Patent Grant
10889866
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on May 16, 2014, is named 12636.6-304_SL.txt and is 183 kilobytes in size.
RNA splicing, a highly regulated molecular event orchestrated by the spliceosome, results in the removal of intronic sequences from pre-mRNA to generate mature mRNA. Dysregulation of RNA splicing has been identified as a causative defect in several diseases. In addition, dysregulated splicing has been proposed to play an important role in tumorigenesis and resistance to therapy; however, the molecular causes of dysregulated splicing in cancer have remained elusive.
SF3B1 is a protein involved in RNA splicing. It forms part of the U2 snRNP complex which binds to the pre-mRNA at a region containing the branchpoint site and is involved in early recognition and stabilization of the spliceosome at the 3′ splice site (3′ ss). A thorough and systematic analysis of the effects of SF3B1 mutations is needed to define their effects on RNA splicing in cells and may lead to novel therapeutic approaches for SF3B1 mutant cancers.
The description provided herein demonstrates that certain SF3B1 mutations result in neomorphic activity with the production of known and novel splicing alterations. In addition, lineage-specific splicing aberrations were identified in chronic lymphocytic leukemia (CLL), melanoma, and breast cancer. Furthermore, treatment of SF3B1-mutant cancer cell lines, xenografts, and CLL patient samples with modulators of SF3B1 reduced aberrant splicing and induced tumor regression.
The methods described herein involve detecting or quantifying the expression of one or more splice variants in a cell containing a neomorphic mutant SF3B1 protein. Various embodiments of the invention include detecting or quantifying splice variants to determine whether a patient has a cancer with one or more neomorphic SF3B1 mutations. Additional embodiments include measuring the amount of a splice variant to evaluate the effects of a compound on a mutant SF3B1 protein. Further embodiments include methods of treating a patient who has cancer cells with a neomorphic mutant SF3B1 protein.
Various embodiments encompass a method of detecting one or more splice variants selected from rows 1-790 of Table 1 in a biological sample, comprising:
a) providing a biological sample suspected of containing one or more splice variants;
b) contacting the biological sample with one or more nucleic acid probes capable of specifically hybridizing to the one or more splice variants, and
c) detecting the binding of the one or more probes to the one or more splice variants.
In some embodiments, the one or more nucleic acid probes capable of specifically hybridizing to the one or more splice variants each comprise a label. In some embodiments, the method of detecting one or more splice variants selected from rows 1-790 of Table 1 in a biological sample further comprises contacting the biological sample with one or more additional nucleic acid probes, wherein the additional probes are each labeled with a molecular barcode.
Embodiments further encompass a method of modulating the activity of a neomorphic mutant SF3B1 protein in a target cell, comprising applying an SF3B1-modulating compound to the target cell, wherein the target cell has been determined to express one or more aberrant splice variants selected from rows 1-790 of Table 1 at a level that is increased or decreased relative to the level in a cell not having the neomorphic mutant SF3B1 protein.
Embodiments also encompass a method for evaluating the ability of a compound to modulate the activity of a neomorphic mutant SF3B1 protein in a target cell, comprising the steps of:
a) providing a target cell having a mutant SF3B1 protein;
b) applying the compound to the target cell; and
c) measuring the expression level of one or more splice variants selected from row 1-790 of Table 1.
In some embodiments, the method for evaluating the ability of a compound to modulate the activity of a neomorphic mutant SF3B1 protein in a target cell further comprises the step of measuring the expression level of one or more splice variants selected from row 1-790 of Table 1 before step (b).
In some embodiments, the neomorphic mutant SF3B1 protein is selected from K700E, K666N, R625C, G742D, R625H, E622D, H662Q, K666T, K666E, K666R, G740E, Y623C, T663I, K741N, N626Y, T663P, H662R, G740V, D781E, or R625L. In some embodiments, the neomorphic mutant SF3B1 protein is selected from E622D, E622K, E622Q, E622V, Y623C, Y623H, Y623S, R625C, R625G, R625H, R625L, R625P, R625S, N626D, N626H, N626I, N626S, N626Y, H662D, H662L, H662Q, H662R, H662Y, T663I, T663P, K666E, K666M, K666N, K666Q, K666R, K666S, K666T, K700E, V701A, V701F, V701I, I704F, I704N, I704S, I704V, G740E, G740K, G740R, G740V, K741N, K741Q, K741T, G742D, D781E, D781G, or D781N.
In some embodiments, the step of measuring the expression level of one or more splice variants comprises using an assay to quantify nucleic acid selected from nucleic acid barcoding (e.g. NanoString®), RT-PCR, microarray, nucleic acid sequencing, nanoparticle probes (e.g. SmartFlare™), and in situ hybridization (e.g. RNAscope®).
In some embodiments, the step of measuring the expression level of one or more splice variants comprises measuring the number of copies of the one or more splice variant RNAs in the target cell.
In further embodiments, the compound is selected from a small molecule, an antibody, an antisense molecule, an aptamer, an RNA molecule, and a peptide. In further embodiments, the small molecule is selected from pladienolide and a pladienolide analog. In additional embodiments, the pladienolide analog is selected from pladienolide B, pladienolide D, E7107, a compound of formula 1:
a compound of formula 2:
a compound of formula 3:
or a compound of formula 4:
In some embodiments, the target cell is obtained from a patient suspected of having myelodysplastic syndrome, chronic lymphocytic leukemia, chronic myelomonocytic leukemia, or acute myeloid leukemia. In some embodiments, the target cell is obtained from a sample selected from blood or a blood fraction or is a cultured cell derived from a cell obtained from a sample chosen from blood or a blood fraction. In some embodiments, the target cell is a lymphocyte.
In further embodiments, the target cell is obtained from a solid tumor. In some embodiments, the target cell is a breast tissue cell, pancreatic cell, lung cell, or skin cell.
In some embodiments, one or more of the aberrant variants are selected from rows 1, 7, 9, 10, 13, 15, 16, 18, 21, 24, 27, 28, 30, 31, 33, 34, 48, 51, 62, 65, 66, 71, 72, 81, 84, 89, 91, 105, 107, 121, 135, 136, 152, 178, 235, 240, 247, 265, 267, 272, 276, 279, 282, 283, 286, 292, 295, 296, 298, 302, 306, 329, 330, 331, 343, 350, 355, 356, 360, 364, 372, 378, 390, 391, 423, 424, 425, 426, 431, 433, 438, 439, 443, 445, 447, 448, 451, 452, 458, 459, 460, 462, 468, 469, 472, 500, 508, 517, 519, 521, 524, 525, 527, 528, 530, 533, 536, 540, 543, 548, 545, 554, 556, 559, 571, 573, 580, 582, 583, 597, 601, 615, 617, 618, 639, 640, 654, 657, 666, 670, 680, 727, 730, 750, 758, 767, or 774 of Table 1.
In some embodiments, one or more of the aberrant variants are selected from rows 21, 31, 51, 81, 118, 279, 372, 401, 426, 443, 528, 543, 545, 548 or 566 of Table 1.
Embodiments further encompass a method for treating a patient with a neoplastic disorder, comprising administering a therapeutically effective amount of an SF3B1-modulating compound to the patient, wherein a cell from the patient has been determined to:
Additional embodiments are set forth in the description which follows.
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
In certain aspects, the methods of the invention provide assays for measuring the amount of a splice variant in a cell, thereby determining whether a patient has a cancer with a neomorphic SF3B1 mutation. In some embodiments, at least one of the measured splice variants is an aberrant splice variant associated with a neomorphic mutation in an SF3B1 protein. In additional aspects, the measurement of a splice variant in a cell may be used to evaluate the ability of a compound to modulate a mutant neomorphic SF3B1 protein in a cell.
To assist in understanding the present invention, certain terms are first defined. Additional definitions are provided throughout the application.
As used herein, the term “mutant SF3B1 protein” includes SF3B1 proteins that differ in amino acid sequence from the human wild type SF3B1 protein set forth in SEQ ID NO:1200 (GenBank Accession Number NP_036565, Version NP_036565.2) (S. Bonnal, L. Vigevani, and J. Valcarcel, “The spliceosome as a target of novel antitumour drugs,” Nat. Rev. Drug Discov. 11:847-59 [2012]). Certain mutant SF3B1 proteins are “neomorphic” mutants, which refers to mutant SF3B1 proteins that are associated with differential expression of aberrant splice variants. In certain embodiments, neomorphic SF3B1 mutants include K700E, K666N, R625C, G742D, R625H, E622D, H662Q, K666T, K666E, K666R, G740E, Y623C, T663I, K741N, N626Y, T663P, H662R, G740V, D781E, or R625L. In other embodiments, neomophic SF3B1 mutants include E622D, E622K, E622Q, E622V, Y623C, Y623H, Y623S, R625C, R625G, R625H, R625L, R625P, R625S, N626D, N626H, N626I, N626S, N626Y, H662D, H662L, H662Q, H662R, H662Y, T663I, T663P, K666E, K666M, K666N, K666Q, K666R, K666S, K666T, K700E, V701A, V701F, V701I, I704F, I704N, I704S, I704V, G740E, G740K, G740R, G740V, K741N, K741Q, K741T, G742D, D781E, D781G, or D781N. Certain SF3B1 mutations are not associated with expression of aberrant splice variants, including K700R.
The term “splice variant” as used herein includes nucleic acid sequences that span a junction either between two exon sequences or across an intron-exon boundary in a gene, where the junction can be alternatively spliced. Alternative splicing includes alternate 3′ splice site selection (“3′ss”), alternate 5′ splice site selection (“5′ss”), differential exon inclusion, exon skipping, and intron retention (
The term “evaluating” includes determining the ability of a compound to treat a disease associated with a neomorphic SF3B1 mutation. In some instances, “evaluating” includes determining whether or to what degree a compound modulates aberrant splicing events associated with a neomorphic SF3B1 protein. Modulation of the activity of an SF3B1 protein may encompass up-regulation or down-regulation of aberrant splice variant expression associated with a neomorphic SF3B1 protein. Additionally, “evaluating” includes distinguishing patients that may be successfully treated with a compound that modulates the expression of splice variants associated with a neomorphic SF3B1 protein.
