The invention encompasses an expression vector and a bacterial carrier. The expression vector is capable of generating a virus after being delivered into host cells. The bacterial carrier of the invention may be utilized to deliver the expression vector into host cells. The virus produced in the host cells from the expression vector may be either attenuated or not attenuated.
Influenza virus has caused three recorded pandemics. The 1918 influenza pandemic, also known as Spanish influenza, caused at least 675,000 deaths in the U.S. alone and up to 50 million deaths worldwide (1, 34). The 1957 influenza pandemic caused at least 70,000 deaths in U.S. and 1-2 million deaths worldwide (2, WHO). The 1968 influenza pandemic caused about 34,000 deaths in U.S. and 700,000 deaths worldwide (2, WHO). Since 2003, there were 411 human cases and 256 deaths of avian influenza from 15 countries (WHO). The estimated mortality is more than 60%, making the highly pathogenic H5N1 avian influenza virus a potential candidate for the next influenza pandemic. The economic consequences of such a pandemic due to morbidity and health care delivery would be staggering.
The annual economic burden of influenza epidemics is also enormous. During a typical year in the United States, 30,000 to 50,000 persons die as a result of influenza virus infection, and the global death toll is about 20 to 30 times higher than the toll in this country (26). Based on the 2003 US population, annual influenza epidemics result in an average of 610,660 life-years lost, 3.1 million hospitalized days, and 31.4 million outpatient visits with the total direct medical costs averaging up to $10.4 billion annually. Projected lost earnings due to illness and loss of life amounted to $16.3 billion annually. The total economic burden of annual influenza epidemics using projected statistical life values amounted to $87.1 billion (20). The aforementioned socio-economic factors make influenza one of the critical infectious agents and hence a vaccine to prevent the resulting pandemics is highly warranted.
The three-recorded pandemics and most yearly global outbreaks of influenza are caused by influenza A virus (3, 13, 31, 32, 35). The virus belongs to the family Orthomyxoviridae, and contains a segmented negative-strand RNA genome. Influenza viral RNAs (vRNAs) associate with influenza RNA polymerase complex (PBI, PB2, PA), and nucleoprotein (NP) to make up a set of ribonucleoproteins (RNPs) (14, 21, 25). RNPs are both critical and essential constituents that mediate transcription or replication of vRNA. RNP can be reconstituted in vitro by incubating purified influenza polymerase and nucleoprotein with vRNA transcribed from template DNA (17). The reconstituted RNP has catalytic properties very similar to those of native viral RNP complexes. In the presence of influenza helper virus the recombinant RNP can be amplified and packaged into virus particles in a eukaryotic host cell, a process commonly known as RNP transfection (17) that also enables site-directed mutagenesis of any single component of the influenza virus genome (8). However, the need to select recombinant virus from the mixture of helper viruses and low viral yield demand more sophisticated approaches for the construction of recombinant influenza virus for the production of vaccines that need to be modified annually.
Effort to construct recombinant influenza virus using modern genetic tools for potential application in vaccines has escalated since the early 1990's. The primary objective is to generate influenza virus from plasmid constructs that can be transfected into a broad range of host cells to provide high viral yields with minimum selection from helper virus. In vivo synthesis of vRNA-like molecules was introduced by using RNA polymerase I (Pol I) dependent transcription of viral RNA (24, 37). In a typical plasmid construct, influenza cDNA is inserted precisely between the murine Pol I promoter and terminator sequences. Upon transfection, vRNA synthesized in the cells is bound by influenza polymerase and nucleoprotein that are provided by helper viruses. However, one major disadvantage in this technique is the cumbersome process of selecting recombinant influenza from the mixture containing the helper viruses. By combining intracellular synthesis of vRNAs and proteins, two reverse genetics systems free of helper virus were established by co-transfection of 12-17 plasmids (9, 23). Both systems utilize eight plasmids to encode vRNAs and four plasmids to encode three viral polymerase subunits and a nucleoprotein. The addition of plasmids expressing the remaining viral structural proteins led to a substantial increase in virus production. Thus, limiting the number of plasmid constructs to generate influenza virus still remained a challenge.
The “ambisense” approach that utilizes two promoters on a bidirectional transcription vector is the first major breakthrough to reduce the number of plasmids required for virus generation (11). In this approach, a Pol I promoter drives the synthesis of vRNA from a cDNA template, whereas, RNA polymerase II (Pol II) promoter drives the synthesis of mRNA from the same template in the opposite direction. A system with eight plasmids (i.e., an eight-plasmid system) was developed using the dual promoter technique, which successfully recovered influenza virus from Vero cells (11). A unidirectional Pol I-Pol II transcription system was also reported, however, it suffers from lower viral yield (11). A much-improved method is the generation of influenza virus using a three-plasmid based reverse genetics system (22). Here, one plasmid carries eight Pol I promoter-driven vRNA transcribing cassettes, another plasmid encodes the three viral polymerase subunits and the third plasmid encodes the nucleoprotein. This three-plasmid system, although arduous to construct, yields higher titers of influenza virus than any of the earlier approaches (22). Use of this technique to generate seed for influenza vaccine would thus require two plasmids individually providing HA and NA from epidemic virus, and three plasmid constructs together to provide the remaining components, making it a “2+3” approach.
Vaccines are necessary to prevent influenza outbreaks. To date, the inactivated and attenuated influenza vaccines commercially available for humans are administered either by injection or by nasal-spray. Influenza vaccine seeds are generated by DNA constructs based on reverse genetics system using the “2+6” strategy, where the HA and NA segments are taken from the circulating strain of influenza virus and the remaining 6 structural segments are taken from either the high productive strain PR8 (A/PR/8/34) or the cold-adapted strain (e.g. A/AA/6/60) (4, 10, 12). The current technology in making influenza vaccines relies on using embryonated eggs, which is time-consuming (takes up to four months), has low viral yield and is a cumbersome procedure.
Use of bacterial species to deliver plasmid DNA encoding viral components in the target host cell is an economical and less cumbersome approach to develop vaccines against influenza virus. However, the challenge would be to minimize the number of plasmid constructs so that it would be much easier to ensure the down stream processes involved in virus generation in a eukaryotic host cell.
The above-mentioned factors present a strong need for a single plasmid system for generating influenza virus to develop an inexpensive, ease of manufacture, quickly modifiable and needle-free influenza vaccine. The present invention addresses the design of a single expression vector for generation of virus, and a bacterial carrier based virus generation system, which could be used to develop vaccines against corresponding viral diseases.
The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
A single expression vector capable of generating an attenuated virus from a segmented genome has been developed. An auxotrophic bacterial carrier can carry and deliver this expression vector into in vitro cultured cells, resulting in the recovery of virus, either attenuated or non-attenuated. The invention greatly simplifies the process of producing viruses that have segmented genomes, which historically have required transfection of multiple expression vectors for vRNA expression, in addition to vectors for expressing mRNAs for translation to viral replication proteins. Advantageously, as illustrated in the examples, the expression vector is stable in bacteria at 37° C., and produces higher titers of virus than traditional multi-vector systems when transfected into eukaryotic cells. This invention also demonstrates that bacterial carrier mediated delivery of such an expression vector can lead to the generation of virus. Therefore, this invention provides a system for bacterial carrier based delivery of attenuated viral vaccines with advantages of low cost, ease of manufacture, flexibility in introducing desired alterations, and finally, needle-free administration.
I. Expression Vector
The expression vector generally comprises a plasmid having at least two types of transcription cassettes. One transcription cassette is designed for vRNA production. The other transcription cassette is designed for the production of both vRNAs, and mRNAs. As will be appreciated by a skilled artisan, the number of transcription cassettes, and their placement within the vector relative to each other, can and will vary depending on the segmented virus that is produced. Each of these components of the expression vector is described in more detail below.
The expression vector may be utilized to produce several different segmented and nonsegmented viruses. Viruses that may be produced from the expression vector include positive-sense RNA viruses, negative-sense RNA viruses and double-stranded RNA (ds-RNA) viruses.
In one embodiment, the virus may be a positive-sense RNA virus. Non-limiting examples of positive-sense RNA virus may include viruses of the family Arteriviridae, Caliciviridae, Coronaviridae, Flaviviridae, Picornaviridae, Roniviridae, and Togaviridae. Non-limiting examples of positive-sense RNA viruses may include SARS-coronavirus, Dengue fever virus, hepatitis A virus, hepatitis C virus, Norwalk virus, rubella virus, West Nile virus, Sindbis virus, Semliki forest virus and yellow fever virus.
In one embodiment, the virus may be a double-stranded RNA virus. Non-limiting examples of segmented double-stranded RNA viruses may include viruses of the family Reoviridae and may include aquareovirus, blue tongue virus, coltivirus, cypovirus, fijivirus, idnoreovirus, mycoreovirus, orbivirus, orthoreovirus, oryzavirus, phytoreovirus, rotavirus, infectious bursal disease virus and seadornavirus.
In yet another embodiment, the virus may be a negative-sense RNA virus. Negative-sense RNA viruses may be viruses belonging to the families Orthomyxoviridae, Bunyaviridae, and Arenaviridae with six-to-eight, three, or two negative-sense vRNA segments, respectively. Non-limiting examples of negative-sense RNA viruses may include thogotovirus, isavirus, bunyavirus, hantavirus, nairovirus, phlebovirus, tospovirus, tenuivirus, ophiovirus, arenavirus, deltavirus and influenza virus.
In another aspect, the invention provides an expression vector capable of generating influenza virus. There are three known genera of influenza virus: influenza A virus, influenza B virus and influenza C virus. Each of these types of influenza viruses may be produced utilizing the single expression vector of the invention.
In one exemplary embodiment, the expression vector is utilized to produce Influenza A virus. Influenza A viruses possess a genome of 8 vRNA segments, including PA, PB1, PB2, HA, NP, NA, M and NS, which encode a total of ten to eleven proteins. To initiate the replication cycle, vRNAs and viral replication proteins must form viral ribonucleoproteins (RNPs). The influenza RNPs consist of the negative-sense viral RNAs (vRNAs) encapsidated by the viral nucleoprotein, and the viral polymerase complex, which is formed by the PA, PB1 and PB2 proteins. The RNA polymerase complex catalyzes three different reactions: synthesis of an mRNA with a 5′ cap and 3′ polyA structure essential for translation by the host translation machinery; a full length complementary RNA (cRNA), and of genomic vRNAs using the cRNAs as a template. Newly synthesized vRNAs, NP and, PB1, PB2 and PA polymerase proteins are then assembled into new RNPs, for further replication or encapsidation and release of progeny virus particles. Therefore, to produce influenza virus using a reverse genetics system, all 8 vRNAs and mRNAs that express the viral proteins essential for replication (NP, PB1, PB1 and PA), must be synthesized. The expression vector of the invention may be utilized to produce all of these vRNAs and mRNAs.
The expression vector may also be utilized to produce any serotype of influenza A virus without departing from the scope of the invention. Influenza A viruses are classified into serotypes based upon the antibody response to the viral surface proteins hemagglutinin (HA or H) encoded by the HA vRNA segment, and neuraminidase (NA or N) encoded by the NA vRNA segment. At least sixteen H subtypes (or serotypes) and nine N subtypes of influenza A virus have been identified. New influenza viruses are constantly being produced by mutation or by reassortment of the 8 vRNA segments when more than one influenza virus infects a single host. By way of example, known influenza serotypes may include H1N1, H1N2, H2N2, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N8, H5N9, H7N1, H7N2, H7N3, H7N4, H7N7, H9N2, and H10N7 serotypes.
(a) Vector
The expression vector of the invention comprises a vector. As used herein, “vector” refers to an autonomously replicating nucleic acid unit. The present invention can be practiced with any known type of vector, including viral, cosmid, phasmid, and plasmid vectors. The most preferred type of vector is a plasmid vector. As is well known in the art, plasmids and other vectors may possess a wide array of promoters, multiple cloning sequences, and transcription terminators.
The vector may have a high copy number, an intermediate copy number, or a low copy number. The copy number may be utilized to control the expression level for the transcription cassettes, and as a means to control the expression vector's stability. In one embodiment, a high copy number vector may be utilized. A high copy number vector may have at least 31, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 copies per bacterial cell. In other embodiments, the high copy number vector may have at least 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 copies per bacterial cell. Non-limiting examples of high copy number vectors may include a vector comprising the pBR ori or the pUC ori. In an alternative embodiment, a low copy number vector may be utilized. For example, a low copy number vector may have one or at least two, three, four, five, six, seven, eight, nine, or ten copies per bacterial cell. A non-limiting example of low copy number vector may be a vector comprising the pSC101 ori. In an exemplary embodiment, an intermediate copy number vector may be used. For instance, an intermediate copy number vector may have at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 copies per bacterial cell. A non-limiting example of an intermediate copy number vector may be a vector comprising the p15A ori.
The vector may further comprise a selectable marker. Generally speaking, a selectable marker encodes a product that the host cell cannot make, such that the cell acquires resistance to a specific compound or is able to survive under specific conditions. For example, the marker may code for an antibiotic resistance factor. Suitable examples of antibiotic resistance markers include, but are not limited to, those coding for proteins that impart resistance to kanamycin, spectomycin, neomycin, gentamycin (G418), ampicillin, tetracycline, and chlorampenicol. However, use of selective markers for drug resistance is undesirable for live attenuated bacterial vaccines and delivery systems and is also undesirable for DNA vaccines. Thus in still other cases, the vector might preferably have selectable Asd+, MurA+, AroA+, DadB+, Alr+, AroC+, AroD+, IlvC+ and/or IlvE+ when the expression vector is used in a balanced-lethal or balanced-attenuation vector-host system when present in and delivered by carrier bacteria.
In some embodiments, the vector may also comprise a transcription cassette for expressing non-viral reporter proteins. By way of example, reporter proteins may include a fluorescent protein, luciferase, alkaline phosphatase, beta-galactosidase, beta-lactamase, horseradish peroxidase, and variants thereof.
In some embodiments, the vector may also comprise a DNA nuclear targeting sequence (DTS). A non-limiting example of a DTS may include the SV40 DNA nuclear targeting sequence.
In some embodiments, the vector may also comprise a NF-κB binding site. The SV40 DTS and NF-κB binding sequence facilitate nuclear import of the plasmid DNA, and this facilitates transcription of genetic sequences on the vector.
(b) Transcription Cassettes for vRNAs Expression
The expression vector comprises at least one transcription cassette for vRNA production. Generally speaking, the transcription cassette for vRNA production minimally comprises a Pol I promoter operably linked to a viral cDNA linked to a Pol I transcription termination sequence. In an exemplary embodiment, the transcription cassette will also include a nuclear targeting sequence. The number of transcription cassettes for vRNA production within the expression vector can and will vary depending on the virus that is produced. For example, the expression vector may comprise two, three, four, five, six, seven, or eight or more transcription cassettes for vRNA production. When the virus that is produced is influenza, the expression cassette typically will comprise four transcription cassettes for vRNA production.
The term “viral cDNA”, as used herein, refers to a copy of deoxyribonucleic acid (cDNA) sequence corresponding to a vRNA segment of an RNA virus genome. cDNA copies of viral RNA segments may be derived from vRNAs using standard molecular biology techniques known in the art (see, e.g., Sambrook et al. (1989) “Molecular Cloning: A Laboratory Manual,” 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, and Knipe et al (2006) “Fields Virology”, Fifth Edition, Lippincott Williams & Wilkins (2007). In some embodiments, the cDNA may be derived from a naturally occurring virus strain or a virus strain commonly used in vitro. In other embodiments, the cDNA may be derived synthetically by generating the cDNA sequence in vitro using methods known in the art. The natural or synthetic cDNA sequence may further be altered to introduce mutations and sequence changes. By way of example, a naturally occurring viral sequence may be altered to attenuate a virus, to adapt a virus for in vitro culture, or to tag the encoded viral proteins.
The selection of promoter can and will vary. The term “promoter”, as used herein, may mean a synthetic or naturally derived molecule that is capable of conferring, activating or enhancing expression of a nucleic acid. A promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or to alter the spatial expression and/or temporal expression of a nucleic acid. The term “operably linked,” as used herein, may mean that expression of a nucleic acid is under the control of a promoter with which it is spatially connected. A promoter may be positioned 5′ (upstream) of the nucleic acid under its control. The distance between the promoter and a nucleic acid to be expressed may be approximately the same as the distance between that promoter and the nucleic acid sequence it controls. As is known in the art, variation in this distance may be accommodated without loss of promoter function. The promoters may be of viral, prokaryotic, phage or eukaryotic origin. Non-limiting examples of promoters may include T7 promoter, T3 promoter, SP6 promoter, RNA polymerase I promoter and combinations thereof. In some embodiments, the promoters may be different in each transcription cassette. In preferred embodiments, the promoters may be the same in each transcription cassette. In preferred alternatives of this embodiment, the promoters may be RNA polymerase I (Pol I) promoters. In an exemplary alternative of this embodiment, the promoters may be human Pol I promoters. In another exemplary alternative of this embodiment, the promoters may be chicken Pol I promoters. In a further exemplary alternative of this embodiment, the promoters are human Pol I promoters as described in Example 1. In another exemplary alternative of this embodiment, the promoters are chicken Pol I promoters as described in Example 1.
The promoter may be operably linked to the cDNA to produce a negative-sense vRNA or a positive-sense cRNA. In an exemplary alternative of this embodiment, the promoter may be operably linked to the cDNA to produce a negative-sense vRNA.
