1420
REMARK	3	S TENSOR
REMARK	3	S11:	0.0552 S12:	0.4310 S13:	0.2096
REMARK	3	S21:	−0.2874 S22:	0.1482 S23:	0.0435
REMARK	3	S31:	−0.1607 S32:	0.1279 S33:	−0.2034
REMARK	3
REMARK	3	TLS GROUP :   2
REMARK	3	NUMBER OF COMPONENTS GROUP : 10  1
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE :	S	27		S	30
REMARK	3	ORIGIN FOR THE GROUP (A):  1.8830  13.9510  10.3950
REMARK	3	T TENSOR
REMARK	3	T11:	0.3899 T22:	0.3846
REMARK	3	T33:	0.3917 T12:	−0.0069
REMARK	3	T13:	−0.0080 T23:	−0.0028
REMARK	3	L TENSOR
REMARK	3	L11:	13.3866 L22:	8.4652
REMARK	3	L33:	2.3797 L12:	16.5096
REMARK	3	L13:	20.9657 L23:	6.5128
REMARK	3	S TENSOR
REMARK	3	S11:	−0.2123 S12:	3.4380 S13:	−2.4695
REMARK	3	S21:	0.4630 S22:	0.0037 S23:	0.3701
REMARK	3	S31:	−0.4595 S32:	1.3261 S33:	0.2086
REMARK	3
REMARK	3	TLS GROUP :   3
REMARK	3	NUMBER OF COMPONENTS GROUP :   2
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE :	P	741		P	751
REMARK	3	RESIDUE RANGE :	S	31		S	33
REMARK	3	ORIGIN FOR THE GROUP (A):  25.2440  24.0090  10.7780
REMARK	3	T TENSOR
REMARK	3	T11:	0.3312 T22:	0.3836
REMARK	3	T33:	0.1885 T12:	−0.1248
REMARK	3	T13:	0.0035 T23:	−0.2482
REMARK	3	L TENSOR
REMARK	3	L11:	27.0359 L22:	12.8898
REMARK	3	L33:	3.0488 L12:	−11.5308
REMARK	3	L13:	6.9418 L23:	9.7576
REMARK	3	S TENSOR
REMARK	3	S11:	−0.1796 S12:	−0.7811 S13:	0.0328
REMARK	3	S21:	0.0981 S22:	0.6418 S23:	−0.9020
REMARK	3	S31:	0.3258 S32:	0.3699 S33:	−0.4622
REMARK	3
REMARK	3	TLS GROUP :   4
REMARK	3	NUMBER OF COMPONENTS GROUP :   2
REMARK	3	COMPONENTS	C	SSSEQI	TO	C	SSSEQI
REMARK	3	RESIDUE RANGE:	Q	742		Q	751
REMARK	3	RESIDUE RANGE:	S	34		S	34
REMARK	3	ORIGIN FOR THE GROUP (A):  2.0970  14.6320  −9.7540
REMARK	3	T TENSOR
REMARK	3	T11:	0.3641 T22:	0.7886
REMARK	3	T33:	0.3224 T12:	0.0231
REMARK	3	T13:	−0.0287 T23:	−0.3737
REMARK	3	L TENSOR
REMARK	3	L11:	12.2712 L22:	36.0604
REMARK	3	L33:	29.0357 L12:	8.7367
REMARK	3	L13:	−1.5182 L23:	−6.3934
REMARK	3	S TENSOR
REMARK	3	S11:	0.2279 S12:	−0.5890 S13:	0.3514
REMARK	3	S21:	−0.2928 S22:	−0.1347 S23:	−0.9119
REMARK	3	S31:	−1.2806 S32:	0.5486 S33:	−0.0932
REMARK	3
REMARK	3
REMARK	3	BULK SOLVENT MODELLING.
REMARK	3	METHOD USED: BABINET MODEL WITH MASK
REMARK	3	PARAMETERS FOR MASK CALCULATION
REMARK	3	VDW PROBE RADIUS	:  1.40
REMARK	3	ION PROBE RADIUS	:  0.80
REMARK	3	SHRINKAGE RADIUS	:  0.80
REMARK	3
REMARK	3	OTHER REFINEMENT REMARKS:
REMARK	3	HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS
REMARK	3
LINK		GLN A 284        LYS A 292        gap
CRYST1	61.010  67.000  78.210  90.00 90.00 90.00 P 21 21 21   0
SCALE1	0.016391  0.000000  0.000000   0.00000
SCALE2	0.000000  0.014925  0.000000   0.00000
SCALE3	0.000000  0.000000  0.012786   0.00000
ATOM	1	N	ALA	A	253	−0.028	51.603	1.317	1.00	35.04	N
ATOM	2	CA	ALA	A	253	0.140	51.454	2.791	1.00	35.02	C
ATOM	3	CB	ALA	A	253	0.597	50.029	3.128	1.00	34.99	C
ATOM	4	C	ALA	A	253	1.130	52.487	3.344	1.00	35.03	C
ATOM	5	O	ALA	A	253	1.654	53.326	2.601	1.00	35.03	O
ATOM	10	N	SER	A	254	1.347	52.434	4.659	1.00	34.96	N
ATOM	11	CA	SER	A	254	2.419	53.178	5.327	1.00	34.85	C
ATOM	12	CB	SER	A	254	1.872	54.385	6.098	1.00	34.74	C
ATOM	13	OG	SER	A	254	1.057	53.989	7.188	1.00	34.80	O
ATOM	14	C	SER	A	254	3.145	52.198	6.255	1.00	34.78	C
ATOM	15	O	SER	A	254	2.549	51.648	7.188	1.00	34.95	O
ATOM	21	N	ILE	A	255	4.426	51.975	5.977	1.00	34.55	N
ATOM	22	CA	ILE	A	255	5.174	50.888	6.584	1.00	34.41	C
ATOM	23	CB	ILE	A	255	5.728	49.955	5.479	1.00	34.48	C
ATOM	24	CG1	ILE	A	255	4.617	49.530	4.504	1.00	34.49	C
ATOM	25	CD1	ILE	A	255	5.127	49.148	3.123	1.00	34.63	C
ATOM	26	CG2	ILE	A	255	6.371	48.716	6.097	1.00	34.54	C
ATOM	27	C	ILE	A	255	6.318	51.442	7.428	1.00	34.29	C
ATOM	28	O	ILE	A	255	7.280	51.965	6.875	1.00	34.19	O
ATOM	40	N	PRO	A	256	6.226	51.324	8.755	1.00	34.34	N
ATOM	41	CA	PRO	A	256	7.305	51.769	9.651	1.00	34.38	C
ATOM	42	CB	PRO	A	256	6.932	51.136	10.993	1.00	34.33	C
ATOM	43	CG	PRO	A	256	5.456	50.995	10.947	1.00	34.37	C
ATOM	44	CD	PRO	A	256	5.094	50.754	9.509	1.00	34.40	C
ATOM	45	C	PRO	A	256	8.664	51.263	9.190	1.00	34.52	C
ATOM	46	O	PRO	A	256	8.746	50.136	8.703	1.00	34.52	O
ATOM	54	N	HIS	A	257	9.706	52.075	9.344	1.00	34.67	N
ATOM	55	CA	HIS	A	257	10.997	51.775	8.725	1.00	34.84	C
ATOM	56	CB	HIS	A	257	12.056	52.818	9.089	1.00	34.94	C
ATOM	57	CG	HIS	A	257	13.344	52.637	8.348	1.00	35.70	C
ATOM	58	ND1	HIS	A	257	14.576	52.855	8.926	1.00	36.95	N
ATOM	59	CE1	HIS	A	257	15.526	52.614	8.039	1.00	37.08	C
ATOM	60	NE2	HIS	A	257	14.956	52.239	6.908	1.00	36.60	N
ATOM	61	CD2	HIS	A	257	13.592	52.244	7.075	1.00	36.39	C
ATOM	62	C	HIS	A	257	11.534	50.384	9.049	1.00	34.64	C
ATOM	63	O	HIS	A	257	12.142	49.752	8.190	1.00	34.67	O
ATOM	72	N	LEU	A	258	11.319	49.911	10.274	1.00	34.47	N
ATOM	73	CA	LEU	A	258	11.841	48.608	10.681	1.00	34.37	C
ATOM	74	CB	LEU	A	258	11.629	48.366	12.181	1.00	34.33	C
ATOM	75	CG	LEU	A	258	12.156	47.034	12.743	1.00	34.17	C
ATOM	76	CD1	LEU	A	258	13.650	46.901	12.515	1.00	34.23	C
ATOM	77	CD2	LEU	A	258	11.834	46.886	14.225	1.00	33.95	C
ATOM	78	C	LEU	A	258	11.205	47.485	9.863	1.00	34.51	C
ATOM	79	O	LEU	A	258	11.888	46.539	9.483	1.00	34.67	O
ATOM	91	N	ILE	A	259	9.901	47.595	9.601	1.00	34.47	N
ATOM	92	CA	ILE	A	259	9.184	46.624	8.773	1.00	34.23	C
ATOM	93	CB	ILE	A	259	7.650	46.875	8.816	1.00	34.21	C
ATOM	94	CG1	ILE	A	259	7.126	46.688	10.245	1.00	34.13	C
ATOM	95	CD1	ILE	A	259	5.608	46.774	10.386	1.00	34.05	C
ATOM	96	CG2	ILE	A	259	6.910	45.936	7.838	1.00	34.09	C
ATOM	97	C	ILE	A	259	9.685	46.630	7.329	1.00	34.20	C
ATOM	98	O	ILE	A	259	9.696	45.590	6.683	1.00	34.37	O
ATOM	110	N	LEU	A	260	10.087	47.789	6.816	1.00	34.17	N
ATOM	111	CA	LEU	A	260	10.668	47.856	5.474	1.00	34.22	C
ATOM	112	CB	LEU	A	260	10.936	49.307	5.047	1.00	34.28	C
ATOM	113	CG	LEU	A	260	9.735	50.187	4.679	1.00	34.15	C
ATOM	114	CD1	LEU	A	260	10.197	51.608	4.366	1.00	33.45	C
ATOM	115	CD2	LEU	A	260	8.954	49.602	3.503	1.00	34.15	C
ATOM	116	C	LEU	A	260	11.962	47.045	5.404	1.00	34.19	C
ATOM	117	O	LEU	A	260	12.224	46.381	4.402	1.00	34.22	O
ATOM	129	N	GLU	A	261	12.756	47.087	6.473	1.00	34.17	N
ATOM	130	CA	GLU	A	261	14.004	46.326	6.533	1.00	34.21	C
ATOM	131	CB	GLU	A	261	14.906	46.805	7.683	1.00	34.22	C
ATOM	132	CG	GLU	A	261	15.294	48.283	7.636	1.00	34.51	C
ATOM	133	CD	GLU	A	261	16.406	48.614	6.642	1.00	35.08	C
ATOM	134	OE1	GLU	A	261	16.696	47.801	5.738	1.00	35.35	O
ATOM	135	OE2	GLU	A	261	16.996	49.712	6.761	1.00	35.39	O
ATOM	136	C	GLU	A	261	13.739	44.821	6.655	1.00	34.18	C
ATOM	137	O	GLU	A	261	14.434	44.022	6.030	1.00	34.27	O
ATOM	144	N	LEU	A	262	12.732	44.437	7.438	1.00	34.19	N
ATOM	145	CA	LEU	A	262	12.372	43.025	7.583	1.00	34.16	C
ATOM	146	CB	LEU	A	262	11.336	42.815	8.690	1.00	34.09	C
ATOM	147	CG	LEU	A	262	11.505	43.371	10.105	1.00	34.22	C
ATOM	148	CD1	LEU	A	262	10.235	43.069	10.909	1.00	34.46	C
ATOM	149	CD2	LEU	A	262	12.724	42.800	10.816	1.00	34.11	C
ATOM	150	C	LEU	A	262	11.819	42.448	6.276	1.00	34.16	C
ATOM	151	O	LEU	A	262	11.961	41.260	6.013	1.00	34.24	O
ATOM	163	N	LEU	A	263	11.186	43.294	5.468	1.00	34.28	N
ATOM	164	CA	LEU	A	263	10.620	42.880	4.186	1.00	34.29	C
ATOM	165	CB	LEU	A	263	9.709	43.970	3.622	1.00	34.21	C
ATOM	166	CG	LEU	A	263	8.296	44.003	4.195	1.00	34.12	C
ATOM	167	CD1	LEU	A	263	7.651	45.353	3.913	1.00	34.11	C
ATOM	168	CD2	LEU	A	263	7.449	42.857	3.631	1.00	33.80	C
ATOM	169	C	LEU	A	263	11.702	42.557	3.163	1.00	34.52	C
ATOM	170	O	LEU	A	263	11.517	41.673	2.326	1.00	34.65	O
ATOM	182	N	LYS	A	264	12.824	43.274	3.232	1.00	34.77	N
ATOM	183	CA	LYS	A	264	13.944	43.069	2.309	1.00	34.88	C
ATOM	184	CB	LYS	A	264	14.989	44.181	2.476	1.00	34.88	C
ATOM	185	CG	LYS	A	264	14.546	45.536	1.916	1.00	34.69	C
ATOM	186	CD	LYS	A	264	15.605	46.623	2.104	1.00	34.14	C
ATOM	187	CE	LYS	A	264	15.012	48.029	1.932	1.00	34.29	C
ATOM	188	NZ	LYS	A	264	15.905	48.961	1.171	1.00	34.46	N
ATOM	189	C	LYS	A	264	14.609	41.693	2.461	1.00	35.16	C
ATOM	190	O	LYS	A	264	15.318	41.244	1.556	1.00	35.37	O
ATOM	204	N	CYS	A	265	14.362	41.029	3.592	1.00	35.36	N
ATOM	205	CA	CYS	A	265	14.913	39.701	3.883	1.00	35.51	C
ATOM	206	CB	CYS	A	265	15.025	39.509	5.400	1.00	35.53	C
ATOM	207	SG	CYS	A	265	15.969	40.801	6.253	1.00	36.50	S
ATOM	208	C	CYS	A	265	14.109	38.533	3.287	1.00	35.47	C
ATOM	209	O	CYS	A	265	14.568	37.394	3.310	1.00	35.70	O
ATOM	215	N	GLU	A	266	12.920	38.815	2.762	1.00	35.41	N
ATOM	216	CA	GLU	A	266	12.057	37.792	2.169	1.00	35.35	C
ATOM	217	CB	GLU	A	266	10.660	38.372	1.931	1.00	35.27	C
ATOM	218	CG	GLU	A	266	9.887	38.643	3.208	1.00	35.13	C
ATOM	219	CD	GLU	A	266	9.531	37.366	3.922	1.00	34.75	C
ATOM	220	OE1	GLU	A	266	10.097	37.091	5.009	1.00	33.72	O
ATOM	221	OE2	GLU	A	266	8.703	36.626	3.362	1.00	35.80	O
ATOM	222	C	GLU	A	266	12.602	37.277	0.840	1.00	35.54	C
ATOM	223	O	GLU	A	266	12.744	38.051	−0.095	1.00	35.91	O
ATOM	230	N	PRO	A	267	12.881	35.981	0.732	1.00	35.85	N
ATOM	231	CA	PRO	A	267	13.479	35.432	−0.494	1.00	36.14	C
ATOM	232	CB	PRO	A	267	13.901	34.019	−0.080	1.00	36.16	C
ATOM	233	CG	PRO	A	267	12.969	33.650	1.016	1.00	36.22	C
ATOM	234	CD	PRO	A	267	12.642	34.934	1.741	1.00	36.03	C
ATOM	235	C	PRO	A	267	12.508	35.379	−1.671	1.00	36.43	C
ATOM	236	O	PRO	A	267	11.303	35.505	−1.460	1.00	36.66	O
ATOM	244	N	ASP	A	268	13.036	35.205	−2.886	1.00	36.59	N
ATOM	245	CA	ASP	A	268	12.202	35.072	−4.083	1.00	36.67	C
ATOM	246	CB	ASP	A	268	13.042	35.177	−5.372	1.00	36.75	C
ATOM	247	CG	ASP	A	268	12.247	35.731	−6.558	1.00	37.23	C
ATOM	248	OD1	ASP	A	268	11.582	36.780	−6.399	1.00	38.06	O
ATOM	249	OD2	ASP	A	268	12.234	35.199	−7.692	1.00	37.63	O
ATOM	250	C	ASP	A	268	11.480	33.732	−4.025	1.00	36.79	C
ATOM	251	O	ASP	A	268	12.092	32.679	−4.235	1.00	36.90	O
ATOM	256	N	GLU	A	269	10.183	33.784	−3.717	1.00	36.76	N
ATOM	257	CA	GLU	A	269	9.342	32.585	−3.627	1.00	36.63	C
ATOM	258	CB	GLU	A	269	7.869	32.962	−3.430	1.00	36.81	C
ATOM	259	CG	GLU	A	269	7.375	32.895	−1.995	1.00	38.11	C
ATOM	260	CD	GLU	A	269	5.861	33.078	−1.891	1.00	40.19	C
ATOM	261	OE1	GLU	A	269	5.189	33.080	−2.953	1.00	39.55	O
ATOM	262	OE2	GLU	A	269	5.342	33.216	−0.742	1.00	42.24	O
ATOM	263	C	GLU	A	269	9.464	31.664	−4.851	1.00	36.33	C
ATOM	264	O	GLU	A	269	9.605	30.453	−4.680	1.00	36.29	O
ATOM	271	N	PRO	A	270	9.386	32.216	−6.068	1.00	35.81	N
ATOM	272	CA	PRO	A	270	9.456	31.392	−7.286	1.00	35.72	C
ATOM	273	CB	PRO	A	270	9.381	32.428	−8.418	1.00	35.67	C
ATOM	274	CG	PRO	A	270	8.716	33.598	−7.819	1.00	35.66	C
ATOM	275	CD	PRO	A	270	9.178	33.639	−6.396	1.00	35.62	C
ATOM	276	C	PRO	A	270	10.721	30.528	−7.433	1.00	35.64	C
ATOM	277	O	PRO	A	270	10.646	29.469	−8.058	1.00	35.87	O
ATOM	285	N	GLN	A	271	11.849	30.977	−6.886	1.00	35.43	N
ATOM	286	CA	GLN	A	271	13.108	30.238	−6.982	1.00	35.29	C
ATOM	287	CB	GLN	A	271	14.306	31.191	−6.863	1.00	35.33	C
ATOM	288	CG	GLN	A	271	14.651	31.868	−8.199	1.00	35.89	C
ATOM	289	CD	GLN	A	271	15.692	32.974	−8.085	1.00	36.39	C
ATOM	290	OE1	GLN	A	271	16.176	33.281	−6.992	1.00	37.36	O
ATOM	291	NE2	GLN	A	271	16.036	33.576	−9.220	1.00	36.72	N
ATOM	292	C	GLN	A	271	13.186	29.123	−5.942	1.00	35.19	C
ATOM	293	O	GLN	A	271	13.676	28.033	−6.231	1.00	34.98	O
ATOM	302	N	VAL	A	272	12.701	29.398	−4.733	1.00	35.21	N
ATOM	303	CA	VAL	A	272	12.583	28.370	−3.698	1.00	35.12	C
ATOM	304	CB	VAL	A	272	12.025	28.964	−2.376	1.00	35.21	C
ATOM	305	CG1	VAL	A	272	11.755	27.855	−1.342	1.00	35.08	C
ATOM	306	CG2	VAL	A	272	12.975	30.031	−1.808	1.00	35.06	C
ATOM	307	C	VAL	A	272	11.652	27.245	−4.184	1.00	35.04	C
ATOM	308	O	VAL	A	272	11.912	26.060	−3.969	1.00	35.24	O
ATOM	318	N	GLN	A	273	10.588	27.651	−4.869	1.00	34.71	N
ATOM	319	CA	GLN	A	273	9.518	26.777	−5.336	1.00	34.40	C
ATOM	320	CB	GLN	A	273	8.449	27.662	−5.977	1.00	34.54	C
ATOM	321	CG	GLN	A	273	7.136	27.005	−6.297	1.00	34.62	C
ATOM	322	CD	GLN	A	273	6.093	28.027	−6.700	1.00	34.79	C
ATOM	323	OE1	GLN	A	273	5.679	28.079	−7.859	1.00	34.90	O
ATOM	324	NE2	GLN	A	273	5.681	28.860	−5.747	1.00	34.57	N
ATOM	325	C	GLN	A	273	9.983	25.722	−6.337	1.00	34.07	C
ATOM	326	O	GLN	A	273	9.655	24.543	−6.200	1.00	33.83	O
ATOM	335	N	ALA	A	274	10.739	26.157	−7.343	1.00	33.91	N
ATOM	336	CA	ALA	A	274	11.242	25.271	−8.400	1.00	33.62	C
ATOM	337	CB	ALA	A	274	11.479	26.059	−9.669	1.00	33.73	C
ATOM	338	C	ALA	A	274	12.523	24.544	−7.995	1.00	33.44	C
ATOM	339	O	ALA	A	274	12.847	23.503	−8.557	1.00	33.36	O
ATOM	345	N	LYS	A	275	13.255	25.111	−7.037	1.00	33.32	N
ATOM	346	CA	LYS	A	275	14.398	24.439	−6.417	1.00	33.26	C
ATOM	347	CB	LYS	A	275	15.112	25.387	−5.435	1.00	33.47	C
ATOM	348	CG	LYS	A	275	16.255	24.764	−4.577	1.00	34.38	C
ATOM	349	CD	LYS	A	275	15.813	24.388	−3.120	1.00	35.18	C
ATOM	350	CE	LYS	A	275	15.544	25.612	−2.219	1.00	35.54	C
ATOM	351	NZ	LYS	A	275	15.439	25.264	−0.752	1.00	35.70	N
ATOM	352	C	LYS	A	275	13.928	23.176	−5.694	1.00	32.95	C
ATOM	353	O	LYS	A	275	14.563	22.131	−5.790	1.00	32.74	O
ATOM	367	N	ILE	A	276	12.807	23.277	−4.981	1.00	32.76	N
ATOM	368	CA	ILE	A	276	12.300	22.165	−4.182	1.00	32.70	C
ATOM	369	CB	ILE	A	276	11.345	22.666	−3.077	1.00	32.87	C
ATOM	370	CG1	ILE	A	276	12.134	23.472	−2.038	1.00	33.42	C
ATOM	371	CD1	ILE	A	276	11.287	24.397	−1.180	1.00	34.02	C
ATOM	372	CG2	ILE	A	276	10.636	21.496	−2.400	1.00	32.89	C
ATOM	373	C	ILE	A	276	11.623	21.137	−5.070	1.00	32.47	C
ATOM	374	O	ILE	A	276	11.677	19.944	−4.785	1.00	32.13	O
ATOM	386	N	MET	A	277	10.999	21.609	−6.147	1.00	32.54	N
ATOM	387	CA	MET	A	277	10.365	20.735	−7.136	1.00	32.48	C
ATOM	388	CB	MET	A	277	9.516	21.555	−8.117	1.00	32.41	C
ATOM	389	CG	MET	A	277	8.475	20.745	−8.881	1.00	32.21	C
ATOM	390	SD	MET	A	277	7.224	20.013	−7.805	1.00	32.33	S
ATOM	391	CE	MET	A	277	7.055	18.389	−8.523	1.00	31.78	C
ATOM	392	C	MET	A	277	11.405	19.925	−7.905	1.00	32.51	C
ATOM	393	O	MET	A	277	11.241	18.723	−8.100	1.00	32.30	O
ATOM	403	N	ALA	A	278	12.478	20.587	−8.325	1.00	32.71	N
ATOM	404	CA	ALA	A	278	13.528	19.940	−9.106	1.00	32.90	C
ATOM	405	CB	ALA	A	278	14.528	20.969	−9.595	1.00	32.95	C
ATOM	406	C	ALA	A	278	14.232	18.869	−8.281	1.00	33.09	C
ATOM	407	O	ALA	A	278	14.516	17.777	−8.775	1.00	33.06	O
ATOM	413	N	TYR	A	279	14.504	19.198	−7.022	1.00	33.37	N
ATOM	414	CA	TYR	A	279	15.112	18.269	−6.071	1.00	33.76	C
ATOM	415	CB	TYR	A	279	15.346	18.973	−4.726	1.00	34.02	C
ATOM	416	CG	TYR	A	279	15.514	18.044	−3.540	1.00	35.08	C
ATOM	417	CD1	TYR	A	279	14.462	17.815	−2.661	1.00	36.26	C
ATOM	418	CE1	TYR	A	279	14.602	16.963	−1.567	1.00	37.30	C
ATOM	419	CZ	TYR	A	279	15.813	16.327	−1.338	1.00	37.78	C
ATOM	420	OH	TYR	A	279	15.942	15.487	−0.248	1.00	38.33	O
ATOM	421	CE2	TYR	A	279	16.880	16.537	−2.201	1.00	37.27	C
ATOM	422	CD2	TYR	A	279	16.723	17.394	−3.299	1.00	36.43	C
ATOM	423	C	TYR	A	279	14.264	17.016	−5.856	1.00	33.81	C
ATOM	424	O	TYR	A	279	14.805	15.917	−5.754	1.00	33.96	O
ATOM	434	N	LEU	A	280	12.943	17.184	−5.783	1.00	33.82	N
ATOM	435	CA	LEU	A	280	12.031	16.062	−5.543	1.00	33.75	C
ATOM	436	CB	LEU	A	280	10.633	16.563	−5.175	1.00	33.81	C
ATOM	437	CG	LEU	A	280	10.490	17.123	−3.760	1.00	33.80	C
ATOM	438	CD1	LEU	A	280	9.246	17.981	−3.660	1.00	33.96	C
ATOM	439	CD2	LEU	A	280	10.466	16.007	−2.724	1.00	33.99	C
ATOM	440	C	LEU	A	280	11.940	15.152	−6.752	1.00	33.84	C
ATOM	441	O	LEU	A	280	11.755	13.943	−6.613	1.00	34.03	O
ATOM	453	N	GLN	A	281	12.068	15.738	−7.936	1.00	33.95	N
ATOM	454	CA	GLN	A	281	12.094	14.974	−9.178	1.00	34.08	C
ATOM	455	CB	GLN	A	281	11.973	15.913	−10.382	1.00	34.08	C
ATOM	456	CG	GLN	A	281	10.563	16.472	−10.574	1.00	34.16	C
ATOM	457	CD	GLN	A	281	10.441	17.374	−11.787	1.00	34.10	C
ATOM	458	OE1	GLN	A	281	10.470	18.598	−11.659	1.00	34.59	O
ATOM	459	NE2	GLN	A	281	10.301	16.775	−12.962	1.00	32.93	N
ATOM	460	C	GLN	A	281	13.362	14.125	−9.278	1.00	34.25	C
ATOM	461	O	GLN	A	281	13.342	13.044	−9.863	1.00	34.25	O
ATOM	470	N	GLN	A	282	14.449	14.614	−8.684	1.00	34.59	N
ATOM	471	CA	GLN	A	282	15.730	13.916	−8.684	1.00	34.93	C
ATOM	472	CB	GLN	A	282	16.854	14.866	−8.286	1.00	34.99	C
ATOM	473	CG	GLN	A	282	18.220	14.371	−8.732	1.00	35.44	C
ATOM	474	CD	GLN	A	282	18.602	14.869	−10.107	1.00	35.71	C
ATOM	475	OE1	GLN	A	282	19.324	15.863	−10.232	1.00	36.78	O
ATOM	476	NE2	GLN	A	282	18.127	14.183	−11.143	1.00	34.76	N
ATOM	477	C	GLN	A	282	15.739	12.712	−7.751	1.00	35.15	C
ATOM	478	O	GLN	A	282	16.192	11.626	−8.126	1.00	35.40	O
ATOM	487	N	GLU	A	283	15.241	12.912	−6.536	1.00	35.49	N
ATOM	488	CA	GLU	A	283	15.036	11.824	−5.577	1.00	35.86	C
ATOM	489	CB	GLU	A	283	14.509	12.389	−4.252	1.00	35.83	C
ATOM	490	CG	GLU	A	283	15.558	13.155	−3.456	1.00	36.16	C
ATOM	491	CD	GLU	A	283	16.041	12.413	−2.216	1.00	37.22	C
ATOM	492	OE1	GLU	A	283	15.749	11.201	−2.091	1.00	37.40	O
ATOM	493	OE2	GLU	A	283	16.718	13.046	−1.361	1.00	37.35	O
ATOM	494	C	GLU	A	283	14.075	10.740	−6.098	1.00	36.16	C
ATOM	495	O	GLU	A	283	13.855	9.732	−5.420	1.00	36.44	O
ATOM	502	N	GLN	A	284	13.494	10.971	−7.279	1.00	36.30	N
ATOM	503	CA	GLN	A	284	12.695	9.985	−8.000	1.00	36.41	C
ATOM	504	CB	GLN	A	284	13.512	8.719	−8.301	1.00	36.29	C
ATOM	505	CG	GLN	A	284	14.421	8.864	−9.520	1.00	36.33	C
ATOM	506	CD	GLN	A	284	15.672	8.006	−9.437	1.00	36.30	C
ATOM	507	OE1	GLN	A	284	15.652	6.828	−9.795	1.00	36.11	O
ATOM	508	NE2	GLN	A	284	16.760	8.595	−8.963	1.00	36.48	N
ATOM	509	C	GLN	A	284	11.401	9.654	−7.255	1.00	36.73	C
ATOM	510	O	GLN	A	284	10.346	9.474	−7.877	1.00	37.29	O
ATOM	519	N	LYS	A	292	11.505	3.201	−4.037	1.00	35.08	N
ATOM	520	CA	LYS	A	292	10.407	3.653	−4.886	1.00	35.02	C
ATOM	521	CB	LYS	A	292	9.755	2.443	−5.559	1.00	34.97	C
ATOM	522	CG	LYS	A	292	10.801	1.462	−6.143	1.00	34.79	C
ATOM	523	CD	LYS	A	292	10.219	0.465	−7.155	1.00	34.31	C
ATOM	524	CE	LYS	A	292	10.984	0.505	−8.478	1.00	34.16	C
ATOM	525	NZ	LYS	A	292	10.505	−0.509	−9.449	1.00	33.93	N
ATOM	526	C	LYS	A	292	9.415	4.506	−4.065	1.00	35.16	C
ATOM	527	O	LYS	A	292	8.318	4.065	−3.716	1.00	35.29	O
ATOM	540	N	LEU	A	293	9.842	5.747	−3.809	1.00	35.14	N
ATOM	541	CA	LEU	A	293	9.260	6.688	−2.831	1.00	35.15	C
ATOM	542	CB	LEU	A	293	9.605	8.138	−3.230	1.00	35.26	C
ATOM	543	CG	LEU	A	293	10.454	8.963	−2.253	1.00	35.63	C
ATOM	544	CD1	LEU	A	293	10.470	10.427	−2.674	1.00	35.86	C
ATOM	545	CD2	LEU	A	293	9.973	8.847	−0.818	1.00	36.21	C
ATOM	546	C	LEU	A	293	7.757	6.637	−2.537	1.00	34.85	C
ATOM	547	O	LEU	A	293	6.939	6.448	−3.438	1.00	34.95	O
ATOM	559	N	SER	A	294	7.423	6.851	−1.262	1.00	34.43	N
ATOM	560	CA	SER	A	294	6.044	6.884	−0.780	1.00	34.12	C
ATOM	561	CB	SER	A	294	5.932	6.114	0.537	1.00	33.96	C
ATOM	562	OG	SER	A	294	5.970	6.984	1.651	1.00	33.91	O
ATOM	563	C	SER	A	294	5.561	8.318	−0.582	1.00	34.03	C
ATOM	564	O	SER	A	294	6.364	9.246	−0.479	1.00	34.16	O
ATOM	570	N	THR	A	295	4.245	8.484	−0.501	1.00	33.74	N
ATOM	571	CA	THR	A	295	3.616	9.803	−0.432	1.00	33.71	C
ATOM	572	CB	THR	A	295	2.090	9.643	−0.334	1.00	33.71	C
ATOM	573	OG1	THR	A	295	1.619	8.764	−1.363	1.00	34.76	O
ATOM	574	CG2	THR	A	295	1.381	10.951	−0.617	1.00	33.56	C
ATOM	575	C	THR	A	295	4.092	10.631	0.763	1.00	33.65	C
ATOM	576	O	THR	A	295	4.461	11.798	0.625	1.00	33.34	O
ATOM	584	N	PHE	A	296	4.044	10.018	1.941	1.00	33.65	N
ATOM	585	CA	PHE	A	296	4.418	10.686	3.174	1.00	33.55	C
ATOM	586	CB	PHE	A	296	4.020	9.840	4.387	1.00	33.35	C
ATOM	587	CG	PHE	A	296	4.522	10.390	5.686	1.00	33.60	C
ATOM	588	CD1	PHE	A	296	3.858	11.434	6.305	1.00	33.45	C
ATOM	589	CE1	PHE	A	296	4.312	11.967	7.490	1.00	33.36	C
ATOM	590	CZ	PHE	A	296	5.461	11.469	8.066	1.00	34.14	C
ATOM	591	CE2	PHE	A	296	6.146	10.428	7.453	1.00	34.21	C
ATOM	592	CD2	PHE	A	296	5.678	9.898	6.266	1.00	33.98	C
ATOM	593	C	PHE	A	296	5.918	10.977	3.201	1.00	33.61	C
ATOM	594	O	PHE	A	296	6.344	11.998	3.734	1.00	33.93	O
ATOM	604	N	GLY	A	297	6.714	10.073	2.646	1.00	33.59	N
ATOM	605	CA	GLY	A	297	8.152	10.272	2.555	1.00	33.65	C
ATOM	606	C	GLY	A	297	8.517	11.443	1.661	1.00	33.54	C
ATOM	607	O	GLY	A	297	9.445	12.183	1.962	1.00	33.58	O
ATOM	611	N	LEU	A	298	7.771	11.609	0.572	1.00	33.43	N
ATOM	612	CA	LEU	A	298	7.962	12.710	−0.370	1.00	33.33	C
ATOM	613	CB	LEU	A	298	7.033	12.519	−1.580	1.00	33.47	C
ATOM	614	CG	LEU	A	298	7.192	13.484	−2.768	1.00	34.02	C
ATOM	615	CD1	LEU	A	298	7.998	12.858	−3.909	1.00	33.98	C
ATOM	616	CD2	LEU	A	298	5.831	13.952	−3.273	1.00	34.28	C
ATOM	617	C	LEU	A	298	7.695	14.066	0.290	1.00	33.05	C
ATOM	618	O	LEU	A	298	8.392	15.041	0.025	1.00	32.81	O
ATOM	630	N	MET	A	299	6.686	14.111	1.155	1.00	32.85	N
ATOM	631	CA	MET	A	299	6.292	15.335	1.845	1.00	32.68	C
ATOM	632	CB	MET	A	299	4.896	15.172	2.447	1.00	32.94	C
ATOM	633	CG	MET	A	299	3.789	14.987	1.434	1.00	33.15	C
ATOM	634	SD	MET	A	299	3.296	16.556	0.759	1.00	34.78	S
ATOM	635	CE	MET	A	299	4.242	16.586	−0.721	1.00	34.64	C
ATOM	636	C	MET	A	299	7.254	15.696	2.960	1.00	32.45	C
ATOM	637	O	MET	A	299	7.367	16.859	3.324	1.00	32.55	O
ATOM	647	N	CYS	A	300	7.924	14.696	3.523	1.00	32.20	N
ATOM	648	CA	CYS	A	300	8.936	14.932	4.545	1.00	32.03	C
ATOM	649	CB	CYS	A	300	9.351	13.625	5.219	1.00	32.02	C
ATOM	650	SG	CYS	A	300	8.111	12.993	6.354	1.00	31.80	S
ATOM	651	C	CYS	A	300	10.154	15.580	3.930	1.00	31.89	C
ATOM	652	O	CYS	A	300	10.802	16.386	4.565	1.00	31.85	O
ATOM	658	N	LYS	A	301	10.454	15.197	2.694	1.00	32.14	N
ATOM	659	CA	LYS	A	301	11.546	15.773	1.917	1.00	32.31	C
ATOM	660	CB	LYS	A	301	11.846	14.883	0.705	1.00	32.39	C
ATOM	661	CG	LYS	A	301	12.430	13.516	1.069	1.00	32.92	C
ATOM	662	CD	LYS	A	301	12.824	12.713	−0.167	1.00	34.05	C
ATOM	663	CE	LYS	A	301	13.419	11.351	0.212	1.00	34.70	C
ATOM	664	NZ	LYS	A	301	14.683	11.447	1.007	1.00	34.61	N
ATOM	665	C	LYS	A	301	11.227	17.194	1.458	1.00	32.31	C
ATOM	666	O	LYS	A	301	12.121	18.019	1.345	1.00	32.38	O
ATOM	680	N	MET	A	302	9.950	17.467	1.199	1.00	32.46	N
ATOM	681	CA	MET	A	302	9.479	18.805	0.833	1.00	32.46	C
ATOM	682	CB	MET	A	302	8.055	18.715	0.269	1.00	32.43	C
ATOM	683	CG	MET	A	302	7.426	20.058	−0.092	1.00	31.98	C
ATOM	684	SD	MET	A	302	5.748	19.923	−0.724	1.00	31.72	S
ATOM	685	CE	MET	A	302	5.967	18.922	−2.199	1.00	31.29	C
ATOM	686	C	MET	A	302	9.499	19.760	2.032	1.00	32.56	C
ATOM	687	O	MET	A	302	9.766	20.947	1.882	1.00	32.54	O
ATOM	697	N	ALA	A	303	9.179	19.241	3.213	1.00	32.72	N
ATOM	698	CA	ALA	A	303	9.232	20.022	4.436	1.00	32.97	C
ATOM	699	CB	ALA	A	303	8.473	19.318	5.537	1.00	32.96	C
ATOM	700	C	ALA	A	303	10.687	20.257	4.849	1.00	33.37	C
ATOM	701	O	ALA	A	303	11.038	21.322	5.340	1.00	33.52	O
ATOM	707	N	ASP	A	304	11.528	19.255	4.634	1.00	33.76	N
ATOM	708	CA	ASP	A	304	12.944	19.320	4.978	1.00	34.10	C
ATOM	709	CB	ASP	A	304	13.592	17.964	4.692	1.00	34.31	C
ATOM	710	CG	ASP	A	304	15.091	18.007	4.754	1.00	35.78	C
ATOM	711	OD1	ASP	A	304	15.633	18.269	5.848	1.00	36.75	O
ATOM	712	OD2	ASP	A	304	15.816	17.777	3.758	1.00	38.38	O
ATOM	713	C	ASP	A	304	13.642	20.440	4.196	1.00	34.11	C
ATOM	714	O	ASP	A	304	14.325	21.283	4.779	1.00	34.10	O
ATOM	719	N	GLN	A	305	13.437	20.451	2.882	1.00	33.97	N
ATOM	720	CA	GLN	A	305	14.000	21.474	2.000	1.00	33.96	C
ATOM	721	CB	GLN	A	305	13.759	21.105	0.531	1.00	34.08	C
ATOM	722	CG	GLN	A	305	14.721	20.082	−0.011	1.00	34.87	C
ATOM	723	CD	GLN	A	305	16.131	20.629	−0.157	1.00	37.01	C
ATOM	724	OE1	GLN	A	305	16.354	21.634	−0.841	1.00	38.44	O
ATOM	725	NE2	GLN	A	305	17.087	19.969	0.483	1.00	38.72	N
ATOM	726	C	GLN	A	305	13.428	22.865	2.260	1.00	33.62	C
ATOM	727	O	GLN	A	305	14.093	23.864	2.024	1.00	33.70	O
ATOM	736	N	THR	A	306	12.186	22.928	2.718	1.00	33.47	N
ATOM	737	CA	THR	A	306	11.592	24.192	3.130	1.00	33.45	C
ATOM	738	CB	THR	A	306	10.117	23.996	3.472	1.00	33.29	C
ATOM	739	OG1	THR	A	306	9.437	23.372	2.375	1.00	32.99	O
ATOM	740	CG2	THR	A	306	9.417	25.333	3.629	1.00	33.54	C
ATOM	741	C	THR	A	306	12.327	24.747	4.352	1.00	33.60	C
ATOM	742	O	THR	A	306	12.448	25.952	4.525	1.00	33.60	O
ATOM	750	N	LEU	A	307	12.815	23.849	5.193	1.00	33.77	N
ATOM	751	CA	LEU	A	307	13.544	24.217	6.394	1.00	34.00	C
ATOM	752	CB	LEU	A	307	13.622	23.008	7.333	1.00	34.30	C
ATOM	753	CG	LEU	A	307	13.884	23.226	8.820	1.00	34.74	C
ATOM	754	CD1	LEU	A	307	13.080	24.391	9.383	1.00	34.91	C
ATOM	755	CD2	LEU	A	307	13.564	21.915	9.557	1.00	35.34	C
ATOM	756	C	LEU	A	307	14.944	24.748	6.068	1.00	33.69	C
ATOM	757	O	LEU	A	307	15.440	25.628	6.757	1.00	33.50	O
ATOM	769	N	PHE	A	308	15.572	24.208	5.025	1.00	33.39	N
ATOM	770	CA	PHE	A	308	16.799	24.777	4.472	1.00	33.02	C
ATOM	771	CB	PHE	A	308	17.254	24.014	3.224	1.00	33.09	C
ATOM	772	CG	PHE	A	308	18.079	22.788	3.508	1.00	33.54	C
ATOM	773	CD1	PHE	A	308	17.526	21.693	4.150	1.00	34.65	C
ATOM	774	CE1	PHE	A	308	18.275	20.552	4.396	1.00	34.55	C
ATOM	775	CZ	PHE	A	308	19.588	20.493	3.992	1.00	34.29	C
ATOM	776	CE2	PHE	A	308	20.153	21.575	3.341	1.00	34.60	C
ATOM	777	CD2	PHE	A	308	19.398	22.714	3.097	1.00	34.14	C
ATOM	778	C	PHE	A	308	16.540	26.213	4.059	1.00	32.89	C
ATOM	779	O	PHE	A	308	17.358	27.086	4.289	1.00	33.16	O
ATOM	789	N	SER	A	309	15.403	26.436	3.416	1.00	32.80	N
ATOM	790	CA	SER	A	309	15.008	27.755	2.943	1.00	32.70	C
ATOM	791	CB	SER	A	309	13.771	27.624	2.042	1.00	32.66	C
ATOM	792	OG	SER	A	309	13.097	28.854	1.893	1.00	32.71	O
ATOM	793	C	SER	A	309	14.754	28.731	4.107	1.00	32.83	C
ATOM	794	O	SER	A	309	15.044	29.927	3.999	1.00	33.00	O
ATOM	800	N	ILE	A	310	14.230	28.219	5.219	1.00	32.78	N
ATOM	801	CA	ILE	A	310	13.966	29.038	6.399	1.00	32.67	C
ATOM	802	CB	ILE	A	310	13.017	28.302	7.384	1.00	32.62	C
ATOM	803	CG1	ILE	A	310	11.623	28.208	6.758	1.00	32.65	C
ATOM	804	CD1	ILE	A	310	10.511	27.832	7.692	1.00	32.71	C
ATOM	805	CG2	ILE	A	310	12.947	29.021	8.727	1.00	32.94	C
ATOM	806	C	ILE	A	310	15.272	29.453	7.081	1.00	32.56	C
ATOM	807	O	ILE	A	310	15.416	30.612	7.480	1.00	32.17	O
ATOM	819	N	VAL	A	311	16.216	28.515	7.193	1.00	32.25	N
ATOM	820	CA	VAL	A	311	17.505	28.783	7.832	1.00	31.95	C
