Support, printed material and reagent kit having enzyme fixed thereon, method for preparing the support, method of storing enzyme and method for restoration enzymes

FIELD OF THE INVENTION

The present invention relates to a support, a printed material and a reagent kit having an enzyme fixed thereon, a method for preparing the support, a method for storing an enzyme, and a method for restoring an enzyme.

BACKGROUND ART

Enzymes are proteins having catalytic activities and are involved in various biological reactions. Thus, enzymes contribute to the maintenance of life.

Enzymes are unstable at room temperature in the presence of moisture. Hence, enzymes are stored in a freeze-dried form or stored in a liquid containing a stabilizing agent at temperatures of −20° C. or below.

Polymerase chain reaction (PCR) is a reaction for the amplification of a nucleic acid, which is catalyzed by an enzyme called “a DNA polymerase”. A DNA polymerase is usually stored in a buffer at a temperature of −20° C. For this storage, a freezer is needed. When the enzyme is delivered from a supplier to a user, it is packaged in a container such as a container made of foamed polystyrene together with dry ice. These storage/delivery systems require specialized facilities and operations and, therefore, they are complicated and costly.

DISCLOSURE OF THE INVENTION
Problems to be Resolved by the Invention

The object of the present invention is to provide a simple method for storing an enzyme.

MEANS FOR RESOLVING THE PROBLEMS

The present inventors have found that, when a DNA polymerase is fixed on a support as a mixture with trehalose for storage purpose and PCR is then performed using the support, the PCR reaction successfully proceeds. Based on this finding, the present invention has been accomplished.

The subject matters of the present invention are as follows.

- (1) A support comprising an enzyme and a protecting agent for the enzyme fixed thereon.
- (2) The support according to item 1, wherein the protecting agent is at least one chemical compound selected from the group consisting of trehalose and derivatives thereof.
- (3) The support according to items 1 or 2, further comprising an enhancer for enzymatic reaction.
- (4) The support according to any one of items 1 to 3, further comprising an aptamer for the enzyme thereon.
- (5) A support comprising an enzyme and an aptamer for the enzyme fixed thereon.
- (6) The support according to any one of items 1 to 5, wherein the enzyme is a DNA polymerase.
- (7) The support according to item 6, further comprising a primer for the amplification of a nucleic acid of interest by a nucleic acid amplification reaction using the DNA polymerase.
- (8) The support according to item 6, further comprising at least one member selected from the group consisting of a nucleic acid which serves as a template for the nucleic acid amplification reaction using the DNA polymerase, a primer for the amplification of the nucleic acid, and a buffer for the nucleic acid amplification reaction.
- (9) A printed material comprising a support as recited in any one of items 1 to 8.
- (10) A reagent kit comprising a support as recited in any one of items 1 to 8.
- (11) A method for preparation of a support as recited in item 1, comprising: preparing a mixed solution of an enzyme and a protecting agent for the enzyme; applying the solution onto a support; and drying the support to fix a mixture of the enzyme and the protecting agent on the support.
- (12) A method for restoration of an enzyme fixed on a support, comprising: immersing a support as recited in any one of items 1 to 8 in a liquid to leach out the enzyme into the liquid.
- (13) A method for amplification of a nucleic acid, comprising: placing a support as recited in any one of items 6 to 8 in a liquid to leach out a DNA polymerase from the support; and performing a nucleic acid amplification reaction using the DNA polymerase.

The present invention also provides a method for storage of an enzyme in the form of being fixed on a support as a mixture with a protecting agent for the enzyme.

The present invention also provides a method for amplification of a nucleic acid, comprising: placing a support as recited in item (7) in a liquid to leach out a DNA polymerase and at least one member selected from the group consisting of a nucleic acid which serves as a template, primers for amplifying the nucleic acid and a buffer for the amplification reaction for the nucleic acid from the support; and performing the nucleic acid amplification reaction using the DNA polymerase and the nucleic acid which serves as a template and/or the primers.

Hereinbelow, the present invention will be described in detail.

The present invention provides a support having an enzyme and a protecting agent for the enzyme fixed thereon.

The enzyme may be any one as long as it has any catalytic activity. Examples of the enzyme include, but are not limited to, a DNA polymerase, an RNA polymerase, a reverse transcriptase, an RNase, a restriction enzyme, a methylase, a modifying enzyme, a ligase, a protease, a kinase, a phosphatase, a transferase, a glycosilase, a topoisomerase and a clonase.

The protecting agent may be any one as long as it can protect an enzyme from drying and store the enzyme stably. Examples of the protecting agent include trehalose and derivatives thereof, polysaccharides, PEG, dextran, Ficol, glycerol, surfactants, and PVA and derivatives thereof. Trehalose and derivatives thereof are particularly effective.

The protecting agent may be a commercially available product or may be synthesized according to any known method.

Trehalose is a non-reductive disaccharide composed of two 1,1-bonded D-glucose molecules and has three types of isomers: α, α-, α, β- and β,β-isomers, depending on the bonding manner.

Examples of the derivatives of trehalose include, but are not limited to, acid esters (e.g., fatty acid esters such as laureate, oleate, linoleate, linolenate, stearate, palmitate and myristate; carboxylates such as acetate and benzoate; and sulfate); alkyl ethers (e.g., ethers with C_8-25alkyls); halides, nitrogen-containing derivatives and sulfur-containing derivatives of trehalose.

Trehalose and derivatives thereof are commercially available, but may be produced by any known method. The methods for production of trehalose and derivatives thereof can be found in, for example, “Developments in Food Carbohydrates”, edited by C. K. Lee, issued by Applied Science Publishers, pp. 1-89, 1980; “Chemical and Pharmaceutical Bulletin”, K. Yoshimoto et. al., vol. 30, No. 4, pp. 1,169-1, 174, 1982; and Japanese Patent Application Laid-open No. 8-157491.

The protecting agent may be mixed with the enzyme in an amount of 10⁻⁵to 10¹M/U enzyme, preferably 10⁻⁴to 10⁻¹M/U enzyme.

On the support, an enhancer for enzymatic reaction may also be fixed. The enzymatic reaction enhancer may be any substance as long as it has an effect of enhancing the desired enzymatic reaction. The effect of enhancing the desired enzymatic reaction includes an effect of preventing the inhibition of the desired enzymatic reaction. Examples of the enzymatic reaction enhancer include, but are not limited to, sodium oxalate, potassium oxalate, sodium malonate, sodium maleate, dimethyl sulfoxide, betaines, glycerol, albumin, surfactants (e.g., Tween 20, Triton X100 and NP40), polyamines (e.g., ethylenediamine, trimethylenediamine, spermine, spermidine, diethylenetriamine, triethylenetetramine, tetraethylenepentamine, pentaethylenehexamine, 1,4-bis(3-aminopropyl)-piperazine, 1-(2-aminoethyl)piperazine, 1-(2-aminoethyl)piperidine, 1,4,10,13-tetraoxa-7,16-diazacyclooctadecane and tris(2-aminoethyl)amine), saccharides (e.g., glucose, fructose, galactose, maltose, sucrose, lactose and polysaccharides), sulfated polysaccharides and salts thereof (e.g., heparin, dextran sulfate), dithiothreitol, polyanions (e.g., DNA, RNA), polyhydric alcohols (e.g., aliphatic polyhydric alcohols such as ethylene glycol, propylene glycol, butanediol, hexanediol, octanediol, glycerin, sorbitan, trimethylol propane and neopentylglycol, diethylene glycol, triethylene glycol, polyethylene glycol and polypropylene glycol), ammonium sulfate and quaternary ammonium salts (e.g., hexadecyltrimethylammonium bromide, hexadecylpyridinium chloride, hexadimethrine bromide, hexafluorenium bromide and methylazolinium bromide). The enzymatic reaction enhancer includes, for example, Ampdirect® (Shimadzu Corporation), which is effective for enhancement of reactions with a DNA polymerase.

