Patent Application
20210163624
This application contains a Sequence Listing, created on May 28, 2015; the file, in ASCII format, is named 48071A_Seqlisting.txt, and is 80,348 bytes. The file is hereby incorporated by reference in its entirety into the application.
The present invention relates generally to antibodies against cytosolic proteins. More particularly, the invention relates to antibodies against Wilm's tumor oncogene protein (WT1), specifically antibodies that recognize a WT1 peptide in conjunction with a major histocompatability antigen.
The Wilms' tumor oncogene protein (WT1) is an attractive target for immunotherapy for most leukemias and a wide range of cancers. WT1 is a zinc finger transcription factor that is normally expressed in mesodermal tissues during embryogenesis. In normal adult tissue, WT1 expression is limited to low levels in CD34+ hematopoietic stem cells but is over-expressed in leukemias of multiple lineages and a wide range of solid tumors (1-2). More recently, WT1 expression has been reported to be a marker of minimal residual disease. Increasing transcript levels in patients with acute myeloid leukemia (AML) in morphologic remission have been predictive of overt clinical relapse (3, 4). Furthermore, antibodies to WT1 are detected in patients with hematopoietic malignancies and solid tumors, indicating that WT1 is a highly immunogenic antigen (7).
For the most part, clinically approved therapeutic monoclonal antibodies (mAbs) recognize structures of cell surface proteins. WT1, however, is a nuclear protein and, therefore, is inaccessible to classical antibody therapy. Up until now, immunotherapy targeting WT1 has been limited to cellular approaches, exclusively aimed at generating WT1-specific cytotoxic CD8 T cell (CTL) responses that recognize peptides presented on the cell surface by MHC class I molecules.
For induction of CTL responses, intracellular proteins are usually degraded by the proteasome or endo/lysosomes, and the resulting peptide fragments bind to MHC class I or II molecules. These peptide-MHC complexes are displayed at the cell surface where they provide targets for T cell recognition via a peptide-MHC (pMHC)-T cell receptor (TCR) interaction (8, 9). Vaccinations with peptides derived from the WT1 protein induce HLA-restricted cytotoxic CD8 T cells, which are capable of killing tumor cells.
To improve efficacy, cancer antigens can be targeted with monoclonal antibody therapy. Monoclonal antibody (mAb) therapy has been shown to exert powerful antitumor effects by multiple mechanisms, including complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC) and direct cell inhibition or apoptosis-inducing effects on tumor cells that over-express the target molecules. Furthermore, mAb can be used as carriers to specifically deliver a cytotoxic moiety such as a radionuclide, cytotoxic drug or toxin to the tumor cells (18).
A tremendous benefit would exist if, in addition to a cellular immunotherapy approach, a humoral immunotherapy approach was available to target non-cell surface tumor antigens. Therefore, a monoclonal antibody (mAb) that mimics a T cell receptor in that it is specific for a target comprising a fragment of an intracellular protein in conjunction with an MHC molecule, for example, a WT1 peptide/HLA-A2 complex, would be a novel and effective therapeutic agent alone or as a vehicle capable of delivering potent anti-cancer reagents, such as drugs, toxins and radioactive elements. Such mAbs would also be useful as diagnostic or prognostic tools.
The present disclosure identifies and characterizes antigen-binding proteins, such as antibodies, that are able to target cytosolic/intracellular proteins, for example, the WT1 oncoprotein. The disclosed antibodies target a peptide/MHC complex as it would typically appear on the surface of a cell following antigen processing of WT1 protein and presentation by the cell. In that regard, the antibodies mimic T-cell receptors in that the antibodies have the ability to specifically recognize and bind to a peptide in an MHC-restricted fashion, that is, when the peptide is bound to an MHC antigen. The peptide/MHC complex recapitulates the antigen as it would typically appear on the surface of a cell following antigen processing and presentation of the WT1 protein to a T-cell.
The antibodies disclosed specifically recognize and bind to epitopes of a peptide/HLA-A2 complex, particularly a WT1/HLA-A0201 complex. Examples of peptides that are recognized by the antigen-binding proteins of the invention as part of an HLA-peptide complex include, but are not limited to, those shown in Table 7, for example, a peptide with the amino acid sequence RMFPNAPYL (SEQ ID NO: 1.)
In one aspect, therefore, the invention relates to an isolated antibody, or antigen-binding fragment thereof, that binds to a peptide with the amino acid sequence, RMFPNAPYL, when said peptide is bound to an MHC antigen, such as HLA-A2.
In another aspect, the invention relates to an isolated antigen-binding protein, antibody, or antigen-binding fragment thereof, comprising (A) (i) a heavy chain (HC) variable region comprising HC-CDR1, HC-CDR2 and HC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 2, 3, and 4; and alight chain (LC) variable region comprising LC-CDR1, LC-CDR2 and LC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 8, 9 and 10; (ii) a heavy chain (HC) variable region comprising HC-CDR1, HC-CDR2 and HC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 20, 21 and 22; and a light chain (LC) variable region comprising LC-CDR1, LC-CDR2 and LC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 26, 27 and 28; (iii) a heavy chain (HC) variable region comprising HC-CDR1, HC-CDR2 and HC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 38, 39 and 40; and alight chain (LC) variable region comprising LC-CDR1, LC-CDR2 and LC-CDR3 respectively, comprising amino acid sequences selected from SEQ ID NOS: 44, 45 and 46; (iv) a heavy chain (HC) variable region comprising HC-CDR1, HC-CDR2 and HC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 56, 57 and 58; and a light chain (LC) variable region comprising LC-CDR1, LC-CDR2 and LC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 62, 63 and 64; (v) a heavy chain (HC) variable region comprising HC-CDR1, HC-CDR2 and HC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 74, 75 and 76; and a light chain (LC) variable region comprising LC-CDR1, LC-CDR2 and LC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 80, 81 and 82; or (vi) a heavy chain (HC) variable region comprising HC-CDR1, HC-CDR2 and HC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 92, 93 and 94; and a light chain (LC) variable region comprising LC-CDR1, LC-CDR2 and LC-CDR3 respectively, comprising amino acid sequences SEQ ID NOS: 98, 99 and 100.
In another aspect, the invention relates to an isolated antigen-binding protein, antibody, or antigen-binding fragment thereof, comprising a VH and VL comprising first and second amino acid sequences, respectively, selected from SEQ ID NOS: 14 and 16; 32 and 34; 50 and 52; 68 and 70; 86 and 88; and 104 and 106.
In yet another aspect, the invention relates to an isolated antigen-binding protein, antibody, or antigen-binding fragment thereof, comprising an amino acid sequence selected from SEQ ID NOS: 18, 36, 54, 72, 90, and 108.
In a related aspect, the isolated antigen-binding protein comprises an antigen-binding region as disclosed in any of Tables 1-8. The antigen-binding protein may be a fusion protein.
In another aspect, the invention relates to an immunoconjugate comprising a first component which is an antigen-binding protein, antibody or antigen-binding fragment thereof as disclosed herein. The immunoconjugate comprises a second component that is a cytotoxin, a detectable label, a radioisotope, a therapeutic agent, a binding protein or a molecule having a second amino acid sequence. Where the second component is a binding protein or second antibody, the binding protein or second antibody has binding specificity for a target that is different from the HLA-peptide complex for which the first is specific.
In a related aspect, therefore, the present invention relates to bispecific antibody comprising an antigen-binding protein or functional fragment thereof as described herein.
In yet another aspect, the invention relates to nucleic acids that encode antigen binding proteins, including antibodies and chimeric antigen receptors specific for a WT1 peptide/HLA complex, in particular the complex of WT1 peptide RMFPNAPYL/HLA-A0201.