ATOM	821	CB	VAL	A	311	18.345	27.504	8.024	1.00	31.68	C
ATOM	822	CG1	VAL	A	311	19.729	27.841	8.564	1.00	31.83	C
ATOM	823	CG2	VAL	A	311	17.666	26.545	8.961	1.00	31.30	C
ATOM	824	C	VAL	A	311	18.302	29.789	7.008	1.00	32.22	C
ATOM	825	O	VAL	A	311	19.033	30.597	7.566	1.00	32.24	O
ATOM	835	N	GLU	A	312	18.145	29.733	5.687	1.00	32.37	N
ATOM	836	CA	GLU	A	312	18.802	30.650	4.764	1.00	32.69	C
ATOM	837	CB	GLU	A	312	18.530	30.209	3.318	1.00	32.75	C
ATOM	838	CG	GLU	A	312	19.394	30.888	2.265	1.00	33.86	C
ATOM	839	CD	GLU	A	312	19.164	30.343	0.855	1.00	35.82	C
ATOM	840	OE1	GLU	A	312	18.100	29.707	0.608	1.00	35.74	O
ATOM	841	OE2	GLU	A	312	20.054	30.555	−0.013	1.00	36.01	O
ATOM	842	C	GLU	A	312	18.306	32.079	4.975	1.00	32.72	C
ATOM	843	O	GLU	A	312	19.087	33.022	4.992	1.00	32.85	O
ATOM	850	N	TRP	A	313	16.997	32.223	5.135	1.00	33.09	N
ATOM	851	CA	TRP	A	313	16.369	33.524	5.345	1.00	33.22	C
ATOM	852	CB	TRP	A	313	14.841	33.394	5.311	1.00	33.27	C
ATOM	853	CG	TRP	A	313	14.144	34.449	6.097	1.00	33.50	C
ATOM	854	CD1	TRP	A	313	13.846	35.702	5.679	1.00	34.11	C
ATOM	855	NE1	TRP	A	313	13.215	36.402	6.679	1.00	34.60	N
ATOM	856	CE2	TRP	A	313	13.094	35.594	7.779	1.00	33.80	C
ATOM	857	CD2	TRP	A	313	13.674	34.355	7.450	1.00	33.38	C
ATOM	858	CE3	TRP	A	313	13.692	33.351	8.424	1.00	33.26	C
ATOM	859	CZ3	TRP	A	313	13.129	33.610	9.671	1.00	32.69	C
ATOM	860	CH2	TRP	A	313	12.559	34.849	9.961	1.00	32.35	C
ATOM	861	CZ2	TRP	A	313	12.532	35.853	9.033	1.00	33.05	C
ATOM	862	C	TRP	A	313	16.804	34.136	6.671	1.00	33.37	C
ATOM	863	O	TRP	A	313	17.085	35.326	6.737	1.00	34.05	O
ATOM	874	N	ALA	A	314	16.852	33.318	7.718	1.00	33.35	N
ATOM	875	CA	ALA	A	314	17.235	33.763	9.053	1.00	33.33	C
ATOM	876	CB	ALA	A	314	17.003	32.649	10.063	1.00	33.10	C
ATOM	877	C	ALA	A	314	18.697	34.204	9.085	1.00	33.55	C
ATOM	878	O	ALA	A	314	19.053	35.191	9.746	1.00	33.26	O
ATOM	884	N	ARG	A	315	19.519	33.476	8.333	1.00	33.59	N
ATOM	885	CA	ARG	A	315	20.973	33.629	8.336	1.00	33.77	C
ATOM	886	CB	ARG	A	315	21.589	32.530	7.466	1.00	33.68	C
ATOM	887	CG	ARG	A	315	23.054	32.284	7.683	1.00	33.90	C
ATOM	888	CD	ARG	A	315	23.650	31.368	6.641	1.00	34.20	C
ATOM	889	NE	ARG	A	315	25.091	31.557	6.505	1.00	34.17	N
ATOM	890	CZ	ARG	A	315	25.782	31.371	5.384	1.00	34.70	C
ATOM	891	NH1	ARG	A	315	25.183	30.983	4.261	1.00	35.10	N
ATOM	892	NH2	ARG	A	315	27.094	31.575	5.382	1.00	34.75	N
ATOM	893	C	ARG	A	315	21.435	34.991	7.827	1.00	33.91	C
ATOM	894	O	ARG	A	315	22.496	35.485	8.220	1.00	33.87	O
ATOM	908	N	SER	A	316	20.648	35.582	6.935	1.00	34.21	N
ATOM	909	CA	SER	A	316	20.967	36.887	6.363	1.00	34.44	C
ATOM	910	CB	SER	A	316	21.078	36.778	4.842	1.00	34.41	C
ATOM	911	OG	SER	A	316	19.929	36.159	4.296	1.00	34.54	O
ATOM	912	C	SER	A	316	19.906	37.916	6.757	1.00	34.73	C
ATOM	913	O	SER	A	316	19.713	38.915	6.066	1.00	34.97	O
ATOM	919	N	SER	A	317	19.227	37.663	7.875	1.00	34.90	N
ATOM	920	CA	SER	A	317	18.271	38.604	8.446	1.00	34.94	C
ATOM	921	CB	SER	A	317	17.202	37.863	9.246	1.00	35.07	C
ATOM	922	OG	SER	A	317	16.437	37.015	8.404	1.00	35.41	O
ATOM	923	C	SER	A	317	18.994	39.603	9.338	1.00	35.00	C
ATOM	924	O	SER	A	317	20.104	39.341	9.790	1.00	34.71	O
ATOM	930	N	ILE	A	318	18.325	40.717	9.629	1.00	35.19	N
ATOM	931	CA	ILE	A	318	18.972	41.927	10.149	1.00	35.26	C
ATOM	932	CB	ILE	A	318	17.919	43.064	10.361	1.00	35.39	C
ATOM	933	CG1	ILE	A	318	17.236	43.428	9.037	1.00	35.49	C
ATOM	934	CD1	ILE	A	318	15.785	43.034	8.983	1.00	35.43	C
ATOM	935	CG2	ILE	A	318	18.567	44.320	10.978	1.00	35.56	C
ATOM	936	C	ILE	A	318	19.759	41.712	11.441	1.00	35.15	C
ATOM	937	O	ILE	A	318	20.965	41.966	11.501	1.00	35.44	O
ATOM	949	N	PHE	A	319	19.068	41.264	12.476	1.00	34.79	N
ATOM	950	CA	PHE	A	319	19.659	41.189	13.804	1.00	34.46	C
ATOM	951	CB	PHE	A	319	18.600	41.582	14.836	1.00	34.70	C
ATOM	952	CG	PHE	A	319	17.914	42.893	14.517	1.00	35.09	C
ATOM	953	CD1	PHE	A	319	16.690	42.915	13.857	1.00	35.60	C
ATOM	954	CE1	PHE	A	319	16.070	44.125	13.543	1.00	35.70	C
ATOM	955	CZ	PHE	A	319	16.671	45.326	13.891	1.00	35.54	C
ATOM	956	CE2	PHE	A	319	17.891	45.317	14.546	1.00	35.62	C
ATOM	957	CD2	PHE	A	319	18.511	44.104	14.850	1.00	35.50	C
ATOM	958	C	PHE	A	319	20.238	39.800	14.070	1.00	34.03	C
ATOM	959	O	PHE	A	319	21.095	39.626	14.934	1.00	33.62	O
ATOM	969	N	PHE	A	320	19.770	38.824	13.298	1.00	33.69	N
ATOM	970	CA	PHE	A	320	20.181	37.432	13.432	1.00	33.34	C
ATOM	971	CB	PHE	A	320	19.207	36.562	12.642	1.00	33.30	C
ATOM	972	CG	PHE	A	320	19.223	35.120	13.024	1.00	32.96	C
ATOM	973	CD1	PHE	A	320	18.510	34.678	14.126	1.00	33.16	C
ATOM	974	CE1	PHE	A	320	18.498	33.328	14.473	1.00	32.83	C
ATOM	975	CZ	PHE	A	320	19.198	32.419	13.714	1.00	32.73	C
ATOM	976	CE2	PHE	A	320	19.911	32.852	12.603	1.00	32.89	C
ATOM	977	CD2	PHE	A	320	19.920	34.193	12.265	1.00	32.53	C
ATOM	978	C	PHE	A	320	21.610	37.228	12.920	1.00	33.17	C
ATOM	979	O	PHE	A	320	22.388	36.483	13.508	1.00	32.85	O
ATOM	989	N	ARG	A	321	21.946	37.904	11.826	1.00	32.95	N
ATOM	990	CA	ARG	A	321	23.296	37.879	11.286	1.00	33.11	C
ATOM	991	CB	ARG	A	321	23.371	38.720	10.002	1.00	33.17	C
ATOM	992	CG	ARG	A	321	23.414	40.225	10.244	1.00	33.52	C
ATOM	993	CD	ARG	A	321	22.599	41.060	9.272	1.00	34.15	C
ATOM	994	NE	ARG	A	321	23.060	40.958	7.895	1.00	35.39	N
ATOM	995	CZ	ARG	A	321	22.557	41.658	6.879	1.00	36.44	C
ATOM	996	NH1	ARG	A	321	21.556	42.519	7.069	1.00	36.12	N
ATOM	997	NH2	ARG	A	321	23.058	41.495	5.656	1.00	37.27	N
ATOM	998	C	ARG	A	321	24.355	38.371	12.294	1.00	33.11	C
ATOM	999	O	ARG	A	321	25.536	38.053	12.146	1.00	33.13	O
ATOM	1013	N	GLU	A	322	23.928	39.144	13.297	1.00	32.99	N
ATOM	1014	CA	GLU	A	322	24.825	39.679	14.327	1.00	33.08	C
ATOM	1015	CB	GLU	A	322	24.300	41.024	14.855	1.00	33.17	C
ATOM	1016	CG	GLU	A	322	24.715	42.230	14.024	1.00	33.91	C
ATOM	1017	CD	GLU	A	322	23.628	43.286	13.942	1.00	34.92	C
ATOM	1018	OE1	GLU	A	322	23.360	43.953	14.966	1.00	34.64	O
ATOM	1019	OE2	GLU	A	322	23.037	43.441	12.850	1.00	36.18	O
ATOM	1020	C	GLU	A	322	25.060	38.743	15.514	1.00	32.90	C
ATOM	1021	O	GLU	A	322	25.918	39.016	16.352	1.00	33.11	O
ATOM	1028	N	LEU	A	323	24.303	37.658	15.602	1.00	32.84	N
ATOM	1029	CA	LEU	A	323	24.478	36.692	16.687	1.00	32.83	C
ATOM	1030	CB	LEU	A	323	23.190	35.891	16.927	1.00	32.77	C
ATOM	1031	CG	LEU	A	323	22.023	36.661	17.557	1.00	33.34	C
ATOM	1032	CD1	LEU	A	323	20.727	35.899	17.402	1.00	33.32	C
ATOM	1033	CD2	LEU	A	323	22.287	36.983	19.032	1.00	33.96	C
ATOM	1034	C	LEU	A	323	25.622	35.731	16.397	1.00	32.73	C
ATOM	1035	O	LEU	A	323	25.932	35.443	15.238	1.00	32.64	O
ATOM	1047	N	LYS	A	324	26.248	35.243	17.464	1.00	32.79	N
ATOM	1048	CA	LYS	A	324	27.164	34.111	17.370	1.00	32.90	C
ATOM	1049	CB	LYS	A	324	27.854	33.856	18.715	1.00	32.85	C
ATOM	1050	CG	LYS	A	324	28.911	34.890	19.080	1.00	33.17	C
ATOM	1051	CD	LYS	A	324	30.252	34.233	19.376	1.00	33.65	C
ATOM	1052	CE	LYS	A	324	31.277	35.236	19.863	1.00	33.53	C
ATOM	1053	NZ	LYS	A	324	31.327	35.267	21.342	1.00	34.06	N
ATOM	1054	C	LYS	A	324	26.360	32.880	16.945	1.00	32.82	C
ATOM	1055	O	LYS	A	324	25.171	32.795	17.232	1.00	32.69	O
ATOM	1069	N	VAL	A	325	27.013	31.928	16.282	1.00	32.80	N
ATOM	1070	CA	VAL	A	325	26.329	30.746	15.748	1.00	32.74	C
ATOM	1071	CB	VAL	A	325	27.313	29.785	15.017	1.00	32.75	C
ATOM	1072	CG1	VAL	A	325	26.622	28.489	14.592	1.00	32.55	C
ATOM	1073	CG2	VAL	A	325	27.916	30.460	13.801	1.00	32.95	C
ATOM	1074	C	VAL	A	325	25.576	29.985	16.839	1.00	32.61	C
ATOM	1075	O	VAL	A	325	24.502	29.455	16.587	1.00	32.67	O
ATOM	1085	N	ASP	A	326	26.127	29.948	18.049	1.00	32.56	N
ATOM	1086	CA	ASP	A	326	25.507	29.219	19.159	1.00	32.58	C
ATOM	1087	CB	ASP	A	326	26.466	29.141	20.347	1.00	32.73	C
ATOM	1088	CG	ASP	A	326	27.677	28.286	20.052	1.00	33.51	C
ATOM	1089	OD1	ASP	A	326	28.810	28.720	20.359	1.00	33.87	O
ATOM	1090	OD2	ASP	A	326	27.584	27.165	19.501	1.00	34.06	O
ATOM	1091	C	ASP	A	326	24.180	29.831	19.602	1.00	32.23	C
ATOM	1092	O	ASP	A	326	23.274	29.116	20.021	1.00	32.04	O
ATOM	1097	N	ASP	A	327	24.085	31.155	19.531	1.00	31.98	N
ATOM	1098	CA	ASP	A	327	22.831	31.854	19.797	1.00	31.79	C
ATOM	1099	CB	ASP	A	327	23.061	33.366	19.931	1.00	31.87	C
ATOM	1100	CG	ASP	A	327	23.557	33.758	21.302	1.00	31.54	C
ATOM	1101	OD1	ASP	A	327	23.827	34.958	21.518	1.00	31.29	O
ATOM	1102	OD2	ASP	A	327	23.709	32.925	22.219	1.00	31.09	O
ATOM	1103	C	ASP	A	327	21.837	31.589	18.686	1.00	31.58	C
ATOM	1104	O	ASP	A	327	20.660	31.360	18.945	1.00	31.34	O
ATOM	1109	N	GLN	A	328	22.327	31.630	17.450	1.00	31.47	N
ATOM	1110	CA	GLN	A	328	21.512	31.363	16.269	1.00	31.28	C
ATOM	1111	CB	GLN	A	328	22.344	31.540	14.991	1.00	31.16	C
ATOM	1112	CG	GLN	A	328	22.625	32.992	14.641	1.00	30.71	C
ATOM	1113	CD	GLN	A	328	23.408	33.156	13.348	1.00	31.08	C
ATOM	1114	OE1	GLN	A	328	24.168	32.270	12.953	1.00	31.65	O
ATOM	1115	NE2	GLN	A	328	23.236	34.296	12.694	1.00	31.31	N
ATOM	1116	C	GLN	A	328	20.868	29.971	16.316	1.00	31.10	C
ATOM	1117	O	GLN	A	328	19.685	29.835	16.020	1.00	30.80	O
ATOM	1126	N	MET	A	329	21.639	28.959	16.712	1.00	31.08	N
ATOM	1127	CA	MET	A	329	21.138	27.589	16.807	1.00	31.27	C
ATOM	1128	CB	MET	A	329	22.282	26.616	17.087	1.00	31.15	C
ATOM	1129	CG	MET	A	329	23.220	26.397	15.913	1.00	31.21	C
ATOM	1130	SD	MET	A	329	24.733	25.505	16.363	1.00	30.82	S
ATOM	1131	CE	MET	A	329	24.099	23.850	16.733	1.00	30.51	C
ATOM	1132	C	MET	A	329	20.073	27.448	17.897	1.00	31.58	C
ATOM	1133	O	MET	A	329	19.021	26.863	17.669	1.00	31.63	O
ATOM	1143	N	LYS	A	330	20.354	27.992	19.079	1.00	32.15	N
ATOM	1144	CA	LYS	A	330	19.412	27.977	20.202	1.00	32.43	C
ATOM	1145	CB	LYS	A	330	19.987	28.757	21.394	1.00	32.51	C
ATOM	1146	CG	LYS	A	330	21.110	28.047	22.140	1.00	32.82	C
ATOM	1147	CD	LYS	A	330	21.795	28.990	23.126	1.00	33.47	C
ATOM	1148	CE	LYS	A	330	23.120	28.428	23.648	1.00	33.83	C
ATOM	1149	NZ	LYS	A	330	24.201	29.467	23.711	1.00	32.91	N
ATOM	1150	C	LYS	A	330	18.044	28.556	19.812	1.00	32.44	C
ATOM	1151	O	LYS	A	330	17.005	27.964	20.101	1.00	32.44	O
ATOM	1165	N	LEU	A	331	18.057	29.706	19.146	1.00	32.54	N
ATOM	1166	CA	LEU	A	331	16.828	30.343	18.678	1.00	32.71	C
ATOM	1167	CB	LEU	A	331	17.130	31.717	18.061	1.00	32.73	C
ATOM	1168	CG	LEU	A	331	17.551	32.851	19.005	1.00	32.68	C
ATOM	1169	CD1	LEU	A	331	17.572	34.181	18.262	1.00	32.27	C
ATOM	1170	CD2	LEU	A	331	16.644	32.937	20.232	1.00	33.07	C
ATOM	1171	C	LEU	A	331	16.062	29.483	17.668	1.00	32.63	C
ATOM	1172	O	LEU	A	331	14.849	29.333	17.783	1.00	32.62	O
ATOM	1184	N	LEU	A	332	16.770	28.914	16.696	1.00	32.70	N
ATOM	1185	CA	LEU	A	332	16.130	28.137	15.624	1.00	32.70	C
ATOM	1186	CB	LEU	A	332	17.047	28.024	14.402	1.00	32.64	C
ATOM	1187	CG	LEU	A	332	17.132	29.237	13.468	1.00	32.81	C
ATOM	1188	CD1	LEU	A	332	18.382	29.136	12.589	1.00	32.67	C
ATOM	1189	CD2	LEU	A	332	15.884	29.372	12.599	1.00	32.79	C
ATOM	1190	C	LEU	A	332	15.678	26.738	16.080	1.00	32.77	C
ATOM	1191	O	LEU	A	332	14.683	26.218	15.580	1.00	32.73	O
ATOM	1203	N	GLN	A	333	16.407	26.131	17.015	1.00	32.76	N
ATOM	1204	CA	GLN	A	333	15.980	24.873	17.637	1.00	32.78	C
ATOM	1205	CB	GLN	A	333	17.051	24.347	18.591	1.00	32.79	C
ATOM	1206	CG	GLN	A	333	18.231	23.688	17.909	1.00	33.64	C
ATOM	1207	CD	GLN	A	333	19.427	23.533	18.834	1.00	35.25	C
ATOM	1208	OE1	GLN	A	333	19.868	24.504	19.452	1.00	37.23	O
ATOM	1209	NE2	GLN	A	333	19.953	22.319	18.932	1.00	36.48	N
ATOM	1210	C	GLN	A	333	14.673	25.058	18.407	1.00	32.63	C
ATOM	1211	O	GLN	A	333	13.914	24.114	18.595	1.00	32.48	O
ATOM	1220	N	ASN	A	334	14.434	26.283	18.861	1.00	32.57	N
ATOM	1221	CA	ASN	A	334	13.229	26.629	19.588	1.00	32.32	C
ATOM	1222	CB	ASN	A	334	13.504	27.847	20.474	1.00	32.52	C
ATOM	1223	CG	ASN	A	334	12.289	28.281	21.262	1.00	32.58	C
ATOM	1224	OD1	ASN	A	334	11.741	27.504	22.037	1.00	32.87	O
ATOM	1225	ND2	ASN	A	334	11.853	29.521	21.059	1.00	31.96	N
ATOM	1226	C	ASN	A	334	12.030	26.918	18.691	1.00	32.14	C
ATOM	1227	O	ASN	A	334	10.909	26.704	19.116	1.00	32.55	O
ATOM	1234	N	CYS	A	335	12.258	27.391	17.463	1.00	31.90	N
ATOM	1235	CA	CYS	A	335	11.178	27.950	16.630	1.00	31.50	C
ATOM	1236	CB	CYS	A	335	11.308	29.479	16.571	1.00	31.43	C
ATOM	1237	SG	CYS	A	335	12.477	30.095	15.341	1.00	30.63	S
ATOM	1238	C	CYS	A	335	11.075	27.415	15.198	1.00	31.40	C
ATOM	1239	O	CYS	A	335	10.334	27.976	14.391	1.00	30.88	O
ATOM	1245	N	TRP	A	336	11.796	26.342	14.884	1.00	31.31	N
ATOM	1246	CA	TRP	A	336	11.871	25.843	13.506	1.00	31.08	C
ATOM	1247	CB	TRP	A	336	12.893	24.697	13.369	1.00	31.04	C
ATOM	1248	CG	TRP	A	336	12.571	23.473	14.186	1.00	30.52	C
ATOM	1249	CD1	TRP	A	336	12.866	23.268	15.496	1.00	30.03	C
ATOM	1250	NE1	TRP	A	336	12.408	22.040	15.898	1.00	31.07	N
ATOM	1251	CE2	TRP	A	336	11.801	21.421	14.837	1.00	31.48	C
ATOM	1252	CD2	TRP	A	336	11.886	22.296	13.741	1.00	30.50	C
ATOM	1253	CE3	TRP	A	336	11.333	21.892	12.523	1.00	31.09	C
ATOM	1254	CZ3	TRP	A	336	10.724	20.651	12.441	1.00	31.91	C
ATOM	1255	CH2	TRP	A	336	10.653	19.805	13.550	1.00	32.27	C
ATOM	1256	CZ2	TRP	A	336	11.186	20.168	14.754	1.00	32.14	C
ATOM	1257	C	TRP	A	336	10.507	25.394	13.006	1.00	31.15	C
ATOM	1258	O	TRP	A	336	10.126	25.681	11.870	1.00	30.79	O
ATOM	1269	N	SER	A	337	9.771	24.700	13.866	1.00	31.38	N
ATOM	1270	CA	SER	A	337	8.479	24.144	13.480	1.00	31.62	C
ATOM	1271	CB	SER	A	337	8.061	22.997	14.400	1.00	31.24	C
ATOM	1272	OG	SER	A	337	8.016	23.414	15.744	1.00	31.53	O
ATOM	1273	C	SER	A	337	7.416	25.232	13.442	1.00	31.59	C
ATOM	1274	O	SER	A	337	6.498	25.149	12.641	1.00	31.76	O
ATOM	1280	N	GLU	A	338	7.551	26.254	14.286	1.00	31.73	N
ATOM	1281	CA	GLU	A	338	6.637	27.406	14.252	1.00	31.70	C
ATOM	1282	CB	GLU	A	338	6.888	28.340	15.416	1.00	31.60	C
ATOM	1283	CG	GLU	A	338	6.530	27.763	16.756	1.00	32.19	C
ATOM	1284	CD	GLU	A	338	6.753	28.765	17.853	1.00	32.93	C
ATOM	1285	OE1	GLU	A	338	5.756	29.380	18.308	1.00	34.01	O
ATOM	1286	OE2	GLU	A	338	7.930	28.949	18.236	1.00	33.13	O
ATOM	1287	C	GLU	A	338	6.795	28.204	12.972	1.00	31.65	C
ATOM	1288	O	GLU	A	338	5.817	28.678	12.407	1.00	31.78	O
ATOM	1295	N	LEU	A	339	8.035	28.353	12.528	1.00	31.51	N
ATOM	1296	CA	LEU	A	339	8.328	29.027	11.282	1.00	31.41	C
ATOM	1297	CB	LEU	A	339	9.835	29.255	11.133	1.00	31.41	C
ATOM	1298	CG	LEU	A	339	10.431	30.380	11.983	1.00	30.89	C
ATOM	1299	CD1	LEU	A	339	11.892	30.523	11.698	1.00	30.75	C
ATOM	1300	CD2	LEU	A	339	9.710	31.695	11.737	1.00	30.69	C
ATOM	1301	C	LEU	A	339	7.788	28.259	10.088	1.00	31.54	C
ATOM	1302	O	LEU	A	339	7.380	28.860	9.119	1.00	31.64	O
ATOM	1314	N	LEU	A	340	7.778	26.932	10.155	1.00	31.94	N
ATOM	1315	CA	LEU	A	340	7.245	26.126	9.056	1.00	31.87	C
ATOM	1316	CB	LEU	A	340	7.622	24.654	9.212	1.00	31.97	C
ATOM	1317	CG	LEU	A	340	9.031	24.250	8.781	1.00	32.44	C
ATOM	1318	CD1	LEU	A	340	9.288	22.835	9.238	1.00	33.44	C
ATOM	1319	CD2	LEU	A	340	9.221	24.364	7.274	1.00	33.15	C
ATOM	1320	C	LEU	A	340	5.738	26.253	9.002	1.00	31.86	C
ATOM	1321	O	LEU	A	340	5.167	26.358	7.939	1.00	31.57	O
ATOM	1333	N	ILE	A	341	5.106	26.241	10.168	1.00	32.25	N
ATOM	1334	CA	ILE	A	341	3.662	26.390	10.275	1.00	32.48	C
ATOM	1335	CB	ILE	A	341	3.223	26.137	11.729	1.00	32.47	C
ATOM	1336	CG1	ILE	A	341	3.354	24.646	12.063	1.00	32.92	C
ATOM	1337	CD1	ILE	A	341	2.600	23.734	11.147	1.00	33.53	C
ATOM	1338	CG2	ILE	A	341	1.796	26.655	11.997	1.00	32.64	C
ATOM	1339	C	ILE	A	341	3.222	27.773	9.814	1.00	32.72	C
ATOM	1340	O	ILE	A	341	2.292	27.889	9.049	1.00	33.36	O
ATOM	1352	N	LEU	A	342	3.896	28.812	10.285	1.00	32.86	N
ATOM	1353	CA	LEU	A	342	3.582	30.187	9.916	1.00	32.92	C
ATOM	1354	CB	LEU	A	342	4.502	31.147	10.690	1.00	32.79	C
ATOM	1355	CG	LEU	A	342	4.244	32.657	10.743	1.00	32.45	C
ATOM	1356	CD1	LEU	A	342	2.786	33.003	10.830	1.00	32.56	C
ATOM	1357	CD2	LEU	A	342	4.966	33.247	11.931	1.00	32.87	C
ATOM	1358	C	LEU	A	342	3.747	30.356	8.403	1.00	33.37	C
ATOM	1359	O	LEU	A	342	2.897	30.935	7.727	1.00	33.46	O
ATOM	1371	N	ASP	A	343	4.843	29.817	7.886	1.00	33.57	N
ATOM	1372	CA	ASP	A	343	5.119	29.789	6.461	1.00	33.91	C
ATOM	1373	CB	ASP	A	343	6.443	29.058	6.251	1.00	34.09	C
ATOM	1374	CG	ASP	A	343	6.894	29.039	4.812	1.00	36.03	C
ATOM	1375	OD1	ASP	A	343	6.949	27.928	4.237	1.00	37.42	O
ATOM	1376	OD2	ASP	A	343	7.254	30.067	4.188	1.00	37.97	O
ATOM	1377	C	ASP	A	343	3.973	29.109	5.695	1.00	33.87	C
ATOM	1378	O	ASP	A	343	3.504	29.622	4.690	1.00	33.94	O
ATOM	1383	N	HIS	A	344	3.506	27.973	6.202	1.00	33.95	N
ATOM	1384	CA	HIS	A	344	2.438	27.202	5.568	1.00	33.73	C
ATOM	1385	CB	HIS	A	344	2.314	25.813	6.223	1.00	33.59	C
ATOM	1386	CG	HIS	A	344	1.050	25.081	5.871	1.00	33.64	C
ATOM	1387	ND1	HIS	A	344	0.009	24.682	6.639	1.00	33.71	N
ATOM	1388	CE1	HIS	A	344	−0.891	24.056	5.811	1.00	33.42	C
ATOM	1389	NE2	HIS	A	344	−0.418	24.065	4.579	1.00	33.62	N
ATOM	1390	CD2	HIS	A	344	0.753	24.677	4.587	1.00	33.15	C
ATOM	1391	C	HIS	A	344	1.112	27.955	5.645	1.00	33.74	C
ATOM	1392	O	HIS	A	344	0.393	28.048	4.659	1.00	33.67	O
ATOM	1401	N	ILE	A	345	0.820	28.509	6.817	1.00	33.93	N
ATOM	1402	CA	ILE	A	345	−0.419	29.240	7.087	1.00	34.27	C
ATOM	1403	CB	ILE	A	345	−0.486	29.614	8.610	1.00	34.58	C
ATOM	1404	CG1	ILE	A	345	−1.316	28.599	9.396	1.00	35.19	C
ATOM	1405	CD1	ILE	A	345	−0.853	27.166	9.282	1.00	36.16	C
ATOM	1406	CG2	ILE	A	345	−1.097	30.995	8.839	1.00	35.28	C
ATOM	1407	C	ILE	A	345	−0.552	30.493	6.211	1.00	34.16	C
ATOM	1408	O	ILE	A	345	−1.632	30.781	5.708	1.00	34.11	O
ATOM	1420	N	TYR	A	346	0.545	31.234	6.054	1.00	34.07	N
ATOM	1421	CA	TYR	A	346	0.577	32.458	5.246	1.00	33.99	C
ATOM	1422	CB	TYR	A	346	1.844	33.279	5.560	1.00	34.01	C
ATOM	1423	CG	TYR	A	346	2.011	34.517	4.706	1.00	33.78	C
ATOM	1424	CD1	TYR	A	346	2.943	34.553	3.681	1.00	33.86	C
ATOM	1425	CE1	TYR	A	346	3.089	35.671	2.887	1.00	33.62	C
ATOM	1426	CZ	TYR	A	346	2.301	36.774	3.109	1.00	33.41	C
ATOM	1427	OH	TYR	A	346	2.455	37.881	2.304	1.00	35.01	O
ATOM	1428	CE2	TYR	A	346	1.365	36.769	4.116	1.00	33.50	C
ATOM	1429	CD2	TYR	A	346	1.222	35.643	4.909	1.00	33.75	C
ATOM	1430	C	TYR	A	346	0.489	32.141	3.748	1.00	34.04	C
ATOM	1431	O	TYR	A	346	0.001	32.954	2.965	1.00	34.12	O
ATOM	1441	N	ARG	A	347	0.948	30.954	3.359	1.00	34.16	N
ATOM	1442	CA	ARG	A	347	0.784	30.463	1.988	1.00	34.03	C
ATOM	1443	CB	ARG	A	347	1.634	29.207	1.745	1.00	34.21	C
ATOM	1444	CG	ARG	A	347	2.540	29.294	0.505	1.00	35.09	C
ATOM	1445	CD	ARG	A	347	3.120	27.956	0.035	1.00	35.44	C
ATOM	1446	NE	ARG	A	347	3.551	27.129	1.157	1.00	36.44	N
ATOM	1447	CZ	ARG	A	347	4.673	27.300	1.852	1.00	35.95	C
ATOM	1448	NH1	ARG	A	347	5.530	28.270	1.546	1.00	36.38	N
ATOM	1449	NH2	ARG	A	347	4.937	26.483	2.862	1.00	35.51	N
ATOM	1450	C	ARG	A	347	−0.685	30.161	1.681	1.00	33.69	C
ATOM	1451	O	ARG	A	347	−1.130	30.346	0.552	1.00	33.51	O
ATOM	1465	N	GLN	A	348	−1.432	29.703	2.685	1.00	33.40	N
ATOM	1466	CA	GLN	A	348	−2.856	29.401	2.511	1.00	33.15	C
ATOM	1467	CB	GLN	A	348	−3.388	28.478	3.618	1.00	32.81	C
ATOM	1468	CG	GLN	A	348	−2.580	27.217	3.895	1.00	31.97	C
ATOM	1469	CD	GLN	A	348	−2.118	26.487	2.642	1.00	30.80	C
ATOM	1470	OE1	GLN	A	348	−2.928	25.916	1.930	1.00	30.63	O
ATOM	1471	NE2	GLN	A	348	−0.816	26.485	2.393	1.00	29.21	N
ATOM	1472	C	GLN	A	348	−3.716	30.661	2.468	1.00	33.27	C
ATOM	1473	O	GLN	A	348	−4.767	30.650	1.847	1.00	33.65	O
ATOM	1482	N	VAL	A	349	−3.283	31.735	3.124	1.00	33.41	N
ATOM	1483	CA	VAL	A	349	−4.031	32.999	3.111	1.00	33.61	C
ATOM	1484	CB	VAL	A	349	−3.498	34.010	4.181	1.00	33.65	C
ATOM	1485	CG1	VAL	A	349	−4.232	35.341	4.090	1.00	33.49	C
ATOM	1486	CG2	VAL	A	349	−3.631	33.436	5.598	1.00	33.59	C
ATOM	1487	C	VAL	A	349	−3.971	33.647	1.722	1.00	33.75	C
ATOM	1488	O	VAL	A	349	−4.999	34.016	1.153	1.00	33.66	O
ATOM	1498	N	VAL	A	350	−2.759	33.756	1.183	1.00	34.03	N
ATOM	1499	CA	VAL	A	350	−2.507	34.416	−0.101	1.00	34.21	C
ATOM	1500	CB	VAL	A	350	−0.993	34.705	−0.287	1.00	34.19	C
ATOM	1501	CG1	VAL	A	350	−0.718	35.284	−1.674	1.00	34.47	C
ATOM	1502	CG2	VAL	A	350	−0.471	35.635	0.812	1.00	33.80	C
ATOM	1503	C	VAL	A	350	−2.984	33.577	−1.291	1.00	34.42	C
ATOM	1504	O	VAL	A	350	−3.853	34.003	−2.049	1.00	34.59	O
ATOM	1514	N	HIS	A	351	−2.407	32.386	−1.441	1.00	34.69	N
ATOM	1515	CA	HIS	A	351	−2.640	31.524	−2.607	1.00	34.82	C
ATOM	1516	CB	HIS	A	351	−1.348	30.780	−2.963	1.00	34.90	C
ATOM	1517	CG	HIS	A	351	−0.218	31.689	−3.333	1.00	35.26	C
ATOM	1518	ND1	HIS	A	351	0.934	31.789	−2.582	1.00	35.29	N
ATOM	1519	CE1	HIS	A	351	1.745	32.670	−3.141	1.00	35.54	C
ATOM	1520	NE2	HIS	A	351	1.159	33.149	−4.224	1.00	35.61	N
ATOM	1521	CD2	HIS	A	351	−0.072	32.555	−4.365	1.00	35.51	C
ATOM	1522	C	HIS	A	351	−3.779	30.512	−2.452	1.00	34.84	C
ATOM	1523	O	HIS	A	351	−4.332	30.047	−3.455	1.00	35.12	O
ATOM	1532	N	GLY	A	352	−4.116	30.157	−1.215	1.00	34.85	N
ATOM	1533	CA	GLY	A	352	−5.173	29.193	−0.955	1.00	34.93	C
ATOM	1534	C	GLY	A	352	−6.541	29.618	−1.473	1.00	35.05	C
ATOM	1535	O	GLY	A	352	−6.881	30.805	−1.483	1.00	35.03	O
ATOM	1539	N	LYS	A	353	−7.321	28.632	−1.912	1.00	35.18	N
ATOM	1540	CA	LYS	A	353	−8.673	28.855	−2.428	1.00	35.27	C
ATOM	1541	CB	LYS	A	353	−8.710	28.613	−3.945	1.00	35.11	C
ATOM	1542	CG	LYS	A	353	−7.609	29.341	−4.722	1.00	35.01	C
ATOM	1543	CD	LYS	A	353	−8.051	29.730	−6.135	1.00	34.85	C
ATOM	1544	CE	LYS	A	353	−8.764	31.081	−6.159	1.00	34.87	C
ATOM	1545	NZ	LYS	A	353	−9.791	31.172	−7.237	1.00	34.58	N
ATOM	1546	C	LYS	A	353	−9.651	27.935	−1.682	1.00	35.44	C
ATOM	1547	O	LYS	A	353	−9.369	27.531	−0.546	1.00	35.70	O
ATOM	1561	N	GLU	A	354	−10.792	27.623	−2.303	1.00	35.46	N
ATOM	1562	CA	GLU	A	354	−11.815	26.765	−1.692	1.00	35.38	C
ATOM	1563	CB	GLU	A	354	−13.168	26.945	−2.404	1.00	35.36	C
ATOM	1564	CG	GLU	A	354	−14.215	25.868	−2.108	1.00	35.30	C
ATOM	1565	CD	GLU	A	354	−15.121	26.221	−0.944	1.00	35.60	C
ATOM	1566	OE1	GLU	A	354	−16.315	26.498	−1.194	1.00	35.89	O
ATOM	1567	OE2	GLU	A	354	−14.647	26.215	0.219	1.00	35.35	O
ATOM	1568	C	GLU	A	354	−11.415	25.287	−1.710	1.00	35.31	C
ATOM	1569	O	GLU	A	354	−11.394	24.654	−2.773	1.00	35.26	O
ATOM	1576	N	GLY	A	355	−11.126	24.746	−0.526	1.00	35.19	N
ATOM	1577	CA	GLY	A	355	−10.839	23.330	−0.365	1.00	35.11	C
ATOM	1578	C	GLY	A	355	−9.633	22.889	−1.173	1.00	35.02	C
ATOM	1579	O	GLY	A	355	−9.748	22.034	−2.053	1.00	34.80	O
ATOM	1583	N	SER	A	356	−8.478	23.485	−0.876	1.00	34.96	N
ATOM	1584	CA	SER	A	356	−7.244	23.186	−1.596	1.00	34.87	C
ATOM	1585	CB	SER	A	356	−7.285	23.799	−3.000	1.00	34.99	C
ATOM	1586	OG	SER	A	356	−7.500	25.200	−2.934	1.00	35.49	O
ATOM	1587	C	SER	A	356	−6.026	23.722	−0.861	1.00	34.59	C
ATOM	1588	O	SER	A	356	−5.821	24.934	−0.812	1.00	34.92	O
ATOM	1594	N	ILE	A	357	−5.221	22.820	−0.303	1.00	34.11	N
ATOM	1595	CA	ILE	A	357	−3.946	23.194	0.304	1.00	33.79	C
ATOM	1596	CB	ILE	A	357	−3.363	22.014	1.140	1.00	33.85	C
ATOM	1597	CG1	ILE	A	357	−4.358	21.514	2.206	1.00	34.33	C
ATOM	1598	CD1	ILE	A	357	−4.925	22.585	3.130	1.00	34.72	C
ATOM	1599	CG2	ILE	A	357	−2.046	22.411	1.777	1.00	33.26	C
ATOM	1600	C	ILE	A	357	−2.942	23.600	−0.779	1.00	33.45	C
ATOM	1601	O	ILE	A	357	−2.601	22.792	−1.639	1.00	33.37	O
ATOM	1613	N	PHE	A	358	−2.486	24.852	−0.746	1.00	33.22	N
ATOM	1614	CA	PHE	A	358	−1.397	25.309	−1.615	1.00	33.03	C
ATOM	1615	CB	PHE	A	358	−1.456	26.827	−1.805	1.00	32.96	C
ATOM	1616	CG	PHE	A	358	−0.605	27.329	−2.938	1.00	33.40	C
ATOM	1617	CD1	PHE	A	358	−1.138	27.503	−4.207	1.00	33.96	C
ATOM	1618	CE1	PHE	A	358	−0.350	27.964	−5.254	1.00	34.09	C
ATOM	1619	CZ	PHE	A	358	0.986	28.258	−5.034	1.00	34.06	C
ATOM	1620	CE2	PHE	A	358	1.526	28.092	−3.775	1.00	33.93	C
ATOM	1621	CD2	PHE	A	358	0.730	27.631	−2.735	1.00	33.81	C
ATOM	1622	C	PHE	A	358	−0.039	24.903	−1.032	1.00	32.78	C
ATOM	1623	O	PHE	A	358	0.296	25.283	0.086	1.00	32.73	O
ATOM	1633	N	LEU	A	359	0.733	24.137	−1.802	1.00	32.61	N
ATOM	1634	CA	LEU	A	359	2.042	23.641	−1.379	1.00	32.50	C
ATOM	1635	CB	LEU	A	359	2.352	22.305	−2.065	1.00	32.41	C
ATOM	1636	CG	LEU	A	359	1.500	21.103	−1.641	1.00	32.41	C
ATOM	1637	CD1	LEU	A	359	1.916	19.876	−2.418	1.00	32.23	C
ATOM	1638	CD2	LEU	A	359	1.606	20.837	−0.141	1.00	32.63	C
ATOM	1639	C	LEU	A	359	3.170	24.635	−1.662	1.00	32.41	C
ATOM	1640	O	LEU	A	359	2.997	25.586	−2.420	1.00	32.43	O
ATOM	1652	N	VAL	A	360	4.326	24.394	−1.045	1.00	32.14	N
ATOM	1653	CA	VAL	A	360	5.513	25.227	−1.234	1.00	32.17	C
ATOM	1654	CB	VAL	A	360	6.612	24.898	−0.170	1.00	32.13	C
ATOM	1655	CG1	VAL	A	360	7.257	23.539	−0.427	1.00	32.04	C
ATOM	1656	CG2	VAL	A	360	7.658	25.995	−0.108	1.00	31.93	C
ATOM	1657	C	VAL	A	360	6.079	25.117	−2.658	1.00	32.12	C
ATOM	1658	O	VAL	A	360	6.755	26.028	−3.135	1.00	32.06	O
ATOM	1668	N	THR	A	361	5.780	24.002	−3.324	1.00	32.20	N
ATOM	1669	CA	THR	A	361	6.200	23.751	−4.703	1.00	32.11	C
ATOM	1670	CB	THR	A	361	6.296	22.238	−4.950	1.00	32.19	C
ATOM	1671	OG1	THR	A	361	5.124	21.580	−4.447	1.00	32.11	O
ATOM	1672	CG2	THR	A	361	7.424	21.637	−4.150	1.00	32.17	C
ATOM	1673	C	THR	A	361	5.284	24.379	−5.764	1.00	32.17	C
ATOM	1674	O	THR	A	361	5.583	24.310	−6.957	1.00	31.89	O
ATOM	1682	N	GLY	A	362	4.172	24.973	−5.337	1.00	32.31	N
ATOM	1683	CA	GLY	A	362	3.347	25.787	−6.222	1.00	32.41	C
ATOM	1684	C	GLY	A	362	2.003	25.211	−6.634	1.00	32.46	C
ATOM	1685	O	GLY	A	362	1.171	25.935	−7.178	1.00	32.54	O
ATOM	1689	N	GLN	A	363	1.777	23.927	−6.370	1.00	32.56	N
ATOM	1690	CA	GLN	A	363	0.547	23.258	−6.790	1.00	32.79	C
ATOM	1691	CB	GLN	A	363	0.812	21.790	−7.103	1.00	32.86	C
ATOM	1692	CG	GLN	A	363	1.909	21.560	−8.123	1.00	33.54	C
ATOM	1693	CD	GLN	A	363	3.300	21.598	−7.519	1.00	34.24	C
ATOM	1694	OE1	GLN	A	363	3.512	21.111	−6.410	1.00	35.24	O
ATOM	1695	NE2	GLN	A	363	4.247	22.184	−8.242	1.00	34.95	N
ATOM	1696	C	GLN	A	363	−0.535	23.348	−5.719	1.00	32.83	C
ATOM	1697	O	GLN	A	363	−0.268	23.724	−4.580	1.00	32.41	O
ATOM	1706	N	GLN	A	364	−1.759	22.991	−6.100	1.00	32.98	N
ATOM	1707	CA	GLN	A	364	−2.886	22.982	−5.179	1.00	33.20	C