The enzymatic reaction enhancer may be fixed on the support in an appropriate amount. For example, a polyamine may be fixed on the support so that the polyamine is present in a reaction solution at a concentration of about 10 to 0.01 mM, preferably 2 to 0.5 mM. The enzymatic reaction enhancer may be fixed on the support in the same or different position as or from that of the mixture of the enzyme and the protecting agent.

The support may be any one as long as it can fix thereon the mixture of the enzyme and the protecting agent. Examples of the support include, but are not limited to, paper such as 60MDP paper (a product by Mishima Paper Co., Ltd., Japan), copy paper, woodfree paper, mechanical paper, kent paper, drawing paper, craft paper, paper for inkjet printing, tracing paper, Japanese paper, board paper, filter paper; glass substrates; silicon substrates; beads; column fillers; silica gel; nitrocellulose membrane; nylon membrane; and PVA membrane.

The support may have a thickness of 1 mm or less, for example. With a very small thickness (for example, about 0.1 mm), the workability of the support can be improved even if a number of enzyme- and protecting agent-fixed supports are stacked for distribution purposes, because the supports are not so bulky.

In addition to the enzyme and the protecting agent, the support may further comprise other components fixed thereon, such as a polynucleotide (e.g., DNA, RNA, a derivative or modified form thereof), an oligonucleotide (e.g., DNA, RNA, a derivative or modified form thereof), a protein (e.g., an antibody, a hormone), a polypeptide, an oligopeptide, a polysaccharide, an oligosaccharide, PNA, a low molecular compound (e.g., EDTA, a salt contained in a PCR buffer composition, Mg²⁺, a dNTP mixture) and a mixture thereof. The components other than the enzyme and the protecting agent may be fixed on the support in the same or different position as or from that of the mixture of the enzyme and the protecting agent. In particular, it is preferred that an aptamer for the enzyme be also fixed on the support. Accordingly, the present invention provides a support comprising an enzyme and an aptamer for the enzyme fixed thereon.

In one preferred embodiment of the present invention, in addition to the DNA polymerase and the protecting agent for the DNA polymerase, the support may further comprise primers for amplifying a nucleic acid of interest by nucleic acid amplification reaction using the DNA polymerase. The support of this type can be used in genotyping and identification of species. The support may further comprise an enhancer for the enzymatic reaction.

In another preferred embodiment of the present invention, in addition to the DNA polymerase and the protecting agent for the DNA polymerase, the support may further comprise at least one member selected from the group consisting of a nucleic acid which serves as a template for a nucleic acid amplification reaction (e.g., PCR) using the DNA polymerase, a primer for amplifying the nucleic acid, and a buffer for the nucleic acid amplification reaction. The support may also comprise an enhancer for enzymatic reaction.

For example, when a DNA polymerase is fixed on paper (support) for storage purpose, in addition to the DNA polymerase and the protecting agent, the paper may further have a set of primers (oligonucleotides), DNA which serves as a template for PCR reaction (which may be synthetic single- or double-stranded DNA or a vector having cDNA cloned therein), an aptamer for the DNA polymerase (functional RNA), components to be contained in a PCR reaction solution (i.e., Tris-HCl, KCl, MgCl, a dNTP mixture, etc.), EDTA and the like fixed thereon. In this case, fixation of these components may be achieved by any one of the following procedures: (1) the DNA polymerase, the protecting agent and the primer set are fixed together on the paper as a single spot, and the DNA as a template for PCR reaction, Tris-HCl and EDTA are fixed together on the paper as a separate single spot; (2) the DNA polymerase, the protecting agent, the primer set and, if required, an aptamer for the DNA polymerase are fixed together on the paper as a single spot; or (3) all of the components required for PCR reaction (i.e., DNA as a template for PCR reaction, the DNA polymerase, the primer set, Tris-HCl, KCl, MgCl, a dNTP mixture and the like and, if required, an aptamer for the DNA polymerase) together with the protecting agent are fixed on the paper as a single spot. For ease of distinction of the component (e.g., a DNA polymerase) spotted on paper, the component to be spotted may be mixed with a dye. Examples of the dye include, but are not limited to, cresol red, bromophenol blue and xylene cyanol.

The amount of the enzyme to be fixed on the support may be properly selected so that the desired enzymatic reaction can be achieved. For example, for PCR-reaction, 5 ng or more of a DNA polymerase may be fixed per spot.

A support having a mixture of an enzyme and a protecting agent for the enzyme fixed thereon can be prepared in the following manner. First, a mixed solution of an enzyme and a protecting agent is prepared. The mixing ratio between the enzyme and the protecting agent is as described above. The solvent is preferably water. The mixed solution may further contain any one of the components other than the enzyme and the protecting agent as described above. Next, the mixed solution of the enzyme and the protecting agent is applied onto a support. For example, in the case where the support is paper, the mixed solution can be spotted on the paper using a syringe, a 96 pin-tool (Multi 96-multiblot replicator VP409, Bio Medical Science Inc., US), a disposable-type pin-tool or the like. The support is then dried to fix the mixture of the enzyme and the protecting agent thereon. Preferably, the support having the mixture of the enzyme and the protecting agent fixed thereon contains substantially no moisture.

By fixing an enzyme on a support as a mixture with a protecting agent for the enzyme as described above, the enzyme can be stored stably. As for the storage conditions, the support is preferably stored at room temperature under light shielding conditions while avoiding high humidities. In the case where the enzyme is a DNA polymerase, for example, when the DNA polymerase is stored at room temperature after being fixed on 60MDP paper as a mixture with trehalose, storage life of at least 6.5 months has been confirmed (the storage test is now being carried on).

For restoration of an enzyme fixed on a support as a mixture with a protecting agent for the enzyme as described above, the support having the mixture of the enzyme and the protecting agent fixed thereon may be immersed in a liquid to leach out the enzyme into the liquid. The liquid to be used for the immersion of the support may be any one as long as it enables the restoration of the enzyme. Examples of the liquid includes, but are not limited to, water and an aqueous solution containing an ingredient other than water. In the case where the enzyme fixed on a support is a DNA polymerase, for example, the liquid to be used for the immersion of the support is preferably water, a PCR reaction solution (i.e., an aqueous solution containing Tris-HCl, KCl, MgCl, a dNTP mixture and the like) or the like. The immersion may be performed at room temperature under atmospheric pressure for 1 to 3 minutes.

