Patent Grant
8168203
The present invention relates to novel protein antigens of Shigella spp., and also present on Escherichia coli enteroinvasive strains and methods for use of these antigens for developing vaccines against shigellosis caused by Shigella species and serotypes, and against disease caused by enteroinvasive E. coli (EIEC) bacteria. The invention also relates to use of the novel antigens and corresponding antibodies for diagnosis of shigellosis and for identification of Shigella bacteria.
Shigella spp. is a Gram-negative bacterial pathogen that causes bacillary dysentery in humans by infecting epithelial cells of the colon. Shigella primarily infects intestinal epithelial cells (IECs). Shigella expresses several proteins that provide a mechanism for delivering effectors that induce bacterial uptake into the host cell via phagocytosis. To accomplish the injection of the effectors, Shigella use a type III secretion (TTS) system to induce their entry into epithelial cells and to trigger apoptosis in infected macrophages.
Bacteria of Shigella spp., including S. dysenteriae, S. flexneri, S. boydii and S. sonnei, are responsible for shigellosis in humans, a disease characterized by the destruction of the colonic epithelium that is responsible for 1 million deaths per year, mostly children in developing countries.
There are 15 serotypes in S. dysenteriae, 14 serotypes and subtypes are recognized in S. flexneri, S. boydii has 20 serotypes and a single serotype exist within S. sonnei although their prevalence is not evenly distributed. The most prevalent Shigella spp. in industrialized countries and of increasing prevalence in some Latin American countries is S. sonnei. S. dysenteriae type 1, which can produce Shiga-toxin, can cause high morbidity and mortality. S. flexneri is most prevalent in endemic region of developing countries. The World Health Organization (WHO) considered the development of a vaccine against shigellosis a priority for developing countries.
Although control and treatment of shigellosis outbreaks with antibiotics is possible, the high cost of antibiotics and the constant emergence of antibiotic resistant Shigella species, even to the newest antibiotics, underscores the need for an effective vaccine to help control Shigella and related enteroinvasive E. coli diseases in the developing regions of the world (12).
To establish a successful infection, Shigella finely regulates the host's immune response, especially those responses leading to inflammation. In contrast to Salmonella typhimurium, Shigella is inefficient at invading the apical pole of polarized intestinal epithelial cells. Instead, Shigella requires transmigration of polymorphonuclear leucocytes (PMN) to disrupt the epithelial barrier, facilitating cell invasion via the basolateral pole of epithelial cells (26). The host's inflammatory response, facilitated by cells of the innate immune system, attracts PMN to the site of inflammation. Therefore, triggering inflammation at the early stage of infection is required for cell invasion by Shigella. Bacteria that reach the intracellular compartment of the cells grow and spread from cell to cell, protected from host immune defenses. But, infected epithelial cells playa large role in the inflammatory process, both as sentinels that detect bacterial invasion and as a major source of mediators, particularly cytokines and chemokines that initiate and orchestrate mucosal inflammation. Recognition of the bacteria by the epithelial cells occurs essentially intracellularly via a cytoplasmic molecule, Nod1/CARD4 that senses a microbial motif, the peptidoglycan (8). Nod1 activation induces other proinflammatory signaling pathways including NF-κ3 and c-Jun N-terminal kinase (JNK) that lead to the expression of chemokines, such as interleukin 8 (IL-8). Thus triggering excessive inflammation is detrimental to Shigella's survival in the host.
Natural Shigella infections confer immunity and provide protection against subsequent infection with homologous virulent Shigella (5). This exclusively human disease is transmitted directly via the fecal-oral route from an infected patient or indirectly through contaminated food and water. It is a highly contagious infection, capable of transmission with as few as 100 microorganisms (6). Epidemiologic and volunteer studies have revealed that protective immunity against Shigella is directed against the LPS or O-specific antigen and is therefore related to serotype. Many approaches have been used for Shigella vaccines including use of live attenuated Shigella (16, 22), killed Shigella whole bacteria (18), and Shigella lipopolyssacharide (LPS) or O-polysaccharides conjugated to carriers such as proteosomes (24), tetanus toxoid (25) and ribosomes (31). Despite many years of extensive research, an effective and inexpensive vaccine against these Shigella species is not yet available.
The use of attenuated strains of Shigella as live oral vaccines has been demonstrated to induce protective efficacy. Results from the clinical trials of genetically well characterized, invasive Shigella vaccines are promising. CVD1208, SC602, WRSS1 add WRSd1 vaccine candidates, administered orally, are safe and immunogenic in volunteer trials and, in the case of SC602, have been demonstrated to protect against dysentery (11, 16, 17, 33). Clinical trials with CVD1208 demonstrated that the symptoms of mild fever and diarrhea, which are seen with some of the live Shigella vaccines, can be reduced by elimination of the sen and set genes from the vaccine strain. Duplication of a successful strategy in one serotype to other serotypes is an ongoing area of research but will eventually require use of a polyvalent mixture of Shigella strains of different serotypes that can protect against most of the Shigella (21). A recent multi centre study of Shigella diarrhoea in six Asian countries indicated that the relative distribution of Shigella species isolated from patients varied from different countries and sites. Moreover, S. flexneri serotypes were highly heterogeneous in their distribution from site to site, and even from year to year. The heterogeneous distribution of Shigella species and serotypes suggest that multivalent or cross-protective Shigella vaccines will be needed to prevent shigellosis worldwide (35). A vaccine that aims to confer broad-spectrum coverage would require inclusion of all of the important Shigella serotypes (21). To resolve this dilemma a vaccine strategy based on the use of ‘pentavalent formulations’, comprising S. flexneri 2a, 3a and 6 strains along with the attenuated S. sonnei and S. dysenteriae 1 strains has been advocated (Noriega et al., 1994). Alternatively, use of complex structures comprised of serotype-specific and cross-reactive antigens from Shigella, such as whole bacteria either killed or live-attenuated, could be considered as an approach to vaccinate against infections caused by the most common species and serotypes of Shigella. Intranasally administered Invaplex, a purified complex from Shigella water extract composed of the Ipa proteins and LPS, has been proposed and is in Phase 1 trials currently at the Walter Reed Army Institute of Research (WRAIR) (23).
There is thus a need for an effective vaccine to help control Shigella and related enteroinvasive E. coli diseases in the developing regions of the world.
In certain embodiments, the invention relates to a vaccine composition for immunizing a mammal against Shigella comprising an amount of a Shigella protein from the group consisting of IcsP2 and SigA2 proteins effective to elicit an immune response against Shigella, and a pharmaceutically acceptable carrier or diluent. In certain embodiments, the Shigella IcsP2 and SigA2 proteins are chemically conjugated or genetically fused with other proteins.
In additional embodiments, the invention relates to a vaccine composition for immunizing a mammal against Shigella comprising an amount of Shigella IcsP2 effective to elicit an immune response against Shigella, and a pharmaceutically acceptable carrier or diluent.
In yet additional embodiments, the invention relates to a vaccine composition for immunizing a mammal against Shigella comprising an amount of Shigella SigA2 effective to elicit an immune response against Shigella, and a pharmaceutically acceptable carrier or diluent.
In yet additional embodiments, the invention relates to a vaccine composition for immunizing a mammal against Shigella comprising an amount of chemically conjugated or genetically fused IcsP2 and SigA2.
In certain embodiments, the vaccine composition further comprises an adjuvant.
In certain embodiments, the adjuvant is an oil phase of an emulsion selected from a group consisting of a water-in-oil emulsion and a double oil emulsion.
In additional embodiments, the invention relates to an isolated polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:2 (for Shigella IcsP2).
In additional embodiments, the invention relates to an isolated polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 4 (for SigA2).
In additional embodiments, the invention relates to a an isolated nucleic acid sequence encoding the Shigella IcsP2 polypeptide.
In additional embodiments, the invention relates to an isolated nucleic acid sequence encoding the SigA2 polypeptide.
In additional embodiments, the invention relates to an isolated nucleic acid sequence encoding the Shigella IcsP2 polypeptide and the SigA2 polypeptide.
In additional embodiments, the invention relates to a vector comprising the nucleic acid sequence encoding the Shigella IcsP2 polypeptide or the SigA2 polypeptide. In additional embodiments, the invention relates to a host cell transfected with any of the vectors described herein.
In additional embodiments, the invention relates to a method for producing Shigella IcsP2 and SigA2 polypeptides comprising culturing any of the host cells described herein under suitable conditions for protein expression and collecting said polypeptides from the cultured cells.
In additional embodiments, the invention relates to an immunogenic composition comprising a) Shigella IcsP2 and SigA2, and b) an adjuvant, wherein the amounts of a) and b) in combination are effective to elicit an immune response against Shigella.
In additional embodiments, the invention relates to a method of treating a mammal suffering from or susceptible to a pathogenic infection, comprising administering an effective amount of the vaccine composition described herein. In certain embodiments, the effective amount of the vaccine composition ranges between about 10 micrograms to about 2 milligrams
In additional embodiments, the invention relates to a method for modulating the immune response of a mammal comprising administering an effective amount of any one of the vaccine compositions described herein. In certain embodiments, the effective amount of the vaccine composition is from about 10 micrograms to about 2 milligrams.
In additional embodiments, the invention relates to an antibody that specifically binds to the Shigella IcsP2 polypeptide.
In additional embodiments, the invention relates to an antibody that specifically binds to the SigA2 polypeptide. In certain embodiments, the antibody further comprises a label. In additional embodiments, the label is selected from the group consisting of an enzyme, protein, peptide, antigen, antibody, lectin, carbohydrate, biotin, avidin, radioisotope, toxin and heavy metal. In additional embodiments, the antibody is a humanized antibody. In additional embodiments, the antibody is a CDR-grafted antibody. In additional embodiments, the antibody is a chimeric antibody. In additional embodiments, the antibody is an antibody fragment. In additional embodiments, the antibody is a monoclonal antibody. In additional embodiments, the antibody is a polyclonal antibody.
In additional embodiments, the invention relates to a conjugate molecule comprising a saccharide comprising an O antigen of Shigella bacteria covalently bound to a Shigella IcsP2 or SigA2 protein.
In additional embodiments, the invention relates to a conjugate molecule comprising a saccharide comprising an O antigen of Shigella bacteria covalently bound to a polypeptide as described herein.
In additional embodiments, the invention relates to a vaccine comprising a conjugate molecule as described herein for immunizing a mammal against shigellosis.