The use of the word “a”, “an” or “the” when used in conjunction with the term “comprising” in the claims or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” “Or” is to be read inclusively to mean “and/or” unless explicitly indicated to refer to alternatives only, such as where alternatives are mutually exclusive.
Splice Variants
Splice variants of the invention are listed in Table 1. Table 1 provides the genomic location of each canonical (“WT”) and aberrant (“Ab.”) splice junction, as well as the sequence. Each sequence listed in the table contains 20 nucleotides from each of the 3′ and 5′ sides of a splice junction (i.e., the splice junction is at the midpoint of the listed nucleotide sequence). The “Avg WT %” and “Avg Ab. %” columns provide the average percentage count that the canonical (WT) or aberrant splice variant, respectively, represented out of the total counts of all splice variants that utilize a shared splice site, where the counts were determined as set forth in Example 1. The “Loge Fold Change” column provides the loge of the fold change observed between percentage counts of canonical and aberrant cohorts (see Example 1). The “FDR Q-Value” column provides, as a measure of statistical significance, q-values calculated using the Benjamini-Hochberg procedure from p-values, which in turn were determined using the moderated t-test defined in the Bioconductor's limma package (see Example 1). The “Event” column indicates the nature of the aberrant splice variant, where “3′ss” indicates alternate 3′ splice site selection, “5′ss” indicates alternate 5′ splice site selection, “exon incl.” indicates differential exon inclusion, and “exon skip” indicates exon skipping. The “Type” column refers to the cancer type of the sample in which the aberrant splice variant was identified, where “Br.” indicates breast cancer, “CLL” indicates chronic lymphocytic leukemia, and “Mel.” indicates melanoma.
Certain splice variants are associated with more than one disease, and thus appear in Table 1 more than one time. In certain instances, splice variants associated with more than one cancer type may have different expression levels in each disease, so there may be more than one set of expression data for a given splice variant. Variants differentially expressed across all tested cancer types can be used to evaluate cells having SF3B1 neomorphic mutations in additional cancer types. Such variants are shown in the following rows of Table 1 (triplicates represent the same splice junction, measured in different cancer types): [13, 272, 525], [27, 286, 527], [33, 536, 330], [107, 445, 657], [28, 350, 573], [229, 762, 467], [240, 508, 767], [7, 356, 524], [76, 374, 596], [35, 547, 280], [84, 364, 571], [85, 564, 297], [24, 597, 296], [21, 372, 545], [36, 576, 407], [105, 423, 639], [62, 580, 447], [31, 279, 528], [235, 758, 439], [306, 89, 666], [34, 295, 533], [390, 72, 640], [48, 343, 554], [360, 65, 540], [178, 329, 750], [71, 265, 556], [15, 283, 530], [18, 267, 583], [129, 418, 622], [333, 25, 541], [247, 500, 774], [259, 5, 542], [152, 438, 615], [292, 1, 517], [81, 543, 443], [347, 70, 592], [91, 431, 617], [30, 298, 582], [17, 334, 602], [16, 276, 559], [51, 426, 548], [118, 401, 566], [83, 435, 574], and [269, 45, 546]. In certain embodiments, variants that are nonspecific to a particular cancer type can be chosen from the following rows of Table 1: [13, 272, 525], [27, 286, 527], [33, 536, 330], [107, 445, 657], [28, 350, 573], [240, 508, 767], [7, 356, 524], [84, 364, 571], [24, 597, 296], [21, 372, 545], [105, 423, 639], [62, 580, 447], [31, 279, 528], [235, 758, 439], [306, 89, 666], [34, 295, 533], [390, 72, 640], [360, 65, 540], [178, 329, 750], [71, 265, 556], [15, 283, 530], [18, 267, 583], [247, 500, 774], [152, 438, 615], [292, 1, 517], [81, 543, 443], [91, 431, 617], [30, 298, 582], [16, 276, 559], or [51, 426, 548].
Certain embodiments of the invention provide splice variants as markers for cancer. In certain circumstances, cancer cells with a neomorphic SF3B1 protein demonstrate differential expression of certain splice variants compared to cells without a neomorphic SF3B1 protein. The differential expression of one or more splice variants therefore may be used to determine whether a patient has cancer with a neomorphic SF3B1 mutation. In certain embodiments, the patient is also determined to have a cancer cell having a mutant SF3B1 protein. In these methods, one or more of the splice variants listed in Table 1 can be measured to determine whether a patient has cancer with a neomorphic SF3B1 mutation. In certain embodiments, one or more aberrant splice variants from Table 1 are measured. In other embodiments, one or more canonical splice variants are measured. Sometimes, both aberrant and canonical variants are measured.
In some embodiments, one or more aberrant splice variants selected from rows 260, 262, 263, 265, 266, 267, 272, 273, 275, 276, 277, 279, 281, 282, 286, 287, 288, 290, 294, 295, 296, 298, 299, 301, 302, 304, 305, 306, 308, 310, 312, 313, 315, 316, 318, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 335, 337, 339, 342, 346, 348, 349, 350, 352, 353, 354, 355, 356, 357, 358, 362, 363, 365, 366, 368, 369, 370, 372, 375, 377, 378, 379, 380, 381, 382, 383, 384, 387, 388, 389, 390, 391, 392, 393, 394, 397, 398, 400, 402, 403, 404, 405, 406, 413, 415, 416, 417, 419, 420, 421, 424, 425, 428, 429, 430, 431, 432, 433, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 454, 455, 456, 458, 459, 460, 461, 462, 464, 465, 468, 469, 471, 472, 473, 474, 475, 476, 477, 478, 480, 481, 483, 484, 485, 486, 487, 488, 490, 491, 494, 496, 497, 498, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 513, 514, 515, or 516 of Table 1 can be measured in a patient suspected of having CLL. In additional embodiments, a patient suspected of having CLL can be identified by measuring the amounts of one or more of the following aberrant splice variants listed in Table 1: row 259, 269, 270, 271, 274, 278, 280, 282, 292, 296, 297, 302, 306, 330, 331, 333, 343, 347, 355, 360, 361, 371, 373, 376, 378, 390, 391, 407, 408, 423, 424, 425, 433, 434, 439, 443, 447, 448, 451, 452, 453, 458, 459, 460, 462, 463, 466, 467, 468, 469, 470, 472, 479, 482, or 489. In additional embodiments, a patient suspected of having CLL can be identified by measuring the amounts of one or more of the following aberrant splice variants listed in Table 1: row 282, 292, 296, 302, 306, 330, 331, 343, 355, 360, 373, 378, 390, 391, 423, 424, 425, 433, 434, 439, 443, 447, 448, 451, 452, 458, 459, 460, 462, 463, 466, 468, 469, 470, 472, 479, 482, or 489. In still further embodiments, a patient suspected of having CLL can be identified by measuring the amount of one or more of the following aberrant splice variants listed in Table 1: row 282, 296, 302, 306, 330, 331, 355, 378, 390, 391, 424, 425, 433, 439, 443, 447, 448, 451, 452, 458, 459, 460, 462, 468, 469, or 472.
In other embodiments, one or more aberrant splice variants selected from rows 2, 3, 4, 7, 9, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 27, 28, 30, 31, 32, 33, 34, 37, 38, 39, 40, 41, 42, 43, 46, 47, 49, 50, 52, 53, 54, 56, 57, 58, 61, 62, 63, 64, 66, 67, 68, 71, 72, 75, 77, 78, 79, 80, 81, 82, 84, 87, 88, 89, 90, 91, 92, 94, 95, 97, 98, 99, 100, 101, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114, 116, 117, 119, 120, 121, 122, 123, 124, 125, 126, 127, 131, 132, 133, 134, 135, 136, 138, 139, 140, 141, 142, 143, 144, 146, 147, 150, 152, 154, 155, 156, 157, 159, 163, 164, 165, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 230, 231, 232, 233, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 247, 249, 250, 251, 252, 253, 254, 255, 256, or 257 of Table 1 can be measured in a patient suspected of having breast cancer. In additional embodiments, a patient suspected of having breast cancer can be identified by measuring the amounts of one or more of the following aberrant splice variants listed in Table 1: row 7, 8, 9, 10, 26, 48, 66, 105, 121, 135, 136, or 166. In additional embodiments, a patient suspected of having breast cancer can be identified by measuring the amounts of one or more of the following aberrant splice variants listed in Table 1: row 7, 8, 9, 10, 26, 48, 66, 105, 121, 135, or 136. In still further embodiments, a patient suspected of having breast cancer can be identified by measuring the amount of one or more of the following aberrant splice variants listed in Table 1: row 7, 9, 10, 66, 121, 135, or 136.
In further embodiments, one or more aberrant splice variants selected from rows 518, 519, 520, 521, 523, 524, 525, 526, 527, 528, 529, 531, 533, 534, 536, 537, 538, 539, 543, 544, 545, 549, 551, 552, 553, 555, 556, 557, 558, 559, 560, 561, 562, 563, 565, 567, 568, 569, 570, 572, 573, 575, 577, 578, 579, 580, 581, 582, 583, 584, 585, 588, 589, 590, 591, 593, 595, 597, 598, 599, 600, 601, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 623, 625, 627, 628, 629, 630, 632, 634, 635, 636, 637, 638, 640, 641, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 654, 657, 658, 659, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 680, 682, 683, 684, 685, 686, 687, 688, 689, 690, 692, 694, 696, 697, 698, 699, 700, 701, 702, 703, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 763, 764, 765, 766, 767, 768, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, or 790 of Table 1 can be measured in a patient suspected of having melanoma. In additional embodiments, a patient suspected of having melanoma can be identified by measuring the amounts of one or more of the following aberrant splice variants listed in Table 1: row 519, 521, 522, 535, 554, 587, 594, 601, 618, 639, 654, 655, 670, 679, 680, 727, 729, or 730. In additional embodiments, a patient suspected of having melanoma can be identified by measuring the amounts of one or more of the following aberrant splice variants listed in Table 1: row 519, 521, 522, 535, 554, 587, 601, 618, 639, 654, 670, 680, 727, or 730. In still further embodiments, a patient suspected of having melanoma can be identified by measuring the amount of one or more of the following aberrant splice variants listed in Table 1: row 519, 521, 601, 618, 654, 670, 680, 727, or 730.
