Patent Application
20180312546
The present invention relates to methods and uses for screening anti-hepadnaviral substances, wherein the substances are inhibitors of hepatitis B e antigen (HBeAg) which is predominantly covalently closed circular (ccc) DNA-dependent in cell lines described in this invention and might serve as a surrogate marker for cccDNA screened for the capacity to inhibit ccc DNA of a hepadnavirus, like Hepatitis B virus (HBV). The methods and uses take advantage of cells comprising a nucleic sequence encoding a tagged hepadnavirus e antigen, like Hepatitis B virus e antigen (HBeAg). Furthermore, the present invention provides nucleic acid sequences encoding a tagged hepadnavirus e antigen and proteins encoded thereby. Also kits for use in the screening methods are provided.
Chronic hepatitis B is currently a substantial public health burden affecting approximately 350 million individuals worldwide and at least 1.2 million in the United States. These patients have an elevated risk of liver cirrhosis, hepatocellular carcinoma (HCC), and other severe clinical sequelae (1, 2, 12, 14). Annually, there are about 1 million deaths due to HBV-related liver disease all over the world. It is therefore a global health priority to cure chronic HBV infection and prevent its dire consequences.
Hepatitis B virus (HBV) is a noncytopathic, liver tropic DNA virus belonging to Hepadnaviridae family. Hepadnaviruses are a family of enveloped, double-stranded viruses which can cause liver infections in humans and animals. Hepadnaviruses share the similar genome organisation. They have small genomes of partially double-stranded circular DNA. The genome consists of two strands of DNA, one having negative-sense orientation, the other strand having a positive-sense orientation. Replication involves reverse transcription of an RNA intermediate called pregenomic RNA (15, 19). Three main open reading frames (ORFs) are encoded and the virus has five known mRNAs (18, 19).
Upon infection, the viral genomic relaxed circular (rc) DNA is transported into the cell nucleus and converted to episomal covalently closed circular (ccc) DNA, which serves as the transcription template for all the viral mRNAs, specifically 3.5-3.6 kb precore mRNA encoding precore protein which is the precursor for HBeAg; 3.5 kb pregenomic (pg) RNA encoding core protein and viral polymerase; 2.4 kb/2.1 kb surface mRNAs encoding viral envelope proteins (large (L), middle (M), and small (S) antigens); and 0.7 kb X mRNA for X protein (18, 19). HBeAg is generated by two proteolytic events removing the N-terminal signal peptide and the C-terminal arginine-rich sequence of the precore protein (Wang (1991) J Virol 65(9), 5080 (10, 21). After transcription and nuclear exportation, cytoplasmic viral pgRNA is assembled with HBV polymerase and capsid proteins to form the nucleocapsid, inside of which polymerase-catalyzed reverse transcription yields minus-strand DNA, which is subsequently copied into plus-strand DNA to form the progeny rcDNA genome. The newly synthesized mature nucleocapsids will either be packaged with viral envelope proteins and egress as virion particles, or shuttled back to the nucleus to amplify the cccDNA reservoir through intracellular cccDNA amplification pathway (19). Therefore, the molecular basis for chronic hepatitis B is the persistence of viral cccDNA in the nuclei of infected hepatocytes.
There is no definitive cure for chronic hepatitis B. Currently approved drugs for HBV treatment are interferon-α (IFN-α) and 5 nucleos(t)ide analogues (lamivudine, adefovir, entecavir, telbivudine, and tenofovir). Xu (2010) J Virol (84) 9332-9340 discloses the treatment of mouse hepatocytes with mouse interferon. IFN-α only achieves sustained virological response in a minor group of patients after 48 weeks of standard treatment, and with significant adverse effects (9). The five nucleos(t)ide analogues (NAs) all act as viral polymerase inhibitors, but rarely cure HBV infection (6), and emergence of resistance dramatically limits their long-term efficacy (16, 24). It is now well acknowledged that the major limitation of current treatment is the failure to eliminate the preexisting cccDNA pool, and/or prevent cccDNA formation from trace-level wild-type or drug-resistant virus. Thus there is an urgent unmet need for the development of novel therapeutic agents that directly target cccDNA formation and maintenance.
