Patent Grant
11629350
The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 786212000601SEQLIST.TXT, date recorded: Feb. 1, 2021, size: 23 KB).
The invention relates to the production and use of Cas-encoding sequences and vectors comprising these. Aspects of the invention provide products, vectors, delivery vehicles, uses and methods for producing Cas-encoding sequences in bacterial or archaeal cells.
The state of the art describes vectors and uses of these that employ CRISPR/Cas systems. For example, reference is made to WO2017/118598, US20180140698, US20170246221, US20180273940, US20160115488, US20180179547, US20170175142, US20160024510, US20150064138, US20170022499, US20160345578, US20180155729, US20180200342, WO2017112620, WO2018081502, PCT/EP2018/066954, PCT/EP2018/066980, PCT/EP2018/071454 and U.S. Ser. No. 15/985,658 and equivalent publications by the US Patent and Trademark Office (USPTO) or WIPO, the disclosures of which are incorporated herein by reference.
The invention provides the following configurations.
In a First Configuration A nucleic acid vector for introduction into a host cell, the vector comprising a first nucleotide sequence encoding a Type I Cas3 and a second nucleotide sequence encoding one or more Cascade proteins, wherein the first and second sequences are under the control of one or more promoters comprised by the vector for expression of the proteins in the cell.
In an example, the vector comprises an operon for expression in the cell of the Cas3 and Cascade proteins from a Cas module, the module comprising the nucleotide sequences encoding the Cas3 and Cascade proteins, and the operon comprising the Cas module under the control of a promoter for controlling the expression of both the Cas3 and Cascade proteins.
The invention also provides a delivery vehicle comprising the vector, as well as a pharmaceutical composition comprising the vector or vehicle and a pharmaceutically acceptable diluent, excipient or carrier.
The invention also provides a method of treating or reducing the risk of a disease or condition in a human or animal subject, the method comprising administering the vector, vehicle or composition to the subject, and introducing the vector into target host bacterial or archaeal cells in the subject (eg, in a gut microbiota, lung, eye or blood of the subject), wherein the Cas cuts (or otherwise modifies) one or more target sequences in the target cells and the cells are killed or growth or proliferation of the cells is reduced.
In a Second Configuration
A method of amplifying copies of a DNA encoding a functional Cas protein (optionally a Cas nuclease) in a bacterial or archaeal production strain of cells, the method comprising
In a Third Configuration
Use of an attenuated promoter in a DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) that is under the control of the promoter, in a method of amplifying copies of the DNA in a population of bacterial or archaeal production strain cells, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, for enhancing the yield of amplified DNA produced by the production host cells.
In a Fourth Configuration
Use of an attenuated promoter in a DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) that is under the control of the promoter, in a method of amplifying copies of the DNA in a population of bacterial or archaeal production strain cells, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, for reducing toxicity of the Cas in the production strain.
In a Fifth Configuration
Use of an attenuated promoter in a DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) that is under the control of the promoter, in a method of amplifying copies of the DNA in a population of bacterial or archaeal production strain cells, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, for reducing mutation of the DNA (optionally the Cas-encoding sequence) in the production strain.
In a Sixth Configuration
Use of an attenuated promoter in a DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) that is under the control of the promoter, in a method of amplifying copies of the DNA in a population of bacterial or archaeal production strain cells, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, for promoting production cell viability during the amplification of the DNA.
In a Seventh Configuration
Use of an attenuated promoter in a DNA construct comprising a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) that is under the control of the promoter, in a method of amplifying copies of the DNA in a population of bacterial or archaeal production strain cells, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, for reducing the occurrence of Cas cutting of DNA.
In an Eighth Configuration
A method for enhancing the yield of amplified copies of a DNA construct in a population of bacterial or archaeal production strain cells, wherein the construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) that is under the control of a promoter, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.
In a Ninth Configuration
A method for reducing toxicity of a functional Cas protein (optionally a Cas nuclease) in a population of bacterial or archaeal production strain cells in a process of amplifying copies of a DNA construct, wherein the construct comprises a nucleotide sequence encoding the Cas and the sequence is under the control of a promoter, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.
In a Tenth Configuration
A method for reducing mutation of a DNA construct encoding a functional Cas protein (optionally a Cas nuclease) in a population of bacterial or archaeal production strain cells in a process of amplifying copies of the construct, wherein the construct comprises a nucleotide sequence encoding the Cas and the sequence is under the control of a promoter, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.
In an Eleventh Configuration
A method for promoting production cell viability of a population of bacterial or archaeal production strain cells in a process of amplifying copies of a DNA construct comprised by the cells, wherein the construct comprises a nucleotide sequence encoding a functional Cas protein (optionally a Cas nuclease) and the sequence is under the control of a promoter, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.
In a Twelfth Configuration
A method for reducing the occurrence of Cas nuclease cutting of a DNA construct in a population of bacterial or archaeal production strain cells in a process of amplifying copies of the construct, wherein the construct comprises a nucleotide sequence encoding the Cas and the sequence is under the control of a promoter, the method comprising culturing the cells to allow replication of the DNA thereby amplifying the DNA in the cells, wherein the promoter is an attenuated promoter.
The invention relates to the production and use of Cas-encoding sequences and vectors comprising these. Aspects of the invention provide products, vectors, delivery vehicles, uses and methods for producing Cas-encoding sequences in bacterial or archaeal cells.
An aspect of the invention provides for the control of expression of Cas and optionally also Cascade proteins from single vectors, such as by regulated use of Cas modules in an operon and/or using attenuated promoters.
Concepts:
An aspect of the invention provides nucleic acid vectors that are useful for introducing into target host cells of any eukaryotic or prokaryotic species (eg, ex vivo or in vitro) for expressing Type I Cas and optionally other components of a Type I CRISPR/Cas system. Usefully, the vector may in some examples therefore provide a single-vector means for introducing a complete exogenous Type I CRISPR/Cas system into a target cell for modification (eg, cutting by Cas3) of DNA in the target cell. In an example, a chromosomal target sequence (ie, protospacer that is cognate with the Cas3) is modified. In another example, an episomal DNA sequence is modified, for example a plasmid sequence or a DNA that has been introduced into the cell. The latter may be useful in a recombineering method of the invention wherein exogenous DNA in the target cell is cut by the Cas3 and optionally this produces one or more recombinogenic ends for recombination of the cut DNA with a further DNA of interest, thereby producing a recombination product in the cell. For example, in such a recombineering method, the target cell is a recombinogenic E coli cell, eg, comprising a red/ET system. In another example, the target cell is an undesired cell (eg, a cell of a species or strain that is pathogenic to humans or animals, such as a bacterial disease-causing species or strain) and the cutting by Cas3 kills the cell. This may be useful for treating or preventing an infection in a human or animal harbouring target cells. The provision of single-vector means that express minimally a Cas endonuclease (eg, Cas3), cognate accessory proteins (eg, Cascade proteins) and at least one CRISPR array (or nucleotide sequence encoding a guide RNA (eg, a single guide RNA)), wherein the Cas, accessory proteins and array (or nucleotide sequence) comprise a functional CRISPR/Cas system is more convenient and the inventors believe more efficient for introducing into a target cell and effecting CRISPR/Cas modification of a target sequence therein than the use of 2 or 3 or more separate vectors (eg, a vector encoding the Cas nuclease and a different vector encoding the accessory proteins, and possibly a further vector comprising the array (or gRNA-encoding nucleotide sequence) which all need to transform the target cell for the system to function). This may provide one or more benefits, therefore, such as simplifying delivery (and thus the design of delivery vehicles), simplifying construction of the vector and vehicle and/or providing for better cutting or killing efficiencies. Conveniently, an example of the invention therefore uses an operon for the coordinated expression in the target cells of the Cas and accessory proteins (and optionally also the array or gRNA-encoding sequence(s)). Whilst not wishing to be bound by any particular theory, the introduction of a single vector (eg, using an operon) as per the invention may advantageously coordinate the expression of the Cas and accessory proteins (and optionally production of cRNAs or gRNAs) so that these are available to operate together without undue delay in the target cell. This may be important to tip the balance between, on the one hand the target cell using its endogenous anti-restriction, endogenous Cas or other endogenous mechanisms that seek out and degrade invading phage and DNA, and on the other hand efficient cell killing or deactivation of such mechanisms by the invading CRISPR components of the vector of the invention. In such an arms race, concerted and early operation of the CRISPR components in the cell are likely to be important to gain the upper hand and effect cell killing. The invention provides means to assist this.
By way of example, the invention thus provides the following Concepts:—
An aspect of the invention provides improved ways of amplifying DNA constructs in bacterial and archaeal production strain cells. For example, the DNA may be a high copy number plasmid or phagemid comprising a constitutive promoter for controlling the expression of one or more Cas proteins when the DNA has been introduced into a target host bacterial or host cell. It is desirable, according to an aspect of the invention, to consider attenuating the promoter activity during amplification of the DNA in the production strain. This is useful, since the inventors have found that Cas expression in production strains may be toxic to production strain cells, thereby reducing the yield of amplified DNA. Toxicity may be due, for example, to off-target cutting of the production strain chromosomal DNA when the Cas is a nuclease (such as Cas9 or Cas3) and/or due to relatively high levels of expression of the Cas in the cells. Additionally or alternatively, undesirably the Cas expression or activity may impose a selective pressure that favours mutation and propagation of mutated DNA constructs (such as mutation in one more or all of a CRISPR/Cas operon, Cas-encoding gene, Cascade-encoding gene, CRISPR array and gRNa-encoding sequence of the DNA construct) in production cells, thereby reducing the yield of desired amplified constructs and imposing an undesired step of separating desired from mutated DNA constructs for further formulation into useful compositions. Such compositions may be pharmaceutical compositions, herbicides, pesticides, environmental remediation compositions etc. In one example, the promoter attenuation in production strains is achieved by using a medium strength (not high or low) promoter to control the Cas-encoding nucleotide sequence of the DNA constructs. A medium level of Cas expression may be tolerable in the production strains, and yet once the DNA is subsequently introduced into target host cells the Cas is expressed at sufficiently high levels to produce desired activity to modify (eg, cut) target sequences in target cells. In an alternative, the invention uses a repressible promoter, wherein the promoter is repressed in production strain, but not repressed in target host cells. For example, aspects of the invention use a tetracycline repressor (tetR) expressed in production strain cells that represses the promoter.
Thus, the yield can be enhanced by one or more of
To this end, the invention provides Embodiments as follows:—
In an example, promoter is a medium strength promoter. In another example, the promoter is repressed in the production strain cell. Hence, the promoter is an attenuated promoter in these examples.
Other examples of suitable repressible promoters are Ptac (repressed by lad) and he Leftward promoter (pL) of phage lambda (which repressed by the λcI repressor). In an example, the promoter comprises a repressible operator (eg, tetO or lacO) fused to a promoter sequence. The corresponding repressor is encoded by a nucleic acid in the production strain (eg, a chromosomally-integrated sequence or a sequence comprised by an episome) and the repressor is expressed during the DNA or vector amplification method of the invention, whereby the promoter controlling Cas expression is repressed. In delivery vehicles that are subsequently produced from isolated amplified DNA/vector, the vehicle is devoid of an expressible nucleotide sequence encoding the repressor, whereby the promoter is functional when the DNA/vector is introduced into a target host cell. For example, in the absence of the repressor the promoter is constitutively ON for expression of the Cas. The system is therefore primed to work once the DNA/vector is introduced into the host cells, and this effect can be enhanced further by using a high copy number DNA/vector comprising an origin of replication that is operable in the host cell. A high copy number vector or DNA is also desirable in the production strain cells for enhancing yield of the DNA/vector, and by use of an attenuated promoter as described herein (eg, medium strength promoter and/or repressed promoter in the production strain cells) one can minimise Cas toxicity whilst culturing to maximise amplification and thus yield of the DNA/vector.
Paragraphs & Generally Applicable Features:
The invention provides the following Paragraphs, which are supported by the Examples below. Any features of the Concepts are combinable with any features of the Embodiments. Any features of the Concepts are combinable with any features of the Embodiments. Any features of the Paragraphs are combinable with any features of the Embodiments.
Any cell herein (eg, a production strain cell or target host cell) may be a bacterial cell, archaeal cell, algal cell, fungal cell, protozoan cell, invertebrate cell, vertebrate cell, fish cell, bird cell, mammal cell, companion animal cell, dog cell, cat cell, horse cell, mouse cell, rat cell, rabbit cell, eukaryotic cell, prokaryotic cell, human cell, animal cell, rodent cell, insect cell or plant cell. Preferably, the cell is a bacterial cell. Alternatively, the cell is a human cell. Optionally, the production strain cell(s) and target host cell(s) are of the same phylum, order, family, genus, species or strain.
In an example, the vector is a DNA vector, eg, ssDNA vector or dsDNA vector.
In an example, the Cas3 is cognate with Cascade proteins encoded by the host cell and/or encoded by a second operon. Optionally, the second operon is comprised by the vector. Optionally, the second operon is comprised by a second vector that is capable of introducing the second operon into the host cell, whereby the Cas3 and Cascade proteins are expressed from the operons in the host cell and are operable with crRNA or gRNA to target the Cas to a host cell target sequence, wherein the Cas3 is capable of modifying the target sequence.
The term “operon” is known to the skilled person such as relating to a functioning unit of DNA containing at least expressible 2 nucleotide sequences respectively encoding for an expression product (eg, a respective translatable mRNA), wherein the sequences are under common promoter control.
Optionally, the Cas3 is a Cas3 encoded by a CRISPR/Cas locus of a first bacterial or archaeal species, wherein in the locus the Cas3-encoding sequence is 3′ of Cascade protein-encoding sequences (ie, the latter are between the Cas3 and the 5′-most promoter of the locus).
Optionally, the Cas3 is a ygcB protein (eg, wherein the production strain cell and/or host target cell is an E coli).
Optionally, the Cascade proteins comprise or consist of
cas5 (casD, csy2)
cas6 (cas6f, cse3, casE)
cas7 (csc2, csy3, cse4, casC)
cas8 (casA, cas8a1, cas8b1, cas8c, cas10d, cas8e, cse1, cas8f, csy1).
Optionally herein the promoter and the Cas3-encoding sequence are spaced no more than 150, 100, 50, 40, 30, 20 or 10 bp apart, eg, from 30-45, or 30-40, or 39 or around 39 bp apart.
Optionally herein a ribosome binding site and the Cas3-encoding sequence are spaced no more than 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 4 or 3 bp apart, eg, from 10-5, 6 or around 6 bp apart.
In an example, the promoter is in combination with a Shine-Dalgarno sequence comprising the sequence 5′-aaagaggagaaa-3′ (SEQ ID NO: 5) or a ribosome binding site homologue thereof.
See Table 2 for more information on Anderson Scores in relation to promoters.
For example, fluorescence using the first EOU is 0.5 to X times the fluorescence using the second EOU, wherein X is from 3.0 to 1.0, eg, 3, 2.5, 2, 1.5 or 1, wherein fluorescence is determined using excitation at 481 nm and emission at 507 nm. Optionally, E coli cultures at OD600 of 0.3-0.5 in the exponential growth phase are used.
For example, the upstream insulator, the nucleotide sequence encoding GFP, 3′ UTR, transcription terminator and downstream insulator of each EOU are as disclosed in Mutalik et al (2013). For example, the upstream insulator, the nucleotide sequence encoding GFP, 3′ UTR, transcription terminator and downstream insulator of each EOU are corresponding sequences of SEQ ID NO: 4. For example, the E coli is E. coli BW25113 is grown in MOPS EZ Rich Medium (Teknova) supplemented with 50 μg/ml kanamycin (kan) at 37° C., shaken at 900 r.p.m. For example, each EOUs is comprised by a medium copy plasmid, eg, a plasmid derived from pFAB217 comprising a p15A replication origin and a kan resistance gene.
An example of a production strain cell is an E coli cell. A production strain cell is a cell that is used to amplify DNA encoding Cas (and optionally other components of a CRISPR/Cas system). Usefully, the strain may package the amplified DNA into transduction particles that are may be isolated to produce a composition that can be contacted with a population of target host cells (eg, bacterial, archaeal, prokaryotic, eukaryotic, human, animal, mammal, rodent, mouse, rat, rabbit, Xenopus, fish, bird, amphibian, insect, plant, amoeba or algae cells) wherein the DNA is introduced into the cells for expression of the Cas (and optional other CRISPR/Cas system components), wherein the Cas is guided to a protospacer target sequence in the host cells and modifies (eg, cuts) the sequence. In another example, the amplified DNA isolated from a population of production strain cells and is combined with a delivery vehicle (eg, a carrier bacterium, nanoparticle or liposome), wherein the delivery vehicle can be contacted with a population of target host cells (eg, bacterial, archaeal, prokaryotic, eukaryotic, human, animal, mammal, rodent, mouse, rat, rabbit, Xenopus, fish, bird, amphibian, insect, plant, amoeba or algae cells) wherein the DNA is introduced into the cells for expression of the Cas (and optional other CRISPR/Cas system components), wherein the Cas is guided to a protospacer target sequence in the host cells and modifies (eg, cuts) the sequence.
In an example, substantially no production strain cells are killed when the Cas3-encoding sequence is amplified therein. In another example, no more than 40, 30, 20, 10, 5, 4, 3, 2, or 1% of production strain cells are killed when the Cas3-encoding sequence is amplified therein. For example this is in a 1, 2, 3, 4, 5, 6, 7, 8 9 10, 12 or 24 hour period of culturing the cells.
For example this is in a 1, 2, 3, 4, 5, 6, 7, 8 9 10, 12 or 24 hour period of culturing the cells. For example, at least 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017 or 1018 copies of the vector are produced per 103, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017 production strain cells respectively.
For example, this is in a 1, 2, 3, 4, 5, 6, 7, 8 9 10, 12 or 24 hour period of culturing the cells.