In another related aspect, the invention relates to cells comprising the nucleic acids or antigen binding proteins disclosed herein, including recombinant immune effector cells, such as, T-cells genetically modified to express a chimeric antigen receptor comprising an antigen binding region in accordance with the present disclosure. Cells which have been engineered to produce antibodies in accordance with the disclosure are also encompassed by the invention.
In a related aspect, the invention relates to vectors comprising the nucleic acids to encode the antigen binding proteins disclosed herein, including vectors to facilitate expression and/or secretion of an antigen binding protein such as an antibody or chimeric antigen receptor in accordance with the present disclosure.
In a related aspect, the invention relates to pharmaceutical compositions comprising the antigen binding proteins, antibodies, nucleic acids, vectors or cells comprising the nucleic acids or antigen binding proteins disclosed herein, together with a pharmaceutically acceptable carrier.
In another aspect, the invention relates to a method for detecting WT1 on the surface of cells or tissues using WT1 antibodies of the invention.
In yet another aspect, the invention relates to methods for treatment of a subject having a WT1-positive disease, comprising administering to the subject a therapeutically effective amount of an antigen binding protein, antibody or antigen binding fragment thereof, nucleic acid encoding the antigen binding protein or antibody or a cell comprising the nucleic acids or proteins as disclosed herein. The WT1-positive disease is a chronic leukemia, acute leukemia or WT1+ cancer selected from the group consisting of chronic myelocytic leukemia, multiple myeloma (MM), acute lymphoblastic leukemia (ALL), acute myeloid/myelogenous leukemia (AML), myelodysplastic syndrome (MDS), mesothelioma, ovarian cancer, gastrointestinal cancers, breast cancer, prostate cancer and glioblastoma. In some embodiments, the antigen binding protein or antibody is a conjugate thereof having a cytotoxic moiety linked thereto.
All publications, patents and other references cited herein are incorporated by reference in their entirety into the present disclosure.
In practicing the present invention, many conventional techniques in molecular biology, microbiology, cell biology, biochemistry, and immunology are used, which are within the skill of the art. These techniques are described in greater detail in, for example, Molecular Cloning: a Laboratory Manual 3rd edition, J. F. Sambrook and D. W. Russell, ed. Cold Spring Harbor Laboratory Press 2001; Recombinant Antibodies for Immunotherapy, Melvyn Little, ed. Cambridge University Press 2009; “Oligonucleotide Synthesis” (M. J. Gait, ed., 1984); “Animal Cell Culture” (R. I. Freshney, ed., 1987); “Methods in Enzymology” (Academic Press, Inc.); “Current Protocols in Molecular Biology” (F. M. Ausubel et al., eds., 1987, and periodic updates); “PCR: The Polymerase Chain Reaction”, (Mullis et al., ed., 1994); “A Practical Guide to Molecular Cloning” (Perbal Bernard V., 1988); “Phage Display: A Laboratory Manual” (Barbas et al., 2001). The contents of these references and other references containing standard protocols, widely known to and relied upon by those of skill in the art, including manufacturers' instructions are hereby incorporated by reference as part of the present disclosure. The following abbreviations are used throughout the application:
Ab: Antibody
ADCC: Antibody-dependent cellular cytotoxicity
ALL: Acute lymphocytic leukemia
AML: Acute myeloid leukemia
APC: Antigen presenting cell
β2M: Beta-2-microglobulin
BiTE: Bi-specific T cell engaging antibody
CAR: Chimeric antigen receptor
CDC: Complement dependent cytotoxicity
CMC: Complement mediated cytotoxicity
CDR: Complementarity determining region (see also HVR below)
CL: Constant domain of the light chain
CH1: 1st constant domain of the heavy chain
CH1, 2, 3: 1st, 2nd and 3rd constant domains of the heavy chain
CH2, 3: 2nd and 3rd constant domains of the heavy chain
CHO: Chinese hamster ovary
CTL: Cytotoxic T cell
E:T Ratio: Effector:Target ratio
Fab: Antibody binding fragment
FACS: Flow assisted cytometric cell sorting
FBS: Fetal bovine serum
FR: Framework region
HC: Heavy chain
HLA: Human leukocyte antigen
HVR-H: Hypervariable region-heavy chain (see also CDR)
HVR-L: Hypervariable region-light chain (see also CDR)
Ig: Immunoglobulin
IRES: Internal ribosome entry site
KD: Dissociation constant
koff: Dissociation rate
kon: Association rate
MHC: Major histocompatibility complex
MM: Multiple myeloma
scFv: Single-chain variable fragment
TCR: T cell receptor
VH: Variable heavy chain includes heavy chain hypervariable region and heavy chain variable framework region
VL: Variable light chain includes light chain hypervariable region and light chain variable framework region
WT1: Wilms tumor protein 1
In the description that follows, certain conventions will be followed as regards the usage of terminology. Generally, terms used herein are intended to be interpreted consistently with the meaning of those terms as they are known to those of skill in the art.
An “antigen-binding protein” is a protein or polypeptide that comprises an antigen-binding region or antigen-binding portion, that is, has a strong affinity to another molecule to which it binds. Antigen-binding proteins encompass antibodies, chimeric antigen receptors (CARs) and fusion proteins.
“Antibody” and “antibodies” as those terms are known in the art refer to antigen binding proteins of the immune system. The term “antibody” as referred to herein includes whole, full length antibodies having an antigen-binding region, and any fragment thereof in which the “antigen-binding portion” or “antigen-binding region” is retained, or single chains, for example, single chain variable fragment (scFv), thereof. A naturally occurring “antibody” is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant (CH) region. The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and alight chain constant CL region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.
The term “antigen-binding portion” or “antigen-binding region” of an antibody, as used herein, refers to that region or portion of the antibody that binds to the antigen and which confers antigen specificity to the antibody; fragments of antigen-binding proteins, for example, antibodies includes one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., an peptide/HLA complex). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of antigen-binding fragments encompassed within the term “antibody fragments” of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; a F(ab)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CH1 domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment (Ward et al., 1989 Nature 341:544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules. These are known as single chain Fv (scFv); see e.g., Bird et al., 1988 Science 242:423-426; and Huston et al., 1988 Proc. Natl. Acad. Sci. 85:5879-5883. These antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
An “isolated antibody” or “isolated antigen-binding protein” is one which has been identified and separated and/or recovered from a component of its natural environment. “Synthetic antibodies” or “recombinant antibodies” are generally generated using recombinant technology or using peptide synthetic techniques known to those of skill in the art.
Traditionally, the MHC-peptide complex could only be recognized by a T-cell receptor (TCR), limiting our ability to detect an epitope of interest using T cell-based readout assays. In the present disclosure, antigen binding proteins, including antibodies, having an antigen-binding region based on scFvs that are selected from human scFv phage display libraries using recombinant HLA-peptide complexes are described. These molecules demonstrated exquisite specificity, for example as shown with anti-WT1 antibodies that recognize only HLA-A2-RMFPNAPYL complexes. In addition, along with their inability to bind to HLA-complexes containing other peptides, the molecules were also unable to bind to the peptides themselves, further demonstrating their TCR-like specificity.
The scFvs of the disclosure selected by phage display were initially tested for their ability to bind to peptide presented on the surface of HLA-positive cells. After T2 cells were incubated in the presence of peptide, fluorescently labeled antibodies could be used to selectively recognize the antigen pulsed cells using flow cytometry.
In some embodiments, the invention includes antibodies that have the scFv sequence fused to one or more constant domains of the heavy to form an antibody with an Fc region of a human immunoglobulin to yield a bivalent protein, increasing the overall avidity and stability of the antibody. In addition, the Fc portion allows the direct conjugation of other molecules, including but not limited to fluorescent dyes, cytotoxins, radioisotopes etc. to the antibody for example, for use in antigen quantitation studies, to immobilize the antibody for affinity measurements, for targeted delivery of a therapeutic agent, to test for Fc-mediated cytotoxicity using immune effector cells and many other applications.
