Patent Application
20100285592
The invention encompasses an expression vector and a bacterial carrier. The expression vector is capable of generating a virus after being delivered into host cells. The bacterial carrier of the invention may be utilized to deliver the expression vector into host cells. The virus produced in the host cells from the expression vector may be either attenuated or not attenuated.
Influenza virus has caused three recorded pandemics. The 1918 influenza pandemic, also known as Spanish influenza, caused at least 675,000 deaths in the U.S. alone and up to 50 million deaths worldwide (1, 34). The 1957 influenza pandemic caused at least 70,000 deaths in U.S. and 1-2 million deaths worldwide (2, WHO). The 1968 influenza pandemic caused about 34,000 deaths in U.S. and 700,000 deaths worldwide (2, WHO). Since 2003, there were 411 human cases and 256 deaths of avian influenza from 15 countries (WHO). The estimated mortality is more than 60%, making the highly pathogenic H5N1 avian influenza virus a potential candidate for the next influenza pandemic. The economic consequences of such a pandemic due to morbidity and health care delivery would be staggering.
The annual economic burden of influenza epidemics is also enormous. During a typical year in the United States, 30,000 to 50,000 persons die as a result of influenza virus infection, and the global death toll is about 20 to 30 times higher than the toll in this country (26). Based on the 2003 US population, annual influenza epidemics result in an average of 610,660 life-years lost, 3.1 million hospitalized days, and 31.4 million outpatient visits with the total direct medical costs averaging up to $10.4 billion annually. Projected lost earnings due to illness and loss of life amounted to $16.3 billion annually. The total economic burden of annual influenza epidemics using projected statistical life values amounted to $87.1 billion (20). The aforementioned socio-economic factors make influenza one of the critical infectious agents and hence a vaccine to prevent the resulting pandemics is highly warranted.
The three-recorded pandemics and most yearly global outbreaks of influenza are caused by influenza A virus (3, 13, 31, 32, 35). The virus belongs to the family Orthomyxoviridae, and contains a segmented negative-strand RNA genome. Influenza viral RNAs (vRNAs) associate with influenza RNA polymerase complex (PBI, PB2, PA), and nucleoprotein (NP) to make up a set of ribonucleoproteins (RNPs) (14, 21, 25). RNPs are both critical and essential constituents that mediate transcription or replication of vRNA. RNP can be reconstituted in vitro by incubating purified influenza polymerase and nucleoprotein with vRNA transcribed from template DNA (17). The reconstituted RNP has catalytic properties very similar to those of native viral RNP complexes. In the presence of influenza helper virus the recombinant RNP can be amplified and packaged into virus particles in a eukaryotic host cell, a process commonly known as RNP transfection (17) that also enables site-directed mutagenesis of any single component of the influenza virus genome (8). However, the need to select recombinant virus from the mixture of helper viruses and low viral yield demand more sophisticated approaches for the construction of recombinant influenza virus for the production of vaccines that need to be modified annually.
Effort to construct recombinant influenza virus using modern genetic tools for potential application in vaccines has escalated since the early 1990's. The primary objective is to generate influenza virus from plasmid constructs that can be transfected into a broad range of host cells to provide high viral yields with minimum selection from helper virus. In vivo synthesis of vRNA-like molecules was introduced by using RNA polymerase I (Pol I) dependent transcription of viral RNA (24, 37). In a typical plasmid construct, influenza cDNA is inserted precisely between the murine Pol I promoter and terminator sequences. Upon transfection, vRNA synthesized in the cells is bound by influenza polymerase and nucleoprotein that are provided by helper viruses. However, one major disadvantage in this technique is the cumbersome process of selecting recombinant influenza from the mixture containing the helper viruses. By combining intracellular synthesis of vRNAs and proteins, two reverse genetics systems free of helper virus were established by co-transfection of 12-17 plasmids (9, 23). Both systems utilize eight plasmids to encode vRNAs and four plasmids to encode three viral polymerase subunits and a nucleoprotein. The addition of plasmids expressing the remaining viral structural proteins led to a substantial increase in virus production. Thus, limiting the number of plasmid constructs to generate influenza virus still remained a challenge.
The “ambisense” approach that utilizes two promoters on a bidirectional transcription vector is the first major breakthrough to reduce the number of plasmids required for virus generation (11). In this approach, a Pol I promoter drives the synthesis of vRNA from a cDNA template, whereas, RNA polymerase II (Pol II) promoter drives the synthesis of mRNA from the same template in the opposite direction. A system with eight plasmids (i.e., an eight-plasmid system) was developed using the dual promoter technique, which successfully recovered influenza virus from Vero cells (11). A unidirectional Pol I-Pol II transcription system was also reported, however, it suffers from lower viral yield (11). A much-improved method is the generation of influenza virus using a three-plasmid based reverse genetics system (22). Here, one plasmid carries eight Pol I promoter-driven vRNA transcribing cassettes, another plasmid encodes the three viral polymerase subunits and the third plasmid encodes the nucleoprotein. This three-plasmid system, although arduous to construct, yields higher titers of influenza virus than any of the earlier approaches (22). Use of this technique to generate seed for influenza vaccine would thus require two plasmids individually providing HA and NA from epidemic virus, and three plasmid constructs together to provide the remaining components, making it a “2+3” approach.
Vaccines are necessary to prevent influenza outbreaks. To date, the inactivated and attenuated influenza vaccines commercially available for humans are administered either by injection or by nasal-spray. Influenza vaccine seeds are generated by DNA constructs based on reverse genetics system using the “2+6” strategy, where the HA and NA segments are taken from the circulating strain of influenza virus and the remaining 6 structural segments are taken from either the high productive strain PR8 (A/PR/8/34) or the cold-adapted strain (e.g. A/AA/6/60) (4, 10, 12). The current technology in making influenza vaccines relies on using embryonated eggs, which is time-consuming (takes up to four months), has low viral yield and is a cumbersome procedure.
Use of bacterial species to deliver plasmid DNA encoding viral components in the target host cell is an economical and less cumbersome approach to develop vaccines against influenza virus. However, the challenge would be to minimize the number of plasmid constructs so that it would be much easier to ensure the down stream processes involved in virus generation in a eukaryotic host cell.
The above-mentioned factors present a strong need for a single plasmid system for generating influenza virus to develop an inexpensive, ease of manufacture, quickly modifiable and needle-free influenza vaccine. The present invention addresses the design of a single expression vector for generation of virus, and a bacterial carrier based virus generation system, which could be used to develop vaccines against corresponding viral diseases.
The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.
A single expression vector capable of generating an attenuated virus from a segmented genome has been developed. An auxotrophic bacterial carrier can carry and deliver this expression vector into in vitro cultured cells, resulting in the recovery of virus, either attenuated or non-attenuated. The invention greatly simplifies the process of producing viruses that have segmented genomes, which historically have required transfection of multiple expression vectors for vRNA expression, in addition to vectors for expressing mRNAs for translation to viral replication proteins. Advantageously, as illustrated in the examples, the expression vector is stable in bacteria at 37° C., and produces higher titers of virus than traditional multi-vector systems when transfected into eukaryotic cells. This invention also demonstrates that bacterial carrier mediated delivery of such an expression vector can lead to the generation of virus. Therefore, this invention provides a system for bacterial carrier based delivery of attenuated viral vaccines with advantages of low cost, ease of manufacture, flexibility in introducing desired alterations, and finally, needle-free administration.
The expression vector generally comprises a plasmid having at least two types of transcription cassettes. One transcription cassette is designed for vRNA production. The other transcription cassette is designed for the production of both vRNAs, and mRNAs. As will be appreciated by a skilled artisan, the number of transcription cassettes, and their placement within the vector relative to each other, can and will vary depending on the segmented virus that is produced. Each of these components of the expression vector is described in more detail below.
The expression vector may be utilized to produce several different segmented and nonsegmented viruses. Viruses that may be produced from the expression vector include positive-sense RNA viruses, negative-sense RNA viruses and double-stranded RNA (ds-RNA) viruses.
In one embodiment, the virus may be a positive-sense RNA virus. Non-limiting examples of positive-sense RNA virus may include viruses of the family Arteriviridae, Caliciviridae, Coronaviridae, Flaviviridae, Picornaviridae, Roniviridae, and Togaviridae. Non-limiting examples of positive-sense RNA viruses may include SARS-coronavirus, Dengue fever virus, hepatitis A virus, hepatitis C virus, Norwalk virus, rubella virus, West Nile virus, Sindbis virus, Semliki forest virus and yellow fever virus.
In one embodiment, the virus may be a double-stranded RNA virus. Non-limiting examples of segmented double-stranded RNA viruses may include viruses of the family Reoviridae and may include aquareovirus, blue tongue virus, coltivirus, cypovirus, fijivirus, idnoreovirus, mycoreovirus, orbivirus, orthoreovirus, oryzavirus, phytoreovirus, rotavirus, infectious bursal disease virus and seadornavirus.
In yet another embodiment, the virus may be a negative-sense RNA virus. Negative-sense RNA viruses may be viruses belonging to the families Orthomyxoviridae, Bunyaviridae, and Arenaviridae with six-to-eight, three, or two negative-sense vRNA segments, respectively. Non-limiting examples of negative-sense RNA viruses may include thogotovirus, isavirus, bunyavirus, hantavirus, nairovirus, phlebovirus, tospovirus, tenuivirus, ophiovirus, arenavirus, deltavirus and influenza virus.