In some embodiments, one or more of the aberrant variants are selected from rows 21, 31, 51, 81, 118, 279, 372, 401, 426, 443, 528, 543, 545, 548 or 566 of Table 1. In certain embodiments, a patient suspected of having cancer can be identified by measuring the amount of one or more of the aberrant variants selected from 21, 31, 51, 81, 118, 279, 372, 401, 426, 443, 528, 543, 545, 548 or 566. In various embodiments the cancer may be CLL, breast cancer, or melanoma, for example.
Additional methods include predicting or monitoring the efficacy of a treatment for cancer by measuring the level of one or more aberrant splice variants in samples obtained from patients before or during the treatment. For example, a decrease in the levels of one or more aberrant splice variants over the course of treatment may indicate that the treatment is effective. In other cases, the absence of a decrease or an increase in the levels of one or more aberrant splice variants over the course of treatment may indicate that the treatment is not effective and should be adjusted, supplemented, or terminated. In some embodiments, the splice variants are used to track and adjust individual patient treatment effectiveness.
Embodiments of the invention also encompass methods of stratifying cancer patients into different categories based on the presence or absence of one or more particular splice variants in patient samples or the detection of one or more particular splice variants at levels that are elevated or reduced relative to those in normal cell samples. Categories may be different prognostic categories, categories of patients with varying rates of recurrence, categories of patients that respond to treatment and those that do not, and categories of patients that may have particular negative side effects, and the like. According to the categories in which individual patients fall, optimal treatments may then be selected for those patients, or particular patients may be selected for clinical trials.
Embodiments also encompass methods of distinguishing cancerous cells with SF3B1 neomorphic mutations from normal cells by using the splice variants disclosed herein as markers. Such methods may be employed, for example, to assess the growth or loss of cancerous cells and to identify cancerous cells to be treated or removed. In some embodiments, the splice variants are measured in cancerous tissue having cells with a neomorphic SF3B1 mutation before and after anti-cancer treatment, for the purpose of monitoring the effect of the treatment on cancer progression.
In additional embodiments, administering an SF3B1 modulator to a cell, such as a cancer cell, can alter the differential expression of splice variants. Accordingly, the change in expression of one or more splice variants can be used to evaluate the effect of the SF3B1 modulator on the SF3B1 protein. In one embodiment, the effect of an SF3B1 modulator on a CLL cell is evaluated by applying an SF3B1 modulator to such a cell, then detecting or quantifying one or more of the splice variants in Table 1. In additional embodiments the one or more splice variants are chosen from rows 258-516 of Table 1. In further embodiments, the one or more splice variants are chosen from rows 260, 262, 263, 265, 266, 267, 272, 273, 275, 276, 277, 279, 281, 282, 286, 287, 288, 290, 294, 295, 296, 298, 299, 301, 302, 304, 305, 306, 308, 310, 312, 313, 315, 316, 318, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 335, 337, 339, 342, 346, 348, 349, 350, 352, 353, 354, 355, 356, 357, 358, 362, 363, 365, 366, 368, 369, 370, 372, 375, 377, 378, 379, 380, 381, 382, 383, 384, 387, 388, 389, 390, 391, 392, 393, 394, 397, 398, 400, 402, 403, 404, 405, 406, 413, 415, 416, 417, 419, 420, 421, 424, 425, 428, 429, 430, 431, 432, 433, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 454, 455, 456, 458, 459, 460, 461, 462, 464, 465, 468, 469, 471, 472, 473, 474, 475, 476, 477, 478, 480, 481, 483, 484, 485, 486, 487, 488, 490, 491, 494, 496, 497, 498, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 513, 514, 515, or 516 of Table 1. In further embodiments, the one or more splice variants are chosen from rows 259, 269, 270, 271, 274, 278, 280, 282, 292, 296, 297, 302, 306, 330, 331, 333, 343, 347, 355, 360, 361, 371, 373, 376, 378, 390, 391, 407, 408, 423, 424, 425, 433, 434, 439, 443, 447, 448, 451, 452, 453, 458, 459, 460, 462, 463, 466, 467, 468, 469, 470, 472, 479, 482, or 489. In additional embodiments, the one or more splice variants are chosen from rows 282, 292, 296, 302, 306, 330, 331, 343, 355, 360, 373, 378, 390, 391, 423, 424, 425, 433, 434, 439, 443, 447, 448, 451, 452, 458, 459, 460, 462, 463, 466, 468, 469, 470, 472, 479, 482, or 489 of Table 1. In still further embodiments, the one or more splice variants are chosen from rows 282, 296, 302, 306, 330, 331, 355, 378, 390, 391, 424, 425, 433, 439, 443, 447, 448, 451, 452, 458, 459, 460, 462, 468, 469, or 472 of Table 1.
In certain embodiments, the effect of an SF3B1 modulator on a breast cancer cell is evaluated by applying an SF3B1 modulator to such a cell, then detecting or quantifying one or more of the splice variants in Table 1. In additional embodiments the one or more splice variants are chosen from rows 1-257 of Table 1. In further embodiments, the one or more splice variants are chosen from rows 2, 3, 4, 7, 9, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 27, 28, 30, 31, 32, 33, 34, 37, 38, 39, 40, 41, 42, 43, 46, 47, 49, 50, 52, 53, 54, 56, 57, 58, 61, 62, 63, 64, 66, 67, 68, 71, 72, 75, 77, 78, 79, 80, 81, 82, 84, 87, 88, 89, 90, 91, 92, 94, 95, 97, 98, 99, 100, 101, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114, 116, 117, 119, 120, 121, 122, 123, 124, 125, 126, 127, 131, 132, 133, 134, 135, 136, 138, 139, 140, 141, 142, 143, 144, 146, 147, 150, 152, 154, 155, 156, 157, 159, 163, 164, 165, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 230, 231, 232, 233, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 247, 249, 250, 251, 252, 253, 254, 255, 256, or 257 of Table 1. In additional embodiments, the one or more splice variants are chosen from rows 7, 8, 9, 10, 26, 48, 66, 105, 121, 135, 136, or 166 of Table 1. In further embodiments, the one or more splice variants are chosen from rows 7, 8, 9, 10, 26, 48, 66, 105, 121, 135, or 136 of Table 1. In still further embodiments, the one or more splice variants are chosen from rows 7, 9, 10, 66, 121, 135, or 136 of Table 1.
In a further embodiment, the effect of an SF3B1 modulator on a melanoma cell is evaluated by applying an SF3B1 modulator to such a cell, then detecting or quantifying one or more of the splice variants in Table 1. In additional embodiments the one or more splice variants are chosen from rows 517-790 of Table 1. In further embodiments, the one or more splice variants are chosen from rows 518, 519, 520, 521, 523, 524, 525, 526, 527, 528, 529, 531, 533, 534, 536, 537, 538, 539, 543, 544, 545, 549, 551, 552, 553, 555, 556, 557, 558, 559, 560, 561, 562, 563, 565, 567, 568, 569, 570, 572, 573, 575, 577, 578, 579, 580, 581, 582, 583, 584, 585, 588, 589, 590, 591, 593, 595, 597, 598, 599, 600, 601, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 623, 625, 627, 628, 629, 630, 632, 634, 635, 636, 637, 638, 640, 641, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 654, 657, 658, 659, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 680, 682, 683, 684, 685, 686, 687, 688, 689, 690, 692, 694, 696, 697, 698, 699, 700, 701, 702, 703, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 763, 764, 765, 766, 767, 768, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, or 790 of Table 1. In still further embodiments, the one or more splice variants are chosen from rows 519, 521, 522, 535, 554, 587, 594, 601, 618, 639, 654, 655, 670, 679, 680, 727, 729, or 730 of Table 1. In additional embodiments, the one or more splice variants are chosen from rows 519, 521, 522, 535, 554, 587, 601, 618, 639, 654, 670, 680, 727, or 730 of Table 1. In still further embodiments, the one or more splice variants are chosen from rows 519, 521, 601, 618, 654, 670, 680, 727, or 730 of Table 1.
In some embodiments, the effect of an SF3B1 modulator on a cancer cell is evaluated by applying an SF3B1 modulator to such a cell, then detecting or quantifying one or more of the aberrant variants selected from rows 21, 31, 51, 81, 118, 279, 372, 401, 426, 443, 528, 543, 545, 548 or 566 of Table 1. In various embodiments, the cancer cell may be a CLL cell, a breast cancer cell, or a melanoma cell, for example.
The specific splice variants that are useful for demonstrating the effect of an SF3B1 modulator on one type of cancer cell may not be useful for demonstrating an effect of the modulator on another type of cancer cell. Aberrant splice variants that are appropriate for revealing such effects in particular cancer cells will be apparent from the description and examples provided herein.
In some embodiments, aberrant splice variants that are present at elevated levels in a cell having a neomorphic SF3B1 protein are used as markers. In other embodiments, splice variants that have reduced levels in a cell having a neomorphic SF3B1 protein are used as markers. In some embodiments, more than one splice variant will be measured. When more than one splice variant is used, they may all have elevated levels, all have reduced levels, or a mixture of splice variants with elevated and reduced levels may be used. In certain embodiments of the methods described herein, more than one aberrant splice variant is measured. In other embodiments, at least one aberrant and at least one canonical splice variant is measured. In some cases, both an aberrant and canonical splice variant associated with a particular genomic location will be measured. In other circumstances, a measured canonical splice variant will be at a different genomic location from the measured aberrant splice variant(s).