The results presented here highlight the specificity, sensitivity and utility of the antibodies of the invention in targeting MHC-peptide complexes.
The molecules of the invention are based on the identification and selection of single chain variable fragments (scFv) using phage display, the amino acid sequence of which confers the molecules' specificity for the MHC restricted peptide of interest and forms the basis of all antigen binding proteins of the disclosure. The scFv, therefore, can be used to design a diverse array of “antibody” molecules, including, for example, full length antibodies, fragments thereof, such as Fab and F(ab′)2, minibodies, fusion proteins, including scFv-Fc fusions, multivalent antibodies, that is, antibodies that have more than one specificity for the same antigen or different antigens, for example, bispecific T-cell engaging antibodies (BiTe), tribodies, etc. (see Cuesta et al., Multivalent antibodies: when design surpasses evolution. Trends in Biotechnology 28:355-362 2010).
In an embodiment in which the antigen-binding protein is a full length antibody, the heavy and light chains of an antibody of the invention may be full-length (e.g., an antibody can include at least one, and preferably two, complete heavy chains, and at least one, and preferably two, complete light chains) or may include an antigen-binding portion (a Fab, F(ab′)2, Fv or a single chain Fv fragment (“scFv”)). In other embodiments, the antibody heavy chain constant region is chosen from, e.g., IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE. In some embodiments, the immunoglobulin isotype is selected from IgG1, IgG2, IgG3, and IgG4, more particularly, IgG1 (e.g., human IgG1). The choice of antibody type will depend on the immune effector function that the antibody is designed to elicit.
In constructing a recombinant immunoglobulin, appropriate amino acid sequences for constant regions of various immunoglobulin isotypes and methods for the production of a wide array of antibodies are known to those of skill in the art.
In one embodiment, the antibody or other antigen binding protein is an anti-WT1/HLA-A2 scFv or or antigen-binding fragment thereof having an antigen binding region that comprises the amino acid sequence of SEQ ID NO: 18 and specifically binds to a peptide with the amino acid sequence RMFPNAPYL (SEQ ID NO: 1) in conjunction with HLA-A0201. In some embodiments, the anti-WT1 antibody is a scFv-Fc fusion protein or full length human IgG with VH and VL regions or CDRs selected from Table 1.
ccaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctg
In another embodiment, the antibody or antigen binding protein is an anti-WT1 scFv or antigen-binding fragment thereof that has an antigen binding region that comprises the amino acid sequence of SEQ ID NO: 36 and specifically binds to a peptide with the amino acid sequence RMFPNAPYL (SEQ ID NO: 1) in conjunction with HLA-A0201. In other embodiments, the anti-WT-1 antibody is a scFv-Fc fusion protein or full length human IgG with VH and VL regions or CDRs selected from Table 2.
gtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtac
In another embodiment, the antibody or antigen binding protein is an anti-WT1 scFv or antigen binding fragment thereof that has an antigen binding region that comprises the amino acid sequence of SEQ ID NO: 54 and specifically binds to a peptide with the amino acid sequence RMFPNAPYL (SEQ ID NO: 1) in conjunction with HLA-A0201. In other embodiments, the anti-WT-1 antibody is a scFv-Fc fusion protein or full length human IgG with VH and VL regions or CDRs selected from Table 3.
In another embodiment, the antibody or antigen binding protein is an anti-WT1 scFv or antigen binding fragment thereof that has an antigen binding region that comprises the amino acid sequence of SEQ ID NO: 72 and specifically binds to a peptide with the amino acid sequence RMFPNAPYL (SEQ ID NO:1) in conjunction with HLA-A0201. In other embodiments, the anti-WT-1 antibody is a scFv-Fc fusion protein or full length human IgG with VH and VL regions or CDRs selected from Table 4.
ggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcag
In another embodiment, the antibody or antigen binding protein is an anti-WT1 scFv or antigen binding fragment thereof that has an antigen binding region that comprises the amino acid sequence of SEQ ID NO: 90 and specifically binds to a peptide with the amino acid sequence RMFPNAPYL (SEQ ID NO: 1) in conjunction with HLA-A0201. In other embodiments, the anti-WT-1 antibody is a scFv-Fc fusion protein or full length human IgG with VH and VL regions or CDRs selected from Table 5.
tcgagatggccgaagtgcagctggtgcagtctgggggaggtgtggtacggcctggggggtcc
In another embodiment, the antibody or antigen binding protein is an anti-WT1 scFv or antigen binding fragment thereof that has an antigen binding region that comprises the amino acid sequence of SEQ ID NO: 108 and specifically binds to a peptide with the amino acid sequence RMFPNAPYL (SEQ ID NO: 1) in conjunction with HLA-A0201. In other embodiments, the anti-WT-1 antibody is a scFv-Fc fusion protein or full length human IgG with VH and VL regions or CDRs selected from Table 6.
atggccgaggtgcagctggtggagaccggaggaggcttgctccagccgggggggtccctcaga
Other embodiments of the disclosed antibodies and antigen binding proteins encompass those comprising light and heavy hypervariable regions and constant regions, for example as shown in Tables 7 (heavy chain), 8 (light chain) and 9 (constant regions).
The invention relates to recombinant antigen-binding proteins, antibodies and antigen binding fragments thereof that specifically recognize epitopes of a complex of a peptide/protein fragment derived from an intracellular protein, and an MHC class I molecule, for example, as the complex might be displayed at the cell surface during antigen presentation. The heavy and light chains of an antibody of the invention may be full-length (e.g., an antibody can include at least one, and preferably two, complete heavy chains, and at least one, and preferably two, complete light chains) or may include an antigen-binding portion (a Fab, F(ab′)2, Fv or a single chain Fv fragment (“scFv”)). In other embodiments, the antibody heavy chain constant region is chosen from, e.g., IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE, particularly chosen from, e.g., IgG1, IgG2, IgG3, and IgG4, more particularly, IgG1 (e.g., human IgG1). In another embodiment, the antibody light chain constant region is chosen from, e.g., kappa or lambda, particularly kappa.
The antibodies and antigen binding proteins of the present invention are intended to encompass bispecific antibodies, including bispecific T-cell engaging antibodies, that is, antibodies comprising two antibody variable domains on a single polypeptide chain that are able to bind two separate antigens. Where a first portion of a bispecific antibody binds an antigen on a tumor cell for example and a second portion of a bispecific antibody recognizes an antigen on the surface of a human immune effector cell, the antibody is capable of recruiting the activity of that effector cell by specifically binding to the effector antigen on the human immune effector cell. In some instances, bispecific antibodies, therefore, are able to form a link between effector cells, for example, T cells and tumor cells, thereby enhancing effector function.
In one embodiment, the constant region/framework region is altered, for example, by amino acid substitution, to modify the properties of the antibody (e.g., to increase or decrease one or more of: antigen binding affinity, Fc receptor binding, antibody carbohydrate, for example, glycosylation, fucosylation etc., the number of cysteine residues, effector cell function, effector cell function, complement function or introduction of a conjugation site). Furthermore, conjugation of the antibody to a drug, toxin, radioisotope, cytokine, inflammatory peptide or cytotoxic agent is also contemplated.
In one embodiment, the antibody is an anti-WT1/A2 antibody and comprises the human IgG1 constant region and Fc domain shown in Table 9. In one embodiment, the anti-WT1/A2 antibody comprises a human kappa sequence, or a human lambda sequence having the sequence set forth in Table 9. The amino acid sequences for some complementarity determining regions (CDRs) of antibodies of the invention are shown in Tables 1-8.