Suitable mobile genetic elements, eg, transposons, are disclosed in WO2016177682 and US20170246221, the disclosures of which are explicitly incorporated herein for possible use in the invention and for providing one or more features for the claims herein.
In one embodiment, the vector comprises nucleotide sequences (in 5′ to 3′ direction) that encode a Cas3 (eg, Cas3′ and/or Cas3″), Cas11, Cas7 and Cas8a1. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas11 sequence. Optionally, the vector comprises a Type IA CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.
In one embodiment, the vector comprises nucleotide sequences (in 5′ to 3′ direction) that encode a Cas3, Cas8b1, Cas7 and Cas5. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas8b1 sequence. Optionally, the vector comprises a Type IB CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.
In one embodiment, the vector comprises nucleotide sequences (in 5′ to 3′ direction) that encode a Cas3, Cas5, Cas8c and Cas7. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas5 sequence. Optionally, the vector comprises a Type IC CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.
In one embodiment, the vector comprises nucleotide sequences (in 5′ to 3′ direction) that encode a Cas3, Cas8U2, Cas7, Cas5 and Cas6. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas8U2 sequence. Optionally, the vector comprises a Type IU CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.
In one embodiment, the vector comprises nucleotide sequences (in 5′ to 3′ direction) that encode a Cas3, Cas10d, Cas7 and Cas5. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas10d sequence. Optionally, the vector comprises a Type ID CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.
In one embodiment, the vector comprises nucleotide sequences (in 5′ to 3′ direction) that encode a Cas3, Cas8e, Cas11, Cas7, Cas5 and Cas6. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas11 sequence. Optionally, the vector comprises a Type IE CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.
In one embodiment, the vector comprises nucleotide sequences (in 5′ to 3′ direction) that encode a Cas3, Cas8f, Cas5, Cas7 and Cas6f. Optionally, a nucleotide sequence encoding Cas6 is between the Cas3 sequence(s) and the Cas8f sequence. Optionally, the vector comprises a Type IF CRISPR array or one or more nucleotide sequences encoding single guide RNA(s) (gRNA(s)), wherein the array and each gRNA comprises repeat sequence that is cognate with the Cas3. Thus, the array is operable in a host cell when the vector has been introduced into the cell for production of guide RNAs, wherein the guide RNAs are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell. Similarly, the single guide RNAs encoded by the vector in one embodiment are operable with the Cas and Cascade proteins to target and modify (eg, cut) a target nucleotide sequence in the host cell, optionally thereby killing the host cell.
The cognate promoter here is the one that controls expression of Cas3 in the wild-type locus.
A corresponding locus is a wild-type locus of a bacterial or archaeal species or strain that comprises an endogenous CRISPR/Cas system encoding the Cas3 and/or Cascade proteins of the type that are also encoded by the vector. Thus, when the vector comprises an operon, the operon may comprise Cas3- and Cascade-encoding nucleotide sequences that are not in a natural configuration.
Thus, the spacer hybridises to the protospacer to guide the Cas3 to the protospacer. Optionally, the Cas3 cuts the protospacer, eg, using exo- and/or endonuclease activity of the Cas3. Optionally, the Cas3 removes a plurality (eg, at least 2, 3,4, 5, 6, 7, 8, 9 or 10) nucleotides from the protospacer.
The phage or particles comprise phage coat proteins encapsidating DNA, wherein the DNA comprises the vector. Suitable examples of phage and particles are disclosed in U.S. Ser. No. 15/985,658 (and its equivalent publication by USPTO) the disclosures of which are incorporated herein by reference for possible use in the invention and for providing one or more features that may be included in the claims herein. Phage or particle is capable of infecting the cell, thereby introducing the vector into the cell.
For example, the targeting is targeting of the Cas to a protospacer sequence comprised by a host cell chromosome or an episome thereof. In another example the targeting is in a recombineering method and the Cas is targeted to a protospacer sequence of a DNA that has been introduced into or amplified in the host cell. In an example of such recombineering, the host cell is an E coli cell.
Thus, said enhancing may be relative to the yield produced using a strong promoter, eg, a strong constitutive promoter (for example a promoter having an Anderson Score (AS) of AS>0.5). In another example, the strong promoter is a promoter comprised by a promoter and translation initiation site (TIS) combination that is capable of producing expression of green fluorescent protein (GFP) from a first expression operating unit (EOU) in E. coli strain BW25113 cells with a fluorescence of >4 times the fluorescence produced in E. coli strain BW25113 cells using a second EOU comprising a P10 promoter (SEQ ID NO: 1) combined with a BCD14 TIS (SEQ ID NO: 2), wherein the EOUs differ only in their promoter and TIS combinations, wherein each EOU comprises (in 5′ to 3′ direction) an upstream initiator, the respective promoter, the respective TIS, a nucleotide sequence encoding GFP, a 3′ UTR, a transcription terminator and a downstream insulator.
In an example, the promoter is a constitutive promoter and optionally the DNA is comprised by a high copy number plasmid or phagemid.
PLlacO-1 is repressed by lac repressor (LacR). PLetO-1 is repressed by tet repressor (TetR).
The invention provides, by way of example, the following Clauses; the features of these are combinable with any other disclosure herein.
It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine study, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims. All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications and all US equivalent patent applications and patents are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Reference is made to WO2017/118598, US20180140698, US20170246221, US20180273940, US20160115488, US20180179547, US20170175142, US20160024510, US20150064138, US20170022499, US20160345578, US20180155729, US20180200342, WO2017112620, WO2018081502, PCT/EP2018/066954, PCT/EP2018/066980, PCT/EP2018/071454 and U.S. Ser. No. 15/985,658 and equivalent publications by the US Patent and Trademark Office (USPTO) or WIPO, the disclosures of which are incorporated herein by reference for providing disclosure that may be used in the present invention and/or to provide one or more features (eg, of a vector) that may be included in one or more claims herein.
The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or.” Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps
The term “or combinations thereof” or similar as used herein refers to all permutations and combinations of the listed items preceding the term. For example, “A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
Any part of this disclosure may be read in combination with any other part of the disclosure, unless otherwise apparent from the context.
All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
The present invention is described in more detail in the following non-limiting Examples.
The examples illustrate fast and precision killing of Escherichia coli strains. As a model programmable nuclease system, we used a CRISPR guided vector (CGV™) to specifically target Escherichia coli MG1655.
A plasmid (which we call a CRISPR Guided Vector™, CGV™) was constructed comprising an operon with nucleotide sequences encoding a Type I Cas3 and Cascade proteins under the control of a common promoter. C. dificile Type IB Cas3 and Cascade was used. A cognate CRISPR array comprising C. dificile repeat sequences and spacer sequence for targeting an E. coli host cell chromosome was also introduced into target cells. An adaptation module containing Cast, Cast and Cas4 was omitted in the vector (see
Results using this synthetic operon arrangement are shown in
We also managed to achieve desirable targeted killing of E coli cells using a similar set-up, except that E coli Type IE Cas and Cascade were used, together with a cognate array targeting host cell E coli chromosomal DNA (data not shown). In this case, a vector was used comprising (in 5′ to 3′ direction) a promoter controlling the expression of Cas3, Cas8e, Cas11, Cas7, Cas5 and Cas6 in an operon.
Materials and Methods
E. coli MG1655 was grown in lysogeny broth (LB) with shaking (250 rpm) at 37° C. When necessary, cultures were supplemented with tetracycline (10 μg/mL), and spectinomycin (400 μg/mL).
To construct a plasmid containing C. difficile CRISPR system under arabinose inducible pBAD promoter, cas3, cas6, cas8b, cas7 and cas5 genes from C. difficile were amplified and cloned in a low copy number plasmid (pSC101 ori). cas3 was located in the beginning of the operon followed by cas6, cas8b, cas7 and cas5. The adaptation module (consisting of cas1, cast, and cas4) was omitted in the vector (
To perform killing assays, both plasmids were transformed into E. coli MG1655 by electroporation. Transformants were grown in liquid LB with antibiotics to mid-log phase, and the killing efficiency was determined by serial dilution and spot plating onto LB, and LB+inducers (0.5 mM IPTG and 1 arabinose). Viability was calculated by counting colony forming units (CFUs) on the plates and data were calculated as viable cell concentration (CFU/ml).
A plasmid (which we call a CRISPR Guided Vector™, CGV™, which is a nucleic acid vector comprising nucleotide sequences encoding CRISPR/Cas components) was constructed comprising an operon with nucleotide sequences encoding a Type I Cas3 and Cascade proteins under the control of a common promoter. C. difficile Type IB Cas3 and Cascade was used. Adaptation module containing Cas1, Cas2 and Cas4 was omitted in the vector. A cognate CRISPR array comprising C. difficile repeat sequences and spacer sequence for targeting an E. coli host cell chromosome was also cloned in the vector (see
The CGV containing the C. difficile CRISPR-Cas system was transformed into E. coli MG1655 which contains a pks sequence incorporated into the genome. Results using this synthetic operon arrangement are shown in
The survival of E. coli MG1655 upon induction was followed over time by plating the cultures in serial dilutions every 60 minutes, for 2 h (
The CGV containing the E. coli CRISPR-Cas system was transformed into other E. coli MG1655 cells which contain a lambda sequence incorporated into the genome. Results using this synthetic operon arrangement are shown in
Materials and Methods
E. coli MG1655 was grown in synthetic medium (SM) with shaking (250 rpm) at 37° C. Cultures were supplemented with 10 μg/mL tetracycline when required.
To construct a plasmid containing C. difficile CRISPR system under arabinose inducible pBAD promoter, cas3, cas6, cas8b, cas7 and cas5 genes from C. difficile were amplified and cloned in a low copy number plasmid (pSC101 ori). cas3 was located in the beginning of the operon followed by cas6, cas8b, cas7 and cas5. Additionally, an IPTG inducible single-spacer array targeting a chromosomal intergenic region in E. coli MG1655 was included in the vector under control of the IPTG-inducible Ptrc promoter (
To construct a plasmid containing E. coli CRISPR system under arabinose inducible pBAD promoter, cas3, cse1, cse2, cas7, cas5 and cas6 genes from E. coli were amplified and cloned in a low copy number plasmid (pSC101 ori). The operon comprised (in 5′ to 3′ direction) cas3 followed by cse1 cse2, cas7, cas5 and cas6. Additionally, an IPTG inducible single-spacer array targeting a chromosomal intergenic region in E. coli MG1655 was included in the vector under control of the IPTG-inducible Ptrc promoter. It contained 32 nucleotides from the lambda sequence (previously integrated into the genome of E. coli MG1655) (tgggatgcctaccgcaagcagcttggcctgaa) (SEQ ID NO: 28) and found to efficiently target in Brouns et al., 2008 (Science. 2008 Aug. 15; 321(5891):960-4. doi: 10.1126/science.1159689; “Small CRISPR RNAs guide antiviral defense in prokaryotes”). Additionally, the 3′-ATG protospacer adjacent motif (PAM) is located adjacent to the selected target sequence in the genome of E. coli MG1655.
The CGVs were transformed into E. coli MG1655 by electroporation. Transformants were grown in liquid SM with antibiotics to mid-log phase, and the killing efficiency was determined by serial dilution and spot plating onto LB, and LB+inducers (0.5 mM IPTG and 1% arabinose). Viability was calculated by counting colony forming units (CFUs) on the plates and data were calculated as viable cell concentration (CFU/ml).
To perform killing curves, E. coli MG1655 harboring the CGV was grown in liquid SM with antibiotics to mid-log phase. The culture was divided into two tubes and either inducers (0.5 mM IPTG and 1% arabinose) or PBS were added. Survival of the strain was followed over time by plating the cultures in serial dilutions (101-106) of drop spots (5 μl) every 60 minutes, for 2 h, on SM plates with antibiotics. Survival frequency was calculated by counting colony forming units (CFUs) on the plates and data were calculated as viable cell concentration (CFU/ml).
An artificial microbial consortium was constructed to study the efficiency of the CGV carrying the CRISPR-Cas system of C. difficile, to specifically target E. coli MG1655 in the presence of other microbes, mimicking the human microbiome.
The synthetic consortium consisted of three strains (two different species) with differential antibiotic resistance profiles: a streptomycin-resistant E. coli MG1655 (target strain), an ampicillin-resistant E. coli Top10, and a chloramphenicol-resistant Lactococcus lactis NZ9000. To create the consortium, bacterial cultures were grown separately in Brain Heart Infusion broth (BHI, optimal growth medium for L. lactis) to mid-log phase and mixed in fresh BHI broth with and without inducers. After 1 h induction at 30° C., the composition of the consortium was determined by counting viable colonies on selective plates. Induction of the CRISPR system in the mixed community, resulted in >10-fold killing of target E. coli MG1655, while leaving E. coli Top10 and L. lactis NZ9000 cell populations unharmed (
Additionally, CRISPR killing of target strain E. coli MG1655 in the synthetic microbial consortium was compared to a pure culture (ie, target strain E. coli MG1655 that is not mixed with another strain or species). Unexpectedly, in both conditions, killing of 3 logs was achieved when plated on BHI agar plates with inducers (
Materials and Methods
E. coli MG1655, E. coli Top10, and Lactococcus lactis NZ9000 were grown in BHI broth with shaking (250 rpm) at 30° C. Cultures were supplemented with 1000 μg/mL streptomycin, 100 μg/mL ampicillin, or 10 μg/mL chloramphenicol, respectively.
To create the consortium, bacterial cultures were grown in BHI with appropriate antibiotics to mid-log phase. Cultures were washed twice in PBS to remove the antibiotics and mixed in fresh BHI broth. The mixed culture was spotted onto BHI plates with streptomycin, ampicillin or chloramphenicol to quantify the initial concentration of E. coli MG1655, E. coli Top10 and L. lactis NZ9000, respectively. The mixed culture was divided into two tubes and either inducers (0.5 mM IPTG and 1% arabinose) or PBS were added. After 1 h induction at 30° C., the composition of the consortium was calculated by counting colony forming units (CFUs) on selective plates and data were calculated as viable cell concentration (CFU/ml).
We engineered an E coli Top10 production strain cell population comprising plasmid CGV DNA and an expressible sequence encoding a Tet repressor (TetR). The DNA comprised a Cas9-encoding nucleotide sequence under the control of a Tet promoter (pLtetO-1 promoter). The promoter is normally constitutively ON, but it was repressed by TetR in our cells. Thus, in this way we could successfully culture the cells and amplify the CGV without observing adverse toxicity due to Cas9 expression.
In an experiment in the absence of repression, we did not observe any colonies of production strain bacteria, and we surmise that this was due to Cas9 toxicity. We believe, in addition to providing a way of increasing CGV yield (eg, for subsequent packaging into phage or non-self-replicative transduction particles), our method using repression can minimize selection for mutations in the DNA that would otherwise be forced by higher Cas9 expression and cutting (eg, due to CGV cutting).