In additional embodiments, the invention relates to a conjugate molecule comprising a saccharide from a bacteria non related to the genus Shigella, said saccharide being covalently bound to a Shigella IcsP2 or SigA2 protein.
In additional embodiments, the invention relates to a conjugate molecule comprising a saccharide from a bacteria non related to the genus Shigella, said saccharide being covalently bound to a polypeptide as described herein.
In additional embodiments, the invention relates to a vaccine comprising a conjugate molecule as described herein for immunizing a mammal against shigellosis and typhoid disease.
The present invention relates to the identification of IcsP and SigA as candidate protein antigens in the composition of vaccines against Shigella infections. More specifically, the present invention relates to specific polypeptide moieties or fragments of Shigella IcsP and SigA, capable of inducing protective immune responses against infection caused by virulent Shigella bacteria. Said specific polypeptides are referred to hereafter to as IcsP2 and SigA2, respectively. IcsP2 is common to all Shigella spp. and is also present on EIEC. SigA2 is present on strains of S. flexneri 2a and of S. boydii and S. sonnei.
The present invention relates to protein antigens IcsP and SigA identified as surface-associated and/or secreted from Shigella that are common to Shigella types and species including S. flexneri, S. sonnei, S. boydii and S. dysenteriae and which can protect against shigellosis and other enteric infections when administered as vaccines. In addition, the present invention relates to certain of such antigens that are also common between Shigella species and EIEC. The invention also relates to the use of antibodies raised against these antigens and of DNA probes for use in the diagnosis of Shigella and EIEC infections.
Antigen Identification and Characteristics of the Antigens
The whole genome sequences of Shigella spp., S. flexneri 2a strains 2457T (37) and Sf301 (15), S. flexneri 5b strain Sf8401 (20), s. dysenteriae 1, strain Sd197, S. boydii serotype 4, strain Sb227 and S. sonnei strain Ss046 are available (38, 39). Besides the whole genome sequences of those Shigella strains, the complete nucleotide sequences of the virulence plasmid from a number of Shigella spp. are also available (3, 14).
IcsP
Shigella movement within the host cell cytoplasm is dependent on the ability of the bacterium to recruit host cell actin to its surface to form an actin tail, which propels the bacterium from one cell to another (2). Actin tail assembly is mediated by a single bacterial protein IcsA, which is found on the outer surface at one pole of the bacterium, that pole at which actin assembly occurs (27). The IcsA protein is localized to the old pole of the bacterium and is both necessary and sufficient for actin assembly (9). The icsA gene is located on the Shigella virulence plasmid, and since it is essential for the movement of the bacteria, it is present among all the serotypes and species (38). The IcsA protein is comprised of two domains: the α-domain (residues 53 to 758) contains the determinant for actin assembly and extends from the bacterial surface into the extracellular environment, whereas the β-domain (residues 759 to 1102) is embedded in the outer membrane (32).
IcsA is slowly cleaved from the bacterial surface by the outer membrane protease IcsP (7). IcsP is encoded by a monocistronic operon on the large (230-kb) virulence plasmid of Shigella (3). Absence of IcsP leads to an alteration in the distribution of surface IcsA, such that the polar cap is maintained and some IcsA is distributed along the lateral walls of the bacterium. The amino acid sequence of 327 a.a polypeptide has 58% sequence identity to each of E. coli proteases OmpP and OmpT, 42% sequence identity to the Salmonella typhimurium protease E precursor, PrtA and 40% sequence identity to the Yersinia pestis fibrinolysin precursor Pla (29).
SigA
The sigA gene is situated on the pathogenicity island of Shigella flexneri 2a chromosomal DNA. Although sigA was believed to be exclusively found in serotype 2a of S. flexneri, the presence of sigA has also been reported in S. boydii and S. sonnei (38). Sequence analysis indicates that sigA encodes a 139 kDa protein which belongs to the SPATE (serine protease autotransporters of Enterobacteriaceae) subfamily of autotransporter proteins (1). Amino acid identity of SigA protein as compared to enteroaggregative E. coli autotransporter Pet, an enterotoxic and cytopathic protease, is 58% (1). SigA mutant bacteria shows reduced fluid accumulation as compared to the wild type Shigella, however, the mutant bacteria still is capable of inducing substantial fluid accumulation, which implies that SigA is only one of a number of enterotoxins produced by S. flexneri 2a.
Identification of novel antigens common to most, if not all, species and serotypes of Shigella would be ideal provided that such antigens are indeed protective. Genomics and proteomics have had a dramatic effect on the ability to find new vaccine targets and develop effective vaccines and some Shigella surface proteins are recognized as possible vaccine candidates for Shigellosis (13, 19, 36).
The present invention also relates to the cloning, expression and purification of Shigella proteins of interest. The purified proteins were used to immunize and evaluate protective immunity in three animal models 1) mouse pneumonia model, 2) guinea pig keratoconjunctivitis model, and 3) guinea pig colitis model (such models are described in 10, 28, 30).
In certain embodiments, the invention provides methods for screening common protein antigens of Shigella spp and the methods used in this invention may be applied to screening of protein antigens of mucosal pathogens.
In certain embodiments, the invention provides methods for producing specific antibodies to said Shigella IcsP2 and SigA2 polypeptides and for preparing corresponding DNA probes specific for said common antigens. Such antibodies and DNA probes can be used for detection of bacteria expressing said common antigens or corresponding genes, for the diagnosis of bacillary dysentery caused by Shigella and EIEC. Therapeutic antibodies can also be used to treat patients suffering from acute bacillary dysentery caused by bacteria expressing the corresponding protein antigens.
Diagnosis of Bacillary Dysentery
Aside from Shigella ssp, certain strains of Escherichia coli can cause dysentery. Currently, there are four recognized classes of enterovirulent E. coli (collectively referred to as the EEC group) that cause gastroenteritis in humans. E. coli is part of the normal intestinal flora of humans and other primates. A minority of E. coli strains are capable of causing human illness by several different mechanisms. Among these are the enteroinvasive (EIEC) strains. It is unknown what foods may harbor these pathogenic enteroinvasive (EIEC) strains responsible for a form of bacillary dysentery. Enteroinvasive E. coli (EIEC) may produce an illness known as bacillary dysentery. The EIEC strains responsible for this syndrome are closely related to Shigella ssp. Following the ingestion of EIEC, the organisms invade the epithelial cells of the intestine, resulting in a mild form of dysentery, often mistaken for dysentery caused by Shigella species. The illness is characterized by the appearance of blood and mucus in the stools of infected individuals. The diagnosis of Shigella and EIEC infection is relatively difficult since the bacteria must be isolated from stools and the infectious dose of Shigella and EIEC is thought to be as few as 10 to 100 organisms.
The culturing of the organism from the stools of infected individuals and the demonstration of invasiveness of isolates in tissue culture or in a suitable animal model is necessary to diagnose dysentery caused by this organism. However, such an approach is cumbersome and time-consuming.
Echeverria P. et al. describe that “( . . . ) the four Shigella species (S. dysenteriae, S. flexneri, S. boydii, and S. sonnei) are classically identified by culture of fecal specimens on selective media and testing of isolates for agglutination by species-specific antisera. DNA probes have been used to identify both lactose-fermenting and non-lactose-fermenting EIEC as well as Shigella isolates that do not agglutinate in antisera. These DNA probes are not necessary for the identification of Shigella if a competent bacteriology laboratory with Shigella antisera is available. The clinical illness associated with EIEC infections is similar to shigellosis. Fewer children with EIEC infections than with shigellosis, however, have occult blood in stool (36% vs. 82%) and more than 10 fecal leukocytes per high-power field (36% vs. 67%). Standard bacteriologic methods and testing of E. coli isolates for hybridization with the Shigella/EIEC probe are currently the most sensitive means of diagnosing infections caused by these enteric pathogens. A more rapid method of identifying Shigella and EIEC infections in a situation where a bacteriology laboratory is not available involves immunological assays” (40), Rev. Infect. Dis. 1991 March-April; 13 Supp 14:S220-5).
The present invention relates in part to the finding that IcsP2 is also expressed by EIEC and its sequence is highly homologous to that of Shigella IcsP2, but not to genes of the other 3 classes of enterovirulent E. coli (EEC). Consequently, an aspect of the present invention relates to IcsP2 as a protective agent against EIEC as well as DNA probes and specific antibodies to Shigella IcsP2 that can be used to diagnose dysentery caused by both Shigella and EIEC.
In one embodiment, the Shigella polypeptide antigens disclosed in the present invention are administered with a pharmaceutically acceptable diluent. Such formulations can be administered by an injection (subcutaneous, intradermal, intramuscular) or applied topically onto the skin using an adhesive patch. Alternatively, the vaccine is administered by a mucosal route (oral, buccal, sublingual, nasal drops, aerosol, rectal) using a pharmaceutically acceptable vehicle. The antigens can also be mixed with an adjuvant to enhance the ensuing immune responses. Example of such adjuvants are without being limited to, aluminium salts, ISCOMs, saponin-based adjuvants, oil-in-water and water-in-oil emulsions, toll-like receptor ligands such as muramyl dipeptide, E. coli LPS, oligonucleotides comprised of unmethylated DNA, poly I:C, lipoteichoic acid, peptidoglycan. Enterotoxins and their adjuvant active derivatives such as cholera toxin, heat-labile E. coli enterotoxin, pertussis toxin, shiga toxin and analogs.