Before performing an assay for splice variants in a cell, one may determine whether the cell has a mutant SF3B1 protein. In certain embodiments, the assay for splice variants is performed if the cell has been determined to have a neomorphic SF3B1 mutant protein.
Samples
Cell samples can be obtained from a variety of biological sources. Exemplary cell samples include but are not limited to a cell culture, a cell line, a tissue, oral tissue, gastrointestinal tissue, an organ, an organelle, a biological fluid, a blood sample, a urine sample, a skin sample, and the like. Blood samples may be whole blood, partially purified blood, or a fraction of whole or partially purified blood, such as peripheral blood mononucleated cells (PBMCs). The source of a cell sample may be a solid tissue sample such as a tissue biopsy. Tissue biopsy samples may be biopsies from breast tissue, skin, lung, or lymph nodes. Samples may be samples of bone marrow, including bone marrow aspirates and bone marrow biopsies.
In certain embodiments, the cells are human cells. Cells may be cancer cells, for example hematological cancer cells or solid tumor cells. Hematological cancers include chronic lymphocytic leukemia, acute lymphoblastic leukemia, acute myeloid leukemia, chronic myeloid leukemia, chronic myelomonocytic leukemia, acute monocytic leukemia, Hodgkin's lymphoma, Non-Hodgkin's lymphoma, and multiple myeloma. Solid tumors include carcinomas, such as adenocarcinomas, and may be selected from breast, lung, liver, prostate, pancreatic, colon, colorectal, skin, ovarian, uterine, cervical, or renal cancers. Cell samples may be obtained directly from a patient or derived from cells obtained from a patient, such as cultured cells derived from a biological fluid or tissue sample. Samples may be archived samples, such as kryopreserved samples, of cells obtained directly from a subject or of cells derived from cells obtained from a patient.
In certain embodiments, cells are obtained from patients suspected of having cancer. The patients may show signs and symptoms of cancer, such as one or more common symptoms of CLL, which include enlarged lymph nodes, liver, or spleen, higher-than-normal white blood cell counts, recurring infections, loss of appetite or early satiety, abnormal bruising, fatigue, and night sweats. In additional embodiments, the cells have a mutant SF3B1 protein.
Cell samples described herein may be used in any of the methods presently disclosed.
Detection of Splice Variants
Certain embodiments of the methods described herein involve detection or quantification of splice variants. A variety of methods exists for detecting and quantifying nucleic acids, and each may be adapted for detection of splice variants in the described embodiments. Exemplary methods include an assay to quantify nucleic acid such as nucleic acid barcoding, nanoparticle probes, in situ hybridization, microarray, nucleic acid sequencing, and PCR-based methods, including real-time PCR (RT-PCR).
Nucleic acid assays utilizing barcoding technology such as NanoString® assays (NanoString Technologies) may be performed, for example, as described in U.S. Pat. Nos. 8,519,115; 7,919,237; and in Kulkarni, M. M., 2011, “Digital Multiplexed Gene Expression Analysis Using the NanoString nCounter System.” Current Protocols in Molecular Biology, 94:25B.10.1-25B.10.17. In an exemplary assay, a pair of probes is used to detect a particular nucleotide sequence of interest, such as a particular splice variant of interest. The probe pair consists of a capture probe and a reporter probe and that each include a sequence of from about 35 to 50 bases in length that is specific for a target sequence. The capture probe includes an affinity label such as biotin at its 3′ end that provides a molecular handle for surface-attachment of target mRNAs for digital detection, and the reporter probe includes a unique color code at its 5′ end that provides molecular barcoding of the hybridized mRNA target sequence. Capture and reporter probe pairs are hybridized to target mRNA in solution, and after excess probes are removed, the target mRNA-probe complexes are immobilized in an nCounter® cartridge. A digital analyzer acquires direct images of the surface of the cartridge to detect color codes corresponding to specific mRNA splice variant sequences. The number of times a color-coded barcode for a particular splice variant is detected reflects the levels of a particular splice variant in the mRNA library. For the detection of splice variants, either the capture or the reporter probe may span a given splice variant's exon-exon or intron-exon junction. In other embodiments, one or both of the capture and reporter probes' target sequences correspond to the terminal sequences of two exons at an exon-exon junction or to the terminal sequences of an intron and an exon at an intron-exon junction, whereby one probe extends to the exon-exon or intron-exon junction, but does not span the junction, and the other probe binds a sequence that begins on opposite side of the junction and extends into the respective exon or intron.
In exemplary PCR-based methods, a particular splice variant may be detected by specifically amplifying a sequence that contains the splice variant. For example, the method may employ a first primer specifically designed to hybridize to a first portion of the splice variant, where the splice variant is a sequence that spans an exon-exon or intron-exon junction at which alternative splicing occurs. The method may further employ a second opposing primer that hybridizes to a segment of the PCR extension product of the first primer that corresponds to another sequence in the gene, such as a sequence at an upstream or downstream location. The PCR detection method may be quantitative (or real-time) PCR. In some embodiments of quantitative PCR, an amplified PCR product is detected using a nucleic acid probe, wherein the probe may contain one or more detectable labels. In certain quantitative PCR methods, the amount of a splice variant of interest is determined by detecting and comparing levels of the splice variant to an appropriate internal control.
Exemplary methods for detecting splice variants using an in situ hybridization assay such as RNAscope® (Advanced Cell Diagnostics) include those described by Wang, F., et al., “RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues,” J. Mol. Diagn. 2012 January; 14(1):22-9. RNAscope® assays may be used to detect splice variants by designing a pair of probes that targets a given splice variant, and are hybridized to target RNA in fixed and permeabilized cells. Target probes are designed to hybridize as pairs which, when hybridized to the target sequence, create a binding site for a preamplifier nucleic acid. The preamplifier nucleic acid, in turn, harbors multiple binding sites for amplifier nucleic acids, which in turn contain multiple binding sites for a labeled probe carrying a chromogenic or fluorescent molecule. In some embodiments, one of the RNAscope® target probes spans a given splice variant's exon-exon or intron-exon junction. In other embodiments, the target probes' target sequences correspond to the terminal sequences of two exons at an exon-exon junction or to the terminal sequences of an intron and an exon at an intron-exon junction, whereby one probe in the target probe pair extends to the exon-exon or intron-exon junction, but does not span the junction, and the other probe binds a sequence beginning on opposite side of the junction and extending into the respective exon or intron.
Exemplary methods for detecting splice variants using nanoparticle probes such as SmartFlare™ (Millipore) include those described in Seferos et al., “Nano-flares: Probes for Transfection and mRNA Detection in Living Cells,” J. Am. Chem. Soc. 129(50):15477-15479 (2007) and Prigodich, A. E., et al., “Multiplexed Nanoflares: mRNA Detection in Live Cells,” Anal. Chem. 84(4):2062-2066 (2012). SmartFlare™ detection probes may be used to detect splice variants by generating gold nanoparticles that are modified with one or more nucleic acids that include nucleotide recognition sequences that (1) are each complementary to a particular splice variant to be detected and (2) are each hybridized to a complementary fluorophore-labeled reporter nucleic acid. Upon uptake of the probe by a cell, a target splice variant sequence may hybridize to the one or more nucleotide recognition sequences and displace the fluorophore-labeled reporter nucleic acid. The fluorophore-labeled reporter nucleic acid, whose fluorophore had been quenched due to proximity to the gold nanoparticle surface, is then liberated from the gold nanoparticle, and the fluorophore may then be detected when free of the quenching effect of the nanoparticle. In some embodiments, nucleotide recognition sequences in the probes recognize a sequence that spans a given splice variant's exon-exon or intron-exon junction. In some embodiments, nucleotide recognition sequences in the probes recognize a sequence that is only on one side of the splice variant's exon-exon or intron-exon junction, including a sequence that terminates at the junction and a sequence that terminates one or more nucleotides away from the junction.
Exemplary methods for detecting splice variants using nucleic acid sequencing include RNA sequencing (RNA-Seq) described in Ren, S. et al. “RNA-Seq analysis of prostate cancer in the Chinese population identifies recurrent gene fusions, cancer-associated long noncoding RNAs and aberrant alternative splicings.” Cell Res 22, 806-821, doi:10.1038/cr.2012.30 (2012); and van Dijk et al., “Ten years of next-generation sequencing technology.” Trends Genet 30(9):418-26 (2014). In some embodiments, high-throughput sequencing, such as next-generation sequencing (NGS) technologies, may be used to dected splice variants. For example, the method may employ commercial sequencing platforms available for RNA-Seq, such as, e.g., Illumina, SOLID, Ion Torrent, and Roche 454. In some embodiments, the sequencing method may include pyrosequencing. For example, a sample may be mixed with sequencing enzymes and primer and exposed to a flow of one unlabeled nucleotide at a time, allowing synthesis of the complementary DNA strand. When a nucleotide is incorporated, pyrophosphate is released leading to light emission, which is monitored in real time. In some embodiments, the sequencing method may include semiconductor sequencing. For example, proton instead of pyrophosphate may be released during nucleotide incorporation and detected in real time by ion sensors. In some embodiments, the method may include sequencing with reversible terminators. For example, the synthesis reagents may include primers, DNA polymerase, and four differently labelled, reversible terminator nucleotides. After incorporation of a nucleotide, which is identified by its color, the 3′ terminator on the base and the fluorophore are removed, and the cycle is repeated. In some embodiments, the method may include sequencing by ligation. For example, a sequencing primer may be hybridized to an adapter, with the 5′ end of the primer available for ligation to an oligonucleotide hybridizing to the adjacent sequence. A mixture of octamers, in which bases 4 and 5 are encoded by one of four color labels, may compete for ligation to the primer. After color detection, the ligated octamer may be cleaved between position 5 and 6 to remove the label, and the cycle may be repeated. Thereby, in the first round, the process may determine possible identities of bases in positions 4, 5, 9, 10, 14, 15, etc. The process may be repeated, offset by one base using a shorter sequencing primer, to determine positions 3, 4, 8, 9, 13, 14, etc., until the first base in the sequencing primer is reached.