Abiotrophia
Acidocella
Actinomyces
Alkalilimnicola
Aquaspirillum
Abiotrophia defectiva
Acidocella aminolytica
Actinomyces bovis
Alkalilimnicola ehrlichii
Aquaspirillum polymorphum
Acaricomes
Acidocella facilis
Actinomyces denticolens
Alkaliphilus
Aquaspirillum
Acaricomes phytoseiuli
Acidomonas
Actinomyces europaeus
Alkaliphilus oremlandii
putridiconchylium
Acetitomaculum
Acidomonas methanolica
Actinomyces georgiae
Alkaliphilus transvaalensis
Aquaspirillum serpens
Acetitomaculum ruminis
Acidothermus
Actinomyces gerencseriae
Allochromatium
Aquimarina
Acetivibrio
Acidothermus cellulolyticus
Actinomyces
Allochromatium vinosum
Aquimarina latercula
Acetivibrio cellulolyticus
Acidovorax
hordeovulneris
Alloiococcus
Arcanobacterium
Acetivibrio ethanolgignens
Acidovorax anthurii
Actinomyces howellii
Alloiococcus otitis
Arcanobacterium
Acetivibrio multivorans
Acidovorax caeni
Actinomyces hyovaginalis
Allokutzneria
haemolyticum
Acetoanaerobium
Acidovorax cattleyae
Actinomyces israelii
Allokutzneria albata
Arcanobacterium pyogenes
Acetoanaerobium noterae
Acidovorax citrulli
Actinomyces johnsonii
Altererythrobacter
Archangium
Acetobacter
Acidovorax defluvii
Actinomyces meyeri
Altererythrobacter
Archangium gephyra
Acetobacter aceti
Acidovorax delafieldii
Actinomyces naeslundii
ishigakiensis
Arcobacter
Acetobacter cerevisiae
Acidovorax facilis
Actinomyces neuii
Altermonas
Arcobacter butzleri
Acetobacter cibinongensis
Acidovorax konjaci
Actinomyces odontolyticus
Altermonas haloplanktis
Arcobacter cryaerophilus
Acetobacter estunensis
Acidovorax temperans
Actinomyces oris
Altermonas macleodii
Arcobacter halophilus
Acetobacter fabarum
Acidovorax valerianellae
Actinomyces radingae
Alysiella
Arcobacter nitrofigilis
Acetobacter ghanensis
Acinetobacter
Actinomyces slackii
Alysiella crassa
Arcobacter skirrowii
Acetobacter indonesiensis
Acinetobacter baumannii
Alysiella filifomis
Acetobacter lovaniensis
Acinetobacter baylyi
Actinomyces turicensis
Aminobacter
Arhodomonas
Acetobacter malorum
Acinetobacter bouvetii
Actinomyces viscosus
Aminobacter aganoensis
Arhodomonas aquaeolei
Acetobacter nitrogenifigens
Acinetobacter calcoaceticus
Actinoplanes
Aminobacter aminovorans
Arsenophonus
Acetobacter oeni
Acinetobacter gerneri
Actinoplanes auranticolor
Aminobacter niigataensis
Arsenophonus nasoniae
Acetobacter orientalis
Acinetobacter haemolyticus
Actinoplanes brasiliensis
Aminobacterium
Acetobacter orleanensis
Acinetobacter johnsonii
Actinoplanes consettensis
Aminobacterium mobile
Arthrobacter
Acetobacter pasteurianus
Acinetobacter junii
Actinoplanes deccanensis
Aminomonas
Arthrobacter agilis
Acetobacter pornorurn
Acinetobacter lwoffi
Actinoplanes derwentensis
Aminomonas paucivorans
Arthrobacter albus
Acetobacter senegalensis
Acinetobacter parvus
Actinoplanes digitatis
Ammoniphilus
Arthrobacter aurescens
Acetobacter xylinus
Acinetobacter radioresistens
Actinoplanes durhamensis
Ammoniphilus oxalaticus
Arthrobacter
Acetobacterium
Acinetobacter schindleri
Actinoplanes ferrugineus
Ammoniphilus oxalivorans
chlorophenolicus
Acetobacterium bakii
Acinetobacter soli
Actinoplanes globisporus
Amphibacillus
Arthrobacter citreus
Acetobacterium
Acinetobacter tandoii
Actinoplanes humidus
Amphibacillus xylanus
Arthrobacter clystallopoietes
carbinolicum
Acetobacterium
Acinetobacter tjernbergiae
Actinoplanes italicus
Amphritea
Arthrobacter cumminsii
dehalogenans
Acetobacterium fimetarium
Acinetobacter towneri
Actinoplanes liguriensis
Amphritea balenae
Arthrobacter globiformis
Acetobacterium malicum
Acinetobacter ursingii
Actinoplanes lobatus
Amphritea japonica
Arthrobacter
Acetobacterium paludosum
Acinetobacter venetianus
Actinoplanes missouriensis
Amycolatopsis
histidinolovorans
Acetobacterium tundrae
Acrocarpospora
Actinoplanes palleronii
Amycolatopsis alba
Arthrobacter ilicis
Acetobacterium wieringae
Acrocarpospora corrugata
Actinoplanes philippinensis
Amycolatopsis albidoflavus
Arthrobacter luteus
Acetobacterium woodii
Acrocarpospora
Actinoplanes rectilineatus
Amycolatopsis azurea
Arthrobacter methylotrophus
Acetofilamentum
macrocephala
Actinoplanes regularis
Amycolatopsis coloradensis
Arthrobacter mysorens
Acetofilamentum rigidum
Acrocarpospora
Actinoplanes
Amycolatopsis lurida
Arthrobacter nicotianae
pleiomorpha
Amycolatopsis mediterranei
Arthrobacter nicotinovorans
Acetohalobium
Actibacter
teichomyceticus
Amycolatopsis rifamycinica
Arthrobacter oxydans
Acetohalobium arabaticum
Actibacter sediminis
Actinoplanes utahensis
Amycolatopsis rubida
Arthrobacter pascens
Acetomicrobium
Actinoalloteichus
Actinopolyspora
Amycolatopsis sulphurea
Arthrobacter
Acetomicrobium faecale
Actinoalloteichus
Actinopolyspora halophila
Amycolatopsis tolypomycina
phenanthrenivorans
Acetomicrobium flavidum
cyanogriseus
Actinopolyspora
Anabaena
Arthrobacter
Acetonema
Actinoalloteichus
mortivallis
Anabaena cylindrica
polychromogenes
Acetonema longum
hymeniacidonis
Actinosynnema
Anabaena flos-aquae
Atrhrobacter protophomiae
Acetothermus
Actinoalloteichus spitiensis
Actinosynnema mirum
Anabaena variabilis
Arthrobacter
Acetothermus paucivorans
Actinobaccillus
Actinotalea
Anaeroarcus
psychrolactophilus
Acholeplasma
Actinobacillus capsulatus
Actinotalea fermentans
Anaeroarcus burkinensis
Arthrobacter ramosus
Acholeplasma axanthum
Actinobacillus delphinicola
Aerococcus
Anaerobaculum
Arthrobacter sulfonivorans
Acholeplasma brassicae
Actinobacillus hominis
Aerococcus sanguinicola
Anaerobaculum mobile
Arthrobacter sulfureus
Acholeplasma
Actinobacillus indolicus
Aerococcus urinae
Anaerobiospirillum
Arthrobacter uratoxydans
cavigenitalium
Acholeplasma equifetale
Actinobacillus lignieresii
Aerococcus urinaeequi
Anaerobiospirillum
Arthrobacter ureafaciens
Acholeplasma granularum
Actinobacillus minor
Aerococcus urinaehominis
succiniciproducens
Arthrobacter viscosus
Acholeplasma hippikon
Actinobacillus muris
Aerococcus viridans
Anaerobiospirillum thomasii
Arthrobacter woluwensis
Acholeplasma laidlawii
Actinobacillus
Aeromicrobium
Anaerococcus
Asaia
Acholeplasma modicum
pleuropneumoniae
Aeromicrobium elythreum
Anaerococcus hydrogenalis
Asaia bogorensis
Acholeplasma morum
Actinobacillus porcinus
Aeromonas
Anaerococcus lactolyticus
Asanoa
Acholeplasma multilocale
Actinobacillus rossii
Aeromonas
Anaerococcus prevotii
Asanoa ferruginea
Actinobacillus scotiae
allosaccharophila
Anaerococcus tetradius
Asticcacaulis
Acholeplasma palmae
Actinobacillus seminis
Aeromonas bestiarum
Anaerococcus vaginalis
Asticcacaulis biprosthecium
Acholeplasma parvum
Actinobacillus succinogenes
Aeromonas caviae
Asticcacaulis excentricus
Acholeplasma pleciae
Actinobaccillus suis
Aeromonas encheleia
Anaerofustis
Atopobacter
Acholeplasma vituli
Actinobacillus ureae
Aeromonas
Anaerofustis stercorihominis
Atopobacter phocae
Achromobacter
Actinobaculum
enteropelogenes
Anaeromusa
Atopobium
Achromobacter denitrificans
Actinobaculum massiliense
Aeromonas eucrenophila
Anaeromusa acidaminophila
Atopobium fossor
Achromobacter insolitus
Actinobaculum schaalii
Aeromonas ichthiosmia
Anaeromyxobacter
Atopobium minutum
Achromobacter piechaudii
Actinobaculum suis
Aeromonas jandaei
Anaeromyxobacter
Atopobium parvulum
Achromobacter ruhlandii
Actinomyces urinale
Aeromonas media
dehalogenans
Atopobium rimae
Achromobacter spanius
Actinocatenispora
Aeromonas popoffii
Anaerorhabdus
Atopobium vaginae
Acidaminobacter
Actinocatenispora rupis
Aeromonas sobria
Anaerorhabdus furcosa
Aureobacterium
Acidaminobacter
Actinocatenispora
Aeromonas veronii
Anaerosinus
Aureobacterium barkeri
hydrogenoformans
thailandica
Agrobacterium
Anaerosinus glycerini
Aurobacterium
Acidaminococcus
Actinocatenispora sera
Agrobacterium
Anaerovirgula
Aurobacterium liquefaciens
Acidaminococcus fermentans
Actinocorallia
gelatinovorum
Anaerovirgula multivorans
Avibacterium
Acidaminococcus intestini
Actinocorallia aurantiaca
Agrococcus
Ancalomicrobium
Avibacterium avium
Acidicaldus
Actinocorallia aurea
Agrococcus citreus
Ancalomicrobium adetum
Avibacterium gallinarum
Acidicaldus organivorans
Actinocorallia cavernae
Agrococcus jenensis
Ancylobacter
Avibacterium paragallinarum
Acidimicrobium
Actinocorallia glomerata
Agromonas
Ancylobacter aquaticus
Avibacterium volantium
Acidimicrobium
Actinocorallia herbida
Agromonas oligotrophica
Aneurinibacillus
Azoarcus
ferrooxidans
Acidiphilium
Actinocorallia libanotica
Agromyces
Aneurinibacillus
Azoarcus indigens
Acidiphilium acidophilum
Actinocorallia longicatena
Agromyces fucosus
aneurinilyticus
Azoarcus tolulyticus
Acidiphilium angustum
Actinomadura
Agromyces hippuratus
Aneurinibacillus migulanus
Azoarcus toluvorans
Acidiphilium cryptum
Actinomadura alba
Agromyces luteolus
Aneurinibacillus
Acidiphilium multivorum
Actinomadura atramentaria
Agromyces mediolanus
themioaerophilus
Acidiphilium organovorum
Actinomadura
Agromyces ramosus
Angiococcus
Azohydromonas
Acidiphilium rubrum
bangladeshensis
Agromyces rhizospherae
Angiococcus disciformis
Azohydromonas australica
Acidisoma
Actinomadura catellatispora
Akkermansia
Angulomicrobium
Azohydromonas lata
Acidisoma sibiricum
Actinomadura chibensis
Akkermansia muciniphila
Angulomicrobium tetraedrale
Azomonas
Acidisoma tundrae
Actinomadura chokoriensis
Albidiferax
Anoxybacillus
Azomonas agilis
Acidisphaera
Actinomadura citrea
Albidiferax ferrireducens
Anoxybacillus pushchinoensis
Azomonas insignis
Acidisphaera rubrifaciens
Actinomadura coerulea
Albidovulum
Aquabacterium
Azomonas macrocytogenes
Acidithiobacillus
Actinomadura echinospora
Albidovulum inexpectatum
Aquabacterium commune
Azorhizobium
Acidithiobacillus albertensis
Actinomadura fibrosa
Alcaligenes
Aquabacterium parvum
Azorhizobium caulinodans
Acidithiobacillus caldus
Actinomadura formosensis
Alcaligenes denitrificans
Azorhizophilus
Acidithiobacillus
Actinomadura hibisca
Alcaligenes faecalis
Azorhizophilus paspali
ferrooxidans
Acidithiobacillus
Actinomadura kijaniata
Alcanivorax
Azospirillum
thiooxidans
Acidobacterium
Actinomadura latina
Alcanivorax borkumensis
Azospirillum brasilense
Acidobacterium capsulatum
Actinomadura livida
Alcanivorax jadensis
Azospirillum halopraeferens
Actinomadura
Algicola
Azospirillum irakense
luteofluorescens
Algicola bacteriolytica
Azotobacter
Actinomadura macra
Alicyclobacillus
Azotobacter beijerinckii
Actinomadura madurae
Alicyclobacillus
Azotobacter chroococcum
Actinomadura oligospora
disulfidooxidans
Azotobacter nigricans
Actinomadura pelletieri
Alicyclobacillus
Azotobacter salinestris
Actinomadura rubrobrunea
sendaiensis
Azotobacter vinelandii
Actinomadura
Alicyclobacillus vulcanalis
rugatobispora
Actinomadura umbrina
Actinomadura
Alishewanella
verrucosospora
Alishewanella fetalis
Actinomadura vinacea
Alkalibacillus
Actinomadura viridilutea
Alkalibacillus
Actinomadura viridis
haloalkaliphilus
Actinomadura yumaensis
Bacillus
Bacteroides
Bibersteinia
Borrelia
Brevinema
Bacteroides caccae
Bibersteinia trehalosi
Borrelia afzelii
Brevinema andersonii
Bacteroides coagulans
Bifidobacterium
Borrelia americana
Brevundimonas
Bacteriovorax
Bacteroides eggerthii
Bifidobacterium adolescentis
Borrelia burgdorferi
Brevundimonas alba
Bacteriovorax stolpii
Bacteroides fragilis
Bifidobacterium angulatum
Borrelia carolinensis
Brevundimonas aurantiaca
Bacteroides galacturonicus
Bifidobacterium animalis
Borrelia coriaceae
Brevundimonas diminuta
Bacteroides helcogenes
Bifidobacterium asteroides
Borrelia garinii
Brevundimonas intermedia
Bacteroides ovatus
Bifidobacterium bifidum
Borrelia japonica
Brevundimonas subvibrioides
Bacteroides pectinophilus
Bifidobacterium bourn
Bosea
Brevundimonas vancanneytii
Bacteroides pyogenes
Bifidobacterium breve
Bosea minatitlanensis
Brevundimonas variabilis
Bacteroides salyersiae
Bifidobacterium catenulatum
Bosea thiooxidans
Brevundimonas vesicularis
Bacteroides stercoris
Bifidobacterium choerinum
Brachybacterium
Brochothrix
Bacteroides suis
Bifidobacterium colyneforme
Brachybacterium
Brochothrix campestris
Bacteroides tectus
Bifidobacterium cuniculi
alimentarium
Brochothrix thermosphacta
Bacteroides
Bifidobacterium dentium
Brachybacterium faecium
thetaiotaomicron
Bacteroides unifomiis
Bifidobacterium gallicum
Brachybacterium
Brucella
Bacteroides ureolyticus
Bifidobacterium gallinarum
paraconglomeratum
Brucella canis
Bacteroides vulgatus
Bifidobacterium indicum
Brachybacterium rhamnosum
Brucella neotomae
Balnearium
Bifidobacterium longum
Brachybacterium
Bryobacter
Balnearium lithotrophicum
Bifidobacterium
tyrofermentans
Biyobacter aggregatus
Balneatrix
magnumBifidobacterium
Brachyspira
Burkholderia
Balneatrix alpica
merycicum
Brachyspira alvinipulli
Burkholderia ambifaria
Balneola
Bifidobacterium minimum
Brachyspira hyodysenteriae
Burkholderia andropogonis
Balneola vulgaris
Bifidobacterium
Brachyspira innocens
Burkholderia anthina
Barnesiella
pseudocatenulatum
Brachyspira murdochii
Burkholderia caledonica
Barnesiella viscericola
Bifidobacterium
Brachyspira pilosicoli
Burkholderia caryophylli
Bartonella
pseudolongum
Burkholderia cenocepacia
Bartonella alsatica
Bifidobacterium pullorum
Bradyrhizobium
Burkholderia cepacia
Bartonella bacilliformis
Bifidobacterium ruminantium
Bradyrhizobium canariense
Burkholderia cocovenenans
Bartonella clarridgeiae
Bifidobacterium saeculare
Bradyrhizobium elkanii
Burkholderia dolosa
Bartonella doshiae
Bifidobacterium subtile
Bradyrhizobium japonicum
Burkholderia fungorum
Bartonella elizabethae
Bifidobacterium
Bradyrhizobium liaoningense
Burkholderia glathei
Bartonella grahamii
thermophilum
Brenneria
Burkholderia glumae
Bartonella henselae
Bilophila
Brenneria alni
Burkholderia graminis
Bartonella rochalimae
Bilophila wadsworthia
Brenneria nigrifluens
Burkholderia kururiensis
Bartonella vinsonii
Biostraticola
Brenneria quercina
Burkholderia multivorans
Bavariicoccus
Biostraticola tofi
Brenneria quercina
Burkholderia phenazinium
Bavariicoccus seileri
Brenneria salicis
Burkholderia plantarii
Bdellovibrio
Bizionia
Brevibacillus
Burkholderia pyrrocinia
Bdellovibrio bacteriovorus
Bizionia argentinensis
Brevibacillus agri
Burkholderia silvatlantica
Bdellovibrio exovorus
Blastobacter
Brevibacillus borstelensis
Burkholderia stabilis
Beggiatoa
Blastobacter capsulatus
Brevibacillus brevis
Burkholderia thailandensis
Beggiatoa alba
Blastobacter denitrificans
Brevibacillus centrosporus
Burkholderia tropica
Beijerinckia
Blastococcus
Brevibacillus choshinensis
Burkholderia unamae
Beijerinckia derxii
Blastococcus aggregatus
Brevibacillus invocatus
Burkholderia vietnamiensis
Beijerinckia fluminensis
Blastococcus saxobsidens
Brevibacillus laterosporus
Buttiauxella
Beijerinckia indica
Blastochloris
Brevibacillus parabrevis
Buttiauxella agrestis
Beijerinckia mobilis
Blastochloris viridis
Brevibacillus reuszeri
Buttiauxella brennerae
Belliella
Blastomonas
Brevibacterium
Buttiauxella ferragutiae
Belliella baltica
Blastomonas natatoria
Brevibacterium abidum
Buttiauxella gaviniae
Bellilinea
Blastopirellula
Brevibacterium album
Buttiauxella izardii
Bellilinea caldifistulae
Blastopirellula marina
Brevibacterium aurantiacum
Buttiauxella noackiae
Belnapia
Blautia
Brevibacterium celere
Buttiauxella wamiboldiae
Belnapia moabensis
Blautia coccoides
Brevibacterium epidermidis
Butyrivibrio
Bergeriella
Blautia hansenii
Brevibacterium
Butyrivibrio fibrisolvens
Bergeriella denitrificans
Blautia producta
frigoritolerans
Butyrivibrio hungatei
Beutenbergia
Blautia wexlerae
Brevibacterium halotolerans
Butyrivibrio proteoclasticus
Beutenbergia cavernae
Bogoriella
Brevibacterium iodinum
Bogoriella caseilytica
Brevibacterium linens
Bordetella
Brevibacterium lyticum
Bordetella avium
Brevibacterium mcbrellneri
Bordetella bronchiseptica
Brevibacterium otitidis
Bordetella hinzii
Brevibacterium oxydans
Bordetella holmesii
Brevibacterium paucivorans
Bordetella parapertussis
Brevibacterium stationis
Bordetella pertussis
Bordetella petrii
Bordetella trematum
Bacillus
B. acidiceler
B. aminovorans
B. glucanolyticus
B. taeanensis
B. lautus
B. acidicola
B. amylolyticus
B. gordonae
B. tequilensis
B. lehensis
B. acidiproducens
B. andreesenii
B. gottheilii
B. thermantarcticus
B. lentimorbus
B. acidocaldarius
B. aneurinilyticus
B. graminis
B. thermoaerophilus
B. lentus
B. acidoterrestris
B. anthracis
B. halmapalus
B. thermoamylovorans
B. lichenifomis
B. aeolius
B. aquimaris
B. haloalkaliphilus
B. thermocatenulatus
B. ligniniphilus
B. aerius
B. arenosi
B. halochares
B. thermocloacae
B. litoralis
B. aerophilus
B. arseniciselenatis
B. halodenitfificans
B. thermocopriae
B. locisalis
B. agaradhaerens
B. arsenicus
B. halodurans
B. thermodenitrificans
B. luciferensis
B. agri
B. aurantiacus
B. halophilus
B. thermoglucosidasius
B. luteolus
B. aidingensis
B. arvi
B. halosaccharovorans
B. thermolactis
B. luteus
B. akibai
B. aryabhattai
B. hemicellulosilyticus
B. thermoleovorans
B. macauensis
B. alcalophilus
B. asahii
B. hemicentroti
B. thermophilus
B. macerans
B. algicola
B. atrophaeus
B. herbersteinensis
B. thermoruber
B. macquariensis
B. alginolyticus
B. axarquiensis
B. horikoshii
B. thermosphaericus
B. macyae
B. alkalidiazotrophicus
B. azotofixans
B. horneckiae
B. thiaminolyticus
B. malacitensis
B. alkalinitrilicus
B. azotoformans
B. horti
B. thioparans
B. mannanilyticus
B. alkalisediminis
B. badius
B. huizhouensis
B. thuringiensis
B. marisflavi
B. alkalitelluris
B. barbaricus
B. humi
B. tianshenii
B. marismortui
B. altitudinis
B. bataviensis
B. hwajinpoensis
B. trypoxylicola
B. marmarensis
B. alveayuensis
B. beijingensis
B. idriensis
B. tusciae
B. massiliensis
B. alvei
B. benzoevorans
B. indicus
B. validus
B. megaterium
B. beringensis
B. infantis
B. vallismortis
B. mesonae
B.