In a further embodiment of the invention the antigens disclosed are cloned and expressed in non virulent or in an attenuated bacteria and the later are used as vectors containing a DNA promoter element capable of initiating the synthesis of mRNA operably linked to an open reading frame containing one or both of the genes encoding Shigella IcsP and SigA. The resultant protein(s) is(are) exported and assembled on the bacterial surface and/or periplasm. Such non virulent or attenuated bacteria can then be used as oral or mucosal vaccine. Examples of bacterial vectors are known in the art, such as E. coli, Salmonella spp., Shigella spp., Vibrio cholera, Bacillus spp, Clostridium spp, Listerium monocytogenes, Mycobacterium spp., Lactobacillus spp., Lactococcus spp., Streptococcus gordonii. In another embodiment, the IcsP and the SigA antigens are being overexpressed in non virulent strains or mutant strains of Shigella that have been equipped with a suitable promoter. Such bacteria expressing either IcsP or SigA antigens or both can then be used as live vaccines against shigellosis. Alternatively, such overexpressing strains can be inactivated with formalin or by heating and the resulting bacteria can be used as killed vaccines. Further embodiments of the invention are vectors used to transform Shigella species which results in the periplasmic expression of heterologous antigens. This expression is not likely to alter either Shigella's natural tissue tropism (colonic epithelium) following oral administration or significantly reduce strain invasiveness. Suitable Shigella species include live, attenuated vaccine strains of S. sonnei, S. dysenteriae, S. flexneri, and S. boydii. Exemplified transformed Shigella strains include Shigella vaccine strain, e.g. Shigella flexneri 2a (SC608 (3098)), Shigella flexneri 2a (SC608 (cfaAE)), Shigella flexneri 2a (SC608 (pCFAI)) and Shigella flexneri 2a (SC608 (pCFAI/LTB)). These strains are characterized as having deletions in icsA, a gene that enables intracellular and intercellular spread of Shigella in host epithelial cells and in the gene iucA that plays a role in iron acquisition by the bacteria. These transformed Shigella strains are suitable for use in immunogenic composition, in particular oral or mucosally administered vaccines. Other bacteria have been described and are well known in the art for use as vector systems:
The vectors that are used to introduce IcsP and/or SigA polypeptides into mammalian cells, tissues, organs or organisms also comprise attenuated viruses equipped with a suitable promoter element that control expression of the trans genes encoding IcsP and/or SigA can be prepared and used to produce IcsP and/or SigA. Examples of viral vectors that can be used to express IcsP and/or SigA include without being limited to adenoviruses, polioviruses, a sindbis virus vector, Semliki Forrest virus, a poxvirus, a papilloma virus, a retrovirus or a lentivirus. Additional vectors used to express IcsP and/or SigA include virus-like particles (VLP) and bacteriophages.
Additionally, IcsP and SigA can be incorporated into a recombinant expression vector comprising a selection gene, a yeast sequence, and a polynucleotide encoding IcsP and/or SigA, wherein said polynucleotide is operably linked to a yeast promoter and said vector is being used to transfect yeast cells which produce IcsP and/or SigA polypeptides of the present invention. The recombinant expression vectors of the invention can be designed for expression of the proteins of the invention in yeast cells. Methods of expressing proteins in yeast, such as Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, and Kluyveromyces lactis, are well-known in the art.
The present invention also relates to the use of reagents specific for the IcsP and SigA genes and the IcsP2 and SigA2 polypeptides in the design of diagnostic tests.
In a further embodiment of the invention the antigens disclosed are cloned and expressed in non virulent or in an attenuated bacteria and the later are used as vectors containing a DNA promoter element capable of initiating the synthesis of mRNA operably linked to an open reading frame containing one or both of the genes encoding Shigella IcsP and SigA. The resultant protein(s) is(are) exported and assembled on the bacterial surface and/or periplasm. Such non virulent or attenuated bacteria can then be used as oral or mucosal vaccine. In another embodiment, the IcsP and the SigA antigens are being overexpressed in non virulent strains or mutant strains of Shigella that have been equipped with a suitable promoter. Such bacteria expressing either IcsP or SigA antigens or both can then be used as live vaccines against shigellosis. Alternatively, such overexpressing strains can be inactivated with formalin or by heating and the resulting bacteria can be used as killed vaccines. Further embodiments of the invention are vectors used to transform Shigella species which results in the periplasmic expression of heterologous antigens. This expression is not likely to alter either Shigella's natural tissue tropism (colonic epithelium) following oral administration or significantly reduce strain invasiveness. Suitable Shigella species include live, attenuated vaccine strains of S. sonnei, S. dysenteriae, S. flexneri, and S. boydii. Exemplified transformed Shigella strains include Shigella vaccine strain, e.g. Shigella flexneri 2a (SC608 (3098)), Shigella flexneri 2a (SC608 (cfaAE)), Shigella flexneri 2a (SC608 (pCFAI)) and Shigella flexneri 2a (SC608 (pCFAI/LTB)). These strains are characterized as having deletions in icsA, a gene that enables intracellular and intercellular spread of Shigella in host epithelial cells and in the gene iucA that plays a role in iron acquisition by the bacteria. These transformed Shigella strains are suitable for use in immunogenic composition, in particular oral or mucosally administered vaccines. Other bacteria have been described and are well known in the art for use as vector systems:
The present invention also relates to the use of reagents specific for the IcsP and SigA genes and the IcsP2 and SigA2 polypeptides in the design of diagnostic tests.
The technique of gene amplification referred to as polymerase chain reaction (PCR) is well known in the art and has been used for the diagnosis of Shigella infections (41). The present invention discloses specific primers capable of binding to the IcsP2 and the SigA2 gene sequences. Such primers can be used to amplify either icsP or sigA genes from bacteria present in a clinical sample (e.g. stool) and the amplified fragment can be detected by visual, photometric, isotopic or fluorometric methods. Thus, the present invention claims the use of oligonucleotide primers specific for said IcsP2 and SigA2 gene sequences in the diagnosis of dysentery caused by Shigella spp and EIEC.
The present invention also relates to the production of antisera against SigA2 and IcsP2. Such antisera were capable of reacting with corresponding polypeptides expressed by different species of Shigella. Further, such antisera were capable of inhibiting in vitro infection of HeLa cells by Shigella bacteria and of protecting animals against inflammation caused by Shigella, in a keratoconjunctivitis model.
The present invention also relates to conjugates of IscP2 and an O polysaccharide antigen of Shigella and conjugates of the SigA2 and of O polysaccharide antigen of Shigella. The O-specific polysaccharides on the surface of pathogenic bacteria are thought to be both protective antigens and essential virulence factors. The inability of most polysaccharides to elicit protective levels of anti-polysaccharide antibodies in infants and adults with weakened immune systems could be overcome by their covalent attachment to proteins that conferred T-cell dependent properties. This principle led to the construction of vaccines against Haemophilus influenzae b (Hib), pneumococcal pneumonia, and Neisseria meningitidis. Extension of the conjugate technology to the O-specific polysaccharides of Gram-negative bacteria provided a new generation of glycoconjugate vaccines. Originally, Avery and Goebel in J. Exp. Med. 50:531 (1929) and Goebel in J. Exp. Med. 50:469-520 (1929) showed that the immunogenicity of pneumococcus type 3 polysaccharide could be increased by binding it chemically to a carrier protein. This principle has been applied successfully to increase the immunogenicity of polysaccharides of other pathogens. Methods to couple covalently polysaccharides to protein carriers are known in the art and include the following:
In another embodiment, the invention relates to conjugates wherein Shigella O polysaccharide is coupled through a spacer to either IcsP or SigA to enhance antigenicity and immunogenicity of the polysaccharide and the conjugate is used to induce an immune response to both the protein and the polysaccharide.
In yet another embodiment, the Shigella IcsP and SigA proteins can be chemically conjugated or are the products of genetic fusion with other proteins for use as immunogens in, for example, vaccines. Such proteins include tetanus toxoid, diptheria toxoid, cholera toxin B subunit, E. coli enterotoxin B subunit, and flagellin. These proteins are well known in the art and have been extensively used for these purposes in the industry and/or research as set forth in the following publications:
In yet another embodiment, the invention relates to conjugates wherein the polysaccharide of another enteropathogenic bacteria such as Salmonella typhi Vi polysaccharide or Salmonella paratyphi is covalently coupled through a spacer to either IcsP or SigA, and the conjugate is used to induce an immune response to both the protein and the polysaccharide and thus to vaccinate against both shigellosis and typhoid (or paratyphoid) disease.
The present invention also provides methods to produce anti-Shigella IcsP2 and SigA2 antibodies in animals and recombinant polypeptides for use in diagnostic methods for detecting Shigella in patients known or suspected of having shigellosis. Such antibodies present in the sera of immunized mice and guinea pigs can also be produced in other animal species, such as horse, goat, rabbit, monkey, cattle, donkey, hamster. Molecular biology and antibody technology, such as that involving the use of hybridomas, has made available to researchers and clinicians sources of highly specific and potent monoclonal antibodies useful in general diagnostic and clinical procedures. Such monoclonal antibodies can be obtained by standard fusion of immune cells from an animal immunized with either IcsP2 or SigA2 with appropriate myeloma cells. More specifically, nucleic acid, protein or peptide molecules of the invention may be utilized to develop monoclonal or polyclonal antibodies that bind Shigella IcsP2 or SigA2. For preparation of the Shigella IcsP2- or SigA2-binding antibodies of the present invention, any technique which provides for the production of antibody molecules by continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein (256 Nature 495-497 (1975)) may be used. See also U.S. Pat. No. 4,376,110; Ausubel et al., Antibodies: a Laboratory Manual, (Harlow & Lane eds., Cold Spring Harbor Lab. 1988); Current Protocols in Immunology, (Colligan et at., eds., Greene Pub. Assoc. & Wiley Interscience N.Y., 1992-1996).
Another advantageous route for creating high affinity and/or high avidity human antibodies involves antigen priming of native human lymphocytes in vitro, transferal of the resultant in vitro antigen primed lymphocytes to an immunocompromised donor, e.g., a SCID mouse, boosting the immunocompromised donor with antigen, isolating human antibody secreting B-cells (IgG secreting) from the donor, and EBV-transforming the isolated human antibody secreting cells, as described in U.S. Pat. No. 6,537,809.
The antibodies of the present invention include chimeric antibodies comprising part human and part mouse antibodies, in which the constant region from human antibodies are cloned to a variable regions of light and heavy chains from mouse. In some instances, 70% of the human sequences are retained. Humanized antibodies are chimeric antibodies in which perhaps 90% of the human antibody framework is retained, and combined only with the murine the complementary determining regions. Fully humanized antibodies are also contemplated in the present invention.
Recombinant murine or chimeric murine-human or human-human antibodies that bind an epitope included in the amino acid sequences of Shigella IcsP2 or SigA2 can be provided using known techniques. See, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. Wiley Interscience, N.Y., 1987, 1992, 1993); Sambrook et al. Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press 1989); EP0239400.
Anti-Shigella IcsP2 and SigA2 antibodies and/or peptides of the present invention are useful for immunoassays which detect or quantitate Shigella IcsP2 and SigA2, or anti-Shigella IcsP2 and SigA2 antibodies, in a sample. An immunoassay for Shigella IcsP2 and SigA2 typically comprises incubating a clinical or biological sample in the presence of a detectably labeled high affinity (or high avidity) anti-Shigella IcsP2 or SigA2 antibody or polypeptide of the present invention capable of selectively binding to IcsP2-specific antibodies or SigA2-specific antibodies, and detecting the labeled peptide or antibody which is bound in a sample. Various clinical assay procedures are well known in the art. See, e.g., Immunoassays for the 80's (Voller et al., eds., University Park, 1981). Such samples include tissue blood, serum, and fecal samples, or liquids collected from the colorectal track following enema or oral laxative solution and subjected to ELISA analysis as described below.