In another aspect, the invention provides an expression vector capable of generating influenza virus. There are three known genera of influenza virus: influenza A virus, influenza B virus and influenza C virus. Each of these types of influenza viruses may be produced utilizing the single expression vector of the invention.
In one exemplary embodiment, the expression vector is utilized to produce Influenza A virus. Influenza A viruses possess a genome of 8 vRNA segments, including PA, PB1, PB2, HA, NP, NA, M and NS, which encode a total of ten to eleven proteins. To initiate the replication cycle, vRNAs and viral replication proteins must form viral ribonucleoproteins (RNPs). The influenza RNPs consist of the negative-sense viral RNAs (vRNAs) encapsidated by the viral nucleoprotein, and the viral polymerase complex, which is formed by the PA, PB1 and PB2 proteins. The RNA polymerase complex catalyzes three different reactions: synthesis of an mRNA with a 5′ cap and 3′ polyA structure essential for translation by the host translation machinery; a full length complementary RNA (cRNA), and of genomic vRNAs using the cRNAs as a template. Newly synthesized vRNAs, NP and, PB1, PB2 and PA polymerase proteins are then assembled into new RNPs, for further replication or encapsidation and release of progeny virus particles. Therefore, to produce influenza virus using a reverse genetics system, all 8 vRNAs and mRNAs that express the viral proteins essential for replication (NP, PB1, PB1 and PA), must be synthesized. The expression vector of the invention may be utilized to produce all of these vRNAs and mRNAs.
The expression vector may also be utilized to produce any serotype of influenza A virus without departing from the scope of the invention. Influenza A viruses are classified into serotypes based upon the antibody response to the viral surface proteins hemagglutinin (HA or H) encoded by the HA vRNA segment, and neuraminidase (NA or N) encoded by the NA vRNA segment. At least sixteen H subtypes (or serotypes) and nine N subtypes of influenza A virus have been identified. New influenza viruses are constantly being produced by mutation or by reassortment of the 8 vRNA segments when more than one influenza virus infects a single host. By way of example, known influenza serotypes may include H1N1, H1N2, H2N2, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N8, H5N9, H7N1, H7N2, H7N3, H7N4, H7N7, H9N2, and H10N7 serotypes.
The expression vector of the invention comprises a vector. As used herein, “vector” refers to an autonomously replicating nucleic acid unit. The present invention can be practiced with any known type of vector, including viral, cosmid, phasmid, and plasmid vectors. The most preferred type of vector is a plasmid vector. As is well known in the art, plasmids and other vectors may possess a wide array of promoters, multiple cloning sequences, and transcription terminators.
The vector may have a high copy number, an intermediate copy number, or a low copy number. The copy number may be utilized to control the expression level for the transcription cassettes, and as a means to control the expression vector's stability. In one embodiment, a high copy number vector may be utilized. A high copy number vector may have at least 31, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 copies per bacterial cell. In other embodiments, the high copy number vector may have at least 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 copies per bacterial cell. Non-limiting examples of high copy number vectors may include a vector comprising the pBR ori or the pUC ori. In an alternative embodiment, a low copy number vector may be utilized. For example, a low copy number vector may have one or at least two, three, four, five, six, seven, eight, nine, or ten copies per bacterial cell. A non-limiting example of low copy number vector may be a vector comprising the pSC101 ori. In an exemplary embodiment, an intermediate copy number vector may be used. For instance, an intermediate copy number vector may have at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 copies per bacterial cell. A non-limiting example of an intermediate copy number vector may be a vector comprising the p15A ori.
The vector may further comprise a selectable marker. Generally speaking, a selectable marker encodes a product that the host cell cannot make, such that the cell acquires resistance to a specific compound or is able to survive under specific conditions. For example, the marker may code for an antibiotic resistance factor. Suitable examples of antibiotic resistance markers include, but are not limited to, those coding for proteins that impart resistance to kanamycin, spectomycin, neomycin, gentamycin (G418), ampicillin, tetracycline, and chlorampenicol. However, use of selective markers for drug resistance is undesirable for live attenuated bacterial vaccines and delivery systems and is also undesirable for DNA vaccines. Thus in still other cases, the vector might preferably have selectable Asd+, MurA+, AroA+, DadB+, Alr+, AroC+, AroD+, IlvC+ and/or IlvE+ when the expression vector is used in a balanced-lethal or balanced-attenuation vector-host system when present in and delivered by carrier bacteria.
In some embodiments, the vector may also comprise a transcription cassette for expressing non-viral reporter proteins. By way of example, reporter proteins may include a fluorescent protein, luciferase, alkaline phosphatase, beta-galactosidase, beta-lactamase, horseradish peroxidase, and variants thereof.
In some embodiments, the vector may also comprise a DNA nuclear targeting sequence (DTS). A non-limiting example of a DTS may include the SV40 DNA nuclear targeting sequence.
In some embodiments, the vector may also comprise a NF-κB binding site. The SV40 DTS and NF-κB binding sequence facilitate nuclear import of the plasmid DNA, and this facilitates transcription of genetic sequences on the vector.
(b) Transcription Cassettes for vRNAs Expression
The expression vector comprises at least one transcription cassette for vRNA production. Generally speaking, the transcription cassette for vRNA production minimally comprises a Pol I promoter operably linked to a viral cDNA linked to a Pol I transcription termination sequence. In an exemplary embodiment, the transcription cassette will also include a nuclear targeting sequence. The number of transcription cassettes for vRNA production within the expression vector can and will vary depending on the virus that is produced. For example, the expression vector may comprise two, three, four, five, six, seven, or eight or more transcription cassettes for vRNA production. When the virus that is produced is influenza, the expression cassette typically will comprise four transcription cassettes for vRNA production.
The term “viral cDNA”, as used herein, refers to a copy of deoxyribonucleic acid (cDNA) sequence corresponding to a vRNA segment of an RNA virus genome. cDNA copies of viral RNA segments may be derived from vRNAs using standard molecular biology techniques known in the art (see, e.g., Sambrook et al. (1989) “Molecular Cloning: A Laboratory Manual,” 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, and Knipe et al (2006) “Fields Virology”, Fifth Edition, Lippincott Williams & Wilkins (2007). In some embodiments, the cDNA may be derived from a naturally occurring virus strain or a virus strain commonly used in vitro. In other embodiments, the cDNA may be derived synthetically by generating the cDNA sequence in vitro using methods known in the art. The natural or synthetic cDNA sequence may further be altered to introduce mutations and sequence changes. By way of example, a naturally occurring viral sequence may be altered to attenuate a virus, to adapt a virus for in vitro culture, or to tag the encoded viral proteins.
The selection of promoter can and will vary. The term “promoter”, as used herein, may mean a synthetic or naturally derived molecule that is capable of conferring, activating or enhancing expression of a nucleic acid. A promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or to alter the spatial expression and/or temporal expression of a nucleic acid. The term “operably linked,” as used herein, may mean that expression of a nucleic acid is under the control of a promoter with which it is spatially connected. A promoter may be positioned 5′ (upstream) of the nucleic acid under its control. The distance between the promoter and a nucleic acid to be expressed may be approximately the same as the distance between that promoter and the nucleic acid sequence it controls. As is known in the art, variation in this distance may be accommodated without loss of promoter function. The promoters may be of viral, prokaryotic, phage or eukaryotic origin. Non-limiting examples of promoters may include T7 promoter, T3 promoter, SP6 promoter, RNA polymerase I promoter and combinations thereof. In some embodiments, the promoters may be different in each transcription cassette. In preferred embodiments, the promoters may be the same in each transcription cassette. In preferred alternatives of this embodiment, the promoters may be RNA polymerase I (Pol I) promoters. In an exemplary alternative of this embodiment, the promoters may be human Pol I promoters. In another exemplary alternative of this embodiment, the promoters may be chicken Pol I promoters. In a further exemplary alternative of this embodiment, the promoters are human Pol I promoters as described in Example 1. In another exemplary alternative of this embodiment, the promoters are chicken Pol I promoters as described in Example 1.
The promoter may be operably linked to the cDNA to produce a negative-sense vRNA or a positive-sense cRNA. In an exemplary alternative of this embodiment, the promoter may be operably linked to the cDNA to produce a negative-sense vRNA.
The transcription cassette also includes a terminator sequence, which causes transcriptional termination at the end of the viral cDNA sequence. By way of a non-limiting example, terminator sequences suitable for the invention may include a Pol I terminator, the late SV40 polyadenylation signal, the CMV polyadenylation signal, the bovine growth hormone polyadenylation signal, or a synthetic polyadenylation signal. In some embodiments, the terminators may be different in each transcription cassette. In a preferred embodiment, the terminators may be the same in each transcription cassette. In one alternative of this embodiment, the Pol I terminator may be a human Pol I terminator. In an exemplary embodiment, the terminator is a murine Pol I terminator. In an exemplary alternative of this embodiment, the terminator sequence of the expression cassettes may be a truncated version of the murine Pol I terminator as described in Example 1.
To function properly during replication, vRNAs transcribed from the transcription cassettes generally have precise 5′ and 3′ ends that do not comprise an excess of non-virus sequences. Depending on the promoters and terminators used, this may be accomplished by precise fusion to promoters and terminators or, by way of example, the transcription cassette may comprise ribozymes at the ends of transcripts, wherein the ribozymes cleave the transcript in such a way that the sequences of the 5′ and 3′ termini are generated as found in the vRNA.