Cai (2013) Methods in Mol Biol 1030 (151-161) disclose a southern blot assay for detection of HBV ccc (covalently closed circular) DNA from cell cultures. Yet, to date, screens for anti-cccDNA agents have been limited due to the lack of efficient in vitro HBV infection models, and a practical approach for measuring cccDNA in high to mid-throughput format was unavailable. Alternatively, cccDNA formation can be achieved through the intracellular amplification pathway in stably-transfected HBV cell cultures that constitutively or conditionally replicate HBV genome, as represented by HepG2.2.15 and HepAD38 cells (7, 11, 20).
However, the direct cccDNA detection from HBV cell lines by either Southern blot hybridization or real-time PCR assay would not be amenable to screening due to the sensitivity and specificity issues, respectively. On the other hand, there is no suitable surrogate marker for cccDNA in HepG2.2.15 cells since the most majority of viral products are derived from integrated viral transgene, which are indistinguishable from cccDNA contributions. It has been previously reported that the production of secreted HBeAg was predominantly cccDNA-dependent in HepAD38 cells and might serve as a surrogate marker for cccDNA (1, 23). Recently, Cai, et al. applied an upgraded version of a solely cccDNA-dependent HBeAg producing cell line, named HepDE19 cells (7), into 96-well format assay for screening of cccDNA inhibitors and identified two small molecule compounds that inhibit cccDNA formation (3). Such work thus provided a solid “proof-of-concept” demonstration that cccDNA biosynthesis can be directly targeted by chemical molecules, and cccDNA inhibitors could be identified from high throughput screening campaign. However, certain disadvantages of the existing HepDE19 assay system render a screen of larger libraries impractical. For instance, the traditional ELISA assay currently used for HBeAg requires multiple manipulations, exhibits a certain extent of cross reaction with viral core protein due to amino acid sequence homology, and are not suitable for larger format cell-based assay.
Thus, the technical problem underlying the present invention is the provision of means and methods to reliably screen inhibitors of hepadnaviral cccDNA.
The technical problem is solved by provision of the embodiments characterized in the claims.
Accordingly, the present invention relates to a method for assessing the capacity of a candidate molecule to inhibit ccc (covalently closed circular) DNA of a hepadnavirus comprising the steps of
The methods are generally applicable to other mammalian and avian hepadnaviruses, such as the representative woodchuck hepatitis virus (WHV) and duck hepatitis B virus (DHBV) which share a similar gene organization and replication strategy with Hepatitis B virus (HBV). The herein provided explanations and experiments with regard to Hepatitis B virus apply therefore likewise to other hepadnaviruses. However, the teachings provided herein relate in preferred embodiment to “Hepatitis B virus”/HBV. The terms “hepadnavirus”, “Hepatitis B virus”, “duck hepatitis B virus”, “woodchuck hepatitis virus (WHV)” are well known in the art and used accordingly herein. The abbreviations “HBV”, “DHBV” or “WHV” are used interchangeably herein with the full terms “Hepatitis B virus”, “duck hepatitis B virus” and “woodchuck hepatitis virus”, respectively.
The herein preferred hepadnavirus is preferably Hepatitis B virus (HBV). Hepatitis B virus (HBV) is a noncytopathic, liver tropic DNA virus belonging to Hepadnaviridae family, i.e. HBV is a hepadnavirus. Exemplary nucleic acid sequences of HBV genomes are shown in SEQ ID NO: 27, 28, 29, 30, 31, 32, 33 or 34.
The herein preferred hepadnavirus e antigen is Hepatitis B virus e antigen (HBeAg). The terms “Hepatitis B virus e antigen” and “HBeAg” are used interchangeably herein. An exemplary nucleic acid sequence and amino acid sequence of HBeAg is shown in SEQ ID NO: 16 and 18, respectively. As used herein “hepadnavirus e antigen” (and likewise “Hepatitis B virus e antigen”) refers primarily to a protein/polypeptide e.g. a protein/polypeptide having an amino acid sequences as shown in SEQ ID NO: 18.
HBeAg can be produced upon infection as follows: upon infection, the HBV virus genomic relaxed circular (rc) DNA is transported into the cell nucleus and converted to episomal cccDNA, which serves as the transcription template for all the viral mRNAs, including a 3.5-3.6 kb precore mRNA encoding precore protein which is the precursor for HBeAg. The terms “ccc DNA” and “covalently closed circular DNA” are used interchangeably herein.