Thus, an anti-Shigella IcsP2 or SigA2 antibodies or Shigella IcsP2 and SigA2 polypeptides can be fixed to nitrocellulose, or another solid support which is capable of immobilizing soluble proteins. The support can then be washed with suitable buffers followed by treatment with the detectably labeled Shigella IcsP2 and SigA2-specific peptide or antibody. The solid phase support can then be washed with the buffer a second time to remove unbound peptide or antibody. The amount of bound label on the solid support can then be detected by known method steps.
“Solid phase support” or “carrier” refers to any support capable of binding peptide, antigen, or antibody. Well-known supports or carriers, include glass, polystyrene, polypropylene, polyethylene, polyvinyl fluoride (PVDF), dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses, and magnetite. The nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention. The support material can have virtually any possible structural configuration so long as the coupled molecule is capable of binding to Shigella IcsP2 and SigA2 or an anti-Shigella IcsP2 or anti-Shigella SigA2 antibody. Thus, the support configuration can be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface can be flat, such as a sheet, culture dish, test strip, etc. For example, supports may include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody, peptide or antigen, or can ascertain the same by routine experimentation.
Well known method steps can determine binding activity of a given lot of anti-Shigella IcsP2 and SigA2 peptide and/or antibody. Those skilled in the art can determine operative and optimal assay conditions by routine experimentation.
Detectably labeling a Shigella IcsP2- or SigA2-specific peptide and/or antibody can be accomplished by linking to an enzyme for use in an enzyme immunoassay (ETA), or enzyme-linked immunosorbent assay (ELISA). The linked enzyme reacts with the exposed substrate to generate a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or by visual means. Enzymes which can be used to detectably label the Shigella IcsP2- and SigA2-specific antibodies of the present invention include, but are not limited to, horseradish peroxidase, alkaline phosphatase, glucose oxidase, beta-galactosidase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
By radioactively labeling the Shigella IcsP2- and SigA2-specific antibodies, it is possible to detect Shigella IcsP2 and SigA2 through the use of a radioimmunoassay (RIA). See Work et al., LABORATORY TECHNIQUES & BIOCHEMISTRY IN MOLECULAR BIOLOGY (North Holland Publishing Co., N.Y. (1978). The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography. Isotopes which are particularly useful for the purpose of the present invention are: 3H, 131I, 35S, 14C, and 125I.
It is also possible to label the Shigella IcsP2- and SigA2-specific antibodies with a fluorescent compound. When the fluorescent labeled antibody is exposed to light of the proper wave length, its presence can then be detected due to fluorescence. Among the most commonly used fluorescent labelling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
The Shigella IcsP2 and SigA2-specific antibodies can also be detectably labeled using fluorescence-emitting metals such as 125Eu, or others of the lanthanide series. These metals can be attached to the Shigella IcsP2- and SigA2-specific antibodies using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediamine-tetraacetic acid (EDTA).
The Shigella IcsP2- and SigA2-specific antibodies also can be detectably labeled by coupling to a chemiluminescent compound. The presence of the chemiluminescently labeled antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
Likewise, a bioluminescent compound can be used to label the Shigella IcsP2- and SigA2-specific antibody, portion, fragment, polypeptide, or derivative of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aequorin.
Detection of the Shigella IcsP2- and SigA2-specific antibodies, portion, fragment, polypeptide, or derivative can be accomplished by a scintillation counter, for example, if the detectable label is a radioactive gamma emitter, or by a fluorometer, for example, if the label is a fluorescent material. In the case of an enzyme label, the detection can be accomplished by colorometric methods which employ a substrate for the enzyme. Detection can also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
For the purposes of the present invention, the Shigella IcsP2 and SigA2 which is detected by the above assays can be present in a biological sample. Any sample containing Shigella IcsP2 or SigA2 can be used. For example, the sample is a biological fluid such as, for example, blood, serum, urine, feces, a tissue extract or homogenate, and the like. However, the invention is not limited to assays using only these samples, it being possible for one of ordinary skill in the art to determine suitable conditions which allow the use of other samples.
The antibody, fragment or derivative of the present invention can be adapted for utilization in an immunometric assay, also known as a “two-site” or “sandwich” assay. In a typical immunometric assay, a quantity of unlabeled antibody (or fragment of antibody) is bound to a solid support that is insoluble in the fluid being tested and a quantity of detectably labeled soluble antibody is added to permit detection and/or quantitation of the ternary complex formed between solid-phase antibody, antigen, and labeled antibody.
Typical, immunometric assays include “forward” assays in which the antibody bound to the solid phase is first contacted with the sample being tested to extract the Shigella IcsP2- or SigA2-containing proteins from the sample by formation of a binary solid phase antibody-Shigella IcsP2 or SigA2 complex. After a suitable incubation period, the solid support is washed to remove the residue of the fluid sample, including unreacted Shigella IcsP2 or SigA2, if any, and then contacted with the solution containing a known quantity of labeled antibody (which functions as a “reporter molecule”). After a second incubation period to permit the labeled antibody to complex with the Shigella IcsP2 or SigA2 bound to the solid support through the unlabeled antibody, the solid support is washed a second time to remove the unreacted labeled antibody. This type of forward sandwich assay can be used to determine whether Shigella IcsP2 and/or SigA2 is present or can be made quantitative by comparing the measure of labeled antibody with that obtained for a standard sample containing known quantities of Shigella IcsP2 and SigA2. Such “two-site” or “sandwich” assays are described by Wide, Radioimmune Assay Methods, 199-206 (Kirkham, ed., Livingstone, Edinburgh, 1970).
Other type of “sandwich” assays, which can also be useful with Shigella IcsP2 and SigA2, are the so-called “simultaneous” and “reverse” assays. A simultaneous assay involves a single incubation step wherein the antibody bound to the solid support and labeled antibody are both added to the sample being tested at the same time. After the incubation is completed, the solid support is washed to remove the residue of fluid sample and uncomplexed labeled antibody. The presence of labeled antibody associated with the solid support is then determined as it would be in a conventional sandwich assay.
In the “reverse” assay, stepwise addition first of a solution of labeled antibody to the fluid sample followed by the addition of unlabeled antibody bound to a solid support after a suitable incubation period, is utilized. After a second incubation, the solid phase is washed in conventional fashion to free it of the residue of the sample being tested and the solution of unreacted labeled antibody. The determination of labeled antibody associated with a solid support is then determined as in the “simultaneous” and “forward” assays. In one embodiment, a combination of antibodies of the present invention specific for separate epitopes can be used to construct a sensitive three-site immunoradiometric assay.
In accordance with the present invention there may be numerous tools and techniques within the skill of the art, such as those commonly used in molecular immunology, cellular immunology, pharmacology, and microbiology. Such tools and techniques are described in detail in e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.; Ausubel et al. eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Bonifacino et al. eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al. eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, N.J.; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, N.J.
The abbreviations in the specification correspond to units of measure, techniques, properties or compounds as follows: “min” means minutes, “h” means hour(s), “μL” means microliter(s), “mL” means milliliter(s), “mM” means millimolar, “M” means molar, “mmole” means millimole(s), “kb” means kilobase, “bp” means base pair(s), and “IU” means International Units.
“Polymerase chain reaction” is abbreviated PCR; “Reverse transcriptase polymerase chain reaction” is abbreviated RT-PCR; “Untranslated region” is abbreviated UTR; “Sodium dodecyl sulfate” is abbreviated SDS; and “High Pressure Liquid Chromatography” is abbreviated HPLC.
“Amplification” of DNA as used herein denotes the use of polymerase chain reaction (PCR) to increase the concentration of a particular DNA sequence within a mixture of DNA sequences. For a description of PCR see Saiki et al., Science 1988, 239:487.
A “polynucleotide” or “nucleotide sequence” is a series of nucleotide bases (also called “nucleotides”) in a nucleic acid, such as DNA and RNA, and means any chain of two or more nucleotides. A nucleotide sequence typically carries genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms include double or single stranded genomic and cDNA, RNA, any synthetic and genetically manipulated polynucleotide, and both sense and anti-sense polynucleotide (although only sense stands are being represented herein). This includes single- and double-stranded molecules, i.e., DNA-DNA, DNA-RNA and RNA-RNA hybrids, as well as “protein nucleic acids” (PNA) formed by conjugating bases to an amino acid backbone. This also includes nucleic acids containing modified bases, for example thio-uracil, thio-guanine and fluoro-uracil.
The nucleic acids herein may be flanked by natural regulatory (expression control) sequences, or may be associated with heterologous sequences, including promoters, internal ribosome entry sites (IRES) and other ribosome binding site sequences, enhancers, response elements, suppressors, signal sequences, polyadenylation sequences, introns, 5′- and 3′-non-coding regions, and the like. The nucleic acids may also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.). Polynucleotides may contain one or more additional covalently linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g., metals, radioactive metals, iron, oxidative metals, etc.), and alkylators. The polynucleotides may be derivatized by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage. Furthermore, the polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplary labels include radioisotopes, fluorescent molecules, biotin, and the like.
The term “nucleic acid hybridization” refers to anti-parallel hydrogen bonding between two single-stranded nucleic acids, in which A pairs with T (or U if an RNA nucleic acid) and C pairs with G. Nucleic acid molecules are “hybridizable” to each other when at least one strand of one nucleic acid molecule can form hydrogen bonds with the complementary bases of another nucleic acid molecule under defined stringency conditions. Stringency of hybridization is determined, e.g., by (i) the temperature at which hybridization and/or washing is performed, and (ii) the ionic strength and (iii) concentration of denaturants such as formamide of the hybridization and washing solutions, as well as other parameters. Hybridization requires that the two strands contain substantially complementary sequences. Depending on the stringency of hybridization, however, some degree of mismatches may be tolerated. Under “low stringency” conditions, a greater percentage of mismatches are tolerable (i.e., will not prevent formation of an anti-parallel hybrid). See Molecular Biology of the Cell, Alberts et al., 3rd ed., New York and London: Garland Publ., 1994, Ch. 7.