ATOM	1708	CB	GLN	A	364	−3.951	23.981	−5.628	1.00	33.20	C
ATOM	1709	CG	GLN	A	364	−3.574	25.415	−5.328	1.00	33.71	C
ATOM	1710	CD	GLN	A	364	−4.765	26.324	−5.131	1.00	34.23	C
ATOM	1711	OE1	GLN	A	364	−4.678	27.211	−4.138	1.00	35.11	O
ATOM	1712	NE2	GLN	A	364	−5.753	26.236	−5.872	1.00	33.26	N
ATOM	1713	C	GLN	A	364	−3.478	21.592	−5.098	1.00	33.35	C
ATOM	1714	O	GLN	A	364	−4.246	21.194	−5.966	1.00	33.60	O
ATOM	1723	N	VAL	A	365	−3.111	20.850	−4.059	1.00	33.56	N
ATOM	1724	CA	VAL	A	365	−3.741	19.560	−3.787	1.00	33.80	C
ATOM	1725	CB	VAL	A	365	−2.866	18.670	−2.869	1.00	33.82	C
ATOM	1726	CG1	VAL	A	365	−1.445	18.561	−3.432	1.00	34.21	C
ATOM	1727	CG2	VAL	A	365	−2.825	19.202	−1.440	1.00	34.08	C
ATOM	1728	C	VAL	A	365	−5.115	19.815	−3.167	1.00	33.83	C
ATOM	1729	O	VAL	A	365	−5.245	20.623	−2.258	1.00	33.87	O
ATOM	1739	N	ASP	A	366	−6.143	19.151	−3.681	1.00	33.96	N
ATOM	1740	CA	ASP	A	366	−7.492	19.314	−3.149	1.00	34.04	C
ATOM	1741	CB	ASP	A	366	−8.522	18.599	−4.033	1.00	34.21	C
ATOM	1742	CG	ASP	A	366	−8.527	19.109	−5.466	1.00	34.71	C
ATOM	1743	OD1	ASP	A	366	−9.479	18.782	−6.209	1.00	34.96	O
ATOM	1744	OD2	ASP	A	366	−7.626	19.840	−5.936	1.00	35.68	O
ATOM	1745	C	ASP	A	366	−7.530	18.726	−1.745	1.00	33.89	C
ATOM	1746	O	ASP	A	366	−6.976	17.653	−1.516	1.00	33.84	O
ATOM	1751	N	TYR	A	367	−8.174	19.424	−0.811	1.00	33.75	N
ATOM	1752	CA	TYR	A	367	−8.304	18.936	0.563	1.00	33.80	C
ATOM	1753	CB	TYR	A	367	−9.023	19.970	1.452	1.00	33.93	C
ATOM	1754	CG	TYR	A	367	−9.343	19.462	2.846	1.00	34.89	C
ATOM	1755	CD1	TYR	A	367	−8.368	19.427	3.849	1.00	36.38	C
ATOM	1756	CE1	TYR	A	367	−8.661	18.939	5.125	1.00	37.01	C
ATOM	1757	CZ	TYR	A	367	−9.944	18.479	5.398	1.00	38.19	C
ATOM	1758	OH	TYR	A	367	−10.271	17.987	6.640	1.00	40.50	O
ATOM	1759	CE2	TYR	A	367	−10.920	18.503	4.422	1.00	37.48	C
ATOM	1760	CD2	TYR	A	367	−10.614	18.991	3.155	1.00	36.56	C
ATOM	1761	C	TYR	A	367	−9.014	17.577	0.623	1.00	33.75	C
ATOM	1762	O	TYR	A	367	−8.814	16.822	1.563	1.00	33.69	O
ATOM	1772	N	SER	A	368	−9.837	17.276	−0.382	1.00	33.85	N
ATOM	1773	CA	SER	A	368	−10.509	15.974	−0.508	1.00	33.98	C
ATOM	1774	CB	SER	A	368	−11.280	15.904	−1.834	1.00	34.00	C
ATOM	1775	OG	SER	A	368	−11.625	17.198	−2.309	1.00	34.49	O
ATOM	1776	C	SER	A	368	−9.529	14.794	−0.432	1.00	34.02	C
ATOM	1777	O	SER	A	368	−9.789	13.792	0.235	1.00	33.77	O
ATOM	1783	N	ILE	A	369	−8.412	14.936	−1.141	1.00	34.21	N
ATOM	1784	CA	ILE	A	369	−7.331	13.949	−1.175	1.00	34.37	C
ATOM	1785	CB	ILE	A	369	−6.213	14.451	−2.142	1.00	34.54	C
ATOM	1786	CG1	ILE	A	369	−6.669	14.281	−3.601	1.00	35.07	C
ATOM	1787	CD1	ILE	A	369	−6.411	15.511	−4.464	1.00	35.66	C
ATOM	1788	CG2	ILE	A	369	−4.875	13.744	−1.898	1.00	34.43	C
ATOM	1789	C	ILE	A	369	−6.745	13.644	0.203	1.00	34.36	C
ATOM	1790	O	ILE	A	369	−6.428	12.486	0.502	1.00	34.43	O
ATOM	1802	N	ILE	A	370	−6.595	14.679	1.029	1.00	34.24	N
ATOM	1803	CA	ILE	A	370	−6.007	14.523	2.360	1.00	34.08	C
ATOM	1804	CB	ILE	A	370	−5.478	15.866	2.925	1.00	34.17	C
ATOM	1805	CG1	ILE	A	370	−4.742	16.687	1.854	1.00	33.90	C
ATOM	1806	CD1	ILE	A	370	−4.353	18.067	2.316	1.00	33.59	C
ATOM	1807	CG2	ILE	A	370	−4.533	15.601	4.095	1.00	34.30	C
ATOM	1808	C	ILE	A	370	−7.015	13.909	3.328	1.00	33.94	C
ATOM	1809	O	ILE	A	370	−6.656	13.066	4.138	1.00	34.11	O
ATOM	1821	N	ALA	A	371	−8.274	14.322	3.225	1.00	33.84	N
ATOM	1822	CA	ALA	A	371	−9.350	13.828	4.088	1.00	33.80	C
ATOM	1823	CB	ALA	A	371	−10.659	14.505	3.718	1.00	33.80	C
ATOM	1824	C	ALA	A	371	−9.530	12.312	4.034	1.00	33.78	C
ATOM	1825	O	ALA	A	371	−9.734	11.674	5.063	1.00	33.95	O
ATOM	1831	N	SER	A	372	−9.457	11.747	2.836	1.00	33.70	N
ATOM	1832	CA	SER	A	372	−9.695	10.318	2.636	1.00	33.86	C
ATOM	1833	CB	SER	A	372	−10.019	10.044	1.166	1.00	33.87	C
ATOM	1834	OG	SER	A	372	−8.972	10.493	0.326	1.00	33.90	O
ATOM	1835	C	SER	A	372	−8.536	9.414	3.067	1.00	33.97	C
ATOM	1836	O	SER	A	372	−8.750	8.235	3.359	1.00	33.97	O
ATOM	1842	N	GLN	A	373	−7.321	9.960	3.097	1.00	34.09	N
ATOM	1843	CA	GLN	A	373	−6.111	9.173	3.346	1.00	34.20	C
ATOM	1844	CB	GLN	A	373	−5.096	9.436	2.223	1.00	34.34	C
ATOM	1845	CG	GLN	A	373	−4.472	8.176	1.610	1.00	35.16	C
ATOM	1846	CD	GLN	A	373	−4.593	8.146	0.100	1.00	35.49	C
ATOM	1847	OE1	GLN	A	373	−4.000	8.979	−0.593	1.00	36.05	O
ATOM	1848	NE2	GLN	A	373	−5.371	7.200	−0.414	1.00	36.22	N
ATOM	1849	C	GLN	A	373	−5.440	9.444	4.703	1.00	34.14	C
ATOM	1850	O	GLN	A	373	−4.483	8.755	5.061	1.00	34.27	O
ATOM	1859	N	ALA	A	374	−5.936	10.431	5.450	1.00	33.89	N
ATOM	1860	CA	ALA	A	374	−5.306	10.860	6.699	1.00	33.61	C
ATOM	1861	CB	ALA	A	374	−5.445	12.364	6.861	1.00	33.69	C
ATOM	1862	C	ALA	A	374	−5.916	10.150	7.907	1.00	33.46	C
ATOM	1863	O	ALA	A	374	−7.134	10.026	8.010	1.00	33.33	O
ATOM	1869	N	GLY	A	375	−5.064	9.696	8.822	1.00	33.26	N
ATOM	1870	CA	GLY	A	375	−5.514	9.101	10.069	1.00	33.10	C
ATOM	1871	C	GLY	A	375	−5.955	10.140	11.089	1.00	32.86	C
ATOM	1872	O	GLY	A	375	−6.176	11.297	10.749	1.00	32.93	O
ATOM	1876	N	ALA	A	376	−6.065	9.727	12.347	1.00	32.67	N
ATOM	1877	CA	ALA	A	376	−6.644	10.567	13.393	1.00	32.64	C
ATOM	1878	CB	ALA	A	376	−6.963	9.738	14.623	1.00	32.62	C
ATOM	1879	C	ALA	A	376	−5.756	11.743	13.774	1.00	32.62	C
ATOM	1880	O	ALA	A	376	−6.232	12.875	13.828	1.00	32.68	O
ATOM	1886	N	THR	A	377	−4.480	11.474	14.052	1.00	32.45	N
ATOM	1887	CA	THR	A	377	−3.543	12.517	14.477	1.00	32.26	C
ATOM	1888	CB	THR	A	377	−2.125	11.945	14.734	1.00	32.25	C
ATOM	1889	OG1	THR	A	377	−2.180	10.870	15.678	1.00	32.16	O
ATOM	1890	CG2	THR	A	377	−1.242	12.966	15.441	1.00	32.64	C
ATOM	1891	C	THR	A	377	−3.446	13.628	13.453	1.00	32.17	C
ATOM	1892	O	THR	A	377	−3.510	14.804	13.801	1.00	32.06	O
ATOM	1900	N	LEU	A	378	−3.282	13.248	12.194	1.00	32.27	N
ATOM	1901	CA	LEU	A	378	−3.087	14.211	11.116	1.00	32.63	C
ATOM	1902	CB	LEU	A	378	−2.616	13.503	9.843	1.00	32.60	C
ATOM	1903	CG	LEU	A	378	−2.487	14.297	8.547	1.00	32.45	C
ATOM	1904	CD1	LEU	A	378	−1.401	15.347	8.650	1.00	32.47	C
ATOM	1905	CD2	LEU	A	378	−2.188	13.335	7.432	1.00	32.88	C
ATOM	1906	C	LEU	A	378	−4.348	14.998	10.831	1.00	32.93	C
ATOM	1907	O	LEU	A	378	−4.270	16.142	10.410	1.00	32.91	O
ATOM	1919	N	ASN	A	379	−5.502	14.374	11.041	1.00	33.56	N
ATOM	1920	CA	ASN	A	379	−6.786	15.054	10.884	1.00	34.00	C
ATOM	1921	CB	ASN	A	379	−7.948	14.059	10.938	1.00	34.08	C
ATOM	1922	CG	ASN	A	379	−8.555	13.807	9.578	1.00	35.10	C
ATOM	1923	OD1	ASN	A	379	−9.189	14.834	9.022	1.00	37.09	O
ATOM	1924	ND2	ASN	A	379	−8.454	12.702	9.024	1.00	35.56	N
ATOM	1925	C	ASN	A	379	−6.974	16.139	11.941	1.00	34.04	C
ATOM	1926	O	ASN	A	379	−7.458	17.226	11.638	1.00	33.86	O
ATOM	1933	N	ASN	A	380	−6.584	15.830	13.178	1.00	34.33	N
ATOM	1934	CA	ASN	A	380	−6.598	16.800	14.271	1.00	34.68	C
ATOM	1935	CB	ASN	A	380	−6.188	16.153	15.605	1.00	34.62	C
ATOM	1936	CG	ASN	A	380	−7.263	15.241	16.175	1.00	35.17	C
ATOM	1937	OD1	ASN	A	380	−8.429	15.623	16.265	1.00	36.08	O
ATOM	1938	ND2	ASN	A	380	−6.873	14.025	16.568	1.00	35.65	N
ATOM	1939	C	ASN	A	380	−5.677	17.976	13.975	1.00	34.86	C
ATOM	1940	O	ASN	A	380	−5.983	19.100	14.349	1.00	35.04	O
ATOM	1947	N	LEU	A	381	−4.563	17.704	13.297	1.00	35.08	N
ATOM	1948	CA	LEU	A	381	−3.554	18.720	12.981	1.00	35.42	C
ATOM	1949	CB	LEU	A	381	−2.219	18.061	12.628	1.00	35.50	C
ATOM	1950	CG	LEU	A	381	−1.230	17.804	13.754	1.00	35.83	C
ATOM	1951	CD1	LEU	A	381	−0.150	16.866	13.243	1.00	37.15	C
ATOM	1952	CD2	LEU	A	381	−0.621	19.109	14.249	1.00	36.34	C
ATOM	1953	C	LEU	A	381	−3.951	19.587	11.804	1.00	35.60	C
ATOM	1954	O	LEU	A	381	−3.771	20.792	11.837	1.00	35.44	O
ATOM	1966	N	MET	A	382	−4.446	18.948	10.748	1.00	36.32	N
ATOM	1967	CA	MET	A	382	−4.815	19.630	9.507	1.00	36.73	C
ATOM	1968	CB	MET	A	382	−5.170	18.616	8.403	1.00	37.03	C
ATOM	1969	CG	MET	A	382	−4.049	18.370	7.386	1.00	38.21	C
ATOM	1970	SD	MET	A	382	−3.965	19.676	6.089	1.00	41.87	S
ATOM	1971	CE	MET	A	382	−2.387	20.427	6.432	1.00	40.39	C
ATOM	1972	C	MET	A	382	−6.001	20.550	9.767	1.00	36.67	C
ATOM	1973	O	MET	A	382	−6.090	21.636	9.189	1.00	36.42	O
ATOM	1983	N	SER	A	383	−6.893	20.104	10.651	1.00	36.53	N
ATOM	1984	CA	SER	A	383	−8.102	20.846	10.975	1.00	36.59	C
ATOM	1985	CB	SER	A	383	−9.166	19.930	11.597	1.00	36.67	C
ATOM	1986	OG	SER	A	383	−8.946	19.729	12.985	1.00	37.42	O
ATOM	1987	C	SER	A	383	−7.813	22.029	11.894	1.00	36.27	C
ATOM	1988	O	SER	A	383	−8.365	23.104	11.691	1.00	36.52	O
ATOM	1994	N	HIS	A	384	−6.955	21.845	12.896	1.00	35.86	N
ATOM	1995	CA	HIS	A	384	−6.545	22.974	13.743	1.00	35.64	C
ATOM	1996	CB	HIS	A	384	−5.637	22.528	14.898	1.00	35.66	C
ATOM	1997	CG	HIS	A	384	−6.295	21.571	15.846	1.00	36.74	C
ATOM	1998	ND1	HIS	A	384	−5.582	20.799	16.740	1.00	37.77	N
ATOM	1999	CE1	HIS	A	384	−6.418	20.039	17.428	1.00	37.38	C
ATOM	2000	NE2	HIS	A	384	−7.646	20.285	17.010	1.00	37.06	N
ATOM	2001	CD2	HIS	A	384	−7.598	21.240	16.021	1.00	36.93	C
ATOM	2002	C	HIS	A	384	−5.849	24.027	12.886	1.00	35.20	C
ATOM	2003	O	HIS	A	384	−6.069	25.217	13.073	1.00	35.15	O
ATOM	2012	N	ALA	A	385	−5.037	23.571	11.931	1.00	34.96	N
ATOM	2013	CA	ALA	A	385	−4.356	24.450	10.986	1.00	34.90	C
ATOM	2014	CB	ALA	A	385	−3.433	23.653	10.095	1.00	34.70	C
ATOM	2015	C	ALA	A	385	−5.323	25.256	10.131	1.00	35.19	C
ATOM	2016	O	ALA	A	385	−5.062	26.418	9.849	1.00	35.14	O
ATOM	2022	N	GLN	A	386	−6.435	24.642	9.730	1.00	35.67	N
ATOM	2023	CA	GLN	A	386	−7.397	25.283	8.828	1.00	36.06	C
ATOM	2024	CB	GLN	A	386	−8.306	24.251	8.145	1.00	36.24	C
ATOM	2025	CG	GLN	A	386	−8.358	24.392	6.621	1.00	37.29	C
ATOM	2026	CD	GLN	A	386	−6.987	24.230	5.979	1.00	39.41	C
ATOM	2027	OE1	GLN	A	386	−6.278	23.256	6.265	1.00	40.61	O
ATOM	2028	NE2	GLN	A	386	−6.599	25.192	5.129	1.00	40.28	N
ATOM	2029	C	GLN	A	386	−8.247	26.340	9.523	1.00	36.15	C
ATOM	2030	O	GLN	A	386	−8.578	27.351	8.907	1.00	36.33	O
ATOM	2039	N	GLU	A	387	−8.594	26.110	10.792	1.00	36.03	N
ATOM	2040	CA	GLU	A	387	−9.329	27.100	11.581	1.00	35.96	C
ATOM	2041	CB	GLU	A	387	−9.845	26.508	12.901	1.00	36.12	C
ATOM	2042	CG	GLU	A	387	−10.708	25.249	12.780	1.00	36.83	C
ATOM	2043	CD	GLU	A	387	−11.928	25.410	11.876	1.00	38.35	C
ATOM	2044	OE1	GLU	A	387	−12.765	26.314	12.122	1.00	39.69	O
ATOM	2045	OE2	GLU	A	387	−12.061	24.616	10.920	1.00	38.32	O
ATOM	2046	C	GLU	A	387	−8.433	28.295	11.878	1.00	35.69	C
ATOM	2047	O	GLU	A	387	−8.916	29.401	12.105	1.00	36.05	O
ATOM	2054	N	LEU	A	388	−7.125	28.065	11.876	1.00	35.32	N
ATOM	2055	CA	LEU	A	388	−6.137	29.123	12.092	1.00	34.88	C
ATOM	2056	CB	LEU	A	388	−4.791	28.500	12.480	1.00	34.87	C
ATOM	2057	CG	LEU	A	388	−3.788	29.263	13.350	1.00	34.41	C
ATOM	2058	CD1	LEU	A	388	−2.382	28.927	12.914	1.00	34.37	C
ATOM	2059	CD2	LEU	A	388	−3.982	30.759	13.317	1.00	34.53	C
ATOM	2060	C	LEU	A	388	−5.981	29.966	10.823	1.00	34.58	C
ATOM	2061	O	LEU	A	388	−5.921	31.193	10.886	1.00	34.02	O
ATOM	2073	N	VAL	A	389	−5.915	29.284	9.679	1.00	34.42	N
ATOM	2074	CA	VAL	A	389	−5.860	29.926	8.365	1.00	34.23	C
ATOM	2075	CB	VAL	A	389	−5.813	28.870	7.202	1.00	34.23	C
ATOM	2076	CG1	VAL	A	389	−6.074	29.513	5.842	1.00	33.63	C
ATOM	2077	CG2	VAL	A	389	−4.474	28.140	7.183	1.00	34.32	C
ATOM	2078	C	VAL	A	389	−7.075	30.822	8.170	1.00	34.10	C
ATOM	2079	O	VAL	A	389	−6.947	31.931	7.665	1.00	34.30	O
ATOM	2089	N	ALA	A	390	−8.242	30.336	8.584	1.00	33.97	N
ATOM	2090	CA	ALA	A	390	−9.509	31.031	8.370	1.00	34.01	C
ATOM	2091	CB	ALA	A	390	−10.675	30.056	8.527	1.00	33.92	C
ATOM	2092	C	ALA	A	390	−9.674	32.222	9.316	1.00	34.14	C
ATOM	2093	O	ALA	A	390	−10.369	33.186	8.993	1.00	34.11	O
ATOM	2099	N	LYS	A	391	−9.038	32.146	10.482	1.00	34.37	N
ATOM	2100	CA	LYS	A	391	−9.016	33.261	11.424	1.00	34.68	C
ATOM	2101	CB	LYS	A	391	−8.430	32.820	12.774	1.00	34.82	C
ATOM	2102	CG	LYS	A	391	−9.136	33.404	14.007	1.00	35.74	C
ATOM	2103	CD	LYS	A	391	−9.520	32.302	15.024	1.00	36.81	C
ATOM	2104	CE	LYS	A	391	−10.838	31.609	14.679	1.00	36.91	C
ATOM	2105	NZ	LYS	A	391	−10.727	30.130	14.854	1.00	37.71	N
ATOM	2106	C	LYS	A	391	−8.185	34.398	10.830	1.00	34.75	C
ATOM	2107	O	LYS	A	391	−8.597	35.557	10.849	1.00	34.88	O
ATOM	2121	N	LEU	A	392	−7.019	34.038	10.294	1.00	34.71	N
ATOM	2122	CA	LEU	A	392	−6.111	34.983	9.651	1.00	34.53	C
ATOM	2123	CB	LEU	A	392	−4.748	34.330	9.376	1.00	34.46	C
ATOM	2124	CG	LEU	A	392	−3.516	34.607	10.257	1.00	34.48	C
ATOM	2125	CD1	LEU	A	392	−3.795	35.339	11.565	1.00	34.91	C
ATOM	2126	CD2	LEU	A	392	−2.808	33.299	10.540	1.00	34.38	C
ATOM	2127	C	LEU	A	392	−6.684	35.488	8.339	1.00	34.60	C
ATOM	2128	O	LEU	A	392	−6.404	36.613	7.943	1.00	34.96	O
ATOM	2140	N	ARG	A	393	−7.483	34.671	7.659	1.00	34.59	N
ATOM	2141	CA	ARG	A	393	−8.050	35.079	6.376	1.00	34.71	C
ATOM	2142	CB	ARG	A	393	−8.764	33.911	5.678	1.00	34.77	C
ATOM	2143	CG	ARG	A	393	−8.670	33.925	4.146	1.00	35.35	C
ATOM	2144	CD	ARG	A	393	−8.054	32.655	3.542	1.00	36.10	C
ATOM	2145	NE	ARG	A	393	−8.962	31.510	3.635	1.00	36.52	N
ATOM	2146	CZ	ARG	A	393	−8.634	30.242	3.368	1.00	36.68	C
ATOM	2147	NH1	ARG	A	393	−7.405	29.919	2.972	1.00	36.25	N
ATOM	2148	NH2	ARG	A	393	−9.552	29.285	3.493	1.00	36.62	N
ATOM	2149	C	ARG	A	393	−9.012	36.235	6.618	1.00	34.60	C
ATOM	2150	O	ARG	A	393	−9.026	37.215	5.868	1.00	34.50	O
ATOM	2164	N	SER	A	394	−9.782	36.115	7.697	1.00	34.66	N
ATOM	2165	CA	SER	A	394	−10.786	37.105	8.081	1.00	34.84	C
ATOM	2166	CB	SER	A	394	−11.803	36.477	9.032	1.00	34.84	C
ATOM	2167	OG	SER	A	394	−11.148	35.935	10.168	1.00	35.49	O
ATOM	2168	C	SER	A	394	−10.194	38.352	8.734	1.00	34.77	C
ATOM	2169	O	SER	A	394	−10.910	39.324	8.939	1.00	35.10	O
ATOM	2175	N	LEU	A	395	−8.905	38.316	9.071	1.00	34.79	N
ATOM	2176	CA	LEU	A	395	−8.170	39.493	9.561	1.00	34.82	C
ATOM	2177	CB	LEU	A	395	−7.116	39.067	10.599	1.00	34.93	C
ATOM	2178	CG	LEU	A	395	−7.469	38.936	12.079	1.00	34.71	C
ATOM	2179	CD1	LEU	A	395	−8.959	38.698	12.302	1.00	35.03	C
ATOM	2180	CD2	LEU	A	395	−6.632	37.818	12.704	1.00	34.11	C
ATOM	2181	C	LEU	A	395	−7.441	40.245	8.443	1.00	34.81	C
ATOM	2182	O	LEU	A	395	−6.627	41.122	8.726	1.00	34.82	O
ATOM	2194	N	GLN	A	396	−7.723	39.905	7.185	1.00	34.89	N
ATOM	2195	CA	GLN	A	396	−6.929	40.380	6.046	1.00	34.84	C
ATOM	2196	CB	GLN	A	396	−7.413	41.741	5.555	1.00	34.96	C
ATOM	2197	CG	GLN	A	396	−8.792	41.712	4.927	1.00	35.71	C
ATOM	2198	CD	GLN	A	396	−9.868	42.050	5.926	1.00	36.74	C
ATOM	2199	OE1	GLN	A	396	−10.109	41.284	6.867	1.00	37.26	O
ATOM	2200	NE2	GLN	A	396	−10.504	43.205	5.748	1.00	36.40	N
ATOM	2201	C	GLN	A	396	−5.440	40.430	6.396	1.00	34.49	C
ATOM	2202	O	GLN	A	396	−4.780	41.460	6.250	1.00	34.51	O
ATOM	2211	N	PHE	A	397	−4.945	39.298	6.883	1.00	34.03	N
ATOM	2212	CA	PHE	A	397	−3.534	39.101	7.190	1.00	33.67	C
ATOM	2213	CB	PHE	A	397	−3.337	37.641	7.608	1.00	33.47	C
ATOM	2214	CG	PHE	A	397	−2.000	37.331	8.215	1.00	33.19	C
ATOM	2215	CD1	PHE	A	397	−1.432	38.159	9.170	1.00	32.83	C
ATOM	2216	CE1	PHE	A	397	−0.211	37.850	9.732	1.00	32.62	C
ATOM	2217	CZ	PHE	A	397	0.448	36.695	9.358	1.00	32.59	C
ATOM	2218	CE2	PHE	A	397	−0.112	35.855	8.422	1.00	32.92	C
ATOM	2219	CD2	PHE	A	397	−1.330	36.169	7.859	1.00	33.03	C
ATOM	2220	C	PHE	A	397	−2.696	39.437	5.956	1.00	33.58	C
ATOM	2221	O	PHE	A	397	−2.939	38.897	4.876	1.00	33.65	O
ATOM	2231	N	ASP	A	398	−1.735	40.343	6.107	1.00	33.35	N
ATOM	2232	CA	ASP	A	398	−0.904	40.768	4.982	1.00	33.41	C
ATOM	2233	CB	ASP	A	398	−1.181	42.239	4.618	1.00	33.37	C
ATOM	2234	CG	ASP	A	398	−0.824	43.207	5.728	1.00	33.14	C
ATOM	2235	OD1	ASP	A	398	−1.559	44.198	5.914	1.00	32.83	O
ATOM	2236	OD2	ASP	A	398	0.173	43.079	6.455	1.00	33.24	O
ATOM	2237	C	ASP	A	398	0.583	40.502	5.251	1.00	33.44	C
ATOM	2238	O	ASP	A	398	0.946	39.966	6.302	1.00	33.44	O
ATOM	2243	N	GLN	A	399	1.431	40.875	4.295	1.00	33.34	N
ATOM	2244	CA	GLN	A	399	2.854	40.555	4.350	1.00	33.38	C
ATOM	2245	CB	GLN	A	399	3.501	40.777	2.987	1.00	33.34	C
ATOM	2246	CG	GLN	A	399	4.830	40.051	2.830	1.00	33.63	C
ATOM	2247	CD	GLN	A	399	5.540	40.388	1.538	1.00	33.48	C
ATOM	2248	OE1	GLN	A	399	5.336	41.459	0.967	1.00	34.38	O
ATOM	2249	NE2	GLN	A	399	6.381	39.479	1.078	1.00	33.37	N
ATOM	2250	C	GLN	A	399	3.629	41.338	5.415	1.00	33.38	C
ATOM	2251	O	GLN	A	399	4.607	40.828	5.961	1.00	33.40	O
ATOM	2260	N	ARG	A	400	3.204	42.567	5.697	1.00	33.19	N
ATOM	2261	CA	ARG	A	400	3.834	43.384	6.734	1.00	33.12	C
ATOM	2262	CB	ARG	A	400	3.236	44.795	6.760	1.00	33.18	C
ATOM	2263	CG	ARG	A	400	3.771	45.746	5.697	1.00	33.28	C
ATOM	2264	CD	ARG	A	400	3.441	45.372	4.257	1.00	33.87	C
ATOM	2265	NE	ARG	A	400	2.012	45.152	4.024	1.00	34.41	N
ATOM	2266	CZ	ARG	A	400	1.437	45.077	2.823	1.00	35.12	C
ATOM	2267	NH1	ARG	A	400	2.152	45.210	1.707	1.00	35.16	N
ATOM	2268	NH2	ARG	A	400	0.128	44.870	2.737	1.00	35.41	N
ATOM	2269	C	ARG	A	400	3.637	42.739	8.101	1.00	33.14	C
ATOM	2270	O	ARG	A	400	4.571	42.637	8.902	1.00	33.34	O
ATOM	2284	N	GLU	A	401	2.405	42.317	8.358	1.00	32.93	N
ATOM	2285	CA	GLU	A	401	2.043	41.662	9.605	1.00	32.83	C
ATOM	2286	CB	GLU	A	401	0.522	41.490	9.678	1.00	32.92	C
ATOM	2287	CG	GLU	A	401	−0.256	42.802	9.720	1.00	32.72	C
ATOM	2288	CD	GLU	A	401	−1.709	42.643	9.327	1.00	32.50	C
ATOM	2289	OE1	GLU	A	401	−2.163	41.499	9.150	1.00	32.82	O
ATOM	2290	OE2	GLU	A	401	−2.409	43.664	9.205	1.00	33.15	O
ATOM	2291	C	GLU	A	401	2.715	40.294	9.727	1.00	32.66	C
ATOM	2292	O	GLU	A	401	3.110	39.887	10.810	1.00	32.29	O
ATOM	2299	N	PHE	A	402	2.847	39.599	8.601	1.00	32.76	N
ATOM	2300	CA	PHE	A	402	3.440	38.260	8.566	1.00	32.72	C
ATOM	2301	CB	PHE	A	402	3.226	37.644	7.177	1.00	32.72	C
ATOM	2302	CG	PHE	A	402	4.169	36.520	6.848	1.00	32.34	C
ATOM	2303	CD1	PHE	A	402	3.993	35.265	7.414	1.00	32.74	C
ATOM	2304	CE1	PHE	A	402	4.856	34.214	7.101	1.00	33.43	C
ATOM	2305	CZ	PHE	A	402	5.908	34.421	6.212	1.00	33.25	C
ATOM	2306	CE2	PHE	A	402	6.088	35.676	5.639	1.00	32.90	C
ATOM	2307	CD2	PHE	A	402	5.220	36.716	5.958	1.00	32.18	C
ATOM	2308	C	PHE	A	402	4.933	38.261	8.940	1.00	32.65	C
ATOM	2309	O	PHE	A	402	5.369	37.473	9.778	1.00	32.26	O
ATOM	2319	N	VAL	A	403	5.700	39.153	8.318	1.00	32.50	N
ATOM	2320	CA	VAL	A	403	7.133	39.256	8.572	1.00	32.59	C
ATOM	2321	CB	VAL	A	403	7.819	40.232	7.574	1.00	32.76	C
ATOM	2322	CG1	VAL	A	403	9.227	40.501	7.987	1.00	33.35	C
ATOM	2323	CG2	VAL	A	403	7.808	39.666	6.156	1.00	32.98	C
ATOM	2324	C	VAL	A	403	7.416	39.684	10.025	1.00	32.33	C
ATOM	2325	O	VAL	A	403	8.432	39.294	10.596	1.00	32.22	O
ATOM	2335	N	CYS	A	404	6.525	40.482	10.612	1.00	32.07	N
ATOM	2336	CA	CYS	A	404	6.619	40.825	12.034	1.00	31.98	C
ATOM	2337	CB	CYS	A	404	5.576	41.868	12.437	1.00	31.95	C
ATOM	2338	SG	CYS	A	404	6.006	43.553	11.984	1.00	32.73	S
ATOM	2339	C	CYS	A	404	6.434	39.587	12.896	1.00	31.68	C
ATOM	2340	O	CYS	A	404	7.240	39.325	13.789	1.00	31.32	O
ATOM	2346	N	LEU	A	405	5.376	38.825	12.627	1.00	31.53	N
ATOM	2347	CA	LEU	A	405	5.103	37.619	13.404	1.00	31.60	C
ATOM	2348	CB	LEU	A	405	3.796	36.952	12.959	1.00	31.77	C
ATOM	2349	CG	LEU	A	405	2.460	37.607	13.353	1.00	32.40	C
ATOM	2350	CD1	LEU	A	405	1.399	36.540	13.614	1.00	33.60	C
ATOM	2351	CD2	LEU	A	405	2.572	38.535	14.558	1.00	32.88	C
ATOM	2352	C	LEU	A	405	6.265	36.636	13.326	1.00	31.30	C
ATOM	2353	O	LEU	A	405	6.578	35.983	14.310	1.00	30.88	O
ATOM	2365	N	LYS	A	406	6.915	36.566	12.166	1.00	31.55	N
ATOM	2366	CA	LYS	A	406	8.083	35.705	11.973	1.00	31.91	C
ATOM	2367	CB	LYS	A	406	8.575	35.779	10.531	1.00	32.21	C
ATOM	2368	CG	LYS	A	406	7.904	34.806	9.568	1.00	32.94	C
ATOM	2369	CD	LYS	A	406	8.875	34.340	8.478	1.00	33.06	C
ATOM	2370	CE	LYS	A	406	9.080	35.379	7.408	1.00	33.84	C
ATOM	2371	NZ	LYS	A	406	9.476	34.748	6.105	1.00	35.59	N
ATOM	2372	C	LYS	A	406	9.234	36.084	12.904	1.00	31.90	C
ATOM	2373	O	LYS	A	406	9.869	35.207	13.498	1.00	31.79	O
ATOM	2387	N	PHE	A	407	9.499	37.385	13.018	1.00	31.82	N
ATOM	2388	CA	PHE	A	407	10.566	37.888	13.883	1.00	31.91	C
ATOM	2389	CB	PHE	A	407	10.943	39.327	13.513	1.00	32.04	C
ATOM	2390	CG	PHE	A	407	11.979	39.419	12.425	1.00	32.81	C
ATOM	2391	CD1	PHE	A	407	11.618	39.324	11.085	1.00	33.43	C
ATOM	2392	CE1	PHE	A	407	12.575	39.401	10.080	1.00	33.43	C
ATOM	2393	CZ	PHE	A	407	13.896	39.568	10.410	1.00	33.08	C
ATOM	2394	CE2	PHE	A	407	14.268	39.661	11.740	1.00	33.17	C
ATOM	2395	CD2	PHE	A	407	13.313	39.586	12.738	1.00	33.02	C
ATOM	2396	C	PHE	A	407	10.230	37.786	15.374	1.00	31.70	C
ATOM	2397	O	PHE	A	407	11.121	37.589	16.179	1.00	31.73	O
ATOM	2407	N	LEU	A	408	8.958	37.899	15.737	1.00	31.69	N
ATOM	2408	CA	LEU	A	408	8.538	37.689	17.125	1.00	31.88	C
ATOM	2409	CB	LEU	A	408	7.093	38.171	17.341	1.00	31.91	C
ATOM	2410	CG	LEU	A	408	6.910	39.695	17.229	1.00	32.13	C
ATOM	2411	CD1	LEU	A	408	5.445	40.098	17.261	1.00	32.21	C
ATOM	2412	CD2	LEU	A	408	7.671	40.405	18.331	1.00	32.37	C
ATOM	2413	C	LEU	A	408	8.683	36.228	17.541	1.00	31.80	C
ATOM	2414	O	LEU	A	408	9.014	35.936	18.695	1.00	31.72	O
ATOM	2426	N	VAL	A	409	8.453	35.325	16.587	1.00	32.01	N
ATOM	2427	CA	VAL	A	409	8.598	33.881	16.787	1.00	31.99	C
ATOM	2428	CB	VAL	A	409	7.902	33.078	15.644	1.00	32.30	C
ATOM	2429	CG1	VAL	A	409	8.321	31.601	15.646	1.00	32.11	C
ATOM	2430	CG2	VAL	A	409	6.376	33.196	15.742	1.00	32.29	C
ATOM	2431	C	VAL	A	409	10.076	33.500	16.865	1.00	31.90	C
ATOM	2432	O	VAL	A	409	10.470	32.725	17.734	1.00	31.62	O
ATOM	2442	N	LEU	A	410	10.885	34.056	15.962	1.00	32.04	N
ATOM	2443	CA	LEU	A	410	12.315	33.753	15.901	1.00	32.18	C
ATOM	2444	CB	LEU	A	410	12.926	34.321	14.620	1.00	32.17	C
ATOM	2445	CG	LEU	A	410	14.415	34.035	14.370	1.00	32.90	C
ATOM	2446	CD1	LEU	A	410	14.724	32.548	14.413	1.00	32.78	C
ATOM	2447	CD2	LEU	A	410	14.867	34.617	13.036	1.00	32.88	C
ATOM	2448	C	LEU	A	410	13.057	34.289	17.132	1.00	32.17	C
ATOM	2449	O	LEU	A	410	13.786	33.553	17.804	1.00	31.58	O
ATOM	2461	N	PHE	A	411	12.839	35.566	17.428	1.00	32.38	N
ATOM	2462	CA	PHE	A	411	13.461	36.229	18.570	1.00	32.72	C
ATOM	2463	CB	PHE	A	411	13.688	37.711	18.249	1.00	32.66	C
ATOM	2464	CG	PHE	A	411	14.784	37.942	17.251	1.00	32.33	C
ATOM	2465	CD1	PHE	A	411	14.503	38.077	15.901	1.00	31.89	C
ATOM	2466	CE1	PHE	A	411	15.526	38.273	14.981	1.00	31.51	C
ATOM	2467	CZ	PHE	A	411	16.829	38.331	15.409	1.00	32.07	C
ATOM	2468	CE2	PHE	A	411	17.124	38.195	16.754	1.00	32.29	C
ATOM	2469	CD2	PHE	A	411	16.107	37.999	17.667	1.00	32.15	C
ATOM	2470	C	PHE	A	411	12.637	36.053	19.854	1.00	33.12	C
ATOM	2471	O	PHE	A	411	12.125	37.013	20.421	1.00	33.24	O
ATOM	2481	N	SER	A	412	12.544	34.808	20.311	1.00	33.72	N
ATOM	2482	CA	SER	A	412	11.729	34.437	21.458	1.00	34.09	C
ATOM	2483	CB	SER	A	412	11.416	32.952	21.395	1.00	34.02	C
ATOM	2484	OG	SER	A	412	10.653	32.555	22.515	1.00	34.93	O
ATOM	2485	C	SER	A	412	12.418	34.735	22.787	1.00	34.64	C
ATOM	2486	O	SER	A	412	13.653	34.759	22.868	1.00	34.91	O
ATOM	2492	N	LEU	A	413	11.608	34.941	23.827	1.00	34.87	N
ATOM	2493	CA	LEU	A	413	12.110	35.201	25.175	1.00	35.09	C
ATOM	2494	CB	LEU	A	413	11.293	36.312	25.826	1.00	35.20	C
ATOM	2495	CG	LEU	A	413	11.200	37.628	25.053	1.00	35.50	C
ATOM	2496	CD1	LEU	A	413	10.327	38.626	25.815	1.00	35.90	C
ATOM	2497	CD2	LEU	A	413	12.579	38.210	24.801	1.00	35.47	C
ATOM	2498	C	LEU	A	413	12.088	33.969	26.082	1.00	35.43	C
ATOM	2499	O	LEU	A	413	12.534	34.048	27.238	1.00	35.80	O
ATOM	2511	N	ASP	A	414	11.589	32.844	25.562	1.00	35.65	N
ATOM	2512	CA	ASP	A	414	11.506	31.585	26.311	1.00	35.96	C
ATOM	2513	CB	ASP	A	414	10.286	30.763	25.874	1.00	36.27	C
ATOM	2514	CG	ASP	A	414	8.993	31.553	25.905	1.00	37.59	C
ATOM	2515	OD1	ASP	A	414	8.681	32.174	26.959	1.00	37.94	O
ATOM	2516	OD2	ASP	A	414	8.225	31.587	24.910	1.00	38.86	O
ATOM	2517	C	ASP	A	414	12.741	30.707	26.123	1.00	35.95	C
ATOM	2518	O	ASP	A	414	12.710	29.512	26.447	1.00	35.92	O
ATOM	2523	N	VAL	A	415	13.818	31.288	25.599	1.00	35.97	N
ATOM	2524	CA	VAL	A	415	15.025	30.537	25.274	1.00	35.90	C
ATOM	2525	CB	VAL	A	415	15.536	30.881	23.864	1.00	35.88	C
ATOM	2526	CG1	VAL	A	415	16.747	30.013	23.495	1.00	35.65	C
ATOM	2527	CG2	VAL	A	415	14.412	30.721	22.852	1.00	35.53	C
ATOM	2528	C	VAL	A	415	16.112	30.827	26.300	1.00	35.98	C
ATOM	2529	O	VAL	A	415	16.359	31.982	26.643	1.00	35.96	O
ATOM	2539	N	LYS	A	416	16.757	29.759	26.765	1.00	36.07	N
ATOM	2540	CA	LYS	A	416	17.761	29.829	27.819	1.00	36.23	C
ATOM	2541	CB	LYS	A	416	17.573	28.653	28.789	1.00	36.38	C
ATOM	2542	CG	LYS	A	416	16.109	28.376	29.202	1.00	36.74	C
ATOM	2543	CD	LYS	A	416	15.509	29.510	30.059	1.00	37.09	C
ATOM	2544	CE	LYS	A	416	13.967	29.456	30.112	1.00	37.37	C
ATOM	2545	NZ	LYS	A	416	13.299	30.727	29.664	1.00	37.02	N
ATOM	2546	C	LYS	A	416	19.175	29.804	27.236	1.00	36.22	C
ATOM	2547	O	LYS	A	416	19.365	29.562	26.044	1.00	36.79	O
ATOM	2561	N	ASN	A	417	20.160	30.064	28.086	1.00	36.05	N
ATOM	2562	CA	ASN	A	417	21.576	29.989	27.721	1.00	36.01	C
ATOM	2563	CB	ASN	A	417	21.967	28.543	27.373	1.00	36.06	C
ATOM	2564	CG	ASN	A	417	21.402	27.524	28.348	1.00	36.37	C
ATOM	2565	OD1	ASN	A	417	21.470	27.703	29.569	1.00	36.21	O
ATOM	2566	ND2	ASN	A	417	20.849	26.437	27.810	1.00	36.12	N
ATOM	2567	C	ASN	A	417	22.040	30.920	26.584	1.00	35.90	C
ATOM	2568	O	ASN	A	417	23.056	30.640	25.943	1.00	36.16	O
ATOM	2575	N	LEU	A	418	21.327	32.019	26.335	1.00	35.55	N
ATOM	2576	CA	LEU	A	418	21.749	32.971	25.301	1.00	35.25	C
ATOM	2577	CB	LEU	A	418	20.573	33.817	24.807	1.00	35.25	C
ATOM	2578	CG	LEU	A	418	19.549	33.127	23.903	1.00	34.74	C
ATOM	2579	CD1	LEU	A	418	18.248	33.896	23.901	1.00	34.67	C
ATOM	2580	CD2	LEU	A	418	20.070	32.974	22.480	1.00	34.84	C
ATOM	2581	C	LEU	A	418	22.858	33.891	25.811	1.00	35.30	C
ATOM	2582	O	LEU	A	418	22.683	34.595	26.812	1.00	35.56	O
ATOM	2594	N	GLU	A	419	23.995	33.877	25.117	1.00	35.12	N
ATOM	2595	CA	GLU	A	419	25.113	34.786	25.389	1.00	34.93	C
ATOM	2596	CB	GLU	A	419	26.271	34.496	24.417	1.00	35.11	C
ATOM	2597	CG	GLU	A	419	27.618	35.080	24.849	1.00	35.95	C
ATOM	2598	CD	GLU	A	419	28.327	35.893	23.769	1.00	36.93	C