B. berkeleyi
B. infernus
B. vedderi
B. methanolicus
a. subsp. amyloliquefaciens
B. beveridgei
B. insolitus
B. velezensis
B. methylotrophicus
B. a. subsp. plantarum
B. bogoriensis
B. invictae
B. vietnamensis
B. migulanus
B. boroniphilus
B. iranensis
B. vireti
B. mojavensis
B. dipsosauri
B. borstelensis
B. isabeliae
B. vulcani
B. mucilaginosus
B. drentensis
B. brevis Migula
B. isronensis
B. wakoensis
B. muralis
B. edaphicus
B. butanolivorans
B. jeotgali
B. weihenstephanensis
B. murimartini
B. ehimensis
B. canaveralius
B. kaustophilus
B. xiamenensis
B. mycoides
B. eiseniae
B. carboniphilus
B. kobensis
B. xiaoxiensis
B. naganoensis
B. enclensis
B. cecembensis
B. kochii
B. zhanjiangensis
B. nanhaiensis
B. endophyticus
B. cellulosilyticus
B. kokeshiifomiis
B. peoriae
B. nanhaiisediminis
B. endoradicis
B. centrosporus
B. koreensis
B. persepolensis
B. nealsonii
B. farraginis
B. cereus
B. korlensis
B. persicus
B. neidei
B. fastidiosus
B. chagannorensis
B. kribbensis
B. pervagus
B. neizhouensis
B. fengqiuensis
B. chitinolyticus
B. krulwichiae
B. plakortidis
B. niabensis
B. firmus
B. chondroitinus
B. laevolacticus
B. pocheonensis
B. niacini
B. flexus
B. choshinensis
B. larvae
B. polygoni
B. novalis
B. foraminis
B. chungangensis
B. laterosporus
B. polymyxa
B. oceanisediminis
B. fordii
B. cibi
B. salexigens
B. popilliae
B. odysseyi
B. formosus
B. circulans
B. saliphilus
B. pseudalcalophilus
B. okhensis
B. fortis
B. clarkii
B. schlegelii
B. pseudofirmus
B. okuhidensis
B. fumarioli
B. clausii
B. sediminis
B. pseudomycoides
B. oleronius
B. funiculus
B. coagulans
B. selenatarsenatis
B. psychrodurans
B. olyzaecorticis
B. fusiformis
B. coahuilensis
B. selenitireducens
B. psychrophilus
B. oshimensis
B. galactophilus
B. cohnii
B. seohaeanensis
B. psychrosaccharolyticus
B. pabuli
B. galactosidilyticus
B. composti
B. shacheensis
B. psychrotolerans
B. pakistanensis
B. galliciensis
B. curdlanolyticus
B. shackletonii
B. pulvifaciens
B. pallidus
B. gelatini
B. cycloheptanicus
B. siamensis
B. pumilus
B. pallidus
B. gibsonii
B. cytotoxicus
B. silvestris
B. purgationiresistens
B. panacisoli
B. ginsengi
B. daliensis
B. simplex
B. pycnus
B. panaciterrae
B. ginsengihumi
B. decisifrondis
B. siralis
B. qingdaonensis
B. pantothenticus
B. ginsengisoli
B. decolorationis
B. smithii
B. qingshengii
B. parabrevis
B. globisporus (eg, B.
B. deserti
B. soli
B. reuszeri
B. paraflexus
g. subsp. Globisporus; or B.
B. solimangrovi
B. rhizosphaerae
B. pasteurii
g. subsp. Marinus)
B. solisalsi
B. rigui
B. patagoniensis
B. songklensis
B. ruris
B. sonorensis
B. safensis
B. sphaericus
B. salarius
B. sporothermodurans
B. stearothermophilus
B. stratosphericus
B. subterraneus
B. subtilis (eg, B.
s. subsp. Inaquosorum; or B.
s. subsp. Spizizeni; or B.
s. subsp. Subtilis)
Caenimonas
Campylobacter
Cardiobacterium
Catenuloplanes
Curtobacterium
Caenimonas koreensis
Campylobacter coli
Cardiobacterium hominis
Catenuloplanes atrovinosus
Curtobacterium
Caldalkalibacillus
Campylobacter concisus
Carnimonas
Catenuloplanes castaneus
albidum
Caldalkalibacillus uzonensis
Campylobacter curvus
Carnimonas nigrificans
Catenuloplanes crispus
Curtobacterium citreus
Caldanaerobacter
Campylobacter fetus
Carnobacterium
Catenuloplanes indicus
Caldanaerobacter
Campylobacter gracilis
Carnobacterium
Catenuloplanes japonicus
subterraneus
Caldanaerobius
Campylobacter helveticus
alterfunditum
Catenuloplanes nepalensis
Caldanaerobius fijiensis
Campylobacter hominis
Carnobacterium divergens
Catenuloplanes niger
Caldanaerobius
Campylobacter
Carnobacterium funditum
Chryseobacterium
hyointestinalis
polysaccharolyticus
Campylobacter jejuni
Carnobacterium gallinarum
Chlyseobacterium
Caldanaerobius zeae
Campylobacter lari
Carnobacterium
balustinum
Campylobacter mucosalis
maltaromaticum
Caldanaerovirga
Campylobacter rectus
Carnobacterium mobile
Citrobacter
Caldanaerovirga
Campylobacter showae
Carnobacterium viridans
C. amalonaticus
acetigignens
Caldicellulosiruptor
Campylobacter sputorum
Caryophanon
C. braakii
Caldicellulosiruptor bescii
Campylobacter upsaliensis
Calyophanon latum
C. diversus
Caldicellulosiruptor
Capnocytophaga
Calyophanon tenue
C. farmeri
kristjanssonii
Caldicellulosiruptor
Capnocytophaga canimorsus
Catellatospora
C. freundii
owensensis
Capnocytophaga cynodegmi
Catellatospora citrea
C. gillenii
Capnocytophaga gingivalis
Catellatospora
C. koseri
Capnocytophaga granulosa
methionotrophica
C. murliniae
Capnocytophaga
Catenococcus
C. pasteurii
[1]
haemolytica
Capnocytophaga ochracea
Catenococcus thiocycli
C. rodentium
Capnocytophaga sputigena
C. sedlakii
C. werkmanii
C. youngae
Clostridium
Coccochloris
Coccochloris elabens
Corynebacterium
Corynebacterium flavescens
Corynebacterium variabile
Clostridium
Clostridium absonum, Clostridium aceticum, Clostridium acetireducens, Clostridium acetobutylicum, Clostridium acidisoli, Clostridium aciditolerans,
Clostridium acidurici, Clostridium aerotolerans, Clostridium aestuarii, Clostridium akagii, Clostridium aldenense, Clostridium aldrichii, Clostridium
algidicarni, Clostridium algidixylanolyticum, Clostridium algifaecis, Clostridium algoriphilum, Clostridium alkalicellulosi, Clostridium aminophilum,
Clostridium aminovalericum, Clostridium amygdalinum, Clostridium amylolyticum, Clostridium arbusti, Clostridium arcticum, Clostridium
argentinense, Clostridium asparagifomie, Clostridium aurantibutyricum, Clostridium autoethanogenum, Clostridium baratii, Clostridium barkeri,
Clostridium bartlettii, Clostridium beijerinckii, Clostridium bifermentans, Clostridium bolteae, Clostridium bornimense, Clostridium botulinum,
Clostridium bowmanii, Clostridium bryantii, Clostridium butyricum, Clostridium cadaveris, Clostridium caenicola, Clostridium caminithermale,
cellobioparum, Clostridium cellulofermentans, Clostridium cellulolyticum, Clostridium cellulosi, Clostridium cellulovorans, Clostridium
chartatabidum, Clostridium chauvoei, Clostridium chromiireducens, Clostridium citroniae, Clostridium clariflavum, Clostridium clostridioforme,
Clostridium coccoides, Clostridium cochlearium, Clostridium colletant, Clostridium colicanis, Clostridium colinum, Clostridium collagenovorans,
Clostridium cylindrosporum, Clostridium difficile, Clostridium diolis, Clostridium disporicum, Clostridium drakei, Clostridium durum,
Clostridium estertheticum, Clostridium estertheticum estertheticum, Clostridium estertheticum laramiense, Clostridium fallax, Clostridium
felsineum, Clostridium fervidum, Clostridium fimetarium, Clostridium formicaceticum, Clostridium frigidicarnis, Clostridium frigoris,
Clostridium ganghwense, Clostridium gasigenes, Clostridium ghonii, Clostridium glycolicum, Clostridium glycyrrhizinilyticum, Clostridium
grantii, Clostridium haemolyticum, Clostridium halophilum, Clostridium hastiforme, Clostridium hathewayi, Clostridium herbivorans,
Clostridium hiranonis, Clostridium histolyticum, Clostridium homopropionicum, Clostridium huakuii, Clostridium hungatei, Clostridium
hydrogenifomians, Clostridiumhydroxybenzoicum, Clostridium hylemonae, Clostridium jejuense, Clostridium indolis, Clostridium
innocuum, Clostridium intestinale, Clostridium irregulare, Clostridium isatidis, Clostridium josui, Clostridium kluyveri, Clostridium
lactatifermentans, Clostridium lacusfryxellense, Clostridium laramiense, Clostridium lavalense, Clostridium lentocellum, Clostridium
lentoputrescens, Clostridium leptum, Clostridium limosum, Clostridium litorale, Clostridium lituseburense, Clostridium ljungdahlii, Clostridium
lortetii, Clostridium lundense, Clostridium magnum, Clostridium malenominatum, Clostridium mangenotii, Clostridium mayombei, Clostridium
methoxybenzovorans, Clostridium methylpentosum, Clostridium neopropionicum, Clostridium nexile, Clostridium nitrophenolicum,
Clostridium novyi, Clostridium oceanicum, Clostridium orbiscindens, Clostridium oroticum, Clostridium oxalicum, Clostridium papyrosolvens,
Clostridium
paradoxum, Clostridium paraperfringens (Alias: C. welchii), Clostridium paraputrificum, Clostridium pascui, Clostridium
pasteurianum, Clostridiumpeptidivorans, Clostridium perenne, Clostridium perfringens, Clostridium pfennigii, Clostridium phytofermentans,
Clostridium pilifomie, Clostridium polysaccharolyticum, Clostridium populeti, Clostridium propionicum, Clostridium proteoclasticum, Clostridium
proteolyticum, Clostridium psychrophilum, Clostridium puniceum, Clostridium purinilyticum, Clostridium putrefaciens, Clostridium
putrificum, Clostridium quercicolum, Clostridium quinii, Clostridium ramosum, Clostridium rectum, Clostridium roseum, Clostridium
saccharobutylicum, Clostridium saccharogumia, Clostridium saccharolyticum, Clostridium saccharoperbutylacetonicum, Clostridium
sardiniense, Clostridium sartagoforme, Clostridium scatologenes, Clostridium schirmacherense, Clostridium scindens, Clostridium septicum,
Clostridium sordellii, Clostridium sphenoides, Clostridium spiroforme, Clostridium sporogenes, Clostridium sporosphaeroides, Clostridium
stercorarium, Clostridium stercorarium leptospartum, Clostridium stercorarium stercorarium, Clostridium stercorarium thermolacticum,
Clostridium sticklandii, Clostridium straminisolvens, Clostridium subterminale, Clostridium sufflavum, Clostridium sulfidigenes, Clostridium
symbiosum, Clostridium tagluense, Clostridium tepidiprofundi, Clostridium termitidis, Clostridium tertium, Clostridium tetani, Clostridium
tetanomorphum, Clostridium thermaceticum, Clostridium thermautotrophicum, Clostridium thermoalcaliphilum, Clostridium thermobutyricum,
Clostridium thermocellum, Clostridium thermocopriae, Clostridium thermohydrosulfuricum, Clostridium thermolacticum, Clostridium
thermopalmarium, Clostridiumthermopapyrolyticum, Clostridium thermosaccharolyticum, Clostridium thermosuccinogenes, Clostridium
thermosulfurigenes, Clostridiumthiosulfatireducens, Clostridium tyrobutyricum, Clostridium uliginosum, Clostridium ultunense,
Clostridium villosum, Clostridium vincentii, Clostridium viride, Clostridium xylanolyticum, Clostridium xylanovorans