When a DNA polymerase is fixed on a support, the support may be placed in a liquid to leach out the DNA polymerase from the support and nucleic acid amplification reaction may be then performed using the leached-out DNA polymerase to amplify a nucleic acid.

The present invention also provides a printed material comprising a support having an enzyme and a protecting agent for the enzyme fixed thereon.

The printed material includes, but is not limited to, complete books (e.g., textbooks), handbooks, catalogues, journals, magazines, articles, booklets, minibooklets, leaflets, pamphlets, reports, posters, cards and labels.

FIG. 1 shows an embodiment of the printed material according to the present invention, in which a mixture of an enzyme (a DNA polymerase) and trehalose together with a primer set, a cDNA clone which serves as a template for PCR reaction and other components required for the PCR reaction (i.e., Tris-HCl, KCl, MgCl, each dNTP and, if required, an aptamer for the DNA polymerase) is spotted on paper (support). The DNA polymerase and trehalose are spotted on the paper 6 (hereinafter, this spot is referred to as “DNA Spot 1”). In the paper 6, in addition to DNA spot 1, the name 2 of a protein encoded by the cDNA clone (“malate dehydrogenase”), the identification number 3 of the cDNA clone (“Clone ID”), the nucleotide sequence 4 of the cDNA clone (“DNA sequence”) and the instructions 5 of the procedure for an experiment (PCR reaction) (“Procedures”) are printed on the paper.

FIG. 2 shows a magazine 13 including a scientific article 12, to which the paper 6 having DNA spot 1 thereon shown in FIG. 1 is added as an appendix.

FIG. 3 shows a book 22 in which the paper 6 having DNA spot 1 thereon shown in FIG. 1 is bounded. This book may further include a table of contents.

FIG. 4 shows another embodiment of the book in which paper (support) comprising a mixture of an enzyme (a DNA polymerase) and trehalose spotted thereon is bounded. On each grid of a checkerboard pattern of page 34 on which a mixture of an enzyme (a DNA polymerase) and trehalose are spotted, the DNA polymerase and trehalose together with a primer set, a cDNA clone which serves as a template for PCR reaction and other components required for the PCR reaction (i.e., Tris-HCl, KCl, MgCl, each dNTP and, if required, an aptamer for the DNA polymerase) are spotted (hereinafter, this spot is referred to as “DNA spot 31”). On the page 34 having these spots 31, symbols 32 (column number) and 33 (row number) for identification of each spot are printed. Also printed are the identification number 30 (“Rearray PLATE ID”) of a page having DNA spotted thereon. The information about the spotted cDNA clone, such as EC number of an enzyme encoded by the cDNA clone, name of an enzyme encoded by the cDNA clone (“Gene name”), ID number (“RIKEN Clone ID”) and deposition number (“Accession Number”) of the clone, length of the cDNA clone insert (“cDNA Insert), length of a PCR reaction product (“After PCR”) and the explanation of a reaction in which the enzyme encoded by the cDNA clone is involved, and the information about the primer set, such as nucleotide sequence of the primers, are recorded in a CD-ROM 36 (as a substitute for the CD-ROM, other recording medium such as FD and MD may be used). The recording medium is added as an appendix to the book (FIG. 5). In FIG. 5, the CD-ROM 36 is packed in a bag 37 and attached to the book 35 with the bag 37 being sealed with a seal 38. This book may also have a page on which a table of contents, an instruction manual for the spots containing the cDNA clone and primer set, and an access guide to the information recorded in the recording medium are printed.

Exemplary types of the printed material include the following: 1) an encyclopedia-like all-inclusive type (e.g., FANTOM clone, human metabolome); 2) a volume-separated type by item (e.g., function, organ); 3) a small volume type by subdivided subjects or contents which consists of one to several pages (e.g., loose-leaf type); and 4) a card type which is intended to have a smaller number of attachments.

The present invention also provides a reagent kit comprising a support having an enzyme and a protecting agent for the enzyme fixed thereon.

The reagent kit according to the present invention can be used as a nucleic acid amplification reaction (e.g., PCR) kit, a protein production kit, an antibody kit and other types of kits for use in a variety of experiments, tests, diagnoses and the like.

The reagent kit according to the present invention may be in the form of a printed material as described above. Other embodiments of the reagent kit are shown in FIGS. 6 to 9.

FIG. 6 shows an embodiment of the reagent kit according to the present invention, in which a mixture of an enzyme (a DNA polymerase) and trehalose together with a primer set and other components required for PCR reaction (i.e., Tris-HCl, KCl, MgCl, each dNTP and, if required, an aptamer for the DNA polymerase) is spotted on paper (support). In the paper, the DNA polymerase and trehalose are spotted in a proper position on the paper (hereinafter, this spot is referred to as “DNA spot 41”).

FIG. 7 shows an embodiment of the reagent kit, which comprises a sheet of paper 42 having a DNA spot 41 shown in FIG. 6 thereon. The paper 42 having the DNA spot 41 is placed in a light-proof bottle 51, and then stored or distributed with the bottle 51 hermetically sealed with a cap 52. The reagent kit may further include an instruction manual 53 on which the information about the kit, such as the contents of the kit (e.g., names/quantities of components included in the kit, recommended use, directions for storage/expiration date, package unit), directions for use, cautions in use and handling, and customer inquiry, is printed. The instruction manual 53 may be included in the light-proof bottle 51 or placed in a package box (now shown) including the light-proof bottle 51. Alternatively, the instruction manual may be printed on a label and attached on the light-proof bottle 51.

FIG. 8 shows an embodiment of the regent kit according to the present invention, in which a mixture of an enzyme (a DNA polymerase) and trehalose is spotted on paper (support). In the paper 62, the DNA polymerase and trehalose together with a primer set and other components required for PCR reaction (i.e., Tris-HCl, KCl, MgCl, each dNTP and, if required, an aptamer for the DNA polymerase) are spotted in a proper position on the paper (hereinafter, this spot is referred to as “DNA spot 61”).

FIG. 9 shows an embodiment of the reagent kit comprising a sheet of paper 62 having DNA spots 61 thereon. The paper 62 having DNA spots 61 is placed in a packaging pack 71 and stored or distributed with the packaging pack 71 being hermetically sealed. The reagent kit may further include an instruction manual 72 on which the information about the kit, such as the contents of the kit (e.g., names/quantities of components included in the kit, recommended use, directions for storage/expiration date, package unit), directions for use, cautions in use and handling, and customer inquiry, is printed. The instruction manual 72 may be included in the packaging pack 71 or placed in a package box (now shown) including the packaging pack 71. Alternatively, the instruction manual 72 may be printed on a label and attached on the packaging pack 71 or the package box.