ATOM	2599	OE1	GLU	A	419	27.903	35.855	22.591	1.00	37.21	O
ATOM	2600	OE2	GLU	A	419	29.330	36.571	24.108	1.00	37.40	O
ATOM	2601	C	GLU	A	419	24.723	36.267	25.277	1.00	34.54	C
ATOM	2602	O	GLU	A	419	25.243	37.112	26.010	1.00	34.74	O
ATOM	2609	N	ASN	A	420	23.819	36.568	24.349	1.00	34.13	N
ATOM	2610	CA	ASN	A	420	23.409	37.935	24.054	1.00	33.83	C
ATOM	2611	CB	ASN	A	420	23.932	38.334	22.669	1.00	33.73	C
ATOM	2612	CG	ASN	A	420	23.800	39.818	22.390	1.00	33.79	C
ATOM	2613	OD1	ASN	A	420	23.452	40.599	23.271	1.00	34.93	O
ATOM	2614	ND2	ASN	A	420	24.084	40.215	21.154	1.00	33.36	N
ATOM	2615	C	ASN	A	420	21.883	38.071	24.135	1.00	33.79	C
ATOM	2616	O	ASN	A	420	21.220	38.424	23.159	1.00	33.75	O
ATOM	2623	N	PHE	A	421	21.336	37.796	25.317	1.00	33.81	N
ATOM	2624	CA	PHE	A	421	19.901	37.932	25.567	1.00	33.85	C
ATOM	2625	CB	PHE	A	421	19.539	37.391	26.959	1.00	33.86	C
ATOM	2626	CG	PHE	A	421	18.063	37.121	27.148	1.00	34.21	C
ATOM	2627	CD1	PHE	A	421	17.443	36.091	26.466	1.00	34.19	C
ATOM	2628	CE1	PHE	A	421	16.085	35.835	26.633	1.00	34.60	C
ATOM	2629	CZ	PHE	A	421	15.331	36.614	27.493	1.00	34.30	C
ATOM	2630	CE2	PHE	A	421	15.931	37.650	28.180	1.00	34.46	C
ATOM	2631	CD2	PHE	A	421	17.296	37.899	28.008	1.00	34.89	C
ATOM	2632	C	PHE	A	421	19.416	39.378	25.426	1.00	33.97	C
ATOM	2633	O	PHE	A	421	18.223	39.613	25.266	1.00	33.98	O
ATOM	2643	N	GLN	A	422	20.335	40.338	25.482	1.00	34.18	N
ATOM	2644	CA	GLN	A	422	19.990	41.756	25.366	1.00	34.43	C
ATOM	2645	CB	GLN	A	422	21.178	42.632	25.786	1.00	34.51	C
ATOM	2646	CG	GLN	A	422	20.986	44.111	25.486	1.00	34.92	C
ATOM	2647	CD	GLN	A	422	21.739	44.997	26.435	1.00	35.70	C
ATOM	2648	OE1	GLN	A	422	21.151	45.572	27.353	1.00	36.52	O
ATOM	2649	NE2	GLN	A	422	23.043	45.122	26.219	1.00	36.42	N
ATOM	2650	C	GLN	A	422	19.532	42.147	23.958	1.00	34.40	C
ATOM	2651	O	GLN	A	422	18.623	42.959	23.802	1.00	34.48	O
ATOM	2660	N	LEU	A	423	20.179	41.590	22.941	1.00	34.51	N
ATOM	2661	CA	LEU	A	423	19.839	41.894	21.551	1.00	34.47	C
ATOM	2662	CB	LEU	A	423	20.949	41.424	20.612	1.00	34.52	C
ATOM	2663	CG	LEU	A	423	20.714	41.703	19.127	1.00	34.75	C
ATOM	2664	CD1	LEU	A	423	20.524	43.205	18.886	1.00	35.02	C
ATOM	2665	CD2	LEU	A	423	21.868	41.158	18.309	1.00	34.96	C
ATOM	2666	C	LEU	A	423	18.525	41.239	21.145	1.00	34.38	C
ATOM	2667	O	LEU	A	423	17.789	41.783	20.318	1.00	34.30	O
ATOM	2679	N	VAL	A	424	18.253	40.067	21.721	1.00	34.23	N
ATOM	2680	CA	VAL	A	424	17.020	39.328	21.452	1.00	34.12	C
ATOM	2681	CB	VAL	A	424	17.076	37.888	22.042	1.00	34.10	C
ATOM	2682	CG1	VAL	A	424	15.756	37.140	21.820	1.00	33.96	C
ATOM	2683	CG2	VAL	A	424	18.234	37.109	21.430	1.00	34.07	C
ATOM	2684	C	VAL	A	424	15.828	40.089	22.022	1.00	34.00	C
ATOM	2685	O	VAL	A	424	14.845	40.320	21.322	1.00	34.05	O
ATOM	2695	N	GLU	A	425	15.937	40.485	23.289	1.00	34.07	N
ATOM	2696	CA	GLU	A	425	14.914	41.288	23.974	1.00	33.99	C
ATOM	2697	CB	GLU	A	425	15.299	41.510	25.455	1.00	34.16	C
ATOM	2698	CG	GLU	A	425	15.027	42.898	26.059	1.00	35.44	C
ATOM	2699	CD	GLU	A	425	13.681	43.018	26.762	1.00	36.48	C
ATOM	2700	OE1	GLU	A	425	13.074	41.980	27.081	1.00	38.00	O
ATOM	2701	OE2	GLU	A	425	13.228	44.157	27.007	1.00	37.46	O
ATOM	2702	C	GLU	A	425	14.669	42.610	23.241	1.00	33.64	C
ATOM	2703	O	GLU	A	425	13.541	43.095	23.214	1.00	33.65	O
ATOM	2710	N	GLY	A	426	15.716	43.162	22.627	1.00	33.17	N
ATOM	2711	CA	GLY	A	426	15.635	44.427	21.917	1.00	32.98	C
ATOM	2712	C	GLY	A	426	14.831	44.395	20.633	1.00	32.88	C
ATOM	2713	O	GLY	A	426	14.185	45.384	20.289	1.00	32.79	O
ATOM	2717	N	VAL	A	427	14.878	43.265	19.927	1.00	33.00	N
ATOM	2718	CA	VAL	A	427	14.163	43.087	18.657	1.00	32.84	C
ATOM	2719	CB	VAL	A	427	14.865	42.043	17.761	1.00	32.89	C
ATOM	2720	CG1	VAL	A	427	14.070	41.782	16.473	1.00	32.87	C
ATOM	2721	CG2	VAL	A	427	16.282	42.499	17.436	1.00	32.51	C
ATOM	2722	C	VAL	A	427	12.701	42.695	18.908	1.00	32.81	C
ATOM	2723	O	VAL	A	427	11.814	43.125	18.188	1.00	32.41	O
ATOM	2733	N	GLN	A	428	12.460	41.868	19.920	1.00	32.93	N
ATOM	2734	CA	GLN	A	428	11.119	41.710	20.471	1.00	33.10	C
ATOM	2735	CB	GLN	A	428	11.176	40.994	21.822	1.00	33.28	C
ATOM	2736	CG	GLN	A	428	10.754	39.555	21.801	1.00	34.10	C
ATOM	2737	CD	GLN	A	428	9.282	39.366	21.552	1.00	34.65	C
ATOM	2738	OE1	GLN	A	428	8.460	40.243	22.117	1.00	35.25	O
ATOM	2739	NE2	GLN	A	428	8.891	38.432	20.850	1.00	35.09	N
ATOM	2740	C	GLN	A	428	10.482	43.087	20.681	1.00	33.35	C
ATOM	2741	O	GLN	A	428	9.411	43.364	20.142	1.00	33.42	O
ATOM	2750	N	GLU	A	429	11.162	43.934	21.466	1.00	33.23	N
ATOM	2751	CA	GLU	A	429	10.696	45.283	21.812	1.00	33.25	C
ATOM	2752	CB	GLU	A	429	11.751	46.022	22.677	1.00	33.43	C
ATOM	2753	CG	GLU	A	429	11.819	47.550	22.523	1.00	34.14	C
ATOM	2754	CD	GLU	A	429	13.055	48.191	23.168	1.00	35.07	C
ATOM	2755	OE1	GLU	A	429	14.188	47.703	22.953	1.00	35.79	O
ATOM	2756	OE2	GLU	A	429	12.903	49.210	23.878	1.00	34.73	O
ATOM	2757	C	GLU	A	429	10.372	46.093	20.562	1.00	33.07	C
ATOM	2758	O	GLU	A	429	9.318	46.718	20.479	1.00	33.01	O
ATOM	2765	N	GLN	A	430	11.276	46.070	19.587	1.00	33.00	N
ATOM	2766	CA	GLN	A	430	11.168	46.961	18.435	1.00	33.08	C
ATOM	2767	CB	GLN	A	430	12.547	47.232	17.812	1.00	33.26	C
ATOM	2768	CG	GLN	A	430	12.744	48.696	17.403	1.00	33.83	C
ATOM	2769	CD	GLN	A	430	14.099	48.970	16.759	1.00	34.89	C
ATOM	2770	OE1	GLN	A	430	15.018	48.152	16.845	1.00	35.54	O
ATOM	2771	NE2	GLN	A	430	14.222	50.128	16.116	1.00	35.48	N
ATOM	2772	C	GLN	A	430	10.179	46.465	17.382	1.00	32.75	C
ATOM	2773	O	GLN	A	430	9.515	47.270	16.742	1.00	32.67	O
ATOM	2782	N	VAL	A	431	10.079	45.147	17.219	1.00	32.70	N
ATOM	2783	CA	VAL	A	431	9.166	44.534	16.248	1.00	32.47	C
ATOM	2784	CB	VAL	A	431	9.565	43.053	15.938	1.00	32.50	C
ATOM	2785	CG1	VAL	A	431	8.535	42.364	15.053	1.00	32.38	C
ATOM	2786	CG2	VAL	A	431	10.923	43.000	15.259	1.00	32.68	C
ATOM	2787	C	VAL	A	431	7.720	44.631	16.745	1.00	32.27	C
ATOM	2788	O	VAL	A	431	6.811	44.909	15.967	1.00	31.86	O
ATOM	2798	N	ASN	A	432	7.525	44.406	18.042	1.00	32.24	N
ATOM	2799	CA	ASN	A	432	6.228	44.590	18.696	1.00	32.24	C
ATOM	2800	CB	ASN	A	432	6.338	44.257	20.186	1.00	32.22	C
ATOM	2801	CG	ASN	A	432	5.068	44.576	20.965	1.00	32.31	C
ATOM	2802	OD1	ASN	A	432	4.267	43.697	21.247	1.00	32.62	O
ATOM	2803	ND2	ASN	A	432	4.898	45.837	21.340	1.00	33.78	N
ATOM	2804	C	ASN	A	432	5.731	46.014	18.538	1.00	32.55	C
ATOM	2805	O	ASN	A	432	4.562	46.233	18.248	1.00	33.02	O
ATOM	2812	N	ALA	A	433	6.631	46.974	18.751	1.00	32.58	N
ATOM	2813	CA	ALA	A	433	6.318	48.394	18.658	1.00	32.33	C
ATOM	2814	CB	ALA	A	433	7.425	49.208	19.301	1.00	32.37	C
ATOM	2815	C	ALA	A	433	6.118	48.842	17.212	1.00	32.14	C
ATOM	2816	O	ALA	A	433	5.382	49.789	16.954	1.00	32.32	O
ATOM	2822	N	ALA	A	434	6.785	48.170	16.280	1.00	31.90	N
ATOM	2823	CA	ALA	A	434	6.652	48.460	14.858	1.00	31.78	C
ATOM	2824	CB	ALA	A	434	7.793	47.832	14.087	1.00	31.66	C
ATOM	2825	C	ALA	A	434	5.320	47.945	14.336	1.00	31.96	C
ATOM	2826	O	ALA	A	434	4.703	48.579	13.492	1.00	31.92	O
ATOM	2832	N	LEU	A	435	4.888	46.792	14.848	1.00	32.20	N
ATOM	2833	CA	LEU	A	435	3.601	46.192	14.498	1.00	32.25	C
ATOM	2834	CB	LEU	A	435	3.544	44.731	14.974	1.00	32.26	C
ATOM	2835	CG	LEU	A	435	2.272	43.954	14.618	1.00	32.31	C
ATOM	2836	CD1	LEU	A	435	2.268	43.556	13.156	1.00	32.62	C
ATOM	2837	CD2	LEU	A	435	2.124	42.733	15.491	1.00	33.04	C
ATOM	2838	C	LEU	A	435	2.458	46.977	15.128	1.00	32.23	C
ATOM	2839	O	LEU	A	435	1.407	47.161	14.526	1.00	32.37	O
ATOM	2851	N	LEU	A	436	2.675	47.422	16.357	1.00	32.24	N
ATOM	2852	CA	LEU	A	436	1.726	48.261	17.073	1.00	32.35	C
ATOM	2853	CB	LEU	A	436	2.281	48.547	18.471	1.00	32.26	C
ATOM	2854	CG	LEU	A	436	1.439	49.268	19.516	1.00	31.74	C
ATOM	2855	CD1	LEU	A	436	0.046	48.677	19.633	1.00	31.49	C
ATOM	2856	CD2	LEU	A	436	2.170	49.207	20.850	1.00	30.94	C
ATOM	2857	C	LEU	A	436	1.497	49.560	16.303	1.00	32.58	C
ATOM	2858	O	LEU	A	436	0.406	50.109	16.319	1.00	32.74	O
ATOM	2870	N	ASP	A	437	2.540	50.009	15.611	1.00	32.93	N
ATOM	2871	CA	ASP	A	437	2.545	51.231	14.809	1.00	33.34	C
ATOM	2872	CB	ASP	A	437	4.004	51.615	14.529	1.00	33.56	C
ATOM	2873	CG	ASP	A	437	4.180	53.067	14.187	1.00	34.67	C
ATOM	2874	OD1	ASP	A	437	3.873	53.464	13.039	1.00	36.40	O
ATOM	2875	OD2	ASP	A	437	4.654	53.887	15.000	1.00	36.60	O
ATOM	2876	C	ASP	A	437	1.809	51.053	13.478	1.00	33.26	C
ATOM	2877	O	ASP	A	437	1.043	51.921	13.065	1.00	33.14	O
ATOM	2882	N	TYR	A	438	2.058	49.924	12.816	1.00	33.33	N
ATOM	2883	CA	TYR	A	438	1.507	49.629	11.492	1.00	33.23	C
ATOM	2884	CB	TYR	A	438	2.209	48.402	10.892	1.00	33.23	C
ATOM	2885	CG	TYR	A	438	1.564	47.842	9.638	1.00	33.26	C
ATOM	2886	CD1	TYR	A	438	1.951	48.275	8.367	1.00	32.96	C
ATOM	2887	CE1	TYR	A	438	1.358	47.758	7.219	1.00	32.44	C
ATOM	2888	CZ	TYR	A	438	0.374	46.791	7.339	1.00	33.21	C
ATOM	2889	OH	TYR	A	438	−0.226	46.253	6.224	1.00	33.09	O
ATOM	2890	CE2	TYR	A	438	−0.018	46.346	8.584	1.00	33.50	C
ATOM	2891	CD2	TYR	A	438	0.578	46.867	9.722	1.00	33.58	C
ATOM	2892	C	TYR	A	438	0.001	49.391	11.538	1.00	33.26	C
ATOM	2893	O	TYR	A	438	−0.710	49.742	10.603	1.00	33.45	O
ATOM	2903	N	THR	A	439	−0.478	48.787	12.623	1.00	33.17	N
ATOM	2904	CA	THR	A	439	−1.904	48.505	12.784	1.00	32.96	C
ATOM	2905	CB	THR	A	439	−2.149	47.460	13.891	1.00	32.82	C
ATOM	2906	OG1	THR	A	439	−1.494	47.864	15.099	1.00	32.55	O
ATOM	2907	CG2	THR	A	439	−1.515	46.123	13.543	1.00	32.81	C
ATOM	2908	C	THR	A	439	−2.645	49.779	13.135	1.00	32.93	C
ATOM	2909	O	THR	A	439	−3.839	49.899	12.876	1.00	32.78	O
ATOM	2917	N	MET	A	440	−1.930	50.721	13.740	1.00	33.04	N
ATOM	2918	CA	MET	A	440	−2.502	52.005	14.128	1.00	33.23	C
ATOM	2919	CB	MET	A	440	−1.609	52.650	15.192	1.00	33.26	C
ATOM	2920	CG	MET	A	440	−2.239	53.812	15.933	1.00	33.85	C
ATOM	2921	SD	MET	A	440	−1.093	55.177	16.191	1.00	33.56	S
ATOM	2922	CE	MET	A	440	−1.901	56.509	15.268	1.00	35.26	C
ATOM	2923	C	MET	A	440	−2.696	52.949	12.921	1.00	33.22	C
ATOM	2924	O	MET	A	440	−3.690	53.671	12.851	1.00	33.10	O
ATOM	2934	N	CYS	A	441	−1.760	52.923	11.971	1.00	33.36	N
ATOM	2935	CA	CYS	A	441	−1.806	53.808	10.803	1.00	33.61	C
ATOM	2936	CB	CYS	A	441	−0.400	54.047	10.249	1.00	33.56	C
ATOM	2937	SG	CYS	A	441	0.735	54.841	11.403	1.00	33.54	S
ATOM	2938	C	CYS	A	441	−2.676	53.252	9.682	1.00	33.85	C
ATOM	2939	O	CYS	A	441	−3.497	53.968	9.113	1.00	34.02	O
ATOM	2945	N	ASN	A	442	−2.473	51.980	9.354	1.00	34.11	N
ATOM	2946	CA	ASN	A	442	−3.158	51.354	8.224	1.00	34.35	C
ATOM	2947	CB	ASN	A	442	−2.328	50.186	7.676	1.00	34.38	C
ATOM	2948	CG	ASN	A	442	−1.145	50.655	6.842	1.00	34.63	C
ATOM	2949	OD1	ASN	A	442	−1.280	50.902	5.640	1.00	34.76	O
ATOM	2950	ND2	ASN	A	442	0.016	50.793	7.478	1.00	34.05	N
ATOM	2951	C	ASN	A	442	−4.583	50.894	8.550	1.00	34.46	C
ATOM	2952	O	ASN	A	442	−5.473	50.998	7.708	1.00	34.54	O
ATOM	2959	N	TYR	A	443	−4.796	50.393	9.766	1.00	34.54	N
ATOM	2960	CA	TYR	A	443	−6.117	49.942	10.203	1.00	34.56	C
ATOM	2961	CB	TYR	A	443	−6.081	48.437	10.507	1.00	34.69	C
ATOM	2962	CG	TYR	A	443	−5.607	47.585	9.348	1.00	35.03	C
ATOM	2963	CD1	TYR	A	443	−4.317	47.062	9.322	1.00	35.26	C
ATOM	2964	CE1	TYR	A	443	−3.879	46.284	8.257	1.00	35.43	C
ATOM	2965	CZ	TYR	A	443	−4.734	46.023	7.200	1.00	35.55	C
ATOM	2966	OH	TYR	A	443	−4.310	45.248	6.145	1.00	36.22	O
ATOM	2967	CE2	TYR	A	443	−6.017	46.529	7.203	1.00	35.32	C
ATOM	2968	CD2	TYR	A	443	−6.447	47.306	8.273	1.00	35.53	C
ATOM	2969	C	TYR	A	443	−6.589	50.729	11.436	1.00	34.48	C
ATOM	2970	O	TYR	A	443	−6.751	50.153	12.512	1.00	34.47	O
ATOM	2980	N	PRO	A	444	−6.830	52.034	11.281	1.00	34.47	N
ATOM	2981	CA	PRO	A	444	−7.146	52.901	12.428	1.00	34.45	C
ATOM	2982	CB	PRO	A	444	−7.277	54.300	11.801	1.00	34.39	C
ATOM	2983	CG	PRO	A	444	−7.520	54.072	10.358	1.00	34.34	C
ATOM	2984	CD	PRO	A	444	−6.842	52.784	10.011	1.00	34.40	C
ATOM	2985	C	PRO	A	444	−8.431	52.517	13.159	1.00	34.48	C
ATOM	2986	O	PRO	A	444	−8.387	52.316	14.369	1.00	34.64	O
ATOM	2994	N	GLN	A	445	−9.540	52.393	12.434	1.00	34.49	N
ATOM	2995	CA	GLN	A	445	−10.833	52.062	13.046	1.00	34.45	C
ATOM	2996	CB	GLN	A	445	−12.003	52.569	12.182	1.00	34.59	C
ATOM	2997	CG	GLN	A	445	−12.002	52.095	10.724	1.00	34.96	C
ATOM	2998	CD	GLN	A	445	−11.600	53.191	9.740	1.00	35.52	C
ATOM	2999	OE1	GLN	A	445	−12.241	54.244	9.675	1.00	35.47	O
ATOM	3000	NE2	GLN	A	445	−10.540	52.943	8.973	1.00	36.05	N
ATOM	3001	C	GLN	A	445	−10.993	50.566	13.358	1.00	34.33	C
ATOM	3002	O	GLN	A	445	−12.031	50.146	13.867	1.00	34.22	O
ATOM	3011	N	GLN	A	446	−9.972	49.767	13.053	1.00	34.25	N
ATOM	3012	CA	GLN	A	446	−9.913	48.378	13.503	1.00	34.22	C
ATOM	3013	CB	GLN	A	446	−9.561	47.441	12.342	1.00	34.33	C
ATOM	3014	CG	GLN	A	446	−10.776	46.944	11.544	1.00	34.64	C
ATOM	3015	CD	GLN	A	446	−10.784	47.387	10.084	1.00	35.25	C
ATOM	3016	OE1	GLN	A	446	−9.604	47.648	9.520	1.00	35.55	O
ATOM	3017	NE2	GLN	A	446	−11.852	47.479	9.473	1.00	35.16	N
ATOM	3018	C	GLN	A	446	−8.893	48.270	14.640	1.00	34.05	C
ATOM	3019	O	GLN	A	446	−7.739	47.877	14.436	1.00	34.11	O
ATOM	3028	N	THR	A	447	−9.349	48.628	15.838	1.00	33.83	N
ATOM	3029	CA	THR	A	447	−8.504	48.697	17.029	1.00	33.62	C
ATOM	3030	CB	THR	A	447	−9.275	49.356	18.199	1.00	33.60	C
ATOM	3031	OG1	THR	A	447	−9.974	50.519	17.745	1.00	33.72	O
ATOM	3032	CG2	THR	A	447	−8.320	49.893	19.245	1.00	33.65	C
ATOM	3033	C	THR	A	447	−8.043	47.318	17.469	1.00	33.38	C
ATOM	3034	O	THR	A	447	−6.967	47.167	18.037	1.00	33.24	O
ATOM	3042	N	GLU	A	448	−8.874	46.316	17.205	1.00	33.33	N
ATOM	3043	CA	GLU	A	448	−8.607	44.953	17.643	1.00	33.33	C
ATOM	3044	CB	GLU	A	448	−9.902	44.117	17.598	1.00	33.57	C
ATOM	3045	CG	GLU	A	448	−10.396	43.706	16.208	1.00	34.53	C
ATOM	3046	CD	GLU	A	448	−11.412	44.661	15.602	1.00	35.80	C
ATOM	3047	OE1	GLU	A	448	−12.340	45.099	16.315	1.00	37.27	O
ATOM	3048	OE2	GLU	A	448	−11.284	44.972	14.396	1.00	36.76	O
ATOM	3049	C	GLU	A	448	−7.481	44.251	16.877	1.00	32.92	C
ATOM	3050	O	GLU	A	448	−6.917	43.304	17.390	1.00	32.96	O
ATOM	3057	N	LYS	A	449	−7.151	44.727	15.675	1.00	32.74	N
ATOM	3058	CA	LYS	A	449	−6.231	44.028	14.758	1.00	32.48	C
ATOM	3059	CB	LYS	A	449	−5.880	44.903	13.552	1.00	32.68	C
ATOM	3060	CG	LYS	A	449	−6.904	44.858	12.433	1.00	33.22	C
ATOM	3061	CD	LYS	A	449	−6.519	43.873	11.331	1.00	33.05	C
ATOM	3062	CE	LYS	A	449	−7.736	43.501	10.482	1.00	33.45	C
ATOM	3063	NZ	LYS	A	449	−7.588	43.893	9.055	1.00	34.02	N
ATOM	3064	C	LYS	A	449	−4.934	43.574	15.391	1.00	32.06	C
ATOM	3065	O	LYS	A	449	−4.565	42.413	15.269	1.00	31.93	O
ATOM	3079	N	PHE	A	450	−4.236	44.502	16.034	1.00	31.57	N
ATOM	3080	CA	PHE	A	450	−2.958	44.213	16.679	1.00	31.15	C
ATOM	3081	CB	PHE	A	450	−2.484	45.446	17.457	1.00	30.72	C
ATOM	3082	CG	PHE	A	450	−1.300	45.200	18.338	1.00	29.50	C
ATOM	3083	CD1	PHE	A	450	−0.022	45.170	17.808	1.00	28.67	C
ATOM	3084	CE1	PHE	A	450	1.081	44.946	18.624	1.00	28.48	C
ATOM	3085	CZ	PHE	A	450	0.907	44.756	19.985	1.00	28.29	C
ATOM	3086	CE2	PHE	A	450	−0.367	44.780	20.527	1.00	28.63	C
ATOM	3087	CD2	PHE	A	450	−1.463	45.003	19.705	1.00	28.93	C
ATOM	3088	C	PHE	A	450	−3.059	42.994	17.605	1.00	31.37	C
ATOM	3089	O	PHE	A	450	−2.212	42.106	17.564	1.00	31.23	O
ATOM	3099	N	GLY	A	451	−4.097	42.971	18.435	1.00	31.62	N
ATOM	3100	CA	GLY	A	451	−4.291	41.923	19.420	1.00	31.69	C
ATOM	3101	C	GLY	A	451	−4.716	40.602	18.826	1.00	31.98	C
ATOM	3102	O	GLY	A	451	−4.415	39.550	19.382	1.00	31.94	O
ATOM	3106	N	GLN	A	452	−5.422	40.648	17.701	1.00	32.21	N
ATOM	3107	CA	GLN	A	452	−5.818	39.431	17.000	1.00	32.35	C
ATOM	3108	CB	GLN	A	452	−6.875	39.735	15.937	1.00	32.52	C
ATOM	3109	CG	GLN	A	452	−8.138	40.366	16.506	1.00	33.79	C
ATOM	3110	CD	GLN	A	452	−9.334	40.285	15.570	1.00	35.43	C
ATOM	3111	OE1	GLN	A	452	−10.201	39.422	15.738	1.00	38.13	O
ATOM	3112	NE2	GLN	A	452	−9.397	41.195	14.600	1.00	35.46	N
ATOM	3113	C	GLN	A	452	−4.607	38.737	16.378	1.00	32.26	C
ATOM	3114	O	GLN	A	452	−4.578	37.510	16.284	1.00	32.33	O
ATOM	3123	N	LEU	A	453	−3.608	39.524	15.972	1.00	32.13	N
ATOM	3124	CA	LEU	A	453	−2.343	38.999	15.462	1.00	31.92	C
ATOM	3125	CB	LEU	A	453	−1.537	40.089	14.760	1.00	31.93	C
ATOM	3126	CG	LEU	A	453	−2.164	40.745	13.533	1.00	32.30	C
ATOM	3127	CD1	LEU	A	453	−1.474	42.079	13.226	1.00	32.28	C
ATOM	3128	CD2	LEU	A	453	−2.098	39.818	12.343	1.00	32.77	C
ATOM	3129	C	LEU	A	453	−1.490	38.388	16.573	1.00	31.82	C
ATOM	3130	O	LEU	A	453	−0.947	37.308	16.394	1.00	31.92	O
ATOM	3142	N	LEU	A	454	−1.362	39.066	17.712	1.00	31.54	N
ATOM	3143	CA	LEU	A	454	−0.569	38.523	18.818	1.00	31.63	C
ATOM	3144	CB	LEU	A	454	−0.344	39.571	19.910	1.00	31.56	C
ATOM	3145	CG	LEU	A	454	0.513	40.814	19.623	1.00	32.05	C
ATOM	3146	CD1	LEU	A	454	0.722	41.576	20.917	1.00	32.01	C
ATOM	3147	CD2	LEU	A	454	1.845	40.498	18.974	1.00	31.97	C
ATOM	3148	C	LEU	A	454	−1.180	37.251	19.451	1.00	31.66	C
ATOM	3149	O	LEU	A	454	−0.452	36.372	19.909	1.00	31.41	O
ATOM	3161	N	LEU	A	455	−2.504	37.150	19.481	1.00	31.67	N
ATOM	3162	CA	LEU	A	455	−3.161	35.984	20.086	1.00	32.10	C
ATOM	3163	CB	LEU	A	455	−4.616	36.296	20.454	1.00	32.04	C
ATOM	3164	CG	LEU	A	455	−4.697	37.248	21.650	1.00	33.04	C
ATOM	3165	CD1	LEU	A	455	−6.059	37.910	21.728	1.00	33.89	C
ATOM	3166	CD2	LEU	A	455	−4.368	36.542	22.965	1.00	33.05	C
ATOM	3167	C	LEU	A	455	−3.083	34.746	19.186	1.00	31.85	C
ATOM	3168	O	LEU	A	455	−3.350	33.631	19.627	1.00	31.09	O
ATOM	3180	N	ARG	A	456	−2.690	34.966	17.934	1.00	32.10	N
ATOM	3181	CA	ARG	A	456	−2.455	33.891	16.989	1.00	32.26	C
ATOM	3182	CB	ARG	A	456	−2.549	34.416	15.550	1.00	32.15	C
ATOM	3183	CG	ARG	A	456	−3.704	33.816	14.769	1.00	33.20	C
ATOM	3184	CD	ARG	A	456	−5.022	34.579	14.856	1.00	34.71	C
ATOM	3185	NE	ARG	A	456	−5.486	34.793	16.233	1.00	35.67	N
ATOM	3186	CZ	ARG	A	456	−6.333	34.019	16.888	1.00	35.84	C
ATOM	3187	NH1	ARG	A	456	−6.840	32.938	16.326	1.00	38.46	N
ATOM	3188	NH2	ARG	A	456	−6.673	34.316	18.130	1.00	36.28	N
ATOM	3189	C	ARG	A	456	−1.117	33.187	17.232	1.00	32.30	C
ATOM	3190	O	ARG	A	456	−0.893	32.110	16.693	1.00	32.44	O
ATOM	3204	N	LEU	A	457	−0.250	33.780	18.052	1.00	32.32	N
ATOM	3205	CA	LEU	A	457	1.077	33.218	18.329	1.00	32.42	C
ATOM	3206	CB	LEU	A	457	2.030	34.283	18.903	1.00	32.46	C
ATOM	3207	CG	LEU	A	457	2.618	35.236	17.866	1.00	32.71	C
ATOM	3208	CD1	LEU	A	457	3.480	36.278	18.548	1.00	32.67	C
ATOM	3209	CD2	LEU	A	457	3.400	34.468	16.802	1.00	33.11	C
ATOM	3210	C	LEU	A	457	1.081	31.978	19.222	1.00	32.32	C
ATOM	3211	O	LEU	A	457	1.753	31.009	18.887	1.00	31.91	O
ATOM	3223	N	PRO	A	458	0.389	32.008	20.363	1.00	32.34	N
ATOM	3224	CA	PRO	A	458	0.168	30.789	21.162	1.00	32.26	C
ATOM	3225	CB	PRO	A	458	−0.832	31.244	22.230	1.00	32.08	C
ATOM	3226	CG	PRO	A	458	−0.601	32.694	22.379	1.00	32.19	C
ATOM	3227	CD	PRO	A	458	−0.184	33.194	21.023	1.00	32.34	C
ATOM	3228	C	PRO	A	458	−0.412	29.612	20.372	1.00	32.23	C
ATOM	3229	O	PRO	A	458	−0.053	28.468	20.620	1.00	32.17	O
ATOM	3237	N	GLU	A	459	−1.308	29.893	19.439	1.00	32.43	N
ATOM	3238	CA	GLU	A	459	−1.924	28.849	18.629	1.00	32.65	C
ATOM	3239	CB	GLU	A	459	−3.102	29.428	17.851	1.00	32.67	C
ATOM	3240	CG	GLU	A	459	−4.224	29.937	18.751	1.00	32.73	C
ATOM	3241	CD	GLU	A	459	−5.343	30.605	17.981	1.00	32.06	C
ATOM	3242	OE1	GLU	A	459	−5.110	31.021	16.827	1.00	30.91	O
ATOM	3243	OE2	GLU	A	459	−6.457	30.706	18.531	1.00	32.50	O
ATOM	3244	C	GLU	A	459	−0.931	28.205	17.661	1.00	32.91	C
ATOM	3245	O	GLU	A	459	−0.988	27.000	17.422	1.00	33.42	O
ATOM	3252	N	ILE	A	460	−0.042	29.020	17.100	1.00	32.86	N
ATOM	3253	CA	ILE	A	460	0.988	28.569	16.174	1.00	32.91	C
ATOM	3254	CB	ILE	A	460	1.668	29.794	15.513	1.00	32.94	C
ATOM	3255	CG1	ILE	A	460	0.821	30.292	14.337	1.00	33.27	C
ATOM	3256	CD1	ILE	A	460	1.113	31.729	13.930	1.00	33.07	C
ATOM	3257	CG2	ILE	A	460	3.082	29.469	15.057	1.00	33.01	C
ATOM	3258	C	ILE	A	460	2.018	27.715	16.903	1.00	32.83	C
ATOM	3259	O	ILE	A	460	2.510	26.723	16.372	1.00	33.26	O
ATOM	3271	N	ARG	A	461	2.356	28.128	18.112	1.00	32.74	N
ATOM	3272	CA	ARG	A	461	3.226	27.366	18.977	1.00	32.81	C
ATOM	3273	CB	ARG	A	461	3.445	28.129	20.291	1.00	32.80	C
ATOM	3274	CG	ARG	A	461	4.155	27.355	21.403	1.00	33.87	C
ATOM	3275	CD	ARG	A	461	5.379	26.565	20.956	1.00	35.56	C
ATOM	3276	NE	ARG	A	461	6.614	27.122	21.503	1.00	37.83	N
ATOM	3277	CZ	ARG	A	461	7.793	27.169	20.873	1.00	39.34	C
ATOM	3278	NH1	ARG	A	461	7.951	26.686	19.646	1.00	39.93	N
ATOM	3279	NH2	ARG	A	461	8.833	27.710	21.484	1.00	40.57	N
ATOM	3280	C	ARG	A	461	2.626	25.974	19.232	1.00	32.85	C
ATOM	3281	O	ARG	A	461	3.331	24.976	19.155	1.00	32.83	O
ATOM	3295	N	ALA	A	462	1.321	25.925	19.492	1.00	32.83	N
ATOM	3296	CA	ALA	A	462	0.625	24.696	19.858	1.00	32.78	C
ATOM	3297	CB	ALA	A	462	−0.743	25.017	20.433	1.00	32.94	C
ATOM	3298	C	ALA	A	462	0.475	23.746	18.684	1.00	32.82	C
ATOM	3299	O	ALA	A	462	0.680	22.550	18.838	1.00	32.87	O
ATOM	3305	N	ILE	A	463	0.115	24.271	17.515	1.00	32.96	N
ATOM	3306	CA	ILE	A	463	0.020	23.453	16.311	1.00	33.05	C
ATOM	3307	CB	ILE	A	463	−0.512	24.264	15.118	1.00	33.15	C
ATOM	3308	CG1	ILE	A	463	−1.999	24.554	15.295	1.00	33.66	C
ATOM	3309	CD1	ILE	A	463	−2.543	25.616	14.336	1.00	33.68	C
ATOM	3310	CG2	ILE	A	463	−0.330	23.490	13.804	1.00	33.93	C
ATOM	3311	C	ILE	A	463	1.373	22.840	15.975	1.00	32.96	C
ATOM	3312	O	ILE	A	463	1.438	21.719	15.489	1.00	33.12	O
ATOM	3324	N	SER	A	464	2.446	23.566	16.263	1.00	33.28	N
ATOM	3325	CA	SER	A	464	3.793	23.143	15.893	1.00	33.50	C
ATOM	3326	CB	SER	A	464	4.694	24.372	15.746	1.00	33.48	C
ATOM	3327	OG	SER	A	464	5.001	24.918	17.010	1.00	33.94	O
ATOM	3328	C	SER	A	464	4.402	22.115	16.872	1.00	33.46	C
ATOM	3329	O	SER	A	464	5.169	21.261	16.462	1.00	33.02	O
ATOM	3335	N	MET	A	465	4.057	22.206	18.153	1.00	33.72	N
ATOM	3336	CA	MET	A	465	4.394	21.162	19.116	1.00	34.13	C
ATOM	3337	CB	MET	A	465	4.023	21.571	20.550	1.00	34.45	C
ATOM	3338	CG	MET	A	465	4.741	22.785	21.111	1.00	36.68	C
ATOM	3339	SD	MET	A	465	6.544	22.667	21.073	1.00	42.74	S
ATOM	3340	CE	MET	A	465	6.965	23.672	19.498	1.00	40.02	C
ATOM	3341	C	MET	A	465	3.634	19.877	18.780	1.00	33.70	C
ATOM	3342	O	MET	A	465	4.157	18.782	18.944	1.00	33.50	O
ATOM	3352	N	GLN	A	466	2.386	20.022	18.349	1.00	33.59	N
ATOM	3353	CA	GLN	A	466	1.560	18.882	17.964	1.00	33.51	C
ATOM	3354	CB	GLN	A	466	0.119	19.313	17.662	1.00	33.76	C
ATOM	3355	CG	GLN	A	466	−0.759	19.653	18.877	1.00	35.20	C
ATOM	3356	CD	GLN	A	466	−1.920	20.597	18.503	1.00	37.64	C
ATOM	3357	OE1	GLN	A	466	−2.524	20.475	17.422	1.00	37.77	O
ATOM	3358	NE2	GLN	A	466	−2.207	21.554	19.382	1.00	38.60	N
ATOM	3359	C	GLN	A	466	2.157	18.233	16.723	1.00	32.95	C
ATOM	3360	O	GLN	A	466	2.167	17.013	16.603	1.00	32.75	O
ATOM	3369	N	ALA	A	467	2.661	19.061	15.811	1.00	32.40	N
ATOM	3370	CA	ALA	A	467	3.199	18.584	14.541	1.00	32.15	C
ATOM	3371	CB	ALA	A	467	3.478	19.750	13.600	1.00	31.94	C
ATOM	3372	C	ALA	A	467	4.463	17.778	14.767	1.00	31.81	C
ATOM	3373	O	ALA	A	467	4.676	16.773	14.114	1.00	31.78	O
ATOM	3379	N	GLU	A	468	5.292	18.229	15.699	1.00	31.62	N
ATOM	3380	CA	GLU	A	468	6.526	17.537	16.042	1.00	31.80	C
ATOM	3381	CB	GLU	A	468	7.358	18.367	17.019	1.00	31.89	C
ATOM	3382	CG	GLU	A	468	8.091	19.540	16.394	1.00	32.60	C
ATOM	3383	CD	GLU	A	468	8.844	20.351	17.431	1.00	33.14	C
ATOM	3384	OE1	GLU	A	468	9.472	19.757	18.320	1.00	34.44	O
ATOM	3385	OE2	GLU	A	468	8.804	21.587	17.373	1.00	35.34	O
ATOM	3386	C	GLU	A	468	6.225	16.184	16.677	1.00	31.60	C
ATOM	3387	O	GLU	A	468	6.913	15.205	16.419	1.00	31.23	O
ATOM	3394	N	GLU	A	469	5.194	16.141	17.512	1.00	31.50	N
ATOM	3395	CA	GLU	A	469	4.795	14.906	18.169	1.00	31.51	C
ATOM	3396	CB	GLU	A	469	3.778	15.201	19.268	1.00	31.63	C
ATOM	3397	CG	GLU	A	469	4.443	15.808	20.487	1.00	32.62	C
ATOM	3398	CD	GLU	A	469	3.472	16.246	21.554	1.00	33.97	C
ATOM	3399	OE1	GLU	A	469	3.706	17.323	22.142	1.00	36.05	O
ATOM	3400	OE2	GLU	A	469	2.492	15.519	21.820	1.00	34.65	O
ATOM	3401	C	GLU	A	469	4.257	13.904	17.160	1.00	31.11	C
ATOM	3402	O	GLU	A	469	4.445	12.710	17.305	1.00	30.84	O
ATOM	3409	N	TYR	A	470	3.615	14.421	16.124	1.00	31.18	N
ATOM	3410	CA	TYR	A	470	3.097	13.624	15.029	1.00	31.08	C
ATOM	3411	CB	TYR	A	470	2.157	14.479	14.181	1.00	31.08	C
ATOM	3412	CG	TYR	A	470	1.884	13.895	12.826	1.00	30.75	C
ATOM	3413	CD1	TYR	A	470	1.017	12.824	12.687	1.00	29.97	C
ATOM	3414	CE1	TYR	A	470	0.768	12.279	11.469	1.00	29.24	C
ATOM	3415	CZ	TYR	A	470	1.387	12.782	10.344	1.00	29.32	C
ATOM	3416	OH	TYR	A	470	1.134	12.224	9.114	1.00	29.08	O
ATOM	3417	CE2	TYR	A	470	2.258	13.844	10.449	1.00	29.65	C
ATOM	3418	CD2	TYR	A	470	2.507	14.392	11.689	1.00	29.63	C
ATOM	3419	C	TYR	A	470	4.233	13.114	14.154	1.00	31.20	C
ATOM	3420	O	TYR	A	470	4.231	11.968	13.711	1.00	30.95	O
ATOM	3430	N	LEU	A	471	5.202	13.986	13.906	1.00	31.47	N
ATOM	3431	CA	LEU	A	471	6.342	13.670	13.055	1.00	31.45	C
ATOM	3432	CB	LEU	A	471	7.090	14.957	12.711	1.00	31.58	C
ATOM	3433	CG	LEU	A	471	7.955	15.021	11.454	1.00	32.71	C
ATOM	3434	CD1	LEU	A	471	9.358	14.507	11.707	1.00	33.50	C
ATOM	3435	CD2	LEU	A	471	7.309	14.285	10.291	1.00	34.11	C
ATOM	3436	C	LEU	A	471	7.273	12.674	13.752	1.00	31.18	C
ATOM	3437	O	LEU	A	471	7.907	11.856	13.092	1.00	30.93	O
ATOM	3449	N	TYR	A	472	7.326	12.737	15.083	1.00	30.88	N
ATOM	3450	CA	TYR	A	472	8.145	11.832	15.874	1.00	31.03	C
ATOM	3451	CB	TYR	A	472	8.389	12.368	17.298	1.00	31.05	C
ATOM	3452	CG	TYR	A	472	9.789	12.108	17.836	1.00	31.96	C
ATOM	3453	CD1	TYR	A	472	10.508	13.112	18.492	1.00	33.47	C
ATOM	3454	CE1	TYR	A	472	11.798	12.881	18.988	1.00	33.42	C
ATOM	3455	CZ	TYR	A	472	12.371	11.633	18.829	1.00	34.10	C
ATOM	3456	OH	TYR	A	472	13.632	11.382	19.304	1.00	35.26	O
ATOM	3457	CE2	TYR	A	472	11.678	10.620	18.190	1.00	34.12	C
ATOM	3458	CD2	TYR	A	472	10.395	10.862	17.698	1.00	33.44	C
ATOM	3459	C	TYR	A	472	7.461	10.472	15.928	1.00	30.86	C
ATOM	3460	O	TYR	A	472	8.121	9.443	15.900	1.00	30.53	O