Other nucleic acid detection and analytical methods that also distinguish between splice variants of a given exon-exon or intron-exon junction in a gene by identifying the nucleotide sequence on both sides of the junction may be utilized to detect or quantify the splice variants disclosed herein. For example, splice variants of an exon-exon junction may be detected by primer extension methods in which a primer that binds to one exon is extended into the exon on the other side of the junction according to the sequence of that adjacent exon. See, for example, McCullough, R. M., et al., “High-throughput alternative splicing quantification by primer extension and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry,” Nucleic Acids Research, 2005 Jun. 20; 33(11):e99; and Milani, L., et al., “Detection of alternatively spliced transcripts in leukemia cell lines by minisequencing on microarrays,” Clin. Chem. 52: 202-211 (2006). Detection of variants on a large scale may be performed using expression microarrays that carry exon-exon or intron-exon junction probes, as described, for example, in Johnson, J. M. et al., “Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays,” Science 302: 2141-2144 (2003); and Modrek, B., et al., “Genome-wide detection of alternative splicing in expressed sequences of human genes,” Nucleic Acids Res 29: 2850-2859 (2001).
Various embodiments include reagents for detecting splice variants of the invention. In one example, reagents include NanoString® probes designed to measure the amount of one or more of the aberrant splice variants listed in Table 1. Probes for nucleic acid quantification assays such as barcoding (e.g. NanoString®), nanoparticle probes (e.g. SmartFlare™), in situ hybridization (e.g. RNAscope®), microarray, nucleic acid sequencing, and PCR-based assays may be designed as set forth above.
In these exemplary methods or in other methods for nucleic acid detection, aberrant splice variants may be identified using probes, primers, or other reagents which specifically recognize the nucleic acid sequence that is present in the aberrant splice variant but absent in the canonical splice variant. In other embodiments, the aberrant splice variant is identified by detecting the sequence that is specific to the aberrant splice variant in the context of the junction in which it occurs, i.e., the unique sequence is flanked by the sequences which are present on either side of the splice junction in the canonical splice variant. In such cases, the portion of the probe, primer, or other detection reagent that specifically recognizes its target sequence may have a length that corresponds to the length of the aberrant sequence or to or a portion of the aberrant sequence. In other embodiments, the portion of the probe, primer, or other detection reagent that specifically recognizes its target sequence may have a length that corresponds to the length of the aberrant sequence plus the length of a chosen number of nucleotides from one or both of the sequences which flank the aberrant sequence at the splice junction. Generally, the probe or primer should be designed with a sufficient length to reduce non-specific binding. Probes, primers, and other reagents that detect aberrant or canonical splice variants may be designed according to the technical features and formats of a variety of methods for detection of nucleic acids.
SF3B1 Modulators
A variety of SF3B1 modulating compounds are known in the art, and can be used in accordance with the methods described herein. In some embodiments, the SF3B1 modulating compound is a pladienolide or pladienolide analog. A “pladienolid analog” refers to a compound which is structurally related to a member of the family of natural products known as the pladienolides. Plandienolides were first identified in the bacteria Streptomyces platensis (Sakai, Takashi; Sameshima, Tomohiro; Matsufuji, Motoko; Kawamura, Naoto; Dobashi, Kazuyuki; Mizui, Yoshiharu. “Pladienolides, New Substances from Culture of Streptomyces platensis Mer-11107. I. Taxonomy, Fermentation, Isolation and Screening.” The Journal of Antibiotics. 2004, Vol. 57, No. 3). One of these compounds, pladienolide B, targets the SF3B spliceosome to inhibit splicing and alter the pattern of gene expression (Kotake et al., “Splicing factor SF3b as a target of the antitumor natural product pladienolide”, Nature Chemical Biology 3:570-575 [2007]). Certain pladienolide B analogs are described in WO 2002/060890; WO 2004/011459; WO 2004/011661; WO 2004/050890; WO 2005/052152; WO 2006/009276; and WO 2008/126918.
U.S. Pat. Nos. 7,884,128 and 7,816,401, both entitled “Process for Total Synthesis of Pladienolide B and Pladienolide D,” describe methods for synthesizing pladienolide B and D. Synthesis of pladienolide B and D may also be performed using methods described in Kanada et al., “Total Synthesis of the Potent Antitumor Macrolides Pladienolide B and D,” Angew. Chem. Int. Ed. 46:4350-4355 (2007). Kanada et al., U.S. Pat. No. 7,550,503, and International Publication No. WO 2003/099813 (WO '813), entitled “Novel Physiologically Active Substances,” describe methods for synthesizing E7107 (Compound 45 of WO '813) from pladienolide D (11107D of WO '813). In some embodiments, the SF3B1 modulator is pladienolide B. In other embodiments, the SF3B1 modulator is pladienolide D. In further embodiments, the SF3B1 modulator is E7107.
In some embodiments, the SF3B1 modulator is a compound described in U.S. application Ser. No. 14/710,687, filed May 13, 2015, which is incorporated herein by reference in its entirety. In some embodiments, the SF3B1 modulating compound is a compound having one of formulas 1-4 as set forth in Table 2. Table 2. Exemplary SF3B1 modulating compounds.
The methods described herein may be used to evaluate known and novel SF3B1 modulating compounds.
Methods of Treatment
Various embodiments of the invention include treating a patient diagnosed with cancer using an SF3B1 modulator. In certain instances, cancer cells from the patient have been determined to have a mutant SF3B1 protein. Specific SF3B1 mutants include E622D, E622K, E622Q, E622V, Y623C, Y623H, Y623S, R625C, R625G, R625H, R625L, R625P, R625S, N626D, N626H, N626I, N626S, N626Y, H662D, H662L, H662Q, H662R, H662Y, T663I, T663P, K666E, K666M, K666N, K666Q, K666R, K666S, K666T, K700E, V701A, V701F, V701I, I704F, I704N, I704S, I704V, G740E, G740K, G740R, G740V, K741N, K741Q, K741T, G742D, D781E, D781G, or D781N. In certain embodiments, SF3B1 mutants are chosen from K700E, K666N, R625C, G742D, R625H, E622D, H662Q, K666T, K666E, K666R, G740E, Y623C, T663I, K741N, N626Y, T663P, H662R, G740V, D781E, or R625L. In additional embodiments, the cancer cells have been tested to measure the amount of one or more splice variants selected from Table 1. Specific splice variants associated with neomorphic SF3B1 mutations are shown in Table 1 and described in the section on splice variants above.
In certain embodiments, a cancer patient determined to have a mutant SF3B1 protein is treated with an SF3B1 modulator as described in U.S. application Ser. No. 14/710,687, filed May 13, 2015.
To investigate splicing alterations associated with SF3B1 mutations (“SF3B1MUT”) across multiple tumor types, an RNA-Seq quantification and differential splicing pipeline was developed and used to analyze RNA-Seq profiles from the following samples:
RNA-Seq Quantification Methods
Splice junctions were quantified directly from alignments (BAM files) to facilitate discovery of unannotated splice variants. For internally generated RNA-Seq data, reads were aligned to the human reference genome hg19 (GRCh37) by MapSplice and quantified by RSEM against the TCGA GAF 2.1 isoform and gene definition, emulating the TCGA “RNASeqV2” pipeline. Splice junction counts generated by MapSplice were used for downstream processing. For TCGA RNA-Seq data, comprehensive splice junction counts generated by MapSplice were not available; instead TCGA “Level 3” splice junction data reports mapped read counts for a predefined set of splice junctions from reference transcriptomes. To reconstruct genome-wide splice junction counts comparable to internally-generated RNA-Seq samples, raw RNA-Seq alignments (BAM files) were obtained from CGHub and any reads that span across a potential splice junction were directly counted. RSEM-estimated gene expression read counts were gathered directly from the TCGA RNA-SeqV2 Level 3 data matrices.
Because MapSplice only provides exon-exon junction counts, estimates of read counts spanning each intron-exon junction were required for identification of intron-retention splice variants. For every splice junction in each BAM file, reads with at least a 3-bp overhang across each of the 3′ and 5′ intron-exon junctions were counted.
For all manipulation of spliced reads within BAM files, a custom Python module “splicedbam” was used, which uses the “pysam” extension of samtools (Li, H., et al., “The Sequence Alignment/Map format and SAMtools.” Bioinformatics, 2009 Aug. 15; 25(16):2078-9).
In some instances, splice junctions had very low counts, occasionally due to sequencing and alignment errors. Therefore, only splice junctions that had at least a total of 10 counts on average from either SF3B1WT or SF3B11T cohorts were included in downstream analyses.
Differential Splicing Detection Methods
In order to detect differential usage of a splice variant in one cohort relative to another, independent of gene expression changes and pre-defined alternative splicing models, a computational differential splicing pipeline was developed that converts splice junction counts into percentages of junction usage at splice sites with multiple possible junctions. The percentage of junction usage is a measurement of the occurrence of one splice variant relative to all other splice variants that share the same splice site. For instance, a splice variant with an alternative 3′ splice site must share its 5′ splice site with another splice variant. Therefore, for each shared splice site, the raw counts of each splice variant were divided by the total counts of all splice variants that utilize the shared splice site in order to derive a ratio. This ratio was then multiplied by 100 to convert it to a percentage. For each sample, the sum of all of the percentages of splice variants that share the same splice site will equal 100. The transformation of raw counts of each splice variant into a percentage of all splice variants sharing a splice site is itself a normalization to reduce the effect of gene expression changes. The percentages for canonical and aberrant junctions are listed in Table 1 as “Avg WT %” and “Avg Ab. %,” respectively. Differences between these percentages were assessed for statistical significance by using the moderated t-test defined in the Bioconductor's limma package. The statistical p-values were corrected into q values using the Benjamini-Hochberg procedure, and listed as “FDR Q-Values” in Table 1. Any splice variant that satisfied a q value of less than or equal to 0.05 was considered statistically significant.