Typically, hybridization of two strands at high stringency requires that the sequences exhibit a high degree of complementarity over an extended portion of their length. Examples of high stringency conditions include: hybridization to filter-bound DNA in 0.5 M NaHPO4, 7% SDS, 1 mM EDTA at 65° C., followed by washing in 0.1×SSC/0.1% SDS at 68° C. (where 1×SSC is 0.15M NaCl, 0.15M Na citrate) or for oligonucleotide molecules washing in 6×SSC/0.5% sodium pyrophosphate at about 37° C. (for 14 nucleotide-long oligos), at about 48° C. (for about 17 nucleotide-long oligos), at about 55° C. (for 20 nucleotide-long oligos), and at about 60° C. (for 23 nucleotide-long oligos)). Accordingly, the term “high stringency hybridization” refers to a combination of solvent and temperature where two strands will pair to form a “hybrid” helix only if their nucleotide sequences are almost perfectly complementary (see Molecular Biology of the Cell, Alberts et al., 3rd ed., New York and London: Garland Publ., 1994, Ch. 7).
Conditions of intermediate or moderate stringency (such as, for example, an aqueous solution of 2×SSC at 65° C.; alternatively, for example, hybridization to filter-bound DNA in 0.5 M NaHPO4, 7% SDS, 1 mM EDT A at 65° C., and washing in 0.2×SSC/0.1% SDS at 42° C.) and low stringency (such as, for example, an aqueous solution of 2×SSC at 55° C.), require correspondingly less overall complementarity for hybridization to occur between two sequences. Specific temperature and salt conditions for any given stringency hybridization reaction depend on the concentration of the target DNA and length and base composition of the probe, and are normally determined empirically in preliminary experiments, which are routine (see Southern, J. Mol. Biol. 1975; 98: 503; Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 2, ch. 9.50, CSH Laboratory Press, 1989; Ausubel et al. (eds.), 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
As used herein, the term “standard hybridization conditions” refers to hybridization conditions that allow hybridization of sequences having at least 75% sequence identity. According to a specific embodiment, hybridization conditions of higher stringency may be used to allow hybridization of only sequences having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or at least 99% sequence identity.
Nucleic acid molecules that “hybridize” to any desired nucleic acids of the present invention may be of any length. In one embodiment, such nucleic acid molecules are at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, and at least 70 nucleotides in length. In another embodiment, nucleic acid molecules that hybridize are of about the same length as the particular desired nucleic acid.
As used herein, the term “isolated” means that the referenced material is removed from the environment in which it is normally found. Thus, an isolated biological material can be free of cellular components, i.e., components of the cells in which the material is found or produced. Isolated nucleic acid molecules include, for example, a PCR product, an isolated mRNA, a cDNA, or a restriction fragment. Isolated nucleic acid molecules also include, for example, sequences inserted into plasmids, cosmids, artificial chromosomes, and the like. An isolated nucleic acid molecule is preferably excised from the genome in which it may be found, and more preferably is no longer joined to non-regulatory sequences, non-coding sequences, or to other genes located upstream or downstream of the nucleic acid molecule when found within the genome. An isolated protein may be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein.
A “host cell” includes an individual cell or cell culture which can be or has been a recipient for vector(s) or for incorporation of polynucleotide molecules. In the present invention, a host cell can be a bacteria, a mammalian cell, an insect cell or a yeast cell.
“Treating” or “treatment” of a state, disorder or condition includes:
(1) preventing or delaying the appearance of clinical or sub-clinical symptoms of the state, disorder or condition developing in a mammal that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; or
(2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or sub-clinical symptom thereof; or
(3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms.
The benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician.
An “immune response” refers to the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest. Such a response usually consists of the subject producing antibodies, B cells, helper T cells, and/or cytotoxic T cells directed specifically to an antigen or antigens included in the composition or vaccine of interest. The immune response also may include regulatory T-cells, whose activity is beyond the organism of interest, and may suppress other immune or allergic responses.
A “therapeutically effective amount” means the amount of a compound, adjuvant, or vaccine composition that, when administered to a mammal for treating a state, disorder or condition, is sufficient to effect such treatment. The “therapeutically effective amount” will vary depending on the compound, bacteria or analogue administered as well as the disease and its severity and the age, weight, physical condition and responsiveness of the mammal to be treated.
A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
While it is possible to use a composition provided by the present invention for therapy as is, it may be preferable to administer it in a pharmaceutical formulation, e.g., in admixture with a suitable pharmaceutical excipient, diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice. Accordingly, in one aspect, the present invention provides a pharmaceutical composition or formulation comprising at least one active composition, or a pharmaceutically acceptable derivative thereof, in association with a pharmaceutically acceptable excipient, diluent and/or carrier. The excipient, diluent and/or carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
The compositions of the invention can be formulated for administration in any convenient way for use in human or veterinary medicine. The invention therefore includes within its scope pharmaceutical compositions comprising a product of the present invention that is adapted for use in human or veterinary medicine.
In a preferred embodiment, the pharmaceutical composition is conveniently administered as a liquid oral formulation. Although there are no physical limitations to delivery of the formulation, oral delivery is preferred because of its ease and convenience, and because oral formulations readily accommodate additional mixtures, such as milk, yogurt, and infant formula. Other oral dosage forms are well known in the art and include tablets, caplets, gel caps, capsules, and medical foods. Tablets, for example, can be made by well-known compression techniques using wet, dry, or fluidized bed granulation methods.
Such oral formulations may be presented for use in a conventional manner with the aid of one or more suitable excipients, diluents, and carriers. Pharmaceutically acceptable excipients assist or make possible the formation of a dosage form for a bioactive material and include diluents, binding agents, lubricants, glidants, disintegrants, coloring agents, and other ingredients. Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, ascorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used. An excipient is pharmaceutically acceptable if, in addition to performing its desired function, it is non-toxic, well tolerated upon ingestion, and does not interfere with absorption of bioactive materials.
Acceptable excipients, diluents, and carriers for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins (A. R. Gennaro edit. 2005). The choice of pharmaceutical excipient, diluent, and carrier can be selected with regard to the intended route of administration and standard pharmaceutical practice.
As used herein, the phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are generally regarded as physiologically tolerable.
“Patient” or “subject” refers to mammals and includes human and veterinary subjects.
The dosage of an adjuvant formulation or vaccine composition containing the adjuvant will vary widely, depending upon the nature of the disease, the patient's medical history, the frequency of administration, the manner of administration, the clearance of the agent from the host, and the like. The initial dose may be larger, followed by smaller maintenance doses. The dose may be administered as infrequently as monthly or annually to maintain an effective immunological memory.
The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.
The invention also encompasses pharmaceutical compositions and vaccines. The pharmaceutical compositions and vaccine compositions of the invention comprise at least one of the novel Shigella antigens, and one or more adjuvants along with a pharmaceutically acceptable carrier or excipient. Methods of formulating pharmaceutical compositions and vaccines are well-known to those of ordinary skill in the art, as described in Remington's, supra.
Formulations. The compositions of the present invention may comprise pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers. Such compositions include diluents of various buffer content (e.g., Tris-Hel, acetate, phosphate), pH and ionic strength; additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol); incorporation of the material into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. Hylauronic acid may also be used. See, e.g., Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, Pa. 18042) pages 1435-1712 which are herein incorporated by reference.
Contemplated for use herein are oral solid dosage forms, which are described generally in Remington's Pharmaceutical Sciences, 18th Ed. 1990 (Mack Publishing Co. Easton Pa. 18042) at Chapter 89, which is herein incorporated by reference. Solid dosage forms include tablets, capsules, pills, troches or lozenges, cachets, pellets, powders, or granules. Also, liposomal or proteinoid encapsulation may be used to formulate the present compositions (as, for example, proteinoid micro spheres reported in U.S. Pat. No. 4,925,673). Liposomal encapsulation may be used and the liposomes may be derivatized with various polymers (e.g., U.S. Pat. No. 5,013,556). A description of possible solid dosage forms for the therapeutic is given by Marshall, K. In: Modern Pharmaceutics Edited by G. S. Banker and C. T. Rhodes Chapter 10, 1979, herein incorporated by reference. In general, the formulation will include the therapeutic agent and inert ingredients which allow for protection against the stomach environment, and release of the biologically active material in the intestine.
Also contemplated for use herein are liquid dosage forms for oral administration, including pharmaceutically acceptable emulsions, solutions, suspensions, and syrups, which may contain other components including inert diluents; adjuvants, wetting agents, emulsifying and suspending agents; and sweetening, flavoring, coloring, and perfuming agents.
For oral formulations, the location of release may be the stomach, the small intestine (the duodenum, the jejunem, or the ileum), or the large intestine. One skilled in the art has available formulations which will not dissolve in the stomach, yet will release the material in the duodenum or elsewhere in the intestine, e.g., by the use of an enteric coating. Examples of the more common inert ingredients that are used as enteric coatings are cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PV AP), Eudragit L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S, and Shellac. These coatings may be used as mixed films.
A coating or mixture of coatings can also be used on tablets, which are not intended for protection against the stomach. This can include sugar coatings, or coatings which make the tablet easier to swallow. Capsules may consist of a hard shell (such as gelatin) for delivery of dry therapeutic (i.e. powder), for liquid forms a soft gelatin shell may be used. The shell material of cachets could be thick starch or other edible paper. For pills, lozenges, molded tablets or tablet triturates, moist massing techniques can be used. The formulation of the material for capsule administration could also be as a powder, lightly compressed plugs, or even as tablets. These therapeutics could be prepared by compression.
One may dilute or increase the volume of the therapeutic agent with an inert material. These diluents could include carbohydrates, especially mannitol, β-lactose, anhydrous lactose, cellulose, sucrose, modified dextrans and starch. Certain inorganic salts may be also be used as fillers including calcium triphosphate, magnesium carbonate and sodium chloride. Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and Avicell.
Disintegrants may be included in the formulation of the therapeutic agent into a solid dosage form. Materials used as disintegrates include but are not limited to starch, including the commercial disintegrant based on starch, Explotab, Sodium starch glycolate, Amberlite, sodium carboxymethyl cellulose, ultramylopectin, sodium alginate, gelatin, orange peel, acid carboxymethyl cellulose, natural sponge and bentonite may all be used. The disintegrants may also be insoluble cationic exchange resins. Powdered gums may be used as disintegrants and as binders. and can include powdered gums such as agar, Karaya or tragacanth. Alginic acid and its sodium salt are also useful as disintegrantsBinders may be used to hold the therapeutic agent together to form a hard tablet and include materials from natural products such as acacia, tragacanth, starch and gelatin. Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl cellulose (CMC). Polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose (HPMC) could both be used in alcoholic solutions to granulate the peptide (or derivative).