ATOM	3470	N	TYR	A	473	6.136	10.473	16.000	1.00	30.75	N
ATOM	3471	CA	TYR	A	473	5.383	9.231	15.974	1.00	30.86	C
ATOM	3472	CB	TYR	A	473	3.889	9.494	16.167	1.00	30.83	C
ATOM	3473	CG	TYR	A	473	3.003	8.394	15.644	1.00	31.46	C
ATOM	3474	CD1	TYR	A	473	2.811	7.223	16.372	1.00	32.50	C
ATOM	3475	CE1	TYR	A	473	2.002	6.210	15.898	1.00	32.76	C
ATOM	3476	CZ	TYR	A	473	1.378	6.361	14.679	1.00	33.12	C
ATOM	3477	OH	TYR	A	473	0.570	5.366	14.196	1.00	34.13	O
ATOM	3478	CE2	TYR	A	473	1.559	7.509	13.935	1.00	32.85	C
ATOM	3479	CD2	TYR	A	473	2.362	8.516	14.419	1.00	32.05	C
ATOM	3480	C	TYR	A	473	5.649	8.502	14.655	1.00	30.79	C
ATOM	3481	O	TYR	A	473	5.908	7.300	14.651	1.00	30.88	O
ATOM	3491	N	LYS	A	474	5.604	9.244	13.551	1.00	30.68	N
ATOM	3492	CA	LYS	A	474	5.852	8.698	12.220	1.00	30.76	C
ATOM	3493	CB	LYS	A	474	5.534	9.744	11.141	1.00	30.92	C
ATOM	3494	CG	LYS	A	474	4.065	10.169	11.054	1.00	30.85	C
ATOM	3495	CD	LYS	A	474	3.152	9.061	10.545	1.00	30.99	C
ATOM	3496	CE	LYS	A	474	3.267	8.863	9.051	1.00	31.09	C
ATOM	3497	NZ	LYS	A	474	2.282	7.859	8.564	1.00	31.60	N
ATOM	3498	C	LYS	A	474	7.292	8.220	12.048	1.00	30.71	C
ATOM	3499	O	LYS	A	474	7.532	7.242	11.358	1.00	30.68	O
ATOM	3513	N	HIS	A	475	8.234	8.910	12.684	1.00	30.75	N
ATOM	3514	CA	HIS	A	475	9.653	8.551	12.651	1.00	30.75	C
ATOM	3515	CB	HIS	A	475	10.483	9.662	13.302	1.00	30.93	C
ATOM	3516	CG	HIS	A	475	11.896	9.271	13.612	1.00	31.06	C
ATOM	3517	ND1	HIS	A	475	12.802	8.915	12.637	1.00	31.64	N
ATOM	3518	CE1	HIS	A	475	13.960	8.621	13.199	1.00	32.02	C
ATOM	3519	NE2	HIS	A	475	13.839	8.777	14.505	1.00	32.23	N
ATOM	3520	CD2	HIS	A	475	12.558	9.183	14.789	1.00	31.44	C
ATOM	3521	C	HIS	A	475	9.935	7.231	13.365	1.00	30.67	C
ATOM	3522	O	HIS	A	475	10.763	6.439	12.914	1.00	30.53	O
ATOM	3531	N	LEU	A	476	9.247	7.013	14.482	1.00	30.76	N
ATOM	3532	CA	LEU	A	476	9.403	5.803	15.282	1.00	30.93	C
ATOM	3533	CB	LEU	A	476	8.888	6.022	16.703	1.00	30.82	C
ATOM	3534	CG	LEU	A	476	9.666	7.002	17.572	1.00	30.92	C
ATOM	3535	CD1	LEU	A	476	8.931	7.201	18.879	1.00	31.19	C
ATOM	3536	CD2	LEU	A	476	11.090	6.534	17.811	1.00	31.06	C
ATOM	3537	C	LEU	A	476	8.671	4.625	14.652	1.00	31.01	C
ATOM	3538	O	LEU	A	476	8.976	3.477	14.958	1.00	31.05	O
ATOM	3550	N	ASN	A	477	7.711	4.920	13.779	1.00	31.20	N
ATOM	3551	CA	ASN	A	477	6.995	3.906	13.017	1.00	31.50	C
ATOM	3552	CB	ASN	A	477	5.598	4.426	12.650	1.00	31.53	C
ATOM	3553	CG	ASN	A	477	4.593	3.313	12.406	1.00	31.48	C
ATOM	3554	OD1	ASN	A	477	4.651	2.256	13.028	1.00	31.19	O
ATOM	3555	ND2	ASN	A	477	3.651	3.557	11.502	1.00	31.87	N
ATOM	3556	C	ASN	A	477	7.769	3.521	11.756	1.00	31.75	C
ATOM	3557	O	ASN	A	477	7.375	2.608	11.042	1.00	31.73	O
ATOM	3564	N	GLY	A	478	8.862	4.235	11.483	1.00	32.20	N
ATOM	3565	CA	GLY	A	478	9.733	3.951	10.355	1.00	32.35	C
ATOM	3566	C	GLY	A	478	9.227	4.518	9.044	1.00	32.65	C
ATOM	3567	O	GLY	A	478	9.452	3.930	8.001	1.00	32.76	O
ATOM	3571	N	ASP	A	479	8.560	5.667	9.094	1.00	33.17	N
ATOM	3572	CA	ASP	A	479	7.935	6.270	7.911	1.00	33.61	C
ATOM	3573	CB	ASP	A	479	6.507	6.721	8.233	1.00	33.59	C
ATOM	3574	CG	ASP	A	479	5.576	5.564	8.523	1.00	33.30	C
ATOM	3575	OD1	ASP	A	479	5.809	4.455	7.996	1.00	32.61	O
ATOM	3576	OD2	ASP	A	479	4.576	5.678	9.266	1.00	33.16	O
ATOM	3577	C	ASP	A	479	8.706	7.471	7.368	1.00	34.18	C
ATOM	3578	O	ASP	A	479	8.478	7.893	6.235	1.00	34.12	O
ATOM	3583	N	VAL	A	480	9.601	8.026	8.180	1.00	34.85	N
ATOM	3584	CA	VAL	A	480	10.355	9.207	7.796	1.00	35.37	C
ATOM	3585	CB	VAL	A	480	10.548	10.174	8.985	1.00	35.28	C
ATOM	3586	CG1	VAL	A	480	11.118	11.490	8.506	1.00	35.36	C
ATOM	3587	CG2	VAL	A	480	9.227	10.413	9.721	1.00	35.36	C
ATOM	3588	C	VAL	A	480	11.710	8.737	7.268	1.00	36.07	C
ATOM	3589	O	VAL	A	480	12.563	8.325	8.059	1.00	36.27	O
ATOM	3599	N	PRO	A	481	11.915	8.802	5.945	1.00	36.81	N
ATOM	3600	CA	PRO	A	481	13.119	8.237	5.312	1.00	37.07	C
ATOM	3601	CB	PRO	A	481	12.940	8.591	3.827	1.00	37.06	C
ATOM	3602	CG	PRO	A	481	11.966	9.713	3.807	1.00	37.02	C
ATOM	3603	CD	PRO	A	481	11.040	9.454	4.949	1.00	36.94	C
ATOM	3604	C	PRO	A	481	14.424	8.816	5.868	1.00	37.40	C
ATOM	3605	O	PRO	A	481	14.435	9.956	6.341	1.00	37.33	O
ATOM	3613	N	TYR	A	482	15.504	8.038	5.765	1.00	37.95	N
ATOM	3614	CA	TYR	A	482	16.686	8.199	6.621	1.00	38.34	C
ATOM	3615	CB	TYR	A	482	17.853	7.290	6.177	1.00	38.37	C
ATOM	3616	CG	TYR	A	482	19.066	7.339	7.112	1.00	38.37	C
ATOM	3617	CD1	TYR	A	482	20.346	7.042	6.644	1.00	38.27	C
ATOM	3618	CE1	TYR	A	482	21.460	7.088	7.498	1.00	38.25	C
ATOM	3619	CZ	TYR	A	482	21.291	7.436	8.830	1.00	38.09	C
ATOM	3620	OH	TYR	A	482	22.366	7.486	9.685	1.00	38.67	O
ATOM	3621	CE2	TYR	A	482	20.036	7.734	9.318	1.00	38.49	C
ATOM	3622	CD2	TYR	A	482	18.931	7.686	8.466	1.00	38.46	C
ATOM	3623	C	TYR	A	482	17.201	9.623	6.804	1.00	38.80	C
ATOM	3624	O	TYR	A	482	17.946	10.142	5.976	1.00	39.04	O
ATOM	3634	N	ASN	A	483	16.769	10.221	7.913	1.00	39.25	N
ATOM	3635	CA	ASN	A	483	17.382	11.397	8.536	1.00	39.44	C
ATOM	3636	CB	ASN	A	483	18.591	10.976	9.380	1.00	39.64	C
ATOM	3637	CG	ASN	A	483	18.178	10.317	10.697	1.00	40.39	C
ATOM	3638	OD1	ASN	A	483	17.263	9.485	10.733	1.00	41.13	O
ATOM	3639	ND2	ASN	A	483	18.839	10.704	11.786	1.00	41.32	N
ATOM	3640	C	ASN	A	483	17.729	12.599	7.657	1.00	39.39	C
ATOM	3641	O	ASN	A	483	18.136	12.474	6.501	1.00	39.40	O
ATOM	3648	N	ASN	A	484	17.557	13.773	8.260	1.00	39.11	N
ATOM	3649	CA	ASN	A	484	17.561	15.034	7.545	1.00	38.80	C
ATOM	3650	CB	ASN	A	484	16.279	15.144	6.701	1.00	38.99	C
ATOM	3651	CG	ASN	A	484	15.164	14.220	7.185	1.00	39.62	C
ATOM	3652	OD1	ASN	A	484	14.999	13.099	6.689	1.00	39.36	O
ATOM	3653	ND2	ASN	A	484	14.390	14.693	8.156	1.00	41.23	N
ATOM	3654	C	ASN	A	484	17.681	16.211	8.527	1.00	38.46	C
ATOM	3655	O	ASN	A	484	17.984	16.020	9.718	1.00	38.43	O
ATOM	3662	N	LEU	A	485	17.482	17.430	8.031	1.00	37.55	N
ATOM	3663	CA	LEU	A	485	17.421	18.584	8.911	1.00	36.77	C
ATOM	3664	CB	LEU	A	485	17.335	19.886	8.104	1.00	36.72	C
ATOM	3665	CG	LEU	A	485	17.291	21.211	8.877	1.00	36.42	C
ATOM	3666	CD1	LEU	A	485	18.450	21.318	9.878	1.00	36.10	C
ATOM	3667	CD2	LEU	A	485	17.303	22.382	7.906	1.00	36.17	C
ATOM	3668	C	LEU	A	485	16.224	18.450	9.842	1.00	36.34	C
ATOM	3669	O	LEU	A	485	16.311	18.822	11.002	1.00	36.44	O
ATOM	3681	N	LEU	A	486	15.117	17.902	9.350	1.00	35.96	N
ATOM	3682	CA	LEU	A	486	13.877	17.880	10.136	1.00	35.67	C
ATOM	3683	CB	LEU	A	486	12.672	17.501	9.269	1.00	35.56	C
ATOM	3684	CG	LEU	A	486	11.448	18.380	9.548	1.00	35.99	C
ATOM	3685	CD1	LEU	A	486	10.776	18.839	8.259	1.00	36.23	C
ATOM	3686	CD2	LEU	A	486	10.461	17.642	10.439	1.00	36.77	C
ATOM	3687	C	LEU	A	486	13.962	16.967	11.360	1.00	35.44	C
ATOM	3688	O	LEU	A	486	13.501	17.338	12.439	1.00	35.19	O
ATOM	3700	N	ILE	A	487	14.567	15.793	11.190	1.00	35.33	N
ATOM	3701	CA	ILE	A	487	14.730	14.831	12.280	1.00	35.36	C
ATOM	3702	CB	ILE	A	487	14.969	13.391	11.715	1.00	35.46	C
ATOM	3703	CG1	ILE	A	487	13.781	12.479	12.030	1.00	35.39	C
ATOM	3704	CD1	ILE	A	487	12.530	12.847	11.291	1.00	35.62	C
ATOM	3705	CG2	ILE	A	487	16.236	12.749	12.268	1.00	35.75	C
ATOM	3706	C	ILE	A	487	15.845	15.269	13.246	1.00	35.54	C
ATOM	3707	O	ILE	A	487	15.773	14.978	14.444	1.00	35.29	O
ATOM	3719	N	GLU	A	488	16.860	15.969	12.734	1.00	35.70	N
ATOM	3720	CA	GLU	A	488	17.903	16.534	13.595	1.00	35.93	C
ATOM	3721	CB	GLU	A	488	19.098	17.061	12.796	1.00	36.07	C
ATOM	3722	CG	GLU	A	488	20.361	17.164	13.648	1.00	36.89	C
ATOM	3723	CD	GLU	A	488	21.522	17.848	12.944	1.00	37.36	C
ATOM	3724	OE1	GLU	A	488	21.611	19.106	13.022	1.00	36.35	O
ATOM	3725	OE2	GLU	A	488	22.350	17.118	12.340	1.00	35.84	O
ATOM	3726	C	GLU	A	488	17.370	17.644	14.491	1.00	36.07	C
ATOM	3727	O	GLU	A	488	17.782	17.757	15.645	1.00	36.38	O
ATOM	3734	N	MET	A	489	16.464	18.467	13.971	1.00	36.15	N
ATOM	3735	CA	MET	A	489	15.813	19.479	14.797	1.00	36.13	C
ATOM	3736	CB	MET	A	489	14.948	20.415	13.955	1.00	36.15	C
ATOM	3737	CG	MET	A	489	15.660	21.161	12.840	1.00	36.56	C
ATOM	3738	SD	MET	A	489	17.129	22.024	13.359	1.00	37.55	S
ATOM	3739	CE	MET	A	489	16.447	23.045	14.629	1.00	35.97	C
ATOM	3740	C	MET	A	489	14.924	18.773	15.809	1.00	36.26	C
ATOM	3741	O	MET	A	489	14.868	19.155	16.979	1.00	36.69	O
ATOM	3751	N	LEU	A	490	14.236	17.732	15.343	1.00	36.17	N
ATOM	3752	CA	LEU	A	490	13.330	16.944	16.175	1.00	36.05	C
ATOM	3753	CB	LEU	A	490	12.593	15.917	15.299	1.00	36.05	C
ATOM	3754	CG	LEU	A	490	11.287	15.302	15.809	1.00	35.57	C
ATOM	3755	CD1	LEU	A	490	10.121	16.275	15.672	1.00	35.46	C
ATOM	3756	CD2	LEU	A	490	10.992	14.014	15.059	1.00	35.60	C
ATOM	3757	C	LEU	A	490	14.060	16.220	17.314	1.00	36.11	C
ATOM	3758	O	LEU	A	490	13.435	15.854	18.301	1.00	36.08	O
ATOM	3770	N	HIS	A	491	15.373	16.024	17.168	1.00	36.38	N
ATOM	3771	CA	HIS	A	491	16.173	15.234	18.110	1.00	36.54	C
ATOM	3772	CB	HIS	A	491	17.446	14.698	17.431	1.00	36.60	C
ATOM	3773	CG	HIS	A	491	17.294	13.341	16.805	1.00	36.62	C
ATOM	3774	ND1	HIS	A	491	16.316	12.443	17.179	1.00	36.59	N
ATOM	3775	CE1	HIS	A	491	16.433	11.340	16.459	1.00	36.55	C
ATOM	3776	NE2	HIS	A	491	17.454	11.488	15.633	1.00	36.46	N
ATOM	3777	CD2	HIS	A	491	18.012	12.728	15.831	1.00	36.39	C
ATOM	3778	C	HIS	A	491	16.570	15.997	19.376	1.00	36.98	C
ATOM	3779	O	HIS	A	491	17.134	15.399	20.291	1.00	37.55	O
ATOM	3788	N	ALA	A	492	16.306	17.302	19.439	1.00	37.19	N
ATOM	3789	CA	ALA	A	492	16.428	18.038	20.701	1.00	37.40	C
ATOM	3790	CB	ALA	A	492	17.904	18.249	21.084	1.00	37.44	C
ATOM	3791	C	ALA	A	492	15.695	19.372	20.624	1.00	37.56	C
ATOM	3792	O	ALA	A	492	14.466	19.402	20.521	1.00	37.90	O
ATOM	3798	N	GLU	P	741	26.174	18.537	18.803	1.00	34.61	N
ATOM	3799	CA	GLU	P	741	24.704	18.619	19.033	1.00	34.61	C
ATOM	3800	CB	GLU	P	741	24.354	19.893	19.824	1.00	34.56	C
ATOM	3801	CG	GLU	P	741	23.788	19.642	21.218	1.00	34.47	C
ATOM	3802	CD	GLU	P	741	22.302	19.320	21.214	1.00	34.56	C
ATOM	3803	OE1	GLU	P	741	21.534	19.998	20.493	1.00	34.60	O
ATOM	3804	OE2	GLU	P	741	21.895	18.391	21.944	1.00	34.22	O
ATOM	3805	C	GLU	P	741	23.968	18.579	17.690	1.00	34.65	C
ATOM	3806	O	GLU	P	741	23.336	17.574	17.350	1.00	34.82	O
ATOM	3812	N	ASN	P	742	24.075	19.665	16.928	1.00	34.52	N
ATOM	3813	CA	ASN	P	742	23.393	19.807	15.648	1.00	34.44	C
ATOM	3814	CS	ASN	P	742	22.328	20.908	15.750	1.00	34.59	C
ATOM	3815	CG	ASN	P	742	20.926	20.358	15.920	1.00	34.84	C
ATOM	3816	OD1	ASN	P	742	20.128	20.365	14.979	1.00	34.23	O
ATOM	3817	ND2	ASN	P	742	20.614	19.892	17.128	1.00	35.04	N
ATOM	3818	C	ASN	P	742	24.400	20.152	14.557	1.00	34.22	C
ATOM	3819	O	ASN	P	742	24.576	21.314	14.206	1.00	34.17	O
ATOM	3826	N	ALA	P	743	25.070	19.136	14.031	1.00	34.07	N
ATOM	3827	CA	ALA	P	743	26.135	19.351	13.056	1.00	34.03	C
ATOM	3828	CB	ALA	P	743	26.861	18.043	12.767	1.00	34.11	C
ATOM	3829	C	ALA	P	743	25.615	19.974	11.759	1.00	34.04	C
ATOM	3830	O	ALA	P	743	26.266	20.849	11.186	1.00	34.22	O
ATOM	3836	N	LEU	P	744	24.446	19.528	11.310	1.00	33.98	N
ATOM	3837	CA	LEU	P	744	23.820	20.034	10.083	1.00	34.02	C
ATOM	3838	CB	LEU	P	744	22.652	19.121	9.674	1.00	33.99	C
ATOM	3839	CG	LEU	P	744	21.890	19.396	8.364	1.00	34.54	C
ATOM	3840	CD1	LEU	P	744	22.805	19.843	7.223	1.00	35.40	C
ATOM	3841	CD2	LEU	P	744	21.103	18.158	7.935	1.00	34.32	C
ATOM	3842	C	LEU	P	744	23.340	21.491	10.209	1.00	33.95	C
ATOM	3843	O	LEU	P	744	23.545	22.292	9.299	1.00	34.11	O
ATOM	3855	N	LEU	P	745	22.705	21.831	11.330	1.00	33.80	N
ATOM	3856	CA	LEU	P	745	22.260	23.207	11.581	1.00	33.70	C
ATOM	3857	CB	LEU	P	745	21.507	23.314	12.923	1.00	33.70	C
ATOM	3858	CG	LEU	P	745	20.266	24.207	13.046	1.00	33.27	C
ATOM	3859	CD1	LEU	P	745	20.170	24.815	14.437	1.00	32.24	C
ATOM	3860	CD2	LEU	P	745	20.186	25.299	11.975	1.00	33.44	C
ATOM	3861	C	LEU	P	745	23.450	24.157	11.605	1.00	33.73	C
ATOM	3862	O	LEU	P	745	23.385	25.264	11.077	1.00	34.09	O
ATOM	3874	N	ARG	P	746	24.535	23.721	12.232	1.00	33.50	N
ATOM	3875	CA	ARG	P	746	25.749	24.518	12.295	1.00	33.42	C
ATOM	3876	CB	ARG	P	746	26.766	23.850	13.219	1.00	33.49	C
ATOM	3877	CG	ARG	P	746	28.025	24.669	13.417	1.00	33.46	C
ATOM	3878	CD	ARG	P	746	28.982	24.111	14.442	1.00	33.87	C
ATOM	3879	NE	ARG	P	746	29.480	25.184	15.296	1.00	35.04	N
ATOM	3880	CZ	ARG	P	746	28.927	25.572	16.444	1.00	35.37	C
ATOM	3881	NH1	ARG	P	746	27.846	24.968	16.930	1.00	35.42	N
ATOM	3882	NH2	ARG	P	746	29.475	26.576	17.121	1.00	36.26	N
ATOM	3883	C	ARG	P	746	26.366	24.736	10.907	1.00	33.26	C
ATOM	3884	O	ARG	P	746	26.813	25.836	10.583	1.00	33.19	O
ATOM	3898	N	TYR	P	747	26.396	23.683	10.099	1.00	33.16	N
ATOM	3899	CA	TYR	P	747	26.945	23.768	8.753	1.00	33.21	C
ATOM	3900	CB	TYR	P	747	26.883	22.404	8.051	1.00	33.28	C
ATOM	3901	CG	TYR	P	747	27.324	22.460	6.599	1.00	33.04	C
ATOM	3902	CD1	TYR	P	747	28.666	22.570	6.272	1.00	32.68	C
ATOM	3903	CE1	TYR	P	747	29.081	22.640	4.951	1.00	32.93	C
ATOM	3904	CZ	TYR	P	747	28.148	22.613	3.936	1.00	32.17	C
ATOM	3905	OH	TYR	P	747	28.574	22.695	2.636	1.00	30.38	O
ATOM	3906	CE2	TYR	P	747	26.803	22.519	4.234	1.00	32.58	C
ATOM	3907	CD2	TYR	P	747	26.396	22.444	5.562	1.00	32.25	C
ATOM	3908	C	TYR	P	747	26.196	24.812	7.924	1.00	33.22	C
ATOM	3909	O	TYR	P	747	26.809	25.580	7.185	1.00	32.89	O
ATOM	3919	N	LEU	P	748	24.874	24.830	8.058	1.00	33.41	N
ATOM	3920	CA	LEU	P	748	24.022	25.713	7.273	1.00	33.75	C
ATOM	3921	CB	LEU	P	748	22.569	25.242	7.338	1.00	33.68	C
ATOM	3922	CG	LEU	P	748	22.337	23.852	6.737	1.00	34.49	C
ATOM	3923	CD1	LEU	P	748	21.048	23.231	7.267	1.00	35.23	C
ATOM	3924	CD2	LEU	P	748	22.312	23.899	5.219	1.00	34.49	C
ATOM	3925	C	LEU	P	748	24.131	27.167	7.729	1.00	34.01	C
ATOM	3926	O	LEU	P	748	23.866	28.078	6.951	1.00	34.17	O
ATOM	3938	N	LEU	P	749	24.534	27.379	8.978	1.00	34.31	N
ATOM	3939	CA	LEU	P	749	24.711	28.727	9.518	1.00	34.77	C
ATOM	3940	CB	LEU	P	749	24.395	28.734	11.018	1.00	34.88	C
ATOM	3941	CG	LEU	P	749	22.940	28.447	11.393	1.00	34.51	C
ATOM	3942	CD1	LEU	P	749	22.849	28.088	12.868	1.00	34.55	C
ATOM	3943	CD2	LEU	P	749	22.055	29.637	11.075	1.00	34.15	C
ATOM	3944	C	LEU	P	749	26.107	29.341	9.284	1.00	35.01	C
ATOM	3945	O	LEU	P	749	26.273	30.550	9.453	1.00	34.78	O
ATOM	3957	N	ASP	P	750	27.089	28.517	8.901	1.00	35.61	N
ATOM	3958	CA	ASP	P	750	28.480	28.965	8.668	1.00	35.93	C
ATOM	3959	CB	ASP	P	750	29.477	27.962	9.256	1.00	36.06	C
ATOM	3960	CG	ASP	P	750	29.436	27.913	10.768	1.00	36.98	C
ATOM	3961	OD1	ASP	P	750	29.449	28.987	11.411	1.00	36.82	O
ATOM	3962	OD2	ASP	P	750	29.397	26.837	11.399	1.00	38.78	O
ATOM	3963	C	ASP	P	750	28.816	29.154	7.185	1.00	35.85	C
ATOM	3964	O	ASP	P	750	29.368	30.184	6.799	1.00	36.02	O
ATOM	3969	N	LYS	P	751	28.522	28.140	6.374	1.00	35.65	N
ATOM	3970	CA	LYS	P	751	28.734	28.191	4.924	1.00	35.57	C
ATOM	3971	CB	LYS	P	751	30.206	28.463	4.586	1.00	35.59	C
ATOM	3972	CG	LYS	P	751	30.463	29.776	3.854	1.00	35.24	C
ATOM	3973	CD	LYS	P	751	31.916	30.205	3.997	1.00	34.64	C
ATOM	3974	CE	LYS	P	751	32.268	31.306	3.020	1.00	34.57	C
ATOM	3975	NZ	LYS	P	751	31.359	32.471	3.156	1.00	34.62	N
ATOM	3976	C	LYS	P	751	28.309	26.871	4.273	1.00	35.69	C
ATOM	3977	O	LYS	P	751	27.211	26.366	4.514	1.00	35.79	O
ATOM	3991	N	ASN	Q	742	6.446	8.836	−7.386	1.00	33.84	N
ATOM	3992	CA	ASN	Q	742	5.438	8.085	−8.179	1.00	33.97	C
ATOM	3993	CB	ASN	O	742	5.294	6.647	−7.653	1.00	34.00	C
ATOM	3994	CG	ASN	Q	742	6.317	5.690	−8.262	1.00	34.60	C
ATOM	3995	OD1	ASN	Q	742	6.298	5.429	−9.467	1.00	35.17	O
ATOM	3996	ND2	ASN	Q	742	7.212	5.159	−7.427	1.00	34.86	N
ATOM	3997	C	ASN	Q	742	4.085	8.813	−8.208	1.00	34.03	C
ATOM	3998	O	ASN	Q	742	3.900	9.725	−9.013	1.00	34.29	O
ATOM	4004	N	ALA	Q	743	3.149	8.442	−7.332	1.00	33.87	N
ATOM	4005	CA	ALA	Q	743	1.750	8.853	−7.499	1.00	33.63	C
ATOM	4006	CB	ALA	Q	743	0.838	8.046	−6.589	1.00	33.61	C
ATOM	4007	C	ALA	Q	743	1.549	10.344	−7.263	1.00	33.66	C
ATOM	4008	O	ALA	Q	743	1.095	11.052	−8.159	1.00	33.60	O
ATOM	4014	N	LEU	Q	744	1.902	10.815	−6.067	1.00	33.62	N
ATOM	4015	CA	LEU	Q	744	1.717	12.220	−5.699	1.00	33.50	C
ATOM	4016	CB	LEU	Q	744	2.040	12.445	−4.218	1.00	33.52	C
ATOM	4017	CG	LEU	Q	744	1.892	13.887	−3.710	1.00	33.80	C
ATOM	4018	CD1	LEU	Q	744	0.518	14.458	−4.037	1.00	34.25	C
ATOM	4019	CD2	LEU	Q	744	2.139	13.963	−2.216	1.00	33.73	C
ATOM	4020	C	LEU	Q	744	2.550	13.173	−6.545	1.00	33.35	C
ATOM	4021	O	LEU	Q	744	2.045	14.196	−6.998	1.00	33.25	O
ATOM	4033	N	LEU	Q	745	3.824	12.846	−6.744	1.00	33.30	N
ATOM	4034	CA	LEU	Q	745	4.725	13.714	−7.502	1.00	33.28	C
ATOM	4035	CB	LEU	Q	745	6.149	13.151	−7.488	1.00	33.29	C
ATOM	4036	CG	LEU	Q	745	7.251	14.015	−8.111	1.00	33.71	C
ATOM	4037	CD1	LEU	Q	745	7.542	15.243	−7.264	1.00	33.90	C
ATOM	4038	CD2	LEU	Q	745	8.520	13.200	−8.308	1.00	33.82	C
ATOM	4039	C	LEU	Q	745	4.235	13.912	−8.944	1.00	33.20	C
ATOM	4040	O	LEU	Q	745	4.297	15.018	−9.472	1.00	33.21	O
ATOM	4052	N	ARG	Q	746	3.741	12.842	−9.563	1.00	33.07	N
ATOM	4053	CA	ARG	Q	746	3.205	12.906	−10.923	1.00	33.12	C
ATOM	4054	CB	ARG	Q	746	2.917	11.499	−11.464	1.00	33.14	C
ATOM	4055	CG	ARG	Q	746	2.375	11.499	−12.884	1.00	33.02	C
ATOM	4056	CD	ARG	Q	746	2.622	10.222	−13.663	1.00	33.71	C
ATOM	4057	NE	ARG	Q	746	2.144	10.353	−15.043	1.00	33.83	N
ATOM	4058	CZ	ARG	Q	746	1.975	9.348	−15.895	1.00	33.75	C
ATOM	4059	NH1	ARG	Q	746	2.250	8.095	−15.543	1.00	34.27	N
ATOM	4060	NH2	ARG	Q	746	1.525	9.597	−17.117	1.00	34.03	N
ATOM	4061	C	ARG	Q	746	1.936	13.760	−10.995	1.00	33.14	C
ATOM	4062	O	ARG	Q	746	1.723	14.493	−11.960	1.00	33.03	O
ATOM	4076	N	TYR	Q	747	1.100	13.656	−9.968	1.00	33.26	N
ATOM	4077	CA	TYR	Q	747	−0.101	14.473	−9.849	1.00	33.28	C
ATOM	4078	CB	TYR	Q	747	−0.900	14.050	−8.611	1.00	33.30	C
ATOM	4079	CG	TYR	Q	747	−1.943	15.048	−8.171	1.00	33.77	C
ATOM	4080	CD1	TYR	Q	747	−1.782	15.782	−6.998	1.00	34.13	C
ATOM	4081	CE1	TYR	Q	747	−2.744	16.708	−6.593	1.00	34.84	C
ATOM	4082	CZ	TYR	Q	747	−3.882	16.904	−7.372	1.00	34.56	C
ATOM	4083	OH	TYR	Q	747	−4.838	17.814	−6.990	1.00	34.21	O
ATOM	4084	CE2	TYR	Q	747	−4.056	16.187	−8.541	1.00	34.53	C
ATOM	4085	CD2	TYR	Q	747	−3.090	15.266	−8.934	1.00	34.20	C
ATOM	4086	C	TYR	Q	747	0.229	15.969	−9.794	1.00	33.27	C
ATOM	4087	O	TYR	Q	747	−0.511	16.790	−10.341	1.00	33.15	O
ATOM	4097	N	LEU	Q	748	1.345	16.313	−9.150	1.00	33.36	N
ATOM	4098	CA	LEU	Q	748	1.741	17.712	−8.976	1.00	33.37	C
ATOM	4099	CB	LEU	Q	748	2.834	17.832	−7.909	1.00	33.40	C
ATOM	4100	CG	LEU	Q	748	2.445	17.435	−6.478	1.00	33.31	C
ATOM	4101	CD1	LEU	Q	748	3.686	17.318	−5.594	1.00	33.15	C
ATOM	4102	CD2	LEU	Q	748	1.444	18.411	−5.863	1.00	33.23	C
ATOM	4103	C	LEU	Q	748	2.206	18.346	−10.287	1.00	33.44	C
ATOM	4104	O	LEU	Q	748	1.816	19.467	−10.615	1.00	33.35	O
ATOM	4116	N	LEU	Q	749	3.022	17.615	−11.038	1.00	33.66	N
ATOM	4117	CA	LEU	Q	749	3.526	18.091	−12.327	1.00	33.97	C
ATOM	4118	CB	LEU	Q	749	4.519	17.086	−12.918	1.00	34.02	C
ATOM	4119	CG	LEU	Q	749	5.759	16.725	−12.095	1.00	34.34	C
ATOM	4120	CD1	LEU	Q	749	6.403	15.454	−12.650	1.00	34.83	C
ATOM	4121	CD2	LEU	Q	749	6.751	17.879	−12.076	1.00	34.34	C
ATOM	4122	C	LEU	Q	749	2.397	18.305	−13.339	1.00	34.10	C
ATOM	4123	O	LEU	Q	749	2.336	19.345	−14.001	1.00	34.12	O
ATOM	4135	N	ASP	Q	750	1.504	17.320	−13.437	1.00	34.17	N
ATOM	4136	CA	ASP	Q	750	0.480	17.283	−14.484	1.00	34.24	C
ATOM	4137	CB	ASP	Q	750	−0.186	15.896	−14.528	1.00	34.24	C
ATOM	4138	CG	ASP	Q	750	0.696	14.833	−15.193	1.00	34.67	C
ATOM	4139	OD1	ASP	Q	750	1.827	15.155	−15.631	1.00	34.76	O
ATOM	4140	OD2	ASP	Q	750	0.334	13.641	−15.325	1.00	34.79	O
ATOM	4141	C	ASP	Q	750	−0.586	18.387	−14.376	1.00	34.20	C
ATOM	4142	O	ASP	Q	750	−1.326	18.620	−15.335	1.00	34.27	O
ATOM	4147	N	LYS	Q	751	−0.669	19.053	−13.222	1.00	34.12	N
ATOM	4148	CA	LYS	Q	751	−1.497	20.253	−13.068	1.00	34.04	C
ATOM	4149	CB	LYS	Q	751	−2.928	19.877	−12.652	1.00	34.03	C
ATOM	4150	CG	LYS	Q	751	−3.966	19.942	−13.766	1.00	33.85	C
ATOM	4151	CD	LYS	Q	751	−4.345	21.375	−14.117	1.00	33.62	C
ATOM	4152	CE	LYS	Q	751	−5.318	21.422	−15.292	1.00	33.41	C
ATOM	4153	NZ	LYS	Q	751	−5.054	22.579	−16.185	1.00	33.02	N
ATOM	4154	C	LYS	Q	751	−0.881	21.198	−12.031	1.00	34.07	C
ATOM	4155	O	LYS	Q	751	0.328	21.448	−12.031	1.00	33.89	O
ATOM	4169	O43	PPA	L	1	−2.683	13.046	2.647	1.00	36.59	O
ATOM	4170	C42	PPA	L	1	−1.973	12.439	1.856	1.00	36.77	C
ATOM	4171	C44	PPA	L	1	−1.315	13.116	0.665	1.00	36.61	C
ATOM	4172	C45	PPA	L	1	−1.556	14.627	0.599	1.00	36.00	C
ATOM	4173	C46	PPA	L	1	−0.460	15.423	1.301	1.00	35.69	C
ATOM	4174	C47	PPA	L	1	−0.890	16.866	1.574	1.00	35.51	C
ATOM	4175	C48	PPA	L	1	0.176	17.655	2.340	1.00	35.35	C
ATOM	4176	C49	PPA	L	1	−0.440	18.673	3.301	1.00	35.77	C
ATOM	4177	C50	PPA	L	1	0.569	19.206	4.325	1.00	35.36	C
ATOM	4178	C51	PPA	L	1	1.309	20.425	3.796	1.00	35.59	C
ATOM	4179	C52	PPA	L	1	2.761	20.483	4.283	1.00	36.70	C
ATOM	4180	C53	PPA	L	1	2.893	20.954	5.734	1.00	36.61	C
ATOM	4181	C54	PPA	L	1	4.043	21.942	5.875	1.00	36.48	C
ATOM	4182	C55	PPA	L	1	4.143	22.465	7.304	1.00	37.07	C
ATOM	4183	C56	PPA	L	1	4.833	21.460	8.196	1.00	37.56	C
ATOM	4184	C57	PPA	L	1	5.276	21.837	9.396	1.00	38.55	C
ATOM	4185	C58	PPA	L	1	5.976	20.859	10.319	1.00	38.57	C
ATOM	4186	O41	PPA	L	1	−1.752	11.011	2.077	1.00	36.88	O
ATOM	4187	C40	PPA	L	1	−1.735	10.466	3.404	1.00	35.73	C
ATOM	4188	C38	PPA	L	1	−0.454	10.840	4.147	1.00	34.28	C
ATOM	4189	C39	PPA	L	1	−0.291	9.981	5.398	1.00	33.72	C
ATOM	4190	O19	PPA	L	1	−1.199	10.305	6.457	1.00	33.32	O
ATOM	4191	P16	PPA	L	1	−1.011	9.490	7.839	1.00	33.40	P
ATOM	4192	O17	PPA	L	1	0.404	9.747	8.301	1.00	32.80	O
ATOM	4193	O18	PPA	L	1	−1.470	8.066	7.620	1.00	34.54	O
ATOM	4194	O15	PPA	L	1	−2.015	10.119	8.930	1.00	34.72	O
ATOM	4195	C14	PPA	L	1	−1.556	10.312	10.276	1.00	35.34	C
ATOM	4196	C6	PPA	L	1	−2.191	9.386	11.302	1.00	35.84	C
ATOM	4197	O7	PPA	L	1	−3.227	10.071	11.968	1.00	35.93	O
ATOM	4198	C8	PPA	L	1	−1.182	8.964	12.355	1.00	36.16	C
ATOM	4199	O9	PPA	L	1	−1.615	7.735	12.931	1.00	37.73	O
ATOM	4200	P10	PPA	L	1	−2.873	7.663	13.933	1.00	39.45	P
ATOM	4201	O12	PPA	L	1	−4.116	7.289	13.150	1.00	40.20	O
ATOM	4202	O13	PPA	L	1	−2.848	8.894	14.792	1.00	38.10	O
ATOM	4203	O11	PPA	L	1	−2.556	6.354	14.835	1.00	39.26	O
ATOM	4204	C1	PPA	L	1	−2.997	6.260	16.190	1.00	37.98	C
ATOM	4205	C2	PPA	L	1	−4.455	5.829	16.286	1.00	37.45	C
ATOM	4206	C4	PPA	L	1	−5.119	6.606	17.415	1.00	37.20	C
ATOM	4207	O5	PPA	L	1	−5.436	7.911	16.978	1.00	36.01	O
ATOM	4208	O3	PPA	L	1	−4.558	4.439	16.569	1.00	36.89	O
ATOM	4209	O37	PPA	L	1	−0.493	12.216	4.510	1.00	34.58	O
ATOM	4210	C21	PPA	L	1	0.800	12.858	4.656	1.00	34.98	C
ATOM	4211	O20	PPA	L	1	1.663	12.665	3.821	1.00	35.77	O
ATOM	4212	C22	PPA	L	1	1.064	13.763	5.837	1.00	35.70	C
ATOM	4213	C23	PPA	L	1	1.171	15.234	5.433	1.00	36.25	C
ATOM	4214	C24	PPA	L	1	2.597	15.624	5.056	1.00	36.54	C
ATOM	4215	C25	PPA	L	1	3.562	15.418	6.214	1.00	36.61	C
ATOM	4216	C26	PPA	L	1	4.644	16.488	6.265	1.00	37.07	C
ATOM	4217	C27	PPA	L	1	5.594	16.193	7.426	1.00	37.44	C
ATOM	4218	C28	PPA	L	1	6.185	17.459	8.035	1.00	37.93	C
ATOM	4219	C29	PPA	L	1	5.940	17.528	9.527	1.00	38.45	C
ATOM	4220	C30	PPA	L	1	4.730	17.746	10.054	1.00	39.11	C
ATOM	4221	C31	PPA	L	1	3.494	17.929	9.200	1.00	38.75	C
ATOM	4222	C32	PPA	L	1	2.382	18.600	10.002	1.00	37.88	C
ATOM	4223	C33	PPA	L	1	1.194	18.898	9.087	1.00	37.14	C
ATOM	4224	C34	PPA	L	1	0.081	19.598	9.852	1.00	36.55	C
ATOM	4225	C35	PPA	L	1	0.284	21.107	9.890	1.00	35.37	C
ATOM	4226	C36	PPA	L	1	−0.314	21.757	8.667	1.00	34.63	C
ATOM	4227	O3	TRS	L	3	9.347	29.715	2.255	1.00	42.27	O
ATOM	4228	C3	TRS	L	3	10.479	30.376	2.803	1.00	41.84	C
ATOM	4229	C	TRS	L	3	10.156	31.810	3.223	1.00	41.88	C
ATOM	4230	N	TRS	L	3	9.040	31.825	4.173	1.00	42.35	N
ATOM	4231	C2	TRS	L	3	11.367	32.385	3.945	1.00	41.73	C
ATOM	4232	O2	TRS	L	3	11.291	32.060	5.319	1.00	41.98	O
ATOM	4233	C1	TRS	L	3	9.766	32.667	2.012	1.00	42.24	C
ATOM	4234	O1	TRS	L	3	8.431	32.437	1.595	1.00	42.95	O
ATOM	4235	O	HOH	S	1	2.108	5.986	−1.133	1.00	23.43	O
ATOM	4236	O	HOH	S	2	13.244	5.029	13.018	1.00	35.88	O
ATOM	4237	O	HOH	S	3	11.511	38.773	6.589	1.00	30.96	O
ATOM	4238	O	HOH	S	4	15.542	30.877	1.405	1.00	42.07	O
ATOM	4239	O	HOH	S	5	13.286	31.186	18.972	1.00	25.09	O
ATOM	4240	O	HOH	S	6	0.792	27.561	22.768	1.00	32.79	O
ATOM	4241	O	HOH	S	7	−5.956	26.103	15.642	1.00	35.97	O
ATOM	4242	O	HOH	S	8	24.892	33.395	10.244	1.00	29.28	O
ATOM	4243	O	HOH	S	9	6.109	25.566	5.485	1.00	31.19	O
ATOM	4244	O	HOH	S	10	15.560	15.611	2.255	1.00	33.67	O
ATOM	4245	O	HOH	S	11	8.926	31.294	19.207	1.00	38.26	O
ATOM	4246	O	HOH	S	12	−7.554	15.507	7.142	1.00	32.33	O
ATOM	4247	O	HOH	S	13	−10.744	29.028	1.079	1.00	35.19	O
ATOM	4248	O	HOH	S	14	−11.785	42.259	12.347	1.00	25.32	O
ATOM	4249	O	HOH	S	15	9.213	25.519	16.927	1.00	31.32	O
ATOM	4250	O	HOH	S	16	−4.149	23.203	18.085	1.00	36.87	O
ATOM	4251	O	HOH	S	17	−9.056	18.745	19.148	1.00	32.61	O
ATOM	4252	O	HOH	S	18	4.012	22.577	1.516	1.00	31.64	O
ATOM	4253	O	HOH	S	19	−2.446	3.229	17.583	1.00	41.97	O
ATOM	4254	O	HOH	S	20	0.638	36.935	22.612	1.00	45.48	O
ATOM	4255	O	HOH	S	21	18.151	17.304	4.963	1.00	33.50	O
ATOM	4256	O	HOH	S	22	−12.356	38.189	17.814	1.00	34.96	O
ATOM	4257	O	HOH	S	23	0.105	41.383	1.512	1.00	32.51	O
ATOM	4258	O	HOH	S	24	25.510	40.496	25.615	1.00	30.99	O
ATOM	4259	O	HOH	S	25	29.679	33.213	15.194	1.00	31.76	O
ATOM	4260	O	HOH	S	26	9.168	30.436	22.604	1.00	40.62	O
ATOM	4261	O	HOH	S	27	23.696	15.780	14.185	1.00	36.32	O
ATOM	4262	O	HOH	S	28	−4.140	26.248	17.617	1.00	38.61	O
ATOM	4263	O	HOH	S	29	−5.299	7.378	−3.270	1.00	28.27	O
ATOM	4264	O	HOH	S	30	−6.455	6.396	13.074	1.00	39.28	O
ATOM	4265	O	HOH	S	31	21.631	15.274	16.032	1.00	30.87	O
ATOM	4266	O	HOH	S	32	21.836	28.385	5.120	1.00	22.13	O
ATOM	4267	O	HOH	S	33	29.257	21.528	11.551	1.00	26.18	O
ATOM	4268	O	HOH	S	34	−2.361	18.935	−9.788	1.00	25.42	O
ATOM	4271	O	HOH	S	37	−0.094	5.428	10.256	1.00	20.40	O

