Patent Grant
7332176
1. Field of the Invention
This invention relates to biological methods and products useful for the control of Solenopsis invicta. More specifically, the present invention is directed to novel Solenopsis invicta viruses, nucleic acids encoding the novel viruses, biocontrol compositions, and methods of using the viruses and/or biocontrol compositions for control of fire ants.
2. Description of the Related Art
Red imported fire ant, Solenopsis invicta (Buren), was first detected in the United States near Mobile, Ala. in the late 1920s (Loding, USDA Insect Pest Surv. Bull., Volume 9, 241, 1929). Since that time, it has spread to encompass more than 128 million hectares, primarily in the southeastern United States (Williams et al., Am. Entomol., Volume 47, 146-159, 2001). Fire ants are known to destroy young citrus trees, growing crops, and germinating seeds. This has an economic impact on agriculture in infested areas. Telephone companies spend substantial amounts of money each year treating their electrical equipment to prevent fire ant invasion because fire ants accumulate at electrical contacts and can short out electrical equipment. Even, farm equipment can be damaged by large fire any mounds. Fire ants also present a danger to wildlife, such as ground nesting birds and animals. Furthermore, fire ants are known to excavate the soil from under roadways causing damage.
Fire ants also pose health care problems to millions of people stung each year-a significant number of which require medical care. Fire ant stings are also blamed for human deaths. Consequently, there is much interest in controlling these troublesome pests.
This interest has resulted in much research and resources being expended through the years to develop reagents and methods for controlling fire ants. While many useful insecticide formulations have resulted from this research, the problems associated with fire ants still exist because the relief gained by insecticide use is only temporary. Once the insecticide pressure is relaxed, fire ant populations invariably repopulate the areas. This reinfestation ability is attributed to the high reproductive capabilities, the efficient foraging behavior, and the ecological adaptability of the ants. While effective for controlling ants in relatively small defined areas, insecticides can create other problems. For example, some insecticides, which are effective at controlling fire ants, can pose a significant threat to the environment, including birds and animals.
Although considerable research effort has been brought to bear against the red imported fire ant, it remains the primary pest ant species in infested areas; initial eradication trials failed, yielding to the wide distribution of pesticide-based control products and a federally imposed quarantine to prevent further spread. Recently, much of the research effort has focused on elucidating basic life processes in an attempt to develop unique control measures, and fostering the development of self-sustaining methods of control, including biocontrol organisms and microbes (Williams et al., Am. Entomol., Volume 49, 150-163, 2003).
A dearth of natural enemies of the red imported fire ant have been found including a neogregarine (Pereira et al., J. Invertebr. Pathology, Volume 81, 45-48, 2002) and a fungus (Pereira et al., J. Invertebr. Pathology, Volume 84, 38-44, 2004).
U.S. Pat. No. 6,660,290 discloses a non-sporulating mycelial stage of an insect-specific parasitic fungi for control of pests with fire ants listed as one of many examples of insects controlled by the biopesticide.
U.S. Pat. Nos. 4,925,663; 5,683,689; 6,254,864; and 6,403,085 disclose a biopesticide effective against fire ants that includes the fungus Beauveria bassiana.
There remains a need for biocontrol and/or microbial control agents that eliminate or at least reduce the spread of fire ant colonies using novel pathogens. The present invention described below is directed to novel Solenopsis invicta viruses useful for the control of fire ants which are different from prior art pathogens and their uses.
It is therefore an object of the present invention to provide novel Solenopsis invicta virus (SINV) for biocontrol of Solenopsis invicta.
A further object of the present invention is to provide a nucleic acid sequence of SINV-1 for production of primers and biocontrol compositions.
A still further object of the present invention is to provide nucleic acid sequence SEQ ID NO 1.
Another object of the present invention is to provide nucleic acid sequence ID NO 21.
Another object of the present invention is to provide a biocontrol method for controlling fire ants that includes applying SINVs to a carrier that is a fire ant food source to form a biocontrol composition which is scattered near a fire ant colony.
Further objects and advantages of the present invention will become apparent from the following description.
