The invention relates generally to intra-operative diagnostics of sample tissues. More specifically, the invention relates to the use of mass spectrometry for the detection of specific biomarkers.
Cancer presents many highly complex issues in clinical medicine. For example, consider just one of the many different and varied types of cancer, such as breast cancer. As a severely malignant and invasive tumor, breast cancer is a leading cause of death in cancerous women. Surgical removal of a cancerous tumor is usually the initial treatment of breast cancer, either by lumpectomy or mastectomy. Most women have a preference for the less invasive lumpectomy, for example, because of the cosmetic appearance. However, the accurate intra-operative determination of a tumor margin is challenging when planning and performing a breast-conserving surgery.
Normally, breast surgeons remove the tumor along with a few centimeters of surrounding healthy tissues on the basis of preoperative imaging using mammography, ultrasonography, or magnetic resonance imaging (MRI) to ensure the complete resection of cancer. Although accurate tumor size assessment may be available, the lack of real-time imaging in conjunction with surgical procedures relative to these techniques affects the surgery success rate and oftentimes leads to the need for further operations, giving the risk of local recurrence of breast cancer after lumpectomy and leading to a higher incidence of mastectomy. Therefore, the development of a technique allowing fast and in situ diagnosis and accurate characterization of a tumor margin boundary would facilitate a breast surgeon's decision making during lumpectomy.
The intra-operative application of MRI has been newly developed, especially in brain surgery. However, instead of providing real time imaging, this technique still requires the surgery to be interrupted. Ultrasonography has been applied intra-operatively in breast cancer excision, but it is unreliable in detecting nonpalpable tumor or ductal carcinoma in situ lesions. Positron emission tomography (PET), and near-infrared fluorescence (NIRF) optical imaging are two techniques that are being developed for intra-operative tumor assessment. However, the incorporation of radioactive or fluorescent labels presents a disadvantage not only to the patient but also to the operative personnel repeated exposure.
The review of tissue sections by light microscopy remains a cornerstone of tumor diagnostics. In recent decades, monitoring expression of individual proteins using immunohistochemistry and characterizing chromosomal aberrations, point mutations and gene expression with genetic tools has further enhanced diagnostic capabilities. These ancillary tests, however, often require days to perform and results become available long after surgery is completed. For this reason, the microscopic review of tissue biopsies frequently remains the sole source of intraoperative diagnostic information, with many important surgical decisions based on this information. This approach is time consuming, requiring nearly 30 minutes between the moment a tissue is biopsied and the time the pathologist's interpretation is communicated back to the surgeon. Tools that provide immediate feedback to the surgeon could transform the way surgery is performed.
Stereotactic surgical procedures were developed in the early 1900's and were first applied clinically in the 1940's (Kelly, P., Neurosurgery 46:16 (2000)). Initially these procedures were used in neurosurgery and involved affixing an external apparatus to a patient's skull to establish a coordinate system for locating, in a reproducible manner, the exact position of a lesion within the intracranial area. Today, stereotactic procedures have been applied to other tissues and are typically used in conjunction with diagnostic imaging procedures such as CT scans and MRIs to map internal tissues, prior to, or during, surgery (see, e.g., Poza, et al., Appl. Neurophysiol., 48:482-487 (1985); Dorwald, et al. Br. J. Neurosurg. 16:110-118 (2002); Krieger, et al., J. Surg. Oncol. 14:13-25 (1998)).
The development of stereotactic methods and imaging techniques has been accompanied by the development of surgical instruments that allow physicians to perform procedures at sites that were formerly inaccessible. Among the most successful of the instruments that have been developed for neurosurgery are probes designed to ultrasonically ablate tissue. For example, the Cavitron Ultrasonic Surgical Aspirator® (Integra Radionics) uses pulses of ultrasonic energy delivered to a needle-like tip to fragment tissue, which is concurrently irrigated and removed by aspiration. Although probes of this type were initially designed primarily for the surgical resection of tumors, it was subsequently found that the tissue fragments generated by the devices maintain sufficient integrity to be used diagnostically (Richmond, et al., Neurosurg. 13:415-419 (1983); Malhotra, et al., Acta Neurochir. 81:132-134 (1986); Blackie, et al., J. Clin. Pathol. 37:1101-1104 (2008)).
In addition to probes that ablate tissue ultrasonically, probes such as the Nico Myriad™ probe (NICO Corporation) have been designed to perform surgical ablations by mechanically cutting or shaving tissue. One attractive aspect of these “mechanical sampling” probes is that tissue is obtained without the generation of heat.
Despite the advances noted above, the diagnostic use of ultrasonic and mechanical probes has gone largely undeveloped and potential advantages over traditional methods of tissue sampling have often gone unrecognized.
Thus, a need exists for an intra-operative diagnostic solution that provides a surgeon with more information about a tumor margin boundary.
The present invention overcomes the aforementioned drawbacks by providing a system for utilizing mass spectrometry within the procedure room to provide real time feedback concerning the presence of cancerous cells at the surgery boundary. A hand held sampling probe can be used that allows a surgeon to collect samples intra-operatively from target areas of a surgery site. One exemplary probe is disclosed in U.S. Patent Publication No. 2011/0144476, the entirety of which is incorporated herein by reference.
One aspect of the present invention provides a system for determining a presence of cancer in a tissue sample. The system includes a sampling probe including a tip configured to vibrate in response to ultra-sonic energy to remove the tissue sample, and an aspirating pathway in communication with the tip. A mass spectrometry apparatus is in communication with the sampling probe via the aspiration pathway and configured to receive the tissue sample and analyze the tissue sample using a mass spectrometry process to generate mass spectrometry data. A computer system includes a computer processor having access to a non-transitory, computer-readable storage medium having stored thereon instructions that cause the computer processor to: receive the mass spectrometry data from the mass spectrometry apparatus, analyze the mass spectrometry data to determine a presence of at least one potential biomarker indicating the presence of cancer in the tissue sample, access a database of at least one of biomarker information and biomarker analysis algorithms, analyze the potential biomarker using the at least one of the biomarker information and biomarker analysis algorithms to determine a presence of cancer in the tissue sample, and determine from the presence of cancer in the tissue sample a likelihood of cancer in the tissue sample, and a report generator configured to deliver a report indicating the likelihood of cancer in the tissue sample.
In another aspect, the present invention provides a method for determining a presence of cancerous cells within a subject during a surgical procedure to remove the cancerous cells. The method includes harvesting the cancerous cells, positioning a sampling probe including an aspiration pathway proximate to an analysis site, vibrating a tip of the sampling probe in response to ultrasonic energy to remove a tissue sample, aspirating the tissue sample through the aspiration pathway, providing the tissue sample from the sampling probe to a mass spectrometry system, conducting a mass spectrometry procedure on the tissue sample to produce a spectrographic report, analyzing the spectrographic report to determine a presence of a biomarker indicating a presence of cancer in the tissue sample from the subject, and generating a report indicating a likelihood of cancer existing in the analysis site.
The foregoing and other aspects and advantages of the invention will appear from the following description. In the description, reference is made to the accompanying drawings which form a part hereof, and in which there is shown by way of illustration a preferred embodiment of the invention. Such embodiment does not necessarily represent the full scope of the invention, however, and reference is made therefore to the claims and herein for interpreting the scope of the invention.
The invention will be better understood and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings.
Table 1 is a summary of tissues samples used in exemplary experiments.
Table 2 is a detail of an exemplary bio marker.
Table 3 is a detail of another exemplary bio marker.
Table 4 is a detail of another exemplary bio marker.
Table 5 is a detail of another exemplary bio marker.
Table 6 is a detailed description of samples used in an IDH1 study. IHC and DESI results are shown, for both solvent systems used.
Table 7 shows 2-HG levels results for surgical Case 3.
Table 8 shows samples used in IDH1 study. IHC and DESI results are shown.
Table 9 shows classification results for samples from surgical case 9. Results indicate the percent of pixels within each image that were assigned to a given class. Surgical samples used as reference to build the SVM classifier are in boldface (D38 and D40). GBM, glioblastoma.
Table 10 shows p-values obtained for the eight peaks from t-tests. The p-values of the Wilcoxon/Kruskal-Wallis (PWKW) test and the Anderson-Darling Test (PAD) indicate a significant difference between the GBM and the necrosis data sets for each m/z value of
While the invention is susceptible to various modifications and alternative forms, specific embodiments thereof have been shown by way of example in the drawings and are herein described in detail. It should be understood, however, that the description herein of specific embodiments is not intended to limit the invention to the particular forms disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention as defined by the appended claims.
As discussed above, routine intra-operative distinction between tumor and normal breast tissue is currently not possible in breast conserving surgery. This limitation affects the success of many surgical procedures. For example, considering just one common cancer surgery, in breast cancer surgery, up to about forty percent (40%) of operations require more than one operative procedure.
Mass spectrometry imaging (MSI) has been applied to investigate the molecular distribution of proteins, lipids and metabolites without the use of labels. In particular, desorption electrospray ionization (DESI) allows direct tissue analysis with little or no sample preparation. Therefore, with the advantage of easy implementation, DESI mass spectrometry imaging (DESI-MSI) has great potential in the application of intra-operative tumor assessment. As described herein, imaging includes spatially encoded information correlated with the surgical site and/or the tissue histology itself. However, not all spectroscopy data in accordance with the present invention needs to be spatially encoded. For example, one or a series of points may be sampled with or without spatial encoding information and delivered to the clinician. Furthermore, when the spectroscopy data is spatially encoded, the spatial encoding may include two or three-dimensional spatial encoding. Thus, the data may be presented in pixels or voxels.
Mass spectrometry offers the possibility for the in-depth analysis of proteins and lipids comprising tissues. Desorption electrospray ionization-mass spectrometry (DESI-MS) is a powerful methodology for characterizing the lipids within tumor specimens. The ionization profile of lipids within tumors can be used for tumor classification and to provide valuable prognostic information such as tumor grade. Because DESI-MS is performed in ambient conditions with minimal pretreatment of the samples, diagnostic information can be provided rapidly within the procedure room. The present invention leverages the ability to quickly acquire such valuable diagnostic information from lipids to use DESI-MS to detect additional molecules of diagnostic value within tumors such as their metabolites.
Recurrent mutations have been described in the genes encoding isocitrate dehydrogenases 1 and 2 (IDH1 and IDH2) in a number of tumor types including gliomas, intrahepatic cholangiocarcinomas, acute myelogenous leukaemias (AML) and chondrosarcomas. These mutant enzymes have the novel property of converting α-ketoglutarate to 2-hydroxyglutarate (2-HG). This oncometabolite has pleiotropic effects impacting DNA methylation patterns, and the activity of prolyl hydroxylase activity. While 2-HG is present in vanishingly small amounts in normal tissues, concentrations of several micromoles per gram of tumor have been reported in tumors with mutations in IDH1 and IDH2. As will be described, the present invention enables the detection of, among other things, 2-hydroxyglutarate using 2-dimensional DESI-MS on a series of gliomas or other tumor types. Additionally, the invention may apply to other surgery situations outside of tumor boundary detection or to the recognition of other biomarkers. Detecting metabolites in tumor tissues with precise spatial distribution and under ambient conditions provides a new paradigm for intraoperative surgical decision-making.
