This application claims priority to EP21181309.2 filed in European Patent Office on Jun. 24, 2021. This parent application is incorporated by reference in its entirety.
Not applicable.
Not applicable.
The invention relates to the technology of spatial sequencing. The aim is to determine the distribution of mRNA in areas of a tissue or in individual cells within the tissue.
Spatial sequencing is a collective term for methods that allow direct sequencing of the mRNA content of a cell in relation to its tissue context. These methods can on the one hand serve to analyze mRNA expression profiles of cells in a kind of highly multiplexed fluorescence in situ hybridization (FISH) assay.
On the other hand, in situ sequencing can also enable the read-out of mRNA sequence information, using specific mRNA-binding probes, which can take up a copy of predefined portion of specific mRNA or cDNA sequence (“Gap-fill padlock probes”, Ke et al., Nature Methods 2013, doi:10.1038/nmeth.2563). All in situ sequencing methods require a signal amplification step, which is in most cases performed by circularization of mRNA- or cDNA-binding probes and subsequent rolling circle amplification (RCA), creating a DNA molecule containing multiple copies of the probe sequence, the so called Nanoballs, Rolonies or Rolling circle amplification products (RCPs). As these are large molecules with size in nm or μm scale, the number of rolonies that can be formed within one cell is strictly limited by the size of this cell.
Furthermore, if the density of rolonies within cells is too high, discrimination of single mRNA signals during the optical detection step of the sequencing procedure is strongly impaired. As this is a major drawback of the technology, various techniques have been developed to circumvent this, e.g. design of smaller rolonies or generation and clearing of tissue-hydrogel complexes (Asp et al., BioEssays 2020, DOI: 10.1002/bies.201900221). However, these methods do still not fully evade the inherent spatial limitations of in situ sequencing.
Another approach avoids in situ signal amplification: In situ capturing relies on the transfer of mRNA molecules from tissue onto a surface coated with spots of barcoded primers, allowing backtracking of the ex situ gained sequence information to the specific tissue region the sequenced mRNA was extracted from. Nevertheless, this method is also limited, as RNA capture efficiency is restricted and resolution is poor (no single-cell analysis) due to the relatively large size of the barcoded capturing spots (Asp et al., BioEssays 2020, DOI:10.1002/bies.201900221).
The present invention is directed to a method which uses optical methods to insert a genetic code into a sequence. This code can be used to retrieve the position at which the coding was carried out. The aim here is that the limitations of existing in situ sequencing methods with regard to the number of measurable mRNA sequences in situ and also the expression dynamics are largely overcome. Optical coding can have a resolution in the range of one μm and a variability of the code that is sufficient for each cell to receive its own code in tissue sections of typical size.
Additionally, optical coding of specific mRNA-binding probes and reverse transcription-mediated “copying” of enclosed mRNAs region into these probes can be performed. The method can thus be used not only to profile the distribution of mRNA (single cell expression profiling) but also to determine the sequence information of certain mRNA sections (e.g., single nucleotide polymorphisms, SNPs; single cell sequencing).
The basic principle of the method as disclosed herein is based on the binding of padlock probes to the mRNA present in the cells. These will subsequently be referred to as MICTAG probes (Mismatch Cell Tagging, or Mismatch Code Tagging).
The proposed MICTAG workflow is depicted in
Providing of the MICTAG Probes to the mRNA is an essential part of the invention and can be achieved by two general variants.
First object of the invention is a method to obtain the spatial location and sequence information of at least a part of a RNA or cDNA strand (006) in a sample comprising the steps
The MICTAG probe may consist of two probes (204, 204′) each containing one of the aforementioned specific mRNA binding sites, connected by a partially complementary bound ‘bridge’ (bridge oligonucleotide (205) in
Second object of the invention is a method to obtain the spatial location and sequence information of at least a part of a RNA or cDNA strand ((006)) in a sample comprising the steps
In the following, the detection probe oligonucleotide is referred to as “MICTAG Probe”, the bridge oligonucleotide (205) contains a plurality of “MICTAG Digits” or shorter as “Digit” and the gap region (206) is filled in with barcode oligonucleotides referred to as “MICTAG Snips” or shorter as “Snip”.
The variants to create the detection probe oligonucleotide are shown in
In
In
In a first variant of the embodiment, shown in
In a second variant of the embodiment shown in
In the variant shown in
Different than to the embodiment shown in
This variant is shown in
The gap (207′) may then be filled with reverse transcriptase (208) with nucleotides complementary to the adjacent part of the at least one RNA or cDNA strand to obtain a first target sequence (207). The final ligation of the first oligonucleotide (204) and the second oligonucleotide (204′) is then performed with DNA ligase (209).
In
In alternative, the first detection probe oligonucleotide (204) is first hybridized to the complementary part ((006)) of the at least one RNA or cDNA strand (005) and then partially hybridized to a bridge oligonucleotide (205).
In both cases, a gap region (206) which is capable of binding oligonucleotides is created.