The present invention is based on the identification of antigen-specific binding sequences from which a variety of antigen-binding proteins can be produced. In addition to antibodies specific for an antigen that represents a protein fragment (peptide)/HLA complex similar to that typically recognized by a T-cell receptor following antigen processing and presentation of the protein to the T-cell, identification of amino acid and nucleic sequences as disclosed herein for the preparation of antibodies can also be used to generate other antigen-binding molecules including chimeric antigen receptors (CARs), with specificity for the protein fragment (peptide)/HLA complex. These can be incorporated into cells to make them specifically ctyotoxic to the antigen expressing cell.
The present invention employs a novel approach to obtaining therapeutic antibodies to any protein, including those proteins that are inaccessible because they are not expressed on the cell surface. Nearly any intracytoplasmic or intranuclear protein (in addition to cell surface proteins) is a potential target for the approach described herein. This includes, but is not limited to, oncogenic proteins, transcription factors, enzymes, etc.
In order to target tumor antigens derived from intracellular or nuclear proteins, development of a therapeutic antibody an uncommon approach was required. This approach is to generate recombinant mAbs that recognize the peptide/MHC complex expressed on the cell surface, with the same specificity as a T-cell receptor (TCR). Such mAbs share functional homology with TCRs regarding target recognition, but confer higher affinity and capabilities of arming with potent cytotoxic agents that antibodies feature. Technically, TCR-like mAbs may be generated by conventional hybridoma techniques known to those of skill in the art, to produce human, humanized or chimeric antibodies.
Furthermore, fully-human mAbs are preferred for therapeutic use in humans because murine antibodies cause an immunogenicity reaction, known as the HAMA (human anti-mouse antibodies) response (24, 25), when administered to humans, causing serious side effects, including anaphylaxis and hypersensitivity reactions. This immunogenicity reaction is triggered by the human immune system recognizing the murine antibodies as foreign because of slightly different amino acid sequences from natural human antibodies. Humanization methods known in the art (26, 27) can be employed to reduce the immunogenicity of murine-derived antibodies (28).
Recently, the use of phage display libraries has made it possible to select large numbers of Ab repertoires for unique and rare Abs against very defined epitopes (for more details on phage display see McCafferty et al., Phage antibodies: filamentous phage displaying antibody variable domains. Nature, 348: 552-554.) The rapid identification of human Fab or single chain Fv (ScFV) fragments highly specific for tumor antigen-derived peptide-MHC complex molecules has thus become possible (19-22). More recently, immuno-toxins, generated by fusing TCR-like Fab specific for melanoma Ag MART-1 26-35/A2 or gp100 280-288/A2 to a truncated form of Pseudomonas endotoxin, have been shown to inhibit human melanoma growth both in vitro and in vivo (23). In addition, by engineering full-length mAb using the Fab fragments, it is possible to directly generate a therapeutic human mAb, by-passing months of time-consuming work, normally needed for developing therapeutic mAbs. The present invention involves the development of a TCR-like, fully human mAb that recognizes, for example, the WT1 peptide/HLA-A2 complex (RMFPNAPYL, SEQ ID NO: 1) for cancer therapy.
Recombinant antibodies with TCR-like specificity represent a new and valuable tool for research and therapeutic applications in tumor immunology and immunotherapy. WT1 is a well-established and validated tumor antigen that has been investigated throughout the world as a marker, prognostic factor and therapeutic target. It was recently prioritized as the top priority tumor antigen by an NCI task force (29).
Identification of Peptides with High Predictive Binding to HLA Molecules
In one embodiment, the present invention relates to a method for the generation of antibodies that specifically bind to HLA-restricted peptides, which, when presented as part of a peptide/MHC complex are able to elicit a specific cytotoxic T-cell response. HLA class I molecules present endogenous derived peptides of about 8-12 amino acids in length to CD8+ cytotoxic T lymphocytes. Peptides to be used in the method of the present invention are generally about 6-22 amino acids in length, and in some embodiments, between about 9 and 20 amino acids and comprise an amino acid sequence derived from a protein of interest, for example, human WT1 protein (Genbank accession no. P19544) or an analog thereof.
Peptides suitable for use in generating antibodies in accordance with the method of the present invention can be determined based on the presence of HLA-A0201-binding motifs and the cleavage sites for proteasomes and immune-proteasomes using computer prediction models known to those of skill in the art. For predicting MHC class I binding sites, such models include, but are not limited to, ProPred1 (described in more detail in Singh and Raghava, ProPred: prediction of HLA-DR binding sites. BIOINFORMATICS 17(12):1236-1237 2001), and SYFPEITHI (see Schuler et al. SYFPEITHI, Database for Searching and T-Cell Epitope Prediction. in Immunoinformatics Methods in Molecular Biology, vol 409(1): 75-93 2007)
HLA-A*0201 is expressed in 39-46% of all caucasians and therefore, represents a suitable choice of MHC antigen for use in the present method. For preparation of one embodiment of a WT1 peptide antigen, amino acid sequences and predicted binding of putative CD84+ epitopes to HLA-A0201 molecules were identified using the predictive algorithm of the SYFPEITHI database (see Schuler et al. SYFPEITHI, Database for Searching and T-Cell Epitope Prediction. in Immunoinformatics Methods in Molecular Biology, vol 409(1): 75-93 2007).
Once appropriate peptides have been identified, peptide synthesis may be done in accordance with protocols well known to those of skill in the art. Because of their relatively small size, the peptides of the invention may be directly synthesized in solution or on a solid support in accordance with conventional peptide synthesis techniques. Various automatic synthesizers are commercially available and can be used in accordance with known protocols. The synthesis of peptides in solution phase has become a well-established procedure for large-scale production of synthetic peptides and as such is a suitable alternative method for preparing the peptides of the invention. (See for example, Solid Phase Peptide Synthesis by John Morrow Stewart and Martin et al. Application of Almez-mediated Amidation Reactions to Solution Phase Peptide Synthesis, Tetrahedron Letters Vol. 39, pages 1517-1520 1998.)
Each of the peptides used in the protocols described herein was purchased and synthesized by Genemed Synthesis, Inc. (San Antonio, Tex.) using fluorenylmethoxycarbonyl chemistry and solid-phase synthesis and purified by high-pressure liquid chromatography. The quality of the peptides was assessed by high-performance liquid chromatography analysis, and the expected molecular weight was observed using matrix-assisted laser desorption mass spectrometry. Peptides were sterile and 70% to 90% pure. The peptides were dissolved in DMSO and diluted in PBS (pH 7.4) or saline at 5 mg/mL and stored at −80° C.
Subsequent to peptide selection, binding activity of selected peptides is tested using the antigen-processing-deficient T2 cell line, which increases expression of HLA-A when stabilized by a peptide in the antigen-presenting groove. Briefly, T2 cells are pulsed with peptide for a time sufficient to induce HLA-A expression. HLA-A expression of T2 cells is then measured by immunostaining with a fluorescently labeled monoclonal antibody specific for HLA-A (for example, BB7.2) and flow cytometry. Fluorescence index (FI) is calculated as the mean fluorescence intensity (MFI) of HLA-A0201 on T2 cells as determined by fluorescence-activated cell-sorting analysis, using the formula FI=(MFI[T2 cells with peptide]/MFI [T2 cells without peptide]-1.
Fully human T-cell receptor (TCR)-like antibodies to Wilm's tumor oncognene protein (WT1) were produced using the method disclosed herein. TCR-like anti-WT1 antibodies generated by phage display technology are specific for a WT1 peptide/HLA complex similar to that which induces HLA-restricted cytotoxic CD8 T-cells.