Turning to
Once a sample is provided to the sample receptacle 108, the sample is processed by a mass-spectrometry system 110. The mass-spectrometry system 110 analyzes the tissue to determine a presence of a biomarker indicating a presence of cancer in the tissue sample. The mass-spectrometry system 110 may be a desorption electrospray ionization apparatus. In any case, the mass-spectrometry system 110 is coupled to a report generator 112 that is configured to deliver a report indicating a likelihood of cancer remaining in the subject based on the analysis and, more particularly, the above-described biomarkers. The report generator 112 may include a printing system to print a physical report or may include a display to display a report, including figures and user-interface components, for example, such as will be described with respect to
The mass-spectrometry system 110 and/or report generator 112 may include or be connected to a computer system 114. The computer system 114 includes a computer processor connected to a non-transitory, computer-readable storage medium or memory 118 that can store computer programs to control operation of the computer system 114 and, thereby, control operation of or coordinate operation with the mass-spectrometry system 110 and/or report generator 112. Accordingly, the computer system 114 may include any of a variety of user interfaces 120 or communications mechanisms, including a keyboard, mouse, touch screen, monitor, audio or video input or output, and the like. In addition, the computer system 114 may include a variety of input or communications connection 122, including traditional computer-system input/outputs, network communications ports (wired and wireless) that may provide access to wide and local networks and the Internet. By way of the communications connection 122, the computer system 114 may be coupled to a database 124 or other information repository. As will be described, the database 124 may store a variety of information to facilitate data analysis, including data on various biomarkers, such as will be described, and various algorithms or processes that the processor 116 may utilize to analyze information about the sample provided to the receptacle 108 and provide a report through the report generator 112.
Thus, in operation, the system 100 can be utilized within an operating room or any clinical setting that would benefit from accessing tissue information to support a clinical decision to provide real-time feedback to a surgeon or other clinician. In addition to the mass spectrometry results and the feedback regarding any of a variety of biomarkers and/or analysis algorithms, the probe 106 may also be coupled with additional navigation or recording systems, such as disclosed in co-pending U.S. patent application Ser. No. 13/059,524.
That is, the probe 106 may include stereotactic tracking elements or beacons that are linked to imaging components. In one construction, an imaging device 126 such as an MRI, CAT, CT, PET, MRS, or other imaging device is used to create a three-dimensional (3D) anatomical image of the surgery site. The stereotactic tracking elements may then be used to track the probe 106 or the location from which a tissue sample was manually resected within the anatomical image. In this way, the surgeon may track the location within an additional image of where the tissue sample was collected and correlate the report details, such as the spectroscopy images, to the exact location. In this way, the surgeon may use the 3D image as a map and examine various areas of the surgery site for the presence of biomarkers, for example through a report generator 112. Regardless of whether additional imaging or tracking systems are used, the system 100 provides the surgeon with real-time and direct feedback about the operating site. This provides a very powerful tool for real-time feedback during medical procedures. For example, in the case of a cancer resection, the system 100 allows the surgeon or clinician to completely remove the cancerous cells, while maintaining the maximum amount of healthy tissue intact, because, as will be described, the feedback from the system 100 can indicate the presence or absence of cancer cells in real-time.
The report generator 112 is located within the procedure room such that the surgeon can monitor the anatomical image, the probe location, and the spectroscopy data and image for any sampled point within the surgery site in real time. This provides the surgeon with more information about the surgery while he or she can still affect the outcome of the surgery without having to wait for lengthy lab procedures. The report generator 112 may include a visual monitor that includes a color display large enough to be easily read in an procedure room environment. The display may be large enough such that it is easily read to reduce error of interpretation during surgery. The display can provide the anatomical image, the spectroscopy data and images, the stereotactic tracking information, and other information related to the surgery as desired. The Figures show several examples of the type of information which may be displayed on the report generator 112. The report generator 112 can be configured to be mounted within the procedure room.
Thus, using the invention, the surgeon or other clinician can verify the full resection of the cancer while still in the procedure room.
Referring to
The method 200 may begin at process block 202 where a harvesting of cancerous cells is performed. As one non-limiting example, this may be an interventional or surgical procedure, for example, performed in a procedure room. At process block 204, a sampling probe including an aspiration pathway is positioned proximate to an analysis site. For example, the analysis site may be a location in the subject that was proximate to the harvested cancer cells, such that an in vivo analysis can be performed. As another example, the analysis site may be a portion of a resected or harvested sample, such that an in vitro analysis can be performed. As will be described, in either case, the present disclosure provides a system and method to perform the following analysis to provide a report that can be used to inform further clinical decisions with respect to a surgical or cancer removal procedure. As an alternative, the sampling probe can be a tool that mechanically resects a sample and provides it to a mass spectrometry system.
Next, at process block 206, a tissue sample is aspirated through the aspiration pathway. Subsequently, at process block 208, the tissue sample is provided from the sampling probe to a mass spectrometry system. Next, at process block 210, a mass spectrometry procedure is conducted on the tissue sample to produce a spectrographic report. At the following process block 212, the spectrographic report is analyzed to determine a presence of a biomarker indicating a presence of cancer in the tissue sample from the subject. Finally, at process block 214, the method includes generating a report indicating a likelihood of cancer existing in the analysis site.
The method 300 may begin at process block 302 where a harvesting of cancerous cells is performed. At process block 304, a sampling probe is positioned proximate to an analysis site. At process block 306, a tissue sample is acquired from the analysis site using the sampling probe. At process block 308, the tissue sample is provided from the sampling probe to a mass spectrometry system. At process block 310, a mess spectrometry procedure is conducted on the tissue sample to produce a spectrographic report. At process block 312, the spectrographic report is analyzed to determine the presence of a biomarker indicating a presence of cancer in the tissue sample from the subject. At process block 314, a report is generated indicating a likelihood of cancer existing in the analysis site.
In certain embodiments, the computer processor is further caused to determine a relative abundance of the biomarker. In certain embodiments, the report generator is configured to indicate a higher relative abundance of the biomarker as compared to healthy tissue as indicating cancer in the tissue sample. In certain embodiments, the step of analyzing can include determining a relative abundance of the biomarker. In certain embodiments, the relative abundance of the biomarker is higher in a cancerous tissue sample than a healthy tissue sample.
In certain embodiments, the report can include a chart of a relative abundance of all detected ions. In certain embodiments, the method further include indicating a boundary between cancerous cells and non-cancerous cells using the report.
In certain embodiments, the mass spectrometry apparatus or procedure can include a desorption electrospray ionization. In certain embodiments, the mass spectrometry apparatus or procedure can include operating in a negative ion mode or a positive ion mode.
In certain embodiments, aspirating the tissue sample can include providing irrigating fluid to a tip of the sampling probe through the irrigation channel.
In certain embodiments, the method can further include vibrating a tip of the sampling probe in response to ultrasonic energy to remove the tissue sample.
In certain embodiments, the method can further include conducing an imaging procedure. The method can also include stereotactically tracking a location of the tip of the sampling probe. The method can further include correlating the report to the tracked location of the tip within an image produced by the imaging procedure. The imaging procedure can include, among other things, a magnetic resonance imaging procedure, an ultrasound imaging procedure, and the like.
In certain embodiments, the biomarker includes a lipid. In certain embodiments, the biomarker includes one of m/z 89.1, m/z 281.3, m/z 282.24, m/z 303.3, m/z 304.24, m/z 365.4, m/z 366.35, m/z 391.4, m/z 392.37, m/z 413.4, m/z 445.4, m/z 572.6, m/z 626.8, m/z 656.8, and m/z 682.8.
The following description of the operation and features of the system 100 is divided into five sections. SECTION I discusses an exemplary probe 106 for obtaining the tissue sample and tracking the location of origin of the sample. Section II discusses various details an exemplary methodology of sample acquisition and imaging in accordance with the present invention. SECTION III illustrates a second exemplary methodology of sample acquisition and imaging in accordance with the present invention. SECTION IV illustrates a third exemplary methodology of sample acquisition and imaging in accordance with the present invention. SECTIONS II and III discuss the use of laboratory techniques for secondary analysis of the collected samples. The laboratory analysis was conducted as a way to verify the invention's effectiveness and to verify the effectiveness of the inventive methodology and system. Thus, the discussion of the methods for validation utilize traditional analysis techniques/systems, rather that the system of
Section I
One example of a probe 106 that integrates a tissue resection device with a stereotactic navigation system and uses the device to collect tissue fragments for diagnostic assays is discloses below. The probe 106 allows tissue sampling locations to be precisely determined. Preliminary results and published articles reporting on the histopathological evaluation of tissue fragments indicate that ultrasonically generated fragments preserve the features required for standard histopathological diagnosis. It is expected that mechanically generated fragments would also preserve these features.
In one aspect, the probe 106 includes a medical device that can be used in collecting tissue samples from biopsy sites in a patient. The device includes a hand held support, also referred to as a hand held base unit, typically made of plastic, metal or rubber with a shape and size that allows it to be easily held and maneuvered in an operator's hand. Typically, these supports will have a rectangular or cylindrical shape and be about 4 to 8 inches in length, although other shapes and sizes are possible. Extending from, and attached to, one end of the hand held support is an elongated metal rod with a proximal end (the end attached to the support) and a distal end (the end furthest from the support). The rod will typically be about 3 to 10 inches long and terminate at its distal end in a tip that either itself vibrates in response to ultrasonic energy or which has a separate component attached to it that vibrates in response to ultrasonic energy. Alternatively the tip may include a sharpened cutting surface that, in response to electrical stimulation, cuts or shaves tissue.
The medical device also includes means for supplying ultrasonic energy to the tip or to the separate vibrational component, preferably at a frequency of 15-100 kHz and, more preferably, at 20-60 kHz. Alternatively the device may be designed to respond to the input of electrical energy by moving in a manner that results in the cutting or shaving of tissue. For example, there may be an electrical motor that causes the tip to rotate in the manner of a drill in response to electrical input.
In addition, the device includes means for supplying irrigating fluid to the distal end of the tip and for aspirating tissue fragments created at the tip as the result of ultrasonic vibrations or due to mechanical cutting or shaving. A preferred method for supplying irrigating fluid is by pumping it from a reservoir through a tubular channel running through the rod and terminating in an opening at the tip. The exact diameter of the channel is not critical to the invention but will typically be between ⅛ and ½ of an inch. The reservoir may contain any pharmaceutically acceptable fluid such as water, saline, Ringer's solution etc. and may be maintained at room temperature or chilled, e.g., to 0-15° C. If desired, the fluid may also include antibiotics to help prevent infection or other drugs.
With respect to aspiration, it is preferred that the metal rod of the device have a hollow core that provides a fluid passageway for tissue fragments. This passageway is open at the tip and extends through or past the hand held support of the device. Sufficient suction is provided, e.g., by means of a medical suction pump, to aspirate material through the opening at the tip in the direction of the hand held support. As with the channel for providing irrigation fluid, the diameter of the passageway for aspiration is not critical but will, in general, be between ⅛ and ½ inch.