In other words,
This kind of single-stranded DNA probe contains two specific mRNA binding regions that hybridize with two neighboring regions or two nearby, but not directly neighboring regions of the mRNA. The gap created when probe binding occurs at two nearby, but not directly neighboring regions, can then be “filled up” (‘gap-filling’) with a sequence complementary to the enclosed mRNA via reverse transcriptase.
Subsequently, the probe is circularized by a DNA ligase, allowing later rolling circle amplification (209 in
In the following process steps, the gap region (206) is filled step by step, inserting a piece of the complementary sequence (MICTAG Snip) in each step to the complementary MICTAG Digit and fixing it with light. In contrast to the cyclic chemistry used e.g. in a Sequencing by Synthesis process, in one embodiment no single deoxynucleotides are inserted, but small oligonucleotides (MICTAG Snip).
Accordingly, the bridge gap region (206) may at least in part filled by hybridizing barcode oligonucleotides comprising the same or different photocleavable blocking groups to complementary parts of the bridge oligonucleotide (205) by removing the photocleavable blocking group with light after hybridizing.
The MICTAG Snips (barcode oligonucleotides) can have one or more mismatches with the corresponding MICTAC Digit, depending on their length, but should have a sufficient sequence length to still bind specifically to the (almost) complementary parts of the bridge oligonucleotide.
The term “mismatch” refers to barcode oligonucleotides which have at least one non-complementary nucleotide.
A MICTAG Snip can contain one or two mismatches with a preferred ratio MICTAG Snip:mismatch=10:1 bp. In addition to the mismatch versions, MICTAG Snips might also contain the matching code, serving as another variant.
To assure specific hybridization with their associated MICTAG Digits, Snips need to be designed in such a way that they cannot bind other Digits. As an alternative to mismatches in Snips, bridge primers can also be designed in such a way that they contain universal bases at the complementary positions to Snip mismatches.
Annealing of these MICTAG Snips is performed within a cyclic process, which is triggered by a structured illumination of the tissue sample by treating it with another spatially structured pattern of light in each cycle. “Structured illumination” and “spatially structured pattern of light” refer to illuminating only a part or selected areas of the sample. For example,
Further downstream in the method of the invention, the information obtained for structured illumination and/or for spatially structured pattern of light is utilized during photo-treatment for MICTAG Code generation (102) which enables circularization of the padlock probes 201 and finally, after RCA, formation of rolonies 202. With the aid of the structured illumination, only the selected areas/cells of the sample 202 are subjected to Next Generation Sequencing of rolonies (100) and sequence analysis (101).
The kinetics of binding of the MICTAG Snips is adjusted so that if a photocleavable group is not removed, the Snip can be detached and washed off, e.g. by increasing the temperature. If the exposure has been made, the MICTAG Snips, hybridized with their corresponding MICTAG Digit within the bridge oligonucleotide, are fixed within the probe, as a photocleavable group is detached by patterned illumination, allowing ligase reaction at this site. Finally, the individual combination of MICTAG Snips determines the MICTAG Code that encodes the location of the MICTAG probe within a tissue section or even within a cell.
The process of MICTAG coding is shown in
Starting from the MICTAG probe where gap filling with reverse transcriptase of the target strand has already been done, the MICTAG Snips are built in in a cyclic process until the code, which consists of several Snips, is written. In the example shown in
After the coding has been completed, all MICTAG probes i.e. the circular templates are isolated i.e. removed from the tissue sample. The bridge oligonucleotides may be detached from circular templates, e.g., by heat-induced double strand melting. In an alternative variant, the bridge oligonucleotides are provided with a primer sequence to induce rolling circle amplification and thus can remain on the circular templates/MICTAG probes.
In principle, the method is not limited in terms of the number of mRNA types examined simultaneously, nor is it limited in terms of individual mRNA expression levels, so that high-level expressers as housekeeping genes will not impair the process. The number of cells examined individually at the same time is limited by the chosen code length. The limitation is only in the capacity and throughput of the sequencer.
One step in the method of the invention is directed to determine the sequence of nucleotides of the rolonies i.e. the information encoded on the MICTAG probes is read out by sequencing. One method for sequencing can be sequencing be synthesis (SBS). For increasing readout signals, amplification of the MICTAG probe sequences can be performed. One method for clonal amplification can be rolling circle amplification (RCA) of the isolated MICTAG probes, which is performed before starting the sequencing process on the rolonies.
In a variant of the invention, the sequence of the MICTAG code may be read separately from the sequence of the target gene (gap-fill sequence). This can be realized by splitting up the sequencing procedure into two runs with two different sequencing primers.
The sequencing of the MICTAG Snips can be accelerated if the matching code before and after the mismatching region consists of only a sequence of 3 of the four bases (e.g. G,T,C). In the following sequence M is a placeholder for one of the bases G, A, C and X is a placeholder for the mismatching code:
MMMMMTXXMMMMM (MICTAG Snip with M={G, A, C} and X={A, G, T, C}
In the context of cyclic chemistry applied for sequencing by synthesis, incorporated nucleotides are usually modified with a base-specific fluorophore and a terminator (indicated here by A*, G*, C*, T*), which blocks further polymerase-mediated strand-elongation until the position is read. When reading the MICTAG Snip in the variant given above, a mixture of nucleotides T, G, C without dye and terminator and A* can be applied, which are then incorporated until T occurs, always preceding the mismatch, prevents further elongation by incorporating an A*.