The WT1 protein sequence was screened using the SYFPEITHI algorithm and WT1 peptides (for example, peptides designated 428, 328, and 122) were identified that had predicted high-affinity binding to multiple HLA molecules that are highly expressed in the Caucasian population. Peptide 428 spans WT1 amino acids 428-459, peptide 328 spans WT1 amino acids 328-349, and peptide 122 spans WT1 amino acids 122-140 (see
Heteroclitic peptides can also be designed by conservative amino acid substitutions of MHC-binding residues expected to enhance the affinity toward the MHC class 1 allele, as predicted by the prediction algorithm. WT1 peptide 122 comprises within it a known CD8+ epitope (126-134). In one embodiment, therefore, a modified peptide of the peptide that spans the WT1 amino acid residues 126-134 and contains a modified amino acid at positions may be used. Peptides used for alanine mutagenesis of WT1A (otherwise designated RFM) were named based on the position where the substitution was made. Examples of WT1 peptides which may be used are shown in Table 10 along with irrelevant peptides, RHAMM-R3 and EW.
Once a suitable peptide has been identified, the target antigen to be used for phage display library screening, that is, a peptide/HLA complex (for example, WT1 peptide/HLA-A0201) is prepared by bringing the peptide and the histocompatibility antigen together in solution to form the complex.
The next step is the selection of phage that bind to the target antigen of interest with high affinity, from phage in a human phage display library that either do not bind or that bind with lower affinity. This is accomplished by iterative binding of phage to the antigen, which is bound to a solid support, for example, beads or mammalian cells followed by removal of non-bound phage and by elution of specifically bound phage. In one embodiment, antigens are first biotinylated for immobilization to, for example, streptavidin-conjugated Dynabeads M-280. The phage library is incubated with the cells, beads or other solid support and non binding phage is removed by washing. Clones that bind are selected and tested.
Once selected, positive scFv clones are tested for their binding to HLA-A2/peptide complexes on live T2 cell surfaces by indirect flow cytometry. Briefly, phage clones are incubated with T2 cells that have been pulsed with Wt1-A peptide, or an irrelevant peptide (control). The cells are washed and then with a mouse anti-M13 coat protein mAb. Cells are washed again and labeled with a FITC-goat (Fab)2 anti-mouse Ig prior to flow cytometry.
In other embodiments, the anti-WT1/A antibodies may comprise one or more framework region amino acid substitutions designed to improve protein stability, antibody binding, expression levels or to introduce a site for conjugation of therapeutic agents. These scFv are then used to produce recombinant human monoclonal Igs in accordance with methods known to those of skill in the art.
Methods for reducing the proliferation of leukemia cells is also included, comprising contacting leukemia cells with a WT1 antibody of the invention. In a related aspect, the antibodies of the invention can be used for the prevention or treatment of leukemia. Administration of therapeutic antibodies is known in the art.
Antibody Conjugates with Anti-Cancer Agents
Monoclonal antibodies represent the preferred vehicle for the targeted delivery of bioactive agents to cancer sites, including antibody-based delivery of cytotoxics, radionuclides or immunomodulatory cytokines. Conjugates of the antibodies of the invention with therapeutic agents, including without limitation, drugs (such as calecheamicin, aureastatin, doxorubicin), or toxins (such as ricin, diphtheria, gelonin) or radioisotopes emitting alpha or beta particles (such as, 90I, 131I, 225Ac, 213Bi, 223Ra and 227Th), inflammatory peptides (such as IL2, TNF, IFN-γ) are encompassed by the invention.
Pharmaceutical Compositions and Methods of Treatment
WT1 antibodies of the present invention can be administered for therapeutic treatments to a patient suffering from a tumor or WT1-associated pathologic condition in an amount sufficient to prevent, inhibit, or reduce the progression of the tumor or pathologic condition. Progression includes, e.g, the growth, invasiveness, metastases and/or recurrence of the tumor or pathologic condition. Amounts effective for this use will depend upon the severity of the disease and the general state of the patient's own immune system. Dosing schedules will also vary with the disease state and status of the patient, and will typically range from a single bolus dosage or continuous infusion to multiple administrations per day (e.g., every 4-6 hours), or as indicated by the treating physician and the patient's condition.
The identification of medical conditions treatable by WT1 antibodies of the present invention is well within the ability and knowledge of one skilled in the art. For example, human individuals who are either suffering from a clinically significant leukemic disease or who are at risk of developing clinically significant symptoms are suitable for administration of the present WT1 antibodies. A clinician skilled in the art can readily determine, for example, by the use of clinical tests, physical examination and medical/family history, if an individual is a candidate for such treatment.
Non-limiting examples of pathological conditions characterized by WT1 expression include chronic myelocytic leukemia, acute lymphoblastic leukemia (ALL), acute myeloid/myelogenous leukemia (AML) and myelodysplastic syndrome (MDS). Additionally, solid tumors, in general and in particular, tumors associated with mesothelioma, ovarian cancer, gastrointestinal cancers, breast cancer, prostate cancer and glioblastoma are amenable to treatment using WT1 antibodies.
In another embodiment, therefore, the present invention provides a method of treating a medical condition by administering a WT1 antibody of the present invention in combination with one or more other agents. For example, an embodiment of the present invention provides a method of treating a medical condition by administering a WT1 antibody of the present invention with an antineoplastic or antiangiogenie agent. The WT1 antibody can be chemically or biosynthetically linked to one or more of the antineoplastic or antiangiogenic agents.
Any suitable method or route can be used to administer a WT1 antibody of the present invention, and optionally, to coadminister antineoplastic agents and/or antagonists of other receptors. Routes of administration include, for example, oral, intravenous, intraperitoneal, subcutaneous, or intramuscular administration. It should be emphasized, however, that the present invention is not limited to any particular method or route of administration.
It is noted that a WT1 antibody of the present invention can be administered as a conjugate, which binds specifically to the receptor and delivers a toxic, lethal payload following ligand-toxin internalization.
It is understood that WT1 antibodies of the invention will be administered in the form of a composition additionally comprising a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include, for example, one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the binding proteins. The compositions of the injection may, as is well known in the art, be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the mammal.
Other aspects of the invention include without limitation, the use of antibodies and nucleic acids that encode them for treatment of WT1 associated disease, for diagnostic and prognostic applications as well as use as research tools for the detection of WT1 in cells and tissues. Pharmaceutical compositions comprising the disclosed antibodies and nucleic acids are encompassed by the invention. Vectors comprising the nucleic acids of the invention for antibody-based treatment by vectored immunotherapy are also contemplated by the present invention. Vectors include expression vectors which enable the expression and secretion of antibodies, as well as vectors which are directed to cell surface expression of the antigen binding proteins, such as chimeric antigen receptors.
Cells comprising the nucleic acids, for example cells that have been transfected with the vectors of the invention are also encompassed by the disclosure.
For use in diagnostic and research applications, kits are also provided that contain a WT1 antibody or nucleic acids of the invention, assay reagents, buffers, and the like.
The method of the present invention will now be described in more detail with respect to representative embodiments.
Cell samples, cell lines and antibodies. After informed consent on Memorial Sloan-Kettering Cancer Center Institutional Review Board approved protocols, peripheral blood mononuclear cells (PBMC) from HLA-typed healthy donors and patients were obtained by Ficoll density centrifugation. The sources for obtaining human mesothelioma cell lines are described previously (29). The cell lines include: H-Meso1A, JMN, VAMT, H2452, H2373, H28, MSTO, Meso 11, Meso 34, Meso 37, Meso 47, and Meso 56. All cells were HLA typed by the Department of Cellular Immunology at Memorial Sloan-Kettering Cancer Center. Leukemia cell lines LAMA81, BV173, and 697, (WT1+, A0201+) were kindly provided by Dr. H. J. Stauss (University College London, London, United Kingdom). Melanoma cell line MeWo (WT1-, A201+), SKLY16 (B-cell lymphoma; WT1-, A0201+); K562, RwLeu4, and HL60, all WT1+ leukemias, and a TAP-deficient T2 cell line were obtained from the American Type Culture Collection. The cell lines were cultured in RPMI 1640 supplemented with 5% FCS, penicillin, streptomycin, 2 mmol/L glutamine, and 2-mercaptoethanol at 37 C/5% CO2.