Exemplary nucleic acid sequences and amino acid sequences of a HBV precore protein are shown in SEQ ID NO: 15 and 17, respectively. The HBV precore protein has an N-terminal 19-amino acid signal peptide, a 10-amino acid linker, a central amino acid stretch and a C-terminal 34-amino acid arginine-rich domain.
Exemplary nucleic acid sequences and amino acid sequences of a HBV core protein are shown in SEQ ID NO: 23 and 24, respectively. The core protein corresponds to the precore protein (see SEQ ID NO: 17) in that it comprises the C-terminal arginine-rich sequence of the precore protein; however, the core protein does not comprise the N-terminal signal peptide and the 10-amino acid linker sequence of the precore protein.
HBeAg is generated by two proteolytic events removing the N-terminal signal peptide and the C-terminal arginine-rich sequence of the precore protein (Wang (1991) J Virol 65(9), 5080 (21). Thus, Hepatitis B virus e antigen (HBeAg) corresponds to the precore protein (see SEQ ID NO: 17) in that it comprises the N-terminal 10-aa linker peptide of the precore protein; however, HBeAg does not comprise the C-terminal arginine-rich sequence of the precore protein.
The molecular basis for chronic hepatitis B is the persistence of viral cccDNA in the nuclei of infected hepatocytes.
The terms “covalently closed circular DNA” and “cccDNA” are used interchangeably herein. The term “covalently closed circular DNA”/“cccDNA” is well known in the art and used accordingly herein. Generally, “covalently closed circular DNA”/“cccDNA” as used herein refers to a DNA that serves as the authentic episomal transcription template for the hepadnaviral mRNAs.
Hepatitis B virus e antigen (HBeAg) is an accepted surrogate marker for cccDNA of HBV hepadnaviruses that in turn reflects chronic hepadnavirus infection. Yet, the known cell based assays employing HBeAg suffer from disadvantages, like cross reaction with viral core protein.
In order to improve the specificity and sensitivity of cccDNA reporter detection, herein cell lines were established that support the cccDNA-dependent production of recombinant HBeAg with a tag (like an N-terminal embedded hemagglutinin (HA) epitope tag). Moreover, chemiluminescence ELISA (CLIA) and AlphaLISA assays for the detection of (HA-)tagged HBeAg were developed. The assay system is adaptable to high throughput screening formats and full automation.
The herein provided methods take advantage of the use of established tags (like HA-tag, or His-tag, Flag-tag, c-myc-tag, V5-tag or C9-tag that can be used in the place of an HA-tag or in addition thereto). These tags can be used in the purification and detection of tagged hepadnavirus e antigen. By using antibodies specifically binding to the tag (e.g. via ELISA assays, like chemiluminescence ELISA (CLIA) and AlphaLISA), the level of tagged hepadnavirus e antigen can be reliably and rapidly assessed and cross-reactions with core protein can be avoided.
The methods provided herein employ cells comprising a nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen. The nucleic acid molecule can comprise a sequence encoding a hepadnavirus precore protein or even a hepadnavirus genome to reflect and enable cccDNA formation of hepadnaviruses. In the art it is known that HBV genome has a highly compact gene organization which exhibits overlapped ORFs and multiple cis elements. Therefore, it was believed that gene insertion/deletion or sequence replacement would very likely affect viral DNA replication (13, 22). (Liu, et al, J Virol. 2004; 78(2):642-9.)(Wang, et al. PLoS One. 2013 2; 8(4):e60306) Previous works have replaced HBV sequence, such as pol/envelope coding region in most cases, by GFP to make recombinant HBV genome, but trans-complement of viral proteins was needed to support viral replication and virion assembly (17)(Protzer, et al, PNAS (1999). 96: 10818-23.). Moreover, this reported recombinant HBV genome can only make first round cccDNA synthesis if used to infect permissive cells, intracellular amplification of cccDNA is blocked due to the defective viral DNA replication.