Although viruses can be important biological control agents against insect populations (Lacey et al., Biol. Comtemp., Volume 21, 230-248, 2001), none have been shown to infect Solenopsis invicta. The only report present in the literature was the observation of “virus-like particles” in a Solenopsis species from Brazil (Avery et al., Brazil. Fla. Entomol., Volume 60, 17-20, 1977). Solenopsis invicta viruses (SINV) represent the first infection of the red imported fire ant by this group of organisms. In the laboratory, SINV causes brood death of an entire colony and infection of healthy colonies (Valles et al., Virology, Volume 328, 151-157, 2004; Valles et al., J. Invert. Path., Volume 88, 232-237, 2005; both references herein incorporated in their entirety).
SINV particles are isometric with a diameter of about 31 nm. They have a monopartite, bicistronic, single-stranded RNA genome. To date, several SINV viruses have been isolated. SINV-1 is composed of about 8026 nucleotides. The genome size was confirmed by Northern analysis in which a band was observed at about 8.4 kb. ORFs 1 and 2 were found to be homologous to nonstructural and structural proteins, respectively, of well-characterized picorna-like viruses (Ghosh et al, J. Gen. Virol., Volume 80, 1541-1549, 1999; Govan et al., Virology, Volume 277, 457-463, 2000; Leat et al., J. Gen. Virol., Volume 81, 2111-2119, 2000).
SINV-1 ORF-1 amino acid sequence was aligned with acute bee paralysis virus (ABPV), sacbrood virus (SBV), black queen cell virus (BQCV), cow pea mosaic virus (CPMV), and hepatitis A virus (HAV) using the Vecto NTI alignment sotware with ClustalW algorithm (InforMax, Inc., Bethesda, Md.) (
During elucidation of the genome of SINV-1, a nucleotide sequence, similar to but distinct from SINV-1, was discovered. The sequence, SINV-1A, is homologous to SINV-1 ORF 2, i.e., structural proteins, of picorna-like insect viruses with highly significant identity to SINV-1. This suggests that SNV-1A is a distinct, closely related species or a genotype of SINV-1 (
SINV-1A is sufficiently similar to SINV-1 to occasionally result in amplification even in cases where oligonucleotide mismatches were present. SINV-1A is a compilation of contiguous fragments that do not match the SINV-1 sequence perfectly.
The nucleotide sequence of the 3′-end (structural proteins) of SINV-1 and SINV-1A exhibit about 89.9% nucleotide identity and about 97% amino acid identity of the translated 3′ proximal ORF.
SINV-1 and SINV-1A infect S. invicta in the same geographic locations (sympatry). S. invicta has 2 distinct social forms, monogyne and polygyne, and these differences were shown recently to have a genetic basis (Krieger and Ross, Science, Volume 295, 328-332, 2002). Monogyne S. invicta is characterized as having a single fertile queen and polygyne S. invicta has multiple fertile queens. Both viruses infect both social forms. Dual infections with SINV-1 and SINV-1A were found in both monogyne and polygyne nests. Social form-specific pathogen infectivity has been reported previously in S. invicta. Oi et al. (Environ. Entomol., Volume 33, 340-345, 2004) showed that infection of North American S. invicta with the microsporidian Thelohania solenopsis, was restricted to the polygyne social form.
Other SINV viruses have been discovered in fire ant colonies in California, Louisiana, South Carolina, Texas, and Florida. SEQ ID NOs 40-46 (
SINV-1 and SINV-1A were found to infect all fire ant castes. The viruses are transmissible by simply feeding uninfected ants a homogenate prepared from SINV-1- and/or SINV-1A-infected individuals. The viruses were present in field populations of S. invicta from several locations in Florida. Nests from some areas were devoid of infection, but in some locations infection rates were as high as about 88%.
The present invention provides nucleic acids encoding for SINV-1 as set forth in SEQ ID NO 1 (GenBank Accession NO. AY634314; herein incorporated by reference) and
The present invention also provides a nucleic acid encoding ORF2 gene for SINV-1A as set forth in SEQ ID NO 21. The invention also provides nucleic acid sequences 2, 3, and 22-39 which are capable of selectively hybridizing DNA, RNA, and cDNA sequences which can be derived from SEQ ID NO 21.