As will be appreciated by a skilled artisan, when the expression vector produces influenza virus, the expression vector may comprise at least one transcription cassette for vRNA production. The transcription cassette may be selected from the group consisting of (1) a Pol I promoter operably linked to an influenza virus HA cDNA linked to a Pol I transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus NA cDNA linked to a Pol I transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus M cDNA linked to a Pol I transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NS cDNA linked to a Pol I transcription termination sequence. The expression vector may comprise at least 2, 3, or 4 of these transcription cassettes. In an exemplary embodiment, the expression vector will also include either one or two different nuclear targeting sequences (e.g., SV40 DTS and NF-κB binding sequence).
In an exemplary embodiment when the expression vector produces influenza virus, the expression vector will comprise four transcription cassettes for vRNA production. The transcription cassettes for this embodiment will comprise (1) a Pol I promoter operably linked to an influenza virus HA cDNA linked to a Pol I transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus NA cDNA linked to a Pol I transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus M cDNA linked to a Pol I transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NS cDNA linked to a Pol I transcription termination sequence. In an exemplary embodiment, the expression vector will also include either one or two different nuclear targeting sequences (e.g., SV40 DTS and NF-κB binding sequence).
(c) Transcription Cassettes for vRNA and mRNA Expression
The expression vector comprises at least one transcription cassette for vRNA and mRNA production. Typically, the transcription cassette for vRNA and mRNA production minimally comprises a Pol I promoter operably linked to a viral cDNA linked to a Pol I transcription termination sequence, and a Pol II promoter operably linked to the viral cDNA and a Pol II transcription termination sequence. In an exemplary embodiment, the transcription cassette will also include a nuclear targeting sequence. The number of transcription cassettes for vRNA and mRNA production within the expression vector can and will vary depending on the virus that is produced. For example, the expression vector may comprise two, three, four, five, six, seven, or eight or more transcription cassettes for vRNA and mRNA production. When the virus that is produced is influenza, the expression cassette typically may comprise four transcription cassettes for vRNA and mRNA production.
The viral cDNA, Pol I promoter and Pol I terminator suitable for producing vRNA is as described above in section (b).
For mRNA production, each transcription cassette comprises a Pol II promoter operably linked to cDNA and a Pol II termination sequence. Non-limiting examples of promoters may include the cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, simian virus 40 (SV40) early promoter, ubiquitin C promoter or the elongation factor 1 alpha (EF1α) promoter. In some embodiments, the promoters may be different in each transcription cassette. In preferred embodiments, the promoters may be the same in each transcription cassette. In preferred alternatives of this embodiment, the promoters may be the CMV Pol II promoter. In an exemplary alternative of this embodiment, the promoters are CMV Pol II promoters as described in Example 1.
Each transcription cassette also comprises a Pol II terminator sequence. By way of non-limiting example, terminator sequences suitable for the invention may include the late SV40 polyadenylation signal, the CMV polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, or a synthetic polyadenylation signal. In some embodiments, the terminators may be different in each transcription cassette. In a preferred embodiment, the terminators may be the same in each transcription cassette. In an exemplary embodiment, the terminator is a BGH polyadenylation signal. In an exemplary alternative of this embodiment, the terminator sequence of the expression cassettes may be a truncated version of the BGH polyadenylation signal as described in Example 1.
To function properly in initiating vRNA replication, mRNAs transcribed from the transcription cassettes may contain signals for proper translation by the host cell translation machinery. Most cellular mRNAs transcribed from a Pol II promoter are capped at the 5′ end and polyadenylated at the 3′ end after transcription to facilitate mRNA translation. However, some cellular mRNAs and many viral mRNAs encode other sequences that facilitate translation of the mRNA in the absence of a 5′ cap structure or 3′ polyA structure. By way of example, some cellular mRNAs and viral mRNAs may encode an internal ribosomal entry site (IRES), which could functionally replace the 5′ cap. By way of another example, some mRNAs and viral mRNAs may encode an RNA structure, such as a pseudoknot, at the 3′ end of the mRNA, which could functionally replace the 3′ polyA. In an exemplary embodiment, the mRNAs transcribed from the transcription cassettes are capped at the 5′ end and polyadenylated at the 3′ end.
As will be appreciated by a skilled artisan, when the expression vector produces influenza virus, the expression vector may comprise at least one transcription cassette for vRNA and mRNA production. The transcription cassette may be selected from the group consisting of (1) a Pol I promoter operably linked to an influenza virus PA cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PA cDNA and a Pol II transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus PB1 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB1 cDNA and a Pol II transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus PB2 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB2 cDNA and a Pol II transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NP cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the NP cDNA and a Pol II transcription termination sequence. The expression vector may comprise at least 2, 3, or 4 of these transcription cassettes. In an exemplary embodiment, the expression vector will also include either one or two different nuclear targeting sequences (e.g., SV40 DTS or NF-κB binding sequence).
In an exemplary embodiment when the expression vector produces influenza virus, the expression vector will comprise four transcription cassettes for vRNA and mRNA production. The transcription cassettes for this embodiment will comprise (1) a Pol I promoter operably linked to an influenza virus PA cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PA cDNA and a Pol II transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus PB1 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB1 cDNA and a Pol II transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus PB2 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB2 cDNA and a Pol II transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NP cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the NP cDNA and a Pol II transcription termination sequence. In an exemplary embodiment, each expression plasmid construct will also include either one or two different nuclear translocation signals (e.g., SV40 DTS or NF-κB binding sequence).
In an exemplary iteration of the invention, a single expression vector will comprise all of the genomic segments necessary for the production of influenza virus in a host cell. As detailed above, for the production of influenza virus HA, NA, NS, and M vRNA must be produced and PA, PB1, PB2, and NP vRNA and mRNA must be produced. For this iteration, the expression vector will comprise four transcription cassettes for vRNA production and four transcription cassettes for vRNA and mRNA production. The four cassettes for vRNA production will comprise (1) a Pol I promoter operably linked to an influenza virus HA cDNA linked to a Pol I transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus NA cDNA linked to a Pol I transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus M cDNA linked to a Pol I transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NS cDNA linked to a Pol I transcription termination sequence. The four transcription cassettes for vRNA and mRNA production will comprise (1) a Pol I promoter operably linked to an influenza virus PA cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PA cDNA and a Pol II transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus PB1 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB1 cDNA and a Pol II transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus PB2 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB2 cDNA and a Pol II transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NP cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the NP cDNA and a Pol II transcription termination sequence. The expression vector will preferably also include either one or two different nuclear translocation signals (e.g., SV40 DTS or NF-κB binding sequence). In an exemplary embodiment, the vector is a plasmid. The plasmid will generally be a low or intermediate copy number plasmid. A particularly exemplary expression vector for this embodiment is detailed in the Examples.
The arrangement and direction of transcription cassettes within the single expression vector relative to each other can and will vary without departing from the scope of the invention. It is believed, however, without being bound by any particular theory that arrangement of transcription cassettes in pairs of vRNA cassettes and vRNA and mRNA cassettes is preferable because it may reduce the degree of recombination and as a result, yield an expression vector with increased genetic stability.
It is also envisioned that in certain embodiments, influenza genomic segments may be produced from more than a single expression vector without departing from the scope of the invention. The genomic segments may be produced, for example, from 2, 3, or 4 or more different expression vectors. In an iteration of this embodiment, NS, and M vRNA, and PA, PB1, PB2, and NP vRNA and mRNA are produced from a single expression vector. For this iteration, the expression vector will comprise two transcription cassettes for vRNA production and four transcription cassettes for vRNA and mRNA production. The two transcription cassettes for vRNA production will comprise (1) a Pol I promoter operably linked to an influenza virus M cDNA linked to a Pol I transcription termination sequence; and (2) a Pol I promoter operably linked to an influenza virus NS cDNA linked to a Pol I transcription termination sequence. The four transcription cassettes for vRNA and mRNA production will comprise (1) a Pol I promoter operably linked to an influenza virus PA cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PA cDNA and a Pol II transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus PB1 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB1 cDNA and a Pol II transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus PB2 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB2 cDNA and a Pol II transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NP cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the NP cDNA and a Pol II transcription termination sequence. The expression of HA vRNA and NA vRNA may be from a single expression vector that comprises two transcription cassettes comprising (1) a Pol I promoter operably linked to an influenza virus HA cDNA linked to a Pol I transcription termination sequence; and (2) a Pol I promoter operably linked to an influenza virus NA cDNA linked to a Pol I transcription termination sequence. Alternatively, expression of HA vRNA and NA vRNA may be from two separate expression vectors.
In some embodiments, restriction digestion sites may be placed at convenient locations in the expression vector. By way of example, restriction enzyme sites placed at the extremities of the cDNAs may be used to facilitate replacement of cDNA segments to produce a desired reassortment or strain of the virus. By way of another example, restriction enzyme sites placed at the extremities of the transcription cassettes may be used to facilitate replacement of transcription cassettes to produce a desired reassortment or strain of the virus. Suitable, endonuclease restriction sites include sites that are recognized by restriction enzymes that cleave double-stranded nucleic acid. By way of non-limiting example, these sites may include AarI, AccI, AgeI, Apa, BamHI, BglI, BglII, BsiWI, BssHI, BstBI, ClaI, CviQI, Ddel, DpnI, DraI, EagI, EcoRI, EcoRV, FseI, FspI, HaeII, HaeIII, HhaI, HincII, HindIII, HpaI, HpaII, KpnI, KspI, MboI, MfeI, NaeI, NarI, NcoI, NdeI, NgoMIV, NheI, NotI, PacI, PhoI, PmlI, PstI, PvuI, PvulI, SacI, SacII, SalI, SbfI, SmaI, SpeI, SphI, SrfI, StuI, TaqI, TfiI, TliI, XbaI, XhoI, XmaI, XmnI, and ZraI. In an exemplary alternative of this embodiment, the restriction enzyme site may be AarI.