An antifrictional agent may be included in the formulation to prevent sticking during the formulation process. Lubricants may be used as a layer between the peptide (or derivative) and the die wall, and these can include but are not limited to; stearic acid including its magnesium and calcium salts, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and waxes. Soluble lubricants may also be used such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol of various molecular weights, Carbowax 4000 and 6000.
Glidants that might improve the flow properties drug during formulation and to aid rearrangement during compression might be added. The glidants may include starch, talc, pyrogenic silica and hydrated silicoaluminate.
To aid dissolution of the therapeutic agent into the aqueous environment a surfactant might be added as a wetting agent. Surfactants may include anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate. Cationic detergents might be used and could include benzalkonium chloride or benzethomium chloride. The list of potential nonionic detergents that could be included in the formulation as surfactants are lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 40, 60, 65 and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose. These surfactants could be present in the formulation of the protein or derivative either alone or as a mixture in different ratios.
Controlled release oral formulations may used in practicing the present invention. The therapeutic agent could be incorporated into an inert matrix which permits release by either diffusion or leaching mechanisms, e.g., gums. Slowly degenerating matrices may also be incorporated into the formulation. Some enteric coatings also have a delayed release effect. Another form of a controlled release is by a method based on the Oros therapeutic system (Alza Corp.), i.e. the therapeutic agent is enclosed in a semipermeable membrane which allows water to enter and push agent out through a single small opening due to osmotic effects.
Other coatings may be used for the formulation. These include a variety of sugars which could be applied in a coating pan. The therapeutic agent could also be given in a film coated tablet and the materials used in this instance are divided into 2 groups. The first are the nonenteric materials and include methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, methylhydroxy-ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl-methyl cellulose, sodium carboxy-methyl cellulose, providone and the polyethylene glycols. The second group consists of the enteric materials that are commonly esters of phthalic acid. A mix of materials might be used to provide the optimum film coating. Film coating may be carried out in a pan coater or in a fluidized bed or by compression coating.
In one embodiment, the Shigella polypeptide antigens disclosed in the present invention are administered with a pharmaceutically acceptable diluent. Such formulations can be administered by an injection (subcutaneous, intradermal, intramuscular) or applied topically onto the skin using an adhesive patch. Alternatively, the vaccine is administered by a mucosal route (oral, buccal, sublingual, nasal drops, aerosol, rectal) using a pharmaceutically acceptable vehicle. The antigens can also be mixed with an adjuvant to enhance the ensuing immune responses. Example of such adjuvants are without being limited to, aluminium salts, ISCOMs, saponin-based adjuvants, oil-in-water and water-in-oil emulsions, toll-like receptor ligands such as muramyl dipeptide, E. coli LPS, oligonucleotides comprised of unmethylated DNA, poly I:C, lipoteichoic acid, peptidoglycan. Enterotoxins and their adjuvant active derivatives such as cholera toxin, heat-labile E. coli enterotoxin, pertussis toxin, shiga toxin and analogs
Preparations according to this invention for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, or emulsions. Examples of non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and corn oil, gelatin, and injectable organic esters such as ethyl oleate. Such dosage forms may also contain adjuvants, preserving, wetting, emulsifying, and dispersing agents. The pharmaceutical compositions may be sterilized by, for example, filtration through a bacteria retaining filter, by incorporating sterilizing agents into the compositions, by irradiating the compositions, or by heating the compositions. They can also be manufactured using sterile water, or some other sterile injectable medium, immediately before use.
Vaccines. In the case of vaccines, it is often observed that a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Therefore the vaccines of the invention may contain adjuvants including, but not limited to, cholera toxin, fragments and mutants or derivatives with adjuvant properties, Escherichia coli heat-labile enterotoxin, fragments and mutants or derivatives with adjuvant properties, oil-in-water and water-in-oil emulsions, toll-like receptor ligands such as muramyl dipeptide, E. coli LPS, oligonucleotides comprised of unmethylated DNA, poly I:C, lipoteichoic acid, peptidoglycan. Enterotoxins and their adjuvant active derivatives such as cholera toxin, heat-labile E. coli enterotoxin, pertussis toxin, shiga toxin and analogs. Other adjuvants can be used such as complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, and potentially useful human adjuvants such as N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1′-2′-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine, BCG (bacille Calmette-Guerin) and Corynebacterium parvum. An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifically enhances the immune response (Hood et al., Immunology, Second Ed., 1984, Benjamin/Cummings: Menlo Park, Calif., p. 384). Where the vaccine is intended for use in human subjects, the adjuvant should be pharmaceutically acceptable.
Administration. Such pharmaceutical compositions or vaccines may be for administration by oral (solid or liquid), parenteral (intramuscular, intraperitoneal, intravenous (IV) or subcutaneous injection), transdermal (either passively or using ionophoresis or electroporation), transmucosal (nasal, vaginal, rectal, or sublingual), or inhalation routes of administration, or using bioerodible inserts and can be formulated in dosage forms appropriate for each route of administration.
In one preferred embodiment, the compositions or vaccines are administered by pulmonary delivery. The composition or vaccine is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream [see, e.g., Adjei, et al. Pharmaceutical Research 1990; 7:565-569; Adjei, et al. Int. J. Pharmaceutics 1990; 63:135-144 (leuprolide acetate); Braquet, et al. J. Cardiovascular Pharmacology 1989; 13 (sup5):143-146 (endothelin-1); Hubbard, et al. (1989) Annals of Internal Medicine, Vol. III, pp. 206-212 (α1-antitrypsin); Smith, et al. J. Clin. Invest. 1989; 84: 1145-1146 (α-1-proteinase); Oswein, et al. “Aerosolization of Proteins”, 1990; Proceedings of Symposium on Respiratory Drug Delivery II Keystone, Colo. (recombinant human growth hormone); Debs, et al. J. Immunol. 1988; 140:3482-3488 (interferon-γ and tumor necrosis factor α); and U.S. Pat. No. 5,284,656 to Platz, et al. (granulocyte colony stimulating factor). A method and composition for pulmonary delivery of drugs for systemic effect is described in U.S. Pat. No. 5,451,569 to Wong, et al. See also U.S. Pat. No. 6,651,655 to Licalsi et al.
Contemplated for use in the practice of this invention are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art. Some specific examples of commercially available devices suitable for the practice of this invention are the Ultravent nebulizer (Mallinckrodt Inc., St. Louis, Mo.); the Acorn II nebulizer (Marquest Medical Products, Englewood, Colo.); the Ventolin metered dose inhaler (Glaxo Inc., Research Triangle Park, NC); and the Spinhaler powder inhaler (Fisons Corp., Bedford, Mass.). All such devices require the use of formulations suitable for the dispensing of the therapeutic agent. Typically, each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to the usual diluents, adjuvants, surfactants and/or carriers useful in therapy. Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated.
Formulations for use with a metered-dose inhaler device will generally comprise a finely divided powder containing the therapeutic agent suspended in a propellant with the aid of a surfactant. The propellant may be any conventional material employed for this purpose, such as a chlorofluorocarbon, a hydro chlorofluorocarbon, a hydro fluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof. Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid may also be useful as a surfactant.
Formulations for dispensing from a powder inhaler device will comprise a finely divided dry powder containing the therapeutic agent, and may also include a bulking agent, such as lactose, sorbitol, sucrose, or mannitol in amounts which facilitate dispersal of the powder from the device, e.g., 50 to 90% by weight of the formulation. The therapeutic agent should most advantageously be prepared in particulate form with an average particle size of less than 10 mm (or microns), most preferably 0.5 to 5 mm, for most effective delivery to the distal lung.
Nasal or other mucosal delivery of the therapeutic agent is also contemplated. Nasal delivery allows the passage to the blood stream directly after administering the composition to the nose, without the necessity for deposition of the product in the lung. Formulations for nasal delivery include those with dextran or cyclodextran and saponin as an adjuvant.
The composition or vaccine of the present invention may be administered in conjunction with one or more additional active ingredients, pharmaceutical compositions, or vaccines. The therapeutic agents of the present invention may be administered to an animal, preferably a mammal, most preferably a human.
Dosages
Following methodologies which are well-established in the art, effective doses and toxicity of the compounds and compositions of the instant invention, which performed well in in vitro tests, are then determined in preclinical studies using small animal models (e.g., mice or rats) in which the Shigella antigens, polypeptide, pharmaceutical, or vaccine compositions have been found to be therapeutically effective and in which these drugs can be administered by the same route proposed for the human clinical trials.
Formulations or dosage forms for use in the present invention need not contain a therapeutically effective amount of the components disclosed here because such therapeutically effective amounts can be achieved by administering a plurality of such formulations or dosage forms.
For any pharmaceutical composition used in the methods of the invention, the therapeutically effective dose can be estimated initially from animal models. Dose-response curves derived from animal systems are then used to determine testing doses for the initial clinical studies in humans. In safety determinations for each composition, the dose and frequency of administration should meet or exceed those anticipated for use in the clinical trial.
As disclosed herein, the dose of the components in the compositions of the present invention is determined to ensure that the dose administered continuously or intermittently will not exceed an amount determined after consideration of the results in test animals and the individual conditions of a patient. A specific dose naturally varies depending on the dosage procedure, the conditions of a patient or a subject animal such as age, body weight, sex, sensitivity, feed, dosage period, drugs used in combination, and seriousness of the disease. The appropriate dose and dosage times under certain conditions can be determined by the test based on the above-described indices but may be refined and ultimately decided according to the judgment of the practitioner and each patient's circumstances (age, general condition, severity of symptoms, sex, etc.) according to standard clinical techniques.
Toxicity and therapeutic efficacy of the compositions of the invention can be determined by standard pharmaceutical procedures in experimental animals, e.g., by determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index and it can be expressed as the ratio ED50/LD50. Compositions that exhibit large therapeutic indices are preferred.
The data obtained from animal studies can be used in formulating a range of doses for use in humans. The therapeutically effective doses of in humans lay preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. Ideally, a single dose of each drug should be used daily.
The following describes materials and methods employed in Examples 1-14.
Cloning, Expression and Purification of Shigella SigA2 and Icsp2 Polypeptides
DNA sequences of the protein antigens are available as described above (37). SigA DNA sequence of S. flexneri 2a strain 2457T was obtained from the gene bank accession number [Genbank AE014073]. The DNA sequence of icsP of S. flexneri 5a strain M90T was also obtained from the gene bank accession number [Genbank AL391753]. The nucleotide identity and amino acid sequence homology among different species of Shigella are more than 99%. The DNA fragments were inserted into a commercially available E. coli over-expression plasmid pET21d (Novagen, Gibbstown, N.J., USA) and purified according to the manufacturer's instruction using TALON metal-affinity resin (Clontech, Mountain View, Calif., USA).