Hereinabove, the present invention is described with reference to several embodiments of the combination of a DNA polymerase and DNA. However, the invention is not limited to these embodiments and applicable to a variety of enzymes.

In this specification, it is noted that the mark “-” means a numerical range in which the numerical numbers given before and after the mark are included in the range as the minimum value and the maximum value, respectively.

EFFECT OF THE INVENTION

According to the present invention, a simple method for storing an enzyme is provided.

This specification includes part or all of the contents as disclosed in the specification and/or drawings of Japanese Patent Application No. 2003-339542 based on which the present application claims priority.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 shows an embodiment of paper (support) comprising a mixture of a DNA polymerase and trehalose together with DNA (cDNA, primer, aptamer, etc.) spotted thereon.

FIG. 2 shows an embodiment of a magazine including a scientific article, in which paper comprising a mixture of a DNA polymerase and trehalose together with DNA (cDNA, primer, aptamer, etc.) spotted thereon is added as an appendix.

FIG. 3 shows an embodiment of a book in which paper comprising a mixture of a DNA polymerase and trehalose together with DNA (cDNA, primer, aptamer, etc.) spotted thereon is bounded.

FIG. 4 shows another embodiment of a book in which paper (support) comprising a mixture of a DNA polymerase and trehalose together with DNA (cDNA, primer, aptamer, etc.) spotted thereon is bounded.

FIG. 5 shows an embodiment of packaging into a bag a CD-ROM on which the information about cDNA spotted on the paper shown in FIG. 4 is recorded, with the CD-ROM being added as an appendix to the book with the bag sealed with a seal.

FIG. 6 shows an embodiment of paper (support) comprising a mixture of a DNA polymerase and trehalose together with DNA (cDNA, primer, aptamer, etc.) spotted thereon.

FIG. 7 shows an embodiment of a reagent kit comprising the paper shown in FIG. 6.

FIG. 8 shows an embodiment of paper (support) comprising a mixture of a DNA polymerase and trehalose together with DNA (cDNA, primer, aptamer, etc.) spotted thereon.

FIG. 9 shows an embodiment of a reagent kit comprising the paper shown in FIG. 8.

FIG. 10 shows the constitution of pFLC vector in which murine malate dehydrogenase cDNA is cloned.

FIG. 11 shows 60MDP paper having both a spot of a solution of murine malate dehydrogenase cDNA and a spot of a [polymerase+primer] solution.

FIG. 12 shows the electrophoretic results of a product of the PCR reaction performed using the spots shown in FIG. 11.

FIG. 13 shows 60MDP paper having a spot of a [primer+aptamer+polymerase] solution.

FIG. 14 shows the electrophoretic results of a product of the PCR reaction performed using the spot shown in FIG. 13.

FIG. 15 shows 60MDP paper having spots of a [cDNA+primer+aptamer+polymerase+PCR buffer composition] solution, wherein the cDNA is that for any one of murine malate dehydrogenase, murine isocitrate dehydrogenase (NADP), murine isocitrate dehydrogenase (NAD) and murine oxoglutarate dehydrogenase.

FIG. 16 shows the electrophoretic results of a product of the PCR reaction performed using the spots shown in FIG. 15.

FIG. 17 shows the electrophoretic results of a product of the PCR reaction performed using the spots of a [cDNA+primer+reaction enhancer (spermidine)+polymerase+PCR buffer composition] solution.

EXPLANATION OF REFERENCE SIGNS IN THE DRAWINGS

1: DNA spots

2: Name of protein (enzyme such as malate dehydrogenase) encoded by cDNA clone

3: Identification number of cDNA clone

4: Nucleotide sequence of cDNA clone

5: Instruction manual for experimental procedure

6: Paper having a mixture of DNA polymerase and trehalose together with DNA (cDNA, primer, aptamer, etc.) spotted thereon

12: Scientific article

13: Magazine

22: Book

30: Identification number of page on which DNA is spotted

31: DNA spots

32: Symbol 1 for identification of spot (column number)

33: Symbol 2 for identification of spot (row number)

34: Page having a mixture of DNA polymerase and trehalose together with DNA (cDNA, primer, aptamer, etc.) spotted thereon

35: Book

36 CD-ROM

37: Bag

38: Seal

41: DNA spot

42: Paper (support)

51: Light-proof bottle

52: Cap

53: Instruction manual

61: DNA spots

62: Paper (support)

71: Packaging pack

72: Instruction manual

BEST MODES FOR CARRYING OUT THE INVENTION

Hereinbelow, the present invention will be described in great detail with reference to the following examples. However, the examples are illustrative only and the scope of the invention is not limited to these examples.

EXAMPLES
Example 1

DMA Book Having Spots of cDNA Clone and Polymerase Thereon

A set of primers having the following sequences were synthesized according to a conventional method.

Primer Set 1:

−21M13:(SEQ ID NO:1)5′-TGTAAAACGACGGCCAGT-3′1233-Rv:(SEQ ID NO:2)5′-AGCGGATAACAATTTCACACAGGA-3′

pFLC vector, into which murine malate dehydrogenase cDNA (Clone ID: 1500012M15, 1758 bp) having the following nucleotide sequence collected from the Riken clones (http://fantom.gsc.riken.go.jp/) had been cloned FIG. 10), was dissolved in TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) to give a concentration of 0.1 μg/μl.

Murine malate dehydrogenase 1500012M15(SEQ ID NO:3) 1 cccggttctc tcccagagtc tgttccgctg tagaggtgac ctgactgctg gagactgcct 61 tttgcaggtg cagagatcgg ccttgcagtt tgcaataatg tctgaaccaa tcagagtcct 121 tgtgactgga gcagctggtc aaattgcata ttcactgttg tacagtattg gaaatggatc 181 tgtctttggg aaagaccagc ccatcattct tgtgctgttg gacatcaccc ccatgatggg 241 tgttctggac ggtgtcctga tggaactgca agactgtgcc cttccccttc tgcaggatgt 301 cattgcaacg gacaaagaag agattgcctt caaagacctg gatgtggctg tcctagtggg 361 ctccatgcca ataagggaag gcatggagag gaaggaccta ctgaaagcca atgtgaaaat 421 cttcaaatcc cagggcacag ccttggagaa atacgccaag aaatcagtta aggtcattgt 481 tgtgggaaac ccagccaata cgaactgcct gacagcctcc aagtcagcgc catcgatccc 541 caaggagaat ttcagttgcc tgactcgctt ggaccacaac cgagcaaaat ctcaaattgc 601 tcttaaactc ggtgtaaccg ctgatgatgt aaagaatgtc attatctggg gaaatcattc 661 atcgacccag tatccagatg tcaatcatgc caaggtgaaa ctgcaaggaa aggaagtcgg 721 tgtgtatgaa gccctgaaag acgacagctg gctgaaggga gagttcatca cgactgtgca 781 acagcgtggt gctgctgtca tcaaggctcg gaagctgtcc agtgcaatgt ctgctgcgaa 841 agccatcgca gaccacatca gagacatctg gtttggaacc ccagagggag agttcgtgtc 901 gatgggtgtt atctctgatg gcaactccta tggtgtccct gatgacctgc tctactcatt 961 ccctgtcgtg atcaagaata agacctggaa gtttgttgaa ggcctcccca ttaatgactt1021 ctcccgtgaa aagatggacc tgacagcaaa ggagctgacc gaggaaaagg agaccgcttt1081 tgagtttctc tcctctgcgt gactagacac tcgttttgac atcagcagac agccgaaggc1141 tgaggaatca aaatgtcgtc tttgagccta gtaccaaaca gtaataatgc tacattcaaa1201 ttgtgaacag caaaatattt taaatagtgt gtgctttatg atttgtgaaa gtctatcatg1261 ttgttagtgc tgcaatctaa ataaaagtat attcaagtga aaatctctca gactctgttt1321 ctactttata tttagtatct tcaggaaaac aagtttgccc aatagattat aattttactt1381 ttttaattga ctaaaagaaa taaagatgga aaatattatg aagtaaagca ttagtctcta1441 acataaacaa ggaagcccaa tcaatttcag agggatccca ttacttaagt ccttaaaggt1501 tggttcatgt tttgctcata atttgatttt aaaattagct gtaagaaggt tgcagataat1561 ctatcttctt tatattctat agcagaataa tgaagtcatt aatatttgat agccaataat1621 accacactat taatatttgt aagctaagat tattagaaac ataaaactgt ttttgagtca1681 gtctgttttc catgagaaga catgcatcat ctttgtgtgt tttgtgcatt actcagtgca1741 ataaataacc aataatctc