TABLE 4
Human SF-1 amino acid and cDNA nucleotide sequences.
Sequence NM_004959
1	ggaggacgga	cggacagggc	cagcctgctg	tccggctgcc	gcccgccgtg	gtgtgagggg	(SEQ ID NO:_)
61	gtttctgcgc	acccacagtc	gccaccgtcc	cacctgggct	gccggagcct	ccccctggac
121	ccctggtgcc	cactgccacc	ctcatccggt	gtgagagcgc	tgcttccgct	tcgcggacgc
181	cgcgggcatg	gactattcgt	acgacgagga	cctggacgag	ctgtgccccg	tgtgcgggga
241	caaggtgtcc	ggctaccact	acggactgct	cacgtgtgag	agctgcaagg	gcttcttcaa
301	gcgcacggtg	cagaacaaca	agoactacac	gtgcaccgag	agccagagct	gcaagatcga
361	caagacgcag	cgcaagcgct	gtcccttctg	ccgcttccag	aaatgcctga	cggtggggat
421	gcgcctggaa	gccgtgcgcg	ctgaccgtat	gaggggtggc	cggaacaagt	ttgggccgat
481	gtacaagcgg	gaccgggccc	tgaaacagca	gaagaaggca	cagattcggg	ccaatggctt
541	caagctggag	acagggcccc	cgatgggggt	gcccccgccg	ccccctcccg	caccggacta
601	cgtgctgcct	cccagcctgc	atgggcctga	gcccaagggc	ctggccgccg	gtccacctgc
661	tgggccactg	ggcgactttg	gggccccagc	actgcccatg	gccgtgcccg	gtgcccacgg
721	gccactggct	ggctacctct	accctgcctt	tcctggccgt	gccatcaagt	ctgagtaccc
781	ggagccttat	gccagccccc	cacagcctgg	gctgccgtac	ggctacccag	agcccttctc
841	tggagggccc	aacgtgcctg	agctcatcct	gcagctgctg	cagctggagc	cggatgagga
901	ccaggtgcgg	gcccgcatct	tgggctgcct	gcaggagccc	accaaaagcc	gccccgacca
961	gccggcggcc	ttcggcctcc	tgtgcagaat	ggccgaccag	accttcatct	ccatcgtgga
1021	ctgggcacgc	aggtgcatgg	tcttcaagga	gctggaggtg	gccgaccaga	tgacgctgct
1081	gcagaactgc	tggagcgagc	tgctggtgtt	cgaccacatc	taccgccagg	tccagcacgg
1141	caaggagggc	agcatcctgc	tggtcaccgg	gcaggaggtg	gagctgacca	cagtggccac
1201	ccaggcgggc	tcgctgctgc	acagcctggt	gttgcgggcg	caggagctgg	tgctgcagct
1261	gcttgcgctg	cagctggacc	ggcaggagtt	tgtctgcctc	aagttcatca	tcctcttcag
1321	cctggatttg	aagttcctga	ataaccacat	cctggtgaaa	gacgctcagg	agaaggccaa
1381	cgccgccctg	cttgactaca	ccctgtgcca	ctacccgcac	tgcggggaca	aattccagca
1441	gctgctgctg	tgcctggtgg	aggtgcgggc	cctgagcatg	caggccaagg	agtacctgta
1501	ccacaagcac	ctgggcaacg	agatgccccg	caacaacctg	ctcatcgaaa	tgctgcaagc
1561	caagcagact	tgagcctggg	ccgggggcgg	ggccgggact	gggggcggga	ctgggggcgg
1621	ggcctgggcg	gggccgcagc	cacaccgctg	gctctgcatg	gttcattttc	tgatgcccac
1681	cgaggagccc	cagccccgtc	ccagaggccg	ctgcccctga	gttctgacac	tgtgtgtttg
1741	ggaagtgggt	gaggctgggc	agggcctggc	ggaggtggag	tggccactgg	cacttgcctg
1801	ctgcttggag	tgccccaagg	aggtggctgt	taaccacccg	ccccgccccc	tccctgctcc
1861	cagctctctc	tcctggagtc	tgaagcctgc	aggtccgggg	aggaggttcg	ggattccctg
1921	gtgggcctcg	acgtcccttg	gatcagaggt	catcccttcc	tcctctcctg	gaaacagaca
1981	gggagaagtt	gagcaggtat	caactagggg	aggagagagg	gtctccagtg	ttccccccat
2041	agagaccagg	agggagagcc	tctgttttgt	aaactaagga	taaccgagtt	tgctaaattg
2101	agaggggcta	ttgggcccta	gaggacacta	ggagactggt	taggacaaaa	agaccttctc
2161	cctagccctt	ctaccccacc	tgacctctgc	aagagggggc	attgatacat	catcgggaaa
2221	aaactttgct	ccaggcatca	ctgattccct	ctcccaccca	aggagaacgt	ttggtacaat
2281	cgacatccta	gccccaccca	gaggtggccc	tcccaggctg	gtatttatct	gcaaggttgt
2341	agtcaagagg	tttttctccc	cgctttttgt	ttttaagctt	ctagacactc	cttgaaatgt
2401	gtgtgtgatg	gagggaaggg	gacagatttg	aggactgaag	ctggggcttg	gggattgcca
2461	ctaagtacag	ctgatggttt	ctccccggac	actcgcctac	taagtaccct	tggggtggtg
2521	ctgggtcatt	acttctgagc	cccagcccca	atccagagaa	gcgctgttgc	ccgccctcca
2581	cccactaggt	gaacagcagg	atgccctgtt	gggggcttca	ggtctctgtg	ggtgggaatg
2641	caagtgaact	tgggaggggg	cacgggcctg	tagatcaggg	atagcgctgt	tgatcccctc
2701	tctgtggctc	caacccgttg	ggtcccttgc	tgcaaaccca	tgaagctggc	cctcagctcc
2761	ctgaccccct	gtcctaggtc	atgaaggaca	ctctgcaggg	tgaagcacca	gggagaggcc
2821	tcggctgtct	cctgtccccg	gcggggtgcc	tgctgtccgt	cccgctttca	tgttactgtt
2881	gcagcttgtg	ctgagcctgc	ccagttggag	gagactgggc	acccctgcct	cctgcctccc
2941	gcctcccgcc	accctgtctc	agtacctccc	ccccccgccc	cctgaaacat	gtgcccctgc
3001	caaggccgga	gacccacagc	cctgaaacga	gaagtgccct	taaggatcac	cccagccccc
3061	acagccctgg	aataaatttc	gcaattagtt	tccaaaaaaa	aaaaaaaaaa	aaaaaaaaa
Sequence NP_004950
1	mdysydedld	elcpvcgdkv	sgyhyglltc	esckgffkrt	vqnnkhytct	esqsckidkt	(SEQ ID NO:_)
61	qrkrcpfcrf	qkcltvgmrl	eavradrmrg	grnkfgpmyk	rdralkqqkk	aqirangfkl
121	etgppmgvpp	ppppapdyvl	ppslhgpepk	glaagppagp	lgdfgapalp	mavpgahgpl
181	agylypafpg	raikseypep	yasppqpglp	ygypepfsgg	pnvpelilql	lqlepdedqv
241	rarilgclqe	ptksrpdqpa	afgllcrmad	qtfisivdwa	rrcmvfkele	vadqmtllqn
301	cwsellvfdh	iyrqvqhgke	gsillvtgqe	velttvatqa	gsllhslvlr	aqelvlqlla
361	lqldrqefvc	lkfiilfsld	lkflnnhilv	kdaqekanaa	lidytlchyp	hcgdkfqqll
421	lclvevrals	mqakeylyhk	hlgnemprnn	lliemlqakq	t