The 5′ stem-loop structure (epsilon) in hepadnavirus pgRNA, preferably HBV pgRNA, is an essential cis element for viral replication. It serves as the pgRNA packaging signal and DNA priming site. The epsilon overlaps with the 5′ portion of precore ORF and contains the start codon of capsid (core) protein ORF. To insert a nucleic acid sequence encoding a tag downstream of the N-terminal signal peptide sequence in precore ORF without altering the integrity of epsilon structure encoded by the HBV genome, a three-amino-acid linker sequence was introduced herein (GTG GAC ATC) at the 5′ end of the (HA-)tag to replace the original viral sequence (ATG GAC ATC) of the right arm at the bottom of the epsilon as encoded by the HBV genome. Thereby the base pairing of the epsilon as encoded by the HBV genome was maintained and the start codon of core ORF was moved to a position downstream of epsilon as encoded by the HBV genome. In addition, the original GGC sequence was placed between the HA-tag sequence and core AUG in order to keep the authentic Kozak motif of core start codon (
It was envisioned herein that the above modifications cause minimal effects on HBV pgRNA-dependent core expression and pgRNA encapsidation, since the epsilon and the core expression cassette were preserved, although the translation initiation site of core protein was moved 39-nt further downstream in the pgRNA template. Indeed, the recombinant HBV genome supported near wildtype level of viral DNA replication, and the HA-tagged HBeAg was successfully produced upon the reconstitution of precore ORF in cccDNA molecule.
The insertion of an oligo encoding a tag did not affect viral DNA application, so that the herein provided method allows for production of cccDNA and consequently the assessment of the capacity of substances/candidate molecules to inhibit cccDNA formation by determining the amount of the surrogate marker “tagged hepadnavirus e antigen”. The herein provided means and methods are primarily useful to screen and identify candidate molecules that can be used in the therapy of chronic diseases associated with hepadnaviruses, like (chronic) hepatitis and in particular chronic hepatitis B infection.
The insertion of a nucleic acid sequence encoding a tag (like an HA-tag) into the hepadnavirus (like HBV) precore ORF leads to hepadnavirus (like HBV) cccDNA-dependent production of tagged hepadnavirus e antigen (like HBeAg) which is useful for improved antigen detection specificity. In support of the present invention, it was confirmed herein that the (HA-)tag insertion does not affect the expression of precore protein and its subsequent posttranslational processing (N-terminal signal peptide cleavage and C-terminal domain cleavage) and mature HBeAg secretion (
The present invention relates to screen and assessment of pharmacological agents for their activities against hepadnaviruses. In particular, this invention describes the design and construction of recombinant hepatitis B virus (HBV) genome and novel cell lines for inducible expression of HBV cccDNA-dependent epitope (e.g. Human influenza hemagglutinin (HA) tag)-tagged HBV e antigen (HBeAg). The tagged HBeAg secreted into the culture fluid can be quantitatively measured for example by chemiluminescence enzyme immunoassay (CLIA) and/or AlphaLISA. This invention provides an effective cell-based HBV reporter system to screen compounds for anti-hepadnaviral activity, especially those inhibiting cccDNA formation, maintenance, and/or its transcriptional activity.
The present invention is further illustrated by
For example, the following non-limiting anti-hepadnaviral assays can be performed in accordance with the present invention:
1. Screen of Compounds/Candidate Molecules Regulating cccDNA Stability and/or Transcriptional Activity Using HepBHAe Cell Lines.
According to the present invention, the in vitro assay method can be used to screen/evaluate the efficacy of compounds/candidate molecules to regulate cccDNA stability or transcriptional activity in the nucleus. The compounds/candidate molecules thereby alter the level of tagged hepadnavirus e antigen (like HA-HBeAg) in culture supernatant. To perform the assay, cells can be first seeded in culture plates in the presence of tetracycline, and after cells reach confluent, the medium will be replaced with tetracycline-free medium to induce hapadnavirus (like HBV) DNA replication and cccDNA formation, which normally takes 6-8 days. After that, tetracycline can be added back to shut down the de novo viral DNA replication from integrated HBV genome, together with the addition of 3TC (or other HBV polymerase inhibitors) to block the intracellular amplification pathway of cccDNA. At the same time, test compounds can be added into culture medium for a certain period of time. Culture medium can then be used for ELISA measurement of tagged hepadnavirus e antigen (like HA-HBeAg). Media from wells that do not contain test compound can be used as control. Effective compounds that reduce tagged hepadnavirus e antigen (like HA-HBeAg) level in culture medium may have the activity to promote cccDNA turnover or silence cccDNA transcription. The phrase “effective or effectively” can be used herein to indicate that a compound, at certain testing concentration, is sufficient to prevent, and preferably reduce by at least 50%, most preferably by at least 90%, the production of tagged hepadnavirus e antigen (like HA-HBeAg) in a cell based assay system of the present invention. Direct measurement of the steady state levels of cccDNA and precore mRNA by qPCR or hybridization can be used to distinguish whether the test compound/candidate compound/candidate molecule reduces cccDNA stability or transcription, respectively.