The mismatch portion of the sequence can then be detected by using a mixture of nucleotides modified with terminator and fluorescent dye. Then, the T, G, C, A* mixture is added again and strand elongation proceeds until the next T in front of the next mismatch position in the following MICTAG Snip.
This can essentially reduce the number of cycles required to sequence the mismatch positions in the MICTAG Code. Using this strategy, dephasing of the cyclic incorporation is avoided and corrected. The first MICTAG Snip sequence to be read can also be designed in such a way that the sequencing primer binds just before the mismatch sequence, thus eliminating the need for initial padding with the T, G, C, A*.
This variant of the invention is shown in
The variant utilizes by way of example the following sequences:
SEQ1: 3′ end of sequencing primer 221: 5′- . . . TGATCATG-3′ (less than 10 nucleotides, no sequence listing)
SEQ2: First MICTAG Snip (with mismatch nucleotides 224): 3′-GCTAGTACTCGAGCC-5′
SEQ3: Second MICTAG Snip (with mismatch nucleotides 224′): 3′-GCAACGGCCTAGCCTG-5′
SEQ4: 3′ end of third MICTAG Snip: 3′-CGCAAAGGCT . . . -5′
SEQ5: 5′ end of complementary sequence generated in sequencing by synthesis procedure (with labeled nucleotides 222): 5′- . . . TGATCATGAGCTCGGCGTTGCCGGATCGGTCGCGTTTCCGA . . . -3′
Different MICTAG Codes
The MICTAG code can be generated by different MICTAG Snip combinations. Here, the variability N of the Snips represents the number of different Snips. Preferable, the number of different Snips is N=2, 4 or 16. The number of MICTAG Digits, M (number of binding regions), might be in the range between 1 and 32. The total variability of the MICTAG Code is then NM. The number of cycles needed to write the code is N×M.
Acceleration of the Code Generation
After the incorporation of the (N−1) types of MICTAG Snips at each of the MICTAG Digits (binding sites) the last type of the MICTAG Snips can be incorporated without the application of light, since it is related to the complementary entity of the already illuminated areas within the first N−1 steps. This can be utilized by providing a Snip having no photocleavable group. This non-photocleavable Snip can then be provided together with the first (photocleavable) MICTAG Snip for the following MICTAG Digit. Counting this as a single cycle reduces the required cycles to N×M−M+1=(N−1)×M+1. The last cycle would than complete the MICTAG code without the application of light. This method is especially useful in the case N=2 where N×M−M+1=M+1.
The following table shows the examples of the variants of the method of the invention and their effect on the number of required cycles for MICTAG coding.
When the MICTAG Code is written, errors may occur when the MICTAG Snips are incorporated. If one of the MICTAG Snips is not inserted, the probe will not be circularized, no RCA can take place and subsequently no sequencing information will be generated.
If an incorrect MICTAG Snip is inserted, the code will not refer to the correct cell. This restriction is only valid if the acceleration of the code generation outlined in the preceding section is not applied.
In other words, if a MICTAG Snip is not inserted, no padlock will be created which will in term not by subjected to sequencing. Insofar, the method of the invention has a build-in error handling.
In addition, it can make sense to include other error correction methods. For example, a second identical code can be inserted at the same time into the bridge at a different position, so that one can validate the codes internally. It is also possible to increase the code length and to add error correction by redundancy.
In this variant, the bridge oligonucleotide contains at least two identical binding regions for the same MICTAG Snip, which are accessible at the same time to assure specific binding reactions. Again, if one MICTAG Snip is not inserted correctly, the respective padlock is not created and will not be subjected to sequencing.
In this respect,
The readout of the genetic code suffers from readout errors. These errors can occur in the MICTAG code as well as in the mRNA sequence. Therefore, it may be helpful to enzymatically cut the strand produced by RCA and generate multiple strands from each strand again by RCA for sequencing. It is then helpful to include a unique molecular identifier (UMI) in the MICTAG probe so that error correction can be performed on both the MICTAG code and the mRNA sequence. This variant is shown in
In addition to the suggested MICTAG procedure, alternative methods can be used to write a code into a MICTAG Probe in situ. One variant of the so far described MICTAG procedure is depicted in
Instead of the additional primers mentioned in
Organisms, Tissue and Tissue Content
Technical Procedures
Reagents and Generated Products
While various details have been described in conjunction with the exemplary implementations outlined above, various alternatives, modifications, variations, improvements, and/or substantial equivalents, whether known or that are or may be presently unforeseen, may become apparent upon reviewing the foregoing disclosure. While the systems and methods above are directed to the separation of biological materials such as cells, they may also be applied to the separation of other sorts of inert particles suspended in a fluid, such as paints or slurries. And while the systems and methods are described above with respect to separating a single, individual particle or cell, it should be understood that a plurality of cells or particles may be separated. Accordingly, the exemplary implementations set forth above, are intended to be illustrative, not limiting.
Number | Date | Country | Kind |
---|---|---|---|
21181309.2 | Jun 2021 | EU | national |