Monoclonal Ab against human HLA-A2 (clone BB7.2) conjugated to FITC or APC, and its isotype control mouse IgG2b/FITC or APC, to human or mouse CD3, CD19, CD56, CD33, CD34 (BD Biosciences, San Diego), goat F(ab)2 anti-human IgG conjugated with PE or FITC and goat F(ab)2 anti-mouse Ig's conjugated to fluorescent (In Vitrogen, City) were purchased. Mouse mAb to HLA-class I (W6/32) was obtained from the MSKCC Monoclonal antibody Core Facility.
Peptides. All peptides were purchased and synthesized by Genemed Synthesis, Inc. (San Antonio, Tex.). Peptides were >90% pure. (Table 1.) The peptides were dissolved in DMSO and diluted in saline at 5 mg/mL and frozen at −180 C. Biotinylated single chain WT1 peptide/HLA-A0201 and RHAMM-3/HLA-A0201 complexes were synthesized by refolding the peptides with recombinant HLA-A2 and beta2 microglobulen (β2M) at the Tetramer facility at MSKCC.
Animals. Eight to 10 week-old NOD.Cg-Prkdc scid IL2rgtm1Wjl/SzJ mice, known as NOD scid gamma (NSG), were purchased from the Jackson Laboratory (Bar Harbor, Me.) or obtained from MSKCC animal breeding facility.
Flow cytometry analysis. For cell surface staining, cells were incubated with appropriate mAbs for 30 minutes on ice, washed, and incubated with secondary antibody reagents when necessary. Flow cytometry data were collected on a FACS Calibur (Becton Dickinson) and analyzed with FlowJo V8.7.1 and 9.4.8 software.
Selection and characterization of scFv specific for WT1 peptide/HLA-A0201 complexes. A human scFv antibody phage display library was used for the selection of mAb clones. In order to reduce the conformational change of MHC1 complex introduces by immobilizing onto plastic surfaces, a solution panning method was used in place of conventional plate panning. In brief, biotinylated antigens were first mixed with the human scFv phage library, then the antigen-scFv antibody complexes were pulled down by streptavidin-conjugated Dynabeads M-280 through a magnetic rack. Bound clones were then eluted and were used to infect E. coli XL1-Blue. The scFv phage clones expressed in the bacteria were purified (35, 36). Panning was performed for 3-4 cycles to enrich scFv phage clones binding to HLA-A0201/WT1 complex specifically. Positive clones were determined by standard ELISA method against biotinylated single chain HLA-A0201/WT1 peptide complexes. Positive clones were further tested for their binding to HLA-A2/peptide complexes on live cell surfaces by flow cytometry, using a TAP-deficient, HLA-A0201+ cell line, T2. T2 cells were pulsed with peptides (50 ug/ml) in the serum-free RPM11640 medium, in the presence of 20 μg/ml β2 M ON. The cells were washed, and the staining was performed in following steps.
The cells were first stained with purified scFv phage clones, and followed by staining with a mouse anti-M13 mAb, and finally the goat F(ab)2 anti-mouse Ig's conjugate to FITC. Each step of the staining was done between 30-60 minutes on ice and the cells were washed twice between each step of the staining.
Engineering full length mAb using the selected ScFv fragments. Full-length human IgG1 of the selected phage clones were produced in HEK293 and Chinese hamster ovary (CHO) cell lines, as described (37). In brief, antibody variable regions were subcloned into mammalian expression vectors, with matching human lambda or kappa light chain constant region and human IgG1 constant region sequences. Molecular weight of the purified full length IgG antibodies were measured under both reducing and non-reducing conditions by electrophoresis.
Engineering chimeric antigen receptors and immune effector cells. Nucleic acids that encode antibodies and antigen binding proteins identified herein can be used engineer recombinant immune effector cells. Methods and vectors to generate genetically modified T-cells, for example, are known in the art (See Brentjens et al., Safety and persistence of adoptively transferred autologous CD19-targeted T cells in patients with relapsed or chemotherapy refractory B-cell leukemias in Blood 118(18):4817-4828, November 2011).
Characterization of the full-length human IgG1 for the WT1p/A2 complex. Initially, specificities of the fully human IgG1 mAbs for the WT1 peptide/A2 complex were determined by staining T2 cells pulsed with or without RMF or RHAMM-R3 control peptides, followed by secondary goat F(ab)2 anti-human IgG mAb conjugate to PE or FITC. The fluorescence intensity was measured by flow cytometry. The same method was used to determine the binding of the mAbs to fresh tumor cells and cell lines.
Radioimmunoassays. WT1 ab1 was labeled with 125-I (PerkinElmer) using the chloramine-T method (38). 100 μg antibody was reacted with 1 mCi 125-I and 20 μg chloramine-T, quenched with 200 μg Na metabisulfite, then separated from free 125-I using a 10DG column (company) equilibrated with 2% bovine serum albumin in PBS. Specific activities of products were in the range of 7-8 mCi/mg.
Hematopoietic cell lines, adherent cell lines (harvested with a non-enzymatic cell stripper (name)), PBMCs from normal donors and AML patients were obtained as described. Cells were washed once with PBS and re-suspended in 2% human serum in PBS at 107 cells/mL at 0°. Cells (106 tube in duplicate) were incubated with 125-I-labeled WT1 AB1 (1 μg/mL) for 45 minutes on ice, then washed extensively with 1% bovine serum albumin in PBS at 0°. To determine specific binding, a duplicate set of cells was assayed after pre-incubation in the presence of 50-fold excess unlabeled WT1 AB1 for 20 minutes on ice. Bound radioactivity was measured by a gamma counter, specific binding was determined, and the number of bound antibodies per cell was calculated from specific activity.
Antibody-dependent cellular cytotoxicity (ADCC). Target cells used for ADCC were T2 cells pulsed with or without WT1 or RHAAM-3 peptides, and tumor cell lines without peptide pulsing. WT1 ab1 or its isotype control human IgG1 at various concentrations were incubated with target cells and fresh PBMCs at different effector: target (E:T) ratio for 16 hrs. The supernatant were harvested and the cytotoxicity was measured by LDH release assay using Cytotox 96 non-radioreactive kit from Promega following their instruction. Cytotoxicity is also measured by standard 4 hours 51Cr-release assay.
Transduction and selection of luciferase/GFP positive cells. BV173 and JMN cells were engineered to express high level of GFP-luciferase fusion protein, using lentiviral vectors containing a plasmid encoding the luc/GFP (39). Using single cell cloning, only the cells showing high level GFP expression were selected by flow cytometry analysis and were maintained and used for the animal study.
Therapeutic trials of the WT1 ab1 in a human leukemia xenograft NSG model. Two million BV173 human leukemia cells were injected IV into NSG mice. On day 5, tumor engraftment was confirmed by firefly luciferase imaging in all mice that were to be treated; mice were then randomly divided into different treatment groups. On day 6 and day 10, mAb WT1 ab1 or the isotype control mAb were injected IV. In animals that also received human effector cells with or without mAb, cells (CD34 and CD3-depleted healthy donor human PBMCs) were injected IV into mice (10 cells/mouse) 4 hr before the mAb injections. Tumor growth was assessed by luminescence imaging once to twice a week, and clinical activity was assessed daily.
Selection and characterization of scFv specific for WT peptide/HLA-A0201 complexes. Selection of an WT1-specific scFV is achieved using a 9-mer T1-derived peptide comprising amino acids 126-134 (RMFPNAPYL, SEQ ID NO: 1) of WT1. This peptide has been shown to be processed and presented by HLA-A0201 to induce cytotoxic CD8+ T cells that are capable of killing WT1-positive tumor cells.