2. Screen of Compounds/Candidate Molecules that Inhibit Hepadnavirus (Like HBV) cccDNA Formation Using HepBHAe Cell Lines.
According to another aspect of the present invention, the in vitro assay method can be used to evaluate compounds/candidate molecules that suppress cccDNA formation. Briefly, cells can be seeded into culture wells and tetracycline can be omitted at the day when cell monolayer becomes confluent. Simultaneously, test compound can be added and tagged hepadnavirus e antigen (like HA-HBeAg) in the medium can be measured by ELISA at the end of treatment (approximately 6 days). Any compound resulting in the reduction of tagged hepadnavirus e antigen (like HA-HBeAg) indicates that it may effectively block the formation of cccDNA. As an expanding aspect of this in vitro assay method, it is worth to note that the reduction of tagged hepadnavirus e antigen (like HA-HBeAg) in this assay may also indicate that the compound has the potential to inhibit hepadnavirus (like HBV) DNA replication. Such possibility can be investigated through direct measurement of viral core DNA by Southern blot and/or qPCR. The “hits” emerging from the assay described above may also include compounds that affect cccDNA stability and/or transcription. During the induction time period, the stability and/or transcription activity of the early made cccDNA may be targeted by testing compounds.
Theoretically, compound “hits” from the aforementioned assays may directly inhibit HA-tagged precore protein translation, or posttranslational processing, or tagged hepadnavirus e antigen (like HA-HBeAg) secretion. To rule out such non-cccDNA inhibitors, “hits” can becounter-screened in HepHA-HBe cells, which produce tagged hepadnavirus e antigen (like HA-tagged HBeAg) using transgene as template. On the other hand, HepHA-HBe cells could also be used to screen HBeAg inhibitors.
The term “inhibit covalently closed circular DNA” and grammatical versions thereof can refer to an inhibition of the stability of covalently closed circular DNA (i.e. to a reduced stability of covalently closed circular DNA), to an inhibition of transcriptional activity of covalently closed circular DNA (i.e. to a reduced transcription of hepadnaviral mRNAs using covalently closed circular DNA as a transcription template) or to an inhibition of the formation of covalently closed circular DNA (i.e. no or less cccDNA is formed).
These exemplary explanations and definitions of the term “inhibit covalently closed circular DNA” are not mutually exclusive. For example, an inhibited formation of covalently closed circular DNA can lead to/be associated with a reduced transcription of hepadnaviral mRNAs using covalently closed circular DNA as a transcription template (i.e. an inhibition of transcriptional activity of covalently closed circular DNA). An inhibited stability of covalently closed circular DNA can lead to/be associated with a reduced transcription of hepadnaviral mRNAs using covalently closed circular DNA as a transcription template.
A tagged hepadnavirus e antigen can be used herein as surrogate marker for any such inhibition of cccDNA of a hepadnavirus.
In accordance with the above, the herein provided method can be (used) for assessing the capacity of a candidate molecule to inhibit the formation of cccDNA of a hepadnavirus. In this context, the cell can be contacted with the candidate molecule before cccDNA has formed.
The herein provided method can be (used) for assessing the capacity of a candidate molecule to decrease stability of cccDNA (e.g. the amount or number of cccDNA) of a hepadnavirus. Here, the cell can be contacted with the candidate molecule after cccDNA has formed.
The herein provided method can be (used) for assessing the capacity of a candidate molecule to decrease the transcription (activity) of cccDNA of a hepadnavirus. Here, the cell can be contacted with the candidate molecule after cccDNA has formed.
