Pursuant to the provisions of 37 C.F.R. § 1.52(e)(5), the sequence listing text file named 0037USU1_ST25, created on Dec. 27, 2007 and having a size of 3,027 bytes, and which is being submitted herewith, is incorporated by reference herein in its entirety.
The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described herein in any way.
This application relates generally to methods and systems for detecting biological molecules and, in particular, to methods and systems for detecting nucleic acids in a sample.
Nucleic acid amplification may be performed in conjunction with a variety of assays. Such assays may be qualitative, for example when used to evaluate a biological sample. However, a wide variety of biological applications could be improved by the ability to detect the amplification of target nucleic acids, without requiring either cumbersome blotting techniques, or the expensive and delicate equipment typically required for optical methods.
Accordingly, there still exists a need for improved methods for detecting nucleic acids in a sample.
According to a first embodiment, a method for detecting a target nucleic in a sample is provided which comprises:
melting the sample by heating the sample to a first temperature, wherein the sample comprises:
a primer which hybridizes to at least a portion of the target nucleic acid;
subsequently annealing the sample by reducing the temperature to a second temperature lower than the first temperature to allow the primer and the hybridization probe to each hybridize to a single stranded portion of the target nucleic acid in the sample; and
subsequently elongating the primer by allowing the polymerase to extend the primer hybridized to the target nucleic acid at a third temperature;
allowing the exonuclease activity of the enzyme to cleave the hybridization probe thereby releasing the probe fragment;
optionally repeating melting, annealing and elongating at least once;
contacting the sample with a surface of a solid support, wherein the surface of the solid support comprises one or more capture probes which hybridize to at least a portion of the second region of the probe fragment;
allowing the capture probes to hybridize to at least a portion of the probe fragment present in the sample at a fourth temperature wherein the fourth temperature is lower than the second and third temperatures; and
detecting label on the surface of the solid support;
wherein at least one portion of the hybridization probe hybridizes to another portion of the hybridization probe to thereby form a folded structure and wherein the melting temperature (Tm) of the folded structure is lower than the third temperature and higher than the fourth temperature.
According to a second embodiment, a kit for detecting a target nucleic acid in a sample is provided which comprises:
a hybridization probe comprising a first region which hybridizes to at least a portion of the target nucleic acid and a second region comprising a detectable label, wherein the second region does not hybridize to the target nucleic acid and wherein an exonuclease enzyme can cleave the hybridization probe when hybridized to the target nucleic acid to thereby produce a probe fragment comprising the second region and the detectable label;
a solid support comprising a capture probe on a surface thereof, wherein the capture probe hybridizes to the second region of the probe fragment;
optionally, a primer which hybridizes to at least a portion of the target nucleic acid; and
optionally, a polymerase and an enzyme comprising an exonuclease activity wherein the polymerase extends the hybridized primer in the direction of the hybridized probe and the exonuclease activity of the enzyme cleaves the hybridized probe to thereby release a probe fragment comprising the second region of the probe and the detectable label;
wherein at least one portion of the hybridization probe hybridizes to another portion of the hybridization probe to thereby form a folded structure and wherein the melting temperature (Tm) of the folded structure is lower than the melting temperature of the duplex formed when the intact hybridization probe hybridizes to the target nucleic acid and higher than the melting temperature of the duplex formed when the probe fragment hybridizes to the capture probe.
The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
GTTACTTCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGT
wherein the probe has a 19 mer nucleotide sequence that is non-complementary to a target sequence of a target nucleic acid.
CTTCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGT
wherein the probe has a 15 mer nucleotide sequence that is non-complementary to a target sequence of a target nucleic acid.
TCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGT
wherein the probe has a 13 mer nucleotide sequence that is non-complementary to a target sequence of a target nucleic acid.
For the purposes of interpreting of this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended (for example to understand the document where the term is originally used). The use of “or” herein means “and/or” unless stated otherwise or where the use of “and/or” is clearly inappropriate. The use of “a” herein means “one or more” unless stated otherwise or where the use of “one or more” is clearly inappropriate. The use of “comprise,” “comprises,” “comprising” “include,” “includes,” and “including” are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term “comprising,” those skilled in the art would understand that in some specific instances, the embodiment or embodiments can be alternatively described using language “consisting essentially of” and/or “consisting of.”
As used herein, “capture probe” refers to a nucleobase polymer that is surface bound. The capture probe can be a nucleic acid (e.g. DNA or RNA), a nucleic acid analog (e.g. locked nucleic acid (LNA)), a nucleic acid mimic (e.g. peptide nucleic acid (PNA)) or a chimera.