Representative data from a patient with AML after 6 vaccinations with a WT1 RMF peptide are shown in
Well established phage display libraries and screening methods known to those of skill in the art were used to select scFv fragments highly specific for an WT1-A peptide/HLA-A2 complex. In one embodiment, a human scFv antibody phage display library (7×1010 clones) was used for the selection of mAb clones. In order to reduce the conformational change of MHC1 complex introduced by immobilizing onto plastic surfaces, a solution panning method was used in place of conventional plate panning. In brief, biotinylated antigens were first mixed with the human scFv phage library, then the antigen-scFv phage antibody complexes were pulled down by streptavidin-conjugated Dynabeads M-280 through a magnetic rack.
Bound clones were then eluted and were used to infect E. coli XL1-Blue. The scFv phage clones expressed in the bacteria were purified (35, 36). Panning was performed for 3-4 cycles to enrich scFv phage clones binding to HLA-A0201/WT1 complex specifically. Positive clones were determined by standard ELISA method against biotinylated single chain HLA-A0201/WT1 peptide complexes (
The cells were first stained with purified scFv phage clones, followed by staining with a mouse anti-M13 mAb, and finally, a goat F(ab)2 anti-mouse Ig conjugated to FITC. Each step of the staining was done for 30-60 minutes on ice. The cells were washed twice between each staining step. Results are shown in
Binding affinity of the full-length IgG1 of WT1 ab1 to the peptide/A0201 complex was tested by titration of WT1 ab1 at indicated concentrations. T2 cells were pulsed with 50 μg/ml or 10 μg/ml, followed by secondary goat F(ab) anti-human IgG/PE. Results are shown in
The positive scFv clones were tested for their binding to HLA-A2/peptide complexes on live cell surfaces by indirect flow cytometry on: (i) a TAP deficient HLA-A0201+ T2 cells pulsed with WT1 peptide or irrelevant peptide; (ii) a WT1+ HLAA0201+ cell lines such as BV173, U266 and control WTI HLA-A0201+ cell line SKLY16, or WT1+ HLA-A0201 cell line, K562, without pulsing with the peptide. The latter determine the recognition and binding affinity of the scFv to the naturally processed WT1p/A2 complex on tumor cells.
A total of 28 phage clones were screened for their ability to produce mAb specific for the WTI-A peptide/A2 complex. The recognition of the WT1 p/A2 complex on live cells was measured by the binding of the phage scFv to T2 cells pulsed with the WTI-A peptide and the other HLA-A2-binding peptides (50 μg/ml). These include: T2 cells alone; T2 cells pulsed with WTI-A peptide; T2 cells pulsed with heteroclitic peptide WT1-A1; T2 cells pulsed with irrelevant EW peptide (HLA-A0201-binding 9-mer peptide, derived from Ewing sarcoma) or RHAMM-R3 (
Phage display technology allows for the rapid selection and production of antigen-specific scFv and Fab fragments, which are useful in and of themselves, or which can be further developed to provide complete antibodies, antigen binding proteins or antigen binding fragments thereof. Complete mAbs with Fc domains have a number of advantages over the scFv and Fab antibodies. First, only full length Abs exert immunological function such as CDC and ADCC mediated via Fc domain. Second, bivalent mAbs offer stronger antigen-binding affinity than monomeric Fab Abs. Third, plasma half-life and renal clearance will be different with the Fab and bivalent mAb. The particular features and advantages of each can be matched to the planned effector strategy. Fourth, bivalent mAb may be internalized at different rates than scFv and Fab, altering immune function or carrier function. Alpha emitters, for example, do not need to be internalized to kill the targets, but many drugs and toxins will benefit from internalization of the immune complex. In one embodiment, therefore, once scFv clones specific for WT1p/A2 were obtained from phage display libraries, a full length IgG mAb using the scFv fragments was produced.
To produce recombinant human monoclonal IgG in Chinese hamster ovary (CHO) cells, a full length IgG mAb was engineered based on a method known to those of skill in the art (Tomomatsu et al., Production of human monoclonal antibodies against FceRIa by a method combining in vitro immunization with phage display. Biosci Biotechnol Biochem 73(7): 1465-1469 2009). Briefly, antibody variable regions were subcloned into mammalian expression vectors (
Phage display against HLA-A0201/WT1 peptide complex was performed for 3-4 panning rounds to enrich the scFv phage clones binding to HLA-A0201/WT1 peptide complex specifically. Individual scFv phage clones positive for the WT1 peptide/A2 complex were determined by ELISA and the clones that possessed unique DNA coding sequences were subjected to further characterization. To test if the ScFv bound to the WT1p/A2 complex on live cells, the positive phage clones were tested for binding to a TAP deficient, HLA-A0201-positive cell line, T2. T2 cells can only present the exogenous peptides and therefore have been widely used for detection of specific epitopes presented by HLA-A2 molecules. A total 35 phage clones were screened on T2 cells and 15 clones showed specific binding to T2 cells pulsed with only WT1 RMF peptide, but not to T2 cells alone or pulsed with control RHAMM-3 peptide (
Immunological function such as CDC and ADCC depend on the Fc domain of bivalent IgG. In addition, bivalent mAbs offer stronger antigen-binding avidity than monomeric scFv Abs. Therefore, 6 ScFv phage clones among 15 positive phage clones were selected to produce the full-length human monoclonal IgG1 in HEK293 and Chinese hamster ovary (CHO) cells. In brief, variable regions of the mAbs were subcloned into mammalian expression vectors with matching human lambda or kappa light chain constant region and human IgG1 constant region sequences. Purified full length IgG antibodies showed expected molecular weight under both reducing and non-reducing conditions (
T2 cells, pulsed with or without RMF or RHAMM-3 peptides initially were used to determine the binding specificity of the mAb. Three out of five human IgG1, including WT1 ab1, showed specific binding to the T2 cells that were pulsed only with WT1 peptide, but not to T2 alone or T2 pulsed with control peptide RHAMM-R3. The binding avidity of the mAb were substantially enhanced (50 to 100 fold), compared to their parental scFv phage clones. Two mAbs among the five showed binding to T2 cells alone or pulsed with the control peptide RHAMM-R3, although the binding was greatly enhanced by pulsing the cells with RMF peptide. This suggested that these two mAb also had high avidity for epitopes on the HLA-A2 molecule alone and therefore were excluded from further investigation. This was not unexpected, as it has been a common problem for producing such mAb against peptide/MHC complexes, given the predominance of the MHC class I molecule epitopes within the complexes. It also suggests that the precise specificity of the mAb for the complexes might not be determined easily at the scFv stage, due to the lower affinity compared to the bivalent IgG1 mAb.
The binding affinity of the three remaining mAb specific for the WT1p/A2 complex first was investigated on T2 cells pulsed with or without RMF and control RHAMM-R3 peptides (50 ug/ml) by titration of the mAbs. Mab WT1 ab1 showed the strongest binding, down to a concentration of 0.01 ug/ml. Isotype control human IgG1 showed no binding at any concentrations tested (
To investigate with more precision the epitope for WT1 ab1 recognition, RMF peptides were substituted at positions 1, 3, 4, 5, 6, 7 and 8 with alanine and pulsed onto T2 cells and were tested for binding of WT1 ab1. Positions 2 and 9 of the RMF were left intact, as these are the anchor residues for peptide binding to the HLA-A0201 molecule. Except for position 1, alanine substitutions at other positions did not greatly affect the binding of the WT1 ab1, as compared to the native RMF peptide (
The next important question was whether WT1 ab1 was able to recognize naturally processed WT1 epitope RMF presented by HLA-A0201 molecules on the cell surface. A panel of cell lines was selected based on the expression of WT1 mRNA and HLA genotyping (Table 12).
WT1 mRNA expression level was estimated according to a previous study (Rena), by quantitative RT-PCR.