The transcription cassette also includes a terminator sequence, which causes transcriptional termination at the end of the viral cDNA sequence. By way of a non-limiting example, terminator sequences suitable for the invention may include a Pol I terminator, the late SV40 polyadenylation signal, the CMV polyadenylation signal, the bovine growth hormone polyadenylation signal, or a synthetic polyadenylation signal. In some embodiments, the terminators may be different in each transcription cassette. In a preferred embodiment, the terminators may be the same in each transcription cassette. In one alternative of this embodiment, the Pol I terminator may be a human Pol I terminator. In an exemplary embodiment, the terminator is a murine Pol I terminator. In an exemplary alternative of this embodiment, the terminator sequence of the expression cassettes may be a truncated version of the murine Pol I terminator as described in Example 1.
To function properly during replication, vRNAs transcribed from the transcription cassettes generally have precise 5′ and 3′ ends that do not comprise an excess of non-virus sequences. Depending on the promoters and terminators used, this may be accomplished by precise fusion to promoters and terminators or, by way of example, the transcription cassette may comprise ribozymes at the ends of transcripts, wherein the ribozymes cleave the transcript in such a way that the sequences of the 5′ and 3′ termini are generated as found in the vRNA.
As will be appreciated by a skilled artisan, when the expression vector produces influenza virus, the expression vector may comprise at least one transcription cassette for vRNA production. The transcription cassette may be selected from the group consisting of (1) a Pol I promoter operably linked to an influenza virus HA cDNA linked to a Pol I transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus NA cDNA linked to a Pol I transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus M cDNA linked to a Pol I transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NS cDNA linked to a Pol I transcription termination sequence. The expression vector may comprise at least 2, 3, or 4 of these transcription cassettes. In an exemplary embodiment, the expression vector will also include either one or two different nuclear targeting sequences (e.g., SV40 DTS and NF-κB binding sequence).
In an exemplary embodiment when the expression vector produces influenza virus, the expression vector will comprise four transcription cassettes for vRNA production. The transcription cassettes for this embodiment will comprise (1) a Pol I promoter operably linked to an influenza virus HA cDNA linked to a Pol I transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus NA cDNA linked to a Pol I transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus M cDNA linked to a Pol I transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NS cDNA linked to a Pol I transcription termination sequence. In an exemplary embodiment, the expression vector will also include either one or two different nuclear targeting sequences (e.g., SV40 DTS and NF-κB binding sequence).
(c) Transcription Cassettes for vRNA and mRNA Expression
The expression vector comprises at least one transcription cassette for vRNA and mRNA production. Typically, the transcription cassette for vRNA and mRNA production minimally comprises a Pol I promoter operably linked to a viral cDNA linked to a Pol I transcription termination sequence, and a Pol II promoter operably linked to the viral cDNA and a Pol II transcription termination sequence. In an exemplary embodiment, the transcription cassette will also include a nuclear targeting sequence. The number of transcription cassettes for vRNA and mRNA production within the expression vector can and will vary depending on the virus that is produced. For example, the expression vector may comprise two, three, four, five, six, seven, or eight or more transcription cassettes for vRNA and mRNA production. When the virus that is produced is influenza, the expression cassette typically may comprise four transcription cassettes for vRNA and mRNA production.
The viral cDNA, Pol I promoter and Pol I terminator suitable for producing vRNA is as described above in section (b).
For mRNA production, each transcription cassette comprises a Pol II promoter operably linked to cDNA and a Pol II termination sequence. Non-limiting examples of promoters may include the cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, simian virus 40 (SV40) early promoter, ubiquitin C promoter or the elongation factor 1 alpha (EF1α) promoter. In some embodiments, the promoters may be different in each transcription cassette. In preferred embodiments, the promoters may be the same in each transcription cassette. In preferred alternatives of this embodiment, the promoters may be the CMV Pol II promoter. In an exemplary alternative of this embodiment, the promoters are CMV Pol II promoters as described in Example 1.
Each transcription cassette also comprises a Pol II terminator sequence. By way of non-limiting example, terminator sequences suitable for the invention may include the late SV40 polyadenylation signal, the CMV polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, or a synthetic polyadenylation signal. In some embodiments, the terminators may be different in each transcription cassette. In a preferred embodiment, the terminators may be the same in each transcription cassette. In an exemplary embodiment, the terminator is a BGH polyadenylation signal. In an exemplary alternative of this embodiment, the terminator sequence of the expression cassettes may be a truncated version of the BGH polyadenylation signal as described in Example 1.
To function properly in initiating vRNA replication, mRNAs transcribed from the transcription cassettes may contain signals for proper translation by the host cell translation machinery. Most cellular mRNAs transcribed from a Pol II promoter are capped at the 5′ end and polyadenylated at the 3′ end after transcription to facilitate mRNA translation. However, some cellular mRNAs and many viral mRNAs encode other sequences that facilitate translation of the mRNA in the absence of a 5′ cap structure or 3′ polyA structure. By way of example, some cellular mRNAs and viral mRNAs may encode an internal ribosomal entry site (IRES), which could functionally replace the 5′ cap. By way of another example, some mRNAs and viral mRNAs may encode an RNA structure, such as a pseudoknot, at the 3′ end of the mRNA, which could functionally replace the 3′ polyA. In an exemplary embodiment, the mRNAs transcribed from the transcription cassettes are capped at the 5′ end and polyadenylated at the 3′ end.
As will be appreciated by a skilled artisan, when the expression vector produces influenza virus, the expression vector may comprise at least one transcription cassette for vRNA and mRNA production. The transcription cassette may be selected from the group consisting of (1) a Pol I promoter operably linked to an influenza virus PA cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PA cDNA and a Pol II transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus PB1 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB1 cDNA and a Pol II transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus PB2 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB2 cDNA and a Pol II transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NP cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the NP cDNA and a Pol II transcription termination sequence. The expression vector may comprise at least 2, 3, or 4 of these transcription cassettes. In an exemplary embodiment, the expression vector will also include either one or two different nuclear targeting sequences (e.g., SV40 DTS or NF-κB binding sequence).
In an exemplary embodiment when the expression vector produces influenza virus, the expression vector will comprise four transcription cassettes for vRNA and mRNA production. The transcription cassettes for this embodiment will comprise (1) a Pol I promoter operably linked to an influenza virus PA cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PA cDNA and a Pol II transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus PB1 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB1 cDNA and a Pol II transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus PB2 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB2 cDNA and a Pol II transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NP cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the NP cDNA and a Pol II transcription termination sequence. In an exemplary embodiment, each expression plasmid construct will also include either one or two different nuclear translocation signals (e.g., SV40 DTS or NF-κB binding sequence).
(d) Exemplary Expression Vectors
In an exemplary iteration of the invention, a single expression vector will comprise all of the genomic segments necessary for the production of influenza virus in a host cell. As detailed above, for the production of influenza virus HA, NA, NS, and M vRNA must be produced and PA, PB1, PB2, and NP vRNA and mRNA must be produced. For this iteration, the expression vector will comprise four transcription cassettes for vRNA production and four transcription cassettes for vRNA and mRNA production. The four cassettes for vRNA production will comprise (1) a Pol I promoter operably linked to an influenza virus HA cDNA linked to a Pol I transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus NA cDNA linked to a Pol I transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus M cDNA linked to a Pol I transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NS cDNA linked to a Pol I transcription termination sequence. The four transcription cassettes for vRNA and mRNA production will comprise (1) a Pol I promoter operably linked to an influenza virus PA cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PA cDNA and a Pol II transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus PB1 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB1 cDNA and a Pol II transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus PB2 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB2 cDNA and a Pol II transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NP cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the NP cDNA and a Pol II transcription termination sequence. The expression vector will preferably also include either one or two different nuclear translocation signals (e.g., SV40 DTS or NF-κB binding sequence). In an exemplary embodiment, the vector is a plasmid. The plasmid will generally be a low or intermediate copy number plasmid. A particularly exemplary expression vector for this embodiment is detailed in the Examples.
The arrangement and direction of transcription cassettes within the single expression vector relative to each other can and will vary without departing from the scope of the invention. It is believed, however, without being bound by any particular theory that arrangement of transcription cassettes in pairs of vRNA cassettes and vRNA and mRNA cassettes is preferable because it may reduce the degree of recombination and as a result, yield an expression vector with increased genetic stability.
It is also envisioned that in certain embodiments, influenza genomic segments may be produced from more than a single expression vector without departing from the scope of the invention. The genomic segments may be produced, for example, from 2, 3, or 4 or more different expression vectors. In an iteration of this embodiment, NS, and M vRNA, and PA, PB1, PB2, and NP vRNA and mRNA are produced from a single expression vector. For this iteration, the expression vector will comprise two transcription cassettes for vRNA production and four transcription cassettes for vRNA and mRNA production. The two transcription cassettes for vRNA production will comprise (1) a Pol I promoter operably linked to an influenza virus M cDNA linked to a Pol I transcription termination sequence; and (2) a Pol I promoter operably linked to an influenza virus NS cDNA linked to a Pol I transcription termination sequence. The four transcription cassettes for vRNA and mRNA production will comprise (1) a Pol I promoter operably linked to an influenza virus PA cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PA cDNA and a Pol II transcription termination sequence; (2) a Pol I promoter operably linked to an influenza virus PB1 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB1 cDNA and a Pol II transcription termination sequence; (3) a Pol I promoter operably linked to an influenza virus PB2 cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the PB2 cDNA and a Pol II transcription termination sequence; and (4) a Pol I promoter operably linked to an influenza virus NP cDNA linked to a Pol I transcription termination sequence and a Pol II promoter operably linked to the NP cDNA and a Pol II transcription termination sequence. The expression of HA vRNA and NA vRNA may be from a single expression vector that comprises two transcription cassettes comprising (1) a Pol I promoter operably linked to an influenza virus HA cDNA linked to a Pol I transcription termination sequence; and (2) a Pol I promoter operably linked to an influenza virus NA cDNA linked to a Pol I transcription termination sequence. Alternatively, expression of HA vRNA and NA vRNA may be from two separate expression vectors.
In some embodiments, restriction digestion sites may be placed at convenient locations in the expression vector. By way of example, restriction enzyme sites placed at the extremities of the cDNAs may be used to facilitate replacement of cDNA segments to produce a desired reassortment or strain of the virus. By way of another example, restriction enzyme sites placed at the extremities of the transcription cassettes may be used to facilitate replacement of transcription cassettes to produce a desired reassortment or strain of the virus. Suitable, endonuclease restriction sites include sites that are recognized by restriction enzymes that cleave double-stranded nucleic acid. By way of non-limiting example, these sites may include AarI, AccI, AgeI, Apa, BamHI, BglI, BglII, BsiWI, BssHI, BstBI, ClaI, CviQI, Ddel, DpnI, DraI, EagI, EcoRI, EcoRV, FseI, FspI, HaeII, HaeIII, HhaI, HincII, HindIII, HpaI, HpaII, KpnI, KspI, MboI, MfeI, NaeI, NarI, NcoI, NdeI, NgoMIV, NheI, NotI, PacI, PhoI, PmlI, PstI, PvuI, PvulI, SacI, SacII, SalI, SbfI, SmaI, SpeI, SphI, SrfI, StuI, TaqI, TfiI, TliI, XbaI, XhoI, XmaI, XmnI, and ZraI. In an exemplary alternative of this embodiment, the restriction enzyme site may be AarI.
II. Bacterial Carrier
An additional aspect of the invention comprises a bacterial carrier that can carry and deliver the expression vector described in Section I into a host cell. The host cell may be in vitro (i.e., cultured cells) or in vivo (e.g., an animal) as described in more detail in section III below. The bacterial carrier is typically auxotrophic and may be either a Gram-positive bacterium or Gram-negative bacterium. In this context, the bacterial carrier generally carries at least one gene mutation for an auxotrophic phenotype to enable intracellular release of the expression vector, and at least one gene mutation to enable stable carriage of the expression vector and at least one mutation to impose appropriate attenuation and for other desirable phenotypes such as for escaping the endosome in a eukaryotic cell. Additionally, the bacterial carrier may be a live bacterium or a bacterial ghost. In addition, the bacterial carrier may be attenuated. The bacterial carrier may also carry additional plasmid vectors for better invasion efficiency or for regulated delayed lysis in vivo. Preferably, the bacterial carrier is sensitive to all antimicrobial drugs including antibiotics that might be useful in treating infections with wild-type variants of the particular bacterial carrier being used to deliver the plasmid vector to eukaryotic cells.
As will be appreciated by a skilled artisan, the bacterial carrier may be utilized to deliver a single expression vector or to deliver multiple expression vectors. The single expression vector may encode information for generation of a segmented virus or non-segmented virus; for instance, the expression vector can encode 8 vRNAs, 3 polymerase subunits and nucleoprotein of influenza virus.
Alternatively, the bacterial carrier may be utilized to deliver multiple expression vectors. For example, one p15A ori based expression vector encodes PB2, PB1, PA and NP genes, and the other pBR ori based expression vector encodes HA, NA, M and NS genes.
In yet another embodiment, the bacterial carrier may be utilized to deliver an expression vector for virus generation. For example, the expression vector pYA4519 encodes 8 vRNAs, 3 polymerase subunits and nucleoprotein of influenza virus.
In one embodiment, the bacterial carrier may be utilized to deliver an expression vector in vitro. For instance, the expression vector encodes 8 vRNAs, 3 polymerase subunits and nucleoprotein of influenza virus.
In an alternative embodiment, the bacterial carrier may be utilized to deliver an expression vector in vivo. For example, oral administration with an auxotrophic, attenuated Salmonella Typhimurium carrying pYA4930 designed for regulated delayed lysis to deliver pYA4930 into avians.
In one embodiment, the bacterial carrier may be utilized to deliver an expression vector to humans. By way of non-limiting example, the expression vector encodes HA and NA from epidemic influenza virus, and the other 6 segments from cold-adapted influenza virus (e.g. A/AA/6/60). The polybasic cleavage site in HA will be removed to avoid the generation of reassortant virulent virus in the host. In this embodiment, the vRNAs transcription is regulated by human RNA Pol I promoters, and the transcription of mRNAs is regulated by CMV promoters.
In another embodiment, the bacterial carrier may be utilized to deliver expression vectors into other animals. For example, the expression vector encodes HA and NA from a highly pathogenic avian influenza virus (polybasic cleavage site in HA will be removed to avoid the generation of reassortant virulent virus in the host), and the other 6 segments from a cold-adapted influenza virus (e.g. A/AA/6/60).
In each of the foregoing embodiments, the bacterial carrier may be designed to have host-specificity for and be utilized for primates (e.g., humans, monkeys, chimpanzies etc), poultry (e.g., chickens, turkeys, ducks, geese and other fowl), ruminants (e.g., beef cattle, dairy cattle, and sheep, etc), pigs, and companion animals (e.g., horses, dogs, cats, and other pets).
As will be appreciated by a skilled artisan, suitable bacterial carriers may comprise several different bacterial strains to the extent the bacterial strain is capable of maintaining and delivering an expression vector to a host cell. By way of non-limiting example, the bacterial strain may be Gram-negative bacteria, including Salmonella spp., Shigella spp, Yersinia spp., and engineered Escherichia coli expressing an invasin gene. In a preferred alternative of this embodiment, the bacterium may be a Salmonella enterica serovar. In one alternative of this embodiment, the bacterium may be a Salmonella enterica serovar Abortusovis. In another alternative of this embodiment, the Salmonella bacterium may be Salmonella enterica serovar Typhi. In a preferred embodiment, the bacterium may be a Salmonella enterica serovar Typhimurium (Salmonella Typhimurium). In an exemplary alternative of this embodiment, the Salmonella Typhimurium strain is χ9052 (ΔasdA33 Δalr-3 ΔdadB4). In other exemplary alternatives of this embodiment, the Salmonella Typhimurium strain is χ11017 (ΔasdA27::TT araC PBAD c2 ΔaraBAD23 Δ(gmd-fcl)-26 Δpmi-2426 ΔrelA198::TT araC PBAD lacI ΔPmurA25::araC PBAD murA) or χ11327 (ΔasdA27::TT araC PBAD c2 ΔPmurA25::TT araC PBAD murA ΔaraBAD23 Δ(gmd-fcl)-26 ΔrelA198::araC PBAD lacI TTΔpmi-2426 ΔtlpA181 ΔsseL116 ΔPhilA::Ptrc ΔlacO888 hilA ΔsifA26).
In an alternative of this embodiment, the Salmonella Typhimurium strains may also comprise deletions of the bacterial nucleic acid sequences recA62, recF126 or both. In an alternative of this embodiment, the Salmonella Typhimurium strains may also comprise a deletion of the bacterial nucleic acid sequence for the aroA gene to result in the aroA21419 mutation.
Alternatively, the bacterial strain may be Gram-positive bacteria. By way of non-limiting example, one suitable Gram-positive bacterium is Listeria monocytogenes.
In certain embodiments, the bacterial carrier may be attenuated. By way of example, the bacterial carrier may be live bacteria with appropriate attenuation due to a phoP mutation or other means of attenuation if the carrier is derived from a pathogenic bacterium capable of causing disease. In yet another embodiment, the bacterial carrier may be bacteria with a regulated delayed lysis genotype, such as araC PBAD promoter regulated expression of the murA gene. The live bacteria carrying an expression vector may be induced to express a phage lysis gene E or some other lysis gene to form bacterial ghosts.