KOD plus polymerase (Toyobo Engineering Co., Ltd., Japan), trehalose and the primer set 1 were mixed together to prepare a solution having the final concentrations of 25 U/μl of KOD plus DNA polymerase, 0.1 M of trehalose and 2 μM of primer set 1.

The cDNA solution and the [polymerase+primer] solution were spotted on a sheet of 60MDP paper (Mishima Paper Co., Ltd., Japan) using a 96 pin-tool (Multi 96-multiblot replicator VP409, Bio Medical Science Inc., US) so that the positions and the types of the spots could be identified, as shown in FIG. 11. The cDNA solution and the [polymerase+primer] solution were spotted at rates of 0.5 μl/spot and 1 μl/spot, respectively.

The spotted paper was dried at room temperature for at least 30 minutes. Thereafter, two 4 mm×4 mm pieces were cut out from the 60MDP paper so that each piece contained the spotted cDNA or [polymerase+primer] and then placed in a PCR microtube. The tube was added with 25 μl of a PCR reaction solution (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 5.3 mM MgCl, 200 μM each dNTP) and PCR was run under the following conditions:

2 min at 94° C.;

29 cycles of (1 min at 94° C., 1 min at 55° C., 75 sec at 68° C.); and then

15 min at 74° C.

After the reaction was completed, a proper amount of the reaction solution was removed from the tube and then subjected to 1% agarose gel electrophoresis. The results are shown in FIG. 12. A band observed at the position around 1800 bp was considered to be the desired fragment. It was demonstrated that the DNA was leached out from the 60MDP paper and could be amplified by PCR.

Example 2

#Experiment of [Aptamer+Polymerase] Using Lutenizing Hormone Gene

Primers having the following sequences were synthesized according to a conventional method.

Primer set 1 (a primer set for amplification of human lutenizing hormone gene exon 1):

HsLH1F:(SEQ ID NO:4)CCAGGGGCTGCTGCTGTTGHsLH1R:(SEQ ID NO:5)CATGGTGGGGCAGTAGCC

Primer sets 2 (a primer set for amplification of human lutenizing hormone gene exon 2):

HsLH2F:(SEQ ID NO:6)ATGCGCGTGCTGCAGGCGHsLH2R:(SEQ ID NO:7)TGCGGATTGAGAAGCCTTTATTG

An oligonucleotide having the following sequence, which is a known aptamer for Taq DNA polymerase (Yun Lin, Sumedha D. Jayasena, Inhibition of Multiple Thermostable DNA Polymerases by a Heterodimeric Aptamer, Journal of Molecular Biology (1997), Vol. 27, Issue 1, pages 100-11), was synthesized by a conventional method.

(SEQ ID NO:8)GCCGGCCAATGTACAGTATTGGCCGGC

Two kinds of spotting solutions were prepared.

The above primer sets, the aptamer for Taq DNA polymerase and Taq DNA polymerase were mixed together to prepare a solution having the final concentrations of 2 μM of the primer sets, 2 μM of the aptamer for Taq DNA polymerase, 25 U/μl of Taq DNA polymerase and 0.1 M trehalose. Another solution having the same composition except that the aptamer for Taq DNA polymerase was eliminated was also prepared.

Each of the [primer+aptamer+polymerase] solutions prepared as described above was spotted on a sheet of 60MDP paper (Mishima Paper Co., Ltd., Japan) using a 96 pin-tool (Multi 96-multiblot replicator VP409, Bio Medical Science Inc., US) so that the position and the type of the spot could be identified, as shown in FIG. 13. The spotting solution was applied at a rate of 1 μl/spot.

The spotted paper was dried at room temperature for at least 30 minutes. Thereafter, a 4 mm×4 mm piece was cut out from the 60MDP paper so that the piece contained the spotted area and then placed in a PCR microtube. The tube was added with 25 μl of a PCR reaction solution (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 5.3 mM MgCl, 200 μM each dNTP) and 50 ng of template DNA (human genomic DNA; BD Biosciences Clontech, US), and PCR was run under the following conditions:

3 min at 94° C.;

50 cycles of (30 sec at 94° C., 30 sec at 40° C., 30 sec at 72° C.); and then

15 min at 72° C.

After the reaction was completed, a proper amount of the reaction solution was removed from the tube and then subjected to 1% agarose gel electrophoresis. The results are shown in FIG. 14. Bands observed at the positions around 184 bp and 343 bp were considered to be the desired DNA fragments of exons 1 and 2, respectively. It was demonstrated that fragments of interest could be amplified by PCR from the template DNA by using the primers fixed on the 60MDP paper. Comparison was made between the samples with and without the aptamer for Taq DNA polymerase, and it was found that the reaction with the aptamer could inhibit non-specific amplification.

Example 3

DMA Book Having Spots of Riken cDNA Clone+PCR Solution Thereon

A set of primers having the following sequences were synthesized according to a conventional method.

Primer set 1:

−21M13:(SEQ ID NO:1)5′-TGTAAAACGACGGCCAGT-3′1233-Rv:(SEQ ID NO:2)5′-AGCGGATAACAATTTCACACAGGA-3′

pFLC vector, into which any one of murine malate dehydrogenase cDNA (Clone ID: 1500012M15, 1758 bp), murine isocitrate dehydrogenase (NADP) (Clone ID: 1500012E04, 2440 bp), murine isocitrate dehydrogenase (NAD) (Clone ID: E030024J03, 2160 bp) and murine oxoglutarate dehydrogenase (Clone ID: E430020N12, 3554 bp) having the following nucleotide sequences collected from the Riken clones (http://fantom.gsc.riken.go.jp/) had been cloned (FIG. 10), was dissolved in TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) to give a concentration of 0.1 μg/μl.