An additional aspect of the invention comprises a bacterial carrier that can carry and deliver the expression vector described in Section I into a host cell. The host cell may be in vitro (i.e., cultured cells) or in vivo (e.g., an animal) as described in more detail in section III below. The bacterial carrier is typically auxotrophic and may be either a Gram-positive bacterium or Gram-negative bacterium. In this context, the bacterial carrier generally carries at least one gene mutation for an auxotrophic phenotype to enable intracellular release of the expression vector, and at least one gene mutation to enable stable carriage of the expression vector and at least one mutation to impose appropriate attenuation and for other desirable phenotypes such as for escaping the endosome in a eukaryotic cell. Additionally, the bacterial carrier may be a live bacterium or a bacterial ghost. In addition, the bacterial carrier may be attenuated. The bacterial carrier may also carry additional plasmid vectors for better invasion efficiency or for regulated delayed lysis in vivo. Preferably, the bacterial carrier is sensitve to all antimicrobial drugs including antibiotics that might be useful in treating infections with wild-type variants of the particular bacterial carrier being used to deliver the plasmid vector to eukaryotic cells.
As will be appreciated by a skilled artisan, the bacterial carrier may be utilized to deliver a single expression vector or to deliver multiple expression vectors. The single expression vector may encode information for generation of a segmented virus or non-segmented virus; for instance, the expression vector can encode 8 vRNAs, 3 polymerase subunits and nucleoprotein of influenza virus.
Alternatively, the bacterial carrier may be utilized to deliver multiple expression vectors. For example, one p15A ori based expression vector encodes PB2, PB1, PA and NP genes, and the other pBR ori based expression vector encodes HA, NA, M and NS genes.
In yet another embodiment, the bacterial carrier may be utilized to deliver an expression vector for virus generation. For example, the expression vector pYA4519 encodes 8 vRNAs, 3 polymerase subunits and nucleoprotein of influenza virus.
In one embodiment, the bacterial carrier may be utilized to deliver an expression vector in vitro. For instance, the expression vector encodes 8 vRNAs, 3 polymerase subunits and nucleoprotein of influenza virus.
In an alternative embodiment, the bacterial carrier may be utilized to deliver an expression vector in vivo. For example, oral administration with an auxotrophic, attenuated Salmonella Typhimurium carrying pYA4930 designed for regulated delayed lysis to deliver pYA4930 into avians.
In one embodiment, the bacterial carrier may be utilized to deliver an expression vector to humans. By way of non-limiting example, the expression vector encodes HA and NA from epidemic influenza virus, and the other 6 segments from cold-adapted influenza virus (e.g. A/AA/6/60). The polybasic cleavage site in HA will be removed to avoid the generation of reassortant virulent virus in the host. In this embodiment, the vRNAs transcription is regulated by human RNA Pol I promoters, and the transcription of mRNAs is regulated by CMV promoters.
In another embodiment, the bacterial carrier may be utilized to deliver expression vectors into other animals. For example, the expression vector encodes HA and NA from a highly pathogenic avian influenza virus (polybasic cleavage site in HA will be removed to avoid the generation of reassortant virulent virus in the host), and the other 6 segments from a cold-adapted influenza virus (e.g. A/AA/6/60).
In each of the foregoing embodiments, the bacterial carrier may be designed to have host-specificity for and be utilized for primates (e.g., humans, monkeys, chimpanzies etc), poultry (e.g., chickens, turkeys, ducks, geese and other fowl), ruminants (e.g., beef cattle, dairy cattle, and sheep, etc), pigs, and companion animals (e.g., horses, dogs, cats, and other pets).
As will be appreciated by a skilled artisan, suitable bacterial carriers may comprise several different bacterial strains to the extent the bacterial strain is capable of maintaining and delivering an expression vector to a host cell. By way of non-limiting example, the bacterial strain may be Gram-negative bacteria, including Salmonella spp., Shigella spp, Yersinia spp., and engineered Escherichia coli expressing an invasin gene. In a preferred alternative of this embodiment, the bacterium may be a Salmonella enterica serovar. In one alternative of this embodiment, the bacterium may be a Salmonella enterica serovar Abortusovis. In another alternative of this embodiment, the Salmonella bacterium may be Salmonella enterica serovar Typhi. In a preferred embodiment, the bacterium may be a Salmonella enterica serovar Typhimurium (Salmonella Typhimurium). In an exemplary alternative of this embodiment, the Salmonella Typhimurium strain is χ9052 (ΔasdA33 Δalr-3 ΔdadB4). In other exemplary alternatives of this embodiment, the Salmonella Typhimurium strain is χ11017 (ΔasdA27::TT araC PBAD c2 ΔaraBAD23 Δ(gmd-fcl)-26 Δpmi-2426 ΔrelA198::TT araC PBAD lacI ΔPmurA25::araC PBAD murA) or χ11327 (ΔasdA27::TT araC PBAD c2 ΔPmurA25::TT araC PBAD murA ΔaraBAD23 Δ(gmd-fcl)-26 ΔrelA198::araC PBAD lacI TTΔpmi-2426 ΔtlpA181 ΔsseL116 ΔPhilA::Ptrc ΔlacO888 hilA ΔsifA26).
In an alternative of this embodiment, the Salmonella Typhimurium strains may also comprise deletions of the bacterial nucleic acid sequences recA62, recF126 or both. In an alternative of this embodiment, the Salmonella Typhimurium strains may also comprise a deletion of the bacterial nucleic acid sequence for the aroA gene to result in the aroA21419 mutation.
Alternatively, the bacterial strain may be Gram-positive bacteria. By way of non-limiting example, one suitable Gram-positive bacterium is Listeria monocytogenes.
In certain embodiments, the bacterial carrier may be attenuated. By way of example, the bacterial carrier may be live bacteria with appropriate attenuation due to a phoP mutation or other means of attenuation if the carrier is derived from a pathogenic bacterium capable of causing disease. In yet another embodiment, the bacterial carrier may be bacteria with a regulated delayed lysis genotype, such as araC PBAD promoter regulated expression of the murA gene. The live bacteria carrying an expression vector may be induced to express a phage lysis gene E or some other lysis gene to form bacterial ghosts.
In an alternative embodiment, the bacterial carrier may carry a mutation in at least one gene for an auxotrophic phenotype. For example, these genes include, but are not limited to aroA, aroC, aroD, llvC, llvE, asd, murA, dadB, and alr.
In certain embodiments to facilitate stable carriage of an expression vector with repetitive sequences, either recA or recF gene inactivation may be included to reduce either intra- or inter-plasmid recombination.
In certain embodiments the bacterial carrier may carry a sifA mutation to facilitate escape from the endosome.
In other embodiments the bacterial carrier may carry an endA mutation to minimize chances of endonuclease digestion of the expression vector.
Several methods generally known in the art utilized to attenuate a bacterial carrier may be employed without departing from the scope of the invention. Suitable non-limiting examples of such attenuation means include gene mutations in phoP, phoQ, cya, crp, cdt, an aro gene, asd, a dap gene, dadB and alr, murA, nadA, pncB, rpsL, ilvE, rpoS, ompR, htrA, rfc, poxA, dam, hemA, sodC, recA, ssrA, sirA, inv, hilA, rpoE, flgM, tonB, slyA, pmi, galE, galU, mviA, rfaH, a pur gene, a pab gene, and fur.
In a further embodiment, the bacterial carrier may also comprise additional plasmid vectors for improving its invasion efficiency. For example, a plasmid expressing the gene encoding invasin from Yersinia pseudotuberculosis.
In an additional embodiment, the bacterial carrier may comprise additional plasmid vectors for regulated lysis in vivo. For example, the plasmid pYA3681 (araC PBAD promoter regulates expression of asd and murA genes) in strain χ11020.
The expression vector detailed in section (I) may be utilized to produce a segmented virus in vitro or in vivo. Depending upon the intended use, the resulting virus may, by way of example, be purified, attenuated or inactivated. In some embodiments, the virus is purified and used as a seed virus for further production of virus. In other embodiments, the virus is attenuated for use in a vaccine composition. In yet other embodiments, the virus is inactivated for use in a vaccine composition.
In one aspect, the invention provides a method for producing a virus by introducing the expression vector into a eukaryotic cell. The expression vector may be delivered to the cell using transfection. Methods for transfecting nucleic acids are well known to individuals skilled in the art. Transfection methods include, but are not limited to, cationic transfection, liposome transfection, dendrimer transfection, electroporation, heat shock, nucleofection transfection, magnetofection, nanoparticles, biolistic particle delivery (gene gun), and proprietary transfection reagents such as Lipofectamine, Dojindo Hilymax, Fugene, jetPEI, Effectene, DreamFect, or ExGen 500.
The expression vector may also be delivered to the cell using a viral vector. Viral vectors suitable for introducing nucleic acids into cells include retroviruses, vaccinia viruses, adenoviruses, adeno-associated viruses, rhabdoviruses, and herpes viruses.