In an alternative embodiment, the bacterial carrier may carry a mutation in at least one gene for an auxotrophic phenotype. For example, these genes include, but are not limited to aroA, aroC, aroD, llvC, llvE, asd, murA, dadB, and alr.
In certain embodiments to facilitate stable carriage of an expression vector with repetitive sequences, either recA or recF gene inactivation may be included to reduce either intra- or inter-plasmid recombination.
In certain embodiments the bacterial carrier may carry a sifA mutation to facilitate escape from the endosome.
In other embodiments the bacterial carrier may carry an endA mutation to minimize chances of endonuclease digestion of the expression vector.
Several methods generally known in the art utilized to attenuate a bacterial carrier may be employed without departing from the scope of the invention. Suitable non-limiting examples of such attenuation means include gene mutations in phoP, phoQ, cya, crp, cdt, an aro gene, asd, a dap gene, dadB and alr, murA, nadA, pncB, rpsL, ilvE, rpoS, ompR, htrA, rfc, poxA, dam, hemA, sodC, recA, ssrA, sirA, inv, hilA, rpoE, flgM, tonB, slyA, pmi, galE, galU, mviA, rfaH, a pur gene, a pab gene, and fur.
In a further embodiment, the bacterial carrier may also comprise additional plasmid vectors for improving its invasion efficiency. For example, a plasmid expressing the gene encoding invasin from Yersinia pseudotuberculosis.
In an additional embodiment, the bacterial carrier may comprise additional plasmid vectors for regulated lysis in vivo. For example, the plasmid pYA3681 (araC PBAD promoter regulates expression of asd and murA genes) in strain χ11020.
III. Methods for Producing a Segmented Virus
The expression vector detailed in section (I) may be utilized to produce a segmented virus in vitro or in vivo. Depending upon the intended use, the resulting virus may, by way of example, be purified, attenuated or inactivated. In some embodiments, the virus is purified and used as a seed virus for further production of virus. In other embodiments, the virus is attenuated for use in a vaccine composition. In yet other embodiments, the virus is inactivated for use in a vaccine composition.
In one aspect, the invention provides a method for producing a virus by introducing the expression vector into a eukaryotic cell. The expression vector may be delivered to the cell using transfection. Methods for transfecting nucleic acids are well known to individuals skilled in the art. Transfection methods include, but are not limited to, cationic transfection, liposome transfection, dendrimer transfection, electroporation, heat shock, nucleofection transfection, magnetofection, nanoparticles, biolistic particle delivery (gene gun), and proprietary transfection reagents such as Lipofectamine, Dojindo Hilymax, Fugene, jetPEI, Effectene, DreamFect, or ExGen 500.
The expression vector may also be delivered to the cell using a viral vector. Viral vectors suitable for introducing nucleic acids into cells include retroviruses, vaccinia viruses, adenoviruses, adeno-associated viruses, rhabdoviruses, and herpes viruses.
In some embodiments, the expression vector may be introduced into eukaryotic tissue culture cells in vitro. Non-limiting examples of eukaryotic cells used for virus production in vitro may include human embryonic kidney 293 (HEK293) cells, Madin-Darby canine kidney (MDCK) cells, chicken embryonic fibroblasts (CEFs), African green monkey kidney epithelial (vero) cells, or any variants or combinations thereof. In all such cases, the sequences in all expression cassettes recognized by RNA polymerase I would have to be changed to possess DNA sequences recognized by the RNA polymerase I from the species of animal for the particular cell line. This is because RNA polymerase I are species specific. In a preferred embodiment, the expression vector may be introduced into HEK293 cells. In another preferred embodiment, the expression vector may be introduced into a mixture of CEFs and MDCK cells. Upon introduction of the expression vector into the eukaryotic cells, the host cells may then be cultured under conditions that permit production of viral proteins and vRNAs using tissue culture techniques known in the art. By way of non-limiting example, the expression vector, when introduced into a tissue culture cell, yields 108 PFU/ml or more of influenza virus after 6 days.
In other aspects, the expression vector may be introduced into a eukaryotic cell in an animal. Non-limiting examples of animals where the expression vector may be introduced may include humans, horses, pigs, chickens, ducks, and geese. Methods of delivery of the expression vector to a eukaryotic cell may be as described above.
Alternatively, and in a preferred embodiment of the invention, the expression vector may be delivered into the eukaryotic cell via a carrier bacterium as described in Section II. The carrier bacteria typically deliver the expression vector into the eukaryotic cell cytoplasm. Suitable carrier bacteria are described in more detail in Section II.
In yet other aspects, bacterial carrier mediated expression vector delivery can be used to generate several different groups of viruses, including positive-sense RNA viruses, negative-sense RNA viruses and double-stranded RNA (ds-RNA) viruses. Non-limiting examples of positive-sense RNA virus include viruses of the family Arteriviridae, Caliciviridae, Coronaviridae, Flaviviridae, Picornaviridae, Roniviridae, and Togaviridae. Non-limiting examples of positive-sense RNA viruses may include SARS-coronavirus, Dengue fever virus, hepatitis A virus, hepatitis C virus, Norwalk virus, rubella virus, West Nile virus, Sindbis virus, Semliki forest virus and yellow fever virus. Non-limiting examples of double-stranded RNA viruses may include viruses of the family Reoviridae and may include aquareovirus, coltivirus, cypovirus, fijivirus, idnoreovirus, mycoreovirus, orbivirus, orthoreovirus, oryzavirus, phytoreovirus, rotavirus, infectious bursal disease virus and seadornavirus. Negative-sense RNA viruses may be viruses belonging to the families Orthomyxoviridae, Bunyaviridae, and Arenaviridae with six-to-eight, three, or two negative-sense vRNA segments respectively. Non-limiting examples of negative-sense RNA viruses may include thogotovirus, isavirus, bunyavirus, hantavirus, nairovirus, phlebovirus, tospovirus, tenuivirus, ophiovirus, arenavirus, deltavirus and influenza virus.
In some embodiments, the bacterial carriers are attenuated as detailed in Section II. As previously described, the bacterial carrier may carry one or more mutations for this purpose. Non-limiting examples are the phoP mutation and the pmi mutation. The bacterial carrier may carry one plasmid to express a lysis gene. Non-limiting example is phage lysis gene E expressing plasmid. The bacterial carrier may carry one plasmid, which complement the mutations on the bacterial carrier chromosome to form a regulated delayed lysis system. For example, χ11020 carrying plasmid pYA3681.
In some embodiments, the expression vector may be modified for generation of attenuated virus. The strategies include, but not limiting to (1) using an attenuated virus genome to construct the single expression vector. For example, using HA and NA from epidemic influenza virus and the other segments from attenuated cold-adapted influenza virus (e.g. A/AA/6/60). Meanwhile the polybasic cleavage site has to be removed from the HA protein. (2) Introducing mutations into viral genes to change the protein sequence. For example, introducing mutations into epidemic influenza virus by reverse genetics to attenuate it, so that the generated virus can be used as vaccine seed. The mutations include (i) removing the polybasic cleavage site from HA protein, (ii) truncating the C-terminal end of the NS1 protein, (iii) and introducing mutations into viral polymerase.
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.
The term “cRNA” refers to a positive-sense RNA copy of a vRNA.
The term “vRNA” refers to a negative-sense genomic viral RNA.
The term “vaccine composition” as used herein means a composition that when administered to a host, typically elicits an immune response against the virus. Such compositions are known in the art.
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EPI300™ chemically competent E. coli (Epicentre) was used for all DNA cloning experiments. Restriction enzyme SrfI was bought from Stratagene (La Jolla, Calif.). All other restriction enzymes were from New England Biolabs (Ipswich, Mass.). Plasmids pTM-Pol I-WSN-All and pCAWS-NP were kindly provided by Dr. Yoshihiro Kawaoka (University of Wisconsin—Madison). Plasmid pYS1190 and pIRES-EGFP were gifts from Dr. Yixin Shi (Arizona State University). Primers used in this study are listed in Table 2. Plasmid constructs used in this study are listed in Table 1.
Cell Culture.
Chicken embryonic fibroblasts (CEFs) were prepared by standard trypsinization of decapitated 8-day old embryos. CEFs, human embryonic kidney (HEK293) cells and Madin-Darby canine kidney (MDCK) cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 μg/ml streptomycin. To co-culture CEFs and MDCK cells, each cell type was grown in 75 cm2 flasks, trypsinized, and ⅓ volume of each was mixed with growth media to a total volume of 40 ml. The mixed cells were seeded into six-well plates at 3 ml per well. All cells were maintained at 37° C. in 5% CO2.
Construction of Chicken Pol I Promoter-Based Reporter plasmids.
Plasmid pcDNA3.1(−) (Invitrogen, Carlsbad, Calif.) carrying the cytomegalovirus (CMV) promoter and the bovine growth hormone (BGH) polyadenylation signal that together form the Pol II promoter-terminator system, was used to construct vector pYA4379 (SEQ ID NO:57). Briefly, chicken Pol I promoter (CPI) was cloned from chicken genomic DNA (18). The truncated murine Pol I terminator (MTI) was amplified from plasmid pTM-Pol I-WSN-All. Using unique enzyme sites introduced by PCR, CPI region (nt: −415 to −1) and MTI (41 bp) were connected with KpnI site to produce SEQ ID NO:61 (Table 3), and placed between NheI and HindIII on pcDNA3.1(−) downstream of the CMV promoter to construct the bidirectional transcription vector pYA4379 (SEQ ID NO:57) (
TCGGTCGCTTCGCGGAGGTGGCTGGGGCACGGCGGAAC
GGTCTACCTGGTCCCGGCGGGCACCGTCCGGCTCGGTC
TCTCCGCGGCGGCGGCGGCTAGGGGTCGCTGCCGGGG
CGTCTCGGAAACGGCGGAACGGTCTACCCGGGTGCTAC
CGTCTCGCGCTCTCCGCGGCGGCGGCTAGAGGTCGCTG
CCGGGGCGGCTTGCGATCCGCGTCCAGGTCTACCCCGT
TTCGGATTGTCTTGGCCGCTCTGGCTGTGGGGGGGGGC
GCTACAGCTCCGGAGCTGCCAGAGGCGTCGCTGTAATTT
TGTACCTCCAGTTACGTCGAGGTAAACCTCGGCTGCCGT
CGGAGCCGCTGCCGGTAGTCGGCGCCTATGGGACTAGA
ACGTTTTTTTCGGATGCCTTATATGTTCGTCTGTAGGA
GTAC
TGCTCCCCCCCAACTTCGGAGGT
CGACCAGTACTCCGGGCGACAC
Plasmid pIRES-EGFP (Clontech; Mountain View, Calif.) was the source of the enhanced green fluorescent protein (EGFP) gene used to measure promoter activities in plasmids pYA4379 (SEQ ID NO:57) and pYA4380 (SEQ ID NO:58). The EGFP gene was amplified by PCR from pIRES-EGFP using primers that introduce 5′ and 3′ non-translating sequences (NTS) from M segment of the WSN virus. The 5′-NTS-EGFP-NTS-3′ fragment was cloned into the AarI sites inbetween CPI and MTI in plasmid pYA4379 (SEQ ID NO:57) and in pYA4380 (SEQ ID NO:58) to obtain plasmids pYA4387 and pYA4392, respectively (
Construction of the 8-unit plasmid pYA4519 (SEQ ID NO: 60)
The 8-unit plasmid pYA4519 was constructed in four stages: a) Construction of eight 1-unit plasmids. Plasmid pTM-PolI-WSN-All provides the whole set of genomic cDNAs of influenza A/WSN/33 virus. The cDNA fragments for PB2, PB1, PA, and NP were individually transferred into the AarI sites on pYA4379 (SEQ ID NO:57) to obtain plasmids pYA4383, pYA4384, pYA4385, and pYA4386, respectively (Table 1,
The 711 bp mCherry gene was amplified from pYS1190 (Table 1) and cloned between the CMV promoter and BGH terminator sequences on plasmid pcDNA3.1(−) to generate the reference plasmid pYA4731. The CMV-mCherry-BGH-polyA cassette was amplified from pYA4731 and cloned into the SrfI site on plasmid pYA4519 (SEQ ID NO:60) to obtain pYA4732 (pYA4519-mCherry) (Table 1).
Transfection.
CEFs and HEK293 cells grown in 6-well plates were transfected according to the manufacturer's instructions. Briefly, 2 μl of Lipofectamine 2000 (Invitrogen) per μg plasmid DNA were individually diluted in 100 μl of Opti-MEM. After 5 min incubation at room temperature (RT), the diluted transfection reagent was mixed with the DNA. After 40 min incubation at RT, the transfection mix was added to pre-washed cells. After further incubation at RT for 3 h, the transfection medium was replaced with DMEM supplemented with 10% FBS. At 24 h post transfection, images were acquired using the Zeiss Axio Cam Mrc-5 mounted onto a Zeiss Axioskop 40-fluorescent microscope.
Virus Generation.
For generation of influenza virus, CEFs or co-cultured CEFs/MDCK cells were transfected with plasmid DNA as described above. After 3 h incubation, the transfection medium was replaced with 2 ml of Opti-MEM containing 0.3% bovine serum albumin (BSA), penicillin and streptomycin. At 24 hr post transfection, each well was supplemented with 1 ml of Opti-MEM containing 2 μg/ml TPCK-trypsin, 0.3% BSA, penicillin and streptomycin. At three to six days post transfection, cell supernatants were titrated onto MDCK cell monolayers to estimate influenza virus titer. All experiments were done in triplicates.
The bidirectional dual promoter transcription vector pYA4379 (SEQ ID NO:57) was constructed by inserting Pol I promoter-terminator elements in plasmid pcDNA3.1(−). Here, cytomegalovirus promoter (CMV) and bovine growth hormone (BGH) polyadenylation signal (BGH) together constitute the Pol II promoter-terminator unit to synthesize mRNA, whereas, chicken Pol I promoter (CPI) and murine Pol I terminator (MTI) together constitute the Pol I promoter-terminator unit to transcribe antisense RNA of the target gene (
To test the promoter activity in each plasmid, CEFs were independently transfected with plasmids (pYA4387 and pYA4392) and HEK293 cells were transfected with plasmid pYA4688 to monitor EGFP expression as a measure of promoter activity. CEFs transfected with pYA4387 were visibly green confirming the synthesis of a functional EGFP protein (
We chose influenza A/WSN/33 virus as our model virus and cDNAs for all eight segments were obtained from the plasmid pTM-PolI-WSN-All.
To determine the transfection and nuclear targeting efficiency of pYA4519 (SEQ ID NO:60), we introduced the mCherry gene into the vector pcDNA3.1(−) downstream of the CMV promoter to generate pYA4731 (pcDNA-mCherry). The entire CMV-mCherry-BGH-polyA cassette was then transferred into the 8-unit plasmid pYA4519 (SEQ ID NO:60) to generate pYA4732 (pYA4519-mCherry) and then to compare the expression of the reporter gene in CEFs and HEK293 cells. Expression of the mCherry gene from the reference plasmid pYA4731 was similar in both CEFs and HEK293 cells (
Efficiency of influenza virus recovery was compared between our 1-unit eight-plasmid system (plasmids pYA4383, pYA4384, pYA4385, pYA4386, pYA4388, pYA4389, pYA4390, and pYA4391) and our novel one-plasmid 8-unit system pYA4519 (SEQ ID NO:60). Cultured CEFs were either transfected with pYA4519 (SEQ ID NO:60) or co-transfected with eight plasmids (pYA4383, pYA4384, pYA4385, pYA4386, pYA4388, pYA4389, pYA4390, and pYA4391) to provide all the necessary viral components as described in Materials and Methods. The mean titer at 3-days and 6-days post transfection was approximately 300 and 1×103 PFU/ml influenza viruses, respectively, when transfected with pYA4519 (SEQ ID NO:60), whereas the virus yield using the eight-plasmid method estimated at the same time points was approximately 50 and 700 PFU/ml, respectively, (Table 4). Virus yield was much higher in cocultured CEFs/MDCK cells transfected by plasmid pYA4519 (SEQ ID NO:60) with approximately 1×104 PFU/ml and 1×108 PFU/ml estimated on the 3 and 6 days post transfection, respectively. This was expected as MDCK cells are known to support the growth of influenza virus better than CEF cells. Together these results suggested that recovery of influenza virus from pYA4519 (SEQ ID NO:60) transfected cells was more efficient than from the previously developed eight-plasmid system.
aTriplicate wells.
bPlasmids pYA4383, pYA4384, pYA4385, pYA4386, pYA4388, pYA4389, pYA4390, and PYA4391.