Among 7 human mesothelioma cell lines that are positive for both HLA-A0201 and WT1 mRNA, WT1 ab1 bound to 6 out of 7 cell lines, but not to the cells that were either HLA-A0201 negative (MSTO and VAMT) or WT1 mRNA negative, such as melanoma cell line, Mewo (
Similarly, among 9 leukemia cell lines tested, WT1 ab1 bound to 3 cell lines BV173 (
As expected, intensity of binding of the WT1 AB1 also appeared to be directly associated with the expression level of HLA-A0201 molecule, as shown in mesothelioma cells H2373, leukemia cell lines 697 and LAMA, and myeloma cell line U266. Although these cell lines were positive for both WT1 transcripts and HLA-A2, the expression level of the HLA-A2 was low (Table 12) and the mAb did not show binding. On the other hand, the results obtained with T2 cells argue against the possibility of WT1 ab1 binding to HLA-A0201 alone as T2 cells expressed a high level of HLA-A2 molecule. Notably, WT1 ab1 did not bind to T2 cells alone or pulsed with R3 and other HLA-A0201-binding peptides such as Ewing sarcoma-derived (EW) or the heteroclitic peptide for the RMF peptide, WT1-A1; these two peptides have been shown to have higher affinity for the HLA-A0201 molecule in T2 stabilization assay (28). These results provided strong evidences that WT1 ab1 recognition was specific for epitopes jointly composed of the RMF peptide and the A0201 molecule in a complex. The binding of the other two mAb, WT1 ab3 and WT1 ab5, to the BV173 and JMN cells was also weaker than WT1 ab1.
A radioimmunoassay using 1251-labeled WT1 ab1 was used to confirm the specificity of the antibody for WT1+ HLA-A0201+ cell lines, to determine an affinity constant and to assess the number of antibody binding sites per cell on a panel of cell lines. Scatchard analysis based on binding to JMN cells showed an avidity constant of about 0.2 nM (
We next investigated if WT1 ab1 is able to detect the RMF epitope on primary AML cells. Radioimmunoassay showed significant binding of the WT1 AB1 to AML blasts of patient 1, who is HLA-A2 positive and WT1 mRNA+. WT1 ab1 bound to CD33+ and CD34+ double positive cells that account for more than 83% of the whole cell populations (
ADCC is considered to be one of the major effector mechanisms of therapeutic mAb in humans. In the presence of human PBMC, WT1 ab1 mediated dose-dependent PBMC ADCC against the T2 cells loaded with RMF peptide, but not T2 cells alone or T2 cells pulsed with control R3 peptide (
The efficacy of WT1 ab1 in vivo was tested in NOD SCID gamma (NSG) mice xenografted intravenously 6 days previously with BV173 bcr/abl positive acute lymphoblastic leukemia. At the time of treatment, mice had leukemia in their liver, spleen, and BM visible by luciferase imaging. NSG mice lack mature B-, T- and NK-cells, and we hypothesized that introducing human effector cells (CD3-, CD34-, PBMCs) along with WT1 ab1 treatment would recapitulate in vivo the ADCC-mediated anti-tumor effects observed in vitro. Injection of effectors along with two 100 μg doses of WT1 ab1 nearly ablated tumor growth compared to controls (
Surprisingly, WT1 ab1 treatment without human effectors also dramatically reduced tumor burden as well as the WT1 ab1 combined with effectors for approximately 30 days (
Engineering Antibodies to Enhance their Cytotoxic Abilities.
Bispecific antibodies are constructed that recognize both WT1/A2 complex and CD3 on immune T cells as described (43,44) with a human IgG1 Fc. Bispecific antibodies are expected to recruit and target cytotoxic T cells to WT1/A2 positive cancer cells, while maintaining Fc effector functions and long half life in vivo. Three mechanisms are involved in the specific killing of cancer cells mediated by bispecific antibodies: i) killing by activated T cells; ii) ADCC activity; iii) CDC activity. Other formats of bispecific antibodies can be constructed, such tandem scFv molecules (taFv), diabodies (Db), or single chain diabodies (scDb), and fusion protein with human serum albumin (45, 46, 47, 48), but are devoid of Fc effector functions with distinct pharmacokinetic profiles.
WT1/A2 target specific-ADCC activity is enhanced by expressing antibodies recombinantly in glycol-engineered CHO cells as described in U.S. Pat. Nos. 8,025,879; 8,080,415; and 8,084,022. The modified oligosaccharide N-glycan on Asn297 alters effector functions as follows: 1) higher affinity binding to CD16/FcRIIIa for improved ADCC activity mediated by human Natural Killer cells; 2) reduced binding affinity to CD32b/FcRIIb, an inhibitory receptor expressed in multiple types of immune cells (except NK cells), for improved ADCC activity mediated by effector cells such as neutrophils and antigen presentation by macrophage and DC cells (50, 51, 52). Enhanced antibodies are expected to achieve better efficacy for cancer treatment in vivo.
Glycosylation (specifically fucosylation) variants of IgG Fc can be produced using host expression cells and methods described in U.S. Pat. Nos. 8,025,879; 8,080,415; and 8,084,022, the contents of which are incorporated by reference. Briefly, messenger RNA (mRNA) coding for heavy or light chain of the antibodies disclosed herein, is obtained by employing standard techniques of RNA isolation purification and optionally size based isolation. cDNAs corresponding to mRNAs coding for heavy or light chain are then produced and isolated using techniques known in the art, such as cDNA library construction, phage library construction and screening or RT-PCR using specific relevant primers. In some embodiments, the cDNA sequence may be one that is wholly or partially manufactured using known in vitro DNA manipulation techniques to produce a specific desired cDNA. The cDNA sequence can then be positioned in a vector which contains a promoter in reading frame with the gene and compatible with the low fucose-modified host cell.
Numerous plasmids that contain appropriate promoters, control sequences, ribosome binding sites, and transcription termination sites, and optionally convenient markers are known in the art, these include but are not limited to, vectors described in U.S. Pat. Nos. 4,663,283 and 4,456,748. In one embodiment, the cDNA coding for the light chain and that coding for the heavy chain may be inserted into separate expression plasmids. In an alternative embodiment, the cDNA coding for the light chain and that coding for the heavy chain may be inserted together in the same plasmid, so long as each is under suitable promoter and translation control. Results are shown in
This application is a continuation application of U.S. application Ser. No. 16/055,535, filed on Aug. 6, 2018, which is a continuation application of U.S. application Ser. No. 15/364,953, filed on Nov. 30, 2016, now U.S. Pat. No. 10,040,865, which is a continuation of U.S. application Ser. No. 14/724,155, filed on May 28, 2015, now U.S. Pat. No. 9,540,448, which is a continuation application of U.S. application Ser. No. 14/008,447 filed Dec. 10, 2013, now U.S. Pat. No. 9,074,000, which is a National Phase filing under 35 U.S.C. § 371 of PCT International Application PCT/US2012/31892 filed Apr. 2, 2012, and published as WO2012/135854 on Oct. 4, 2012. This application also claims priority to U.S. Provisional Application No. 61/470,635, filed Apr. 1, 2011, and U.S. Provisional Application No. 61/491,392, filed May 31, 2011. These Provisional Applications are hereby incorporated by reference in their entirety into the present disclosure.
This invention was made with government support under grants P01CA23766 and R01CA55349 awarded by the U.S. National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61491392 | May 2011 | US | |
| 61470635 | Apr 2011 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16055535 | Aug 2018 | US |
| Child | 17085234 | US | |
| Parent | 15364953 | Nov 2016 | US |
| Child | 16055535 | US | |
| Parent | 14724155 | May 2015 | US |
| Child | 15364953 | US | |
| Parent | 14008447 | Dec 2013 | US |
| Child | 14724155 | US |