Dactylosporangium
Deinococcus
Delftia
Echinicola
Dactylosporangium
Deinococcus aerius
Delftia acidovorans
Echinicola pacifica
aurantiacum
Dactylosporangium fulvum
Deinococcus apachensis
Desulfovibrio
Echinicola vietnamensis
Dactylosporangium
Deinococcus aquaticus
Desulfovibrio desulfuricans
matsuzakiense
Dactylosporangium roseum
Deinococcus aquatilis
Diplococcus
Dactylosporangium
Deinococcus caeni
Diplococcus pneumoniae
thailandense
Dactylosporangium
vinaceum
Deinococcus radiodurans
Deinococcus radiophilus
Enterobacter
Enterobacter kobei
Faecalibacterium
Flavobacterium
E. aerogenes
E. ludwigii
Faecalibacterium prausnitzii
Flavobacterium antarcticum
E. amnigenus
E. mori
Fangia
Flavobacterium aquatile
E. agglomerans
E. nimipressuralis
Fangia hongkongensis
Flavobacterium
E. arachidis
E. olyzae
Fastidiosipila
aquidurense
E. asburiae
E. pulveris
Fastidiosipila sanguinis
Flavobacterium balustinum
E. cancerogenous
E. pyrinus
Fusobacterium
Flavobacterium croceum
E. cloacae
E. radicincitans
Fusobacterium nucleatum
Flavobacterium cucumis
E. cowanii
E. taylorae
Flavobacterium
E. dissolvens
E. turicensis
daejeonense
E. gergoviae
E. sakazakii
Flavobacterium defluvii
Enterobacter soli
E. helveticus
Enterococcus
Flavobacterium degerlachei
E. hormaechei
Enterococcus durans
Flavobacterium
E. intermedius
Enterococcus faecalis
denitrificans
Enterococcus faecium
Flavobacterium filum
Erwinia
Flavobacterium flevense
Erwinia hapontici
Flavobacterium frigidarium
Escherichia
Flavobacterium mizutaii
Escherichia coli
Flavobacterium
okeanokoites
Gaetbulibacter
Haemophilus
Ideonella
Janibacter
Gaetbulibacter
Haemophilus aegyptius
Ideonella azotifigens
Janibacter anophelis
saemankumensis
Gallibacterium
Haemophilus aphrophilus
Idiomarina
Janibacter corallicola
Gallibacterium anatis
Haemophilus felis
Idiomarina abyssalis
Janibacter limosus
Gallicola
Haemophilus gallinarum
Idiomarina baltica
Janibacter melonis
Gallicola barnesae
Haemophilus haemolyticus
Idiomarina fontislapidosi
Janibacter terrae
Garciella
Haemophilus influenzae
Idiomarina loihiensis
Jannaschia
Haemophilus paracuniculus
Idiomarina ramblicola
Jannaschia cystaugens
Geobacillus
Haemophilus
Idiomarina seosinensis
Jannaschia helgolandensis
parahaemolyticus
Geobacillus
Haemophilus parainfluenzae
Idiomarina zobellii
Jannaschia pohangensis
thermoglucosidasius
Geobacillus
Haemophilus
Ignatzschineria
Jannaschia rubra
stearothermophilus
Geobacter
paraphrohaemolyticus
Ignatzschineria larvae
Geobacter bemidjiensis
Haemophilus parasuis
Janthinobacterium
Geobacter bremensis
Haemophilus pittmaniae
Ignavigranum
Janthinobacterium
Geobacter chapellei
Hafnia
Ignavigranum ruoffiae
agaricidamnosum
Geobacter grbiciae
Hafnia alvei
Ilumatobacter
Janthinobacterium lividum
Geobacter hydrogenophilus
Hahella
Ilumatobacter fluminis
Jejuia
Geobacter lovleyi
Hahella ganghwensis
Ilyobacter
Jejuia pallidilutea
Geobacter metallireducens
Ilyobacter delafieldii
Geobacter pelophilus
Halalkalibacillus
Ilyobacter insuetus
Jeotgalibacillus
Geobacter pickeringii
Halalkalibacillus halophilus
Ilyobacter polytropus
Jeotgalibacillus
Geobacter sulfurreducens
Helicobacter
Ilyobacter tartaricus
alimentarius
Geodermatophilus
Helicobacter pylori
Jeotgalicoccus
Geodermatophilus obscurus
Jeotgalicoccus halotolerans
Gluconacetobacter
Gluconacetobacter xylinus
Gordonia
Gordonia rubripertincta
Kaistia
Labedella
Listeria ivanovii
Micrococcus
Nesterenkonia
Kaistia adipata
Labedella gwakjiensis
L. marthii
Micrococcus luteus
Nesterenkonia holobia
Kaistia soli
Labrenzia
L. monocytogenes
Micrococcus lylae
Nocardia
Kangiella
Labrenzia aggregata
L. newyorkensis
Moraxella
Nocardia argentinensis
Kangiella aquimarina
Labrenzia alba
L. riparia
Moraxella bovis
Nocardia corallina
Kangiella koreensis
Labrenzia alexandrii
L. rocourtiae
Moraxella nonliquefaciens
Nocardia
Labrenzia marina
L. seeligeri
Moraxella osloensis
otitidiscaviarum
Kerstersia
Labrys
L. weihenstephanensis
Nakamurella
Kerstersia gyiorum
Labrys methylaminiphilus
L. welshimeri
Nakamurella multipartita
Kiloniella
Labrys miyagiensis
Listonella
Nannocystis
Kiloniella laminariae
Labrys monachus
Listonella anguillarum
Nannocystis pusilla
Klebsiella
Labrys okinawensis
Macrococcus
Natranaerobius
K. granulomatis
Labrys portucalensis
Macrococcus bovicus
Natranaerobius
K. oxytoca
Marinobacter
themophilus
K. pneumoniae
Lactobacillus
Marinobacter algicola
Natranaerobius trueperi
K. terrigena
Marinobacter bryozoorum
Naxibacter
K. variicola
Laceyella
Marinobacter flavimaris
Naxibacter alkalitolerans
Kluyvera
Laceyella putida
Meiothermus
Neisseria
Kluyvera ascorbata
Lechevalieria
Meiothermus ruber
Neisseria cinerea
Kocuria
Lechevalieria
Methylophilus
Neisseria denitrificans
aerocolonigenes
Kocuria roasea
Legionella
Methylophilus
Neisseria gonorrhoeae
Kocuria varians
methylotrophus
Neisseria lactamica
Kurthia
Listeria
Microbacterium
Neisseria mucosa
Kurthia zopfii
L. aquatica
Microbacterium
Neisseria sicca
L. booriae
ammoniaphilum
Neisseria subflava
L. cornellensis
Microbacterium arborescens
Neptunomonas
L. fleischmannii
Microbacterium liquefaciens
Neptunomonas japonica
L. floridensis
Microbacterium oxydans
L. grandensis
L. grayi
L. innocua
Lactobacillus
L. acetotolerans
L. catenaformis
L. mali
L. parakefiri
L. sakei
L. acidifarinae
L. ceti
L. manihotivorans
L. paralimentarius
L. salivarius
L. acidipiscis
L. coleohominis
L. mindensis
L. paraplantarum
L. sanfranciscensis
L. acidophilus
L. collinoides
L. mucosae
L. pentosus
L. satsumensis
Lactobacillus agilis
L. composti
L. murinus
L. perolens
L. secaliphilus
L. algidus
L. concavus
L. nagelii
L. plantarum
L. sharpeae
L. alimentarius
L. colyniformis
L. namurensis
L. pontis
L. siliginis
L. amylolyticus
L. crispatus
L. nantensis
L. protectus
L. spicheri
L. amylophilus
L. crustorum
L. oligofermentans
L. psittaci
L. suebicus
L. amylotrophicus
L. curvatus
L. oris
L. rennini
L. thailandensis
L. amylovorus
L. delbrueckii subsp.
L. panis
L. reuteri
L. ultunensis
L. animalis
bulgaricus
L. pantheris
L. rhamnosus
L. vaccinostercus
L. antri
L. delbrueckii subsp.
L. parabrevis
L. rimae
L. vaginalis
L. apodemi
delbrueckii
L. parabuchneri
L. rogosae
L. versmoldensis
L. aviarius
L. delbrueckii subsp. lactis
L. paracasei
L. rossiae
L. vini
L. bifementans
L. dextrinicus
L. paracollinoides
L. ruminis
L. vitulinus
L. brevis
L. diolivorans
L. parafarraginis
L. saerimneri
L. zeae
L. buchneri
L. equi
L. homohiochii
L. jensenii
L. zymae
L. camelliae
L. equigenerosi
L. iners
L. johnsonii
L. gastricus
L. casei
L. farraginis
L. ingluviei
L. kalixensis
L. ghanensis
L. kitasatonis
L. farciminis
L. intestinalis
L. kefiranofaciens
L. graminis
L. kunkeei
L. fermentum
L. fuchuensis
L. kefiri
L. hammesii
L. leichmannii
L. fomicalis
L. gallinarum
L. kimchii
L. hamsteri
L. lindneri
L. fructivorans
L. gasseri
L. helveticus
L. harbinensis
L. malefermentans
L. frumenti
L. hilgardii
L. hayakitensis
Legionella
Legionella adelaidensis
Legionella drancourtii
Candidatus Legionella jeonii
Legionella quinlivanii
Legionella anisa
Legionella dresdenensis
Legionella jordanis
Legionella rowbothamii
Legionella beliardensis
Legionella drozanskii
Legionella lansingensis
Legionella rubrilucens
Legionella birminghamensis
Legionella dumoffii
Legionella londiniensis
Legionella sainthelensi
Legionella bozemanae
Legionella erythra
Legionella longbeachae
Legionella santicrucis
Legionella brunensis
Legionella fairfieldensis
Legionella lytica
Legionella shakespearei
Legionella busanensis
Legionella fallonii
Legionella maceachernii
Legionella spiritensis
Legionella cardiaca
Legionella feeleii
Legionella massiliensis
Legionella steelei
Legionella cherrii
Legionella geestiana
Legionella micdadei
Legionella steigerwaltii
Legionella cincinnatiensis
Legionella genomospecies
Legionella monrovica
Legionella taurinensis
Legionella gormanii
Legionella moravica
Legionella tucsonensis
Legionella donaldsonii
Legionella gratiana
Legionella nagasakiensis
Legionella tunisiensis
Legionella gresilensis
Legionella nautarum
Legionella wadsworthii
Legionella hackeliae
Legionella norrlandica
Legionella waltersii
Legionella impletisoli
Legionella oakridgensis
Legionella worsleiensis
Legionella israelensis
Legionella parisiensis
Legionella yabuuchiae
Legionella jamestowniensis
Legionella pittsburghensis
Legionella pneumophila
Legionella quateirensis
Oceanibulbus
Paenibacillus
Prevotella
Quadrisphaera
Oceanibulbus indolifex
Paenibacillus
Prevotella albensis
Quadrisphaera granulorum
thiaminolyticus
Oceanicaulis
Pantoea
Prevotella amnii
Quatrionicoccus
Oceanicaulis alexandrii
Pantoea agglomerans
Prevotella bergensis
Quatrionicoccus
Oceanicola
Prevotella bivia
australiensis
Oceanicola batsensis
Paracoccus
Prevotella brevis
Oceanicola granulosus
Paracoccus alcaliphilus
Prevotella bryantii
Quinella
Oceanicola nanhaiensis
Paucimonas
Prevotella buccae
Quinella ovalis
Oceanimonas
Paucimonas lemoignei
Prevotella buccalis
Oceanimonas baumannii
Pectobacterium
Prevotella copri
Ralstonia
Oceaniserpentilla
Pectobacterium aroidearum
Prevotella dentalis
Ralstonia eutropha
Oceaniserpentilla haliotis
Pectobacterium
Prevotella denticola
Ralstonia insidiosa
atrosepticum
Oceanisphaera
Pectobacterium
Prevotella disiens
Ralstonia mannitolilytica
Oceanisphaera donghaensis
betavasculorum
Prevotella histicola
Ralstonia pickettii
Oceanisphaera litoralis
Pectobacterium cacticida
Prevotella intermedia
Ralstonia
Oceanithermus
Pectobacterium carnegieana
Prevotella maculosa
pseudosolanacearum
Oceanithermus desulfurans
Pectobacterium
Prevotella marshii
Ralstonia syzygii
carotovorum
Oceanithermus profundus
Pectobacterium
Prevotella melaninogenica
Ralstonia solanacearum
chrysanthemi
Pectobacterium cypripedii
Prevotella micans
Oceanobacillus
Pectobacterium rhapontici
Prevotella multiformis
Ramlibacter
Oceanobacillus caeni
Pectobacterium wasabiae
Prevotella nigrescens
Ramlibacter henchirensis
Oceanospirillum
Planococcus
Prevotella oralis
Ramlibacter tataouinensis
Oceanospirillum linum
Planococcus citreus
Prevotella oris
Planomicrobium
Prevotella oulorum
Raoultella
Planomicrobium
Prevotella pallens
Raoultella ornithinolytica
okeanokoites
Plesiomonas
Prevotella salivae
Raoultella planticola
Plesiomonas shigelloides
Prevotella stercorea
Raoultella terrigena
Proteus
Prevotella tannerae
Rathayibacter
Proteus vulgaris
Prevotella timonensis
Rathayibacter caricis
Prevotella veroralis
Rathayibacter festucae
Providencia
Rathayibacter iranicus
Providencia stuartii
Rathayibacter rathayi
Pseudomonas
Rathayibacter toxicus
Pseudomonas aeruginosa
Rathayibacter tritici
Pseudomonas alcaligenes
Rhodobacter
Pseudomonas anguillispetica
Rhodobacter sphaeroides
Pseudomonas fluorescens
Ruegeria
Pseudoalteromonas
Ruegeria gelatinovorans
haloplanktis
Pseudomonas mendocina
Pseudomonas
pseudoalcaligenes
Pseudomonas putida
Pseudomonas tutzeri
Pseudomonas syringae
Psychrobacter
Psychrobacter faecalis
Psychrobacter
phenylpyruvicus
Saccharococcus
Sagittula
Sanguibacter
Stenotrophomonas
Tatlockia
Saccharococcus
Sagittula stellata
Sanguibacter keddieii
Stenotrophomonas
Tatlockia maceachernii
thermophilus
Saccharomonospora
Salegentibacter
Sanguibacter suarezii
maltophilia
Tatlockia micdadei
Saccharomonospora azurea
Salegentibacter salegens
Saprospira
Streptococcus
Tenacibaculum
Saccharomonospora cyanea
Salimicrobium
Saprospira grandis
Tenacibaculum
Saccharomonospora viridis
Salimicrobium album
Sarcina
amylolyticum
Saccharophagus
Salinibacter
Sarcina maxima
Streptomyces
Tenacibaculum discolor
Saccharophagus degradans
Salinibacter ruber
Sarcina ventriculi
Streptomyces
Tenacibaculum
Saccharopolyspora
Salinicoccus
Sebaldella
achromogenes
gallaicum
Saccharopolyspora elythraea
Salinicoccus alkaliphilus
Sebaldella termitidis
Streptomyces cesalbus
Tenacibaculum
Saccharopolyspora gregorii
Salinicoccus hispanicus
Streptomyces cescaepitosus
lutimaris
Saccharopolyspora hirsuta
Salinicoccus roseus
Serratia
Streptomyces cesdiastaticus
Tenacibaculum
Saccharopolyspora hordei
Serratia fonticola
Streptomyces cesexfoliatus
mesophilum
Saccharopolyspora
Serratia marcescens
Streptomyces fimbriatus
rectivirgula
Saccharopolyspora spinosa
Salinispora
Sphaerotilus
Streptomyces fradiae
Tenacibaculum
Saccharopolyspora taberi
Salinispora arenicola
Sphaerotilus natans
Streptomyces fulvissimus
skagerrakense
Saccharothrix
Salinispora tropica
Sphingobacterium
Streptomyces griseoruber
Tepidanaerobacter
Saccharothrix australiensis
Salinivibrio
Sphingobacterium
Streptomyces griseus
Tepidanaerobacter
multivorum
Saccharothrix coeruleofusca
Salinivibrio costicola
Staphylococcus
Streptomyces lavendulae
syntrophicus
Saccharothrix espanaensis
Salmonella
Streptomyces
Tepidibacter
Saccharothrix longispora
Salmonella bongori
phaeochromogenes
Tepidibacter
Saccharothrix mutabilis
Salmonella enterica
Streptomyces
fomicigenes
Saccharothrix syringae
Salmonella subterranea
themodiastaticus
Tepidibacter
Saccharothrix tangerinus
Salmonella typhi
Streptomyces tubercidicus
thalassicus
Saccharothrix texasensis
Thermus
Thermus aquaticus
Thermus filiformis
Thermus thermophilus
Staphylococcus
S. arlettae
S. equorum
S. microti
S. schleiferi
S. agnetis
S. felis
S. muscae
S. sciuri
S. aureus
S. fleurettii
S. nepalensis
S. simiae
S. auricularis
S. gallinarum
S. pasteuri
S. simulans
S. capitis
S. haemolyticus
S. petrasii
S. stepanovicii
S. caprae
S. hominis
S. pettenkoferi
S. succinus
S. carnosus
S. hyicus
S. piscifermentans
S. vitulinus
S. caseolyticus
S. intermedius
S. pseudintermedius
S. warneri
S. chromogenes
S. kloosii
S. pseudolugdunensis
S. xylosus
S. cohnii
S. leei
S. pulvereri
S. condimenti
S. lentus
S. rostri
S. delphini
S. lugdunensis
S. saccharolyticus
S. devriesei
S. lutrae
S. saprophyticus
S. epidermidis
S. lyticans
S. massiliensis
Streptococcus
Streptococcus agalactiae
Streptococcus infantarius
Streptococcus orisratti
Streptococcus themophilus
Streptococcus anginosus
Streptococcus iniae
Streptococcus parasanguinis
Streptococcus sanguinis
Streptococcus bovis
Streptococcus intermedius
Streptococcus peroris
Streptococcus sobrinus
Streptococcus canis
Streptococcus lactarius
Streptococcus pneumoniae
Streptococcus suis
Streptococcus constellatus
Streptococcus milleri
Streptococcus
Streptococcus uberis
Streptococcus downei
Streptococcus mitis
pseudopneumoniae
Streptococcus vestibularis
Streptococcus dysgalactiae
Streptococcus mutans
Streptococcus pyogenes
Streptococcus viridans
Streptococcus equines
Streptococcus oralis
Streptococcus ratti
Streptococcus
Streptococcus faecalis
Streptococcus tigurinus
Streptococcus salivariu
zooepidemicus
Streptococcus ferus
Uliginosibacterium
Vagococcus
Vibrio
Virgibacillus
Xanthobacter
Vagococcus carniphilus
Vibrio aerogenes
Virgibacillus
Xanthobacter agilis
Uliginosibacterium
Vagococcus elongatus
Vibrio aestuarianus
halodenitrificans
Xanthobacter
gangwonense
Ulvibacter
Vagococcus fessus
Vibrio albensis
Virgibacillus
aminoxidans
Ulvibacter litoralis
Vagococcus fluvialis
Vibrio alginolyticus
pantothenticus
Xanthobacter
Umezawaea
Vagococcus
lutrae
Vibrio campbellii
Weissella
autotrophicus
Umezawaea tangerina
Vagococcus salmoninarum
Vibrio cholerae
Weissella cibaria
Xanthobacter flavus
Undibacterium
Variovorax
Vibrio cincinnatiensis
Weissella confusa
Xanthobacter tagetidis
Undibacterium pigrum
Variovorax boronicumulans
Vibrio coralliilyticus
Weissella halotolerans
Xanthobacter viscosus
Ureaplasma
Variovorax dokdonensis
Vibrio cyclitrophicus
Weissella hellenica
Xanthomonas
Ureaplasma urealyticum
Variovorax paradoxus
Vibrio diazotrophicus
Weissella kandleri
Xanthomonas
Variovorax soli
Vibrio fluvialis
Weissella koreensis
albilineans
Ureibacillus
Veillonella
Vibrio furnissii
Weissella minor
Xanthomonas alfalfae
Ureibacillus composti
Veillonella atypica
Vibrio gazogenes
Weissella
Xanthomonas
Ureibacillus suwonensis
Veillonella caviae
Vibrio halioticoli
paramesenteroides
arboricola
Ureibacillus terrenus
Veillonella criceti
Vibrio harveyi
Weissella soli
Xanthomonas
Ureibacillus thermophilus
Veillonella dispar
Vibrio ichthyoenteri
Weissella thailandensis
axonopodis
Ureibacillus
Veillonella montpellierensis
Vibrio mediterranei
Weissella viridescens
Xanthomonas
thermosphaericus
Veillonella parvula
Vibrio metschnikovii
Williamsia
campestris
Veillonella ratti
Vibrio mytili
Williamsia marianensis
Xanthomonas citri
Veillonella rodentium
Vibrio natriegens
Williamsia maris
Xanthomonas codiaei
Venenivibrio
Vibrio navarrensis
Williamsia serinedens
Xanthomonas
Venenivibrio
Vibrio nereis
cucurbitae
stagnispumantis
Vibrio nigripulchritudo
Winogradskyella
Xanthomonas
Verminephrobacter
Vibrio ordalii
Winogradskyella
euvesicatoria
Verminephrobacter eiseniae
Vibrio orientalis
thalassocola
Xanthomonas fragariae
Vibrio parahaemolyticus
Wolbachia
Xanthomonas fuscans
Verrucomicrobium
Vibrio pectenicida
Wolbachia persica
Xanthomonas gardneri
Verrucomicrobium
Vibrio penaeicida
Xanthomonas hortorum
spinosum
Vibrio proteolyticus
Wolinella
Xanthomonas hyacinthi
Vibrio shilonii
Wolinella succinogenes
Xanthomonas perforans
Vibrio splendidus
Xanthomonas phaseoli
Vibrio tubiashii
Zobellia
Xanthomonas pisi
Vibrio vulnificus
Zobellia galactanivorans
Xanthomonas populi
Zobellia uliginosa
Xanthomonas theicola
Zoogloea
Xanthomonas
Zoogloea ramigera
translucens
Zoogloea resiniphila
Xanthomonas
vesicatoria
Xylella
Xylella fastidiosa
Xylophilus
Xylophilus ampelinus
Xenophilus
Yangia
Yersinia mollaretii
Zooshikella
Zobellella
Xenophilus azovorans
Yangia pacifica
Yersinia philomiragia
Zooshikella ganghwensis
Zobellella denitrificans
Xenorhabdus
Yaniella
Yersinia pestis
Zunongwangia
Zobellella taiwanensis
Xenorhabdus beddingii
Yaniella flava
Yersinia pseudotuberculosis
Zunongwangia profunda
Xenorhabdus bovienii
Yaniella halotolerans
Yersinia rohdei
Zymobacter
Zeaxanthinibacter
Xenorhabdus cabanillasii
Yeosuana
Yersinia ruckeri
Zymobacter palmae
Zeaxanthinibacter
Xenorhabdus doucetiae
Yeosuana aromativorans
Yokenella
Zymomonas
enoshimensis
Xenorhabdus griffiniae
Yersinia
Yokenella regensburgei
Zymomonas mobilis
Zhihengliuella
Xenorhabdus hominickii
Yersinia aldovae
Yonghaparkia
Zymophilus
Zhihengliuella
Xenorhabdus koppenhoeferi
Yersinia bercovieri
Yonghaparkia alkaliphila
Zymophilus paucivorans
halotolerans
Xenorhabdus nematophila
Yersinia enterocolitica
Zavarzinia
Zymophilus raffinosivorans
Xylanibacterium
Xenorhabdus poinarii
Yersinia entomophaga
Zavarzinia compransoris
Xylanibacterium ulmi
Xylanibacter
Yersinia frederiksenii
Xylanibacter olyzae
Yersinia intermedia
Yersinia kristensenii
aalso shown in the Anderson Catalog, see parts.igem.org/Promoters/Catalog/Anderson
bStrength is the Anderson Score (AS), e.g., a strength of 1 is a AS of 1. Reported activities of the promoters are given as the relative fluorescence of plasmids in strain TG1 grown in LB media to saturation. A suitable plasmid is EX-Ptet-S-rbsRFP-P /RFP reporter/ as described at parts.igem.org/Part:BBa_J61002; insertion of a promoter element between XbaI and SpeI sites results in a RFP reporter.