As used herein, “chimera” refers to a nucleobase polymer comprising two or more linked subunits that are selected from different classes of subunits. For example, a PNA/DNA chimera would comprise at least one PNA subunit linked to at least one 2′-deoxyribonucleic acid subunit (For exemplary methods and compositions related to PNA/DNA chimera preparation See: WO96/40709). Exemplary component subunits of a chimera are selected from the group consisting of PNA subunits, naturally occurring amino acid subunits, DNA subunits, RNA subunits, LNA subunits and subunits of other analogues or mimics of nucleic acids.
As used herein, “flap” refers to a portion of a hybridization probe that is non-complementary to the target nucleic acid the probe is designed to determine.
As used herein, “hybridization probe” is a nucleobase polymer that can be cleaved by exonuclease activity of an enzyme at a site where the probe is hybridized to a complementary strand, said hybridization probe comprising a nucleobase sequence that is complementary to at least a portion of a target nucleic acid of interest in a sample. The hybridization probe can be a oligonucleotide, oligonucleotide analog or chimera so long as it is cleavable by exonuclease activity. In some embodiments, the nucleobase polymer can be a chimera that comprises all DNA subunits except for one LNA subunit. In some embodiments, the nucleobase polymer comprises a single LNA subunit that is situated one subunit removed (toward the 3′ end) from the 5′ end of that portion of the hybridization probe that is designed to hybridize to the target nucleic acid.
As used herein, “nucleobase polymer” refers to a polymer comprising a series of linked nucleobase containing subunits. Non-limiting examples of suitable polymers include oligodeoxynucleotides, oligoribonucleotides, peptide nucleic acids, nucleic acid analogs, nucleic acid mimics and chimeras.
As used herein, “peptide nucleic acid” or “PNA” refers to any polynucleobase strand or segment of a polynucleobase strand comprising two or more PNA subunits, including, but not limited to, any polynucleobase strand or segment of a polynucleobase strand referred to or claimed as a peptide nucleic acid in U.S. Pat. Nos. 5,539,082, 5,527,675, 5,623,049, 5,714,331, 5,718,262, 5,736,336, 5,773,571, 5,766,855, 5,786,461, 5,837,459, 5,891,625, 5,972,610, 5,986,053, 6,107,470 and 6,357,163. For the avoidance of any doubt, PNA is a nucleic acid mimic and not a nucleic acid or nucleic acid analog. PNA is not a nucleic acid since it is not formed from nucleotides. For the avoidance of doubt, PNA oligomers may include polymers that comprise one or more amino acid side chains linked to the backbone.
As used herein, “support”, “solid support” or “solid carrier” refers to any solid phase material. Solid support encompasses terms such as “resin”, “synthesis support”, “solid phase”, “surface” “membrane” and/or “support”. A solid support can be composed of organic polymers such as polystyrene, polyethylene, polypropylene, polyfluoro ethylene, polyethyleneoxy, and polyacrylamide, as well as co-polymers and grafts thereof. A solid support can also be inorganic, such as glass, silica, controlled-pore-glass (CPG), or reverse-phase silica. The configuration of a solid support can be in the form of beads, spheres, particles, granules, a gel, a membrane or a surface. Surfaces can be planar, substantially planar, or non-planar. Solid supports can be porous or non-porous, and can have swelling or non-swelling characteristics. A solid support can be configured in the form of a well, depression, tube, channel, cylinder or other container, vessel, feature or location.
As used herein, “target nucleic acid” refers to a nucleic acid molecule of interest. A sample can comprise more than one target nucleic acid molecule.
As says for the electrochemical detection of a PCR product are disclosed in Provisional U.S. Patent Application No. 60/877,610, filed on even date herewith (Attorney Docket No. 70043.0036USP1). This assay consists of a hybridization probe with, for example, a 15-mer 5′ flap that is non-complimentary to a target nucleic acid but is complimentary to an electrode confined capture probe. This 5′ flap comprises an electrochemical label. During the PCR process, a probe fragment comprising this 5′ flap can be cleaved by an enzyme having exonuclease activity, such as Taq Polymerase. The probe fragment can then hybridize to the electrode confined capture probe and generate signal. The intact (i.e. uncleaved) hybridization probe was found to not hybridize as efficiently to the capture probe as did the probe fragment. This phenomenon permits the monitoring of PCR without separation of the probe fragment from the intact hybridization probe in a one pot assay.