The passageway may be connected at its proximal end to a tissue collection container where aspirated fragments are delivered and which, in some embodiments, contains a fluid such as water, saline or Ringer's solution. This fluid may, optionally be chilled, e.g., to 0-10° C., and may include chemicals for fixing tissue samples. In an alternative embodiment, the tissue fragments may be delivered to a container in which they are quick frozen, e.g., in dry ice or liquid nitrogen. The collected sample may alternatively be supplied directly to a mass spectrometry device without the use of a storage container or solution. In the event that a storage container or solution is used, the storage container or solution will typically not require extensive preparation or lab work such that the tissue sample may be collected and supplied to the mass spectrometry device within the procedure room without the need for additional laboratory work or preparation.
The probe 106 provides a system for stereotactically determining the position of the distal end of the rod (i.e., the location where aspirated tissue samples are collected) relative to the tissue being examined (e.g., brain tissue).
The stereotactic system may include a computer that stores information regarding the spatial relationship between the probe (particularly the tip of the probe) and the tissue of the patient being examined. The probe includes means for communicating information to the computer regarding its position. This may be accomplished using, inter alia: a) ultrasound detectors; b) electromagnetic emitters located on the device (preferably on the hand held support of the device) that transmit signals to a separate electromagnetic receiver; c) sound emitters located on the device (preferably on the hand held support) that transmit signals to microphones; d) by optical tracking using infrared energy detectors; or e) other stereotactic tracking devices, as desired. In each instance, signals are communicated to the computer for analysis. The most preferred method for communicating information concerning the position of the device is with electromagnetic emitters.
In one embodiment, the hand held support includes an actuator switch which, when activated, permits the transmission of ultrasonic or mechanical energy to the tip of the rod or to a separate component which vibrates in response to ultrasonic energy. When the switch is not activated ultrasonic energy is not transmitted. Activation of the actuator switch is, preferably, accompanied by the transmission of a signal to the computer to aid in determining the position of the tip of the rod at the time of actuation. In an alternative and more preferable design, the actuator switch is in the form of a foot pedal which, when activated, transmits ultrasonic energy to the tip of the rod. Actuator switches may also be used which, instead of causing rod tips to ultrasonically vibrate, cause the tip to move in a manner that results in the cutting or shaving of tissue.
In another aspect, the probe 106 provides a method of collecting a tissue sample from a biopsy site by inserting the tip of any of the medical devices described above into a patient so that the distal end of the rod is positioned at the site where the biopsy is to be performed. Energy is then transmitted to the tip of the rod to create ultrasonic vibrations at the site and fragment tissue or to cause the cutting or shaving of tissue. Irrigation fluid is then administered at the biopsy site and the fragments are aspirated into a collection container where they are retrieved for histological examination or other diagnostic tests.
The probe 106 may be used in the system 100 for methods of collecting tissue samples that are mapped to a particular biopsy site. The first step in these methods is to establish a three dimensional stereotactic coordinate system for reproducibly identifying positions in the tissue that is to be examined, e.g., a portion of a patient's brain or a tumorous growth. Any of the stereotactic positioning systems described in the various references cited above can be used for this purpose. Next, one or more diagnostic imaging procedures (e.g., a CT or MRI scan) are performed to identify areas in the patient where one or more biopsy samples may be taken. Finally, tissue samples are collected using a medical device that fragments the tissue, collects the fragments that have been generated and records the position of sampling in the stereotactic coordinate system. The information obtained using this procedure will be particularly useful when multiple sites are sampled, for example, to determine how far cancer cells have invaded. Although the methodology can, in principle be applied to any site in a patient's body, it is expected that, initially, it will be most useful for biopsies involving brain tissue or breast tissue.
Devices of this type can incorporate a component into the hand held support that will provide a signal that can be used in analyzing its exact position. For example, electromagnetic emitters may be included in the support to provide a signal to a separate receiver, which, in turn, communicates this information to a computer for analysis. A drawing of a probe 106 with electromagnetic emitters 128 is shown in
Referring to
Devices should also include means for irrigating and aspirating tissues after fragmentation. This is illustrated in
In order for the devices described above to provide information on the location of sampling sites, they should be integrated with existing systems for the stereotactic analysis of spatial arrangements. The first step in using these systems is to establish a three dimensional stereotactic coordinate system for reproducibly identifying positions in the tissue of the patient. This is usually accomplished using an apparatus or electrodes that are placed in fixed positions on the patient as a frame of reference. Diagnostic imaging procedures (e.g., CT scans or MRI scans) may then be performed to provide information concerning the internal tissues of the patient and the spatial relationship of the tissues to the established coordinate system. For example, imaging procedures may be used to provide information on the exact location of a tumor. After imaging, an important step is the registration step which takes place in the OR.
The final step is to use the medical devices described herein to obtain tissue fragments while, at the same time recording the exact position where each sample was collected. The sample from each site is retrieved from the device and diagnostically analyzed. In this way, pathologic differences in a tissue may be determined. For example, different sites from tissue containing a tumorous growth may provide information on areas in need of surgical resection and sections that can be spared. This is particularly important in tissues such as the brain where as much normal tissue as possible must be preserved.
In one exemplary use, brain tumor specimens were collected using both surgical forceps and CUSA, and then mass spectrometry analyses were performed. A validating histopathological analysis showed preservation of histology features required for diagnosis, and the direct mass spectrometry analysis of the tissue specimens using a DESI-LTQ instrument revealed molecular signatures indicative of neoplasia, as compared to specimens biopsied using surgical forceps. This new integrated surgical-sampling probe can enable the differentiation of tumor from non-tumor tissue based on measurements or imaging of the samples.
Section II
Methodology:
Tissues Sample Preparation:
During development of the invention, Applicants obtained sixty-one (61) cancerous breast samples removed via mastectomy from fourteen (14) research subjects from Brigham and Women Hospital. The samples (shown in Table 1) were collected at a tumor center, a tumor edge, 2 cm away from the tumor edge, 5 cm away from the tumor edge, and from a contralateral breast when available. The types of breast cancer were classified based on the status of three most important receptors: estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (Her2). Among the fourteen cases, nine of them have the tumor type ER positive, PR positive and Her2 negative (ER/PR+, Her2−), which is the most commonly found in breast cancer. As to the gender, one male was included.
Without the above-described system fully developed to allow real-time analysis, samples were flash frozen and stored in −80° C. freezer prior to analysis. The tissues were sectioned at 12 μm thickness using Microm HM550 crystat (Mikron Instrument Inc). 20 μm thickness was selected in several cases with fatty tissue. All the samples were mounted on regular glass slides. The slides were dried in a dessicator before analysis.
DESI Mass Spectrometry Imaging:
All the samples were analyzed using AmazonSpeed mass spectrometer (Bruker Daltonics, MA) connected with a commercial DESI source (Prosolia Inc., IN). The stage holding the glass slides mounted with tissue sections moved horizontally at the speed of 200 μm/s and vertically by 200 μm step to generate 2D image. The stage movement was controlled by OminiSpray 2D (Prosolia Inc., IN). A nondestructive solvent containing 50% acetonitrile and 50% dimethylformamide was used. A flow rate of 1 μL/min was selected for the solvent spray. The spectra were acquired within the mass range m/z 50-1100 with Bruker software Hystar (Bruker Daltonics, MA). In order to display 2D image, FireFly (Prosolia Inc., IN) was used to convert the data to be compatible with Biomap. All the images obtained from Biomap were displayed with the same intensity scale in each figure.
Histological Staining:
Standard hematoxylin and eosin staining (H&E Staining) was performed on the same tissue section after DESI MS imaging as well as serial sections to visualize tissue morphological information. Glass coverslips were used to cover slides with toluene in between as mounting medium. All the reagents used for H&E staining were purchased from Sigma (Sigma-Aldrich, St. Louis, Mo.). The optical tissue images were scanned using Axio Imager M1 microscope (Zeiss, Chester, Va.) at 40× magnification. The morphology of tissue sections was evaluated on the Mirax Digital Slide Desktop Server system.
Results:
Lipid Profiling in Breast Cancer Tissues Using DESI-MSI in Negative Ion Mode:
As discussed above, tissue samples from a total of fourteen research subjects with various ages were analyzed using DESI-MS imaging. All the samples were analyzed in a negative ion mode. The spectra were collected within the range of m/z 50-1100. Therefore, the negatively charged ions from lipids and metabolites were acquired. To validate day-to-day reproducibility, mouse brain sections were tested in exactly the same condition at the beginning of the day before acquiring breast cancer data.
The representative profiled spectra from breast cancerous and healthy tissue sections are shown in
Based on the profiled spectra, significantly distinct lipids were detected from breast cancer and normal cells. Distinctive peak patterns in low mass region were observed in tumor tissue. However, the tissues from tumor edge, depending on cancer cell concentration, gave varying relative abundance in low mass range of the profiled spectra.
DESI-MSI of Breast Cancer Tissues in Negative Ion Mode:
DESI-MSI was performed on the breast cancer samples to display two-dimensional images correlating the lipid intensities with spatial distributions. Chemical information combining with tissue morphology is able to confirm the differentiation of tumor and healthy tissue based on molecular images from DESI-MSI.
Another example from research subject #14 is shown in
Tumor and normal tissues were able to be distinguished unambiguously based on single molecular image of certain lipid obtained from DESI-MSI. Overall 12 out of 14 cases demonstrated striking difference for ion images with m/z 281.250 and m/z 391.375 between tumor and healthy tissues. The use of nondestructive solvent with 50/50 ACN/DMF allows the subsequent histopathological evaluation on the same section as the tissue integrity was retained. The tissues from the tumor edge revealed distinctive molecular images but consistent with the tumor cell distributions evaluated by breast pathologist, allowing the delineation of tumor margin. The results establish the possibility of incorporating DESI-MSI intra-operatively for rapid diagnosis of breast cancer tissue.
A typical spectrum to represent unique peaks only from tumor cells can be obtained by subtracting the ions coming from normal cells from the ions coming from tumor as shown in
Principal Component Analysis:
Although the tumor tissue can be differentiated from healthy tissue simply according to single molecular image from DESI-MSI, principal component analysis (PCA) was conducted for more accurate evaluation using ClinProTool. The statistical analysis of data from research subject #9 and #14 were shown in
Abnormal Observation of Oleic Acid:
An interesting phenomenon was observed in research subject #5 that oleic acid signals (m/z 281.2) in normal tissues were increased dramatically (
Lipid Analysis of Breast Cancer Tissues in Positive Ion Mode:
The tissue sections from normal and tumor samples were also analyzed using DESI-MSI in positive mode. The representative spectra are shown in
Discussion:
A mass spectrometry based methodology is demonstrated here to distinguish breast cancerous and noncancerous tissue in order to potentially facilitate breast surgeon's decision making intra-operatively. Samples from 14 research subjects acquired at various locations of breast with tumor were investigated. The application of DESI-MSI enables the differentiation of the tumor from normal tissues and determination of a tumor boundary based on molecular images.
Compared with positive ion mode, the lipid spectra obtained from negative ion mode gives more unique information. In the profiled spectrum from negative ion mode, distinctive fatty acids and lipids were identified in breast cancer tissues. About 85% of the samples showed a significant increase of ion abundance in the low mass region (<m/z 700) in tumor samples, while most ions in high mass range (e.g. m/z 885.7) exist in normal cells as well. A “tumor” spectrum can be obtained by subtracting the ions coming from normal tissue, which represents the unique ions from cancer and facilitates tumor tissue diagnosis using mass spectrometry. In 2D images from DESI-MSI, the distinction of cancer and healthy tissue can be directly visualized. The tumor margin was able to be delineated even based on single molecular image validating the DESI-MS based diagnosis of breast cancer. Statistical analysis was performed to confirm the classification of tumor and normal tissues.