The conversion of raw junction counts into percentage junction usage can introduce noise in some instances, i.e., when a gene in which a splice variant occurs is expressed in one cohort but has very low expression or is not expressed at all in another cohort. To address this, an additional filtering step was introduced. For each up-regulated splice variant in an SF3B1MUT sample that satisfies the above q value threshold, its corresponding canonical splice variant must be down-regulated in the SF3B1MUT sample and also must also satisfy the q value threshold for the up-regulated splice variant to be considered an aberrant splice variant.
Identification of Aberrant Splice Variants in Neomorphic SF3B1MUT Patient Samples
Initially, this framework was applied to a subset of known SF3B1MUT cancers or wild-type counterparts from The Cancer Genome Atlas (TCGA; luminal A primary breast cancer: 7 SF3B1K700E and 20 SF3B1WT; metastatic melanoma: 4 SF3B1MUT; and 20 SF3B1WT) and internally generated 7 SF3B1MUT and 7 SF3B1WT CLL patient samples. This analysis revealed 626 aberrant splice junctions to be significantly upregulated in SF3B1MUT compared to SF3B1WT. The vast majority of aberrant splicing events use an alternative 3′ss (see Table 1, “Event” column).
The computational screening of aberrant splicing events revealed a pattern of tumor-specific splicing events in breast cancer, melanoma and CLL in neomorphic SF3B1MUT samples (Table 1). In addition, a set of tumor-non-specific events (i.e., splicing events found in at least two tumor types) was observed. Some splice variants of genes with tumor-specific splicing events occur in genes with higher mRNA expression, indicating that some of the observed tumor-specific splicing results from gene expression differences (
To characterize the effect of aberrant splicing in all SF3B1 variants across cancer types, RNA-Seq data for the remaining 70 SF3B1MUT patients from 14 cancer types in TCGA were quantified, and an unsupervised clustering analysis was done using all 136 samples. This clustering separated splicing events associated with neomorphic SF3B1 mutants from those associated with wild-type SF3B1 or non-neomorphic SF3B1 mutants. For example, splicing patterns associated with neomorphic SF3B1 mutants were observed in breast cancer (SF3B1K666E, SF3B1N626D), lung adenocarcinoma (SF3B1K741N, SF3B1G740V), and bladder cancer (SF3B1R625C) patient samples, as splicing events in these samples clustered with those in SF3B1K700E neomorphic samples, whereas the splicing profiles for other SF3B1 mutant samples were similar to those of SF3B1WT samples of the same tumor type. A listing of SF3B1 mutants whose splicing profiles clustered with those of neomorphic SF3B1 mutants is provided in Table 3, column 1. Additional SF3B1 mutations that are predicted to be neomorphic are listed in Table 3, column 2. A schematic diagram showing the locations of all mutations provided in Table 3 is shown in
Aberrant splicing in cell line models was analyzed by collecting RNA-Seq profiles for a panel of cell lines with endogenous SF3B1 neomorphic mutations (pancreatic adenocarcinoma Panc 05.04: SF3B1Q699H/K700E double mutant; metastatic melanoma Colo829: SF3B1P718L; and lung cancer NCI-H358: SF3B1A745V; obtained from the American Type Culture Collection [ATCC] or RIKEN BioResource Center and cultured as instructed) and from several SF3B1WT cell lines from either the same tumor types (pancreatic adenocarcinoma Panc 10.05, HPAF-II, MIAPaCa-2, Panc04.03, PK-59, lung cancer NCI-H358, NCI-H1792, NCI-H1650, NCI-H1975, NCI H1838) or normal control cells of the same patient (Epstein-Barr virus [EBV]-transformed B lymphoblast colo829BL). RNA-Seq profiles were also collected from isogenic pre B-cell lines (Nalm-6) engineered via AAV-mediated homology to express SF3B1K700E (Nalm-6 SF3B1K700E) or a synonymous mutation (Nalm-6 SF3B1K700K). The isogenic cell lines Nalm-6 SF3B1K700E and Nalm-6 SF3B1K700K generated at Horizon Discovery, were cultured in presence of Geneticin (0.7 mg/ml, Life Technologies) for selection. All RNA-Seq analysis was performed using the same pipeline described for patient samples in Example 1. Unsupervised clustering of cell lines using the aberrant splice junctions identified in patients resulted in clear segregation of Panc 05.04 and Nalm-6 SF3B1K700E from wild-type and other SF3B1-mutant cells.
A NanoString® assay was developed to quantify aberrant and canonical splice variants and was validated using the same cell panel. For the NanoString® assay, 750 ng of purified total RNA was used as template for the nCounter® (NanoString Technologies®) expression assay using a custom panel of NanoString® probes. The sample preparation was set up as recommended (NanoString® Technologies protocol no. C-0003-02) for an overnight hybridization at 65° C. The following day, samples were processed through the automated nCounter® Analysis System Prep Station using the high sensitivity protocol (NanoString® Technologies protocol no. MAN-00029-05) followed by processing through the nCounter® Analysis System Digital Analyzer (protocol no. MAN-00021-01) using 1150 FOVs for detection. Data was downloaded and analyzed for quality control metrics and normalization using the nSolver™ Analysis Software (NanoString Technologies®). The data was first normalized for lane-to-lane variation using the positive assay controls provided by the manufacturer (NanoString® positive controls A-F [containing in vitro transcribed RNA transcripts at concentrations of 128 fM, 32 fM, 8 fM, 2 fM, 0.5 fM, and 0.125 fM, each pre-mixed with NanoString® Reporter CodeSet probes])). Any samples with normalization factors <0.3 and >3 were not considered for further analysis. This was followed by content normalization using the geo-mean of GAPDH, EEF1A1 and RPLP0. All samples were within the recommended 0.1-10 normalization factor range. Each normalized value was then checked to ensure that it was at least two standard deviations higher than the average of background signal recorded for that lane. Any value below that was considered below detection limit. These normalized values were taken for further bioinformatics and statistical analysis.
As observed in the RNA-Seq analysis, only the Panc 05.04 and isogenic Nalm-6 SF3B1K700E cell lines showed clear presence of aberrant splicing (
Analysis of SF3B1 Mutant SF3B1Q699H
The Panc 05.04 cell line carries the neomorphic mutation SF3B1K700E and an additional mutation at position 699 (SF3B1Q699H). To evaluate the functional relevance of this second mutation, SF3B1Q699H and SF3B1K700E mutant SF3B1 proteins were expressed alone or in combination in 293FT cells (
Expression of SF3B1K700E and SF3B1Q699H/K700E induced aberrant splicing, whereas SF3B1Q699H alone or SF3B1A745V or SF3B1R1074H (a substitution conferring resistance to the spliceosome inhibitor pladienolide B) did not induce aberrant splicing (
These data confirm that Panc 05.04 and Nalm-6 SF3B1K700E isogenic cells are representative models to study the functional activity of SF3B1 neomorphic mutations and the activity of splicing inhibitors in vitro and in vivo.
The functional activity of neomorphic mutations found in SF3B1MUT cancers was analyzed by expressing SF3B1WT, neomorphic SF3B1 mutants, or SF3B1K700R (the mutation observed in a renal clear cell carcinoma patient that clusters with SF3B1WT patients) in 293FT cells and determining splicing aberrations by NanoString®. The expression of all constructs was confirmed by western blot (
The correlation between the SF3B1K700E neomorphic mutation and aberrant splicing was analyzed using tetracycline-inducible shRNA to selectively knockdown the neomorphic SF3B1 mutant or SF3B1WT allele in Panc 05.04 and Panc 10.05 cell lines (neomorphic SF3B1MUT and SF3B1WT cell lines, respectively; obtained from the American Type Culture Collection [ATCC] or from RIKEN BioResource Center and cultured as instructed).
For the knockdown experiment, virus encoding shRNA was prepared in LentiX-293T cells (Clontech), which were cultured according to the manufacturer's instruction. The inducible shRNA were cloned into AgeI and EcoRI of the pLKO-iKD-H1 euro vector. The sequences of hairpins were:
Cells were transfected with 2.4 μg of target pLKO-shRNA plasmid, plus 2.4 μg of p Δ 8.91 (packaging), and 0.6 μg VSVG (envelope) using TransIT reagent (Mirus). The virus was used to infect Panc 05.04 and Panc 10.05 by spin infection using Polybrene (Millipore). The day after infection, the cells were cultured in selecting media (1.25 μg/ml Puromycin [Life Technologies]) for 7 days to select for shRNA-expressing cells. The selected cells were cultured in the presence or absence of Doxycycline hyclate (100 ng/mL; Sigma) to induce the shRNA. Cells were harvested for protein and RNA at day 4 post-induction. In addition, cells were seeded for colony forming assay and CellTiter-Glo® assay (Promega). At day 9, cells were fixed with formaldehyde and stained with crystal violet.
To confirm SF3B1 knockdown using western blots, protein extracts were prepared by lysing the cells with RIPA (Boston BioProducts). Twenty to 25 μg of protein from each sample was separated by SDS-PAGE and transferred to nitrocellulose membranes (iblot, Life Technologies). Membranes were first blocked with Odyssey Blocking Buffer (Li-Cor) and then incubated with SF3B1 antibody (a-SAP 155, MBL) and anti-GAPDH (Sigma). Li-Cor donkey-anti-mouse 800CW and Li-Cor donkey-anti-rabbit 800CW were used as secondary antibodies and detected by Odyssey imager (Li-Cor).
To confirm SF3B1 knockdown by allele specific qPCR, RNA was isolated from the cells and retrotranscribed using MagMax for Microarray and Superscript VILO II (Life Technologies), respectively according to the manufacturer manual. qPCR was performed using ViiA7 (Life Technologies). The reaction included 20-50 ng cDNA, Power SYBR green master mix (Life Technologies) and 300 nM primers. The following primers were used:
Biological and technical triplicates were performed.