Primers:
IcsP2 primer set CCGGAATTCGGAGTGAAAACGGGGGGAGC and CGGCGGCTCGAGCTAGTGGTGGTGGTGGTGGTGAATACTTGCACTATTTTT was used for amplification if IcsP2 fragment from S. flexneri 2a 2457T strain. The amplified fragment (SEQ ID NO:1, 390 bp, underlined sequence) was digested with EcoRI and XhoI (boxed sequence, as shown in
CTG
was used for amplification of SigA2 fragment from S. flexneri 2a 2457T strain. The amplified fragment (SEQ ID NO:3, 795 bp, underlined sequence) was digested with EcoRI and XhoI (boxed sequence, as shown in
Amplified IcsP2 fragment and SigA2 fragments were inserted into EcoRI and XhoI site of pET21d and the recombinant DNA was verified with sequencing. The E. coli BL21 (DE3) (Novagen, Gibbstown, N.J., USA) bacteria were transformed with each recombinant plasmid and the protein overexpression was induced by 0.5 mM IPTG (Isopropyl-β-D-Thiogalactopyranoside) in the media at 37° C. E. coli BL21 (DE3) overexpressing each fragment was harvested and disrupted by freeze/thaw followed by sonication in the presence of 6 M urea. The E. coli extract was centrifuged by 12,000×g and the supernatant was loaded on the pre-equilibrated (with 1× binding buffer: 20 mM TrisCl pH 7.9, 500 mM NaCl 5 mM immidazole and 6 M urea) TALON resin column (3 ml). The column was washed with 20 ml of 1× binding buffer and 30 ml of 1× washing buffer (20 mM TrisCl pH 7.9, 500 mM NaCl, 15 mM immidazole and 6 M urea) and the protein was eluted by 1× elution buffer (20 mM TrisCl pH 7.9, 500 mM NaCl, 250 mM immidazole).
One other fragment of IcsP was also subcloned as described above (Primer set CCCGGGGAATTCACCACTAACTATCCACTTTT and CGGCGGCTCGAGCTAGTGGTGGTGGTGGTGGTGACTGTAACGACTCTCTTGGTA)
icsP and sigA gene disrupted mutant strains (S. flexneri 2a 2457T background) construction: icsP and sigA gene disrupted mutant strains were constructed individually by using an allele exchange method (17). Briefly, the internal 300 nt DNA fragments of icsP and sigA (from nucleotide 61 to 360) were amplified with primers Ics5Tr/lcs3Tr (5′-GGC TCT AGA ACCACTAACTATCCACTT-3′/5′-GCC GAA TTC CCA GCT CTG GTC GGT CCA-3′) for icsA fragment and Sig5Tr/Sig3Tr (5′-GGC TCT AGA GAA CTG ACC CGG AAA GTT AGT-3′/5′-GCC GAA TIC GTA CGC ACC TCC TAA TGA—3′) for sigA fragment. These fragments were inserted into a suicide plasmid pSW23.oriT. The recombinant plasmid pSWicsPTr and pSEsigATr were used to transform E. coli strain BW19610 (pir+ Amps Cmr). Each plasmid was purified from BW19610, and used to transform E. coli SM10λpir (pir+ Tra+ Amps Cmr). E. coli SM10λpir was conjugated with S. flexneri 2a 2457T and the chloramphenicol resistant S. flexneri was isolated on a Congo Red/streptomycin/chloramphenicol plate. In each knockout strain, the gene on the virulence plasmid and the genome are split into two fragments: 5′ end fragment of 360 nucleotides and 3′ end fragment. This disruption of each gene on the mutant strains was confirmed by PCR and sequencing. Each strain was used for challenging the immunized mice.
Three other fragments of SigA protein were also purified as describe above using primer sets as: SigA1 fragment primer set: CCCGGGGAATTCGGTATGGCGAAACAGCATTTGC and CGGCGGCTCGAGCTAGTGGTGGTGGTGGTGGTGCTCTTGTTTTTTACCATCCA (824 bp fragment using EcoRI and XhoI), SigA3 fragment primer set CCGGGGAAGCTTGACCCCTACAGAAAATAATA and CGGCGGCTCGAGCTAGTGGTGGTGGTGGTGGTGCTCGCCATTGGTGTCACGCA (822 bp fragment using HindIII and XhoI), and SigA4 fragment primer set CCCGGGGAATTCGGGATAAAAAACATGAGCTGG and CGGCGGCTCGAGCTAGTGGTGGTGGTGGTGGTGGAAAGAGTAACGGAAGTTGG (702 bp fragment using EcoRI and XhoI). These fragments were overexpressed and purified as described above. The SigA1 fragment showed immunogenicity but no protection while SigA3 and SigA4 fragments did not provoke antibody responses in mice. All the primers were purchased from Genotech, Taejon, Korea.
Bacterial Strains
S. flexneri 2a strain 2457T and S. flexneri 5a strain M90T were provided by Dr. Philippe Sansonetti, Institut Pasteur, Paris, France).
S. boydii (IB8295) serotype 1: was obtained from a Shigellosis patient in Pakistan collected in 2002 (IVI collection).
S. sonnei (IB4200): was obtained from a Shigellosis patient in India collected in 2004 provided by Dr. G. B. Nair (NICED, India).
S. dysenteriae serotype 1: was provide by Dr. D. Kopecko (FDA, Bethesda, Md., USA).
Animal Immunizations
All animals were maintained under specific pathogen-free conditions in the animal care facilities of the International Vaccine Institute (Seoul) in accordance with International guidelines and all experiments described here were approved by the International Vaccine Institute ethical committees for animal experimentation.
For the purpose of this invention, an immunologic adjuvant is defined as “any substance that acts to accelerate, prolong, or enhance antigen-specific immune responses when used in combination with specific vaccine antigens” (The Use of Conventional Immunologic Adjuvants in DNA Vaccine Preparations, by Shin Sasaki and Kenji Okuda. In D. B. Lowrie and R. G. Whalen (editors), DNA Vaccines: Methods and Protocols, Humana Press, 2000. ISBN 978-0-89603-580-5), as well as “a substance used to help boost the immune response to a vaccine so that less vaccine is needed (Definition of Adjuvant, National Cancer Institute). Cholera toxin, oligodeoxynucleotides which contain unmethylated CpG motifs (CpG ODN), and aluminium salts are known adjuvants, when co-administered with antigens.
Five to six week old female Balb/c mice were immunized with the protein antigens administered by various routes. Dose: for each immunization, a dose of 25 μg of the protein antigens was mixed with an adjuvant in isotonic, pyrogen-free, phosphate-buffered saline, pH 7.4 (PBS). The adjuvant consisted of either cholera toxin (CT) (3 to 5 micrograms μg) per dose), CpG ODN (4 μg per dose), or aluminium hydroxide (alum).
Intra-Peritoneal Administration
25 μg of protein antigen was administered by intraperitoneal injection, with or without adjuvant, in a total volume of 0.2 ml of PBS. Mice were immunized three times, at two weeks intervals.
Intranasal Administration
25 μg of protein antigen was mixed with 3 μg of cholera toxin (CT) and administered through each nostril in a total volume of 50 microliters (approximately 25 microliter per nostril). Two and four weeks later, mice were re-immunized under identical conditions.
Rectal Administration
100 μg protein antigen was mixed with CT (5 microgram) and administered in a final volume of 0.2 milliliters with a pipette inserted into the anorectal orifice. Guinea pigs were immunized three times, at two weeks interval between each immunization.
Animal Models of Shigellosis
Mouse pneumonia model: 2×107 CFU of S. flexneri 2a strain 2457T in 50 microliters of PBS were inoculated into the nostrils of immunized mice. Animals were monitored daily for 10 days. S. flexneri 5a strain M90T and S. dysenteriae 1 strains were also used for challenge experiment.
Guinea pig keratoconjunctivitis model: One week after the last of three consecutive immunizations with Shigella protein antigens adjuvanted with CT, guinea pigs were anesthetized and 1×105 cfu/20 ul of S. flexneri 2a strain 2457T was instillated in the eye conjunctival sac of guinea pigs. Periocular symptoms were monitored daily for 4-5 days. For comparison with systemic immunization, 50 μg of protein was administered through Intraperitoneal route with 3 μg of CT three times two weeks interval, and the immunized Guinea pig was challenged one week after the final immunization as described.
Guinea pig colitis model: A recently developed model of intestinal shigellosis (30) was used to evaluate the protective efficacy of the novel Shigella common protein antigens disclosed in the present invention. Briefly, S. flexneri 2a 2457T (1×109 CFU) or S. flexneri 5a strain M90T were administered by instillation through the ano-rectal orifice of 5 week old guinea pigs, as described by Shim, Suzuki, Chang et al (30). Animals were examined daily for symptoms of dysentery (diarrhea, tenesmus) and then sacrificed by pentobarbital overdose prior to histological analyses of colon tissue specimens.
Measurements of Systemic and Mucosal Immune Responses to Shigella Common Protein Antigens
Collection of Biological Fluids
Serum and secretions (saliva, vaginal and rectal washes) were collected 1 week before the first immunization and thereafter one week after each immunization.
Preparation of Organ Extracts and Isolation of Cell Suspensions
One week after the last immunization, mice were anesthetized with pentobarbital and 125 i.u. of heparin (SIGMA, MO, USA) in 0.2 ml saline was injected intra-peritoneally. Blood was drawn directly from the heart and the mice were sacrificed by cervical dislocation. Mice were perfused by injecting 15 ml of PBS containing heparin (10 i.u./ml) into the heart right ventricle until the lungs were inflated and turned clear. Finely cut lung fragments were digested for 30 min at 37° C. with collagenase A (0.5 mg/ml) (Roche) in RPMI medium (Gibco Europe, U.K.) supplemented with DNase 1 (0.1 mg/ml) (Roche) and single cell suspensions were collected by filtration through a cell strainer. Single cell suspensions from spleen were obtained by pressing the organs through nylon sieves. All suspensions were freed from erythrocytes by treatment with ammonium chloride, washed, resuspended in RPMI medium containing 5% FBS, and stored on ice until being assayed (within 30 minutes) by means of the ELISPOT assay described below.