The goal of this study was to construct the influenza virus genome on a single plasmid and rescue the virus from cultured chicken cells. We chose the influenza virus WSN strain as the model virus and with the combination of reverse genetics and the dual promoter system successfully constructed an 8-unit plasmid pYA4519 (SEQ ID NO:60). Care was also taken to limit the use of multiple CMV promoters in our plasmid to reduce the number of repetitive sequences that may promote intra-plasmid recombination and thus decrease plasmid stability. The 8-unit plasmid was designed to produce influenza polymerase complex (PB1, PB2 and PA), nucleoprotein (NP) and 8 viral RNAs (PB1, PB2, PA, NP, HA, NA, M and NS) in avian cells (
Factors such as plasmid constructs used, and the host cell line, affect the efficiency of virus recovery (22), and our study provides additional vital evidence in their support. We compared both transfection and viral recovery efficiency between CEFs and HEK293 cells. Both cell types could be transfected with equal efficiency when smaller size plasmids were used (
Our plasmid construct should also facilitate the design of a much simpler approach to develop influenza vaccine seeds. Currently, influenza vaccine seeds use the “2+6” strategy, in which the HA and NA segments are taken from an epidemic strain and the remaining 6 segments of the influenza viral genome are taken from either the high productive strain PR8 (A/PR/8/34) or the cold-adapted strain (e.g. A/AA/6/60) (4, 10, 12). Construction of one plasmid producing all the necessary backbone segments and proteins from donor virus provides a simpler and more efficient “1+2” approach to generate influenza vaccine seeds.
The currently used influenza vaccines for human use are the inactivated and attenuated forms of the virus and are administered via the intramuscular or the intranasal routes. Manufacturing these vaccines using cell culture or embryonated chicken eggs is both expensive and a time-consuming process. An inexpensive and oral influenza vaccine remains a medical priority, especially for pandemic influenza. Our one plasmid offers a viable option to generate attenuated influenza virus in vivo where the plasmid can be delivered orally or intranasally using a recombinant bacterial strain. Our laboratory has been successful in constructing recombinant attenuated strains of Salmonella enterica Serovar Typhimurium that are designed for enhanced antigen delivery in the host and ensure regulated delayed lysis of the pathogen to inhibit long-term host colonization (5). To construct such an attenuated strain that could effectively deliver plasmid DNA into the host will be the next step towards developing a recombinant bacteria based-vaccine against influenza to be used both in the poultry industry and for pandemic influenza.
In our pilot study, we choose the influenza virus WSN strain for validation of our one-plasmid system. For developing a bacterial based influenza vaccine, the expression vector must be modified to generate attenuated influenza virus. One strategy would be constructing the single expression vector with HA and NA from epidemic influenza virus and the other 6 segments from a cold-adapted influenza strain (e.g. A/AA/6/60) (4, 12). Another strategy is to introduce mutations into viral polymerase coding genes and another to employ a truncated NS1 (nonstructural protein 1) gene to obtain attenuated influenza virus (7, 29, 33). Additionally, the HA segment from influenza vaccine may form a new ressortant virus with the other segments from a preexisting influenza virus in the host. The polybasic cleavage peptides of the HA proteins are required for high pathogenicity of influenza viruses (36). Thus, for vaccine development, the polybasic cleavage site in HA will be replaced with a consensus sequence derived from HA-encoding sequences from avirulent strains (28, 33).
Optimal gene expression from the 8-unit plasmid requires efficient translocation of the plasmid construct into the nucleus of the host cells. Nuclear targeting sequence and NF-κB binding site have been reported to improve the nuclear import of DNA construct (6, 19). In our study, transfection of chicken cells with plasmid pYA4732 did not result in efficient expression of mCherry (Example 3). One possible reason is the lack of a nuclear targeting sequence to facilitate the nuclear import of pYA4732 (and its parental plasmid pYA4519). Here the SV40 nuclear targeting sequence (SV40 DTS) and NF-κB binding site were introduced into plasmid pYA4519 to enhance its nuclear import. The SV40 DTS was obtained from a commercial vector pBICEP-CMV-3 (Sigma) and the NF-κB binding site was obtained from plasmid pYA4545 (from Clonebank in Curtiss' lab). Then they were fused with a kanamycin-resistance cassette (kan) by PCR. The entire fusion fragment was inserted into the SrfI site of pYA4519 to generate pYA4562 (
To mediate the delivery of plasmid DNA, an auxotrophic Salmonella Typhimurium strain χ9052 (ΔasdA33 Δalr-3 ΔdadB4) was selected. Inactivation of the asd gene causes an obligate requirement for the essential amino acid diaminopimelic acid (DAP), whereas inactivation of both the alr and dadB genes confers an absolute requirement for D-alanine. Both DAP and D-alanine are essential unique subunits of the peptidoglycan ridgid layer of the bacterial cell wall. A replicating bacterial cell requires these components for cell wall synthesis and neither of these amino acids is present in animal tissues. In the absence of these nutrients in the host cell, the integrity of the bacterial cell wall is compromised and the bacterium undergoes lysis in the host. Lysis of the intracellular bacterial cell would release the expression vector into the host cytoplasm, and the nuclear targeting sequence(s) on the vector would then promote the translocation of the expression vector into the nucleus, ultimately resulting in the desired expression of viral genes. The conditional growth on LB agar plates with or without supplement(s) was observed for three bacterial carriers, including χ8276 (ΔasdA27), χ8901 (Δalr-3 ΔdadB4) and χ9052 (ΔasdA33 Δalr-3 ΔdadB4). The wild-type S. Typhimurium control strain showed growth on each plate (
For bacterial carrier-mediated plasmid delivery, it is essential that the structural integrity of the target plasmid construct be maintained. RecA and RecF (encoded by genes recA and recF, respectively) catalyze recombination of homologus DNA sequences on one plasmid or between two plasmids. The 8-unit plasmid construct carries numerous such repeated DNA elements in the form of Pol I and Pol II promoters and terminators. These repeated sequences are very good substrates for both RecA- and RecF-enzyme mediated recombination. We hence determined the individual effect of the inactivation of these genes in Salmonella.
The recA and recF deletion mutations were individually introduced into Salmonella Typhimurium χ9052 (ΔasdA33 Δalr-3 ΔdadB4). The resulting strains are χ9834 (ΔasdA33 Δalr-3 ΔdadB4 ΔrecA62) and χ11018 (Δasd-33 Δalr-3 ΔdadB4 ΔrecF126), respectively.
Salmonella strains χ9052, χ9834 and χ11018 were each transformed with plasmid pYA4519, plated onto LB plates and incubated overnight at 37° C. From each strain, a correct clone was obtained and diluted 1:1000 into 3 ml LB medium and grown at 37° C. for 12 h. The dilution and growth process was repeated for 4 additional cycles. Plasmid DNA was extracted from 1.5 ml of culture from each cycle of growth. An aliquot of plasmid from each sample was digested with BamHI and separated on a 1.2% agarose gel. Bacteria from the final cultures were spread onto supplemented LB-agar plates and incubated overnight at 37° C. Plasmid DNA was extracted from single colonies and structural integrity of the plasmid was verified by comparing the restriction profile upon BamHI digestion (
We noted that at time 0, before passage, the plasmid yield from the Rec+ strain, χ9052, was less than that obtained from the two rec mutants. After the second cycle of growth there was a reduction in the amount of DNA in most of the expected bands, indicating that the plasmid structure was deteriorating after each passage. Qualitatively, the plasmid structure appeared to be stable for the first four passages in strains χ9834 (ΔrecA62), and χ11018 (ΔrecF126). In this experiment we demonstrate that deletion of recA and recF in Salmonella Typhimurium significantly minimizes Rec-dependent recombination of the plasmid, thus ensuring structural integrity of our 8-unit plasmid in spite of repetitive sequences.
The goal of this experiment was to determine whether Salmonella could mediate the delivery of the large expression vector into cultured chicken cells. Plasmid pYA4732 (
Salmonella Typhimurium χ9834 carrying pYA4732 was cultured in 3 ml of LB medium containing 100 μg/ml DL-alanine, 50 μg/ml DAP and 25 μg/ml chloramphenicol at 30° C. As a control, the χ9834 carrying pYA4731 was cultured in 3 ml of LB medium containing 100 μg/ml DL-alanine, 50 μg/ml DAP and 100 μg/ml carbencillin at 30° C. The overnight cultures were pelleted and resuspended in DMEM without fetal bovine serum and antibiotics. Chicken embryonic fibroblasts (CEFs) in 6-well plates were incubated with the bacteria at 37° C. for 1 h. 24 h later, the cells were observed under fluorescence microscope. The results showed that the large plasmid pYA4732 could be delivered into cultured chicken fibroblasts and was expressed. In contrast, the small reporter plasmid pYA4731 was more efficiently delivered by the Salmonella carrier (
The goal of this experiment was to determine whether Salmonella-mediated delivery of the 8-unit plasmid into chicken cells leads to the generation of influenza virus. Based on the transfection data (Table 4), the chicken embryonic fibroblasts did not support the replication of the influenza virus WSN strain (no substantial increase of virus titers between the 3rd and 6th day post transfection). The MDCK cells on the other hand are known to support the growth of the influenza virus WSN strain. A co-culture of chicken embryonic fibroblasts (CEFs) and Madin-Darby canine kidney (MDCK) cells supports the propagation of the influenza virus. Virus generated and released from transfected CEFs can infect the adjacent MDCK cells that support replication of the virus. Transfection of co-cultured CEFs/MDCK cells with the 8-unit plasmid pYA4519 resulted in higher titers of influenza virus (Example 4). Salmonella Typhimurium χ9834 carrying pYA4519 or pYA4562 were cultured in 3 ml of LB medium containing 100 μg/ml DL-alanine, 50 μg/ml DAP and 25 μg/ml chloramphenicol at 30° C. with shaking (200 rpm) for 20 h. In each case, 1 ml of bacterial culture was harvested and resuspended in 1 ml of DMEM without fetal bovine serum (FBS) and antibiotics.
CEFs and MDCK cells grown in 75 cm2 flasks were trypsinized, and ⅓ volume of each was mixed with DMEM containing 10% FBS to a total volume of 40 ml. The mixed cells were seeded into six-well plates at 3 ml per well. All cells were maintained at 37° C. in 5% CO2. The cells were washed with DPBS for three times. 100 μl, 200 μl and 500 μl of resuspended bacteria were added into each well. DMEM was added to a final volume of 1 ml and mixed by rocking back and forth. The cells were incubated at 37° C. in a CO2 incubator for 1 h. For each well, media was changed to 2 ml of Opti-MEM containing 0.3% BSA, 10 μg/ml gentamycin. One day post-infection, each well was supplemented with 1 ml of Opti-MEM containing 0.3% BSA, 10 μg/ml gentamycin and 2 μg/ml TPCK-trypsin (The final concentration is 0.7 μg/ml). Six days post-infection, supernatants from each well were collected for hemagglutination tests (Table 5) and TCID50 determinations (
CEFs/MDCK co-culture infected with χ9834 carrying pYA4562 generated higher titers of influenza virus, supporting our hypothesis that inclusion of additional nuclear targeting sequences in the 8-unit plasmid enhances the nuclear translocation, hence the viral yield.
To generate of attenuated influenza virus in vivo and to determine the immune response against the attenuated strain, it is necessary to construct a plasmid encoding an attenuated virus. So that the virus generated in vivo can be determined by virus shielding, and the immune response can be determined by subsequent challenge with influenza virus.
The influenza A virus (A/chicken/TX/167280-4/02(H5N3) is an isolate from White Leghorns chickens. It belongs to a low pathogenic avian influenza virus and causes clinical symptoms such as wheezing and swollen heads. The viral HA segment (AY296085, henceforth referred to as Tx02HA), shares homology with low pathogenic virus (16). It hence makes an ideal challenge strain. On the other hand, an avirulent influenza A virus can be generated from a single expression vector encoding Tx02HA and Tx02NA (NA segments derived from Tx02 virus) segments and the remaining 6 segments from a mouse adapted influenza virus, such as the WSN virus.
Based on these considerations, the Tx02HA and Tx02NA genes were amplified from influenza A virus (A/chicken/TX/167280-4/02(H5N3) by RT-PCR and cloned between CPI and MTI in the p15A ori plasmids pYA4591 and pYA4592 to generate plasmids pYA4593 and pYA4592-Tx02NA. The CPI-Tx02HA-MTI cassette was amplified from pYA4593 to replace the WSN HA cassette in pYA4519 to obtain plasmid pYA4693. The CPI-Tx02NA-MTI cassette was amplified from pYA4592-Tx02NA to replace the WSN NA cassette in pYA4693 to obtain plasmid pYA4929 (
Another feasible alternative is to directly inject this plasmid construct into the target host using a gene gun to also result in the generation of live attenuated influenza virus, which can also stimulate a protective immune response against other related pathogenic strains of influenza virus.
One can also vaccinate in ovo either by directly injecting the plasmid DNA into the embryonated chicken eggs or by bacterial carrier-mediated delivery to generate live attenuated influenza vaccine. Viral yield by direct injection of the plasmid DNA is at least 1000-fold lower than that obtained by delivering the plasmid construct via a bacterial carrier.
Our laboratory has earlier constructed a “lysis-vector” pYA3681 (
Vaccine Strain:
We have generated various Salmonella Typhimurium strains listed below. We are proposing to introduce ΔrecA62 or ΔrecF126 into some strains to enhance stable maintenance of the expression vector. In other cases, we need to add ΔsifA26 or ΔendA2311 to enable escape from the endosome or prevent endonuclease cutting of released plasmid DNA, respectively. In other cases, the ΔaroA21426 mutation is added to maintain the single 8-unit plasmid specifying synthesis and assembly of influenza virus.
Vaccine Vector:
We have constructed a 8-unit plasmid pYA4930 with a wild-type aroA cassette (
The χ11020-derived strain with recA deletion (or recF deletion) will be harbored with plasmid pYA4930 and one of the lysis vectors (pYA3681, pYA4589, pYA4595, or pYA4594), so that the regulated lysis of the bacterial carrier will mediate the delivery of plasmid pYA4930.
Vaccination:
Chickens will be vaccinated with the above described recombinant strains via three different routes; intranasally, orally, or intramuscularly. The influenza A virus (A/chicken/TX/167280-4/02(H5N3)) is an isolate from White Leghorn chickens. It causes clinical signs, such as wheezing and swollen heads, and belongs to a low pathogenic avian influenza virus (16). This virus will be used to challenge the immunized chickens to evaluate the protection efficiency (clinical symptoms and virus shielding).
37. Zobel, A., G. Neumann, and G. Hobom. 1993. RNA polymerase I catalysed transcription of insert viral cDNA. Nucleic. Acids. Res. 21:3607-3614.
Sequences of this Study.
Influenza A Virus Genes.
All influenza A/WSN/33 virus genes were derived from plasmid pTM-PolI-WSN-All (A gift from Dr. Yoshihiro Kawaoka, University of Wisconsin—Madison). The sequence of each gene was listed as following.