The present invention further provides nucleic acid encoding 3′-proximal open reading frames for other SINV viruses infecting ants from other several different regions of the United States.
With the primers of the present invention, one of ordinary skill in the art could readily identify SINV viruses of the present invention.
For purposes of the present invention, the term “fire ant” and “Solenopsis invicta” are used interchangeably to describe the common red fire ant, originating in South America, but now commonly found in the United States, and Puerto Rico. The term fire ant also is used to describe black fire ants and other hybrid fire ants or other ants that are infected by the viruses of the present invention.
For purposes of the present invention, the term “isolated” is defined as separated from other viruses found in naturally occurring organisms.
For purposes of the present invention, the term “composition” is used to describe a composition which contains the virus of the presently claimed invention, optionally a carrier and optionally a pesticide. The carrier component can be a liquid or a solid material and is an inert, non-repellent carrier for delivering the composition to a desired site. Liquids suitable as carriers include water, and any liquid which will not affect the viability of the viruses of the present invention. Solid carriers can be anything which the fire ant will feed on. Non-limiting examples of solid carriers of the present invention include materials such as corn cob grits, extruded corn pellets, boiled egg yolks, and frozen insects such as crickets.
Optional toxicants include Chlorfenapyr, Imidacloprid, Fipronil, Hydramethylnon, Sulfluramid, Hexaflumuron, Pyriproxyfen, methoprene, lufenuron, dimilin, Chlorpyrifos, and their active derivatives, Neem, azadiractin, boric acid based, etc. The toxicant acts as a stressor which may be required to initiate viral replication which in turn results in brood death in the fire ant colony.
The term “effective amount” or “amount effective for” as used herein means that minimum amount of a virus composition needed to at least reduce, or substantially eradicate fire ants in a fire ant colony when compared to the same colony or other colony which is untreated. The precise amount needed will vary in accordance with the particular virus composition used; the colony to be treated; the environment in which the colony is located. The exact amount of virus composition needed can easily be determined by one having ordinary skill in the art given the teachings of the present specification. The examples herein show typical concentrations which will be needed to at least reduce the number of fire ants in a colony.
In the present method of using the viruses of the present invention, to reduce or eradicate a population of fire ants, the present compositions are delivered to the fire ants by spreading the composition at or near the fire ant colonies. The amount of composition used is an effective amount for producing the intended result, whether to reduce or eradicate the population of fire ants. The composition is prepared by homogenizing approximately 300 workers from an SINV infected colony in an equal volume of water and placing the resulting homogenate on a carrier.
The following examples are intended only to further illustrate the invention and are not intended to limit the scope of the invention as defined by the claims.
A one-step reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify SINV-1-infected S. invicta ants. A 20 ml scintillation vial was plunged into a fire ant mound in the field for several minutes to collect a sample of the worker caste. The ants were returned to the laboratory and RNA was extracted from about 20-50 workers using TRIZOL reagent according to the manufacturer's directions (Invitrogen, Carlsbad, Calif.). cDNA was synthesized and subsequently amplified using the One-Step RT-PCR kit (Invitrogen) with oligonucleotide primers p62-SEQ ID NO 25 and p63-SEQ ID NO 26 (Table 1). Samples were considered positive for the virus when a visible amplicon (about 327 nucleotides) was present after separation on about a 1.2% agarose gel stained with ethidium bromide. RT-PCR was conducted in a PTC 100 thermal cycler (MJ Research, Waltham, Mass.) under the following optimized temperature regime:
SINV-1 was purified for electron microscopy by the method described by Ghosh et al. (J. Gen. Virol., Volume 80, 1541-1549, 1999). Briefly, approximately 0.5 grams of a mixture of workers and brood were homogenized in about 5 ml of NT buffer (Tris-HCl, pH about 7.4, approximately 10 mM NaCl) using a Potter-Elvehjem Teflon pestle and glass mortar. The mixture was clarified by centrifugation at about 1000×g for about 10 minutes in an L8-70M ultracentrifuge (Beckman, Palo Alto, Calif.). The supernatant was extracted with an equal volume of 1,1,2-trichlortrifluoroethane before the aqueous phase was layered onto a discontinuous CsC1 gradient (about 1.2 and about 1.5 g/ml) which was centrifuged at about 270,000×g for about 1 hour in an SW60 rotor. Two whitish bands visible near the interface were removed by suction and desalted. The sample was negatively stained with about 2% phosphotungstic acid, about pH 7, and examined with a Hitachi H-600 transmission electron microscope (Hitachi, Pleasanton, Calif.) at an accelerating voltage of about 75 kV. Uninfected worker ants were prepared and examined in the same manner and served as controls.