| Number | Date | Country | Kind |
|---|---|---|---|
| 1816700 | Oct 2018 | GB | national |
| 1817509 | Oct 2018 | GB | national |
This application is a continuation of U.S. patent application Ser. No. 16/201,736, filed Nov. 27, 2018 which claims priority to Great Britain Patent Application No. 1816700.7, filed Oct. 14, 2018, and Great Britain Patent Application No. 1817509.1, filed Oct. 27, 2018, the contents of each of which are hereby incorporated herein by reference in their entirety.
| Number | Name | Date | Kind |
|---|---|---|---|
| 4626504 | Puhler | Dec 1986 | A |
| 5633154 | Schaefer | May 1997 | A |
| 8241498 | Summer | Aug 2012 | B2 |
| 8252576 | Campbell | Aug 2012 | B2 |
| 8906682 | June | Dec 2014 | B2 |
| 8911993 | June | Dec 2014 | B2 |
| 8916381 | June | Dec 2014 | B1 |
| 8975071 | June | Mar 2015 | B1 |
| 9101584 | June | Aug 2015 | B2 |
| 9102760 | June | Aug 2015 | B2 |
| 9102761 | June | Aug 2015 | B2 |
| 9113616 | Stevens | Aug 2015 | B2 |
| 9328156 | June | May 2016 | B2 |
| 9464140 | June | Oct 2016 | B2 |
| 9481728 | June | Nov 2016 | B2 |
| 9499629 | June | Nov 2016 | B2 |
| 9518123 | June | Dec 2016 | B2 |
| 9540445 | June | Jan 2017 | B2 |
| 9701964 | Clube | Jul 2017 | B2 |
| 10300138 | Clube | May 2019 | B2 |
| 10463049 | Clube | Nov 2019 | B2 |
| 10506812 | Clube | Dec 2019 | B2 |
| 10524477 | Clube | Jan 2020 | B2 |
| 10561148 | Clube | Feb 2020 | B2 |
| 10582712 | Clube | Mar 2020 | B2 |
| 10596255 | Clube | Mar 2020 | B2 |
| 10624349 | Clube | Apr 2020 | B2 |
| 11141481 | Clube | Oct 2021 | B2 |
| 11147830 | Clube | Oct 2021 | B2 |
| 20040096974 | Herron | May 2004 | A1 |
| 20050118719 | Schmidt | Jun 2005 | A1 |
| 20110136688 | Scholl | Jun 2011 | A1 |
| 20130109053 | Macdonald | May 2013 | A1 |
| 20130287748 | June | Oct 2013 | A1 |
| 20130288368 | June | Oct 2013 | A1 |
| 20130309258 | June | Nov 2013 | A1 |
| 20140106449 | June | Apr 2014 | A1 |
| 20140107092 | Meyerson | Apr 2014 | A1 |
| 20140234972 | Zhang | Aug 2014 | A1 |
| 20140370017 | June | Dec 2014 | A1 |
| 20150050699 | Siksnys | Feb 2015 | A1 |
| 20150050729 | June | Feb 2015 | A1 |
| 20150064138 | Lu | Mar 2015 | A1 |
| 20150093822 | June | Apr 2015 | A1 |
| 20150099299 | June | Apr 2015 | A1 |
| 20150118202 | June | Apr 2015 | A1 |
| 20150125463 | Cogswell | May 2015 | A1 |
| 20150132419 | Arvik | May 2015 | A1 |
| 20150139943 | Campana | May 2015 | A1 |
| 20150140001 | Lee | May 2015 | A1 |
| 20150290244 | June | Oct 2015 | A1 |
| 20160009805 | Kowanetz | Jan 2016 | A1 |
| 20160024510 | Bikard | Jan 2016 | A1 |
| 20160081314 | Thurston | Mar 2016 | A1 |
| 20160115488 | Zhang | Apr 2016 | A1 |
| 20160115489 | Zhang | Apr 2016 | A1 |
| 20160130355 | June | May 2016 | A1 |
| 20160159907 | June | Jun 2016 | A1 |
| 20160160186 | Parsley | Jun 2016 | A1 |
| 20160168594 | Zhang et al. | Jun 2016 | A1 |
| 20160194404 | June | Jul 2016 | A1 |
| 20160208012 | June | Jul 2016 | A1 |
| 20160324938 | Bikard | Nov 2016 | A1 |
| 20160333348 | Clube | Nov 2016 | A1 |
| 20160345578 | Barrangou | Dec 2016 | A1 |
| 20160347836 | Grosso | Dec 2016 | A1 |
| 20160354416 | Gajewski | Dec 2016 | A1 |
| 20170022499 | Lu | Jan 2017 | A1 |
| 20170173085 | Kovarik | Jun 2017 | A1 |
| 20170173086 | Boyle | Jun 2017 | A1 |
| 20170175142 | Zhang | Jun 2017 | A1 |
| 20170196225 | Clube | Jul 2017 | A1 |
| 20170233708 | Liu | Aug 2017 | A1 |
| 20170246221 | Clube | Aug 2017 | A1 |
| 20170304443 | Lebwohl | Oct 2017 | A1 |
| 20170327582 | Bissonnette | Nov 2017 | A1 |
| 20170340733 | Cao | Nov 2017 | A1 |
| 20180015131 | Gajewski | Jan 2018 | A1 |
| 20180055852 | Kutok | Mar 2018 | A1 |
| 20180064114 | Clube | Mar 2018 | A1 |
| 20180064115 | Clube | Mar 2018 | A1 |
| 20180070594 | Clube | Mar 2018 | A1 |
| 20180084785 | Clube | Mar 2018 | A1 |
| 20180084786 | Clube | Mar 2018 | A1 |
| 20180140698 | Clube | May 2018 | A1 |
| 20180146681 | Clube | May 2018 | A1 |
| 20180155729 | Beisel | Jun 2018 | A1 |
| 20180179547 | Zhang | Jun 2018 | A1 |
| 20180200342 | Bikard | Jul 2018 | A1 |
| 20180273940 | Sommer | Sep 2018 | A1 |
| 20180303934 | Clube | Oct 2018 | A1 |
| 20180305714 | Maresca | Oct 2018 | A1 |
| 20190133135 | Clube | May 2019 | A1 |
| 20190134194 | Clube | May 2019 | A1 |
| 20190160120 | Haaber | May 2019 | A1 |
| 20190230936 | Clube | Aug 2019 | A1 |
| 20190240325 | Clube | Aug 2019 | A1 |
| 20190240326 | Clube | Aug 2019 | A1 |
| 20190321468 | Clube | Oct 2019 | A1 |
| 20190321469 | Clube | Oct 2019 | A1 |
| 20190321470 | Clube | Oct 2019 | A1 |
| 20190367947 | Lopes Ferreira | Dec 2019 | A1 |
| 20200068901 | Clube | Mar 2020 | A1 |
| 20200077663 | Clube | Mar 2020 | A1 |
| 20200085066 | Clube | Mar 2020 | A1 |
| 20200102551 | Barrangou | Apr 2020 | A1 |
| 20200115716 | Martinez | Apr 2020 | A1 |
| 20200121787 | Clube | Apr 2020 | A1 |
| 20200128832 | Clube | Apr 2020 | A1 |
| 20200164070 | Clube | May 2020 | A1 |
| 20200205416 | Clube | Jul 2020 | A1 |
| 20200254035 | Haaber | Aug 2020 | A1 |
| 20200267992 | Clube | Aug 2020 | A1 |
| 20200337313 | Clube | Oct 2020 | A1 |
| 20200390886 | Clube | Dec 2020 | A1 |
| 20210147827 | Clube | May 2021 | A1 |
| 20210147857 | Clube | May 2021 | A1 |
| 20210189406 | Martinez et al. | Jun 2021 | A1 |
| 20210230559 | Clube | Jul 2021 | A1 |
| 20210283167 | Clube | Sep 2021 | A1 |
| 20210386773 | Clube | Dec 2021 | A1 |
| Number | Date | Country |
|---|---|---|
| 107557378 | Jan 2018 | CN |
| 2840140 | Feb 2015 | EP |
| 3132035 | Apr 2020 | EP |
| 3132036 | Apr 2020 | EP |
| 3630975 | Apr 2020 | EP |
| 3633032 | Apr 2020 | EP |
| 3634442 | Apr 2020 | EP |
| 3634473 | Apr 2020 | EP |
| 2531343 | Oct 2014 | RU |
| 2005046579 | May 2005 | WO |
| 2005046579 | Aug 2005 | WO |
| 2007025097 | Mar 2007 | WO |
| 2008108989 | Sep 2008 | WO |
| 2010011961 | Jan 2010 | WO |
| 2010075424 | Jul 2010 | WO |
| 2012079000 | Jun 2012 | WO |
| 2012079000 | Aug 2012 | WO |
| 2012164565 | Dec 2012 | WO |
| 2013063361 | May 2013 | WO |
| 2013176772 | Nov 2013 | WO |
| 2014012001 | Jan 2014 | WO |
| 2014018423 | Jan 2014 | WO |
| 2014124226 | Aug 2014 | WO |
| 2015034872 | Mar 2015 | WO |
| 2014012001 | Apr 2015 | WO |
| 2015058018 | Apr 2015 | WO |
| 2015069682 | May 2015 | WO |
| 2015071474 | May 2015 | WO |
| 2015088643 | Jun 2015 | WO |
| 2015089419 | Jun 2015 | WO |
| 2015089419 | Sep 2015 | WO |
| 2015136541 | Sep 2015 | WO |
| 2015148680 | Oct 2015 | WO |
| 2015155686 | Oct 2015 | WO |
| 2015159068 | Oct 2015 | WO |
| 2015159086 | Oct 2015 | WO |
| 2015159087 | Oct 2015 | WO |
| 2015136541 | Nov 2015 | WO |
| 2016033088 | Mar 2016 | WO |
| 2016044745 | Mar 2016 | WO |
| 2016063263 | Apr 2016 | WO |
| 2016177682 | Nov 2016 | WO |
| 2016196361 | Dec 2016 | WO |
| 2016196605 | Dec 2016 | WO |
| 2017042347 | Mar 2017 | WO |
| 2017058751 | Apr 2017 | WO |
| 2017112620 | Jun 2017 | WO |
| 2017118598 | Jul 2017 | WO |
| 2018064165 | Apr 2018 | WO |
| 2018081502 | May 2018 | WO |
| 2018141907 | Aug 2018 | WO |
| 2018217351 | Nov 2018 | WO |
| 2018217981 | Nov 2018 | WO |
| 2018222969 | Dec 2018 | WO |
| 2018226853 | Dec 2018 | WO |
| 2019002207 | Jan 2019 | WO |
| 2019002218 | Jan 2019 | WO |
| 2020072248 | Apr 2020 | WO |
| 2020072250 | Apr 2020 | WO |
| 2020072253 | Apr 2020 | WO |
| 2020072254 | Apr 2020 | WO |
| Entry |
|---|
| Mutalik et. al. Precise and reliable gene expression via standard transcription and translation initiation elements. 2013 Nature Methods, vol. 1-(4), pp. 354-360 (Year: 2013). |
| Rolf Lutz and Hermann Bujard. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Research, 1997, vol. 25, No. 6 1203-1210 (Year: 1997). |
| Gomaa et al. Programmable Removal of Bacterial Strains by Use of Genome-Targeting CRISPR-Cas Systems (2014) MBio 5(1):e00928-00913 (Year: 2014). |
| Vercoe et al. Cytotoxic Chromosomal Targeting by CRISPR/Cas Systems Can Reshape Bacterial Genomes and Expel or Remodel Pathogenicity Islands 2013 PLOS Genetics; vol. 9 | Issue 4 | e1003454 (Year: 2013). |
| Aklujkar et al. (2010) “Interference With Histidyl-tRNA Synthetase by a CRISPR Spacer Sequence as a Factor in the Evolution of Pelobacter Carbinolicus,” BMC Evolutionary Biology 10:203, 15 pages. |
| American Lung Association (2019). “Preventing COPD,” retrieved from https://www.lung.org/lung-health-and-diseases/lung-disease-lookup/copd/symptoms-causes-risk-factors/preventing-copd.html, last visited Aug. 5, 2019, 1 page. |
| Anderson Catalog, retrieved from https//parts.igem.org/Promoters/Catalog/Anderson lasted visited Nov. 29, 2018, 2 pages. |
| Anderson Promotor Collection, BBa_J23100, (Aug. 4, 2006), 3 pages. |
| Anderson Promotor Collection, BBa_J23101, (Aug. 4, 2006), 2 pages. |
| Anderson Promotor Collection, BBa_J23102, (Aug. 4, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23103, (Aug. 4, 2006), 2 pages. |
| Anderson Promotor Collection, BBa_J23104, (Aug. 4, 2006), 2 pages. |
| Anderson Promotor Collection, BBa_J23105, (Aug. 14, 2006), 2 pages. |
| Anderson Promotor Collection, BBa_J23106, (Aug. 14, 2006), 5 pages. |
| Anderson Promotor Collection, BBa_J23107, (Aug. 17, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23108, (Aug. 17, 2006), 3 pages. |
| Anderson Promotor Collection, BBa_J23109, (Aug. 17, 2006), 2 pages. |
| Anderson Promotor Collection, BBa_J23110, (Aug. 17, 2006), 2 pages. |
| Anderson Promotor Collection, BBa_J23111, (Aug. 17, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23112, (Aug. 17, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23113, (Aug. 17, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23114, (Aug. 17, 2006), 2 pages. |
| Anderson Promotor Collection, BBa_J23115, (Aug. 17, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23116, (Aug. 17, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23117, (Aug. 17, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23118, (Aug. 17, 2006), 1 pages. |
| Anderson Promotor Collection, BBa_J23119, (Aug. 24, 2006), 3 pages. |
| Ang, Y.L.E. et al. (2015). “Best Practice in the Treatment of Advanced Squamous Cell Lung Cancer,” Ther. Adv. Respir. Dis. 9(5):224-235. |
| Anonymous (Apr. 2016). “Checkpoint Inhibition: A Promising Immunotherapeutic Approach for Colorectal Cancer,” Oncology, 5(3):1-5, retrieved from http//www.personalizedmedonc.com/publications/prno/april-2016-vol-5-no-3/checkpoint-inhibition-a-promising-irmunotherapeutic-approach-for-colorectal-cancer-2/, last visited Aug. 27, 2019, 5 pages. |
| Arnold, I.C. et al. (Apr. 8, 2015, e-pub. Mar. 4, 2015). “Helicobacter Hepaticus Infection in BALB/c Mice Abolishes Subunit-Vaccine-Induced Protection Against M. tuberculosis,” Vaccine 33(15):1808-1814. |
| Arslan, Z. et al. (May 7, 2013). “RcsB-BglJ-Mediated Activation of Cascade Operon Does Not Induce the Maturation of CRISPR RNAs in E. coli K12,” RNA Biology 10(5):708-715. |
| Arumugam et al. (May 12, 2011). “Enterotypes of the human gut microbiome,” Nature 473(7346):174-180, 16 pages. |
| Barrangou, R. et al. (Mar. 2007). “CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes,” Science, 315:1709-1712. |
| Barrett, K.J. et al. (1976). “Interactions Between a Satellite Bacteriophage and Its Helper,” J. Mol. Biol. 106:683-707. |
| Beisel, C.L. et al. (2014). “A CRISPR Design for Next-Generation Antimicrobials,” Genome Biology 15:516, 4 pages. |
| Belizario, J.E. et al. (Oct. 6, 2015). “Human Microbiomes and Their Roles in Dysbiosis, Common Diseases, and Novel Therapeutic Approaches,” Frontiers in Microbiology 6(1050):1-16. |
| Bikard, D. et al. (2013, e-pub. Jun. 12, 2013). “Programmable Repression and Activation of Bacterial Gene Expression Using an Engineered CRISPR-Cas System,” Nucleic Acids Research 41(15):7429-7437. |
| Bikard, D. et al. (2017, e-pub. Sep. 6, 2017). “Using CRISPR-Cas Systems as Antimicrobials,” Current Opinion in Microbiology 37:155-160. |
| Bikard, D. et al. (Aug. 16, 2012). “CRISPR Interference Can Prevent Natural Transformation and Virulence Acquisition during In Vivo Bacterial Infection,” Cell Host & Microbe 12(2):177-186. |
| Bikard, D. et al. (Nov. 2014). “Development of Sequence-Specific Antimicrobials Based on Programmable CRISPR-Cas Nucleases,” Nature Biotechnology 32(11):1146-1151, 16 pages. |
| Broaders, E. et al. (Jul./Aug. 2013). “Mobile Genetic Elements of the Human Gastrointestinal Tract,” Gut Microbes 4(4):271-280. |
| Brouns, S.J.J. et al. (Aug. 15, 2008). Supplemental Material for “Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes,” Science 321:960-964. |
| Brouns, S.J.J. et al. (Aug. 15, 2008).“Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes,” Science 321:960-964. |
| Bryksin, A. V. et al. (Oct. 8, 2010). “Rational Design of a Plasmid Origin That Replicates Efficiently in Both Gram-Positive and Gram-Negative Bacteria,” PloS One 5(10):e13244, 9 pages. |
| Bugrysheva, J.V. et al. (Jul. 2011, E-Pub. Apr. 29, 2011). “The Histone-Like Protein Hlp Is Essential for Growth of Streptococcus pyogenes: Comparison of Genetic Approaches to Study Essential Genes,” Appl. Environ. Microbiol. 77(13):4422-4428. |
| Chan, B.K. et al. (2013). “Phage Cocktails and the Future of Phage Therapy,” Future Microbiol. 8(6):769-783. |
| Chan, C.T.Y. et al. (Dec. 2015). “‘Deadman’ and ‘Passcode’ Microbial Kill Switches for Bacterial Containment,” Nat. Chem. Biol. 12(2):82-86. |