In some embodiments, the expression vector may be introduced into eukaryotic tissue culture cells in vitro. Non-limiting examples of eukaryotic cells used for virus production in vitro may include human embryonic kidney 293 (HEK293) cells, Madin-Darby canine kidney (MDCK) cells, chicken embryonic fibroblasts (CEFs), African green monkey kidney epithelial (vero) cells, or any variants or combinations thereof. In all such cases, the sequences in all expression cassettes recognized by RNA polymerase I would have to be changed to possess DNA sequences recognized by the RNA polymerase I from the species of animal for the particular cell line. This is because RNA polymerase I are species specific. In a preferred embodiment, the expression vector may be introduced into HEK293 cells. In another preferred embodiment, the expression vector may be introduced into a mixture of CEFs and MDCK cells. Upon introduction of the expression vector into the eukaryotic cells, the host cells may then be cultured under conditions that permit production of viral proteins and vRNAs using tissue culture techniques known in the art. By way of non-limiting example, the expression vector, when introduced into a tissue culture cell, yields 108 PFU/ml or more of influenza virus after 6 days.
In other aspects, the expression vector may be introduced into a eukaryotic cell in an animal. Non-limiting examples of animals where the expression vector may be introduced may include humans, horses, pigs, chickens, ducks, and geese. Methods of delivery of the expression vector to a eukaryotic cell may be as described above.
Alternatively, and in a preferred embodiment of the invention, the expression vector may be delivered into the eukaryotic cell via a carrier bacterium as described in Section II. The carrier bacteria typically deliver the expression vector into the eukaryotic cell cytoplasm. Suitable carrier bacteria are described in more detail in Section II.
In yet other aspects, bacterial carrier mediated expression vector delivery can be used to generate several different groups of viruses, including positive-sense RNA viruses, negative-sense RNA viruses and double-stranded RNA (ds-RNA) viruses. Non-limiting examples of positive-sense RNA virus include viruses of the family Arteriviridae, Caliciviridae, Coronaviridae, Flaviviridae, Picornaviridae, Roniviridae, and Togaviridae. Non-limiting examples of positive-sense RNA viruses may include SARS-coronavirus, Dengue fever virus, hepatitis A virus, hepatitis C virus, Norwalk virus, rubella virus, West Nile virus, Sindbis virus, Semliki forest virus and yellow fever virus. Non-limiting examples of double-stranded RNA viruses may include viruses of the family Reoviridae and may include aquareovirus, coltivirus, cypovirus, fijivirus, idnoreovirus, mycoreovirus, orbivirus, orthoreovirus, oryzavirus, phytoreovirus, rotavirus, infectious bursal disease virus and seadornavirus. Negative-sense RNA viruses may be viruses belonging to the families Orthomyxoviridae, Bunyaviridae, and Arenaviridae with six-to-eight, three, or two negative-sense vRNA segments respectively. Non-limiting examples of negative-sense RNA viruses may include thogotovirus, isavirus, bunyavirus, hantavirus, nairovirus, phlebovirus, tospovirus, tenuivirus, ophiovirus, arenavirus, deltavirus and influenza virus.
In some embodiments, the bacterial carriers are attenuated as detailed in Section II. As previously described, the bacterial carrier may carry one or more mutations for this purpose. Non-limiting examples are the phoP mutation and the pmi mutation. The bacterial carrier may carry one plasmid to express a lysis gene. Non-limiting example is phage lysis gene E expressing plasmid. The bacterial carrier may carry one plasmid, which complement the mutations on the bacterial carrier chromosome to form a regulated delayed lysis system. For example, χ11020 carrying plasmid pYA3681.
In some embodiments, the expression vector may be modified for generation of attenuated virus. The strategies include, but not limiting to (1) using an attenuated virus genome to construct the single expression vector. For example, using HA and NA from epidemic influenza virus and the other segments from attenuated cold-adapted influenza virus (e.g. A/AA/6/60). Meanwhile the polybasic cleavage site has to be removed from the HA protein. (2) Introducing mutations into viral genes to change the protein sequence. For example, introducing mutations into epidemic influenza virus by reverse genetics to attenuate it, so that the generated virus can be used as vaccine seed. The mutations include (i) removing the polybasic cleavage site from HA protein, (ii) truncating the C-terminal end of the NS1 protein, (iii) and introducing mutations into viral polymerase.
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.
The term “cRNA” refers to a positive-sense RNA copy of a vRNA.
The term “vRNA” refers to a negative-sense genomic viral RNA.
The term “vaccine composition” as used herein means a composition that when administered to a host, typically elicits an immune response against the virus. Such compositions are known in the art.
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Bacterial strains, enzymes, plasmids and primers. EPI300™ chemically competent E. coli (Epicentre) was used for all DNA cloning experiments. Restriction enzyme SrfI was bought from Stratagene (La Jolla, Calif.). All other restriction enzymes were from New England Biolabs (Ipswich, Mass.). Plasmids pTM-Pol I-WSN-All and pCAWS-NP were kindly provided by Dr. Yoshihiro Kawaoka (University of Wisconsin—Madison). Plasmid pYS1190 and pIRES-EGFP were gifts from Dr. Yixin Shi (Arizona State University). Primers used in this study are listed in Table 2. Plasmid constructs used in this study are listed in Table 1.
Cell culture. Chicken embryonic fibroblasts (CEFs) were prepared by standard trypsinization of decapitated 8-day old embryos. CEFs, human embryonic kidney (HEK293) cells and Madin-Darby canine kidney (MDCK) cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 μg/ml streptomycin. To co-culture CEFs and MDCK cells, each cell type was grown in 75 cm2 flasks, trypsinized, and ⅓ volume of each was mixed with growth media to a total volume of 40 ml. The mixed cells were seeded into six-well plates at 3 ml per well. All cells were maintained at 37° C. in 5% CO2.
Construction of chicken Pol I promoter-based reporter plasmids. Plasmid pcDNA3.1(−) (Invitrogen, Carlsbad, Calif.) carrying the cytomegalovirus (CMV) promoter and the bovine growth hormone (BGH) polyadenylation signal that together form the Pol II promoter-terminator system, was used to construct vector pYA4379 (SEQ ID NO:57). Briefly, chicken Pol I promoter (CPI) was cloned from chicken genomic DNA (18). The truncated murine Pol I terminator (MTI) was amplified from plasmid pTM-Pol I-WSN-All. Using unique enzyme sites introduced by PCR, CPI region (nt: −415 to −1) and MTI (41 bp) were connected with KpnI site to produce SEQ ID NO:61 (Table 3), and placed between NheI and HindIII on pcDNA3.1(−) downstream of the CMV promoter to construct the bidirectional transcription vector pYA4379 (SEQ ID NO:57) (
TCGGTCGCTTCGCGGAGGTGGCTGGGGCACGGCGGAAC
GGTCTACCTGGTCCCGGCGGGCACCGTCCGGCTCGGTC
TCTCCGCGGCGGCGGCGGCTAGGGGTCGCTGCCGGGG
CGTCTCGGAAACGGCGGAACGGTCTACCCGGGTGCTAC
CGTCTCGCGCTCTCCGCGGCGGCGGCTAGAGGTCGCTG
CCGGGGCGGCTTGCGATCCGCGTCCAGGTCTACCCCGT
TTCGGATTGTCTTGGCCGCTCTGGCTGTGGGGGGGGGC
GCTACAGCTCCGGAGCTGCCAGAGGCGTCGCTGTAATTT
TGTACCTCCAGTTACGTCGAGGTAAACCTCGGCTGCCGT
CGGAGCCGCTGCCGGTAGTCGGCGCCTATGGGACTAGA
ACGTTTTTTTCGGATGCCTTATATGTTCGTCTGTAGGA
GTAC
TGCTCCCCCCCAACTTCGGAGGT
CGACCAGTACTCCGGGCGACAC
Plasmid pIRES-EGFP (Clontech; Mountain View, Calif.) was the source of the enhanced green fluorescent protein (EGFP) gene used to measure promoter activities in plasmids pYA4379 (SEQ ID NO:57) and pYA4380 (SEQ ID NO:58). The EGFP gene was amplified by PCR from pIRES-EGFP using primers that introduce 5′ and 3′ non-translating sequences (NTS) from M segment of the WSN virus. The 5′-NTS-EGFP-NTS-3′ fragment was cloned into the AarI sites in-between CPI and MTI in plasmid pYA4379 (SEQ ID NO:57) and in pYA4380 (SEQ ID NO:58) to obtain plasmids pYA4387 and pYA4392, respectively (
Construction of the 8-unit plasmid pYA4519 (SEQ ID NO:60). The 8-unit plasmid pYA4519 was constructed in four stages: a) Construction of eight 1-unit plasmids. Plasmid pTM-PolI-WSN-All provides the whole set of genomic cDNAs of influenza A/WSN/33 virus. The cDNA fragments for PB2, PB1, PA, and NP were individually transferred into the AarI sites on pYA4379 (SEQ ID NO:57) to obtain plasmids pYA4383, pYA4384, pYA4385, and pYA4386, respectively (Table 1,
The 711 bp mCherry gene was amplified from pYS1190 (Table 1) and cloned between the CMV promoter and BGH terminator sequences on plasmid pcDNA3.1(−) to generate the reference plasmid pYA4731. The CMV-mCherry-BGH-polyA cassette was amplified from pYA4731 and cloned into the SrfI site on plasmid pYA4519 (SEQ ID NO:60) to obtain pYA4732 (pYA4519-mCherry) (Table 1).