A portion of the SINV-1 genome was identified from an expression library produced from a monogyne S. invicta colony collected in Gainesville, Fla. This contiguous 1780-nucleotide fragment exhibited significant identity with the acute bee paralysis virus and was comprised of clones 14D5, 3F6, and 24C10 (Table 2). From this fragment, a series of 5′RACE reactions were conducted to obtain the upstream sequence of the SINV-1 genome using the 5′RACE system (Invitrogen). cDNA was synthesized with a gene-specific oligonucleotide primer (GSP) from total RNA, the RNA template was degraded with RNase, and the cDNA purified. The 3′ end of the cDNA was polycytidylated with terminal deoxynucleotidyl transferase and dCTP. The tailed cDNA was then amplified with a second, upstream GSP and an abridged anchor primer.
Six 5′ RACE reactions were necessary to obtain the entire SINV-1 genome. Anticipating the potential need to remove the VPg often covalently attached to the 5′ end of insect picorna-like viruses (Christian and Scotti, In: The Insect Viruses, Plenum Publishing Corporation, New York, 301-336, 1998), 50 μg of total RNA prepared from SINV-1 infected ants was digested with about 600 μg/ml proteinase K for approximately 1 hour at about 37° C. The digested RNA was purified by acidic phenol/chloroform/isoamyl alcohol extraction. cDNA synthesis was conducted for about 50 minutes at about 45° C. with approximately 2.5 μg of total RNA using oligonucleotide primers p134-SEQ ID NO 5, p138-SEQ ID NO 7, p138-SEQ ID NO 9, p157-SEQ ID NO 13, p162-SEQ ID NO 14, and p274-SEQ ID NO 20 (See
A single 3′ RACE reaction was conducted with the GeneRacer kit (Invitrogen). cDNA was synthesized from about 1 μg total RNA purified from SINV-1-infected workers and brood using the GeneRacer Oligo dT primer p113-SEQ ID NO 4 and the GeneRacer 3′ primer. Amplicons were cloned and sequenced as described for the 5′ RACE.
Northern analysis was conducted to determine the genome size following the general procedure of Sambrook and Russell (Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001). Membranes were blotted with approximately 6 μg of total RNA from SINV-1-infected and -uninfected fire ant colonies. The approximately 327-nucleotide probe was synthesized using oligonucleotide primers p62-SEQ ID NO 2 and p63-SEQ ID NO 3 (Table 1) and a clone from the 3′ end of the genome as template (genomic region 6246 to 6572).
The genome of SINV-1 was constructed by compiling sequences from a series of six successive 5′ RACE reactions, one 3′ RACE reaction, and the sequences of three cDNA clones from a fire ant expression library (
Typical of Picornaviridae, the genome sequence was A/U rich (approximately 32.9% A, 28.2% U, 18.3% C, and 20.5% G). Analysis of the genome revealed two large open reading frames (ORFs) in the sense orientation (within frame) with an untranslated region (UTR) at each end and between the two ORFs. The 5′ proximal ORF (ORF1) commenced at the first start AUG codon present at nucleotide position 28 and ended at a UAA stop codon at nucleotide 4218, which encoded a predicted product of approximately 160,327 Da. The 3′ proximal ORF (ORF2), commenced at nucleotide position 4390 (AUG start codon), terminated at nucleotide position 7803 (UAA stop codon), and encoded a predicted product of approximately 127,683 Da. No large ORFs were found in the inverse orientation, suggesting that the SINV-1 genome was a positive-strand RNA virus. The 5′, 3′, and intergenic UTRs were comprised of about 27,223 and 171 nucleotides, respectively. BLAST analysis (Altschul et al., Nucleic Acids Research, Volume 25, 3389-3402, 1997) of ORFs 1 and 2 revealed identity to nonstructural and structural proteins, respectively, from picorna-like viruses. ORF1 of SINV-1 genome was found to exhibit the characterisitic helicase, protease, and RNA-dependent RNA polymerase (RdRp) sequence motifs ascribed to Picornaviridae (
Electron microscopic examination of negatively stained samples from SINV-1-infected fire ants revealed particles that were consistent with Picornaviridae (
Urochloa hoja blanca virus
A field survey was conducted to examine the extent of SINV-1 infection among S. invicta nests from locations around Florida. Nests were sampled from Gainesville (n=72), Newberry (n=11), LaCrosse (n=9), McIntosh (n=9), Fort Pierce (n=6), Orlando (n=4), Okahumpka (n=4), Ocala (n=4), Canoe Creek (n=4), Fort Drum (n=4), Cedar Key (n=11), Otter Creek (n=10), Bronson (n=9), and Perry (n=11). Samples of workers were retrieved from the field and treated as described above in Example 1. Primer pairs p62/p63 (SEQ ID NO 2/3), p136/p137 (SEQ ID NO 7/8), or p164/p165 (SEQ ID NO 15/16) were used in an RT-PCR reaction to determine the presence of SINV-1 infection (Table 1 above).