It is known that the lipids in breast samples degrade quickly during defrosting. In the exemplary experiments discussed above, although the samples were transferred carefully from −80° C. freezer to −20° C. cryostat for sectioning, the dramatic decrease of lipid signals were observed in DESI-MSI when the tissues were resectioned. The comparison of the tissues from the same sample but sectioned and analyzed at different days is shown in
Tables 2-5 show details of a number of biomarkers that may be useful for identifying tumor margins or boundaries. These biomarkers were uncovered during Applicants' study of DESI-MSI analysis. Further, the following biomarkers were uncovered in the negative ion mode:
The markers represented above and in Tables 2-5 are examples only. Other markers may exist and would be detected by the inventive system and method. In addition, all chemical formulas, names, identifications, and classifications are exemplary and form no boundary about the invention.
Section II
Identification of 2-Hydroxyglutarate by DESI-MS
To determine if 2-hydroxygluterate (2-HG) could be detected from glioma tissue sections by DESI-MS, the negative ion mode mass spectra were first collected from two glioma samples: an oligodendroglioma with mutated IDH1 (encoding the amino acid change R132H) and a glioblastoma with wild-type IDH1. 2-HG is a small organic acid containing two carboxylic acid functional groups in its structure. In the negative ion mode, in its deprotonated form, 2-HG should be detected at an m/z of approximately 147. Together with the rich diagnostic lipid information commonly observed from gliomas by DESI-MS in the mass range m/z 200-1000, an intense peak was detected at m/z 147.2 in an IDH1 mutated sample (
Tandem MS analysis (MS2) with a linear ion trap mass spectrometer was used to characterize the peaks at m/z 147. Tandem MS analysis of m/z 147 (the less intense peak noise levels) from a glioblastoma sample with wild-type IDH1 revealed main fragment ions at m/z 89 and m/z 103 (
The peaks were further characterized using a high-resolution LTQ Orbitrap mass spectrometer. DESI-MS mass spectra from an IDH1 R132H mutant sample showed a prominent peak at m/z 147.02985, with a mass resolution of ˜200,000 in the negative ion mode (
2-Hydroxyglutarate Levels by DESI-MS in Gliomas Correlates with Mutational Status
The levels of 2-HG were next monitored using DESI-MS in a panel of 35 human glioma resection specimens. These samples included primary and recurrent oligodendrogliomas, oligoastrocytomas and astrocytomas of different grades, including Grade IV glioblastoma samples (Table 6). The presence of the R132H mutation in IDH1 was determined by immunohistochemistry using a previously validated antibody that selective recognizes the R132H mutant epitope and not the wild-type epitope from IDH1 (Table 6). 2-HG levels were measured using a linear ion trap LTQ DESI-MS rapidly, directly from frozen tissue sections, and without any sample preparation. The 2-HG signal at m/z 147 was normalized to the levels of the forty most abundant lipid species detected from the glioma samples. This allowed the relative levels of 2-HG to be determined from each sample. Levels of 2-HG in R132 mutant IDH1 tumors ranged from 5 to 35 μmol per gram of tumor. Nearly all of the tumors that lacked the R132H mutation had over 100-fold less 2-HG (Table 6).
Interestingly, however, two samples (G28 and G33) that did not react with the R132H mutant-detecting antibody demonstrated a significant peak at m/z 147 (data not shown). The presence of 2-HG was confirmed by both tandem MS and high mass resolution experiments (data not shown). These findings suggested that the samples possessed alternate mutations in IDH1 or IDH2 that would generate the onco-metabolite, 2-HG. To address this possibility, targeting sequencing was performed for all of the major mutations in IDH1 and IDH2 that have been described in gliomas. This analysis revealed that both of these samples harbored a less common but previously described mutation in IDH1 that leads to amino acid change R132C (
Two-Dimensional DESI-MS Imaging of Glioma Sections
To further validate the ability to identify IDH1 mutant tumor tissue, a recently developed method for studying the spatial distribution of molecules across a tissue section was pursued, namely, two-dimensional (2D)-DESI-MS ion imaging. Because DESI-MS imaging does not destroy a sample as it is being analyzed, the same tissue section can be stained with H&E. Thus, a user can overlay the quantitative spatial information that 2D-DESI-MS provides onto the optical image of the tissue section. This facilitates correlating molecular signals such as 2-HG levels or tumor lipid levels with the underlying histopathology.
As an example, 2D-DESI-MS was used to evaluate the distribution of 2-HG and other diagnostic lipid species in a number of the glioma specimens which were previously characterized in Table 6. DESI-MS ion images of a densely cellular glioblastoma with wild-type IDH1, showed characteristic lipid species but m/z 147 was not detected (data not shown). In contrast, in a densely cellular glioblastoma with mutant IDH1, accumulation of 2-HG (m/z 147) was observed in the region with high tumor cell concentration and was essentially absent in an abutting region containing only hemorrhage. Lipid species that are characteristic for glioblastoma (m/z 788.4, m/z 885.5 and m/z 281.5) fully overlapped with the distribution of 2-HG (
Tumor Margin Delineation for IDH1 Mutated Surgical Cases Using 2-HG Levels
Above, with 2D-DESI-MS imaging, a visual demonstration that IDH1 mutant tumor tissues can be discriminated from normal tissues was provided. Intraoperatively, this ability could help detect glioma margins, i.e. where glioma cells interface with non-neoplastic brain tissue. Integrating the 2-HG information derived from DESI-MS with a patient's radiological imaging data would greatly empower a surgeon's intraoperative decision making To integrate these two forms of information, samples were collected from five neurosurgical resections of IDH1 mutant tumors performed with 3D mapping and registration in the Advanced Multimodality Image Guided Operating (AMIGO) Suite. This advanced surgical and interventional environment at Brigham and Women's Hospital is a part of the National Center for Image-Guided Therapy. The five cases included Grade II and III oligodendroglioma and oligoastrocytoma. The presence of the IDH1 R132H mutation was demonstrated in each case by immunohistochemistry. Tumor cell concentration was determined by a microscopic visual review of the H&E stained sections and of the IDH1 R132H immunostained sections. Strong 2-HG signals were identified in samples from the center of the tumor mass that were comprised of dense tumor (
In this report, it has been demonstrated that 2-hydroxyglutarate (2-HG) can be detected in glioma tissues using 2-dimensional DESI-MS. By monitoring 2-HG levels in tumor samples, at the time of surgery, this approach can provide rapid diagnostic information and actionable feedback.
Frozen tissue samples can be readily analyzed with the platform described herein. Fulfilling the true promise of this approach will, however, require the eventual development of surgical tools that allow DESI-analysis directly from tissue sampled by the neurosurgeon from the tumor resection bed. Nonetheless, with this current study a new paradigm for clinical diagnostics can be proposed. It has been previously demonstrated that many tumor types can be discriminated based on their lipid profile. Here, using gliomas with IDH1 mutations as an example, it has been shown that a single metabolite analyzed in the procedure room can rapidly provide highly relevant information: tumor classification (i.e. 2-HG expressing CNS tumors are nearly always gliomas), genotype information (i.e. 2-HG expressing tumors carry mutations in IDH1 or IDH2), prognostic information (i.e. 2-HG expressing tumors have a more favorable outcome) as well as intraoperative guidance for discriminating tumor from normal brain tissue. Presumably the approach described here should be applicable for the resection of all 2-HG producing tumors including chondrosarcoma and cholangiocarcinoma. Because ˜70-80% of grade II and grade III gliomas as well as the majority of secondary glioblastomas contain IDH mutations, monitoring 2-HG with DESI-MS could be useful for many neurosurgical interventions.
Other metabolites such as succinate and fumarate, which accumulate in specific tumor types, may similarly prove to be valuable markers using DESI-MS approaches. As metabolomic discovery efforts intensify, the cadre of useful metabolite markers and signatures is expected to expand significantly. This will undoubtedly increase the breadth and potential of MS diagnostics.
Two-dimensional DESI-MS analysis provides excellent spatial resolution without damaging the tissue, which can subsequently be stained with H&E dyes and visualized by standard light microscopy. Because the analyzed tissue remains intact, correlating the amount of metabolite with its originating source (i.e., stroma, blood vessel, tumor or normal non-neoplastic tissue) is now possible and practical. In addition, monitoring metabolite profiles simultaneously with lipid profiles (and their lipid-based tumor classifiers) as was done in this study will add to the diagnostic specificity and expand our understanding of tumor cell heterogeneity at a precise molecular level. Moreover, three-dimensional MRI mapping allows a correlation between radiologic imaging features and abundance of metabolites. Intraoperatively, in advanced multimodality image guided operating facilities, a surgeon could review visual information of the resection field and DESI-MS information about metabolite abundance and tumor classifiers all in the context of pre-operative and intra-operative radiological landmarks. Fluidly integrating all of this information, in a rapid timeframe, should significantly enhance a surgeon's capacity to achieve optimal tumor resection and would provide the foundation for surgery guided by metabolite-imaging mass spectrometry.
Tissue Samples
The tissue samples used in this study were obtained from the BWH Neurooncology Program Biorepository collection as previously described. They were obtained and analyzed under Institutional Review Board protocols approved at BWH. Informed written consent was obtained by neurosurgeons at BWH. The samples were sectioned for DESI-MS analysis as previously described. The tumors were classified in accordance with the WHO classification system. Resections of brain tumor lesions were performed using neuronavigation, with stereotactic mapping and spatial registering of biopsies performed as previously described. 3D-reconstruction of the tumor from MRI imaging data was achieved with 3-dimensional Slicer software package.
Histopathology and Immunohistochemistry
In addition to banked snap frozen samples, all cases had tissue samples that were formalin-fixed and paraffin embedded. Sections of FFPE tissue were stained with an anti-isocitrate dehydrogenase 1 (IDH1)-R132H antibody (clone HMab-1 from EMD Millipore) as previously described. Tissues were sectioned and immunostained as previously described. Hematoxylin and eosin (H&E) stained serial tissue sections were scanned using Mirax Micro 4SL telepathology system from Zeiss to generate digital optical images. Tumor content was evaluated by a trained neuropathologist (S. Santagata) through examination of H&E stained tissue sections and IDH1 R132H stained sections.