Transfection. CEFs and HEK293 cells grown in 6-well plates were transfected according to the manufacturer's instructions. Briefly, 2 μl of Lipofectamine 2000 (Invitrogen) per pg plasmid DNA were individually diluted in 100 μl of Opti-MEM. After 5 min incubation at room temperature (RT), the diluted transfection reagent was mixed with the DNA. After 40 min incubation at RT, the transfection mix was added to pre-washed cells. After further incubation at RT for 3 h, the transfection medium was replaced with DMEM supplemented with 10% FBS. At 24 h post transfection, images were acquired using the Zeiss Axio Cam Mrc-5 mounted onto a Zeiss Axioskop 40-fluorescent microscope.
Virus generation. For generation of influenza virus, CEFs or co-cultured CEFs/MDCK cells were transfected with plasmid DNA as described above. After 3 h incubation, the transfection medium was replaced with 2 ml of Opti-MEM containing 0.3% bovine serum albumin (BSA), penicillin and streptomycin. At 24 hr post transfection, each well was supplemented with 1 ml of Opti-MEM containing 2 μg/ml TPCK-trypsin, 0.3% BSA, penicillin and streptomycin. At three to six days post transfection, cell supernatants were titrated onto MDCK cell monolayers to estimate influenza virus titer. All experiments were done in triplicates.
The bidirectional dual promoter transcription vector pYA4379 (SEQ ID NO:57) was constructed by inserting Pol I promoter-terminator elements in plasmid pcDNA3.1(−). Here, cytomegalovirus promoter (CMV) and bovine growth hormone (BGH) polyadenylation signal (BGH) together constitute the Pol II promoter-terminator unit to synthesize mRNA, whereas, chicken Pol I promoter (CPI) and murine Pol I terminator (MTI) together constitute the Pol I promoter-terminator unit to transcribe antisense RNA of the target gene (
To test the promoter activity in each plasmid, CEFs were independently transfected with plasmids (pYA4387 and pYA4392) and HEK293 cells were transfected with plasmid pYA4688 to monitor EGFP expression as a measure of promoter activity. CEFs tranfected with pYA4387 were visibly green confirming the synthesis of a functional EGFP protein (
We chose influenza A/WSN/33 virus as our model virus and cDNAs for all eight segments were obtained from the plasmid pTM-PolI-WSN-All.
To determine the transfection and nuclear targeting efficiency of pYA4519 (SEQ ID NO:60), we introduced the mCherry gene into the vector pcDNA3.1(−) downstream of the CMV promoter to generate pYA4731 (pcDNA-mCherry). The entire CMV-mCherry-BGH-polyA cassette was then transferred into the 8-unit plasmid pYA4519 (SEQ ID NO:60) to generate pYA4732 (pYA4519-mCherry) and then to compare the expression of the reporter gene in CEFs and HEK293 cells. Expression of the mCherry gene from the reference plasmid pYA4731 was similar in both CEFs and HEK293 cells (
Efficiency of influenza virus recovery was compared between our 1-unit eight-plasmid system (plasmids pYA4383, pYA4384, pYA4385, pYA4386, pYA4388, pYA4389, pYA4390, and pYA4391) and our novel one-plasmid 8-unit system pYA4519 (SEQ ID NO:60). Cultured CEFs were either transfected with pYA4519 (SEQ ID NO:60) or co-transfected with eight plasmids (pYA4383, pYA4384, pYA4385, pYA4386, pYA4388, pYA4389, pYA4390, and pYA4391) to provide all the necessary viral components as described in Materials and Methods. The mean titer at 3-days and 6-days post transfection was approximately 300 and 1×103 PFU/ml influenza viruses, respectively, when transfected with pYA4519 (SEQ ID NO:60), whereas the virus yield using the eight-plasmid method estimated at the same time points was approximately 50 and 700 PFU/ml, respectively, (Table 4). Virus yield was much higher in cocultured CEFs/MDCK cells transfected by plasmid pYA4519 (SEQ ID NO:60) with approximately 1×104 PFU/ml and 1×108 PFU/ml estimated on the 3 and 6 days post transfection, respectively. This was expected as MDCK cells are known to support the growth of influenza virus better than CEF cells. Together these results suggested that recovery of influenza virus from pYA4519 (SEQ ID NO:60) transfected cells was more efficient than from the previously developed eight-plasmid system.
aTriplicate wells.
bPlasmids pYA4383, pYA4384, pYA4385, pYA4386, pYA4388, pYA4389, pYA4390, and PYA4391.
The goal of this study was to construct the influenza virus genome on a single plasmid and rescue the virus from cultured chicken cells. We chose the influenza virus WSN strain as the model virus and with the combination of reverse genetics and the dual promoter system successfully constructed an 8-unit plasmid pYA4519 (SEQ ID NO:60). Care was also taken to limit the use of multiple CMV promoters in our plasmid to reduce the number of repetitive sequences that may promote intra-plasmid recombination and thus decrease plasmid stability. The 8-unit plasmid was designed to produce influenza polymerase complex (PB1, PB2 and PA), nucleoprotein (NP) and 8 viral RNAs (PB1, PB2, PA, NP, HA, NA, M and NS) in avian cells (
Factors such as plasmid constructs used, and the host cell line, affect the efficiency of virus recovery (22), and our study provides additional vital evidence in their support. We compared both transfection and viral recovery efficiency between CEFs and HEK293 cells. Both cell types could be transfected with equal efficiency when smaller size plasmids were used (
Our plasmid construct should also facilitate the design of a much simpler approach to develop influenza vaccine seeds. Currently, influenza vaccine seeds use the “2+6” strategy, in which the HA and NA segments are taken from an epidemic strain and the remaining 6 segments of the influenza viral genome are taken from either the high productive strain PR8 (A/PR/8/34) or the cold-adapted strain (e.g. A/AA/6/60) (4, 10, 12). Construction of one plasmid producing all the necessary backbone segments and proteins from donor virus provides a simpler and more efficient “1+2” approach to generate influenza vaccine seeds.
The currently used influenza vaccines for human use are the inactivated and attenuated forms of the virus and are administered via the intramuscular or the intranasal routes. Manufacturing these vaccines using cell culture or embryonated chicken eggs is both expensive and a time-consuming process. An inexpensive and oral influenza vaccine remains a medical priority, especially for pandemic influenza. Our one plasmid offers a viable option to generate attenuated influenza virus in vivo where the plasmid can be delivered orally or intranasally using a recombinant bacterial strain. Our laboratory has been successful in constructing recombinant attenuated strains of Salmonella enterica Serovar Typhimurium that are designed for enhanced antigen delivery in the host and ensure regulated delayed lysis of the pathogen to inhibit long-term host colonization (5). To construct such an attenuated strain that could effectively deliver plasmid DNA into the host will be the next step towards developing a recombinant bacteria based-vaccine against influenza to be used both in the poultry industry and for pandemic influenza.
In our pilot study, we choose the influenza virus WSN strain for validation of our one-plasmid system. For developing a bacterial based influenza vaccine, the expression vector must be modified to generate attenuated influenza virus. One strategy would be constructing the single expression vector with HA and NA from epidemic influenza virus and the other 6 segments from a cold-adapted influenza strain (e.g. A/AA/6/60) (4, 12). Another strategy is to introduce mutations into viral polymerase coding genes and another to employ a truncated NS1 (nonstructural protein 1) gene to obtain attenuated influenza virus (7, 29, 33). Additionally, the HA segment from influenza vaccine may form a new ressortant virus with the other segments from a preexisting influenza virus in the host. The polybasic cleavage peptides of the HA proteins are required for high pathogenicity of influenza viruses (36). Thus, for vaccine development, the polybasic cleavage site in HA will be replaced with a consensus sequence derived from HA-encoding sequences from avirulent strains (28, 33).
Optimal gene expression from the 8-unit plasmid requires efficient translocation of the plasmid construct into the nucleus of the host cells. Nuclear targeting sequence and NF-κB binding site have been reported to improve the nuclear import of DNA construct (6, 19). In our study, transfection of chicken cells with plasmid pYA4732 did not result in efficient expression of mCherry (Example 3). One possible reason is the lack of a nuclear targeting sequence to facilitate the nuclear import of pYA4732 (and its parental plasmid pYA4519). Here the SV40 nuclear targeting sequence (SV40 DTS) and NF-κB binding site were introduced into plasmid pYA4519 to enhance its nuclear import. The SV40 DTS was obtained from a commercial vector pBICEP-CMV-3 (Sigma) and the NF-κB binding site was obtained from plasmid pYA4545 (from Clonebank in Curtiss' lab). Then they were fused with a kanamycin-resistance cassette (kan) by PCR. The entire fusion fragment was inserted into the SrfI site of pYA4519 to generate pYA4562 (
To mediate the delivery of plasmid DNA, an auxotrophic Salmonella Typhimurium strain χ9052 (ΔasdA33 Δalr-3 ΔdadB4) was selected. Inactivation of the asd gene causes an obligate requirement for the essential amino acid diaminopimelic acid (DAP), whereas inactivation of both the alr and dadB genes confers an absolute requirement for D-alanine. Both DAP and D-alanine are essential unique subunits of the peptidoglycan ridgid layer of the bacterial cell wall. A replicating bacterial cell requires these components for cell wall synthesis and neither of these amino acids is present in animal tissues. In the absence of these nutrients in the host cell, the integrity of the bacterial cell wall is compromised and the bacterium undergoes lysis in the host. Lysis of the intracellular bacterial cell would release the expression vector into the host cytoplasm, and the nuclear targeting sequence(s) on the vector would then promote the translocation of the expression vector into the nucleus, ultimately resulting in the desired expression of viral genes. The conditional growth on LB agar plates with or without supplement(s) was observed for three bacterial carriers, including χ8276 (ΔasdA27), χ8901 (Δalr-3 ΔdadB4) and χ9052 (ΔasdA33 Δalr-3 ΔdadB4). The wild-type S. Typhimurium control strain showed growth on each plate (
For bacterial carrier-mediated plasmid delivery, it is essential that the structural integrity of the target plasmid construct be maintained. RecA and RecF (encoded by genes recA and recF, respectively) catalyze recombination of homologus DNA sequences on one plasmid or between two plasmids. The 8-unit plasmid construct carries numerous such repeated DNA elements in the form of Pol I and Pol II promoters and terminators. These repeated sequences are very good substrates for both RecA- and RecF-enzyme mediated recombination. We hence determined the individual effect of the inactivation of these genes in Salmonella.