The western blotting and allele specific PCR both confirmed knockdown of the SF3B1 alleles (
To determine the association between the expression of SF3B1 mutations and aberrant splicing, RNA isolated from the cells following doxycycline-induced knockdown was analyzed by NanoString®. In Panc 05.04, after knockdown of the neomorphic SF3B1MUT allele, the aberrant splice variants were downregulated and the canonical splice variants were upregulated, whereas the opposite was observed with selective depletion of the SF3B1WT allele (
Overall Effect of E7107 on Splicing
E7107 is a small-molecule compound that inhibits splicing by targeting the U2 snRNP-associated complex SF3B (Kotake, Y. et al. “Splicing factor SF3b as a target of the antitumor natural product pladienolide.” Nat Chem Biol 3, 570-575, doi:10.1038/nchembio.2007.16 [2007]). The ability of E7107 to inhibit splicing was observed in an in vitro splicing assay (IVS) using the substrate Ad2 (Pellizzoni, L., Kataoka, N., Charroux, B. & Dreyfuss, G. “A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing.” Cell 95, 615-624 [1998]) and nuclear extracts from the Nalm-6 isogenic cell lines or 293F cells (Life Technologies; cultured according to the manufacturer's instructions) expressing Flag-tag SF3B1WT or SF3B1K700E, as follows.
Nuclear extracts were prepared from 293F cells transfected with pFLAG-CMV-2-SF3B1 plasmids, or from isogenic Nalm-6 cells (SBH Sciences). The plasmids were generated by cloning the mxSF3B1 gene into the HindIII and KpnI sites of pFLAG-CMV2 (Sigma), and the mutations mxSF3B1K700E, mxSF3B1R1074H and mxSF3B1K700E-R1074H were introduced using the same site-directed mutagenesis kit. Cell pellets were resuspended in hypotonic buffer (10 mM HEPES pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.2 mM PMSF, and 0.5 mM DTT; for Nalm-6 cells, 40 mM KCl was used). The suspension was brought up to a total of five packed cell volumes (PCV). After centrifugation, the supernatant was discarded, and the cells were brought up to 3 PCV with hypotonic buffer, and incubated on ice for 10 minutes. Cells were lysed using a dounce homogenizer and then centrifuged. The supernatant was discarded, and the pellet was resuspended with ½ packed nuclear volume (PNV) of low salt buffer (20 mM HEPES pH 7.9, 1.5 mM MgCl2, 20 mM KCl, 0.2 mM EDTA, 25% glycerol, 0.2 mM PMSF, 0.5 mM DTT), followed by ½ PNV of high salt buffer (same as low salt buffer except 1.4M KCl was used). The nuclei were gently mixed for 30 minutes before centrifuging. The supernatant (nuclear extract) was then dialyzed into storage buffer (20 mM HEPES pH 7.9, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 0.2 mM PMSF, 0.5 mM DTT). Protein concentration was determined using NanoDrop 8000 UV-Vis spectrophotometer (Thermo Scientific).
For in vitro splicing (IVS) reactions, an Ad2-derived sequence (Pellizzoni, L., Kataoka, N., Charroux, B. & Dreyfuss, G. “A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing.” Cell 95, 615-624 [1998]) was cloned into the pGEM-3Z vector (Promega) using EcoRI and XbaI restriction sites. The resulting pGEM-3Z-Ad2 plasmid was linearized using XbaI, purified, resuspended in TE buffer, and used as a DNA template in the in vitro transcription reaction. The Ad2 pre-mRNA was generated and purified using MEGAScript T7 and MegaClear kits, respectively (Invitrogen). Twenty μL splicing reactions were prepared using 80 μg nuclear extracts, 20U RNAsin Ribonuclease inhibitor (Promega), 10 ng Ad2 pre-mRNA, and varying concentrations of E7107. After a 15 minute pre-incubation, activation buffer (0.5 mM ATP, 20 mM creatine phosphate, 1.6 mM MgCl2) was added to initiate splicing, and the reactions were incubated for 90 minutes. RNA was extracted using a modified protocol from a RNeasy 96 Kit (Qiagen). The splicing reactions were quenched in 350 μL Buffer RLT Plus (Qiagen), and 1.5 volume ethanol was added. The mixture was transferred to an RNeasy 96 plate, and the samples were processed as described in the kit protocol. RNA was diluted 1/10 with dH2O. 10 μL RT-qPCR reactions were prepared using TaqMan RNA-to-CT 1-step kit (Life Technologies), 8.5 μL RNA, and 1 μL of Ad2 mRNA primers/probe set (FW 5′ ACTCTCTTCCGCATCGCTGT (SEQ ID NO: 1191), RW 5′-CCGACGGGTTTCCGATCCAA (SEQ ID NO: 1192) and probe 5′ CTGTTGGGCTCGCGGTTG (SEQ ID NO: 1193)).
To evaluate pSF3B1, in vitro splicing reactions were prepared as described above. To quench the reactions, 6× Laemmli Buffer (Boston Bioproducts) was added, and the samples were subjected to SDS-PAGE gels (Life Technologies). The separated proteins were transferred onto nitrocellulose membranes then blocked with blocking buffer (50% Odyssey Blocking Buffer (Li-Cor Biosciences) and 50% TBST). The blots were incubated with anti-SF3B1 antibody overnight, after several washes in TBST, they were incubated with IRDye 680LT donkey-α-mouse-IgG antibody and visualized using an Odyssey CLx imaging system (Li-Cor Biosciences).
E7107 was able to inhibit splicing in nuclear extracts from both the Nalm-6 cells or the 293F cells expressing Flag-tag SF3B1WT or SF3B1K700E (
E7107 Binds Both SF3B1WT and SF3B1K700E Proteins
The ability of E7107 to bind both SF3B1WT and SF3B1K700E proteins was evaluated in a competitive binding assay using Flag-tag SF3B1 proteins immunoprecipitated with anti-Flag antibody from transiently transfected 293F cells. Batch immobilization of antibody to beads was prepared by incubating 80 μg of anti-SF3B1 antibody (MBL International) and 24 mg anti-mouse PVT SPA scintillation beads (PerkinElmer) for 30 minutes. After centrifugation, the antibody-bead mixture was resuspended in PBS supplemented with PhosSTOP phosphatase inhibitor cocktail (Roche) and complete ULTRA protease inhibitor cocktail (Roche). Nuclear extracts were prepared by diluting 40 mg into a total volume of 16 mL PBS with phosphatase and protease inhibitors, and the mixture was centrifuged. The supernatant was transferred into a clean tube, and the antibody-bead mixture was added and incubated for two hours. The beads were collected by centrifuging, washed twice with PBS+0.1% Triton X-100, and resuspended with 4.8 mL of PBS. 100 μL binding reactions were prepared using slurry and varying concentrations of E7107. After 15 minutes pre-incubation at room temperature, one nM 3H-probe molecule (described in Kotake, Y. et al. Splicing factor SF3b as a target of the antitumor natural product pladienolide. Nat Chem Biol 3, 570-575, doi:10.1038/nchembio.2007.16 [2007]) was added. The mixture was incubated at room temperature for 15 minutes, and luminescence signals were read using a MicroBeta2 Plate Counter (PerkinElmer).
As shown in
Effect of E7107 and Other Compounds on Normal and Aberrant Splicing
E7107 was also tested in vitro in Nalm-6 isogenic cell lines for the ability to modulate normal and aberrant splicing induced by SF3B1WT and SF3B1K700E protein. Nalm-6 isogenic cells were treated with increasing concentrations of E7107 for six hours and RNA was analyzed by qPCR. As shown in
To investigate the broader activity of E7107 on normal and aberrant splicing, RNA from Nalm-6 isogenic cells treated for two and six hours at 15 nM was analyzed by NanoString®. Only partial inhibition of splicing was observed at two hours in both isogenic cell lines, and at the level of gene, WT-associated isoforms, and MUT-associated isoform expression. After six hours of treatment, clear inhibition was detected for all isoforms quantified (
In addition, the ability of E7107 to modulate splicing was tested in mice bearing human tumor xenografts. Nalm-6 isogenic xenograft mice were generated by subcutaneously implanting 10×106 Nalm-6 isogenic cells into the flank of CB17-SCID mice, and tumors from these mice were collected at different timepoints after a single intravenous (IV) dose of E7107 (5 mg/kg) and analyzed to determine compound concentrations and splicing regulation. RNA was isolated from the tumors using RiboPure™ RNA purification kit (Ambion®) and used for NanoString® assay or qPCR. The RNA was retrotranscribed according to the instructions of the SuperScript® VILO™ cDNA synthesis kit (Invitrogen™) and 0.04 μl of cDNA was used for qPCR. qPCR for pre-mRNA EIF4A1 and mature mRNA SLC24A19 and pharmacokinetic evaluation were performed as described in Eskens, F. A. et al. “Phase I pharmacokinetic and pharmacodynamic study of the first-in-class spliceosome inhibitor E7107 in patients with advanced solid tumors.” Clin Cancer Res 19, 6296-6304, doi:10.1158/1078-0432.CCR-13-0485 (2013). The primers and probes used for ZDHHC16 were the following: FW 5′-TCTTGTCTACCTCTGGTTCCT (SEQ ID NO: 1194), RW 5′ CCTTCTTGTTGATGTGCCTTTC (SEQ ID NO: 1195) and probe 5′ FAM CAGTCTTCGCCCCTCTTTTCTTAG (SEQ ID NO: 1196). The primers and probes used for COASY were the following: FW 5′-CGGTGGTGCAAGTGGAA (SEQ ID NO: 1197), RW 5′-GCCTTGGTGTCCTCATTTCT (SEQ ID NO: 1198) and probe 5′-FAM-CTTGAGGTTTCATTTCCCCCTCCC (SEQ ID NO: 1199). E7107 reached similar drug concentrations and modulated canonical splicing (accumulation of pre-mRNA for EIF4A1 and downregulation of the mature mRNA SLC25A19) in both Nalm-6 SF3B1K700K and Nalm-6 SF3B1K700E models and downregulated abnormal splicing of COASY and ZDHHC16 in the Nalm-6 SF3B1K700E cells (
SF3B1 modulator E7107 was tested for antitumor activity in vivo by determining the effect of E7107 in a subcutaneous model of Nalm-6 SF3B1K700E. 10×106 Nalm-6 SF3B1K700E were subcutaneously implanted into the flank of CB17-SCID mice, and mice were administered E7107 intravenously once a day for 5 consecutive days (QD×5) at three well tolerated dose levels (1.25, 2.5 and 5 mg/kg). After this dosing, the animals were monitored until they reached either of the following endpoints: 1) excessive tumor volume measured three times a week (tumor volume calculated by using the ellipsoid formula: (length×width)/2), or 2) development of any health problem such as paralysis or excessive body weight loss. Partial regression (PR) and complete regression (CR) are defined as 3 consecutive tumor measurements <50% and <30% of starting volume respectively.