Experiments were conducted to determine if the virus was infecting all caste members. Samples of workers were taken from ant nests from areas in Gainesville, Fla. and examined for infection by RT-PCR using primer pairs p62-SEQ ID NO 2/63-SEQ ID NO 26, p136-SEQ ID NO 7/137-SEQ ID NO 8, or p164-SEQ ID NO 15/p165-SEQ ID NO 16 (Table 1 above and Table 4 below). Nests determined to be infected were revisited on the same day, and samples of queens, workers, early instars (1st and 2nd), late instars (3rd and 4th), pupae, sexual pupae, and male and female alates were directly taken from the field. Queens were placed separately into 1.5 ml microcentrifuge tubes and held at about 30° C. for about 24 hours to obtain a sample of eggs. All samples were analyzed for infection by RT-PCR.
The PCR analytic survey for the SINV-1 virus from extracts of S. invicta collected around Florida revealed a pattern of fairly widespread distribution (Table 3). Among about 168 nests surveyed, infection rates among different sites ranged from about 0% to about 87.5% with a mean of about 22.9% (SD=26.3) infected. It appears that SINV-1 infects S. invicta year round in Florida because it was found from May to January. Although the rate of infection among individuals within SINV-1-infected nests was not determined, it was found that the infection was present in all caste members and developmental stages, including eggs, early (1st-2nd) and late (3rd-4th) instars, worker pupae, workers, sexual pupae, alates (male and female) and queens (data not shown).
To evaluate the transmissibility of the SINV-1, uninfected polygyne nests were identified by RT-PCR, excavated from the field, and parsed into two equivalent fragment colonies comprised of a queen, about 0.25 grams of brood, and about 0.5 grams of workers. Colonies were infected by the method described by Ackey and Beck (J. Insect Physiol., Volume 18, 1901-1914, 1972, herein incorporated by reference). Workers and brood, about 1-5 grams each from an SINV-1-infected colony, were homogenized in an equal volume of water and immediately placed onto boiled chicken egg yolks which are a food source for ants. The food source was placed into one of the fragment colonies for about 3 days. The control was identical except uninfected ants were used. Workers from treated and untreated paired fragment colonies were sampled at about 3, 11, and 18 days after introduction of the treated food source and analyzed for the SINV-1 by RT-PCR.
To determine the duration of SINV-1 infection within a fire ant colony, infected colonies were identified in the field, excavated, and placed into rearing trays with a food source of approximately 3 grams of cooked chicken egg yolks, approximately 15 frozen crickets, 10% sugar water, and a colony cell. Periodically, worker ants were removed and analyzed for infection by RT-PCR. Control colonies, without detectable SINV-1 infection, were removed from the field and treated as the infected colonies.
Individuals from uninfected colonies were infected within about 3 days of providing uninfected fire ants the food source mixed with a homogenate made from SINV-1 infected worker ants. SINV-1 did not appear to infect every individual within the recipient colonies; often several samples had to be evaluated by RT-PCR to detect infection. The infection was detectable for at least 18 days after treatment, indicating sustained infection among recipient colonies.