| Chasteen, L. et al. (2006, e-pub. Nov. 6, 2006). “Eliminating Helper Phage From Phage Display,” Nucleic Acids Research 34(21):e145, 11 pages. |
| Cheadle, E.J. et al. (2012). “Chimeric Antigen Receptors for T-Cell Based Therapy,” Methods Mol. Biol. 907:645-666, 36 pages. |
| Christie, G.E. (1990). “Interactions Between Satellite Bacteriophage P4 and Its Helpers,” Annu. Rev. Genet. 24:465-490. |
| Christie, G.E. (2012, e-pub. Nov. 3, 2012). “Pirates of the Caudovirales,” Virology 434:210-221. |
| Citorik, R.J. et al. (Nov. 2014, e-pub Sep. 21, 2014). “Sequence-Specific Antimicrobials Using Efficiently Delivered RNA-Guided Nucleases,” Nat. Biotechnol. 32(11):1141-1145, 18 pages. |
| Cochrane, K. et al. (2016, e-pub. Nov. 3, 2015). “Complete Genome Sequences and Analysis of the Fusobacterium nucleatum Subspecies animalis 7-1 Bacteripophage Φfunu1 and Φfunu2,” Anaerobe 38:125-129. Abstract Only. |
| Coyne, M.J. et al. (2014). “Evidence of Extensive DNA Transfer between Bacteroidales Species Within the Human Gut,” mBio 5(3):e01305-14, 12 pages. |
| De Filippo, C. et al. (Aug. 33, 2010). “Impact of Diet in Shaping Gut Microbiota Revealed by a Comparative Study in Children From Europe and Rural Africa,” Proc. Natl. Acad. Sci. USA 107(33):14691-14696, 6 pages. |
| De Paepe, M. et al. (Mar. 28, 2014). “Bacteriophages: An Underestimated Role in Human and Animal Health?” Frontiers in Cellular and Infection Microbiology 4(39):1-11. |
| Deeks, E.D. (2014, e-pub. Jul. 15, 2014). “Nivolumab: A Review of Its Use in Patients With Malignant Melanoma,” Drugs 74:1233-1239. |
| Deghorain, M. et al. (Nov. 23, 2012). “The Staphylococci Phages Family: An Overview,” Viruses 4:3316-3335. |
| Dickson, R.P. et al. (Jan./Feb. 2017). “Bacterial Topography of the Healthy Human Lower Respiratory Tract,” American Society for Microbiology 8(1):e02287-6, 12 pages. |
| Diez-Villasenor, C. et al. (May 2013). “CRISPR-Spacer Integration Reporter Plasmids Reveal Distinct Genuine Acquisition Specificities Among CROSPR-Cas 1-E Variants of Escherichia coli,” RNA Biology 10(5):792-802. |
| Dutilh, B.E. et al. (Jul. 24, 2014). “A Highly Abundant Bacteriophage Discovered in the Unknown Sequences of Human Faecal Metagenomes,” Nature Communications 5(4498):1-10. |
| Edgar et al. (Dec. 2010). “The Escherichia coli CRISPR System Protects From λ Lysogenization, Lysogens, and Prophage Induction,” Journal of Bacteriology 192(23):6291-6294. |
| Ex Parte Re-Exam, mailed Dec. 10, 2018, for U.S. Appl. No. 90/014,184, filed Aug. 10, 2018, for U.S. Pat. No. Re. 9,701,964 102 pages. |
| Extended European Search Report, dated Mar. 6, 2020, for European Patent Application No. 190202999.99, 10 pages. |
| Final Office Action, dated May 29, 2020, for U.S. Appl. No. 16/201,736, filed Nov. 27, 2018, 10 pages. |
| Foca, A. et al. (2015, e-pub. Apr. 7, 2015). Gut Inflammation and Immunity: What Is the Role of the Human Gut Virome? Mediators of Inflammation 2015(326032):1-7. |
| Galperin, M.Y. (Dec. 2013). “Genome Diversity of Spore-Forming Firmicutes,” Microbiology Spectrum 1(2):TBS-0015-2012, 27 pages. |
| Garon, E.B. et al. (Oct. 2015). “Current Perspectives in Immunotherapy for Non-Small Cell Lung Cancer,” Seminars in Oncology 42(5 Supp. 2):S11-S18. |
| Garrett W.S. et al. (Oct. 5, 2007). “Communicable Ulcerative Colitis Induced by T-Bet Deficiency in the Innate Immune System,” Cell 131(1):33-45, 23 pages. |
| Golubovskaya, V. et al. (Mar. 15, 2016). “Different Subsets of T Cells, Memory, Effector Functions, and CAR-T Immunotherapy,” Cancers 8(36), 12 pages. |
| Gomaa et al. (Jan. 28, 2014). “Programmable Removal of Bacterial Strains by Use of Genome-Targeting CRISPR-Cas Systems,” mBio, 5(1):e000928-13. |
| Gomaa, A.A. et al. (Jan./Feb. 2014). Supplemental Material to “Programmable Removal of Bacterial Strains by Use of GenomeTargeting CRISPR-Cas Systems,” American Society for Microbiology 5(1):1-9. |
| Gudbergsdottir, S. et al. (2011, e-pub. Nov. 18, 2010). “Dynamic Properties of the Sulfolobus CRISPR/Cas and CRISPR/Cmr Systems When Challenged With Vector-Borne Viral and Plasmid Genes and Protospacers,” Molecular Microbiology 79(1):35-49. |
| Guedan, S. et al. (Aug. 14, 2014). “ICOS-Based Chimeric Antigen Receptors Program Bipolar TH17/TH1 Cells,” Blood 124(7):1070-1080. |
| Hargreaves, K.R. et al. (Aug. 26, 2014). “Abundant and Diverse Clustered Regularly Interspaced Short Palindromic Repeat Spacers in Clostridium difficile Strains and Prophages Target Multiple Phage Types within This Pathogen,” mBio 5(5):e01045-13. |
| Harrington, L.E. (Nov. 2005, e-pub. Oct. 2, 2005). “Interleukin 17-producing CD4+ Effector T Cells Develop via a Lineage Distinct From the T Helper Type 1 and 2 Lineages,” Nat. Immunol. 6(11):1123-1132. |
| Hooper, L.V. et al. (Jun. 8, 2012). “Interactions Between the Microbiota and the Immune System,” Science 336(6086):1268-1273, 16 pages. |
| Horvath, P. et al. (2008, e-pub. Dec. 7, 2007). “Diversity, Activity, and Evolution of CRISPR Loci in Streptococcus thermophiles,” Journal of Bacteriology 190(4):1401-1412. |
| Huddleston, J.R. (Jun. 20, 2014). “Horizontal Gene Transfer in the Human Gastrointestinal Tract: Potential Spread of Antibiotic Resistance Genes,” Infection and Drug Resistance 7:167-176. |
| International Search Report and the Written Opinion of the International Searching Authority for PCT/EP2018/066954, dated Oct. 23, 2018, filed Jun. 25, 2018, 14 pages. |
| International Search Report for PCT/EP2016/059803, dated Jun. 30, 2016, filed May 3, 2016, 6 pages. |
| International Search Report for PCT/EP2018/082053, dated Mar. 14, 2019, filed Nov. 21, 2018, 9 pages. |
| International Search Report for PCT/EP2019/077760, dated Mar. 6, 2020, filed Oct. 14, 2019, 15 pages. |
| Ivanov, I.I. et al. (May 2010). “Segmented Filamentous Bacteria Take the Stage,” Muscosal Immunol. 3(3):209-212, 7 pages. |
| Jiang, W. et al. (Nov. 2013). “Demonstration of CRISPR/Cas9/sgRNA-Mediated Targeted Gene Modification in Arabidopsis, Tobacco, Sorghum and Rice,” Nucleic Acids Research 41(20):e188, 12 pages. |
| Jin, Y. et al. (2019, e-pub. Apr. 23, 2019). “The Diversity of Gut Microbiome is Associated With Favorable Responses to Anti-Programmed Death 1 Immunotherapy in Chinese Patients With NSCLC,” Journal of Thoracic Oncology 14(8):1378-1389. |
| Jinek et al. (Aug. 17, 2012). “A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity,” Science 337(6096):816-821. |
| Kanhere, A. et al. (2005). Structural Properties of Promoters: Similarities and Differences Between Prokaryotes and Eukaryotes Nucleic Acids Research 33(10):3165-3175. |
| Khoja, L. et al. (2015). “Pembrolizumab,” Journal for ImmunoTherapy of Cancer 3(36):1-13. |
| Kim, J.-S. (2016). “CRISPR/Cas9-Mediated Re-Sensitization of Antibiotic-Resistant Escherichia coli Harboring Extended-Spectrum β-Lactamases,” Microbiol. Biotechnol. 26(2):394-401. |
| Kochenderfer, J.N. et al. (Sep. 2009). “Construction and Pre-clinical Evaluation of an Anti-CD19 Chimeric Antigen Receptor,” J. Immunother. 32(7):689-702, 26 pages. |
| Kosiewicz, M.M. et al. (2014, e-pub. Mar. 26, 2014). “Relationship Between Gut Microbiota and Development of T Cell Associated Disease,” FEBS Lett. 588:4195-4206. |
| Krom, R.J. et al. (Jul. 5, 2015). “Engineered Phagemids for Nonlytic, Targeted Antibacterial Therapies,” Nano Letters 15(7):4808-4813. |
| Lim, H.N. et al. (Jun. 28, 2011, e-pub. Jun. 13, 2011). “Fundamental Relationship Between Operon Organization and Gene Expression,” PNAS 108(26):10626-10631. |
| Lopez-Sanchez, M.-J. et al. (2012, e-pub. Jul. 27, 2012). “The Highly Dynamic CRISPR1 System of Streptococcus agalactiae Controls the Diversity of its Mobilome,” Molecular Microbiology 85(6):1057-1071. |
| Ludwig, E.S. et al. (1985). “The Phylogenetic Position of Streptococcus and Enterococcus,” Journal of General Microbiology 131:543-551. |
| Luo, M.L. et al. (2015, e-pub. Oct. 17, 2014). “Repurposing Endogenous Type I CRISPR-Cas Systems for Programmable Gene Repression,” Nucleic Acids Research 43(1):674-681. |
| López, P. et al. (Apr. 5, 2016). “Th17 Responses and Natural IgM Antibodies Are Related to Gut Microbiota Composition in Systemic Lupus Erythematosus Patients,” Sci. Rep. 6:24072, 12 pages. |
| Magee, M.S. et al. (Nov. 2014). “Challenges to Chimeric Antigen Receptor (CAR)-T Cell Therapy for Cancer,” Discov. Med. 18(100):265-271, 6 pages. |
| Mahoney, K.M. et al. (2015). “The Next Immune-Checkpoint Inhibitors: PD-1/PD-L1 Blockade in Melanoma,” Clinical Therapeutics 37(4):764-782. |
| Maikova, A. et al. (Jul. 31, 2018), “New Insights Into Functions and Possible Applications of Clostridium difficile CRISPR-Cas System,” Frontiers in Microbiology 9(1740):1-8. |
| Majsec, K. et al. (2016). “Cas3 Is a Limiting Factor for CRISPR-Cas Immunity in Escherichia coli Cells Lacking H-NS,” BMC Microbiology 16:28, 9 pages. |
| Makarova, J.S. et al. (Nov. 2015, e-pub. Sep. 28, 2015). “An Updated Evolutionary Classification of CRISPR-Cas Systems,” Nature Rev. Microbiol. 13:722-736. |
| Makarova, K.S. et al. (2015). “Annotation and Classification of CRISPR-Cas Systems,” Methods Mol. Biol. 1311:47-75, 27 pages. |
| Makarova, K.S. et al. (Feb. 27, 2017). “Snapshot: Class 1 CRISPR-Cas Systems,” Cell 168(5):946, 2 pages. |
| Mancha-Agresti, P. et al. (Mar. 2017). “A New Broad Range Plasmid for DNA Delivery in Eukaryotic Cells Using Lactic Acid Bacteria: In Vitro and In Vivo Assays,” Molecular Therapy: Methods & Clinical Development 4:83-91. |
| Manica, A. et al. (2011, e-pub. Mar. 8, 2011). “In vivo Activity of CRISPR-Mediated Virus Defence in a Hyperthermophilic Archaeon,” Molecular Microbiology 80(2):481-491. |
| Marraffini, L.A. et al. (Dec. 19, 2008). “CRISPR Interference Limits Horizontal Gene Transfer in Staphylococci by Targeting DNA,” Science 322(5909):1843-1845, 12 pages. |
| Mayo Clinic (2019). “Pulmonary Embolism,” retrieved from https://www.nnayoclinic.org/diseases-conditions/pulnnonary-ennbolisnn/synnptonns-causes/syc-20354647, last visited Aug. 5, 2019, 8 pages. |
| Mayo Clinic (2020). “Infectious Diseases,” retrieved from https://www.nnayoclinic.org/diseases-conditions/infectious-diseases/diagnosis-treatnnent/drc-20351179, last visited Jan. 17, 2020, 5 pages. |
| Mayo Clinic (2020). “Malaria,” retrieved from https://www.nnayoclinic.org/diseases-conditions/nnalaria/diagnosis-treatnnent/drc-20351190, last visited Jan. 17, 2020, 3 pages. |
| Mayo Clinic (2020). “Sexually Transmitted Diseases (STDs),” retrieved from https://www.nnayoclinic.org/diseases-conditions/sexually-transnnitted-diseases-stds/diagnosis-treatnnent/drc-20351246, last visited Jan. 17, 2020, 5 pages. |
| Medina-Aparicio, L. et al. (May 2011, e-pub. Mar. 11, 2011). “The CRI SPR/Cas Immune System Is an Operon Regulated by LeuO, H-NS, and Leucine-Responsive Regulatory Protein in Salmonella enterica Serovar typhi,” Journal of Bacteriology 193(10):2396-2407. |
| Mercenier, A. (1990). “Molecular Genetics of Streptococcus thermophiles,” FEMS Microbiology Letters 87(1-2):61-77. |
| Mick, E. et al. (May 2013). “Holding a Grudge: Persisting Anti-Phage CRISPR Immunity in Multiple Human Gut Microbiomes,” RNA Biology 10(5):900-906. |
| Mills, S. et al. (Jan./Feb. 2013). “Movers and Shakers: Influence of Bacteriophages in Shaping the Mammalian Gut Microbiota,” Gut Microbes 4(1):4-16. |
| Moon, B.Y. et al. (Mar. 8, 2016). “Mobilization of Genomic Islands of Staphylococcus aureus by Temperate Bacteriophage,” PLOS One 11(3):e0151409, 16 pages. |
| Mutalik, V.K. et al. (Apr. 2013, e-pub. Mar. 10, 2013) “Precise and Reliable Gene Expression via Standard Transcription and Translation Initiation Elements,” Nat. Methods 10(4):354-360. |
| Nakamura, S. et al. (Nov. 2008). “Metagenomic Diagnosis of Bacterial Infections,” Emerging Infectious Diseases 14(11):1784-1786. |
| Nale, J.Y. et al. (2012). “Diverse Temperate Bacteriophage Carriage in Clostridium Difficile 027 Strains,” PloS One 7(5):e37263, 9 pages. |
| Navarre, L. et al. (2007). “Silencing of Xenogeneic DNA by H-NS-Facilitation of Lateral Gene Transfer in Bacteria by a Defense System That Recognizes Foreign DNA,” Genes & Development 21:1456-1471. |
| Nelson, M.H. et al. (2015). “Harnessing the Microbiome to Enhance Cancer Immunotherapy,” Journal of Immunology Research 2015:Article 368736, 12 pages. |
| Non-Final Office Action, dated Nov. 25, 2019, for U.S. Appl. No. 16/201,736, filed Nov. 27, 2018, 8 pages. |
| Non-Final Office Action, dated Nov. 30, 2020, for U.S. Appl. No. 16/201,736, filed Nov. 27, 2018, 35 pages. |
| Norris, J.S. et al. (2000). “Prokaryotic Gene Therapy to Combat Multidrug Resistant Bacterial Infection,” Gene Therapy 7:723-725. |
| Novick, R. (May 18, 2018). “Reincarnation of a Staphylococcal Pathogenicity Island as an antibacterial Drone,” 5th World Congress on Targeting Infectious Diseases: Targeting Phage & Antibiotic Resistance: Phage Therapy and Other Innovative Ideas. |
| Nowak, P. et al. (Nov. 28, 2015). “Gut Microbiota Diversity Predicts Immune Status in HIV-1 Infection,” AIDS 29(18):2409-2418. |