Murine isocitrate dehydrogenase (NADP) 1500012E04

(SEQ ID NO:9)

1 gggtgttgcc gctgtcgccg cggtgaggga agtggacgcg atggccgggt ccgcgtgggt

61 gtccaaggtc tctcggctgc tgggtgcatt ccacaacaca aaacaggtga caagaggttt

121 tgctggtggt gttcagacag taactttaat tcctggagat ggaattggcc cagaaatttc

181 agcctcagtc atgaagattt ttgatgctgg ccaaagcacc tattcagtgg gaggagcgca

241 atgtcacagc aattcaagga ccaggaggaa agtgggatga tccctccaga agccaaggag

301 tccatggata agaacaagat gggcttgaaa ggcccactaa agaccccaat agccgctggc

361 catccatcta tgaatctgtt gcttcgtaag acatttgacc tttatgccaa tgtccggcca

421 tgtgtctcaa ttgaaggtta taaaacccct tacacggatg taaatatcgt caccatccga

481 gagaacacgg aaggagaata cagtggaatt gagcatgtga tcgttgatgg ggttgtgcag

541 agcatcaagc tcatcaccga agaagcaagc aagcgcattg cagagtttgc cttcgagtac

601 gctcggaaca accaccggag caacgtcaca gctgtgcaca aagctaacat catgaggatg

661 tcagatgggc tctttctgca aaaatgcagg gaagttgcgg agaactgtaa agacattaaa

721 tttaacgaga tgtaccttga tactgtatgt ttaaatatgg tacaagaccc atcccagttt

781 gatgttcttg tcatgccaaa tttatacgga gacatcctta gtgatctgtg tgcaggactg

841 attggaggtc ttggggtgac tccaagtggc aatattggag ccaacggtgt tgccatcttt

901 gaatcggttc atggaacagc cccggacatt gcaggcaagg acatggccaa ccccacggcc

961 ctcctgctta gtgctgtgat gatgcttcgc cacatgggac tttttgacca tgcagcaaaa

1021 atcgaggctg catgttttgc tacaattaag gatggaaaga gcttaacaaa agatctggga

1081 ggcaacgcga agtgctctga cttcacagaa gaaatctgtc gtagagtcaa agacttagat

1141 tagcactcct gctggtggat ttgctgcagt cagtcaatca ctccaaaagg ataccctgta

1201 atcctccttg agggcgccca ccattggttt gcttgcttct tgacagagta cgttttttga

1261 atctggcctt ttcttaacaa aacccttgca atggatgcac atgatggccc caggccttca

1321 ttcaaagggt tttcccaagt gctggttgta tttattgtcc gtctggtaaa ccttattttg

1381 taaactgtaa gtgaactgta tcatttatca ttgttaaccc attttacact tcaggcaaaa

1441 tcattttcct caactgtaaa tattctgata cagaattaat aagagaagat atttaacttt

1501 ttaacaaaag ccctggattt ttggtttatg aaaaacaaac tgggaataaa acagggtttc

1561 aacaatcgca caagataaca ttattctaat actaatgggt acaaaagaaa tttactggga

1621 aagttcacag caaaaaactg gtatatttct taaaaatatg gaaataaagt atttgtccta

1681 tacatgaatt actattaata aaaatgtaag ctccaagaaa tccataatga atgatgtaat

1741 tttgttacta catcggtaat ccttgtcaag gccccggatg ctctctgtgt atttgattct

1801 ttggttacct tgagattcac tatttggggg gaagagcttt cagataaggg agatcactcc

1861 tcactagaca gatcgtcagc attgcgagct gtcagccatg agagccagcc actgcagatc

1921 ccctcccacg tggccacact ccagccagtg ctgcaggtga ccctggaaag gcctggctgc

1981 cccttgactt tccctaaagc aaccagtcac tgccttctgc cccagtagca cccattacag

2041 acttaattgc cgaggtggag ctgactcagc ccacgctcat acaaatcagg ccaagcgggg

2101 gcctgtgtta ccagctgctg accatcaggt tctgcccctc attcttccca cagcctctgc

2161 tccacagcat gaacctagcc tttggcccac accaaagcca agctgtcttc ccttagccct

2221 tgcactagtt tgcaaactcg tggctttgca taatgtaccc tggtcccaag gggatttctt

2281 aacaacagat gtccctgtct gggtcatttt tttaaagctt ttatttggac ttacaatctt

2341 ctgtgtattt tactttaaaa ctgctgcttt ccctgtctca ctggattgtt ctggttagca

2401 gtggctttgg gttcacagta ataaagaact taagaact

Murine isocitrate dehydrogenase (NAD) E030024J03

(SEQ ID NO:10)