TABLE 5
Human LRH-1 amino acid and cDNA nucleotide sequences, and mouse LRH-1
nucleotide sequence.
Sequence NM_003822
1	aaaaagtaca	gagtccaggg	aaagacttgc	ttgtaacttt	atgaattctg	gatttttttt	(SEQ ID NO:_)
61	tttcctttgc	tttttcttaa	ctttcactaa	gggttactgt	agtctgatgt	gtccttccca
121	aggccacgaa	atttgacaag	ctgcactttt	cttttgctca	atgatttctg	ctttaagcca
181	aagaactgcc	tataatttca	ctaagaatgt	cttctaattc	agatactggg	gatttacaag
241	agtctttaaa	gcacggactt	acacctattg	tgtctcaatt	taaaatggtg	aattactcct
301	atgatgaaga	tctggaagag	ctttgtcccg	tgtgtggaga	taaagtgtct	gggtaccatt
361	atgggctcct	cacctgtgaa	agctgcaagg	gattttttaa	gcgaacagtc	caaaataata
421	aaaggtacac	atgtatagaa	aaccagaact	gccaaattga	caaaacacag	agaaagcgtt
481	gtccttactg	tcgttttcaa	aaatgtctaa	gtgttggaat	gaagctagaa	gctgtaaggg
541	ccgaccgaat	gcgtggagga	aggaataagt	ttgggccaat	gtacaagaga	gacagggccc
601	tgaagcaaca	gaaaaaagcc	ctcatccgag	ccaatggact	taagctagaa	gccatgtctc
661	aggtgatcca	agctatgccc	tctgacctga	ccatttcctc	tgcaattcaa	aacatccact
721	ctgcctccaa	aggcctacct	ctgaaccatg	ctgccttgcc	tcctacagac	tatgacagaa
781	gtccctttgt	aacatccccc	attagcatga	caatgccccc	tcacggcagc	ctgcaaggtt
841	accaaacata	tggccacttt	cctagccggg	ccatcaagtc	tgagtaccca	gacccctata
901	ccagctcacc	cgagtccata	atgggctatt	catatatgga	tagttaccag	acgagctctc
961	cagcaagcat	cccacatctg	atactggaac	ttttgaagtg	tgagccagat	gagcctcaag
1021	tccaggctaa	aatcatggcc	tatttgcagc	aagagcaggc	taaccgaagc	aagcacgaaa
1081	agctgagcac	ctttgggctt	atgtgcaaaa	tggcagatca	aactctcttc	tccattgtcg
1141	agtgggccag	gagtagtatc	ttcttcagag	aacttaaggt	tgatgaccaa	atgaagctgc
1201	ttcagaactg	ctggagtgag	ctcttaatcc	tcgaccacat	ttaccgacaa	gtggtacatg
1261	gaaaggaagg	atccatcttc	ctggttactg	ggcaacaagt	ggactattcc	ataatagcat
1321	cacaagccgg	agccaccctc	aacaacctca	tgagtcatgc	acaggagtta	gtggcaaaac
1381	ttcgttctct	ccagtttgat	caacgagagt	tcgtatgtct	gaaattcttg	gtgctcttta
1441	gtttagatgt	caaaaacctt	gaaaacttcc	agctggtaga	aggtgtccag	gaacaagtca
1501	atgccgccct	gctggactac	acaatgtgta	actacccgca	gcagacagag	aaatttggac
1561	agctacttct	tcgactaccc	gaaatccggg	ccatcagtat	gcaggctgaa	gaatacctct
1621	actacaagca	cctgaacggg	gatgtgccct	ataataacct	tctcattgaa	atgttgcatg
1681	ccaaaagagc	ataagttaca	acccctagga	gctctgcttt	caaaacaaaa	agagattggg
1741	ggagtgggga	gggggaagaa	gaacaggaag	aaaaaaagta	ctctgaactg	ctccaagtaa
1801	cgctaattaa	aaacttgctt	taaagatatt	gaatttaaaa	aggcataata	atcaaatact
1861	taatagcaaa	taaatgatgt	atcagggtat	ttgtattgca	aactgtgaat	caaaggcttc
1921	acagccccag	aggattccat	ataaaagaca	ttgtaatgga	gtggattgaa	ctcacagatg
1981	gataccaaca	cggtcagaag	aaaaacggac	agaacggttc	ttgtatattt	aaactgatct
2041	ccactatgaa	gaaatttagg	aactaatctt	attaattagg	cttatacagc	gggggatttg
2101	agcttacagg	attcctccat	ggtaaagctg	aactgaaaca	attctcaaga	atgcatcagc
2161	tgtacctaca	atagcccctc	cctcttcctt	tgaaggcccc	agcacctctg	ccctgtggtc
2221	accgaatctg	tactaaggac	ctgtgttcag	ccacacccag	tggtagctcc	accaaatcat
2281	gaacagccta	attttgagtg	tctgtgtctt	agacctgcaa	acagctaata	ggaaattcta
2341	ttaatatgtt	agcttgccat	tttaaatatg	ttctgagggt	tgttttgtct	cgtgttcatg
2401	atgttaagaa	aatgcaggca	gtatccctca	tcttatgtaa	gtgtgaatta	atattaaggg
2461	aaatgactac	aaactttcaa	agcaaatgct	ccatagctaa	agcaacttag	accttatttc
2521	tgctactgtt	gctgaaatgt	ggctttggca	ttgttggatt	tcataaaaaa	tttctggcag
2581	gaagtcttgt	tagtatacat	cagtcttttt	catcatccaa	gtttgtagtt	catttaaaaa
2641	tacaacatta	aacacatttt	gctaggatgt	caaatagtca	cagttctaag	tagttggaaa
2701	caaaattgac	gcatgttaat	ctatgcaaag	agaaaggaaa	ggatgaggtg	atgtattgac
2761	tcaaggttca	ttcttgctgc	aattgaacat	cctcaagagt	tgggatggaa	atggtgattt
2821	ttacatgtgt	cctggaaaga	tattaaagta	attcaaatct	tccccaaagg	ggaaaggaag
2881	agagtgatac	tgaccttttt	aagtcataga	ccaaagtctg	ctgtagaaca	aatatgggag
2941	gacaaagaat	cgcaaattct	tcaaatgact	attatcagta	ttattaacat	gcgatgccac
3001	aggtatgaaa	gtcttgcctt	atttcacaat	tttaaaaggt	agctgtgcag	atgtggatca
3061	acatttgttt	aaaataaagt	attaatactt	taaagtcaaa	taagatatag	tgtttacatt
3121	ctttaggtcc	tgaggggcag	ggggatctgt	gatataacaa	aatagcaaaa	gcggtaattt
3181	ccttaatgtt	atttttctga	ttggtaatta	tttttaacag	tacttaatta	ttctatgtcg
3241	tgagacacta	aaatcaaaaa	cgggaatctc	atttagactt	taattttttt	gagattatcg
3301	gcggcacaat	cactttgtag	aaactgtaaa	aaataaaagt	atctcctagt	cccttaattt
3361	tttcataaat	atttctggct	tttgagtagt	gtatttatat	tgtatatcat	actttcaact
3421	gtagacaatt	atgatgctaa	tttattgttt	cttggtttca	cctttgtata	agatatagcc
3481	aagactgaag	aaaccaaata	tatgtgttta	ctgtagcatg	tcttcaaatt	agtggaactt
3541	agttcaggga	catagaagag	tcttaatgaa	ttaaaatcat	tcacttgatt	aaatgtctgt
3601	aaatcttcat	cattcctact	gtagtttatt	taatatctat	tgtaaattat	gtgacttgta
3661	gcttcctctg	gttttcaagt	aaactcaaca	aggtggagtc	ttacctggtt	ttcctttcca
3721	agcattgtaa	attgtatacc	aaagatatta	gttattactt	ctgtgtgtac	aaagaggatt
3781	attttattat	gtttattaat	cacctctaat	actcatccac	atgaagggta	cacattaggt
3841	aagctgggcg	ttgactcatg	cgcagtctca	gtcacccgtg	ttatcttcgt	ggctcaaagg
3901	acaatgcaaa	atcgccgatc	agagctcata	cccaaagcat	tacagagaac	agcagcatca
3961	ttgccctccc	cagctgaaaa	acaagttggc	tagaagatac	atggagagga	atggtgtggt
4021	caacagttaa	tgaaacggtt	ctatcatgca	tgtgtaatgt	ggatggagac	aattataaga
4081	tttgactata	actatttgga	gggtctttaa	cattgccaaa	aaaacaaata	tgttgatttt
4141	tattttattt	tattttttat	tttaagaggc	gggatcttga	tctcacatgt	tgcccaggct
4201	ggccttgaac	tcctgggctc	aagcattcct	cctgcctcag	cctcccccat	agctgggact
4261	aggggtgcat	gccagcatac	ctggctacgt	tgactcttaa	aatctatgtt	ctcttatttt
4321	aaagatacag	tgctccccac	tgaaaattaa	acctaaaaaa	tgtcacatat	tggtatgttg
4381	ttaacctggt	agattaaatc	atgagaatga	ttagaaagac	gggcaacaca	gcgggttaca
4441	tccacactgc	tgatcacacc	aacgacagga	gctgataagc	aagaaagcgt	cacagccagc
4501	gtctgttcac	ccaaggttga	caagtgaagt	ttctctaatg	ttgattgtta	gccgatttgt
4561	aacctggcat	ttacttagca	actgccttat	caattacagg	atttgccggt	aaaagcagac
4621	tcaaatataa	aggtttttgg	cttaacttgg	tttattatag	ttgctctatg	tttgtaaaca
4681	gacaatctct	aatgtctgat	tatttgtatc	acagatctgc	agctgccttg	gacttgaatc
4741	catgcaatgt	ttagagtgtg	aagtcagtta	cttgttgatg	ttttcttact	gtatcaatga
4801	aatacatatt	gtcatgtcag	ttcttgccag	gaacttctca	acaaaatgga	attttttttt
4861	tcagtatttc	aataaatatt	gatatgccca	gcctgataat	ttttaaaaaa	aaaaaa
Sequence NP_003813
1	mssnsdtgdl	qeslkhgltp	ivsqfkmvny	sydedleelc	pvcgdkvsgy	hyglltcesc	(SEQ ID NO:_)
61	kgffkrtvqn	nkrytcienq	ncqidktqrk	rcpycrfqkc	lsvgmkleav	radrmrggrn
121	kfgpmykrdr	alkqqkkali	ranglkleam	sqviqampsd	ltissaiqni	hsaskglpln
181	haalpptdyd	rspfvtspis	mtmpphgslq	gyqtyghfps	raikseypdp	ytsspesimg
241	ysymdsyqts	spasiphlil	ellkcepdep	qvqakimayl	qqeqanrskh	eklstfglmc
301	kmadqtlfsi	vewarssiff	relkvddqmk	llqncwsell	ildhiyrqvv	hgkegsiflv
361	tgqqvdysii	asqagatlnn	lmshaqelva	klrslqfdqr	efvclkflvl	fsldvknlen
421	fqlvegvqeq	vnaalldytm	cnypqqtekf	gqlllrlpei	raismqaeey	lyykhlngdv
481	pynnllieml	hakra
Sequence NM_205860
1	aaaaagtaca	gagtccaggg	aaagacttgc	ttgtaacttt	atgaattctg	gatttttttt	(SEQ ID NO:_)
61	tttcctttgc	tttttcttaa	ctttcactaa	gggttactgt	agtctgatgt	gtccttccca
121	aggccacgaa	atttgacaag	ctgcactttt	cttttgctca	atgatttctg	ctttaagcca
181	aagaactgcc	tataatttca	ctaagaatgt	cttctaattc	agatactggg	gatttacaag
241	agtctttaaa	gcacggactt	acacctattg	gtgctgggct	tccggaccga	cacggatccc
301	ccatccccgc	ccgcggtcgc	cttgtcatgc	tgcccaaagt	ggagacggaa	gccctgggac
361	tggctcgatc	gcatggggaa	cagggccaga	tgccggaaaa	catgcaagtg	tctcaattta
421	aaatggtgaa	ttactcctat	gatgaagatc	tggaagagct	ttgtcccgtg	tgtggagata
481	aagtgtctgg	gtaccattat	gggctcctca	cctgtgaaag	ctgcaaggga	ttttttaagc
541	gaacagtcca	aaataataaa	aggtacacat	gtatagaaaa	ccagaactgc	caaattgaca
601	aaacacagag	aaagcgttgt	ccttactgtc	gttttcaaaa	atgtctaagt	gttggaatga
661	agctagaagc	tgtaagggcc	gaccgaatgc	gtggaggaag	gaataagttt	gggccaatgt
721	acaagagaga	cagggccctg	aagcaacaga	aaaaagccct	catccgagcc	aatggactta
781	agctagaagc	catgtctcag	gtgatccaag	ctatgccctc	tgacctgacc	atttcctctg
841	caattcaaaa	catccactct	gcctccaaag	gcctacctct	gaaccatgct	gccttgcctc
901	ctacagacta	tgacagaagt	ccctttgtaa	catcccccat	tagcatgaca	atgccccctc
961	acggcagcct	gcaaggttac	caaacatatg	gccactttcc	tagccgggcc	atcaagtctg
1021	agtacccaga	cccctatacc	agctcacccg	agtccataat	gggctattca	tatatggata
1081	gttaccagac	gagctctcca	gcaagcatcc	cacatctgat	actggaactt	ttgaagtgtg
1141	agccagatga	gcctcaagtc	caggctaaaa	tcatggccta	tttgcagcaa	gagcaggcta
1201	accgaagcaa	gcacgaaaag	ctgagcacct	ttgggcttat	gtgcaaaatg	gcagatcaaa
1261	ctctcttctc	cattgtcgag	tgggccagga	gtagtatctt	cttcagagaa	cttaaggttg
1321	atgaccaaat	gaagctgctt	cagaactgct	ggagtgagct	cttaatcctc	gaccacattt
1381	accgacaagt	ggtacatgga	aaggaaggat	ccatcttcct	ggttactggg	caacaagtgg
1441	actattccat	aatagcatca	caagccggag	ccaccctcaa	caacctcatg	agtcatgcac
1501	aggagttagt	ggcaaaactt	cgttctctcc	agtttgatca	acgagagttc	gtatgtctga
1561	aattcttggt	gctctttagt	ttagatgtca	aaaaccttga	aaacttccag	ctggtagaag
1621	gtgtccagga	acaagtcaat	gccgccctgc	tggactacac	aatgtgtaac	tacccgcagc
1681	agacagagaa	atttggacag	ctacttcttc	gactacccga	aatccgggcc	atcagtatgc
1741	aggctgaaga	atacctctac	tacaagcacc	tgaacgggga	tgtgccctat	aataaccttc
1801	tcattgaaat	gttgcatgcc	aaaagagcat	aagttacaac	ccctaggagc	tctgctttca
1861	aaacaaaaag	agattggggg	agtggggagg	gggaagaaga	acaggaagaa	aaaaagtact
1921	ctgaactgct	ccaagtaacg	ctaattaaaa	acttgcttta	aagatattga	atttaaaaag
1981	gcataataat	caaatactta	atagcaaata	aatgatgtat	cagggtattt	gtattgcaaa
2041	ctgtgaatca	aaggcttcac	agccccagag	gattccatat	aaaagacatt	gtaatggagt
2101	ggattgaact	cacagatgga	taccaacacg	gtcagaagaa	aaacggacag	aacggttctt
2161	gtatatttaa	actgatctcc	actatgaaga	aatttaggaa	ctaatcttat	taattaggct
2221	tatacagcgg	gggatttgag	cttacaggat	tcctccatgg	taaagctgaa	ctgaaacaat
2281	tctcaagaat	gcatcagctg	tacctacaat	agcccctccc	tcttcctttg	aaggccccag
2341	cacctctgcc	ctgtggtcac	cgaatctgta	ctaaggacct	gtgttcagcc	acacccagtg
2401	gtagctccac	caaatcatga	acagcctaat	tttgagtgtc	tgtgtcttag	acctgcaaac
2461	agctaatagg	aaattctatt	aatatgttag	cttgccattt	taaatatgtt	ctgagggttg
2521	ttttgtctcg	tgttcatgat	gttaagaaaa	tgcaggcagt	atccctcatc	ttatgtaagt
2581	gtgaattaat	attaagggaa	atgactacaa	actttcaaag	caaatgctcc	atagctaaag
2641	caacttagac	cttatttctg	ctactgttgc	tgaaatgtgg	ctttggcatt	gttggatttc
2701	ataaaaaatt	tctggcagga	agtcttgtta	gtatacatca	gtctttttca	tcatccaagt
2761	ttgtagttca	tttaaaaata	caacattaaa	cacattttgc	taggatgtca	aatagtcaca
2821	gttctaagta	gttggaaaca	aaattgacgc	atgttaatct	atgcaaagag	aaaggaaagg
2881	atgaggtgat	gtattgactc	aaggttcatt	cttgctgcaa	ttgaacatcc	tcaagagttg
2941	ggatggaaat	ggtgattttt	acatgtgtcc	tggaaagata	ttaaagtaat	tcaaatcttc
3001	cccaaagggg	aaaggaagag	agtgatactg	acctttttaa	gtcatagacc	aaagtctgct
3061	gtagaacaaa	tatgggagga	caaagaatcg	caaattcttc	aaatgactat	tatcagtatt
3121	attaacatgc	gatgccacag	gtatgaaagt	cttgccttat	ttcacaattt	taaaaggtag
3181	ctgtgcagat	gtggatcaac	atttgtttaa	aataaagtat	taatacttta	aagtcaaata
3241	agatatagtg	tttacattct	ttaggtcctg	aggggcaggg	ggatctgtga	tataacaaaa
3301	tagcaaaagc	ggtaatttcc	ttaatgttat	ttttctgatt	ggtaattatt	tttaacagta
3361	cttaattatt	ctatgtcgtg	agacactaaa	atcaaaaacg	ggaatctcat	ttagacttta
3421	atttttttga	gattatcggc	ggcacaatca	ctttgtagaa	actgtaaaaa	ataaaagtat
3481	ctcctagtcc	cttaattttt	tcataaatat	ttctggcttt	tgagtagtgt	atttatattg
3541	tatatcatac	tttcaactgt	agacaattat	gatgctaatt	tattgtttct	tggtttcacc
3601	tttgtataag	atatagccaa	gactgaagaa	accaaatata	tgtgtttact	gtagcatgtc
3661	ttcaaattag	tggaacttag	ttcagggaca	tagaagagtc	ttaatgaatt	aaaatcattc
3721	acttgattaa	atgtctgtaa	atcttcatca	ttcctactgt	agtttattta	atatctattg
3781	taaattatgt	gacttgtagc	ttcctctggt	tttcaagtaa	actcaacaag	gtggagtctt
3841	acctggtttt	cctttccaag	cattgtaaat	tgtataccaa	agatattagt	tattacttct
3901	gtgtgtacaa	agaggattat	tttattatgt	ttattaatca	cctctaatac	tcatccacat
3961	gaagggtaca	cattaggtaa	gctgggcgtt	gactcatgcg	cagtctcagt	cacccgtgtt
4021	atcttcgtgg	ctcaaaggac	aatgcaaaat	cgccgatcag	agctcatacc	caaagcatta
4081	cagagaacag	cagcatcatt	gccctcccca	gctgaaaaac	aagttggcta	gaagatacat
4141	ggagaggaat	ggtgtggtca	acagttaatg	aaacggttct	atcatgcatg	tgtaatgtgg
4201	atggagacaa	ttataagatt	tgactataac	tatttggagg	gtctttaaca	ttgccaaaaa
4261	aacaaatatg	ttgattttta	ttttatttta	ttttttattt	taagaggcgg	gatcttgatc
4321	tcacatgttg	cccaggctgg	ccttgaactc	ctgggctcaa	gcattcctcc	tgcctcagcc
4381	tcccccatag	ctgggactag	gggtgcatgc	cagcatacct	ggctacgttg	actcttaaaa
4441	tctatgttct	cttattttaa	agatacagtg	ctccccactg	aaaattaaac	ctaaaaaatg
4501	tcacatattg	gtatgttgtt	aacctggtag	attaaatcat	gagaatgatt	agaaagacgg
4561	gcaacacagc	gggttacatc	cacactgctg	atcacaccaa	cgacaggagc	tgataagcaa
4621	gaaagcgtca	cagccagcgt	ctgttcaccc	aaggttgaca	agtgaagttt	ctctaatgtt
4681	gattgttagc	cgatttgtaa	cctggcattt	acttagcaac	tgccttatca	attacaggat
4741	ttgccggtaa	aagcagactc	aaatataaag	gtttttggct	taacttggtt	tattatagtt
4801	gctctatgtt	tgtaaacaga	caatctctaa	tgtctgatta	tttgtatcac	agatctgcag
4861	ctgccttgga	cttgaatcca	tgcaatgttt	agagtgtgaa	gtcagttact	tgttgatgtt
4921	ttcttactgt	atcaatgaaa	tacatattgt	catgtcagtt	cttgccagga	acttctcaac
4981	aaaatggaat	tttttttttc	agtatttcaa	taaatattga	tatgcccagc	ctgataattt
5041	ttaaaaaaaa	aaaa
Sequence NP_995582
1	mssnsdtgdl	qeslkhgltp	igaglpdrhg	spipargrlv	mlpkveteal	glarshgeqg	(SEQ ID NO:_)
61	qmpenmqvsq	fkmvnysyde	dleelcpvcg	dkvsgyhygl	ltcesckgff	krtvqnnkry
121	tcienqncqi	dktqrkrcpy	crfqkclsvg	mkleavradr	mrggrnkfgp	mykrdralkq
181	qkkalirang	lkleamsqvi	qampsdltis	saiqnihsas	kglplnhaal	pptdydrspf
241	vtspismtmp	phgslqgyqt	yghfpsraik	seypdpytss	pesimgysym	dsyqtsspas
301	iphlilellk	cepdepqvqa	kimaylqqeq	anrskhekls	tfglmckmad	qtlfsivewa
361	rssiffrelk	vddqmkllqn	cwsellildh	iyrqvvhgke	gsiflvtgqq	vdysiiasqa
421	gatlnnlmsh	aqelvaklrs	lqfdqrefvc	lkflvlfsld	vknlenfqlv	egvqeqvnaa
481	lldytmcnyp	qqtekfgqll	lrlpeirais	mqaeeylyyk	hlngdvpynn	lliemlhakr
541	a
Sequence NM_030676
1	tgttttttcc	ccctttttct	taactttcac	taaggaaatg	agggttactg	tagtctgagg	(SEQ ID NO:_)
61	tttccttccc	aaagtcacaa	aatatgacaa	gctgcaatct	ttctcacatt	caatgatttc
121	tgctgtaagc	caaaggactg	ccaataattt	cgctaagaat	gtctgctagt	ttggatactg
181	gagattttca	agaatttctt	aagcatggac	ttacagctat	tgcgtctgca	ccagggtcag
241	agactcgcca	ctcccccaaa	cgtgaggaac	aactccggga	aaaacgtgct	gggcttccgg
301	accgacaccg	acgccccatt	cccgcccgca	gccgccttgt	catgctgccc	aaagtggaga
361	cggaagcccc	aggactggtc	cgatcgcatg	gggaacaggg	gcagatgcca	gaaaacatgc
421	aagtgtctca	atttaaaatg	gtgaattact	cctatgatga	agatctggaa	gagctatgtc
481	ctgtgtgtgg	cgataaagtg	tctgggtacc	attacggtct	cctcacgtgc	gaaagctgca
541	agggtttttt	taagcgaact	gtccaaaacc	aaaaaaggta	cacgtgcata	gagaaccaga
601	attgccaaat	tgacaaaacg	cagagaaaac	gatgtcccta	ctgtcgattc	aaaaaatgta
661	tcgatgttgg	gatgaagctg	gaagccgtaa	gagccgaccg	catgcgaggg	ggcagaaata
721	agtttgggcc	aatgtacaag	agagacaggg	ctttgaagca	gcagaagaaa	gccctcattc
781	gagccaatgg	acttaagctg	gaagccatgt	ctcaggtgat	ccaagcaatg	ccctcagacc
841	tgacctctgc	aattcagaac	attcattccg	cctccaaagg	cctacctctg	agccatgtag
901	ccttgcctcc	gacagactat	gacagaagtc	cctttgtcac	atctcccatt	agcatgacaa
961	tgccacctca	cagcagcctg	catggttacc	aaccctatgg	tcactttcct	agtcgggcca
1021	tcaagtctga	gtacccagac	ccctactcca	gctcacctga	gtcaatgatg	ggttactcct
1081	acatggatgg	ttaccagaca	aactccccgg	ccagcatccc	acacctgata	ctggaacttt
1141	tgaagtgtga	accagatgag	cctcaagttc	aagcgaagat	catggcttac	ctccagcaag
1201	agcagagtaa	ccgaaacagg	caagaaaagc	tgagcgcatt	tgggctttta	tgcaaaatgg
1261	cggaccagac	cctgttctcc	attgttgagt	gggccaggag	tagtatcttc	ttcagggaac
1321	tgaaggttga	tgaccaaatg	aagctgcttc	aaaactgctg	gagtgagctc	ttgattctcg
1381	atcacattta	ccgacaagtg	gcgcatggga	aggaagggac	aatcttcctg	gttactggag
1441	aacacgtgga	ctactccacc	atcatctcac	acacagaagt	cgcgttcaac	aacctcctga
1501	gtctcgcaca	ggagctggtg	gtgaggctcc	gttcccttca	gttcgatcag	cgggagtttg
1561	tatgtctcaa	gttcctggtg	ctgttcagct	cagatgtgaa	gaacctggag	aacctgcagc
1621	tggtggaagg	tgtccaagag	caggtgaatg	ccgccctgct	ggactacacg	gtttgcaact
1681	acccacaaca	gactgagaaa	ttcggacagc	tacttcttcg	gctacccgag	atccgggcaa
1741	tcagcaagca	ggcagaagac	tacctgtact	ataagcacgt	gaacggggat	gtgccctata
1801	ataacctcct	cattgagatg	ctgcatgcca	aaagagccta	agtccccacc	cctggaagct
1861	tgctctagga	acacagactg	gaaggagaag	aggaggacga	tgacagaaac	acaatactct
1921	gaactgctcc	aagcaatgct	aattataaac	ttggtttaaa	gacactgaat	tttaaaagca
1981	taataattaa	atacctaata	gcaaataaat	gatatatcag	ggtatttgta	ctgcaaactg
2041	tgaatcaaag	gctgtatgaa	tcaaaggatt	catatgaaag	acattgtaat	ggggtggatt
2101	gaacttacag	atggagacca	ataccacagc	agaataaaaa	tggacagaac	aatccttgta
2161	tatttaaact	aatctgctat	taagaaattc	agaagttgat	ctctgttatt	aattggattt
2221	gtcctgaatt	actccgtggt	gacgctgaac	aactcaagaa	tacatgggct	gtgcttggca
2281	gcccctcccc	atccctccca	acaccaccac	ccccaccccc	acaaggccct	ataccttctg
2341	acctgtgagc	cctgaagcta	ttttaaggac	ttctgttcag	ccatacccag	tagtagctcc
2401	actaaaccat	gatttctgga	tgtctgtgtc	ttagacctgc	caacagctaa	taagaacaat
2461	gtataaatat	gtcagcttgc	attttaaata	tgtgctgaag	tttgttttgt	cgtgtgttcg
2521	taattaaaaa	gaaaacgggc	agtaaccctc	ttctatataa	gcattagtta	atattaaggg
2581	aaatcaaaca	aatctaagcc	aatactccca	acaagcaagt	tagatcttac	ttctgctgct
2641	gttgctgaaa	tgtggctttg	gcatggttgg	gtttcataaa	actttttggc	caagaggctt
2701	gttagtatac	atccatctgt	ttagtcatca	aggtttgtag	ttcacttaaa	aaaaaataaa
2761	ccactagaca	tcttttgctg	aatgtcaaat	agtcacagtc	taagtagcca	aaaagtcaaa
2821	gcgtgttaaa	cattgccaaa	tgaaggaaag	ggtgagctgc	aaaggggatg	gttcgaggtt
2881	cattccagtt	gtgacccgag	cgtccccaaa	acctgggatg	caaagacagt	gattctgcat
2941	atggcctgga	aagacaggaa	agccagtctc	ctacaaaggg	gaatggaaga	tcctggcctc
3001	taagtcatag	accaaagtct	gctgtag