SINV-1 infection was detectable for at least about 3 months among colonies excavated from the field and held in the laboratory.
A second nucleotide sequence, similar to SINV-1, was discovered during elucidation of the genome of SINV-1. To obtain cDNA of nucleotide sequence similar to but distinct from SINV-1, approximately 50 μg of total RNA prepared from SINV-1A-infected ants as in example 2 was digested with approximately 600 μg/ml proteinase K for about 1 hour at about 37° C. Fire ants were identified as being infected with SINV-1A with oligonucleotide primers p117 and p118 (Seq. ID nos. 29 and 30). The digested RNA was purified by acidic penol:chloroform:isoamyl alcohol extraction. One-step RT-PCR (Invitrogen) was conducted with primer pairs p62-SEQ ID NO 2 p63-SEQ ID NO 3, p102-SEQ ID NO 24, p191-SEQ ID NO 33; p59-SEQ ID NO 23, p221-SEQ ID NO 35; p188-SEQ ID NO 30 p222-SEQ ID NO 36, p188-SEQ ID NO 30, p189-SEQ ID NO 31, p137-SEQ ID NO 8, and p193-SEQ ID NO 34 (Table 4) using the following temperature regime:
Reverse transcriptase at about 45° C. for about 50 minutes
Denaturation at about 94° C. for about 2 minutes
35 cycles of denaturation at about 94° C. for about 15 seconds
Annealing (for individual temperatures see Table X) for about 15 minutes, and
Elongation at about 68° C. for about 1.5 minutes
Final elongation at about 68° C. for about 5 minutes
Gel purified amplicons were ligated in to the pCR4-TOPO vector and transformed into TOP10 competent cells (Invitrogen). Insert-positive clones were sequenced by the Interdisciplinary Center for Biotechnology Research, University of Florida.
A single 3′ RACE reaction was conducted with the GeneRacer kit (Invitrogen). cDNA was synthesized from approximately 1 μg total RNA purified from SINV-1A-infected workers and brood using the GeneRacer Oligo(dt) primer. The cDNA was amplified by PCR with oligonucleotide primer p58-SEQ ID NO 22 or p114-SEQ ID NO 25 and the GeneRacer 3′primer. Amplicons were cloned and sequenced as described above.
BLAST comparisons of the nucleotide sequence and predicted amino acid sequence of the 3-proximal ORF and Clustal W-based algorithm alignments were conducted using the Vector NTI alignment software (InforMax, Bethesda, Md.).
The 3′-end of the genome of SINV-1A was constructed by compiling sequences from a series of RT-PCRs and a 3′RACE reaction. The sequence was about 2845 nucleotides in length, excluding the poly(A) tail present on the 3′-end (Accession No. AY831776) (SEQ ID NO 21). The nucleotide sequence was comprised of about 31.7% A, 28.6% U, 17.6% C and 22.1% G. Analysis of the nucleotide sequence revealed one large ORF in the sense orientation with untranslated regions (UTRs) of about 160 and 225 nucleotides at the 5′ and 3′ ends, respectively. Translation of the ORF commenced at nucleotide position 2620 (UAA stop codon), and encoded a predicted product of approximately 92,076 Da. When the SINV-1 and SINV-1A sequences were compared, the start signal in SINV-1 was further upstream and the corresponding ORF larger compared with SINV-1A. Because the sequences of SINV-1 and SINV-1A were so similar, it is likely that the start site could actually be an internal methoinine and the ORF site begins somewhere further upstream. No large ORFs were found in the inverse orientation. BLAST analyses (Altschul et al., Nucleic Acids Res., Volume 25, 3389-3402, 1997) of the translated ORF revealed identity to structural proteins from picorna-like viruses. The amino acid sequence was most identical to SINV-1 (97%), followed by the Kashmir bee virus (KBV, 30%), and acute bee paralysis virus (ABPV, 29%) (Table 5).