1 ggatctaact ggggccggct tattacagct tgtgtgtacg cgcgggtgtg agccgggtta

61 ttgaagtaaa aatgtccaga aaaatccaag gaggttctgt ggtggagatg caaggagatg

121 aaatgacacg aatcatttgg gaattgatta aggaaaaact tattcttccc tatgtggaac

181 tggatctgca tagctatgat ttaggcatag agaatcgtga tgccaccaat gaccaggtca

241 ccaaagatgc tgcagaggct ataaagaaat acaacgtggg cgtcaagtgt gctaccatca

301 cccccgatga gaagagggtt gaagaattca agttgaaaca aatgtggaaa tccccaaatg

361 gcaccatccg aaacattctg ggtggcactg tcttcaggga agctattatc tgcaaaaata

421 tcccccggct agtgacaggc tgggtaaaac ccatcatcat tggccgacat gcatatgggg

481 accaatacag agcaactgat tttgttgttc ctgggcctgg aaaagtagag ataacctaca

541 caccaaaaga tggaactcag aaggtgacat acatggtaca tgactttgaa gaaggtggtg

601 gtgttgccat gggcatgtac aaccaggata agtcaattga agactttgca cacagttcct

661 tccaaatggc tctgtccaag ggctggcctt tgtatctcag caccaagaac actattctga

721 agaagtatga tgggcgtttc aaagacatct tccaggagat ctatgacaag aaatacaagt

781 cccagtttga agctcagaag atctgctatg aacacaggct catagatgac atggtggccc

841 aagctatgaa gtccgaggga ggcttcatct gggcctgtaa gaattacgat ggggatgtgc

901 agtcagactc agtcgcccaa ggttatggct cccttggcat gatgaccagt gtgctgattt

961 gtccagatgg taagacggta gaagcagagg ctgcccatgg cactgtcaca cgtcactacc

1021 gcatgtacca gaaagggcaa gagacgtcca ccaaccccat tgcttccatt tttgcctggt

1081 cccgagggtt agcccacaga gcaaagcttg ataacaatac tgagctcagc ttcttcgcaa

1141 aggctttgga agacgtctgc attgagacca ttgaggctgg ctttatgact aaggacttgg

1201 ctgcttgcat taaaggctta cccaatgtac aacgttctga ctacttgaat acatttgagt

1261 ttatggacaa acttggagaa aacttgaagg ccaaattagc tcaggcccaa actttaaggt

1321 caaacctggg cttagaatga gtctttgcgg taactaggtc cacaggttta cgtatttttt

1381 tttttttttt tagtaacact caagattaaa aacaaaaatc attttgtaat tggtttagaa

1441 gacaaagttg aacttttata tatgtttaca gtcttttttc tttttcatac agttattgcc

1501 accttaatga atgtggtggg gaaatttttt.taattgtatt ttattgtgta gtagcagtgt

1561 aggaattatg ttagtacctg ttcacaatta actgtcatgt tttctcatgc tctaatgtaa

1621 atgaccaaaa tcagaagtgc tccaagggtg aacaatagct acagtatggt tccccataag

1681 gggaaaagag aaactcactt cccctgttgt ccatgagtgt gaacactggg gcctttgtac

1741 gcaaatgttg tactgtgtgt gggagagcta tacagtaagc tcacataaga ctggaacaga

1801 taggatgtgt gtagctaaaa tgcatggcag acgtgtttat aaagagcatg tatgtgtcca

1861 atatactagt tatattttaa gaccactgga gaattccaag tctagaataa atgcagactg

1921 gaggattctg ctctttgatt tctcttctcc tgtgacccag cctaagtatt atcctacccc

1981 aagcagtaca tttcacccat gggcaataat gggagctgta ccgtttggat ttctgctgac

2041 ctgctgcatt tcttttatat aaatgtgact tttttttccc agaagttgat attaaacact

2101 attccagtct agtccttcta aactgttaat tttaattaaa atgaagtact aatgactctt

Murine oxoglutarate dehydrogenase E430020N12

(SEQ ID NO:11)