| O'Hara, B.J. et al. (Jun. 8, 2017). “A Highly Specific Phage Defense System Is a Conserved Feature of the Vibrio cholera Mobilome,” PLOS Genetics 13(6):e1006838, 17 pages. |
| Park, A. (Oct. 18, 2011). “A Surprising Link Between Bacteria and Colon Cancer,” Cancer retrieved from http://healthlande.time.com/2011/10/18/a-surprising-link-between-bacteria-and-colon-cancer/, last visited Aug. 27, 2019, 3 pages. |
| Park, H. et al. (2005). “A Distinct Lineage Of CD4 T Cells Regulates Tissue Inflammation by Producing Interleukin 17,” Nat. Immunol. 6(11):1133-1141, 24 pages. |
| Patterson, A.G. et al. (2017, e-pub. Mar. 27, 2017). “Regulation of CRISPR-Cas Adaptive Immune Systems,” Current Opinion in Microbiology 37:1-7. |
| Pawluk, A. et al. (Apr. 15, 2014). “A New Group of Phage Anti-CRISPR Genes Inhibits the Type I-E CRISPR-Cas System of Pseudomonas aeruginosa,” mBio. 5(2):e00896. |
| PCT Application No. PCT/EP2018/0071454. |
| Penades, J.R. et al. (Nov. 2015). “The Phage-Inducible Chromosomal Islands: A Family of Highly Evolved Molecular Parasites,” Annual Review of Virology 2:181-201. |
| Pires, D.P. et al. (Sep. 2016, e-pub. Jun. 1, 2016). “Genetically Engineered Phages: A Review of Advances Over the Last Decade,” Microbiology and Molecular Biology Reviews 80(3):523-543. |
| Pul, Ü. et al. (2010, e-pub. Feb. 17, 2010). “Identification and Characterization of E. coli CRISPR-cas Promoters and Their Silencing by H-NS,” Molecular Microbiology 75(6):1495-1512. |
| Ram, G. et al. (Oct. 2, 2012). “Staphylococcal Pathogenicity Island Interference With Helper Phage Reproduction Is a Paradigm of Molecular Parasitism,” Proc. Natl. Acad. Sci. USA 109(40):16300-16305. |
| Ramalingam, S.S. et al. (2014). “LB2-Metastatic Non-Small Cell Lung Cancer: Phase II Study of Nivolumab (Anti-PD-1, BMS-936558, ONO-4538) in Patients With Advanced, Refractory Squamous Non-Small Cell Lung Cancer,” International Journal of Radiation Oncology Biology Physics Late Breaking Abstract (LB2). |
| Ran, F.A.et al. (Apr. 9, 2015). “In Vivo Genome Editing Using Staphylococcus aureus Cas9,” Nature 570(7546):186-191, 28 pages. |
| Rashid, T. et al. (2013). “The Role of Klebsiella in Crohn's Disease With a Potential for the Use of Antimicrobial Measures,” International Journal of Rheumatology 2013(Article ID 610393):1-9. |
| Request for Ex Parte Reexamination mailed Aug. 10, 2018, for U.S. Appl. No. 15/160,405, now U.S. Pat. No. 9,701,964, 42 pages. |
| Request for Ex Parte Reexamination mailed Nov. 1, 2018, for U.S. Appl. No. 15/160,405, now U.S. Pat. 9,701,964, 35 pages. |
| RFP Reporter, https://parts.igem.org/Part:BBa_J61022 lasted visited Nov. 29, 2018, 1 page. |
| Richter, C. et al. (2012, e-pub. Oct. 19, 2012). “Function and Regulation of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR Associated (Cas) Systems,” Viruses 4(12):2291-2311. |
| Ridaura, V.K. et al. (Sep. 6, 2013). “Cultured Gut Microbiota From Twins Discordant for Obesity Modulate Adiposity and Metabolic Phenotypes in Mice,” Science 341(6150):1241214, 22 pages. |
| Roberts, A.P. et al. (Jun. 2009, e-pub. May 20, 2009). “A Modular Master on the Move: The Tn916 Family of Mobile Genetic Elements,” Trends Microbiol. 17(6):251-258. Abstract Only. |
| Ryan, O.W. et al. (2014). “Multiplex Engineering of Industrial Yeast Genomes Using CRISPRm,” Methods in Enzymology 546:473-489. |
| Samar{hacek over (z)}ija, D. et al. (2001). “Taxonomy, Physiology and Growth of Lactococcus Lactis: A Review,” Mljekarstvo 51(1):35-48. |
| Sapranauskas, R. et al. (Nov. 1, 2011, e-pub. Aug. 3, 2011). “The Streptococcus thermophilus CRISPR/Cas System Provides Immunity in Escherichia coli,” Nucleic Acids Research 39(21):9275-9282. |
| Seed, K.D. et al. (Feb. 27, 2013). “A Bacteriophage Encodes Its Own CRISPR/Cas Adaptive Response to Evade Host Innate Immunity,” Nature 494(7438):489-491. |
| Selle, K. et al. (Apr. 1, 2015). “Harnessing CRISPR-Cas Systems for Bacterial Genome Editing,” Trends in Microbiology 23(4):225-232. |
| Sepsis Alliance. (Dec. 14, 2017). “What Are Vaccines,” Retrieved from https://www.sepsis.org/sepsisand/prevention-vaccinations/; last visited Jul. 8, 2019, 3 pages. |
| Sepsis Alliance. (Jul. 8, 2019). “Prevention,” Retrieved from https://www.sepsis.org/sepsisand/prevention/; accessed last visited Jul. 8, 2019, 5 pages. |
| Shoemaker, N.B. et al. (Feb. 2001). “Evidence for Extensive Resistance Gene Transfer Among Bacteroides spp. and Among Bacteroides and Other Genera in the Human Colon,” Appl. Environ. Microbiol. 67(2):561-68. |
| Sivan, A. et al. (Nov. 27, 2015, e-pub Nov. 5, 2015). “Commensal Bifidobacterium Promotes Antitumor Immunity and Facilitates Anti-PD-L1 Efficacy,” Science 350(6264):1084-1089, 13 pages. |
| Somkuti, G. A. et al. (Apr. 1988). “Genetic Transformation of Streptococcus thermophilus by Electroporation,” Biochimie 70(4):579-585. Abstract Only. |
| Sorg, R. A. et al. (2014). “Gene Expression Platform for Synthetic Biology in the Human Pathogen Streptococcus pneumoniae,” ACS Synthetic Biology 4(3):228-239. Abstract Only. |
| Soutourina, O.A. et al. (May 9, 2013). “Genome-Wide Identification of Regulatory RNAs in the Human Pathogen Clostridium difficile,” PLos Genet. 9(5):e1003493, 20 pages. |
| Stern, A. et al. (2012). “CRISPR Targeting Reveals a Reservoir of Common Phages Associated With the Human Gut Microbiome,” Genome Research 22(10):1985-1994. |
| Stern, A. et al. (Aug. 2010), Self-Targeting by CRISPR: Gene Regulation or Autoimmunity? Trends Genet. 26(8):335-340, 10 pages. |
| Stiefel, U. et al. (Aug. 2014, e-pub. May 27, 2014). “Gastrointestinal Colonization With a Cephalosporinase-Producing Bacteroides Species Preserves Colonization Resistance Against Vancomycin-Resistant Enterococcus and Clostridium Difficile in Cephalosporin-Treated Mice,” Antimicrob. Agents Chemother. 58(8):4535-4542. |
| Stoebel, D.M. et al. (2008). “Anti-Silencing: Overcoming H-NS-Mediated Repression of Transcription in Gramnegative Enteric Bacteria,” Microbiology 154:2533-2545. |
| Suvorov, A. (1988). “Transformation of Group A Streptococci by Electroporation,” FEMS Microbiology Letters 56(1):95-100. |
| Takaishi, H. et al. (2008). “Imbalance in Intestinal Microflora Constitution Could Be Involved in the Pathogenesis of Inflammatory Bowel Disease,” Int. J. Med. Microbiol.298:463-472. |
| Tan, J. (Dec. 17, 2015). “Immunotherapy Meets Microbiota,” Cell 163:1561. |
| Topalian, S.L. et al. (Jun. 28, 2012). “Safety, Activity, and Immune Correlates of Anti-PD-1 Antibody in Cancer,” N. Engl. J. Med. 366(26):2443-2454, 19 pages. |
| Tormo et al. (Apr. 2008). “Staphylococcus aureus Pathogenicity Island DNA Is Packaged in Particles Composed of Phage Proteins,” Journal of Bacteriology 190(7):2434-2440. |
| Turnbaugh, P.J. et al. (Dec. 2006). “An Obesity-Associated Gut Microbiome With Increased Capacity for Energy Harvest,” Nature 444:1027-1131. |
| U.S. Appl. No. 62/168,355, filed May 29, 2015, Barrangou, R. et al. |
| U.S. Appl. No. 62/296,853, filed Feb. 18, 2016, Barrangou, R. et al. |
| Uchiyama, J. et al. (2013, e-pub. Mar. 8, 2013). “Characterization of Helicobacter pylori Bacteriophage KHP30,” Applied and Environmental Microbiology 79(10):3176-3184. |
| Veeranagouda, Y. et al. (Jun. 4, 2014). “Identification of Genes Required for the Survival of B. fragilis Using Massive Parallel Sequencing of a Saturated Transposon Mutant Library,” BMC Genomics 15:429, 11 pages. |
| Vercoe, R.B. et al. (Apr. 18, 2013). “Cytotoxic Chromosomal Targeting by CRISPR/Cas Systems Can Reshape Bacterial Genomes and Expel or Remodel Pathogenicity Islands,” PLOS Genetics 9(4):e1003454, 13 pages. |
| Villarino, N.F. et al. (Feb. 23, 2016, e-pub. Feb. 8, 2016). “Composition of the Gut Microbiota Modulates the Severity of Malaria,” Proc. Natl. Acad. Sci. USA 113(8):2235-2240. |
| Vétizou, M. et al. (Nov. 27, 2015, e-pub Nov. 5, 2015). “Anticancer Immunotherapy by CTLA-4 Blockade Relies on the Gut Microbiota,” Science 350(6264):1079-1084, 13 pages. |
| Walters, W.A. et al. (Nov. 17, 2014). “Meta-Analyses of Human Gut Microbes Associated With Obesity and IBD,” FEBS Letters 588(22):4223-4233, 34 pages. |
| Wegmann, U. et al. (2007). “Complete Genome Sequence of the Prototype Lactic Acid Bacterium Lactococcus lactis Subsp. cremoris MG1363,” Journal of Bacteriology, 189(8):3256-3270. |
| Wei, Y. et al. (2015, e-pub. Jan. 14, 2015). “Sequences Spanning the Leader-Repeat Junction Mediate CRISPR Adaptation to Phage in Streptococcus thermophiles,” Nucleic Acids Research 43(3):1749-1758. |
| Westra, E.R. et al. (Sep. 1, 2010, e-pub. Aug. 18, 2010). “H-NS-Mediated Repression of CRISPR-Based Immunity in Escherichia coli K12 Can Be Relieved by the Transcription Activator LeuO,” Molecular Microbiology 77(6):1380-1393. |
| Westwater, C. et al. (Apr. 2003). “Use of Genetically Engineered Phage to Deliver Antimicrobial Agents to Bacteria: An Alternative Therapy for Treatment of Bacterial Infections,” Antimicrobial Agents and Chemotherapy 47(4):1301-1307. |
| Wexler, H.M. (Oct. 2007). “Bacteroides: the Good, the Bad, and the Nitty-Gritty,” Clinical Microbiology Reviews 20(4):593-621. |
| Written Opinion for PCT Application No. PCT/EP2016/059803, dated Jun. 30, 2016, filed May 3, 2016, 6 pages. |
| Written Opinion for PCT/EP2018/082053, dated Mar. 14, 2019, filed Nov. 21, 2018, 6 pages. |
| Xie, Z. et al. (2013, e-pub. Aug. 9, 2013). “Development of a Tunable Wide-Range Gene Induction System Useful for the Study of Streptococcal Toxin-Antitoxin Systems,” Applied and Environmental Microbiology 79(20):6375-6384. |
| Yang, C.-D. et al. (2014, e-pub. May 2, 2014). “CRP Represses the CRISPR/Cas System in Escherichia coli: Evidence That Endogenous CRISPR Spacers Impede Phage P1 Replication,” Molecular Microbiology 92(5):1072-1091. |
| Yang, Y. et al. (Jun. 5, 2014, e-pub. Apr. 13, 2014). “Focused Specificity of Intestinal Th17 Cells Towards Commensal Bacterial Antigens,” Nature 510(7503):152-156, 29 pages. |
| Yosef, I. et al. (2011). “High-Temperature Protein G Is Essential for Activity of the Escherichia coli Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas System,” Proc. Natl. Acad. Sci. USA 108(50):20136-20141. |
| Zhang, X.Z. (2011). “Simple, Fast and High-Efficiency Transformation System for Directed Evolution of Cellulase in Bacillus Subtilis,” Microbial Biotechnology 4(1):98-105. |
| Ziermann, R. et al. (1990). “Characterization of the cos Sites of Bacteriophages P2 and P4,” Gene 96:9-15. |
| Zitvogel, L. et al. (Jan. 2015), “Cancer and the Gut Microbiota: An Unexpected Link,” Sci. Transl. Med. 7(271):271ps1, 10 pages. |
| Bertram, R. et al. (2008). “The Application of Tet Repressor in Prokaryotic Gene Regulation and Expression,” Microbial Biotechnology 1(1):1-6. |
| Chen, S. et al. (Feb. 2007, e-pub. Dec. 22, 2006). “Characterization of Strong Promoters From an Environmental Flavobacterium himemum Strain by Using a Green Fluorescent Protein-based Reporter System,” Applied and Environmental Microbiology 73(4):1089-1100. |
| Extended European Search Report, dated May 10, 2021, for European Patent Application No. 20217137.7, 5 pages. |
| Lutz, R. et al. (1997). “Independent and Tight Regulation of Transcriptional Units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 Regulatory elements,” Nucleic Acids Research 25(6):1203-1210. |
| Nakade, S. et al. (2017, e-pub. Jan. 31, 2017). “Cas9, Cpf1 and C2c1/2/3—What's Next?” Bioengineered 8(3):265-273. |
| Petris, G. et al. (May 22, 2017). “Hit and Go CAS9 Delivered Through a Lentiviral Based Self-Limiting Circuit,” Nature Communications 8:15334, 9 pages. |
| Yao, R. et al. (Sep. 2018). “CRISPR-Cas9/Cas 12a Biotechnology and Application in Bacteria,” Synthetic and Systems Biotechnology 3(3):135-149. |
| Zhang, J. et al. (2019, e-pub. Jul. 30, 2019). “Drug Inducible CRISPR/Cas Systems,” Computational and Structural Biotechnology Journal 17:1171-1177. |
| Leon, L.M. et al. (Apr. 2018). “How Bacteria Control the CRISPR-Cas Arsenal,” Current Opinion in Microbiology 42:87-95, 17 pages. |
| Non-Final Office Action, dated Aug. 20, 2021, for U.S. Appl. No. 17/195,157, filed Mar. 8, 2021, 17 pages. |
| Tao, P. et al. (Feb. 14, 2018). “Unexpected Evolutionary Benefit to Phages Imparted by Bacterial CRISPR-Cas9,” Sci. Adv. 4:eaar4134, 10 pages. |
| U.S. Appl. No. 17/105,392, Clube et al., filed Nov. 25, 2020. |
| Ungerer, J. et al. (Dec. 21, 2016). “Cpf1 Is a Versatile Tool for CRISPR Genome Editing Across Diverse Species of Cyanobacteria,” Scientific Reports 6:39681, 9 pages. |
| Wendt, K.E. et al. (2016). “CRISPR/Cas9 Mediated Targeted Mutagenesis of the Fast Growing Cyanobacterium Synechococcus elongates UTEX 2973,” Microbial Cell Factories 15:115, 8 pages. |
| Li, Q. et al. (2016, e-pub. May 23, 2016). “CRISPR-Based Genome Editing and Expression Control Systems in Clostridium acetobutylcum and Clostridium beijerinckii,” Biotechnology Journal 11:961-972. |
| Xu, T. et al. (Jul. 2015). “Efficient Genome Editing in Clostridium cellulolyticum via CRISPR-Cas9 Nickase,” Applied and Environmental Microbiology 81(13):4423-4431. |
| Number | Date | Country | |
|---|---|---|---|
| 20210163960 A1 | Jun 2021 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16201736 | Nov 2018 | US |
| Child | 17166941 | US |