In the assays described herein, the intact or uncleaved hybridization probe can form a folded structure having a melting temperature (Tm) which is lower than the melting temperature of the duplex formed when the intact hybridization probe hybridizes to the target nucleic acid and higher than the melting temperature of the duplex formed when the probe fragment hybridizes to the capture probe. Without intending to be bound by any theory, it is believed that the folded structure of the intact hybridization probe at temperatures under which the probe fragment hybridizes to the capture probe substantially inhibits hybridization of the intact hybridization probe to the capture probe on the electrode surface thereby improving the signal to noise ratio of the assay.
1. PCR Assay Performed with a Hybridization Probe Comprising a 5′-Flap
TAGGACTACCAGGGGTTTTC
▾GCCTGCAAGTCCTAAGACGCCA
wherein the nucleobases illustrated in bold represents the 5′ flap and the ▾ symbol represents the site where cleavage by the exonucleoase activity is expected to be predominant.
Using this hybridization probe comprising a 5′ osmium electrochemical tag according to the assay illustrated in
The results of the electrochemical measurements for this assay are shown in
2. PCR Assay Performed with a Hybridization Probe Comprising Interacting 5′ and 3′ Flaps
A hybridization probe with complementary 5′ and 3′ flaps that can be used for determining bird flu virus RNA has the sequence:
CTTCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGTCAATCG
wherein the nucleobases illustrated in bold represent the 5′ and 3′ flaps and the ▾ symbol represents the site where cleavage by the exonucleoase activity is expected to be predominant. The predicted Tm of the folded structure of this probe is 43.9° C.
PCR assays were performed using this hybridization probe. After 40 cycles of PCR (extension and annealing at 60° C.) in environmental master mix the temperature was shifted to 28° C. The environmental master mix included 100 mM KCl, 100 mM Tris pH 8, 8 mM MgCl2, 100 μM dntps and 0.3 units/μL gold ampliTaq. At this temperature, the probe fragment generated by exonuclease activity on the hybridized hybridization probe, can anneal to the surface bound capture probe (Tm=32° C.). Under these conditions, any intact (i.e. uncleaved) hybridization probe still present in the sample should form the predicted folded structure as shown in
This assay was repeated with another probe having the nucleobase sequence:
CTTCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGT
wherein the nucleobases illustrated in bold represent a 5′ flap and the ▾ symbol represents the site where cleavage by the exonucleoase activity is expected to be predominant.
PCR assays were performed to compare the efficiency of electrochemical detection using the hybridization probe illustrated in
Additional experiments were conducted to elucidate the effect of the length of the 3′ flap on the stability of the folded structure. The hybridization probes used for these experiments included the probe illustrated in
CTTCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGTCAATCG
AAC
This hybridization probe has the predicted folded structure set forth in
The probe with the 9 nucleobase long 3′ flap has a predicted melting temperature of approximately 53.1° C. whereas the probe with the shorter 6 nucleobase long 3′ flap has a predicted melting temperature of approximately 43.9° C. The results of electrochemical detection after performing a PCR assay for the hybridization probes illustrated in
Additional experiments were conducted to determine the effect of the length of the 5′ flap on assay performance. For these experiments, hybridization probes having 19 mer, 15 mer and 13 mer 5′ flaps directed to bird flu virus were evaluated. These probes did not include a 3′ flap. The probes had the following nucleotide sequences:
GTTACTTCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGT
CTTCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGT
TCGTTCGATTGTC▾TGGACTTATAATGCTGAACTTCTGGT
The nucleobases illustrated above in bold in these sequences represent the 5′ flap and the ▾ symbol represents the site where cleavage by the exonucleoase activity is expected to be predominant. In these hybridization probes, the underlined C nucleobase that is adjacent to the illustrated cleavage site is an LNA subunit. All other subunits of these hybridization probes are DNA.
The results of electrochemical detection after performing the PCR using each of the hybridization probes having the 19 mer, 15 mer and 13 mer 5′ flaps are shown in
Two additional bird flu PCR assays, which were directed to different regions of the hemaglutinin gene of the bird flu virus, were conducted. Both hybridization probes were designed with a 3′ flap which resulted in a predicted Tm for the folded structure of approximately 44-45° C. The predicted folded structures for these two probes are illustrated in
The nucleobase sequence of the first hybridization probe used in these experiments is:
CATGCTACTCAACAC▾AGTTACCATATTCCAATTCACTTTTCATAATTGC
This hybridization probe had a predicted melting point (Tm) of 44.0° C. for the folded structure. The predicted folded structure of this probe is set forth in
The nucleobase sequence of the second hybridization probe used in these experiments is:
ACACGTGTACCTTAC▾TGCAGACAAAGAATCCACTCAAAAGGCAATGG
TACAC
This hybridization probe had a predicted melting point (Tm fold) of 45.2° C. for the folded structure. The predicted folded structure of this probe is set forth in
For these two hybridization probes, the nucleobases illustrated above in bold represent the 5′ and 3′ flaps and the ▾ symbol represents the site where cleavage by the exonucleoase activity is expected to be predominant. In these hybridization probes, the underlined A (first probe) and underlined T (second probe) nucleobase that is adjacent to the illustrated cleavage site is an LNA subunit. All other subunits of these hybridization probes are DNA.