Claims

1. A method for identifying compounds that bind to the ligand binding domain of SF-1 or LRH-1, comprising: contacting a SF-1 or LRH-1 ligand binding domain polypeptide with a test compound; and determining whether said test compound binds to said SF-1 or LRH-1 ligand binding domain polypeptide, thereby identifying test compounds that bind to the ligand binding domain of SF-1 or LRH-1.

2. The method of claim 1, further comprising determining whether said compound binds in a ligand binding pocket.

3. The method of claim 1, further comprising determining whether said compound binds to a co-activator binding surface.

4. The method of claim 1, further comprising determining whether said compound modulates SF-1 or LRH-1.

5. A method for designing a ligand that binds to SF-1 or LRH-1, comprising: identifying as one or more molecular scaffolds one or more compounds that bind to a binding site of SF-1 or LRH-1 ligand binding domain polypeptide with low affinity; determining the orientation of the one or more molecular scaffolds at the binding site of the polypeptide by obtaining co-crystal structures of the one or more molecular scaffolds in the binding site; and modifying one or more structures of at least one scaffold molecule so as to provide a ligand having altered binding affinity or binding specificity or both for binding to the polypeptide as compared to the binding of the scaffold molecule.

6. The method of claim 5, further comprising synthesizing said ligand.

7. The method of claim 5, wherein said one or more molecular scaffolds interact with at least 3 conserved amino acid residues in a binding pocket of said ligand binding domain.

8. The method of claim 5, wherein said one or more molecular scaffolds interact with at least 3 residues with which a phospholipid ligand interacts.

9. A method for identifying interaction properties of a SF-1 or LRH-1 binding compound, comprising: identifying at least one conserved interacting amino acid residue in SF-1 or LRH-1 that interacts with said SF-1 or LRH-1 binding compound and at least one other SF-1 or LRH-1 binding compound; and identifying at least one common interaction property of said binding compound with said conserved residues.

10. The method of claim 9, wherein said interaction property includes an interaction selected from the group consisting of hydrophobic interaction, charge-charge interaction, hydrogen bonding, charge-polar interaction, and polar-polar interaction.

11. A method for developing altered modulators for SF-1 or LRH-1, comprising: selecting a molecular scaffold from a set of at least 3 molecular scaffolds that bind to SF-1 or LRH-1; and modifying one or more structures of said scaffold molecule so as to provide a ligand having altered binding affinity or binding specificity or both for binding to the SF-1 or LRH-1 as compared to the binding of said molecular scaffold.

12. A method of identifying a modulator of a SF-1 or LRH-1 ligand binding domain polypeptide, comprising: designing or selecting a compound that interacts with amino acid residues in a ligand binding site of said SF-1 or LRH-1 ligand binding domain polypeptide, based upon a crystal structure of said ligand binding domain polypeptide, so as to provide said modulator.

13. The method of claim 12, wherein said crystal structure is a structure of SF-1 or LRH-1 ligand binding domain in complex with one or more of a ligand and a coactivator polypeptide.

14. The method of claim 12, further comprising synthesizing said modulator.

15. The method of claim 12, further comprising determining whether said compound modulates the activity of the SF-1 or LRH-1 polypeptide.

16. The method of claim 12, wherein said amino acid residues are conserved residues.

17. The method of claim 12, wherein said amino acid residues interact with a phospholipid ligand.

18. A method for designing a modulator that modulates the activity of a SF-1 or LRH-1, comprising: evaluating the three-dimensional structure of crystallized SF-1 or LRH-1 ligand binding domain polypeptide complexed with one or more of a ligand and a coactivator polypeptide; and synthesizing or selecting a compound based on the three-dimensional structure of said crystal complex that will bind to the SF-1 or LRH-1 ligand binding domain polypeptide.

19. The method of claim 18, further comprising determining whether said compound modulates the activity of SF-1 or LRH-1.

20. A protein crystal, comprising substantially pure SF-1 ligand binding domain polypeptide.

21. The crystal of claim 20, further comprising a ligand.

22. The crystal of claim 21, wherein said ligand is a phospholipid ligand.

23. A protein crystal, comprising substantially pure LRH-1 ligand binding domain polypeptide.

24. The crystal of claim 23, further comprising a ligand.

25. The crystal of claim 24, wherein said ligand is a phospholipid ligand.

26. A method for determining the three-dimensional structure of a crystallized SF-1 or LRH-1 ligand binding domain polypeptide in complex with one or more of a ligand and a coactivator polypeptide, comprising: crystallizing substantially pure SF-1 or LRH-1 ligand binding domain polypeptide in complex with one or more of a ligand and a coactivator polypeptide to form a crystallized complex; and analyzing the crystallized complex to determine the three-dimensional structure of the SF-1 or LRH-1 ligand binding domain polypeptide in complex with one or more of a ligand and a coactivator polypeptide.

27. The method of claim 26, wherein said ligand is a phospholipid ligand.

28. A method of treating a SF-1 or LRH-1 mediated disease or condition in a mammal, comprising: administering to said mammal a therapeutically effective amount of a SF-1 or LRH-1 modulator designed according to the method of claim 5, a prodrug of such modulator, or a pharmaceutically acceptable salt of such modulator or prodrug.

29. The method of claim 28, wherein said disease or condition is elevated cholesterol.

30. The method of claim 28, wherein said disease or condition is cancer.

31. The method of claim 28, wherein said disease or condition is hepatitis B virus infection.

32. The method of claim 28, wherein said disease or condition is a developmental defect or risk therof.

33. A method for identifying structurally and energetically allowed sites on a binding compound for attachment of an additional component, comprising: analyzing the orientation of the binding compound in a SF-1 or LRH-1 binding site, thereby identifying accessible sites on the compound for attachment of the additional component.

34. The method of claim 33, further comprising calculating the change in binding energy on attachment of the additional component at one or more of the accessible sites.

35. The method of claim 33, wherein the orientation is determined by co-crystallography.

36. The method of claim 33, wherein said additional component includes a linker.

37. The method of claim 33, wherein said additional component includes a label.

38. The method of claim 33, wherein said additional component includes a solid phase material.

39. A method for attaching a SF-1 or LRH-1 binding compound to an attachment component without substantially altering the ability of said SF-1 or LRH-1 binding compound to bind SF-1 or LRH-1, comprising: identifying energetically allowed sites for attachment of said attachment component on the binding compound; and attaching the binding compound or derivative thereof to the attachment component at the energetically allowed site.

40. A method for making an affinity matrix for SF-1 or LRH-1, comprising: identifying energetically allowed sites on a SF-1 or LRH-1 binding compound for attachment to a solid phase matrix without substantially altering the ability of said SF-1 or LRH-1 binding compound to bind SF-1 or LRH-1; and attaching said binding compound to said solid phase matrix through the energetically allowed site.

41. A modified SF-1 ligand binding domain, comprising a SF-1 ligand binding domain polypeptide modified by subsitution of surface cysteines, C247 or C412 or both.

42. The modified SF-1 ligand binding of claim 41 domain wherein said substitutions are substitution by serine residues.