Plasmid Sequences
This invention was made with government support under R01 AI065779 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Name | Date | Kind |
|---|---|---|---|
| 4190495 | Curtiss, III | Feb 1980 | A |
| 4888170 | Curtiss, III | Dec 1989 | A |
| 4968619 | Curtiss, III | Nov 1990 | A |
| 5210035 | Stocker | May 1993 | A |
| 5294441 | Curtiss, III | Mar 1994 | A |
| 5387744 | Curtiss | Feb 1995 | A |
| 5389368 | Curtiss, III | Feb 1995 | A |
| 5424065 | Curtiss, III | Jun 1995 | A |
| 5468485 | Curtiss, III | Nov 1995 | A |
| 5536658 | Shotts, Jr. et al. | Jul 1996 | A |
| 5654184 | Curtiss, III | Aug 1997 | A |
| 5656488 | Curtiss, III | Aug 1997 | A |
| 5672345 | Curtiss, III | Sep 1997 | A |
| 5679880 | Curtiss, III | Oct 1997 | A |
| 5686079 | Curtiss, III | Nov 1997 | A |
| 5817317 | Titball | Oct 1998 | A |
| 5827705 | Dean | Oct 1998 | A |
| 5840483 | Curtiss, III | Nov 1998 | A |
| 5855879 | Curtiss, III | Jan 1999 | A |
| 5855880 | Curtiss, III | Jan 1999 | A |
| 5961983 | Brey et al. | Oct 1999 | A |
| 6024961 | Curtiss, III | Feb 2000 | A |
| 6180614 | Davis | Jan 2001 | B1 |
| 6248329 | Chandrashekar et al. | Jun 2001 | B1 |
| 6350454 | Thune | Feb 2002 | B1 |
| 6383496 | Curtiss, III | May 2002 | B1 |
| 6399074 | Roland | Jun 2002 | B1 |
| 6403094 | Titball | Jun 2002 | B1 |
| 6610529 | Curtiss, III | Aug 2003 | B1 |
| 6780405 | Curtiss, III | Aug 2004 | B1 |
| 6872547 | Curtiss, III | Mar 2005 | B1 |
| 6969513 | Galen | Nov 2005 | B2 |
| 7083794 | Curtiss, III | Aug 2006 | B2 |
| 7195757 | Curtiss, III | Mar 2007 | B2 |
| 7205125 | Castillo | Apr 2007 | B2 |
| 7341860 | Curtiss, III | Mar 2008 | B2 |
| 7871604 | Curtiss, III | Jan 2011 | B1 |
| 7968101 | Kawaoka et al. | Jun 2011 | B2 |
| 8133493 | Curtiss, III | Mar 2012 | B2 |
| 8445254 | Curtiss, III et al. | May 2013 | B2 |
| 8465755 | Curtiss, III et al. | Jun 2013 | B2 |
| 20030031683 | Curtiss, III | Feb 2003 | A1 |
| 20030175772 | Wang | Sep 2003 | A1 |
| 20040077556 | Chinery | Apr 2004 | A1 |
| 20040101531 | Curtiss, III | May 2004 | A1 |
| 20040120962 | Curtiss, III | Jun 2004 | A1 |
| 20040137003 | Curtiss, III | Jul 2004 | A1 |
| 20040203039 | Hensel | Oct 2004 | A1 |
| 20050036987 | Pawelek | Feb 2005 | A1 |
| 20050106175 | Montanes | May 2005 | A1 |
| 20050106176 | Curtiss, III | May 2005 | A1 |
| 20050118193 | Andino-Pavlovsky et al. | Jun 2005 | A1 |
| 20060140975 | Curtiss, III | Jun 2006 | A1 |
| 20060171917 | Campbell | Aug 2006 | A1 |
| 20060206961 | Cirpus | Sep 2006 | A1 |
| 20060233829 | Curtiss, II | Oct 2006 | A1 |
| 20060234346 | Retallack | Oct 2006 | A1 |
| 20060275255 | Gudkov | Dec 2006 | A1 |
| 20070025981 | Szalay | Feb 2007 | A1 |
| 20080096809 | Shai | Apr 2008 | A1 |
| 20080248066 | Dubensky, Jr. | Oct 2008 | A1 |
| 20090175829 | Forbes | Jul 2009 | A1 |
| 20100124558 | Curtiss, III | May 2010 | A1 |
| 20100154293 | Hom et al. | Jun 2010 | A1 |
| 20100255022 | Prescott et al. | Oct 2010 | A1 |
| 20100285592 | Curtiss, III | Nov 2010 | A1 |
| 20100317084 | Curtiss, II | Dec 2010 | A1 |
| 20110033501 | Curtiss, III et al. | Feb 2011 | A1 |
| 20110256181 | Curtiss, III | Oct 2011 | A1 |
| 20110287052 | Curtiss, III et al. | Nov 2011 | A1 |
| 20120087946 | Curtiss, III | Apr 2012 | A1 |
| 20130004537 | Curtiss, III et al. | Jan 2013 | A1 |
| 20130171190 | Curtiss, III et al. | Jul 2013 | A1 |
| Number | Date | Country |
|---|---|---|
| 0315682 | Dec 1993 | EP |
| 0381706 | Apr 1995 | EP |
| 0465560 | Jun 1996 | EP |
| 0500699 | Jun 1998 | EP |
| 0558631 | Mar 1999 | EP |
| 0433372 | Jun 2002 | EP |
| 1030690 | Jul 2002 | EP |
| 0556333 | Mar 2003 | EP |
| 1326960 | Dec 2004 | EP |
| 0832255 | Dec 2005 | EP |
| 1537214 | Mar 2006 | EP |
| 1292687 | Aug 2006 | EP |
| 8809669 | Dec 1988 | WO |
| 8903427 | Apr 1989 | WO |
| 9002484 | Mar 1990 | WO |
| 9011687 | Oct 1990 | WO |
| 9011688 | Oct 1990 | WO |
| 9012086 | Oct 1990 | WO |
| 9106317 | May 1991 | WO |
| 9208486 | May 1992 | WO |
| 9209684 | Jun 1992 | WO |
| 9304202 | Mar 1993 | WO |
| 9424291 | Oct 1994 | WO |
| 9424291 | Dec 1994 | WO |
| 9640947 | Dec 1996 | WO |
| 9925387 | May 1999 | WO |
| 0183785 | Nov 2001 | WO |
| 0230457 | Apr 2002 | WO |
| 0183785 | Jun 2002 | WO |
| 02059292 | Aug 2002 | WO |
| 03079792 | Oct 2002 | WO |
| 02030457 | Jan 2003 | WO |
| 02030457 | Jul 2003 | WO |
| 02059292 | Jul 2003 | WO |
| 03096812 | Nov 2003 | WO |
| 2004020643 | Mar 2004 | WO |
| 2004020643 | Apr 2004 | WO |
| 2005001069 | Jan 2005 | WO |
| 2008141226 | Nov 2008 | WO |
| 2009025888 | Feb 2009 | WO |
| 2009046449 | Apr 2009 | WO |
| 2009046451 | Apr 2009 | WO |
| 2010045620 | Apr 2010 | WO |
| 2010078584 | Aug 2010 | WO |
| 2010135563 | Nov 2010 | WO |
| 2011091291 | Jul 2011 | WO |
| 2011150421 | Dec 2011 | WO |
| 2012087483 | Jun 2012 | WO |
| Entry |
|---|
| Nieto et al (Journal of General Virology, 1994. vol. 75, pp. 29-36, abstract). |
| Dean (Experimental Cell Research, 1997. vol. 230, pp. 293-302). |
| Kotton et al., Enteric pathogens as vaccine vectors for foreign antigen delivery. Infect. Immun., 2004, pp. 5535-5547, vol. 72. |
| Lee et al., Characterization of recent H5 subtype avian influenza viruses from US poultry. Avian Pathol., 2004, pp. 288-297, vol. 33. |
| Lee et al., Mechanism of arac autoregulation and the domains of two overlapping promoters, PC and PBAD, in the L-arabinose regulatory region of Escherichia coli. Proc. Natl. Acad. Sci. U S A, 1981, pp. 752-756, vol. 78. |
| Li et al., A sopB Deletion Mutation Enhances the Immunogenicity and Protective Efficacy of a Heterologous Antigen Delivered by Live Attenuated Salmonella enterica Vaccines. Infection and Immunity, 2008, pp. 5238-5246, vol. 76, No. 11. |
| Lee et al., Trigger factor retards protein export in Escherichia coli. J Biol Chem, 2002, pp. 43527-43535, vol. 277. |
| Lefeber et al., Th1-directing adjuvants increase the immunogenicity of oligosaccharide-protein conjugate vaccines related to Streptococcus pneumoniae type 3. Infect Immun, 2003, pp. 6915-6920, vol. 71. |
| Loessner et al., Differential effect of auxotrophies on the release of macromolecules by Salmonella enterica vaccine strains. FEMS Microbiol. Lett., 2006, pp. 81-88, vol. 265. |
| Loewen et al., Genetic mapping of katF, a locus that with katE affects the synthesis of a second catalase species in Escherichia coli. J Bacteriol, 1984, pp. 668-675, vol. 160. |
| Luytjes et al., Amplification, expression, and packaging of foreign gene by influenza virus. Cell, 1989, pp. 1107-1113, vol. 59. |
| Malley et al., CD4+ T cells mediate antibody-independent acquired immunity to pneumococcal colonization. PNAS, 2005, pp. 4848-4853, vol. 102. |
| Massin et al., Cloning of the chicken RNA polymerase I promoter and use for reverse genetics of influenza A viruses in avian cells. J. Virol., 2005, pp. 13811-13816, vol. 79. |
| Matthay et al., Evaluation of the opsonic requirements for phagocytosis of Streptococcus pneumoniae serotypes VII, XIV, and XIX by chemiluminescence assay. Infect Immun, 1981, pp. 228-235, vol. 31. |
| McClelland et al., Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature, 2001, pp. 852-856, vol. 413, No. 6858. |
| McDaniel et al., Monoclonal antibodies against protease sensitive pneumococcal antigens can protect mice from fatal infection with Streptococcus pneumoniae. J. Exp. Med., 1984, pp. 368-97, vol. 160. |
| McDaniel et al., Use of insertional inactivation to facilitate studies of biological properties of pneumococcal surface protein A (PspA). J. Exp. Med., 1987, pp. 381-394, vol. 165. |
| Mesika et al., A regulated, NF κb-assisted import of plasmid DNA into mammalian cell nuclei. Mol. Ther., 2001, pp. 653-657, vol. 3. |
| Miller et al., A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol, 1988, pp. 2575-2583, vol. 170. |
| Miller et al., Bacteriophage T4 genome. Microbiol Mol Biol Rev, 2003, pp. 86-156, vol. 67, No. 1. |
| Molinari et al., The annual impact of seasonal influenza in the US: measuring disease burden and costs. Vaccine, 2007, pp. 5086-50896, vol. 25. |
| Mulvey et al., Regulation of transcription of katE and katF in Escherichia coli. J Bacteriol, 1990, pp. 6713-6720, vol. 172. |
| Murti et al., Localization of RNA polymerases on influenza viral ribonucleoproteins by immunogold labeling. Virology, 1988, pp. 562-566, vol. 164. |
| Nardelli-Haefliger et al., Human papillomavirus type 16 virus-like particles expressed in attenuated Salmonella typhimurium elicit mucosal and systemic neutralizing antibodies in mice. Infect Immun, 1997, pp. 3328-3336, vol. 65. |
| Nayak et al., A live recombinant avirulent oral Salmonella vaccine expressing pneumococcal surface protein A induces protective responses against Streptococcus pneumoniae. Infect Immun., 1998, pp. 3744-3751, vol. 66. |
| Neumann et al., An improved reverse genetics system for influenza A virus generation and its implications for vaccine production. Proc. Natl. Acad. Sci. USA, 2005, pp. 16825-16829, vol. 102. |
| Neumann et al., Generation of influenza A viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. USA, 1999, pp. 9345-9350, vol. 96. |
| Neumann et al., RNA polymerase I-mediated expression of influenza viral RNA molecules. Virology, 1994, pp. 477-479, vol. 202. |
| Nickerson et al., Role of sigma factor RpoS in initial stages of Salmonella typhimurium infection. Infect Immun, 1997, pp. 1814-1823, vol. 65. |
| Noda et al., Architecture of ribonucleoprotein complexes in influenza A virus particles. Nature, 2006, pp. 490-492, vol. 439. |
| Oehler et al., The three operators of the lac operon cooperate in repression. EMBO J, 1990, pp. 973-979, vol. 9, No. 4. |
| Ogunniyi et al., Contributions of Pneumolysin, Pneumococcal Surface Protein a (PspA), and PspC to Pathogenicity of Streptococcus pneumoniae D39 in a Mouse Model. Infect. Immun., 2007, pp. 1843-1851, vol. 75. |
| Osterholm, Preparing for the next pandemic. N. Engl. J. Med., 2005, pp. 1839-1842, vol. 352. |
| Ozaki et al., Generation of high-yielding influenza A viruses in African green monkey kidney (Vero) cells by reverse genetics. J. Virol., 2004, pp. 1851-1857, vol. 78. |
| Park et al., Engineered viral vaccine constructs with dual specificity: avian influenza and Newcastle disease. Proc. Natl. Acad. Sci. USA, 2006, pp. 8203-8208, vol. 103. |
| Pascual et al., Expression of Recombinant Enterotoxigenic Escherichia coli Colonization Factor Antigen I by Salmonella Typhimurium Elicits a Biphasic T Helper Cell Response. Infec. Immun., 1999, pp. 6249-6256, vol. 67. |
| Pashine et al., Th1 dominance in the immune response to live Salmonella Typhimurium requires bacterial invasiveness but not persistence. Int. Immunol., 1999, pp. 481-489, vol. 11. |
| Peterson et al., RpoS proteolysis is regulated by a mechanism that does not require the SprE (RssB) response regulator phosphorylation site. J Bacteriol, 2004, pp. 7403-7410, vol. 186. |
| Pizarro-Cerda et al., The bacterial signal molecule, ppGpp, regulates Salmonella virulence nucleic acid sequence expression. Mol Microbiol, 2004, pp. 1827-1844, vol. 52, No. 6. |
| Prouty et al., Salmonella enterica serovar Typhimurium invasion is repressed in the presence of bile. Infect Immun, 2000, pp. 6763-6769, vol. 68. |
| Quinlivan et al., Attenuation of equine influenza viruses through truncations of the NS1 protein. J. Virol., 2005, pp. 8431-8439, vol. 79. |
| Rand, Crystal violet can be used to visualize DNA bands during gel electrophoresis and to improve cloning efficiency. Tech. Tips Online, 1996 http://www.science-direct.com/science/journal/13662120. |
| Roberts et al., Oral vaccination against tetanus: comparison of the immunogenicities of Salmonella strains expressing fragment C from the nirB and htrA promoters. Infect. Immun., 1998, pp. 3080-3087, vol. 66. |
| Romeo et al., Genetic regulation of glycogen biosynthesis in Escherichia coli: in vitro effects of cyclic AMP and guanosine 5′-diphosphate 3′-diphosphate and analysis of in vivo transcripts. J Bacteriol, 1989, pp. 2773-2782, vol. 171. |
| Sadler et al., A perfectly symmetric lac operator binds the lac repressor very tightly. Proc Natl Acad Sci U S A, 1983, pp. 6785-6789, vol. 80, No. 22. |
| Saeland et al., Serum samples from infants vaccinated with a pneumococcal conjugate vaccine, PncT, protect mice against invasive infection caused by Streptococcus pneumoniae serotypes 6A and 6B. J Infect Dis, 2001, pp. 253-260, vol. 183. |
| Schodel et al., Hybrid hepatitis B virus core-pre-S proteins synthesized in avirulent Salmonella typhimurium and Salmonella typhi for oral vaccination. Infect Immun, 1994, pp. 1669-1676, vol. 62, No. 5. |
| Schodel, Recombinant avirulent Salmonellae as oral vaccine carriers. Infection, 1992, pp. 1-8, vol. 20. |
| Schuchat et al., Bacterial meningitis in the United States in 1995. Active Surveillance Team. N Engl J Med, 1997, pp. 970-976, vol. 337. |
| Schulman et al., Independent variation in nature of hemagglutinin and neuraminidase antigens of influenza virus: distinctiveness of hemagglutinin antigen of Hong Kong-68 virus. Proc. Natl. Acad. Sci. USA, 1969, pp. 326-333, vol. 63. |
| Siegele et al., Gene Expression from plasmids containing the araBAD promoter at subsaturating inducer concentrations represents mixed populations. Proc Natl Acad Sci U S A, 1997, pp. 8168-8172, vol. 94, No. 15. |
| Simonsen et al., The impact of influenza epidemics on hospitalizations. J. Infect. Dis., 2000, pp. 831-837, vol. 181. |
| PCT/US2008/063303 (WO 2008/141226)—International Search Report and Written Opinion of the International Searching Authority, Nov. 26, 2008. |
| PCT/US2008/063293 (WO 2009/025888)—International Search Report and Written Opinion of the International Searching Authority, Feb. 12, 2009. |
| PCT/US2008/078991 (WO 2009/046449)—International Search Report and Written Opinion of the International Searching Authority, Dec. 15, 2008. |
| PCT/US2008/078993 (WO 2009/046451)—International Search Report and Written Opinion of the International Searching Authority, Dec. 15, 2008. |
| PCT/US2010/035630 (WO 2010/135563)—International Search Report and Written Opinion of the International Searching Authority, Sep. 29, 2010. |
| PCT/US2009/061100 (WO 2010/045620)—International Search Report and Written Opinion of the International Searching Authority, Dec. 4, 2009. |
| PCT/US2010/020137 (WO 2010/078584)—International Search Report and Written Opinion of the International Searching Authority, Mar. 9, 2010. |
| PCT/US2011/022110 (WO 2011/091291)—International Search Report and Written Opinion of the International Searching Authority, Apr. 11, 2011. |
| PCT/US2011/038588 (WO 2011/150421)—International Search Report and Written Opinion of the International Searching Authority, Nov. 22, 2011. |
| PCT/US98/24295—International Preliminary Examination Report, Dec. 26, 2000. |
| PCT/US2001/013915—International Preliminary Examination Report, Aug. 16, 2002. |
| European Patent Application No. 89910552.2 (EP0433372), Intention to Grant dated Jun. 19, 2001. |
| European Patent Application No. 89910552.2 (EP0433372), Office Action dated Oct. 10, 1994. |
| European Patent Application No. 89910552.2 (EP0433372), Office Action dated Sep. 12, 1995. |
| European Patent Application No. 89910552.2 (EP0433372), Office Action dated Jun. 20, 2000. |
| European Patent Application No. 89910552.2 (EP0433372), Decision to Grant dated May 6, 2002. |
| European Patent Application No. 90905859.6 (EP0465560), Office Action dated Feb. 19, 1992. |
| European Patent Application No. 90905859.6 (EP0465560), Office Action dated Feb. 9, 1994. |