Solenopsis invicta virus 1
Drosophila C virus
A field survey was conducted to examine the extent of SINV-1 and SINV-1A infection and co-infection among S. invicta nests from four locations around Gainesville, Fla. Ten nests were sampled from 4 different areas in Gainesville (n=40, Table 2). One-step RT-PCR with species/genotype-specific oligonucleotide primers was used to identify virus-infected S. invicta nests. Samples of worker caste ants were collected as described above in Example 1. RNA was extracted from about 20-50 workers using Trizol reagent according to manufacturer's instructions (Invitrogen). cDNA was synthesized and subsequently amplified using the One-Step RT-PCR kit (Invitrogen) with oligonucleotide primers p117-SEQ ID NO 27 and p118-SEQ ID NO 28 (SINV-1A specific) and p114-SEQ ID NO 25 and p116-SEQ ID NO 26 (SINV-1 specific) (Table 4). Samples were considered positive for each virus when a visible amplicon of anticipated size (about 646 nt for SINV-1 and about 153 nt for SINV-1A) was present after separation on about a 1.2% agarose gel stained with ethidium bromide. RT-PCR was conducted in a PTC 100 thermal cycler (MJ Research, Waltham, Mass.) under the following optimized temperature regime:
1 cycle at about 45° C. for about 30 minutes
1 cycle at about 94° C. for about 2 minutes
35 cycles at about 94° C. for about 15 seconds
1 cycle at about 54° C. for about 15 seconds
1 cycle at about 68° C. for about 30 seconds
Elongation step at about 68° C. for about 5 minutes
In an attempt to gain additional insight into whether SINV-1A was a genotype or distinct species, oligonucleotide primers were designed to conserved areas, i.e., in common) of the 3′-end of the SINV-1 and SINV-1A sequences (p341-SEQ ID NO 37 and p343-SEQ ID NO 38, Table 4). These common primers were used for RT-PCR with representative ant colonies infected exclusively with either SINV-1 or SINV-1A (n=3); the resulting amplicons were subjected to analysis. Amplicons generated with the common primers from SINV-1 and SINV-1A-infected ant colonies were digested separately with AvaI and BglII, separated on about a 1.2% agarose gel and visualized by ethidium bromide staining.
In addition, colonies identified as being negative, i.e., no amplification, for infection by either SINV-1 or SINV-1A, as determined previously by RT-PCR and virus-specific primers, were subjected to a second RT-PCR with the common primers p341-SEQ ID NO 37 and p343-SEQ ID NO 38 (Table 4) to possibly identify additional species or genotypes.
A separate survey of monogyne and polygyne ants was conducted to determine if there was a social form-specific virus/genotype. Ant samples were taken from suspected monogyne- and polygyne-predominant areas and evaluated for infection with SINV-1 and SINV-1A as described above in this example. These samples were concomitantly evaluated by PCR to determine the social form of the nest. Social form was determined with PCR by exploiting nucleotide differences between the 2 gp-9 alleles: Gp-9B, Gp-9b, found in North American S. invicta (Krieger and Ross, Science, Volume 295, 328-323, 2002) by the method described by Valles and Porter (Insect. Soc., Volume 50, 199-200, 2003; herein incorporated by reference).
An RT-PCR-based survey for SINV-1 and SINV-1A using RNA extracts of S. invicta collected around Gainesville, Fla., revealed a mean colony infestation rate of bout 25% by SINV-1 and about 55% by SINV-1A (Table 6). Among 40 nests surveyed, infection rates among the four different sites ranged from about 10-40% for SINV-1 and about 40-70% for SINV-1A (Table 6). Both SINV-1 and SINV-1A were found to co-infect about 17.5% of the nests surveyed. It was not determined if individual ants were infected with both SINV-1 and SINV-1A.
RFLP analysis of about a 1584 nucleotide amplicon at the 3′-end of the genomes produced with primers p341 (SEQ ID NO 37) and p343 (SEQ ID NO 38) form SINV-1 and SINV-1A-infected fire ants corroborated sequence data assembled for each species/genotype (
RNA from colonies yielding no amplicon when utilizing SINV-1- and SINV-1A-specific primers, i.e., uninfected, was subsequently used with conserved primers (p341-SEQ ID NO 37 and p343-SEQ ID NO 38) in RT-PCR to possibly identify new viruses or genotypes related to SINV-1 and SINV-1A. In every instance (n=15), no amplification was observed with conserved primers.