Identification and Quantification of 2-Hydroxyglutarate by DESI-MS
To determine if 2-HG could be detected directly from glioma tissue sections by DESI-MS, human glioma samples were tentatively analyzed in the negative ion mode using MeOH:H2O (1:1) and ACN:DMF (1:1) as solvent systems from m/z 100-1100. A description of the samples used in this study is shown in Table 6. The IDH1 status of the specimens was initially evaluated by IHC of a piece of FFPE tissue. For stereotactic cases, all biopsies were less than 0.4 cm and these specimens were divided in two (one portion was frozen for DESI-MS studies and the other was processed for FFPE; the latter was used for IDH1 IHC). Experiments were initially performed using an LTQ linear ion trap mass spectrometer (Thermo Fisher Scientific, San Jose, Calif., USA). Negative ion mode DESI-MS mass spectra of samples G23, and G31 are shown in
In DESI-MS analysis, a tissue section of ˜12 μm in thickness is examined in a pixel by pixel fashion, with a sampling area of 200×200 μm2 for each mass spectra acquired. A rough estimation of the total amount of 2-HG/pixel can be made by first estimating the mass of a 10 mm×6 mm human brain tissue section of 12 μm thickness to be ˜0.5 mg. Each 200×200 μm2 pixel therefore contains a mass of 3.3×10−4 mg. From literature values, it can be then estimated that each pixel being sampled by DESI-MS spray in R132 mutant IDH1 tumors has between 2 and 12 pmol of 2-HG. Therefore, it is expected that the concentration of 2-HG/pixel in wild-type IDH1 tumors would not be within the detectable levels for DESI-MS analysis. To address this, the limit of detection of 2-HG was estimated by depositing different concentrations of standard 2-HG solutions onto mouse brain tissue, followed by DESI-MS analysis under the same experimental conditions that human glioma samples were analyzed. As observed, while a linear relationship between 2-HG concentration and total abundance of m/z 147 was not observed (R2=0.69), a somewhat linear relationship was achieved between 2-HG concentration and total abundance of m/z 147 normalized to the sum of total abundance of the forty most abundant lipid species detected (R2=0.94) from the mouse brain tissue by DESI-MS. These results indicate that the value of m/z 147 abundance normalized to the lipid signals provides an indication of the concentration of 2-HG in tissues. The limit of detection was roughly estimated to be approximately 3 μmol 2-HG/gram of tissue, which is lower than the reported levels of 2-HG in R132 mutant IDH1 tumors.
One of the challenges in the analysis was to determine IDH1 status by DESI-MS detection of 2-HG in samples with low tumor cell concentration from full mass spectral data. For these samples, low detectable values of m/z 147 could be initially assumed as an indication of IDH negative mutation. Nevertheless, MS2 and MS3 of m/z 147 enabled IDH+ status confirmation for these samples, despite the low tumor cell concentration. DESI-MS imaging was performed for a few of the samples analyzed to evaluate the distribution of 2-HG and other diagnostic lipid species compared to tumor cell distribution in tissue
Section IV
For many intraoperative decisions, surgeons depend on frozen section pathology, a technique developed over 150 years ago. Technical innovations that permit rapid molecular characterization of tissue samples at the time of surgery are needed and in most cases, during the surgical procedure. Here, using desorption electrospray ionization mass spectrometry (DESI MS), the tumor metabolite 2-hydroxyglutarate (2-HG) was rapidly detected from tissue sections of surgically-resected gliomas, under ambient conditions and without complex or time consuming preparation. With DESI MS, IDH1-mutant tumors were identified with both high sensitivity and specificity within minutes, immediately providing critical diagnostic, prognostic and predictive information. Imaging tissue sections with DESI MS shows that the 2-HG signal overlaps with areas of tumor and that 2-HG levels correlate with tumor content, thereby indicating tumor margins. Mapping the 2-HG signal onto three-dimensional MRI reconstructions of tumors allows the integration of molecular and radiologic information for enhanced clinical decision-making. The methodology and its deployment in the operating room were also validated—a mass spectrometer has been installed in an Advanced Multimodality Image Guided Operating (AMIGO) suite and the molecular analysis of surgical tissue during brain surgery has been demonstrated. This work indicates that metabolite-imaging mass spectrometry could transform many aspects of surgical care.
Introduction:
The review of tissue sections by light microscopy remains a cornerstone of tumor diagnostics. In recent decades, monitoring expression of individual proteins using immunohistochemistry and characterizing chromosomal aberrations, point mutations and gene expression with genetic tools has further enhanced diagnostic capabilities and this capability is demonstrated here. These ancillary tests, however, often require days to weeks to perform and the results become available long after surgery is completed. For this reason, the microscopic review of tissue biopsies frequently remains the sole source of intraoperative diagnostic information, with many important surgical decisions such as the extent of tumor resection based on this information. This approach is time consuming, requiring nearly 30 minutes between the moment a tissue is biopsied and the time the pathologist's interpretation is communicated back to the surgeon. Even after the report of the final pathologic diagnosis is issued days later, a lot of diagnostic, prognostic and predictive information is left undiscovered and unexamined within the tissue. Tools that provide more immediate feedback to the surgeon and the pathologist and that also rapidly extract detailed molecular information could transform the management of care for cancer patients.
Mass spectrometry offers the possibility for the in-depth analysis of the proteins and lipids that comprise tissues. It has been shown that desorption electrospray ionization mass spectrometry (DESI MS) is a powerful methodology for characterizing lipids within tumor specimens. The intensity profile of lipids ionized from within tumors can be used for classifying tumors and for providing valuable prognostic information such as tumor subtype and grade. Because DESI MS is performed in ambient conditions with minimal pretreatment of the samples, there is the potential to provide diagnostic information rapidly within the procedure room. The ability to quickly acquire such valuable diagnostic information from lipids prompted us to determine whether DESI MS could be used to detect additional molecules of diagnostic value within tumors such as their metabolites.
Recently, recurrent mutations have been described in the genes encoding isocitrate dehydrogenases 1 and 2 (IDH1 and IDH2) in a number of tumor types including gliomas, intrahepatic cholangiocarcinomas, acute myelogenous leukemias (AML) and chondrosarcomas 15. These mutant enzymes have the novel property of converting α-ketoglutarate to 2-hydroxyglutarate (2-HG). This oncometabolite has pleiotropic effects on DNA methylation patterns, on the activity of prolyl hydroxylase and on cellular differentiation and growth. While 2-HG is present in vanishingly small amounts in normal tissues, concentrations are extremely high in tumors with mutations in IDH1 and IDH2—several micromoles per gram of tumor have been reported in tumors. Several groups have reported that 2-HG can be detected by magnetic resonance spectroscopy and imaging hence providing a non-invasive imaging approach for evaluating patients. While such imaging approaches may provide information to plan surgery and to follow the response to chemotherapeutics, applying them to guide decision-making during an operation is currently impractical.
The ability to detect 2-HG intraoperatively would be particularly useful because infiltrating gliomas such as IDH1 mutant gliomas are difficult to visualize with conventional means which contributes to the high prevalence of suboptimal surgical resection. The more residual tumor is left, the shorter the patient survival for both low and high grade gliomas. Detecting infiltrating glioma cells by microscopic review is challenging on well-prepared H&E stained permanent sections, and even more so on H&E stained frozen sections which frequently harbor processing artifacts. Thus, 2-HG detection could help to define surgical margins thereby allowing for more complete resection and for longer survival. Moreover, directing patients toward appropriate clinical trials for targeted therapeutics would be facilitated by more rapid molecular categorization of tumors.
Here, it is shown that 2-HG can be rapidly detected from glioma samples using DESI MS—under ambient conditions, without complex tissue preparation and during surgery allowing rapid molecular characterization and providing information that is unattainable by standard histopathology techniques. The first implementation of mass spectrometry within an operating room for the molecular characterization of tissue as part of an image-guided therapy program is also presented. The findings were cross-validated using standard pathology techniques. Measuring specific metabolites in tumor tissues with precise spatial distribution and under ambient conditions provides a new paradigm for intraoperative surgical decision-making, rapid diagnosis, and patient care management.
Results:
Identification of 2-Hydroxyglutarate with DESI MS:
Referring to
To determine the conditions for detecting 2-hydroxyglutarate (2-HG) from glioma frozen tissue sections by DESI MS, the negative ion mode mass spectra were first recorded from two glioma samples: an oligodendroglioma with mutated IDH1 (encoding the amino acid change R132H) and a glioblastoma with wild-type IDH1. 2-HG is a small organic acid containing two carboxylic acid functional groups in its structure. In the negative ion mode, the deprotonated form of 2-HG should be detected at an m/z of 147.03 (C5H7O5-). Together with the rich diagnostic lipid information commonly observed from gliomas by DESI MS in the mass range m/z 100-1000, a significant peak was detected at m/z 147 in an IDH1 mutated sample (
Tandem MS analysis (MS2) with a linear ion trap mass spectrometer was used to characterize the signal at m/z 147 (
2-HG Levels Correlate with Mutational Status and Tumor Cell Content:
The levels of 2-HG were next monitored using DESI MS in a panel of 35 human glioma specimens (Table 8) including primary and recurrent oligodendrogliomas, oligoastrocytomas and astrocytomas of different grades. The samples were first characterized using a clinically validated antibody that selectively recognizes the R132H mutant epitope and not the wild-type epitope from IDH1 (Table 8). 21 of the 35 samples had the R132H mutation. 2-HG levels in these samples were then measured directly from frozen tissue sections using a linear ion trap LTQ DESI. In some samples, a peak at m/z 147 was detected and assigned to 2-HG by tandem MS (MS2) analysis, thereby providing strong independent evidence that these samples were mutated for one of the IDH genes. To account for the variability in desorption and ionization efficiency throughout the tissue and between samples, 2-HG signal was normalized to the combined intensity of the forty most abundant lipid species that were detected during each data acquisition (see, Table 8 and materials and methods for more details on normalization). In all of the 21 samples with the IDH1 R132H mutation, 2-HG was clearly detected with a limit of detection estimated to be on the order of 3 μmol 2-HG/g of tissue (
A correlation (R2=0.42) was also observed between the concentration of tumor cells and the intensity of the 2-HG signal—samples with low concentrations of tumor cells (<50%) had lower 2-HG levels while samples with high concentrations of tumor cells (>50%) had higher 2-HG levels (
Interestingly, in two of the samples (G33 and G28) that were negative for the IDH1 R132H mutation by immunohistochemical staining (
Referring to
2D DESI MS Imaging of 2-HG in Glioma Sections Delineates Tumor Margins:
To further validate DESI MS as a tool for monitoring 2-HG levels, two-dimensional (2D) DESI MS imaging was used to study the spatial distribution of molecules across a tissue section. DESI MS imaging has recently been shown not to destroy a sample as it is being analyzed when an histologically compatible solvent system is used. This relative preservation allows the same tissue section to be stained with H&E following DESI MS data acquisition and the spatial molecular information derived from DESI MS can then be overlaid onto the optical image of the tissue. As such, this approach provides a powerful way to correlate 2-HG levels with histopathology and, importantly, to validate the DESI MS observations.
As a control, 2D DESI MS data was acquired from frozen sections of human glioblastoma orthotopic xenograft models that had been implanted into the brains of immunocompromised mice (
Tissue sections of human glioma specimens that had been surgically resected were next studied. Using 2D DESI MS with both an LTQ Ion Trap (Thermo Fisher Scientific, San Jose, Calif., USA) and an amaZon Speed ion trap (Bruker Daltonics, Billerica, Mass., USA), accumulation of 2-HG within a densely cellular glioblastoma with mutated IDH1 was observed (
In tissue specimens from two additional glioma resections, areas that contained regions of tumor were identified as well as regions of brain with only scattered infiltrating glioma cells—i.e. within the margin on the tumor. Referring to
3D Mapping of 2-HG onto MRI Tumor Reconstructions:
MRI information is critical for planning neurosurgical procedures. During the surgery, neuronavigation systems allow the neurosurgeon to register the position of surgical instruments with pre-operative plans (i.e. confirming where the tools are relative to the imaging findings). Surgeons can therefore digitally mark the site of a biopsy relative to the tumor in the MRI. Two IDH1 mutated gliomas were resected in this manner, using three-dimensional (3D) mapping, marking the positions of multiple biopsies in each case. In both cases, the 2-HG content of each stereotactic specimen was measured and normalized to its lipid signals (see materials and methods for details). This information was then correlated with the tumor cell content of each stereotactic specimen, as determined by review of both H&E and immunostains for IDH1 R132H.