The recA and recF deletion mutations were individually introduced into Salmonella Typhimurium χ9052 (ΔasdA33 Δalr-3 ΔdadB4). The resulting strains are χ9834 (ΔasdA33 Δalr-3 ΔdadB4 ΔrecA62) and χ11018 (Δasd-33 Δalr-3 ΔdadB4 ΔrecF126), respectively.
Salmonella strains χ9052, χ9834 and χ11018 were each transformed with plasmid pYA4519, plated onto LB plates and incubated overnight at 37° C. From each strain, a correct clone was obtained and diluted 1:1000 into 3 ml LB medium and grown at 37° C. for 12 h. The dilution and growth process was repeated for 4 additional cycles. Plasmid DNA was extracted from 1.5 ml of culture from each cycle of growth. An aliquot of plasmid from each sample was digested with BamHI and separated on a 1.2% agarose gel. Bacteria from the final cultures were spread onto supplemented LB-agar plates and incubated overnight at 37° C. Plasmid DNA was extracted from single colonies and structural integrity of the plasmid was verified by comparing the restriction profile upon BamHI digestion (
We noted that at time 0, before passage, the plasmid yield from the Rec+ strain, χ9052, was less than that obtained from the two rec mutants. After the second cycle of growth there was a reduction in the amount of DNA in most of the expected bands, indicating that the plasmid structure was deteriorating after each passage. Qualitatively, the plasmid structure appeared to be stable for the first four passages in strains χ9834 (ΔrecA62), and χ11018 (ΔrecF126). In this experiment we demonstrate that deletion of recA and recF in Salmonella Typhimurium significantly minimizes Rec-dependent recombination of the plasmid, thus ensuring structural integrity of our 8-unit plasmid in spite of repetitive sequences.
The goal of this experiment was to determine whether Salmonella could mediate the delivery of the large expression vector into cultured chicken cells. Plasmid pYA4732 (
Salmonella Typhimurium χ9834 carrying pYA4732 was cultured in 3 ml of LB medium containing 100 μg/ml DL-alanine, 50 μg/ml DAP and 25 μg/ml chloramphenicol at 30° C. As a control, the χ9834 carrying pYA4731 was cultured in 3 ml of LB medium containing 100 μg/ml DL-alanine, 50 μg/ml DAP and 100 μg/ml carbencillin at 30° C. The overnight cultures were pelleted and resuspended in DMEM without fetal bovine serum and antibiotics. Chicken embryonic fibroblasts (CEFs) in 6-well plates were incubated with the bacteria at 37° C. for 1 h. 24 h later, the cells were observed under fluorescence microscope. The results showed that the large plasmid pYA4732 could be delivered into cultured chicken fibroblasts and was expressed. In contrast, the small reporter plasmid pYA4731 was more efficiently delivered by the Salmonella carrier (
The goal of this experiment was to determine whether Salmonella-mediated delivery of the 8-unit plasmid into chicken cells leads to the generation of influenza virus. Based on the transfection data (Table 4), the chicken embryonic fibroblasts did not support the replication of the influenza virus WSN strain (no substantial increase of virus titers between the 3rd and 6th day post transfection). The MDCK cells on the other hand are known to support the growth of the influenza virus WSN strain. A co-culture of chicken embryonic fibroblasts (CEFs) and Madin-Darby canine kidney (MDCK) cells supports the propagation of the influenza virus. Virus generated and released from transfected CEFs can infect the adjacent MDCK cells that support replication of the virus. Transfection of co-cultured CEFs/MDCK cells with the 8-unit plasmid pYA4519 resulted in higher titers of influenza virus (Example 4). Salmonella Typhimurium χ9834 carrying pYA4519 or pYA4562 were cultured in 3 ml of LB medium containing 100 μg/ml DL-alanine, 50 μg/ml DAP and 25 μg/ml chloramphenicol at 30° C. with shaking (200 rpm) for 20 h. In each case, 1 ml of bacterial culture was harvested and resuspended in 1 ml of DMEM without fetal bovine serum (FBS) and antibiotics.
CEFs and MDCK cells grown in 75 cm2 flasks were trypsinized, and ⅓ volume of each was mixed with DMEM containing 10% FBS to a total volume of 40 ml. The mixed cells were seeded into six-well plates at 3 ml per well. All cells were maintained at 37° C. in 5% CO2. The cells were washed with DPBS for three times. 100 μl, 200 μl and 500 μl of resuspended bacteria were added into each well. DMEM was added to a final volume of 1 ml and mixed by rocking back and forth. The cells were incubated at 37° C. in a CO2 incubator for 1 h. For each well, media was changed to 2 ml of Opti-MEM containing 0.3% BSA, 10 μg/ml gentamycin. One day post-infection, each well was supplemented with 1 ml of Opti-MEM containing 0.3% BSA, 10 μg/ml gentamycin and 2 μg/ml TPCK-trypsin (The final concentration is 0.7 μg/ml). Six days post-infection, supernatants from each well were collected for hemagglutination tests (Table 5) and TCID50 determinations (
CEFs/MDCK co-culture infected with χ9834 carrying pYA4562 generated higher titers of influenza virus, supporting our hypothesis that inclusion of additional nuclear targeting sequences in the 8-unit plasmid enhances the nuclear translocation, hence the viral yield.
To generate of attenuated influenza virus in vivo and to determine the immune response against the attenuated strain, it is necessary to construct a plasmid encoding an attenuated virus. So that the virus generated in vivo can be determined by virus shielding, and the immune response can be determined by subsequent challenge with influenza virus.
The influenza A virus (A/chicken/TX/167280-4/02(H5N3) is an isolate from White Leghorns chickens. It belongs to a low pathogenic avian influenza virus and causes clinical symptoms such as wheezing and swollen heads. The viral HA segment (AY296085, henceforth referred to as Tx02HA), shares homology with low pathogenic virus (16). It hence makes an ideal challenge strain. On the other hand, an avirulent influenza A virus can be generated from a single expression vector encoding Tx02HA and Tx02NA (NA segments derived from Tx02 virus) segments and the remaining 6 segments from a mouse adapted influenza virus, such as the WSN virus.
Based on these considerations, the Tx02HA and Tx02NA genes were amplified from influenza A virus (A/chicken/TX/167280-4/02(H5N3) by RT-PCR and cloned between CPI and MTI in the p15A ori plasmids pYA4591 and pYA4592 to generate plasmids pYA4593 and pYA4592-Tx02NA. The CPI-Tx02HA-MTI cassette was amplified from pYA4593 to replace the WSN HA cassette in pYA4519 to obtain plasmid pYA4693. The CPI-Tx02NA-MTI cassette was amplified from pYA4592-Tx02NA to replace the WSN NA cassette in pYA4693 to obtain plasmid pYA4929 (
Another feasible alternative is to directly inject this plasmid construct into the target host using a gene gun to also result in the generation of live attenuated influenza virus, which can also stimulate a protective immune response against other related pathogenic strains of influenza virus.
One can also vaccinate in ovo either by directly injecting the plasmid DNA into the embryonated chicken eggs or by bacterial carrier-mediated delivery to generate live attenuated influenza vaccine. Viral yield by direct injection of the plasmid DNA is at least 1000-fold lower than that obtained by delivering the plasmid construct via a bacterial carrier.
Our laboratory has earlier constructed a “lysis-vector” pYA3681 (
Vaccine strain: We have generated various Salmonella Typhimurium strains listed below. We are proposing to introduce ΔrecA62 or ΔrecF126 into some strains to enhance stable maintenance of the expression vector. In other cases, we need to add ΔsifA26 or ΔendA2311 to enable escape from the endosome or prevent endonuclease cutting of released plasmid DNA, respectively. In other cases, the ΔaroA21426 mutation is added to maintain the single 8-unit plasmid specifying synthesis and assembly of influenza virus.
Vaccine vector: We have constructed a 8-unit plasmid pYA4930 with a wild-type aroA cassette (
The χ11020-derived strain with recA deletion (or recF deletion) will be harbored with plasmid pYA4930 and one of the lysis vectors (pYA3681, pYA4589, pYA4595, or pYA4594), so that the regulated lysis of the bacterial carrier will mediate the delivery of plasmid pYA4930.