| European Patent Application No. 90905859.6 (EP0465560), Intention to Grant dated Jan. 4, 1995 by A. Ormerod. |
| European Patent Application No. 90905859.6 (EP0465560), Decision to Grant dated Apr. 25, 1996. |
| European Patent Application No. 96919292.1 (EP0832255), Office Action dated Sep. 30, 2003. |
| European Patent Application No. 96919292.1 (EP0832255), Office Action dated Jul. 13, 2004. |
| European Patent Application No. 96919292.1 (EP0832255), Intention to Grant dated May 25, 2005. |
| European Patent Application No. 96919292.1 (EP0832255), Decision to Grant dated Nov. 4, 2005. |
| European Patent Application No. 98958581.5 (EP1030690), Office Action dated Jan. 31, 2001. |
| European Patent Application No. 98958581.5 (EP1030690), Intention to Grant dated Sep. 7, 2001. |
| European Patent Application No. 98958581.5 (EP1030690), Decision to Grant dated May 24, 2002. |
| European Patent Application No. 01944119.5 (EP1292687), Office Action dated Oct. 18, 2004. |
| European Patent Application No. 01944119.5 (EP1292687), Office Action dated Aug. 4, 2005. |
| European Patent Application No. 01944119.5 (EP1292687), Intention to Grant dated Jan. 26, 2006. |
| European Patent Application No. 01944119.5 (EP1292687), Decision to Grant dated Jul. 20, 2006. |
| European Patent Application No. 01979646.5 (EP1326960), Intention to Grant dated Apr. 8, 2004. |
| European Patent Application No. 01979646.5 (EP1326960), Decision to Grant dated Oct. 28, 2004. |
| European Patent Application No. 03721711.4 (EP1499191), Search Report dated May 23, 2006. |
| European Patent Application No. 03721711.4 (EP1499191), Office Action dated Aug. 24, 2006. |
| European Patent Application No. 03721711.4 (EP1499191), Office action dated Jan. 17, 2007. |
| European Patent Application No. 03721711.4 (EP1499191), Office action dated Mar. 23, 2009. |
| European Patent Application No. 03721711.4 (EP1499191), Office action dated Jun. 15, 2010. |
| European Patent Application No. 03721711.4 (EP1499191), Intention to Grant dated Oct. 21, 2011. |
| European Patent Application No. 03770256.0 (EP1537214), Intention to Grant dated Aug. 12, 2005. |
| U.S. Appl. No. 08/473,789, Office Action dated Apr. 15, 1997. |
| U.S. Appl. No. 08/473,789, Office Action dated Dec. 23, 1997. |
| U.S. Appl. No. 08/473,789, Office Action dated Nov. 13, 1998. |
| U.S. Appl. No. 08/473,789, Office Action dated Jun. 14, 1999. |
| U.S. Appl. No. 08/473,789, Office Action dated Jan. 21, 2000. |
| U.S. Appl. No. 08/473,789, Office Action dated Jul. 25, 2000. |
| U.S. Appl. No. 08/473,789, Office Action dated Sep. 27, 2001. |
| U.S. Appl. No. 08/761,769, Office Action dated Jul. 20, 1998. |
| U.S. Appl. No. 08/761,769, Office Action dated Mar. 3, 1999. |
| U.S. Appl. No. 08/761,769, Office Action dated Aug. 9, 2000. |
| CDC, Update: influenza activity—United States, Sep. 30, 2007-Apr. 5, 2008, and composition of the Sep. 2008 influenza vaccine. MMWR Morb. Mortal. Wkly Rep., 2008, pp. 404-409, vol. 57. |
| Chen et al., Genetic mapping of the cold-adapted phenotype of B/Ann Arbor/1/66, the master donor virus for live attenuated influenza vaccines (FluMist). Virology, 2006, pp. 416-423, vol. 345. |
| Collins et al., Mutations at rfc or pmi attenuate Salmonella Typhimurium virulence for mice. Infect. Immun., 1991, pp. 1079-1085, vol. 59. |
| Curtiss et al., Avirulent Salmonella typhimurium delta cya delta crp oral vaccine strains expressing a streptococcal colonization and virulence antigen. Vaccine, 1988, pp. 155-160, vol. 6. |
| Curtiss et al., New technologies in using recombinant attenuated Salmonella vaccine vectors. Crit. Rev. Immunol., 2010, pp. 255-270, vol. 30. |
| Curtiss et al., Salmonella strains with regulated delayed attenuation in vivo. Infect. Immun., 2009, pp. 1071-1082, vol. 77. |
| Curtiss et al., Salmonella typhimurium deletion mutants lacking adenylate cyclase and cyclic AMP receptor protein are avirulent and immunogenic. Infect Immun, 1987, pp. 3035-3043, vol. 55. |
| Curtiss et al., Stabilization of recombinant avirulent vaccine strains in vivo. Res Microbiol, 1990, pp. 797-805, vol. 141. |
| Curtiss, Bacterial infectious disease control by vaccine development. J. Clin. Investig., 2002, pp. 1061-1066, vol. 110. |
| Curtiss, Chromosomal aberrations associated with mutations to bacteriophage resistance in Escherichia coli. J. Bacteriol., 1965, pp. 28-40, vol. 89. |
| Daigle et al., Identification of Salmonella typhi genes expressed within macrophages by selective capture of transcribed sequences (SCOTS). Mol Microbiol, 2001, pp. 1211-1222, vol. 41. |
| Darzins. Nucleotide-sequence analysis of the phosphomannose isomerase gene (PMI) of Pseudomonas aeruginosa and comparison with the corresponding Escherichia-coli gene mana. Gene, 1986, pp. 293-302, vol. 42, No. 3. |
| Dean, 1997. Import of plasmid DNA into the nucleus is sequence specific. Exp. Cell Res., 1997, pp. 293-302, vol. 230. |
| Doggett et al., Immune responses to Streptococcus sobrinus surface protein antigen A expressed by recombinant Salmonella typhimurium. Infect Immun, 1993, pp. 1859-1866, vol. 61. |
| Dunstan et al., Comparison of the Abilities of Different Attenuated Salmonella Typhimurium Strains to Elicit Humoral Immune Responses against a Heterologous Antigen. Infect. Immun., 1998, pp. 732-740, vol. 66. |
| Dusek et al., Brown, Systemic and mucosal immune responses in mice orally immunized with avirulent Salmonella typhimurium expressing a cloned Porphyromonas gingivalis hemagglutinin. Infect Immun, 1994, pp. 1652-1657, vol. 62, No. 5. |
| Egan et al., A regulatory cascade in the induction of rhaBAD. J Mol Biol, 1993, pp. 97-98, vol. 234. |
| Egorov et al., Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. J. Virol., 1998, pp. 6437-6441, vol. 72. |
| Enami et al., Introduction of site-specific mutations into the genome of influenza virus. Proc. Natl. Acad. Sci. USA, 1990, pp. 3802-3805, vol. 87. |
| Fodor et al., Rescue of influenza A virus from recombinant DNA. J. Virol., 1999, pp. 9679-9682, vol. 73. |
| Formal et al., Construction of a potential bivalent vaccine strain: introduction of Shigella sonnei form I antigen genes into the galE Salmonella typhi Ty21a typhoid vaccine strain. Infect. Immun., 1981, pp. 746-750, vol. 34. |
| Fraser et al., The amino acid composition of T3 bacteriophage. J Biol Chem, 1953, pp. 291-295, vol. 205, No. 1. |
| Galan et al., Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cells. Proc Natl Acad Sci U S A, 1989, pp. 6383-6387, vol. 86. |
| Galen et al., Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhi CVD 908-htrA. Infect. Immun., 1999, pp. 6424-6433, vol. 67. |
| Garmory et al., Antibiotic-free plasmid stabilization by operator-repressor titration for vaccine delivery by using live Salmonella enterica serovar Typhimurium. Infect. Immun., 2005, pp. 2005-2011, vol. 73. |
| Gay et al., Positive selection procedure for entrapment of insertion sequence elements in gram-negative bacteria. J Bacteriol, 1985, pp. 918-921, vol. 164, No. 2. |
| Gentschev et al., Delivery of the p67 sporozoite antigen of Theileria parva by using recombinant Salmonella dublin: secretion of the product enhances specific antibody responses in cattle. Infect. Immun., 1998, pp. 2060-2064, vol. 66. |
| Gerdil, The annual production cycle for influenza vaccine. Vaccine, 2003, pp. 1776-1779, vol. 21. |
| Ghany et al. Candidate live, attenuated Salmonella enterica serotype Typhimurium vaccines with reduced fecal shedding are immunogenic and effective oral vaccines. Infect. Immun., 2007, pp. 1835-1842, vol. 75. |
| Greenwood, The epidemiology of pneumococcal infection in children in the developing world. Philos. Trans. R. Soc. Lond. B. Biol. Sci., 1999, pp. 777-785, vol. 354. |
| Gulig et al., Plasmid-associated virulence of Salmonella typhimurium. Infect Immun, 1987, pp. 2891-2901, vol. 55. |
| Guzman et al., Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol, 1995, pp. 4121-4130, vol. 177. |
| Hall et al., The role of fur in the acid tolerance response of Salmonella typhimurium is physiologically and genetically separable from its role in iron acquisition. J Bacteriol, 1996, pp. 5683-5691, vol. 178. |
| Hess et al., Superior efficacy of secreted over somatic antigen display in recombinant Salmonella vaccine induced protection against listeriosis. Proc. Natl. Acad. Sci. USA, 1996, pp. 1458-1463, vol. 93. |
| Hicks et al., Incidence of pneumococcal disease due to non-pneumococcal conjugate vaccine (PCV7) serotypes in the United States during the era of widespread PCV7 vaccination, 1998-2004. J Infect Dis, 2007, pp. 1346-1354, vol. 196. |
| Hitchcock et al., Morphological heteronucleic acid sequenceity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J Bacteriol, 1983, pp. 269-277, vol. 154, No. 1. |
| Hoffmann et al., “Ambisense” approach for the generation of influenza A virus: vRNA and mRNA synthesis from one template. Virology, 2000, pp. 310-317, vol. 267. |
| Hohmann et al., Macrophage-inducible expression of a model antigen in Salmonella typhimurium enhances immunogenicity. Proc Natl Acad Sci U S A, 1995, pp. 2904-2908, vol. 92, No. 7. |
| Hollingshead et al., Diversity of PspA: mosaic genes and evidence for past recombination in Streptococcus pneumoniae. Infect Immun., 2000, pp. 5889-5900, vol. 68. |
| Hopkins et al., A recombinant Salmonella typhimurium vaccine induces local immunity by four different routes of immunization. Infect Immun, 1995, pp. 3279-3286, vol. 63. |
| Jin et al., Multiple amino acid residues confer temperature sensitivity to human influenza virus vaccine strains (FluMist) derived from cold-adapted A/Ann Arbor/6/60. Virology, 2003, pp. 18-24, vol. 306. |
| Kang et al., Immune responses dependent on antigen location in recombinant attenuated Salmonella typhimurium vaccines following oral immunization. FEMS Immunol. Med. Microbiol. Lett., 2003, pp. 99-104, vol. 37. |
| Kang et al., Immune responses to recombinant pneumococcal PspA antigen delivered by live attenuated Salmonella enterica serovar typhimurium vaccine. Infect. Immun., 2002, pp. 1739-1749, vol. 70. |
| Kang et al., Transduction-mediated transfer of unmarked deletion and point mutations through use of counterselectable suicide vectors. J Bacteriol, 2002, pp. 307-312, vol. 184. |
| Katzman et al., Invertebrate connective tissue. Isolation of D-arabinose from sponge acidic polysaccharide. Biochem J, 1970, pp. 17-19, vol. 119, No. 1. |
| Kennedy et al., Attenuation and immunogenicity of Delta cya Delta crp derivatives of Salmonella choleraesuisin pigs. Infection and Immunity, 1999, pp. 4628-4636, vol. 67, No. 9. |
| Kilbourne, Studies on influenza in the pandemic of 1957-1958. III. Isolation of influenza A (Asian strain) viruses from influenza patients with pulmonary complications; details of virus isolation and characterization of isolates, with quantitative comparison of isolation methods. J. Clin. Invest., 1959, pp. 266-274, vol. 38. |
| Klumpp et al., Roles of the influenza virus polymerase and nucleoprotein in forming a functional RNP structure. EMBO J., 1997, pp. 1248-1257, vol. 16. |
| Kong et al, Regulated programmed lysis of recombinant Salmonella in host tissues to release protective antigens and confer biological containment. PNAS, 2008, pp. 9361-9366, vol. 105, No. 27. |
| Konjufca et al., A Recombinant Attenuated Salmonella enterica Serovar Typhimurium Vaccine Encoding Eimeria acervulina Antigen Offers Protection against E. acervulina Challenge. Infect. Immun., 2006, pp. 6785-6796, vol. 74. |
| Song et al., Organization and regulation of the D-xylose operons in Escherichia coli K-12: XyIR acts as a transcriptional activator. J Bacteriol, 1997, pp. 7025-7032, vol. 179. |
| Spellberg et al., Type 1/type 2 immunity in infectious diseases. Clin. Infect. Dis., 2001, pp. 76-102, vol. 32. |
| Schnaitman et al., Genetics of Lipopolysaccharide Biosynthesis in Enteric Bacteria. Microbiological Reviews, 1993, pp. 655-682, vol. 57, No. 3. |
| Srinivasan et al., Oral immunization with attenuated Salmonella expressing human sperm antigen induces antibodies in serum and the reproductive tract. Biol Reprod, 1995, pp. 462-471, vol. 53. |
| Steel et al., Live attenuated influenza viruses containing NS1 truncations as vaccine candidates against H5N1 highly pathogenic avian influenza. J. Virol., 2009, pp. 1742-1753, vol. 83. |
| Tacket et al., Safety and immunogenicity in humans of an attenuated Salmonella typhi vaccine vector strain expressing plasmid-encoded hepatitis B antigens stabilized by the asd-balanced lethal vector system. Infect Immun, 1997, pp. 3381-3385, vol. 65. |
| Taubenberger et al., 1918 Influenza: the mother of all pandemics. Emerg. Infect. Dis., 2006, pp. 15-22, vol. 12. |
| Török et al., Accumulation of ppGpp in a relA mutant of Escherichia coli during amino acid starvation. J. Biol. Chem., 1980, pp. 3838-3840, vol. 255. |
| Tu et al., The PhoP/PhoQ two-component system stabilizes the alternative sigma factor RpoS in Salmonella enterica. Proc Natl Acad Sci U S A., 2006, pp. 13503-13508, vol. 103. |
| Tumpey et al., Characterization of the reconstructed 1918 Spanish influenza pandemic virus. Science, 2005, pp. 77-80, vol. 310. |
| Van Rossum et al., Host and bacterial factors contributing to the clearance of colonization by Streptococcus pneumoniae in a murine model. Infect Immun, 2005, pp. 7718-7726, vol. 73. |
| Van Velkinburgh et al., PhoP-PhoQ-regulated loci are required for enhanced bile resistance in Salmonella spp. Infect Immun, 1999, pp. 1614-1622, vol. 67. |
| Webster et al., Evolution and ecology of influenza A viruses. Microbiol Rev, 1992, pp. 152-179, vol. 56. |
| Wilmes-Riesenberg et al., Role of acid tolerance response in virulence of Salmonella typhimurium. InfectImmun, 1996, pp. 1085-1092, vol. 64. |
| Wu et al., The mechanism underlying T cell help for induction of an antigen-specific in vivo humoral immune response to intact Streptococcus pneumoniae is dependent on the type of antigen. J Immunol, 2002, pp. 5551-5557, vol. 168. |
| Zahn, Overexpression of an mRNA dependent on rare codons inhibits protein synthesis and cell growth. J Bacteriol, 1996, pp. 2926-2933, vol. 178, No. 10. |
| Zhang et al., Characterization and immunogenicity of Salmonella typhimurium SL1344 and UK-1 crp and cdt deletion mutants. Infect. Immun., 1997, pp. 5381-5387, vol. 65. |
| Zobel et al., RNA polymerase I catalysed transcription of insert viral cDNA. Nucleic. Acids. Res., 1993, pp. 3607-3614, vol. 21. |
| Baek et al., Leucine-Responsive Regulator Protein (Lrp) Acts as a Virulence Respressor in Salmonella enterica Servoar Typhimurium. Journal of Bacteriology, 2009, pp. 1278-1292, vol. 191, No. 4. |
| PCT/US2011/061896—International Search Report and Written Opinion of the International Searching Authority, Apr. 5, 2012. |
| Byl et al, Sequence of the Genomore of Salmonella Bacteriophage P22. Journal of Bacteriology, 2000, pp. 6472-6484, vol. 182, 22. |
| Houng et al., Expression of Vi antigen in Escherichia coli K-12: characterization of ViaB from Citrobacter freundii and identity of ViaA with RcsB. J.Bacterio, 1992, pp. 5910-5915, vol. 174, No. 18. |
| Hori et al, Constructionof selt-disruptive Bacillus megaterium in response to substrate exhaustion for polyhydroxybutryrate production. Appl Microbiol Biotechnol, 2002, pp. 211-216, vol. 59. |
| Hurme et al, A Proteinaceous Gene Regulator Thermameter in Salmonella. Cell, 1997, pp. 55-64, vol. 90. |
| Kong et al., Salmonelle synthesizing 1-Monophosphorylated Lipopolysaccharide Exhibits Low Endotoxic while Retaining Its Immunogenicity. J Immunol, 2011, pp. 412-423, vol. 187. |