In the 1.25 mg/kg group, all animals (n=10) reached complete regression (CR) in the Nalm-6 SF3B1K700E xenograft group. In the 2.5 mg/kg group, 10/10 CRs were observed in the Nalm-6 SF3B1K700E group by day 9. In the 5 mg/kg group all Nalm-6 SF3B1K700E xenograft animals reached CR as early as 9 days post treatment and had mean survival times of over 250 days (
The ability of E7107 to inhibit splicing in CLL patient samples in vitro was determined by isolating RNA from samples of E7107-treated patient cells treated for 6 hours with E7107 at 10 nM and performing RNA-Seq analysis. To do so, cells were washed with PBS after treatment with E7107, and RNA was isolated using PureLink (Life Technology) as reported in the manufacturer's manual. cDNA library preparation, sequencing and raw read filtering was performed as described in Ren, S. et al. “RNA-Seq analysis of prostate cancer in the Chinese population identifies recurrent gene fusions, cancer-associated long noncoding RNAs and aberrant alternative splicings.” Cell Res 22, 806-821, doi:10.1038/cr.2012.30 (2012). As shown in
Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
The present application is a national stage application under 35 U.S.C. § 371 of international application number PCT/US2016/049490, filed Aug. 30, 2016, which designated the U.S. and claims the benefit of priority to U.S. Provisional Patent Application No. 62/212,876, filed Sep. 1, 2015, the contents of which are hereby incorporated by reference herein in their entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2016/049490 | 8/30/2016 | WO | 00 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2017/040526 | 3/9/2017 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 7550503 | Kotake et al. | Jun 2009 | B2 |
| 7816401 | Kanada et al. | Oct 2010 | B2 |
| 7884128 | Kanada et al. | Feb 2011 | B2 |
| 7919237 | Dimitrov et al. | Apr 2011 | B2 |
| 8519115 | Dahl | Aug 2013 | B2 |
| 9481669 | Keaney et al. | Nov 2016 | B2 |
| 20100021918 | Mizui | Jan 2010 | A1 |
| 20140364439 | Wu | Dec 2014 | A1 |
| Number | Date | Country |
|---|---|---|
| 2013184887 | Sep 2013 | JP |
| WO 0160890 | Aug 2001 | WO |
| WO 0175067 | Oct 2001 | WO |
| WO 2003099813 | Sep 2005 | WO |
| WO 2004011459 | Nov 2005 | WO |
| WO 2004011661 | Nov 2005 | WO |
| WO 2004050890 | Mar 2006 | WO |
| WO 2005052152 | Jun 2007 | WO |
| WO 2006009276 | May 2008 | WO |
| WO 2008126918 | Jul 2010 | WO |
| WO 2013070521 | May 2013 | WO |
| WO 2014165753 | Oct 2014 | WO |
| Entry |
|---|
| Buonamici et al Blood. Dec. 2014. 124.21 (Year: 2014). |
| Buonamici et al (Haematologica. Jun. 2014. Suppl 1 99: 227 (Year: 2014). |
| Bonnal et al., (2012) “The spliceosome as a target of novel antitumour drugs”, Nat. Rev. Drug Discov., 11:847-859. |
| Convertini et al., (2014) “Sudemycin E influences alternative splicing and changes chromatin modifications”, Nucleic Acids Research, 42(8):4947-4961. |
| Cummings et al., (2017) “Improving genetic diagnosis in Mendelian disease with transcriptome sequencing”, Science Translational Medicine, 9:1-11. |
| Database Geneseq (2002) “DNA encoding novel human diagnostic protein #543”, Database accession No. AAS64739. |
| Database EMBL (2005) “Homo sapiens cDNA clone SKMUS2007303, 5′ end, mRNA sequence”, Database accession No. DA898882. |
| Database EMBL (2007) “Homo sapiens cDNA, clone LYMPB2001721, 5′ end, mRNA sequence”, Database accession No. DC428363. |
| Database EMBL (2009) “Homo sapiens cDNA FLJ59337 complete eds, highly similar to DCC-interacting protein 13 beta”, Database accession No. AK297100. |
| Eskens et al., (2013) “Phase I pharmacokinetic and pharmacodynamic study of the first-in-class spliceosome inhibitor E7107 in patients with advanced solid tumors”, Clin. Cancer Res., 19:6296-6304. |
| Furney et al., (2013) “SF3B1 Mutations Are Associated with Alternative Splicing in Uveal Melanoma”, Cancer Discovery, 3(10):1122-1129. |
| Gentien et al., (2014) “A common alternative splicing signature is associated with SF3B1 mutations in malignancies from different cell lineages”, Leukemia, 28(6):1355-1357. |
| International Patent Application No. PCT/US2016/049490, filed Aug. 30, 2016, by Eisai R&D Management Co., Ltd.: International Search Report and Written Opinion, dated Mar. 14, 2017. |
| Jayasinghe et al., (2018) “Systematic Analysis of Splice-Site-Creating Mutations in Cancer”, Cell Reports, 23:270-281. |
| Johnson et al., (2003) “Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays”, Science, 302:2141-2144. |
| Kanada et al., (2007) “Total Synthesis of the Potent Antitumor Macrolides Pladienolide B and D”, Angew. Chem. Int. Ed., 46:4350-4355. |
| Kimura et al., (2006) “Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes”, Genome Research, 16(1):55-65. |
| Kotake et al., (2007) “Splicing factor SF3b as a target of the antitumor natural product pladienolide”, Nature Chemical Biology, 3:570-575. |
| Kulkarni et al., (2011) “Digital Multiplexed Gene Expression Analysis Using the NanoString nCounter System”, Current Protocols in Molecular Biology, 94:25. |
| Li et al., (2009) “The Sequence Alignment/Map format and SAMtools”, Bioinformatics, 25(16):2078-2079. |
| Maguire et al., (2014) “575 SF3B1 mutations are associated with alternative splicing in ER-positive breast cancer”, European Journal of Cancer, 50:186. |
| McCullough et al., (2005) “High throughput alternative splicing quantification by primer extension and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry”, Nucleic Acids Research, 33(11):e99. |
| Milani et al., (2006) “Detection of alternatively spliced transcripts in leukemia cell lines by minisequencing on microarrays”, Clin. Chem., 52:202-211. |
| Modrek et al., (2001) “Genome-wide detection of alternative splicing in expressed sequences of human genes”, Nucleic Acids Res., 29:2850-2859. |
| Pellizzoni et al., (1998) “A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing”, Cell, 95:615-624. |
| Prigodich et al., (2012) “Multiplexed Nanoflares: mRNA Detection in Live Cells”, Anal. Chem., 84(4):2062-2066. |
| Ren et al., (2012) “RNA-Seq analysis of prostate cancer in the Chinese population identifies recurrent gene fusions, cancer-associated long noncoding RNAs and aberrant alternative splicings”, Cell. Res., 22:806-821. |
| Sakai et al., (2004) “Pladienolides, New Substances from Culture of Streptomyces platensisMer-11107. I. Taxonomy, Fermentation, Isolation and Screening”, The Journal of Antibiotics, 57(3):173-179. |
| Seferos et al., (2007) “Nano-flares: Probes for Transfection and mRNA Detection in Living Cells”, J. Am. Chem. Soc., 129(50):15477-15479. |
| “Tissue-Specific Transcriptome Used to Enhance Exome-, Genome-Based Dystrophy Diagnoses”, Genome Web, 2 pages (Apr. 19, 2017). |
| Van Dijk et al., (2014) “Ten years of next generation sequencing technology”, Trends Genet., 30(9):418-426. |
| Wan et al., (2013) “SF3B1 mutations in chronic lymphocytic leukemia”, Blood, 121(23):4627-4634. |
| Wan et al., (2013) “SF3B1 Mutation Alters the Selection of 3′ RNA Splice Sites in Chronic Lymphocytic Leukemia”, Blood, 122(21):117. |
| Wang et al., (2011) “SF3B1 and Other Novel Cancer Genes in Chronic Lymphocytic Leukemia”, New England Journal of Medicine, 365(26):2497-2506. |
| Wang et al., (2012) “RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues”, J. Mol. Diagn., 14(1):22-29. |
| Yokoi et al., (2011) “Biological validation that SF3b is a target of the antitumor macrolide pladienolide”, FEBS J., 278:4870-4880. |
| Darman et al., (2015) “Cancer-Associated SF3B1 Hotspot Mutations Induce Cryptic 30 Splice Site Selection through Use of a Different Branch Point”, Cell Reports 13(5):1033-1045. |
| Yoshida et al., (2011) “Frequent pathway mutations of splicing machinery in myelodysplasia”, Nature, 478:64-69. |
| Number | Date | Country | |
|---|---|---|---|
| 20180318312 A1 | Nov 2018 | US |
| Number | Date | Country | |
|---|---|---|---|
| 62212876 | Sep 2015 | US |