1 gggggtggag ctgaacggga gacaggtact tgtggaaggc ttcaggacaa aatgtttcat

61 ttaaggactt gtgctgctaa gttaaggcca ttgacagcct cccagactgt taagacattt

121 tcacaaaaca aaccagcagc aattaggacg tttcaacaga ttcggtgcta ttctgcacct

181 gtagctgctg aaccatttct tagtgggact agttcgaact atgtggagga aatgtactgt

241 gcctggttgg agaatcccaa aagtgtacat aagtcatggg acattttttt ccgaaacacc

301 aatgctggag ccccaccggg cactgcctac cagagccccc tttccctgag tcgaagctcc

361 ctggctacca tggcccatgc acagtccctg gtggaagcac aacctaacgt cgacaaactc

421 gtggaggacc acttggcggt gcagtctctc atcagggcat atcagatacg agggcaccat

481 gtagcacagc tggaccccct ggggattttg gatgctgatc tggactcctc cgtgcccgct

541 gacattatct catccacaga caaacttggg ttctatggcc tacacgagtc tgaccttgac

601 aaggtcttcc acttacccac caccactttc atcgggggac aggagccagc acttcctctt

661 cgggagatca tccgtcggct ggagatggcc tactgccagc acattggtgt ggagttcatg

721 ttcattaatg atttggaaca atgccagtgg atccgacaga agtttgagac ccctggaatc

781 atgcagttca ccaatgagga gaagcggacc ttgctggcca ggcttgtacg atccaccagg

841 tttgaggagt tcctacagcg aaagtggtcc tcggagaagc gttttggtct ggaaggctgt

901 gaggtgctga tccctgccct caagacaatc attgatatgt caactcagat gaccctgaag

961 ctgtcatgta tgtatgcaag gtggcagctg agtggagaaa caccttccac aaggatgttg

1021 tagttgatct ggtgtgttat cgacgaaatg gccacaatga gatggacgaa cctatgttta

1081 cacagccact catgtacaag cagatccgca agcagaagcc tgtactgcag aagtatgcag

1141 aattgctagt ctcccagggt gtcgtcaatc agcctgagta cgaggaggaa atctccaagt

1201 atgataagat ctgtgaggaa gcatttacca gatccaaaga tgagaagatc ttgcacatca

1261 agcactggct ggattccccc tggcctggct ttttcaccct ggatggacag cccaggagca

1321 tgacctgccc ctccactggc ctggaggagg atgtcttgtt ccacattgga aaggtggcca

1381 gctctgtacc tgtggagaac tttactatcc atggagggct gagccggatc ttgaagaccc

1441 gcagagagct tgtgacgaac cggactgtgg actgggccct ggcagagtac atggcatttg

1501 gctcactgct gaaggaaggc atccatgtgc ggctgagtgg ccaggatgtg gagcggggca

1561 ccttcagcca tcgccaccat gtgctccatg atcagaatgt tgacaaaaga acctgcatcc

1621 ccatgaacca cctttggcca aatcaggccc cttacactgt atgcaacagc tcgctgtctg

1681 agtacggtgt cctgggcttt gagctgggct ttgccatggc tagccctaat gctctggttc

1741 tctgggaggc ccagtttggt gacttcaaca acatggcaca gtgcatcatt gaccagttca

1801 tctgcccagg acaggcaaag tgggtgcggc agaatggcat tgtgctcctg ctgcctcatg

1861 gcatggaagg catgggtccc gagcattcct ctgaccgccc agagcggttt ctgcatatgt

1921 gcaatgatga cccatatgtc ctgcgtgact tgcaggaaga actctttgac atcaatcagc

1981 tatatgactg caactggatt gttgtcagct gttccacccg tggcaacttc ttccatgtgc

2041 tgcgacaaca gatcttgctg cccttccgta agccgttaat agtcttcact cccaaatccc

2101 tcttgcgcca ccgtgaggca agaactatct ttgacgatat gttgccagga acgcacttcc

2161 agcgtgtgat cccagaaaat ggacatgcag ctcaggaccc tcacaaagtc aagagacttc

2221 tcttctgcac tgggaaggtg tactatgacc tcacccgaga gcgcaaagcc aggaacatga

2281 aggaggaggt ggctattaca aggattgagc agctatcacc attccccttt gacctcctgt

2341 tgaaagaggc tcagaagtat cccaatgctg agctggcctg gtgccaggaa gagcacaaga

2401 accaaggcta ctatgactat gtcaagccaa gacttcgtac caccattgac cgtgctaagc

2461 ctgtctggta tgctgtccga gacccggcag ctgctccagc cactggcaac aagaaaacac

2521 acctgacaga gctgcagcgc tttctggaca cagcctttga cctggacgca ttcaagaaat

2581 tctcttagat gctcctggag ttgatgaggc catggccccc atgtccatga cgctctttgc

2641 ttctcaacta aagaatagtg cctcagcact gtccacacgt cccttcgctg tgccacacca

2701 cccctgttct cataggaatt aagttgtcca ctgcagtgct cagctgctcc ccggtcacat

2761 gctgcccagc ctgtgccgac ttctctcagg ctgcacaccg ttcatggaga ccggaaggag

2821 cagaataagg aaagggcccc tctcaggaca tcctagagaa ggaaggcagc tctggcccca

2881 cccatgcccc cagtgcaatc ctccagggta ggaacagaac cctatgtggc ttcccagggt

2941 actagcactc agccctcgtc acccatcaag tcgcagattc aaggccagga gtagtttcat

3001 cttgctaggg ccaagctgag agctcatgga ggaactatag ctgccaggat ttgggagtca

3061 tcaggatgtt gtgtgaatag agattgtcat ggggtattta gaggacttta gcagtgatgt

3121 tagtctagcc ctgctaccct tcttgggttt gggctgtatg tgggaaactt accccagcta

3181 ccacgcctgg agagcttggc tctgagtacg gcccagaagc tccattggct cccaacgcca

3241 ggcactgctg cctcttggtc ctgctgcctc tgctctcctg acccctcccc agtcacttca

3301 ttttctctgt tgttcccttg aacacacaga agctgttgac gaattctttt ttttgctgtg

3361 ccaaggcagg tcaaaagcag atcagtggat aagagcaagt tgtcccaagg agccagctgt

3421 ccttcctccc tcttttgacc tccactggga cacacctgat ttatttattt tggttaaaaa

3481 aaaaaaggaa atgaaaaaag aacaaccacc tttgcattgc atcggcttga cccataaact

3541 aagttatcat ggtc

The cDNA, the primer set 1, the aptamer for Taq DNA polymerase and Taq DNA polymerase were mixed together to prepare a solution having the final concentrations of 5 μM of the primer set 1, 5 μM of the aptamer for Taq DNA polymerase, 50 U/μl of Taq DNA polymerase, 0.1 M trehalose, 250 mM Tris-HCl (pH 8.3), 1.25 M KCl, 132.5 mM MgCl and 5 μM of each dNTP.

Each of the solutions prepared as described above was spotted on a sheet of 60MDP paper (Mishima Paper Co., Ltd., Japan) using a 96 pin-tool (Multi 96-multiblot replicator VP409, Bio Medical Science Inc., US) so that the position and the type of each spot could be identified, as shown in FIG. 15. Each spotting solution was applied at a rate of 1 μl/spot.

The spotted paper was dried at room temperature for at least 30 minutes. Thereafter, four 4 mm×4 mm pieces were cut out from the 60MDP paper so that each piece contained the spotted area and then placed in a PCR microtube. The tube was added with 25 μl of water, and PCR was run under the following conditions:

2 min at 94° C.;

29 cycles of (1 min at 94° C., 1 min at 55° C., 75 sec at 68° C.); and then 15 min at 74° C.

After the reaction was completed, a proper amount of the reaction solution was removed from the tube and then subjected to 1% agarose gel electrophoresis. The results are shown in FIG. 16: Lane 1, malate dehydrogenase cDNA; Lane 2, isocitrate dehydrogenase (NADP) cDNA; Lane 3, isocitrate dehydrogenase (NAD) cDNA; Lane 4, oxoglutarate dehydrogenase cDNA; and left lane, size markers. It was demonstrated that fragments having desired lengths could be obtained for the four kinds of cDNA, respectively, and that PCR amplification was possible simply by adding water to the cDNA, primers, aptamer, polymerase and PCR buffer composition fixed on the 60MDP paper.

After the reaction was completed, a proper amount of the reaction solution was removed from the tube and then subjected to 1% agarose gel electrophoresis. The results are shown in 108. Bands observed at the positions around 184 bp and 343 bp were considered to be the desired DNA fragments of exons 1 and 2, respectively. It was demonstrated that a desired fragment could be amplified by PCR from the template DNA by using the primers fixed on the 60MDP paper. Comparison was made between the samples with and without the aptamer for Taq DNA polymerase, and it was found that the reaction with the aptamer could inhibit the non-specific amplification.

Example 4

pFLC vector, into which the same murine malate dehydrogenase cDNA clone (Clone ID: 1500012M15, 1758 bp) as used in Example 3 had been cloned (FIG. 10), was dissolved in TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) to give a concentration of 0.1 μg/μl.

The cDNA, the primer set 1, spermidine and Taq DNA polymerase were mixed together to prepare a solution having the final concentrations of 0.005 μg/μl of the cDNA, 5 μM of the primer set, 50 U/μl of Taq DNA polymerase, 100 mM of spermidine, 0.1 M of trehalose, 250 mM of Tris-HCl (pH 8.3), 1.25 M of KCl, 132.5 mM of MgCl and 5 μM of each dNTP.

The solution prepared as described above was spotted on a sheet of 60MDP paper (Mishima Paper Co., Ltd., Japan) using a 96 pin-tool (Multi 96-multiblot replicator VP409, Bio Medical Science Inc., US) so that the position and the type of the spot could be identified, as shown in FIG. 15. The spotting solution was applied at a rate of 1 μl/spot.

2 min at 94° C.;

29 cycles of (1 min at 94° C., 1 min at 55° C., 75 sec at 68° C.); and then

15 min at 74° C.

After the reaction was completed, a proper amount of the reaction solution was removed from the tube and then subjected to 1% agarose gel electrophoresis. The results are shown in FIG. 17: Lanes 1 and 2, samples in which cDNA, primers, polymerase, spermidine (a polyamine) as reaction enhancer and PCR buffer composition were fixed on 60MDP paper; Lane 3, a sample fixing the same solution as those of Lanes 1 and 2 except that spermidine was eliminated. It was demonstrated that for each of the samples, the fixed DNA could be amplified by adding water and that in the samples on which a reaction enhancer was also fixed, the amplification reaction was enhanced.

All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

INDUSTRIAL APPLICABILITY

The support according to the present invention can be used for storage and distribution of enzymes. The support is also applicable to printed materials and reagent kits.

Free Text of Sequence Listing

SEQ ID NO:1 shows the nucleotide sequence of primer −21M13.

SEQ ID NO:2 shows the nucleotide sequence of primer 1233-Rv.

SEQ ID NO:3 shows the nucleotide sequence of cDNA for murine malate dehydrogenase.

SEQ ID NO:4 shows the nucleotide sequence of primer HsLH1F.

SEQ ID NO:5 shows the nucleotide sequence of primer HsLH1R.

SEQ ID NO:6 shows the nucleotide sequence of primer HsLH2F.

SEQ ID NO:7 shows the nucleotide sequence of primer HsLH2R.

SEQ ID NO:8 shows the nucleotide sequence of an aptamer for Taq DNA polymerase.

SEQ ID NO:9 shows the nucleotide sequence of cDNA for murine isocitrate dehydrogenase (NADP).

SEQ ID NO:10 shows the nucleotide sequence of cDNA for murine isocitrate dehydrogenase (NAD).

SEQ ID NO:11 shows the nucleotide sequence of cDNA for murine oxoglutarate dehydrogenase.

Support, printed material and reagent kit having enzyme fixed thereon, method for preparing the support, method of storing enzyme and method for restoration enzymes

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

Priority Claims (1)

PCT Information