In the resection of an oligodendroglioma (
A second surgical resection was performed (
An oligoastrocytoma was resected in this second case. The location of multiple biopsy pieces were digitally registered to the pre-operative MRI and 2-HG levels were measured in each of them (
Real-Time Intraoperative Detection of 2-HG:
Successfully implementing DESI MS in the operative setting requires that we demonstrate the feasibility of immediately detecting 2-HG in the operating room from tissue biopsies. In
In one case, a patient had had an oligoastrocytoma (WHO grade II) resected six years earlier. Upon recurrence of the tumor, the patient was re-operated on in our AMIGO suite. Interestingly, subsequent IDH1 molecular testing showed that the tumor lacked the R132H mutation by IHC testing (
In a second case, a patient had an anaplastic oligoastrocytoma (WHO grade III) resected three years earlier. Upon recurrence of the tumor, the patient was operated on a second time, this time in the AMIGO suite. For this case, smear preparations of the biopsies (
Discussion:
It has previously been demonstrated that many tumor types can be discriminated based on their lipid profile. Here, using gliomas with IDH1 mutations as an example, it is shown that a single metabolite—that can be and was monitored during surgery with ambient mass spectrometry (MS) techniques—can rapidly provide highly relevant information: tumor classification (i.e. 2-HG expressing CNS tumors are nearly always gliomas), genotype information (i.e. 2-HG expressing tumors carry mutations in IDH1 or IDH2), and prognostic information (i.e. 2-HG expressing tumors have a more favorable outcome)—all with excellent sensitivity and specificity.
Because 70-80% of grade II and grade III gliomas as well as the majority of secondary glioblastomas contain IDH1 or IDH2 mutations, monitoring 2-HG with intraoperative MS could conceivably become routinely used for surgeries of primary brain tumors—first to classify the tumor and then, if 2-HG is present, to guide optimal resection. Presumably, the approach described here could be applicable for the resection of all 2-HG producing tumors including chondrosarcoma and cholangiocarcinoma.
Unlike more time-consuming HPLC MS approaches that are standard for quantifying 2-HG, ambient mass spectrometry techniques enable rapid data acquisition and are therefore compatible with the rigorous time constraints of surgery. Because of this, the approach described in this work was shown to provide the intraoperative guidance needed to guide the iterative process of optimizing a resection—discriminating tumor from normal brain tissue—a distinction that is of utmost importance in neurosurgery for improving patient outcomes (increased survival and decreased morbidity). One note, the spatial resolution of DESI MS is approximately 200 μm, which is ample for evaluating surgical biopsies which are often two millimeters or more in size.
While MRI is an important intraoperative tool it does have limitations. MRI is an indirect measure of the presence of a tumor; it does not definitively reveal the type of tumor that is being operated on and can sometimes not discriminate tumor from reactive adjacent tissue; each intraoperative MRI scan requires 1 hour or longer to perform and interpret; MRI is not an iterative process (i.e. generally only one scan can be performed during a procedure); and the surgeon needs to extrapolate what is learned from the MRI to judge how much more tissue needs to be removed (without being able to ask specifically and directly whether the exact tissue area in question in the surgical field is truly tumor tissue). Importantly, performing an MRI is a major interruption to the surgical procedure because the patient's cranium needs to be temporarily closed, the patient is wrapped to prevent movement in the MRI, the operating room must be cleared of all surgical instruments, nearly all personnel must ‘scrub out’ and leave the operating room, and then a team including radiologists and the surgical team has to interpret the results. For much of this, the anesthetized patient is isolated from the clinical team within the MRI scanner. Moreover, each operating room that contains an MRI machine costs over $10 million, so these intraoperative MRIs are found in only the most advanced operating rooms in the world and thereby access to these important technologies is somewhat restricted for many surgeons and patients alike. It is clear how characterizing 2-HG producing tumor tissue with DESI MS could play an important role in neurosurgery.
Other metabolites such as succinate and fumarate, which accumulate in specific tumor types, may similarly prove to be valuable metabolite markers for guiding surgery with MS approaches. As metabolomic discovery efforts intensify, the cadre of useful metabolite markers will expand significantly. This will undoubtedly increase the breadth of applications and the diagnostic utility of MS-based approaches which could utilize DESI technologies or other ambient ionization methods. Fluidly assessing molecular information, in a rapid timeframe, should allow more accurate determination of tumor margins with molecular cues (i.e. “molecular margins”), enhancing the likelihood of achieving optimal tumor resection. The low tissue requirements for our methods also raise the possibility of detection in fine-needle aspirations, core-needle biopsies, or bone marrow biopsies of a wide range of tumors types in both surgical and non-surgical settings, and some preliminary data supporting this claim are available.
Beyond the pragmatic advantages that is described, DESI MS is promising as a research tool. Two-dimensional DESI MS analysis provides adequate spatial resolution without damaging the tissue, which can subsequently be stained with H&E and visualized by standard light microscopy. Because the analyzed tissue remains intact, correlating the amount of metabolite with its originating source (i.e. stroma, blood vessel, tumor or normal non-neoplastic tissue) is possible and practical. By permitting the integration of molecular and histologic information, DESI MS can now allow us to address previously enigmatic research questions, thereby validating concepts about tumor growth and heterogeneity that are difficult to address with standard tools.
Three-dimensional tumor mapping studies hold similar promise. The information derived with DESI MS, MRI and histology, can be integrated, compared and cross-validated. This rigorous approach will help us better understand the clinical and research tools that we use as well as to shed light on tumor growth patterns and pathobiology in situ, directly in the human brain. To date, surgery remains the first and most important treatment modality for patients suffering from brain tumors. Because of the potential that is described here, metabolite-imaging mass spectrometry is a new tool with broad and powerful clinical and research applications that could transform the surgical care of patients with brain and other solid tumors.
Materials and Methods:
Tissue Samples
The tissue samples used in this study were obtained from the BWH/DFCI Neurooncology Program Biorepository collection as previously described or from stereotactic surgical cases as described in
GBM xenografts BT116 and BT329 were derived from surgical resection material acquired from patients undergoing neurosurgery at the Brigham and Women's Hospital on an Institutional Review Board approved protocol. Briefly, tumor resection samples were enzymatically and mechanically dissociated using the MACS Brain Tumor Dissociation Kit (Miltenyi Biotech, Cambridge, Mass.) to generate single cell suspensions. Intracranial xenografts were generated by injecting 100,000 cells in the right striatum of SCID mice (IcrTac:ICRPrkdcscid; Charles River Labs, Wilmington, Mass.) and aged under standard conditions until onset of neurological symptoms. Euthanized xenografts were perfused by intra-cardiac injection of 4% paraformaldehyde and processed by standard methods for paraffin embedding.
Histopathology and Immunohistochemistry
In addition to banked snap frozen samples, all cases had tissue samples that were formalin-fixed and paraffin embedded (FFPE). Sections of FFPE tissue were stained with an anti-isocitrate dehydrogenase 1 (IDH1)-R132H antibody (clone HMab-1 from EMD Millipore) as previously described. Tissues were sectioned and immunostained as previously described. Hematoxylin and eosin (H&E) stained serial tissue sections were scanned using Mirax Micro 4SL telepathology system from Zeiss to generate digital optical images. Tumor content was evaluated by board-certified neuropathologists (S. Santagata and K. L. Ligon) through examination of H&E stained tissue sections and IDH1 R132H stained sections.
Identification of 2-Hydroxyglutarate by DESI MS
The IDH1 status of each specimen was initially evaluated by IHC of a piece of FFPE tissue. For stereotactic cases, all biopsies were less than 0.4 cm and these specimens were divided into two (one portion was frozen for DESI MS studies and the other was processed for FFPE; the latter was used for IDH1 IHC).
To determine if 2-HG could be detected directly from glioma tissue sections by DESI MS, human glioma samples were analyzed by DESI MS in the negative ion mode using either an LTQ Ion Trap (Thermo Fisher Scientific, San Jose, Calif., USA) or an amaZon speed ion trap (Bruker Daltonics, Billerica, Mass.). The solvent used in these experiments consisted of either MeOH:H2O (1:1) or ACN:DMF (1:1) with a mass from m/z 100-1100. All experiments involving the amaZon speed ion trap were carried out using a 5 kV spray voltage, 130 psi nebulizing gas (N2) and a flow rate of 0.7 μL/min.
A description of the samples used in this initial testing stage of this study (analyzed with the LTQ Ion Trap) is shown in Table 8. Negative ion mode DESI MS mass spectra of samples G23, and G31 are shown in
In total, thirty-five human gliomas samples presented in Table 8 were analyzed including oligodendrogliomas, astrocytomas, and oligoastrocytomas of different grades and varying tumor cell concentrations using both ion trap mass spectrometers. Note that as tissue analysis by DESI MS is performed without sample preparation but directly on tissue section, standard quantification of 2-HG as commonly performed with time consuming HPLC-MS protocols is not possible. One means by which relative levels of a certain molecule can be calculated is by normalizing its signal to a reference signal or set of signals obtained from the sample. In this study, the total abundance of 2-HG signal at m/z 147 was normalized to the sum of total abundances of the most abundant lipid species detected from the glioma samples by DESI MS. The mass spectra were exported as nominal mass from Xcalibur software (Thermo Fisher Scientific, San Jose, Calif., USA), and the absolute intensities of the forty most abundant lipid species within m/z 700 to 1000, which had been previously identified by tandem MS, were summed. Noise or background peaks within that m/z range were not considered. Normalization was then accomplished by dividing the total intensity of 147 by the summed intensities of the lipid species. Note that as a small contribution of background signal at the same m/z 147 was present in DESI mass spectra, MS2 was performed for all samples in order to confirm the presence of 2-HG. This was especially important in some IDH1 mutant samples with low tumor cell concentrations and therefore much lower abundances of 2-HG in DESI mass spectrum. If the MS2 fragmentation pattern matched that of authentic 2-HG, the sample was determined to be IDH1 mutated. Discrepancies in the fragmentation pattern or absence of detectable levels of m/z 147 were interpreted as IDH wild-type by MS analysis. Results for DESI MS analysis were obtained using two solvent systems. Note that while the solvent system DMF:ACN (1:1) favored relative abundances of low m/z ions when compared to MeOH:H2O, similar trends in 2-HG were observed for both solvents. Interestingly, the ratio of m/z 147 to the sum of lipid species correlated with the tumor cell concentration determined for the sample by histopathological evaluation of serial tissue section, providing a direct measure of the 2-HG levels in tissue. Most samples that were negative for IDH1 mutation as determined by IHC did not present 2-HG in the DESI MS mass spectra, even if the sample presented high tumor cell concentration, as confirmed by tandem MS analysis (with the exception of two samples as noted in the text).