SINV-1 and SINV-1A were found in monogyne and polygyne nests. Infection by either virus does not appear to be limited to a specific social form (Data not shown).
To evaluate the efficacy of Solenopsis invicta virus complex (SINV-1 and genotypes), uninfected monogyne nests (n=6) initiated by newly mated queens were identified by RT-PCR with oligonucleotide primers designed to the 2 characterized genotypes:
p114 5′CTTGATCGGGCAGGACAAATTC SEQ ID NO 25
p116 5′GAACGCTGATAACCAATGAGCC SEQ ID NO 26
p117 5′CACTCCATACAACATTTGTAATAAAGATTTAATT SEQ ID NO 27
p118 5′CCAATACTGAAACAACTGAGACACG SEQ ID NO 28
RT-PCR was conducted in a PTC 100 thermal cycler (MJ Research, Waltham, Mass.) under the following optimized temperature regime:
1 cycle at about 45° C. for about 30 minutes
1 cycle at about 94° C. for about 2 minutes
35 cycles at about 94° C. for about 15 seconds
1 cycle at about 54° C. for about 15 seconds
1 cycle at about 68° C. for about 35 seconds
Elongation step at about 68° C. for about 15 minutes.
The colonies were comprised of about 40-60 ml of brood, about 40,000-60,000 workers, and a single inseminated queen. Three colonies were used as control and 3 colonies were treated with virus-infected ants. Each colony was randomly assigned and paired. Colonies were infected as described above in Example 4. Approximately 300 workers from an SINV-infected colony were homogenized in an equal volume of water and immediately placed onto a mixture of approximately 3 grams of boiled chicken egg yolks and approximately 15 frozen crickets. The control colonies were treated similarly except uninfected ants were used. About 30 workers from treated and control colonies were removed periodically and tested for known SINV genotypes by RT-PCR. Concomitantly, the colonies were quantitatively assessed by determining the volume of brood and number of workers using a standard rating method described previously (Banks et al., J. Econ. Entomol., Volume 81, 83-87, 1988; herein incorporated by reference).
Colony 12 (
Immune response of the ants must be considered when interpreting these results. Some ants, as any organism, are going to be more susceptible to infection and detrimental effects of a pathogen such as SINV than others. A range of susceptibility would be anticipated. Therefore, not all colonies would be expected to become infected when challenged. Moreover, previous exposure to similar pathogens, such as Cripaviruses, can provide protection to an insect challenged by a similar pathogen later.
External stressors may be required to initiate replication of virus and result in brood death. To test this, 2 newly-mated queen colonies with brood ratings of about 50-60 ml, were infected with SINV-1 or SINV-1A. The virus-infected colonies and one control colony were treated with approximately 15 grams of Extinguish commercial formulation of methoprene (Wellmark, Schaumburg, Ill.) provided in a plastic weigh boat and monitored for about 35 days. Brood and worker ratings were assessed every 7 days after treatment by the method of Banks et al (1988, supra).
Brood were killed 1-3 weeks faster in two SINV-infected colonies treated with Methoprene than in an uninfected colony (
In order to understand effects of SINV against Solenopsis invicta in the field, two sites in Gainesville, Fla., were monitored for 7 months for SINV prevalence. One site was located on US441 on the north side of Paines Prairie State Preserve. The other site was located at the East University Avenue/SR26 junction. Ten fire ant nests from each site per month were sampled as described in Example 1 and used in subsequent RT-PCR analyses as described above in Example 7. Simple observation was used to characterize the mound density each month.
The foregoing detailed description is for the purpose of illustration. Such detail is solely for that purpose and those skilled in the art can make variations without departing from the spirit and scope of the invention.
| Number | Name | Date | Kind |
|---|---|---|---|
| 4925663 | Stimac | May 1990 | A |
| 5683689 | Stimac | Nov 1997 | A |
| 6254864 | Stimac | Jul 2001 | B1 |
| 6369078 | Bowen et al. | Apr 2002 | B1 |
| 6403085 | Stimac | Jun 2002 | B1 |
| 6660290 | Stamets | Dec 2003 | B1 |