Vaccination: Chickens will be vaccinated with the above described recombinant strains via three different routes; intranasally, orally, or intramuscularly. The influenza A virus (A/chicken/TX/167280-4/02(H5N3)) is an isolate from White Leghorn chickens. It causes clinical signs, such as wheezing and swollen heads, and belongs to a low pathogenic avian influenza virus (16). This virus will be used to challenge the immunized chickens to evaluate the protection efficiency (clinical symptoms and virus shielding).
1. Bartlett, J. G. 2006. Planning for avian influenza. Ann. Intern. Med. 145:141-144.
2. Bartlett, J. G., and F. G. Hayden. 2005. Influenza A (H5N1): will it be the next pandemic influenza? Are we ready? Ann. Intern. Med. 143:460-462.
3. CDC. 2008. Update: influenza activity—United States, Sep. 30, 2007-Apr. 5, 2008, and composition of the 2008-09 influenza vaccine. MMWR Morb. Mortal. Wkly Rep. 57:404-409.
4. Chen, Z., A. Aspelund, G. Kemble, and H. Jin. 2006. Genetic mapping of the cold-adapted phenotype of B/Ann Arbor/1/66, the master donor virus for live attenuated influenza vaccines (FluMist). Virology 345:416-423.
5. Curtiss, R., 3rd, S. Y. Wanda, B. M. Gunn, X. Zhang, S. A. Tinge, V. Ananthnarayan, H. Mo, S. Wang, and W. Kong. 2009. Salmonella enterica serovar Typhimurium strains with regulated delayed attenuation in vivo. Infect. Immun. 77:1071-1082.
6. Dean, D. A. 1997. Import of plasmid DNA into the nucleus is sequence specific. Exp. Cell Res. 230:293-302.
7. Egorov, A., S. Brandt, S. Sereinig, J. Romanova, B. Ferko, D. Katinger, A. Grassauer, G. Alexandrova, H. Katinger, and T. Muster. 1998. Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. J. Virol. 72:6437-6441.
8. Enami, M., W. Luytjes, M. Krystal, and P. Palese. 1990. Introduction of site-specific mutations into the genome of influenza virus. Proc. Natl. Acad. Sci. USA 87:3802-3805.
9. Fodor, E., L. Devenish, O. G. Engelhardt, P. Palese, G. G. Brownlee, and A. Garcia-Sastre. 1999. Rescue of influenza A virus from recombinant DNA. J. Virol. 73:9679-9682.
10. Gerdil, C. 2003. The annual production cycle for influenza vaccine. Vaccine 21:1776-1779.
11. Hoffmann, E., G. Neumann, G. Hobom, R. G. Webster, and Y. Kawaoka. 2000. “Ambisense” approach for the generation of influenza A virus: vRNA and mRNA synthesis from one template. Virology 267:310-317.
12. Jin, H., B. Lu, H. Zhou, C. Ma, J. Zhao, C. F. Yang, G. Kemble, and H. Greenberg. 2003. Multiple amino acid residues confer temperature sensitivity to human influenza virus vaccine strains (FluMist) derived from cold-adapted A/Ann Arbor/6/60. Virology 306:18-24.
13. Kilbourne, E. D. 1959. Studies on influenza in the pandemic of 1957-1958. III. Isolation of influenza A (Asian strain) viruses from influenza patients with pulmonary complications; details of virus isolation and characterization of isolates, with quantitative comparison of isolation methods. J. Clin. Invest. 38:266-274.
14. Klumpp, K., R. W. Ruigrok, and F. Baudin. 1997. Roles of the influenza virus polymerase and nucleoprotein in forming a functional RNP structure. EMBO J. 16:1248-1257.
15. Kong, W., S. Y. Wanda, X. Zhang, W. Bollen, S. A. Tinge, K. L. Roland, and R. Curtiss, 3rd. 2008. Regulated programmed lysis of recombinant Salmonella in host tissues to release protective antigens and confer biological containment. Proc. Natl. Acad. Sci. USA 105:9361-9366.
16. Lee, C. W., D. A. Senne, J. A. Linares, P. R. Woolcock, D. E. Stallknecht, E. Spackman, D. E. Swayne, and D. L. Suarez. 2004. Characterization of recent H5 subtype avian influenza viruses from US poultry. Avian Pathol. 33:288-297.
17. Luytjes, W., M. Krystal, M. Enami, J. D. Parvin, and P. Palese. 1989. Amplification, expression, and packaging of foreign gene by influenza virus. Cell 59:1107-1113.
18. Massin, P., P. Rodrigues, M. Marasescu, S. van der Werf, and N. Naffakh. 2005. Cloning of the chicken RNA polymerase I promoter and use for reverse genetics of influenza A viruses in avian cells. J. Virol. 79:13811-13816.
19. Mesika, A., I. Grigoreva, M. Zohar, and Z. Reich. 2001. A regulated, NF κB-assisted import of plasmid DNA into mammalian cell nuclei. Mol. Ther. 3:653-657.
20. Molinari, N. A., I. R. Ortega-Sanchez, M. L. Messonnier, W. W. Thompson, P. M. Wortley, E. Weintraub, and C. B. Bridges. 2007. The annual impact of seasonal influenza in the US: measuring disease burden and costs. Vaccine 25:5086-5096.
21. Murti, K. G., R. G. Webster, and I. M. Jones. 1988. Localization of RNA polymerases on influenza viral ribonucleoproteins by immunogold labeling. Virology 164:562-566.
22. Neumann, G., K. Fujii, Y. Kino, and Y. Kawaoka. 2005. An improved reverse genetics system for influenza A virus generation and its implications for vaccine production. Proc. Natl. Acad. Sci. USA 102:16825-16829.
23. Neumann, G., T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, and Y. Kawaoka. 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. USA 96:9345-9350.
24. Neumann, G., A. Zobel, and G. Hobom. 1994. RNA polymerase I-mediated expression of influenza viral RNA molecules. Virology 202:477-479.
25. Noda, T., H. Sagara, A. Yen, A. Takada, H. Kida, R. H. Cheng, and Y. Kawaoka. 2006. Architecture of ribonucleoprotein complexes in influenza A virus particles. Nature 439:490-492.
26. Osterholm, M. T. 2005. Preparing for the next pandemic. N. Engl. J. Med. 352:1839-1842.
27. Ozaki, H., E. A. Govorkova, C. Li, X. Xiong, R. G. Webster, and R. J. Webby. 2004. Generation of high-yielding influenza A viruses in African green monkey kidney (Vero) cells by reverse genetics. J. Virol. 78:1851-1857.
28. Park, M. S., J. Steel, A. Garcia-Sastre, D. Swayne, and P. Palese. 2006. Engineered viral vaccine constructs with dual specificity: avian influenza and Newcastle disease. Proc. Natl. Acad. Sci. USA 103:8203-8208.
29. Quinlivan, M., D. Zamarin, A. Garcia-Sastre, A. Cullinane, T. Chambers, and P. Palese. 2005. Attenuation of equine influenza viruses through truncations of the NS1 protein. J. Virol. 79:8431-8439.
30. Rand, K. N. 1996. Crystal violet can be used to visualize DNA bands during gel electrophoresis and to improve cloning efficiency. Tech. Tips Online. http://www.science-direct.com/science/journal/13662120.
31. Schulman, J. L., and E. D. Kilbourne. 1969. Independent variation in nature of hemagglutinin and neuraminidase antigens of influenza virus: distinctiveness of hemagglutinin antigen of Hong Kong-68 virus. Proc. Natl. Acad. Sci. USA 63:326-333.
32. Simonsen, L., K. Fukuda, L. B. Schonberger, and N. J. Cox. 2000. The impact of influenza epidemics on hospitalizations. J. Infect. Dis. 181:831-837.
33. Steel, J., A. C. Lowen, L. Pena, M. Angel, A. Solorzano, R. Albrecht, D. R. Perez, A. Garcia-Sastre, and P. Palese. 2009. Live attenuated influenza viruses containing NS1 truncations as vaccine candidates against H5N1 highly pathogenic avian influenza. J. Virol. 83:1742-1753.
34. Taubenberger, J. K., and D. M. Morens. 2006. 1918 Influenza: the mother of all pandemics. Emerg. Infect. Dis. 12:15-22.
35. Tumpey, T. M., C. F. Basler, P. V. Aguilar, H. Zeng, A. Solorzano, D. E. Swayne, N. J. Cox, J. M. Katz, J. K. Taubenberger, P. Palese, and A. Garcia-Sastre. 2005. Characterization of the reconstructed 1918 Spanish influenza pandemic virus. Science 310:77-80.
36. Webster, R. G., W. J. Bean, O. T. Gorman, T. M. Chambers, and Y. Kawaoka. 1992. Evolution and ecology of influenza A viruses. Microbiol Rev 56:152-79.
37. Zobel, A., G. Neumann, and G. Hobom. 1993. RNA polymerase I catalysed transcription of insert viral cDNA. Nucleic. Acids. Res. 21:3607-3614.
Sequences of this Study.
All influenza A/WSN/33 virus genes were derived from plasmid pTM-PolI-WSN-All (A gift from Dr. Yoshihiro Kawaoka, University of Wisconsin—Madison). The sequence of each gene was listed as following.
This invention was made with government support under RO1 AI065779 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61168996 | Apr 2009 | US |