One of the challenges in the analysis was to determine IDH1 status by DESI MS detection of 2-HG in samples with low tumor cell concentration from full mass spectral data. For these samples, low detectable values of m/z 147 could be initially assumed as an indication of IDH negative mutation. Nevertheless, MS2 and MS3 of m/z 147 enabled IDH mutation status confirmation for these samples, despite the low tumor cell concentration (as low as approximately 5% of tumor). DESI MS imaging was performed for a few of the samples analyzed to evaluate the distribution of 2-HG and other diagnostic lipid species compared to tumor cell distribution in tissue.
Genetic Analysis
Archival surgical specimens were reviewed by a pathologist (S. Santagata) to select the most appropriate tumor-enriched area for analysis. Total nucleic acid was extracted from FFPE tumor tissue obtained by manual macro-dissection, followed by extraction using a modified FormaPure System (Agencourt Bioscience Corporation, Beverly, Mass.). SNaPshot mutational analysis of a panel of cancer genes that included IDH1 and IDH2, was performed as previously described.
The primers listed below were used for targeted mutation analysis at codon R132 in IDH1 (nucleotide positions c.394 and c.395) and at codons R140 and R172 in IDH2 (nucleotide positions c.418, c.419, c.514 and c.515). PCR primers: IDH1 exon 4,5′-ACGTTGGATGGGCTTGTGAGTGGATGGGTA-3′ (forward) and 5′-ACGTTGGATGGCAAAATCACATTATTGCCAAC-3′ (reverse), IDH2 exon 4a (to probe codon R140), 5′-ACGTTGGATGGCTGCAGTGGGACCACTATT-3′ (forward), and 5′-ACGTTGGATGTGGGATGTTTTTGCAGATGA-3′ (reverse), and IDH2 exon 4b (to probe codon R172), 5′-ACGTTGGATGAACATCCCACGCCTAGTCC-3′ (forward), and 5′-ACGTTGGATGCAGTGGATCCCCTCTCCAC-3′ (reverse).
Extension primers: IDH1.394 extR 5′-GACTGACTGGACTGACTGACTGACTGACTGGACTGACTGACTGAGATCCCCATAAGC ATG AC-3′, IDH1.395 extR 5′-TGATCCCCATAAGCATGA-3′, IDH2.418 extR 5′-GACTGACTGACTGACTGACTGACTGACTGACTGACTGGACTGACTGACTGACTGCCC CCA GGATGTTCC-3′, IDH2.419 extF 5′-GACTGACTGGACTGACTGACTGACTGAGTCCCAATGGAACTATCC-3′, IDH2.514 extF 5′-GACTGACTGACTGACTGACTGACTGACTGGACTGACTGACTGACTGACTGGACTGAC TGA CCCATCACCATTGGC-3′ and IDH2.515 extR 5′-GACTGACTGACTGACTGACTGACTGACTGACTGACTGGACTGACTGACTGACTGACT GGA CTGACTGAGCCATGGGCGTGC-3′.
Section V
Despite significant advances in image-guided therapy, surgeons are still too often left with uncertainty when deciding to remove tissue. This binary decision between removing and leaving tissue during surgery implies that the surgeon should be able to distinguish tumor from healthy tissue. In neurosurgery, current image-guidance approaches such as magnetic resonance imaging (MRI) combined with neuro-navigation offer a map as to where the tumor should be, but the only definitive method to characterize the tissue at stake is histopathology. While extremely valuable information is derived from this gold standard approach, it is limited to very few samples during surgery and is not practically used for the delineation of tumor margins. The development and implementation of faster, comprehensive and complementary approaches for tissue characterization are required to support surgical decision-making—an incremental and iterative process with tumor removed in multiple and often minute biopsies. The development of atmospheric pressure ionization sources makes it possible to analyze tissue specimens with little to no sample preparation.
Here, the value of desorption electrospray ionization (DESI) is highlighted as one of many available approaches for the analysis of surgical tissue. Twelve surgical samples resected from a patient during surgery were analyzed and diagnosed as glioblastoma (GBM) tumor or necrotic tissue by standard histopathology, and mass spectrometry results were further correlated to histopathology for critical validation of the approach. The use of a robust statistical approach reiterated results from the qualitative detection of potential biomarkers of these tissue types. The correlation of the MS and histopathology results to magnetic resonance images brings significant insight into tumor presentation that could not only serve to guide tumor resection, but that is worthy of more detailed studies on our understanding of tumor presentation on MRI.
Introduction:
Surgery is typically the first step for the treatment of brain tumors. To minimize the removal of functional healthy tissue, brain mapping techniques are often used prior to and during surgery. During the procedure, surgeons can use intraoperative ultrasound and MRI in centers where the technology is available, but these tools still provide limited temporal resolution (MRI) and discriminative capability (ultrasound). In addition, neither ultrasound nor MRI directly sample the tumor to determine the molecular characteristics of the tissue, thereby providing only an indirect assessment of the tumor.
Over several decades, various methods have been proposed to provide tissue discrimination including infrared or Raman spectroscopy, flow-cytometry, in vivo labeling techniques coupled with spectroscopy, and scintillation counting for the characterization of tissues in an operating room. Due to issues of complexity, limited sensitivity for properly discriminating tissues, or limited compatibility with the surgical environment none of these techniques has yet gained widespread use.
A wealth of reports have been published over the past decade on the ability of mass spectometry to discern and characterize biological tissues with increasing sensitivity and specificity. It therefore becomes very natural to return mass spectrometers back into the operating room where they were routinely used in the 1980s to sample airway gases from anesthetized patients. Now, however, they would permit the precise molecular characterization of tissue and serve as an analytical tool in image-guided therapy. Different mass spectrometry (MS) platforms will likely find themsleves interfacing with surgical decision-making at various points in the clinical workflow. MS has already proven to be useful for the characterization of intact biological tissues. For over a decade, matrixassisted laser desorption/ionization (MALDI) mass spectrometers have successfully been used for the profiling of peptides and proteins from tissues and cells in the research setting and has recently been increasingly employed for the analysis of small molecules such as lipids, drugs and their metabolites. MALDI mass spectrometry imaging (MSI) analyses of tissue have become an extremely promising tool to support decision-making in histopathology evaluation of tissue. With its ability to capture essentially a complete mass range of biomolecules that include accepted biomarkers such as proteins, MALDI MSI should assist in diagnosis providing enhanced discriminating power over visual inspection of tissue. A higher level and certainty of diagnosis provided during frozen section analysis would certainly benefit surgical decision-making in better understanding the disease faced by the surgeon. Typically, one or two samples are sent for frozen section analysis during a surgical case, and MALDI MSI could find a way to fit within comparable timelines to standard analysis. For the delineation of tumor margins though, multiple minute specimens would need to be analyzed, and the analysis should result in real-time feedback. Currently, the sample preparation steps required for MALDI MSI would not be compatible with such a workflow.
With the development of ambient ionization methods such as DESI, it is possible to perform MS analysis with essentially no sample preparation, hence making such methods compatible with the time restrictions required for intraoperative tumor diagnosis and margin delineation. In DESI, a pneumatically assisted electrospray produces charged droplets that are directed to collide with the surface of a sample. As the charged droplets collide with the sample surface they create a thin liquid film into which analytes are extracted; the impact of subsequent primary droplets releases secondary microdroplets in a process termed droplet pick-up. Following this pick-up mechanism, the standard electrospray solvent evaporation processes occur, followed by the production of dry ions of analyte either by the field desorption or charge residue process.
DESI is one of multiple atmospheric pressure ionization sources. Aimed at ease of implementation and execution, these enabling technologies produce instantaneous results from solids, aerosols, vapors and liquids situated externally to the MS, in their native environment. Examples include methods in which the energetic beam is metastable gasphase atoms and reagent ions (i.e. DART, DAPCI, FAPA, LTP), energetic droplets (i.e. DESI, EASI, JeDI), and combinations of laser radiation and ESI (i.e. ELDI, MALDESI, LAESI). Ambient methods have many applications including imaging biological tissue, and thin layer chromatography plates, as well as the direct analysis of pharmaceutical tablets and inks on banknotes and many other surfaces. DESI is readily implemented on existing commercial instruments that have a direct interface with the atmosphere and on small, field portable MS systems. Since sampling occurs outside the vacuum system of the instrument, a broad range of samples and sample forms can be presented to the mass spectrometer.
Another critical feature of DESI is that it allows MSI of sections of tissue. MSI enables to record spatially-defined biochemical information in two- and three-dimensions. DESI-MSI analysis is commonly performed by rastering the sample surface with respect to the stationary continuous flux of spray-charged droplets through an array of predefined coordinates while collecting a mass spectrum at each position containing mass-to-charge (m/z) and relative abundance information. The resulting data are concatenated into an array and selected m/z values are plotted to assess spatial distribution of intensity at specific m/z values. DESI coupled with MSI is particularly valuable in the field of tissue diagnosis for comparison with standard clinical diagnosis performed on hematoxylin and eosin (H&E) stained histological tissue sections. In contrast to extractive techniques such as liquid chromatography MS, tissue sections that have been imaged with DESI-MSI are relatively well preserved and can still be stained after the MS sampling, therefore allowing MSI data to be correlated to the exact area of tissue that was analyzed.
DESI has successfully been employed for the study of small molecules including the investigation of lipid distributions in a variety of healthy and diseased animal and human tissues exemplifying the utility of the method for determining diagnostically relevant information by MS with no sample preparation. In comparison to existing MS and optical imaging modalities, the ambient ionization methods show only modest spatial resolution. Despite this limitation, these methods have considerable benefits: they facilitate measurements outside the vacuum of the instrument, require no contrast agents or chemical-tags, and do not require further sample treatment. While very high spatial resolution is desirable for research and development, for example the nanometer range resolution achieved by technologies such as secondary ion mass spectrometry, the modest spatial resolution and fast analysis time provided by ambient MS technologies is ideal for applications in the clinical setting, especially during surgery. The miniaturization of mass spectrometers could also eventually facilitate clinical implementation.
General Workflow:
Surgery remains the most important and usually the first treatment modality for devastating brain tumors such as gliomas as well as other primary and metastatic tumors. While maximal surgical excision with the goal of gross total tumor resection is desirable, in practice, delineation of resection margins is very difficult because tumors can closely resemble normal tissue and frequently infiltrate into surrounding normal brain structures. In addition, tumors often abut or directly involve critical brain regions—too large a resection margin may increase the risk for postoperative neurologic deficits. Preoperative localization by MRI of brain tumors is used to plan the surgical intervention and to minimize postoperative deficits. But the shift in the position of brain structures that occurs following a craniotomy can lead to spatial inaccuracies.
Molecular images obtained rapidly during a surgical procedure could provide surgeons with a powerful tool for performing real-time, image-guided surgery. A variety of mapping techniques (i.e. Raman imaging, Fourier transform infrared spectroscopy imaging, diffusion tensor imaging, positron emission tomographic/single-photon emission computed tomography, electrocortical stimulation and functional magnetic resonance imaging) have been developed to provide surgeons with such understanding of the relationship of the tumor to surrounding key cortical areas for neurosurgery. Intraoperative MRI (iMRI) developed at Brigham and Women's Hospital (BWH) has provided unprecedented intraoperative visualization.