| Pickard et al., Characterization of defined ompR mutants of Salmonella typhi: ompR is involved in the regulation of VI polysaccharide expression. Infect Immun, 1994, pp. 3984-3893, vol. 62, No. 9. |
| Reed et al., The W-Beijing Lineage of Mycobacterium tuberculosis Overproduces Triglycerides and Has the DosR Dormancy Regulon Constitutively Upregulated. Journal of Bacteriology, 2007, pp. 2583-2589, vol. 189, No. 7. |
| Takaya et al., The ATP-Dependent Lon Protease of Salmonella enterica Serovar Typhimurium Regulates Invasion and Expression of Genes Carried on Salmonella Pathogenicity Island 1. Journal of Bacteriology, 2002, pp. 224-232, vol. 184, No. 1. |
| Waltman et al., Biochemical Characteristics of Edwardsiella ictaluri. Applied and Enviornmental Microbiology, 1986, pp. 101-104, vol. 51, No. 1. |
| Sun et al. Highly efficient method for introducing successive multiple scarless gene deletions and markerless gene insertions into the Yersinia pestis chromosome. Appl Environ Microbiol, 2008, pp. 4241-4245, vol. 74. |
| U.S. Appl. No. 13/006,072, Office Action dated Apr. 19, 2012. |
| U.S. Appl. No. 08/761,769, Office Action dated Sep. 25, 2001. |
| U.S. Appl. No. 08/761,769, Office Action dated Aug. 8, 2002. |
| U.S. Appl. No. 08/761,769, Notice of Allowance and Fees Due dated Jan. 22, 2003. |
| U.S. Appl. No. 09/120,970, Office Action dated Sep. 6, 2000. |
| U.S. Appl. No. 09/120,970, Office Action dated Jun. 5, 2001. |
| U.S. Appl. No. 09/120,970, Office Action dated Jan. 12, 2005. |
| U.S. Appl. No. 09/120,970, Office Action dated Nov. 8, 2005. |
| U.S. Appl. No. 09/120,970, Notice of Allowance and Fees Due dated Aug. 6, 2010. |
| U.S. Appl. No. 09/560,539, Office Action dated Feb. 12, 2002. |
| U.S. Appl. No. 09/560,539, Office Action dated Mar. 25, 2003. |
| U.S. Appl. No. 09/560,539, Office Action dated Aug. 29, 2003. |
| U.S. Appl. No. 09/560,539, Notice of Allowance and Fees Due dated Mar. 30, 2004. |
| U.S. Appl. No. 09/686,499, Office Action dated Jun. 20, 2001. |
| U.S. Appl. No. 09/686,499, Office Action dated Jan. 29, 2002. |
| U.S. Appl. No. 09/686,499, Office Action dated Dec. 16, 2002. |
| U.S. Appl. No. 09/686,499, Office Action dated Aug. 27, 2003. |
| U.S. Appl. No. 09/686,499, Notice of Allowance and Fees Due dated Nov. 2, 2004. |
| U.S. Appl. No. 10/138,239, Office Action dated Mar. 15, 2005. |
| U.S. Appl. No. 10/138,239, Office Action dated Sep. 21, 2005. |
| U.S. Appl. No. 10/138,239, Notice of Allowance and Fees Due dated Mar. 16, 2006. |
| U.S. Appl. No. 10/414,533, Office Action dated Apr. 12, 2006. |
| U.S. Appl. No. 10/414,533, Notice of Allowance and Fees Due dated Dec. 8, 2006. |
| U.S. Appl. No. 10/511,616, Office Action dated Nov. 27, 2009. |
| U.S. Appl. No. 10/511,616, Office Action dated Jun. 23, 2010. |
| U.S. Appl. No. 10/511,616, Office Action dated Dec. 27, 2010. |
| U.S. Appl. No. 10/511,616, Notice of Allowance and Fees Due dated Oct. 26, 2011. |
| U.S. Appl. No. 10/620,777, Office Action dated Nov. 14, 2006. |
| U.S. Appl. No. 10/620,777, Office Action dated Oct. 31, 2007. |
| U.S. Appl. No. 10/924,574, Office Action dated Feb. 28, 2007. |
| U.S. Appl. No. 10/924,574, Notice of Allowance and Fees Due dated Oct. 1, 2007. |
| European Patent Application No. 08827622.5, Search Report dated Jun. 27, 2011. |
| European Patent Application No. 08827622.5, Office action dated Feb. 22, 2012. |
| U.S. Appl. No. 12/615,872, Office Action dated Mar. 14, 2012. |
| U.S. Appl. No. 12/681,711, Office Action dated Jan. 31, 2012. |
| U.S. Appl. No. 12/789,869, Office Action dated Mar. 22, 2011. |
| U.S. Appl. No. 12/789,869, Office Action dated Dec. 7, 2011. |
| Bang et al, OmpR regulates the stationary-phase acid tolerance response of Salmonella enterica serovar Typhimurium. J Bacteriol, 2000, pp. 2245-2252, vol. 182. |
| Bang et al., Autoinduction of the ompR response regulator by acid shock and control of the Salmonella enterica acid tolerance response. Mol Microbiol, 2002, pp. 1235-1250, vol. 44. |
| Bartlett et al., Influenza A (H5N1): will it be the next pandemic influenza? Are we ready? Ann. Intern. Med., 2005, pp. 460-462, vol. 143. |
| Bartlett, Planning for avian influenza. Ann. Intern. Med., 2006, pp. 141-144, vol. 145. |
| Bearson et al., A low pH-inducible, PhoPQ-dependent acid tolerance response protects Salmonella typhimurium against inorganic acid stress. J Bacteriol, 1998, pp. 2409-2417, vol. 180. |
| Bertani, Studies on lysonucleic acid sequencesis. I. The mode of phage liberation by lysogenic Escherichia coli. J Bacteriol, 1951, pp. 293-300, vol. 62, No. 3. |
| Black et al., Aspartic •-semialdehydedehydrogenase and aspartic •-semialdehydel Biol. Chem., 1955, pp. 39-50, vol. 213. |
| Briles et al., Immunization of humans with recombinant pneumococcal surface protein a (rPspA) elicits antibodies that passively protect mice from fatal infection with Streptococcus pneumoniae bearing heterologous PspA. J. Infect. Dis., 2000, pp. 1694-1701, vol. 182. |
| Brooks-Walter et al., The pspC gene of Streptococcus pneumoniae encodes a polymorphic protein, PspC, which elicits cross-reactive antibodies to PspA and provides immunity to pneumococcal bacteremia. Infect. Immun., 1999, pp. 6533-6542, vol. 67. |
| Brosius et al., Spacing of the -10 and -35 regions in the tac promoter. Effect on its in vivo activity. J Biol Chem, 1985, pp. 3539-3540, vol. 260, No. 6. |
| Brown et al., MurA (MurZ), the enzyme that catalyzes the first committed step in peptidoglycan biosynthesis, is essential in Escherichia coli. J. Bacteriol., 1995, pp. 4194-4197, vol. 177. |
| Buchanan et al., IL-12 Enhances Antibody Responses to T-Independent Polysaccharide Vaccines in the Absence of T and NK Cells. J Immunol, 1998, pp. 5525-5533, vol. 161. |
| Buchmeier, et al., DNA repair is more important than catalase for Salmonella virulence in mice. J. Clin. Invest., 1995, pp. 1047-1053, vol. 95. |
| Bumann, Regulated antigen expression in live recombinant Salmonella enterica serovar Typhimurium strongly affects colonization capabilities and specific CD4(+)-T-cell responses. Infect Immun, 2001. pp. 7493-7500, vol. 69, No. 12. |
| Alonso et al, Anti-polysaccharide immunoglobulin isotype levels and opsonic activity of antisera: relationships with protection against Streptococcus pneumoniae infection in mice. J Infect Dis, 1995, pp. 562-565, vol. 172. |
| Amann et al., Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Nucleic acid sequence, 1988. pp. 301-315, vol. 69, No. 2. |
| Anderson et al., Delivery of the Pertactin/P.69 polypeptide of Bordetella pertussis using an attenuated Salmonella typhimurium vaccine strain: expression levels and immune response. Vaccine, 1996, pp. 1384-1390 , vol. 14, No. 14. |
| Aravind et al., The HD domain defines a new superfamily of metal-dependent phosphohydrolases. Trends Biochem Sci, 1998, pp. 469-472, vol. 23. |
| Arricau et al., The RcsB-RcsC regulatory system of Salmonella typhi differentially modulates the expression of invasion proteins, flagellin and Vi antigen in response to osmolarity., Mol Microbiol, 1998, pp. 85-50, vol. 29, No. 3. |
| Arulanandam et al., Intranasal vaccination with pneumococcal surface protein A and interleukin-12 augments antibody-mediated opsonization and protective immunity against Streptococcus pneumoniae infection. Infect Immun, 2001, pp. 6718-6724, vol. 69. |
| Audia et al., Breaking through the acid barrier: an orchestrated response to proton stress by enteric bacteria. Int J Med Microbiol, 2001, pp. 97-106, vol. 291. |
| Battesti et al., Acyl carrier protein/SpoT interaction, the switch linking SpoT-dependent stress response to fatty acid metabolism. Mol Microbiol, 2006, pp. 1048-1063, vol. 62. |
| Blattner et al., The complete genome sequence of Escherichia coli K-12. Science, 1997, pp. 1453-1474, vol. 277. |
| Branger et al., Oral vaccination with different antigens from Yersinia pestis Kim delivered by live attenuated Salmonellatyphimurium elicits a protective immune response against plague. Adv Exp Med Biol, 2007, pp. 387-399, vol. 603. |
| Briles et al. The potential for using protein vaccines to protect against otitis media caused by Streptococcus pneumoniae. Vaccine, 2001, pp. S87-S95, vol. 19, Suppl 1. |
| Brubaker, Interleukin-10 and inhibition of innate immunity to Yersiniae: roles of Yops and LcrV (V antigen). Infect Immun, 2003, pp. 3673-3681, vol. 71. |
| Brubaker, the Vwa+ virulence factor of Yersiniae: the molecular basis of the attendant nutritional requirement for Ca2+. Rev Infect Dis, 1983,pp. S748-S758, vol. 5, Suppl 4. |
| Brumell et al., (2004) Salmonella redirects phagosomal maturation. Curr Opin Microbiol, 2004, pp. 78-84, vol. 7. |
| Cárdenas et al., Oral immunization using live attenuated Salmonella spp. as carriers of foreign antigens. Clin. Microbiol. Rev., 1992, pp. 328-342, vol. 5, No. 3. |
| Charnetzky et al., RNA synthesis in Yersinia pestis during growth restriction in calcium-deficient medium. J Bacteriol, 1982, pp. 108-195, vol. 149. |
| Chatfield et al., Use of the nirB promoter to direct the stable expression of heterologous antigens in Salmonella oral vaccine strains: development of a single-dose oral tetanus vaccine. Biotechnology (N Y), 1992, pp. 888-892, vol. 10, No. 8. |
| Cheng et al., Simultaneous analyses of neutral carbohydrates and amino sugars in freshwaters with HPLC-PAD. J. Chromatogr. Sci., 2003, pp. 434-438, vol. 41. |
| Chipman et al., The Act domain family. Curr Opin Struct Biol, 2001, pp. 694-700, vol. 11. |
| Chromy et al., Proteomic characterization of Yersinia pestis virulence. J Bacteriol, 2005, pp. 8172-8180, vol. 187. |
| Coombes et al., SseL Is a Salmonella-Specific Translocated Effector Integrated into the SsrB-Controlled Salmonella Pathogenicity Island 2 Type III Secretion System. Infection and Immunity, 2007, pp. 574-580, vol. 75, No. 2. |
| Cornelis et al., The virulence plasmid of Yersinia, an antihost genome. Microbiol Mol Biol Rev, 1998, pp. 1315-1352, vol. 62. |
| Curtiss et al. Nonrecombinant and recombinant avirulent Salmonella vaccines for poultry. Vet Immunol Immunopathol, 1996, pp. 365-372, vol. 54. |
| Curtiss et al., Live oral avirulent Salmonella vaccines. Vet. Microbiol., 1993, pp. 397-405, vol. 37. |
| Curtiss et al., Recombinant Salmonella vectors in vaccine development. Dev Biol Stand., 1994, pp. 23-33, vol. 82. |
| Datsenko et al., One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A, 2000, pp. 6640-6645, vol. 97. |
| Davison, Towards safer vectors for the field release of recombinant bacteria. Environ. Biosafety Res., 2002, pp. 9-18, vol. 1. |
| De Groote et al., Homocysteine antagonism of nitric oxide-related cytostasis in Salmonella typhimurium. Science, 1996, pp. 414-417, vol. 272. |
| Dekruyff et al., Induction of immunoglobulin synthesis by CD4+ T cell clones. Seminars in Immunology, 1993, pp. 421-430, vol. 5. |
| Del Beccaro et al., Bacteriology of acute otitis media: a new perspective. J Pediatr, 1992, pp. 81-84, vol. 120. |
| Deng et al., Genome sequence of Yersinia pestis Kim. J Bacteriol, 2002, pp. 4601-4611, vol. 184. |
| Doggett et al., Delivery of antigens by recombinant avirulent Salmonella strains. Adv. Exp. Med. Biol., 1992, pp. 165-173, vol. 327. |
| Doublet et al., The murl gene of Escherichia coli is an essential gene that encodes a glutamate racemase activity. J. Bacteriol., 1993, pp. 2970-2979, vol. 175. |
| Dubnau, DNA uptake in bacteria. Annu. Rev. Microbiol., 1999, pp. 217-244, vol. 53. |
| Edwards et al., Improved allelic exchange vectors and their use to analyze 987P fimbria nucleic acid sequence expression. Gene, 1998, pp. 149-157, vol. 207, No. 2. |
| Fooks, Development of oral vaccines for human use. Curr Opin Mol Ther, 2000, pp. 80-86, vol. 2, No. 1. |
| Foster et al., How Salmonella survive against the odds. Annu Rev Microbiol, 1995, pp. 145-174, vol. 49. |
| Galen et al., Can a ‘flawless’ live vector vaccine strain be engineered? Trends Microbiol, 2001, pp. 372-376, vol. 9, No. 8. |
| Garmory et al., The Use of Live Attenuated Bacteria as a Delivery System for Heterologous Antigens. Journal of Drug Targeting, 2003, pp. 471, vol. 11. |
| Garzon et al., recB recJ mutants of Salmonella typhimurium are deficient in transductional recombination, DNA repair and plasmid maintenance. Mol. Gen. Genet., 1996, pp. 570-580, vol. 250. |
| Gentry et al., Mutational analysis of the Escherichia coli spoT gene identifies distinct but overlapping regions involved in ppGpp synthesis and degradation. Mol Microbiol, 1996, pp. 1373-1384, vol. 19. |
| Gentschev et al., The E. coli alpha-hemolysin secretion system and its use in vaccine development. Trends Microbiol, 2002, pp. 39-45, vol. 10, No. 1. |
| Giannella et al., Gastric acidity and cholera. Ann Intern Med, 1973, p. 780, vol. 78. |
| Gilbert, The lac repressor and the lac operator. Ciba Found Symp, 1972, pp. 24-59, vol. 7. |
| Gong et al., Characterization of the Yersinia pestis Yfu ABC inorganic iron transport system. Infect Immun, 2001, pp. 2829-2837, vol. 69. |
| Gor et al., TH1-TH2: a Procrustean paradigm. Nat Immunol, 2003, p. 503-505, vol. 4. |
| Grillot-Courvalin et al., Functional gene transfer from intracellular bacteria to mammalian cells. Nat. Biotechnol., 1998, pp. 862-866, vol. 16. |
| Guerrant et al., Magnitude and Impact of Diarrheal Diseases. Arch. Med. Res., 2002, pp. 351-355, vol. 33. |
| Gunn, Mechanisms of bacterial resistance and response to bile. Microbes Infect, 2000, pp. 907-913, vol. 2. |
| Hengge-Aronis et al., Identification and molecular analysis of glgS, a novel growth-phase-regulated and rpoS-dependent gene involved in glycogen synthesis in Escherichia coli. Mol Microbiol, 1992, pp. 1877-1886, vol. 6. |
| Hess et al., Secretion of different listeriolysin cognates by recombinant attenuated Salmonella typhimurium: superior efficacy of haemolytic over non-haemolytic constructs after oral vaccination. Microbes Infect, 2000, pp. 1799-1806, vol. 2. |
| Hohmann et al., Evaluation of a phoP/phoQ-deleted, aroA-deleted live oral Salmonella typhi vaccine strain in human volunteers. Vaccine, 1996, pp. 19-24, vol. 14. |
| Hu et al., The inducible lac operator-repressor system is functional in mammalian cells. Cell, 1987, pp. 555-566, vol. 48, No. 4. |
| Hu et al., The inducible lac operator-repressor system is functional for control of expression of injected DNA in Xenopus oocytes. Gene, 1988, pp. 301-313, vol. 62, No. 2. |
| Huang et al., Genome-wide screen of Salmonella nucleic acid sequences expressed during infection in pigs, using in vivo expression technology. Appl Environ Microbiol, 2007, pp. 7522-7530, vol. 73, No. 23. |
| Iannelli et al., Allelic variation in the highly polymorphic locus pspC of Streptococcus pneumoniae. Gene, 2002, pp. 63-71, vol. 284. |
| In Soo Lee et al., The stationary-phase sigma factor sS (RpoS) is required for a sustained acid tolerance response in virulent Salmonella typhimurium. Molecular Microbiology, 1995, pp. 155-167, vol. 17. |
| Isoda et al., Expression of a Porphyromonas gingivalis hemagglutinin on the surface of a Salmonella vaccine vector. Vaccine, 2007, pp. 117-126, vol. 25, No. 1. |
| Ivancic-Bace et al, Effects of recJ, recQ, and recFOR mutations on recombination in nuclease-deficient recB recD double mutants of Escherichia coli. J. Bacteriol., 2005, pp. 1350-1356, vol. 187. |
| Kaufmann et al., Impact of intracellular location of and antigen display by intracellular bacteria: implications for vaccine development. Immunol. Lett., 1999, pp. 81-84, vol. 65. |