For preparation of cell-free organ extracts, the PERFEXT technique (34) was used. Lungs from perfused animals were excised and sliced into small (2-3 mm thick) fragments and further perfused by incubation for 30 minutes at 37° C. in PBS containing heparin, under constant agitation. Fragments were pelleted by centrifugation (500 rpm, 3 minutes) and resuspended in extraction buffer, consisting of Triton X100, PMSF and protease inhibitors (34). Samples were snap frozen in liquid nitrogen and stored at −70° C. Prior to use, samples were thawed at room temperature and centrifuged (2000 rpm, 5 minutes). Supernatants were collected and assayed for specific antibody activity by means of ELISA, as described below.
Antibody ELISA (Enzyme Linked Immunosorbent Assay)
The levels of antibodies to Shigella common protein antigens in sera, in secretions and in tissue PERFEXT extracts, were estimated by standard solid phase enzyme-linked immunosorbent assay (ELISA). Individual wells of polystyrene 96-well plates (NUNC, Denmark) were coated with each protein (1 microgram per ml of PBS; 0.1 ml per well; overnight incubation at ambient temperature), blocked with 5% (vol/vol) skim milk in PBS containing 0.05% Tween 20 (0.2 ml per well; 30 minutes at ambient temperature) and washed three times with PBS-Tween. Serial two-fold dilutions of samples in PBS-Tween with 5% skim milk solution were incubated in antigen-coated wells for 2 hrs at ambient temperature, and the plates were washed three times with PBS-Tween to remove unbound antibodies. Next, 0.1 ml of PBS-Tween containing appropriately diluted (1/5000) horseradish peroxidase-conjugated goat anti-mouse IgA or IgG antibodies (Southern Biotechnology, Birmingham, Ala., USA) was added to individual wells. The plates were then washed three times with PBS and enzyme-bound activity was monitored after addition of a chromogenic enzyme substrate. Color development was stopped by adding 50 μl of 0.5 N H2SO4, and measured spectrophotometrically (O.D450) using an ELISA reader. Data are expressed as geometric mean antibody titers, a titer being defined as the reciprocal of the highest dilution of a sample yielding an absorbance value equal or above that of control (no sample) added.
ELISPOT assay: The frequency of cells producing specific antibodies to Shigella protein antigens was determined by means of the enzyme-linked immunospot (ELISPOT) assay (4). For comparison, the frequency of cells producing antibodies to cholera toxin (CT) was determined when applicable. Briefly, 10 μg of cholera toxin, 50 μg of sigA2, and 100 μg of sigA2 protein diluted in PBS were added to individual wells of nitrocellulose-bottomed 96 wells HA plates (Millipore, Bedford, USA). After overnight incubation at 4° C., each well was washed with PBS and blocked with RPMI culture medium (GIBCO, UK) containing 10% fetal bovine serum (FBS). Lung and spleen cell suspensions from immunized mice were incubated in serial two-fold dilutions (starting at eight hundred thousand mononuclear cells per well) in RPMI medium with FBS. After a 4 hrs incubation at 37° C., individual wells were washed 5 times with PBS, 5 times with PBS containing 0.05% Tween 20 and then exposed for 1 hour at room temperature to 0.1 ml of PBS-Tween containing horseradish peroxidase conjugated goat antibodies to mouse IgG or mouse IgA (1:1000 dilution). After 3 washes with PBS-Tween and 4 washes with PBS, wells were exposed to chromogen substrate for 10-20 minutes until spots appeared. Plates were then washes with running tap water and dried. Spots were then enumerated using a stereomicroscope. Data were expressed as numbers of spot-forming cells (SFC) adjusted to one million cells.
Mucosal Immunization with IcsP2 Protects Mice Against Pneumonia Induced by Shigella flexneri 2a
Mice were immunized with IcsP2 given together with CT by the intranasal route, as described above. Animals were challenged with a lethal dose S. flexneri 2a strain 2457T. The results of
Mucosal Immunization with IcsP2 Protects Mice Against Pneumonia Induced by Distinct Serotypes of Shigella flexneri
Mice were immunized with IcsP2 given together with CT by the intranasal route as described above. Animals were challenged with a lethal dose of S. flexneri 5a strain M90T (2×107 CFU in 50 μl). The results shown in
Mice were immunized with IcsP2 given together with CT by the intranasal route as described above. Animals were challenged with a lethal dose S. dysenteriae type 1 (strain provided by Dr. D. Kopecko, FDA, Bethesda, Md., USA).
The results presented in
From the above experiments, it can be concluded that IcsP2 not only protects against mucosal infection with S. flexneri belonging to distinct serotypes but also against an infection caused by a different species of Shigella, such as S. dysenteriae.
SigA protein is known to be present exclusively in S. flexneri 2a and not other serotypes of S. flexneri (1). Mice immunized with SigA2 protein were challenged with lethal dose of S. flexneri 2a (2457T, filled circle) and S. flexneri 5a (M90T, filled square). Mice challenged with 2457T showed 80% survival while the mice challenged with S. flexneri died by bacteria-induced pneumonia. Mice that were immunized with PBS showed 100% death by two strains 2457T (open circle in
Guinea pigs immunized with IcsP2 and control (sham immunized with PBS) as described above. Animals were challenged one week after the last of 3 consecutive immunizations with IcsP2 and CT adjuvant administered by the intranasal or the intraperitoneal route with 1×105 colony-forming units of virulent S. flexneri 2a 2457T. Guinea pigs were then examined at 24 hrs and 48 hrs after challenge for signs and intensity of ocular inflammation (keratoconjunctivitis). Animals with no detectable inflammation were considered protected. As can be seen in the Table 1 below, 40 to 50% of animals immunized with IcsP2 administered by the intranasal or by the intraperitoneal route were protected against Shigella-induced keratoconjunctivitis, whereas control animals (treated with PBS) all displayed keratoconjunctivitis.
Guinea pigs immunized with IcsP2, SigA2, SC602 and PBS were challenged with virulent S. flexneri 2a strain 2457T with inoculum of 1×109 CFU and 24 hr after the inoculation were examined for diarrhea, hemorrhage of the colon, and frequency of tenesmus. As can be seen in Table 2, all control (PBS-treated) animals had hemorrhage of the recto-colonic mucosa, most of whom had diarrhea (lack of solid feces) and presented with signs of straining at stool, also called rectal tenesmus. In contrast, animals immunized with AigA2 had no signs of recto colitis but displayed tenesmus. Animals that had been immunized with live attenuated S. flexneri 2a strain SC602 were protected against challenge with virulent S. flexneri 2a (strain 2457T). Most importantly, guinea pigs that had been immunized with purified IcsP2 were also fully protected against challenge with S. flexneri 2a (strain 2457T).
S. flexneri 2a
S. flexneri 5a
S. dysenteriae 1
Serum antibody levels were then determined one week after the third intranasal immunization. As can be seen in
Antibody-secreting cells in spleen and lung of mice immunized with SigA2 or IcsP2 were enumerated by ELIS pot assay performed on cell suspensions collected one week after 3 intra-nasal immunizations with SigA2 or IcsP2 adjuvanted with CT. Results presented in
Lung extracts from mice immunized with SigA2 by the intra-nasal (i.n.) route or the intra-peritoneal (i.p.) route were assayed for SigA2-specific IgG antibody activity one week after the last of 3 consecutive immunizations. As can be seen in
Taken together, these results demonstrate that mucosally administered SigA2 and IcsP2 are immunogenic and can induce systemic and mucosal antibody responses.
Western blot analyses of Shigella proteins: SDS-PAGE was performed on whole cell detergent extracts of S. flexneri serotype 2a 2457T, S. boydii, S. sonnei and the proteins were transferred on nitrocellulose membranes. Membranes were incubated with mouse antisera diluted to 1/50 or 1/100 (in PBS-Tween 20 for 2 hrs at ambient temperature. These antisera were obtained by intraperitoneal injections of SigA2 and IcsP2 co-administered with alum adjuvant, as described above. After washing with PBS-Tween, the membranes were further incubated with alkaline phosphatase-conjugated goat antibodies to mouse Ig (Southern Biotech, Birmingham, Ala., USA). After washing, membranes were developed by adding BCIP-NBT chromogen substrate. For comparative purposes, separate membranes were stained with Coomassie Blue. As can be seen in
Confluent HeLa cells were infected with an invasive S. flexneri 2a 2457T strain at a multiplicity of infection (m.o.j.) of 100, 10, and 1 for 2 hours at 3° C. The bacteria were washed and cultures were overlaid with agarose. Plaques were visualized by Giemsa staining, performed 48 hours after the infection. To test antisera to SigA2 for its capacity to inhibit plaque formation, invasive bacteria and test antiserum were mixed for 20 min prior to being added to the cells (
The presence of IcsP and SigA in Shigella strains was confirmed by PCR using the primers used for construction of overexpression vectors described in the above section entitled “Cloning, expression and purification of Shigella SigA2 and Icsp2 polypeptides.”
The presence of sigA gene and icsP gene in each serotype of Shigella spp. was confirmed by PCR with primer sets for SigA2 and IcsP2 fragments, as shown in
Antibodies Against SigA2 Inhibit Keratoconjunctivitis by S. flexneri 2a
Virulent S. flexneri 2a strain 2457T (2×104 colony-forming units in 20 microliter) was mixed with PBS, the same volume of antiserum against SigA2, or pre-immune sera, and then inoculated into the conjunctival sac of guinea pigs. As can be seen in
Mice were immunized with IcsP2, SigA2 or SC602 (a live-attenuated S. flexneri 2a strain), respectively. Animals were challenged with S. flexneri 2a or with S. flexneri 2a deleted of either IcsP or SigA (herein referred to as KO strains). As shown in Table 4, mice survive a challenge with S. flexneri 2a but succumbed to challenge with KO strains, demonstrating the specificity of protection induced by IcsP2 and SigA2 respectively.
S. flexneri
S. flexneri
S. flexneri
S. flexneri
S. dysenteriae 1
S. boydii
S. sonnei
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims. It is further to be understood that all values are approximate, and are provided for description.
Patents, patent applications, publications, product descriptions, and protocols are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes.
This application is a divisional of U.S. application Ser. No. 12/603,574, filed Oct. 21, 2009, which claims priority pursuant to 35 U.S.C. §119 to U.S. Provisional Patent Application No. 61/107,306, filed Oct. 21, 2008, both of which are hereby incorporated by reference in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| 20100136045 A1 | Jun 2010 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61107306 | Oct 2008 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 12603574 | Oct 2009 | US |
| Child | 12692187 | US |