Histopathological evaluation of frozen sections from tumor biopsies is currently the only method available to provide surgeons with information about tumor type and grade. While customarily used, evaluating tumors with frozen sections has a number of significant limitations that are disruptive to the surgical workflow—in particular, the analysis of each sample requires 20 minutes or more, and typically no more than a few samples are practical to analyze during any one surgical procedure. Moreover, visual review of stained tissue sections does not provide any direct molecular information about a tumor. The use of DESI MS could help with some of these problems, by allowing continuous sampling of multiple areas within the surgical field, by providing specific information about tumor type, grade and possibly prognosis rapidly (within seconds) and by offering very specific molecular information about a sample including levels of biomarkers or therapeutic compounds.
Results highlighting the use of MS as a powerful tool in characterizing tissue for surgical-decision making are described. More specifically, DESI MS was used to distinguish necrotic tumor tissue from viable GBM tumor. Correlation between histopathological staining and DESI MS was first established to distinguish viable from non-viable tumor tissue, and built a classification model representative of the histological evaluation. A robust statistical method was then used to validate the detection of potential biomarkers. Direct correlation of mass spectrometry and histopathology results offers a level of validation that cannot be bypassed for achieving the goals of introducing this promising analytical tool in the surgical decision-making workflow and of gaining widespread acceptance by medical teams. In this approach to implement mass spectrometry into the operating suite, this validation was pushed further by correlating mass spectrometry and histopathology results to pre and intra-operative MRI. In doing so, it not only ensured the validity of the information acquired from our MS experiment and its data analysis, but also enabled clinicopathologic correlations as presented below. The case presented here addresses the discrimination between necrosis and viable tumor which challenges pre-existing knowledge of the characteristics of such tissue on MRI. This work demonstrates that mass spectrometry could play a significant role in the near- and real-time diagnosis of tumors, assist in tumor delineation, and complement MRI.
Experimental Section:
Sample Collection:
Research subjects were recruited from surgical candidates at the neurosurgery clinic of the BWH, and gave written informed consent to the Partners Healthcare Institutional Review Board (IRB) protocols. Samples were obtained in cooperation with the BWH Neurooncology Program Biorepository collection, and analyzed under Institutional Review Board-approved research protocol.
Image-Guided Neurosurgery:
All surgeries were performed with auxiliary image guidance of the BrainLab Cranial 2.1 neuronavigation system (BrainLab). Preoperative MRI-imaging sequences included full T2 (1×1×2 mm, 100×100 slice matrix) and post-contrast T1 (1×1×1 mm, 256×256 slice matrix, 176 slices), processed in the BrainLab iPlanNet 3.0 software. Standard clinical protocols were observed to obtain primary diagnosis from stained frozen sections.
Stereotactic Sample Acquisition:
After clinical frozen-section diagnosis was confirmed, additional samples were acquired during the course of clinical resection. Each sample site was localized by the neurosurgeon using the neuronavigation system pointer, and the locations were transferred for offline visualization using the OpenIGTLink protocol (client: open-source 3D Slicer software on www.Slicer.org; server: BrainLab Cranial 2.1 with OpenIGTLink license option).
Hematoxylin and Eosin Staining:
The following protocol for H&E staining was performed: 1) fix in MeOH (2 minutes), 2) rinse in water (10 dips), 3) stain in Harris modified hematoxylin solution (1.5 minutes), 4) rinse in water (10 dips), 5) blue in 0.1% ammonia (a quick dip), 6) rinse in water (10 dips), 7) counterstain in Eosin Y (8 seconds), 8) rinse and dehydrate in 100% EtOH (10 dips), 9) rinse and dehydrate again in 100% EtOH (10 dips), 10) dip in xylene (6 dips), and 11) dip in xylene again (6 dips). Sections were dried at room temperature in hood and covered with histological mounting medium (Permount®, Fisher Chemicals, Fair Lawn, N.J.) and a glass cover slide.
DESI Mass Spectrometry Imaging:
DESI-MSI was performed using an amaZon Speed™ ion trap mass spectrometer (Bruker Daltonics) equipped with a commercial DESI ion source from Prosolia, Inc. DESI-MSI was performed in a line-by-line fashion with a lateral spatial resolution of 200 μm. MS instrumental parameters used were 200° C. heated capillary temperature, 5 kV spray voltage and 4 L·min-1 dry gaz. Target mass was set to m/z 600. Seventeen microscans were averaged for each pixel in the images. The spray solvent was 1:1 acetonitrile:dimethylformamide and the solvent flow rate was 3 μL·min-1.
Statistical Analysis:
Classification models for glioma subtype, grade, and tumor cell concentration of gliomas had been previously developed using Support Vector Machine analysis in Bruker ClinProTools 3.0. New SVM classification models were calculated to classify spectra for each surgical sample (glioblastoma multiforme ‘GBM’ Vs. necrosis). Principal component analysis (PCA) and probabilistic latent semantic analysis (pLSA) were also carried out using ClinProTools 3.0 software (Bruker Daltonics). PCA is a mathematical technique designed to extract, display and rank the variance within a data set. With PCA, important information that is present in the data is retained while the dimensionality of the data set is reduced. For DESI-MSI, each mass spectrum presents a series of m/z values with specific intensities. With PCA, the set of spectra were factorized such that the constituent principal component vectors are ranked in the order of variance. In MSI, the first three PCs generally differentiate the most the samples. PCA also provides loading values (comprised between −1 and 1), originating from the calculation of the PCs, that make it easy to select the contributing peaks of each PC for further analysis. pLSA has been introduced in the MS literature as a technique to divulge latent tissue-type specific molecular signatures. For each tissue, a distinct distribution can be considered and mass spectra acquired from this tissue are analyzed as a specific combination of m/z values. In contrast to PCA, pLSA allows to directly visualize the discriminating peaks for a specific tissue type within a mass spectrum.
DESI-MSI data was converted for import to ClinProTools 3.0 using in-house software. Extracted DESI mass spectra were internally recalibrated on common spectra alignment peaks within ClinProTools 3.0. An average mass spectrum created from all single spectra was used for peak selection using the ClinProTools 3.0 internal method (based on vector quantization). Individual peak intensities were standardized across the data set. For statistical analyses, mass spectra were selected from the tissue from representative areas (GBM Vs. necrosis). Extracted DESI MS spectra acquired from D43 surgical sample were imported into ClinProTools 3.0 software. Normalization, baseline subtraction, peak peaking and spectra recalibration were automatically performed using the software.
Visualization of MRI and MS Data:
MRI data obtained were plotted in 3D Slicer (www.Slicer.org) (version 4.1). The results of MS data subjected to the described classification system were overlaid as stereotactic points rendered in grey scales representing the different tissue types.
Results and Discussion:
Mass Spectrometric Evaluation of a Glioblastoma Resection:
Twelve surgical samples (D32 to D43) were taken from a brain tumor. After a full pathologic evaluation, a final report was issued that diagnosed the tumor as a glioblastoma. This report was issued nine days following the operation. Stereotactic information was registered for ten of the biopsies (D32 to D41). Frozen sections from these surgical samples were analyzed by DESI-MSI and subsequently stained with H&E. Review of the H&E stained sections by light microscopy revealed some of these surgical samples were entirely composed of viable tumor while others were entirely composed of nonviable tumor tissue (i.e. necrotic GBM tissue) (Table 1). Because GBM tumors are composed of rapidly proliferating cells, these tumors will frequently display regions of necrosis, either focally or in large regions (termed geographic necrosis).
H&E stained tissue sections of surgical sample D40 showed typical histological features of GBM with a high concentration of viable tumor cells (inset of
It has previously been shown that tissue specimens can be discriminated based upon the presence of specific lipid patterns. To validate the ability to distinguish viable from necrotic GBM by DESI MS molecular profiling, surgical specimens were analyzed from this GBM resection that contain within the same tissue section both viable and necrotic tumor tissue. As shown in
DESI-MSI for Real-Time Molecular Diagnostic:
DESI-MSI has been developed as a platform for intraoperative diagnostics. The ability to discriminate tumors of the central nervous system has been shown. This was possible not only for tumors that are highly distinct from one another (e.g. glioma from meningioma) but also for tumors that are histologically similar (e.g. discriminating low grade gliomas such as oligodendroglioma from low grade astrocytoma).
Here, it has been further demonstrated that a robust classification method can be built for discriminating viable from non-viable tumor tissue. This was readily achieved by building a classification model based on machine learning and then determining the rate of cross validation and recognition capability between GBM and necrotic tissues in other samples. The cross-validation and recognition capability demonstrated here is extremely high—in the twelve surgical samples these were 97.99% and 100%, respectively (Table 9). For D43 and D42 surgical samples, each mass spectra contributing to classify tissues as GBM or necrosis were mapped on binary images in
PCA (
According to the two first principal components, PCA results show that mass spectra acquired in each region belong to the same tissue type delimited in
DESI-MSI and MRI: The Whole is Greater than the Sum of its Parts.
Samples from surgical case 9 were classified as GBM or necrotic tissue based on mass spectral information and the results were validated by histopathology evaluation of each specimen. Although lipid profiling provides highly specific data to discriminate tissues and define boundaries between tumor and healthy brain tissue, DESI-MSI is still an invasive technique requiring direct contact with the tissue of interest. Conversely, MRI is a non-invasive technique that may supply a mm-scale localization of the tumor, but with limited information on the tumor's chemistry. As shown in
Using stereotactic data about the location of the biopsies from surgical case 9, information derived from the classifiers (GBM or necrotic tissue) were mapped onto the MR images (
The 3D MR rendering of the segmented tumor in
Conclusion:
Surgery is the primary treatment for most brain tumors. Surgical decision-making could be improved with tools that rapidly provide molecular information about multiple biopsies or continuous sampling at the time of surgery. Ambient mass spectrometry techniques that can provide near-real time molecular information from tissue samples hold great potential in this area. With DESI MS, the ability to classify tumors, define tumor subtypes, and identify tumor grade has been shown. Here it is shown that in surgical resection specimens, necrotic tumor tissue, an indicator of a high-grade malignancy, can be readily identified and necrotic tumor tissue can be distinguished from viable tumor regions. As DESI MS is applied to a broad range of human malignancies the molecular correlates of a range of histologic features, many of which have become diagnostic hallmarks of cancer (such as necrosis in the diagnosis of GBM), will be able to be defined. Many of these insights will rely on the use of powerful machine learning and statistical tools to assist in turning the vast data sets acquired by mass spectrometry into usable tumor classifiers that are ultimately useful for real-time applications. As more and more is done, DESI MS could have a significant role for a broad range of diagnostic applications including defining the boundaries between tumor and normal tissue, diagnosing image-guided needle biopsies and determining prognostic and predictive information for guiding patient care. The siting of a mass spectrometer into the AMIGO at BWH provides with invaluable opportunities to validate mass spectrometry findings for a variety of surgical diseases tackled by the growing field of mass spectrometry imaging and to continue technology development with the hope of improving patient care.
The invention has been described in connection with what are presently considered to be the most practical and preferred embodiments. However, the present invention has been presented by way of illustration and is not intended to be limited to the disclosed embodiments. Specifically, the above specific methods used are exemplary of the inventive concept and may be altered while still falling within the scope and spirit of the invention. Accordingly, those skilled in the art will realize that the invention is intended to encompass all modifications and alternative arrangements within the spirit and scope of the invention as set forth in the appended claims.
This application claims priority to U.S. Provisional Patent Application No. 61/894,595, filed Oct. 23, 2013, the entire contents of which are incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2014/062017 | 10/23/2014 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 61894595 | Oct 2013 | US |