| Khan et al., Immunogenicity and protective efficacy of DnaJ (hsp40) of Streptococcus pneumoniae against lethal infection in mice. Vaccine, 2006, pp. 6225-6231, vol. 24. |
| Kim et al., Direct transcriptional control of the plasminogen activator gene of Yersinia pestis by the cyclic AMP receptor protein. J Bacteriol, 2007, pp. 8890-8900, vol. 189. |
| Kolodrubetz et al., Regulation of the L-arabinose transport operons in Escherichia coli. J Mol Biol, 1981, pp. 215-227, vol. 151, No. 2. |
| Kwon et al., Salmonella-based vaccines for infectious diseases. Expert Review of Vaccines, 2007, pp. 147-152, vol. 6. |
| Lange et al., Identification of a central regulator of stationary-phase gene expression in Escherichia coli. Mol Microbiol, 1991, pp. 49-59, vol. 5. |
| Lee et al., Regulation of L-arabinose transport in Salmonella typhimurium LT2. Mol Gen Genet, 1982, pp. 136-141, vol. 185, No. 1. |
| Lee et al., Surface-displayed viral antigens on Salmonella carrier vaccine. Nat Biotechnol, 2000, pp. 645-648, vol. 18, No. 6. |
| Lewis, The lac repressor. C R Biol, 2005, pp. 521-548, vol. 328, No. 6. |
| Lobell et al., AraC-DNA looping: orientation and distance-dependent loop breaking by the cyclic AMP receptor protein. J Mol Biol, 1991, pp. 45-54, vol. 218. |
| Lobocka et al., Organization and expression of the Escherichia coli K-12 dad operon encoding the smaller subunit of D-amino acid dehydrogenase and the catabolic alanine racemase. J. Bacteriol., 1994, pp. 1500-1510, vol. 176. |
| Loessner et al., Bacteria-mediated DNA transfer in gene therapy and vaccination. Expert. Opin. Biol. Ther., 2004, pp. 157-168, vol. 4. |
| Loessner et al., Remote control of tumour-targeted Salmonella enterica serovar Typhimurium by the use of L-arabinose as inducer of bacterial gene expression in vivo. Cell Microbiol, 2007, pp. 1529-1537, vol. 9. |
| Marshall et al., Use of the stationary phase inducible promoters, spy and dps, to drive heterologous antigen expression in Salmonella vaccine strains. Vaccine, 2000, pp. 1298-1306, vol. 18, No. 14. |
| Medina et al., Use of live bacterial vaccine vectors for antigen delivery: potential and limitations. Vaccine, 2001, pp. 1573-1580, vol. 19. |
| Mehigh et al., Expression of the low calcium response in Yersinia pestis. Microb Pathog, 1989, pp. 203-217, vol. 6. |
| Moore et al., Enhanced protective immunity against pneumococcal infection with PspA DNA and protein. Vaccine, 2006, p. 5755, vol. 24. |
| Mossing et al., Upstream operators enhance repression of the lac promoter. Science, 1986, pp. 889-892, vol. 233, No. 4766. |
| Motin et al., Passive immunity to Yersiniae mediated by anti-recombinant V antigen and protein A-V antigen fusion peptide. Infect Immun, 1994, pp. 4192-4201, vol. 62. |
| Muller et al., Repression of lac promoter as a function of distance, phase and quality of an auxiliary lac operator. J Mol Biol, 1996, pp. 21-29, vol. 257, No. 1. |
| Muller-Hill et al., Mutants that mke more lac repressor. Proc Natl Acad Sci U S A, 1968, pp. 1259-1264, vol. 59, No. 4. |
| Muller-Hill, Lac repressor and lac operator. Prog Biophys Mol Biol, 1975, pp. 227-252, vol. 30, No. 2-3. |
| Nabors et al., Immunization of healthy adults with a single recombinant pneumococcal surface protein A (PspA) variant stimulates broadly cross-reactive antibodies to heterologous PspA molecules. Vaccine, 2000, p. 1743, vol. 18. |
| Nakayama et al., Construction of an Asd+ expression-cloning vector: stable maintenance and high level expression of cloned nucleic acid sequences in a Salmonella vaccine strain. BioTechnology, 1988, pp. 693-697, vol. 6. |
| Nedialkov et al., Resistance to lipopolysaccharide mediated by the Yersinia pestis V antigen-polyhistidine fusion peptide: amplification of interleukin-10. Infect Immun, 1997, pp. 1196-1203, vol. 65. |
| Neutra et al., Antigen sampling across epithelial barriers and induction of mucosal immune responses. Annu Rev Immunol, 1996, pp. 275-300, vol. 14. |
| O'Callaghan et al., High efficiency transformation of Salmonella typhimurium and Salmonella typhi by electroporation. Mol Gen Genet, 1990, pp. 156-158, vol. 223, No. 1. |
| Ortqvist et al., Randomised trial of 23-valent pneumococcal capsular polysaccharide vaccine in prevention of pneumonia in middle-aged and elderly people. Swedish Pneumococcal Vaccination Study Group. Lancet, 1998, pp. 399-403, vol. 351. |
| Perry et al., Temperature regulation of the hemin storage (Hms+) phenotype of Yersinia pestis is posttranscriptional. J Bacteriol, 2004, pp. 1638-1647, vol. 186. |
| Petersen et al., Essential role for cyclic AMP and its receptor protein in Yersinia enterocolitica virulence. Infect Immun, 2004, pp. 3665-3672, vol. 70. |
| Ramarathinam et al., Salmonella Typhimurium induces IFN-gamma production in murine splenocytes. Role of natural killer cells and macrophages. J Immunol, 1993, pp. 3973-3981, vol. 150. |
| Raupach et al., Bacterial virulence, proinflammatory cytokines and host immunity: how to choose the appropriate Salmonella vaccine strain? Microbes and Infection, 2001, p. 1261, vol. 3. |
| Roland et al., Construction and evaluation of a delta cya delta crp Salmonella typhimurium strain expressing avian pathogenic Escherichia coli O78 LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis, 1999, pp. 429-441, vol. 43, No. 3. |
| Sarubbi et al., (1989) Characterization of the spoT gene of Escherichia coli. J Biol Chem, 1989, pp. 15074-15082, vol. 264. |
| Schmieger et al., Altered cotransduction frequencies exhibited by HT-mutants of Salmonella-phage P22. Mol Gen Genet, 1976, pp. 307-309, vol. 143. |
| Schmieger, Phage P22-mutants with increased or decreased transduction abilities. Mol Gen Genet, 1972, pp. 75-88, vol. 119. |
| Schödel et al., Hybrid hepatitis B virus core antigen as a vaccine carrier moiety. II. Expression in avirulent Salmonella spp. for mucosal immunization. Adv Exp Med Biol., 1996, pp. 15-21, vol. 397. |
| Schodel, Prospects for oral vaccination using recombinant bacteria expressing viral epitopes. Adv. Virus Res., 1992, pp. 409-446, vol. 41. |
| Schwyn et al., Universal chemical assay for the detection and determination of siderophores. Analytical Biochemistry, 1987, p. 47, vol. 160. |
| Sedgwick et al., A solid-phase immunoenzymatic technique for the enumeration of specific antibody-secreting cells. Journal of Immunological Methods, 1983, p. 301, vol. 57. |
| Shalaby, Development of oral vaccines to stimulate mucosal and systemic immunity: barriers and novel strategies. Clin Immunol Immunopathol, 1995, pp. 127-134, vol. 74, No. 2. |
| Sheehan et al., Generation and characterization of hamster monoclonal antibodies that neutralize murine tumor necrosis factors. J Immunol, 1989, pp. 3884-3893, vol. 142. |
| Sizemore et al., Attenuated bacteria as a DNA delivery vehicle for DNA-mediated immunization. Vaccine, 1997, pp. 804-807, vol. 15. |
| Snapper et al., Distinct types of T-cell help for the induction of a humoral immune response to Streptococcus pneumoniae. Trends Immunol, 2001, pp. 308-311, vol. 22. |
| Sodeinde et al., Plasminogen activator/coagulase gene of Yersinia pestis is responsible for degradation of plasmid-encoded outer membrane proteins. Infect Immun, 1988, pp. 2749-2752, vol. 56. |
| Sternberg et al., Bacteriophage-mediated nucleic acid sequenceralized transduction in Escherichia coli and Salmonella typhimurium. Methods Enzymol, 1991, pp. 18-43, vol. 204. |
| Straley et al., Virulence genes regulated at the transcriptional level by Ca2+ in Yersinia pestis include structural genes for outer membrane proteins. Infect Immun, 1986, pp. 445-454, vol. 51. |
| Sun et al., The role of relA and spoT in Yersinia pestis KIM5+ pathogenicity. PLoS One, 2009, pp. E6720, vol. 4. |
| Thompson et al., The bacterial signal molecule, ppGpp, mediates the environmental regulation of both the invasion and intracellular virulence gene programs of Salmonella. J Biol Chem, 2006, pp. 30112-30121, vol. 281. |
| Une et al., In vivo comparison of avirulent Vwa- and Pgm- or Pstr phenotypes of Yersiniae. Infect Immun, 1984, pp. 895-900, vol. 43. |
| Uzzau et al., Epitope tagging of chromosomal genes in Salmonella. Proc Natl Acad Sci U S A, 2001, pp. 15264-15269, vol. 98. |
| Viboud et al., Yersinia outer proteins: role in modulation of host cell signaling responses and pathogenesis. Annu Rev Microbiol, 2005, pp. 69-89, vol. 59. |
| Wasserman et al., Two alanine racemase genes in Salmonella typhimurium that differ in structure and function. J. Bacteriol., 1983, pp. 1439-1450, vol. 153. |
| Whitfield, Biosynthesis and assembly of capsular polysaccharides in Escherichia coli. Annu Rev. Biochem., 2006, pp. 39-68, vol. 75. |
| Winter et al., The Salmonella enterica serotype Typhi regulator TviA reduces interleukin-8 production in intestinal epithelial cells by repressing flagellin secretion. Cell Microbiol, 2008, pp. 247-261, vol. 10, No. 1. |
| Wolf et al., Evolution of aminoacyl tRNA synthetases—analysis of unique domain architectures and phylogenetic trees reveals a complex history of horizontal gene transfer events. Genome Res, 1999, pp. 689-710, vol. 9. |
| Xiao et al., Residual guanosine 39,59-bispyrophosphate synthetic activity of relA null mutants can be eliminated by spoT null mutations. J Biol Chem, 1991, pp. 5980-5990, vol. 266. |
| Zahorchak et al., Effect of exogenous nucleotides on Ca2+ dependence and V antigen synthesis in Yersinia pestis. Infect Immun, 1982, pp. 953-959, vol. 38. |
| Zhang et al., A “one-plasmid” system to generate influenza virus in cultured chicken cells for potential use in influenza vaccine. J. Virol., 2009, pp. 9296-9303, vol. 83. |
| Zhang et al., Transcription activation parameters at ara pBAD. J Mol Biol, 1996, pp. 14-24, vol. 258, No. 1. |
| Zinkernagel et al., Antigen localisation regulates immune responses in a dose- and time-dependent fashion: a geographical view of immune reactivity. Immunol Rev, 1997, pp. 199-209, vol. 156. |
| Briles et al., PspA, a protection-eliciting pneumococcal protein: immunogenicity of isolated native PspA in mice. Vaccine, 1996, pp. 858-867, vol. 14. |
| Hanisch, et al, The Ralstonia eutropha H16 phasin PhaP1 is targeted to intracellular triacylglycerol inclusions in Rhodococcus opacus PD630 and Mycobacterium smegmatis mc2155, and provides an anchor to target other proteins. |
| Kong et al, Regulated Delayed Expression of rfaH in an Attenuated Salmonella enterica Serovar Typhimurium Vaccine Enhances Immunogenicity of Outer Membrane Proteins and Heterologous Antigen. Infec Immun. 2009, pp. 5572-5582, vol. 77, No. 12. |
| Lefman et al, Three-Dimensional Electron Microscopic Imaging of Membrane Invaginations in Escherichia coli Overproducing the Chemotaxis Receptor Tsr. Journal of Bacteriology, 2004, pp. 5052-5061, vol. 186, No. 15. |
| Morita et al., Antibacterial Activity of Bacillus amyloliquefaciencs Phage Endolysin without Holin Conjugation. Journal of Biosciences and Bioengineering, 2001, pp. 469-473, vol. 91, No. 5. |
| Navasa et al, Temperature has reciprocal effects on colanic acid and polysialic acid biosynthesis in E. coli K92. Appl Microbiol Biotechnol, 2009, pp. 721-729, vol. 82. |
| Stevens, Immunization with the C-Domain of alpha-Toxin Prevents Lethal Infection, Localizes Tissue Injury, and Promotes Host Responses to Challenge with Clostridium perfringens. JID, 2004, pp. 767-773, vol. 190. |
| Verjan et al, Genetic Loci of Major Antigenic Protein Genes of Edwardsiella tarda. Applied and Environmental Microbiology, 2005, pp. 5654-5658, vol. 71, No. 9. |
| U.S. Appl. No. 12/599,655, Office Action dated Jul. 2, 2012. |
| U.S. Appl. No. 12/681,721, Office Action dated May 24, 2012. |
| Ellis, R, New Technologies for Making Vaccines. Vaccines, 1988, pp. 568-574, W.B. Saunders Company, Philadelphia. |
| Greenspan et al, Defining epitopes: It's not as easy as it seems. Nature Biotechnology, 1999, pp. 936-937, vol. 17. |
| Houghten et al, Relative Importance of Position and Individual Amino Acid Residues in Peptide Antigen-Antibody Interactions: Implications in the Mechanism of Antigenic Drift and Antigenic Shift. Vaccines86, 1986, pp. 21-25, Cold Spring Harbor Laboratory, USA. |
| U.S. Appl. No. 12/599,655, Office Action dated Mar. 12, 2013. |
| U.S. Appl. No. 12/681,711, Office Action dated Nov. 28, 2012. |
| U.S. Appl. No. 12/789,869, Office Action dated Jun. 3, 2014. |
| U.S. Appl. No. 13/088,141, Office Action dated Apr. 24, 2014. |
| U.S. Appl. No. 13/574,718, Office Action dated Sep. 6, 2013. |
| U.S. Appl. No. 13/574,718, Office Action dated Apr. 28, 2014. |
| U.S. Appl. No. 13/700,591, Office Action dated Apr. 2, 2014. |
| U.S. Appl. No. 13/898,241, Office Action dated Apr. 17, 2014. |
| Bittner et al., RpoS and RpoN are involved in the growth-dependent regulation of rfaH transcription and O antigen expression in Salmonella enterica serovar Typhi, Microbial Pathogenisis. vol. 36, 2004 (p. 19). |
| Liu et al., Nickel-inducible lysis system in Synechocystis sp. PCC 6803. PNAS, vol. 106, 2009, pp. 21550-21554. |
| Liu et al., CO2—limitation-inducible Green Recovery of fatty acids from cyanobacterial biomass. PNAS, vol. 108, 2011 pp. 6905-6908. |
| Moreno et al., Salmonella as Live Trojan Horse for Vaccine Development and Cancer Gene Therapy. Current Gene Therapy, 2010, 10, pp. 56-76. |
| U.S. Appl. No. 13/302,575, Office Action dated Jun. 18, 2013. |
| Folkesson et al., Components of the peptidoglycan-recycling pathway modulate invasion and intracellular survival of Salmonella enterica serovar Typhimurium. Cellular Microbiology, 2005, vol. 7(1) pp. 147-155. |
| Whitworth et al., Expression of the Rickettsia prowazekii pld or tlyC Gene in Salmonella enterica Serovar Typhimurium Mediates Phagosomal Escape, Infection and Immunity, 2005, vol. 73(10), pp. 6668-6673. |
| Quenee, Lauriane E., et al., Yersinia pestis caf1 Variants and the Limits of Plague Vaccine Protection, Infection and Immunity, May 2008, vol. 76, No. 5, pp. 2025-2036. |
| U.S. Appl. No. 13/088,141, Office Action dated Dec. 6, 2012 (Ginny Portner). |
| U.S. Appl. No. 13/006,072, Office Action dated Dec. 11, 2012 (Ja'Na Hines). |
| Kong, W., T-10-, Improving DNA Vaccine Vector for Efficient Vaccine Delivery Using Live Attenuated Bacterial Carrier, The Society, vol. 2008, No. 108, pp. 668. |
| Mesika, Adi, et al., A Regulated, NF kB-Assisted Import of Plasmid DNA into Mammalian Cell Nuclei, Molecular Therapy, vol. 3, No. 5, May 2001, pp. 653-657. |
| Ribeiro, Sofia C., et al., The Role of Polyadenylation Signal Secondary Structures on the Resistance of Plasmid Vectors to Nucleases, The Journal of Gene Medicine, vol. 6, 2004, pp. 565-573. |
| Rytkonen, Anne, et al.,. SseL, a Salmonella Deubiquitinase Required for Macrophage Killing and Virulence, PNAS, vol. 104, No. 9, Feb. 27, 2007, pp. 3502-3507. |
| Wang, Shixia, et al., Hemagglutinin (HA) Proteins from H1 and H3 Serotypes of Influenza a Viruses Require Different Antigen Designs for the Induction of Optimal Protective Antibody Responses as Studied by Codon-Optimized HA DNA Vaccines, Journal of Virology, vol. 80, No. 23, Dec. 2006, pp. 11628-11637. |
| U.S. Appl. No. 13/302,575, Office Action dated Sep. 25, 2012 (Oluwatosin Ogunbiyi). |
| U.S. Appl. No. 12/615,872, Office Action dated Oct. 23, 2012 (Jennifer Graser). |
| American Society of Microbiology, vol. 108; 2008: (p. 668). |
| Number | Date | Country | |
|---|---|---|---|
| 20100285592 A1 | Nov 2010 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61168996 | Apr 2009 | US |