These hybridization and capture probes were used in PCR assays as discussed herein. Post PCR electrochemical detection of bird flu DNA using the first hybridization probe is shown in
Although hybridization probes which adopt stem loop type conformations are disclosed above, hybridization probes adopting other conformations upon folding can also be employed. Such structures include hairpin, internal loop, bulge, branched, cloverleaf and pseudoknot structures. Examples of other folded structures that can be used in the practice of the methods and kits disclosed herein can be found in U.S. Pat. No. 7,118,860 B2.
In some embodiments, the hybridization probe can adopt an intramolecular triplex conformation. An example of a hybridization probe which can form an intramolecular triplex structure is set forth below:
TTJJT
AGATCCTT-[Probe Sequence]-AAGGA
In the above sequence, “J” represents a pseudoisocytosine nucleobase, “Probe Sequence” represents the portion of the probe which is designed to hybridize sequence specifically to the target nucleic acid.
It is anticipated that a hybridization probe of this general configuration can adopt an intramolecular triplex conformation as its folded structure as illustrated in
In the sequence set forth above and structure illustrated in
Any known electrochemical moiety can be used as a label on the cleaved portion of the hybridization probe. Exemplary electrochemical labels which may be used include bis(2,2′-bipyridyl)imidizolylchloroosmium (II) [salt]. This label gives a good Eo of 0.165 vs Ag/AgCl and has good solubility properties for synthesis and purification. Other exemplary labels include ferrocene as well as the labels disclosed in U.S. patent application Ser. No. 11/488,439 filed on Jul. 17, 2006. Moreover, the electrochemical label can be any moiety that can transfer electrons to or from an electrode. Exemplary electrochemical labels include transition metal complexes. Suitable transition metal complexes include, for example, ruthenium2+(2,2′-bipyridine)3 (Ru(bpy)32+), ruthenium2+(4,4′-dimethyl-2,2′-bipyridine)3 (Ru(Me2-bpy)32+), ruthenium2+(5,6-dimethyl-1,10-phenanthroline)3 (Ru(Me2-phen)32+), iron2+(2,2′-bipyridine)3 (Fe(bpy)32+), iron2+(5-chlorophenanthroline)3 (Fe(5-Cl-phen)32+), osmium2+(5-chlorophenanthroline)3 (Os(5-Cl-phen)32+), osmium2+(2,2′-bipyridine)2 (imidazolyl), dioxorhenium1+ phosphine, and dioxorhenium1+ pyridine (ReO2(py)41+). Some anionic complexes useful as mediators are: Ru(bpy)((SO3)2-bpy)22− and Ru(bpy)((CO2)2-bpy)22− and some zwitterionic complexes useful as mediators are Ru(bpy)2 ((SO3)2-bpy) and Ru(bpy)2((CO2)2-bpy) where (SO3)2-bpy2- is 4,4′-disulfonato-2,2′-bipyridine and (CO2)2-bpy2- is 4,4′-dicarboxy-2,2′-bipyridine. Suitable substituted derivatives of the pyridine, bypyridine and phenanthroline groups may also be employed in complexes with any of the foregoing metals. Suitable substituted derivatives include but are not limited to 4-aminopyridine, 4-dimethylpyridine, 4-acetylpyridine, 4-nitropyridine, 4,4′-diamino-2,2′-bipyridine, 5,5′-diamino-2,2′-bipyridine, 6,6′-diamino-2,2′-bipyridine, 4,4′-diethylenediamine-2,2′-bipyridine, 5,5′-diethylenediamine-2,2′-bipyridine, 6,6′-diethylenediamine-2,2′-bipyridine, 4,4′-dihydroxyl-2,2′-bipyridine, 5,5′-dihydroxyl-2,2′-bipyridine, 6,6′-dihydroxyl-2,2′-bipyridine, 4,4′,4″-triamino-2,2′,2″-terpyridine, 4,4′,4″-triethylenediamine-2,2′,2″-terpyridine, 4,4′,4″-trihydroxy-2,2′,2′-terpyridine, 4,4′,4″-trinitro-2,2′,2″-terpyridine, 4,4′,4″-triphenyl-2,2′,2″-terpyridine, 4,7-diamino-1,10-phenanthroline, 3,8-diamino-1,10-phenanthroline, 4,7-diethylenediamine-1,10-phenanthroline, 3,8-diethylenediamine-1,10-phen anthroline, 4,7-dihydroxyl-1,10-phenanthroline, 3,8-dihydroxyl-1,10-phenanthroline, 4,7-dinitro-1,10-phenanthroline, 3,8-dinitro-1,10-phenanthroline, 4,7-diphenyl-1,10-phenanthroline, 3,8-diphenyl-1,10-phenanthroline, 4,7-disperamine-1,10-phenanthroline, 3,8-disperamine-1,10-phenanthroline, dipyrido[3,2-a:2′,2′-c]phenazine, and 6,6′-dichloro-2,2′-bipyridine, among others.
Although electrochemical detection is exemplified above, the disclosed methods are also applicable to the detection of nucleic acids by other detection techniques, such as fluorescence detection. Moreover, the detectable label on the hybridization probe can be any moiety which is capable of being detected and/or quantitated. Exemplary labels include electrochemical, luminescent (e.g., fluorescent, luminescent, or chemiluminescent) and calorimetric labels.
The primers and probes used herein may have any of a variety of lengths and configurations. For example, the primers may be from 18 to about 30 subunits in length or from 20 to 25 subunits in length. Primers need not be limited to DNA or RNA oligonucleotides but they must be extendable by a polymerase. Longer or shorter length primers can also be used.
The length of the region of the hybridization probe which binds to the target nucleic acid can be from 8 to 30 subunits in length whereas the length of the region of the hybridization probe which does not bind to the target nucleic acid (i.e., the 5′ flap) can have a length of 2 to 40 subunits or from 8 to 30 subunits. Hybridization probes having longer or shorter regions than those exemplified above can also be used.
The PCR primers may be designed to bind to and produce an amplified product of any desired length, usually at least 30 or at least 50 nucleotides in length and up to 200, 300, 500, 1000, or more nucleotides in length. The probes and primers may be provided at any suitable concentrations. For example, forward and reverse primers may be provided at concentrations typically less than or equal to 500 nM, such as from 20 nM to 500 nm, or 50 to 500 nM, or from 100 to 500 nM, or from 50 to 200 nM. Probes are typically provided at concentrations of less than or equal to 1000 nM, such as from 20 nM to 500 nm, or 50 to 500 nM, or from 100 to 500 nM, or from 50 to 200 nM. Exemplary conditions for concentrations of NTPs, enzyme, primers and probes can also be found in U.S. Pat. No. 5,538,848 which is incorporated herein by reference in its entirety, or can be achieved using commercially available reaction components (e.g., as can be obtained from Applied Biosystems, Foster City, Calif.).
A plurality of complementary capture probes, each having a characteristic sequence, may also be used in an array format. For example, an array of capture oligonucleotides that hybridize to different hybridization probe fragments may be used to localize and capture individual tag sequences in a plurality of discrete detection zones.
The methods described herein can be used to detect target nucleic acid in real time. For example, the solid support can be in contact with the solution in which nucleic acid amplification is occurring and the process monitored during PCR (i.e. real-time detection). Alternatively, the solid support can be in contact with the solution after the PCR process is complete (i.e., endpoint detection). In some embodiments, the PCR assay can be monitored during PCR (real-time) and after the process in completed (end-point). PCR assays can be performed using traditional PCR formats as well as Fast PCR formats, asymmetric PCR formats and asynchronous PCR formats.
The method described herein allows for a homogenous PCR assays where detection of the surface hybridization of the probe fragment of the hybridization probe indicates the presence of a target nucleic acid in a sample.
While the foregoing specification teaches the principles of the present invention, with examples provided for the purpose of illustration, it will be appreciated by one skilled in the art from reading this disclosure that various changes in form and detail can be made without departing from the true scope of the invention.
This application claims the benefit of Provisional U.S. Patent Application No. 60/877,611, filed on Dec. 29, 2006, which is incorporated by reference herein in its entirety.
| Number | Date | Country | |
|---|---|---|---|
| 60877611 | Dec 2006 | US |