The tagged hepadnavirus e antigen, the level of which is to be assessed in accordance with the present invention, can contain one or more tags. As shown herein, a reliable assessment of the tagged hepadnavirus e antigen can be achieved by using only one tag, e.g. by using an antibody specifically binding to the tag. Accordingly, it is envisaged and preferred herein that the tagged hepadnavirus e antigen contains only one tag.
The following relates to the one or more tag to be used herein.
The term “tag” as used herein refers to any chemical structure useful as a marker. Primarily, the term “tag” refers to a “protein tag”. The terms “tag” and “protein tag” are known in the art; see, inter alia, Fritze C E, Anderson T R. “Epitope tagging: general method for tracking recombinant proteins”. Methods Enzymol. 2000; 327: 3-16; Brizzard B, Chubet R. Epitope tagging of recombinant proteins. Curr Protoc Neurosci. 2001 May; Chapter 5: Unit 5.8; and/or Terpe K. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Appl Microbiol Biotechnol. 2003 January; 60(5):523-33.
Typically, the tag to be used herein is a protein tag that is fused to the hepadnavirus e antigen.
For example, a nucleic acid encoding the tag can be fused to a nucleic acid encoding a hepadnavirus e antigen, so that a fusion protein comprising both the tag and the hepadnavirus e antigen is expressed. The tag(s) can be fused to the 5′-end of the nucleic acid encoding a hepadnavirus e antigen, inserted within the nucleic acid encoding a hepadnavirus e antigen and/or fused to the 3′-end of the nucleic acid encoding a hepadnavirus e antigen. Thus, the resulting fusion protein can comprise (a) tag(s) at the N-terminus, internally (i.e. within the hepadnvirus e antigen/as internal epitope), and/or at the C-terminus. As shown herein, an internal epitope tag can be used for reliable assessment of the level of a tagged hepadnavirus e antigen and is therefore preferred.
Various tags are known in the art and can be used in accordance with the present invention. Usually, a tag to be used herein has a low molecular weight of about 1-3 kDa, preferably of about 1 kDa. Exemplary, non-limiting low molecular weight tags are HA-tag, His-tag, Flag-tag, c-myc-tag, V5-tag or C9-tag. The use of HA-tag is preferred herein. The Flag-tag to be used herein can be 1×Flag-tag or 3×Flag-tag.
The low molecular weight is reflected in the length of the tag, i.e. the number of amino acid residues of which the tag consists. For example, His-tag (6 amino acids), HA-tag (9 amino acids), FLAG-tag (8 amino acids), or 3×FLAG-tag (22 amino acids) can be used herein. These exemplary tags support near wt-level HBV DNA replication and are therefore useful for performing the present invention.
Accordingly, a tag to be used herein can consist of 6 to 22 amino acids, e.g. 6 amino acids, 7 amino acids, 8 amino acids, 9 amino acids, 10 amino acids, 11 amino acids, 12 amino acids, 13 amino acids, 14 amino acids, 15 amino acids, 16 amino acids, 17 amino acids, 18 amino acids, 19 amino acids, 20 amino acids, 21 amino acids, or 22 amino acids.
Exemplary nucleic acid sequences encoding a tag to be used herein is a nucleic acid sequence encoding the HA tag as shown in SEQ ID NO: 1, a nucleic acid sequence encoding the His-tag as shown in SEQ ID NO: 2; a nucleic acid sequence encoding the c-myc-tag as shown in SEQ ID NO: 4, a nucleic acid sequence encoding the V5-tag as shown in SEQ ID NO: 5, or a nucleic acid sequence encoding the C9-tag as shown in SEQ ID NO: 6. Herein the use of an HA tag encoded by SEQ ID NO: 1 or consisting of an amino acid sequence as shown in SEQ ID NO: 8 is preferred.
An exemplary nucleic acid sequence encoding a Flag-tag to be used herein is a nucleic acid sequence encoding a 1×Flag-tag as shown in SEQ ID NO: 3, or a nucleic acid sequence encoding a 3×Flag-tag as shown in SEQ ID NO: 7.
Exemplary amino acid sequences of a tag to be used herein is an amino acid sequence of an HA tag as shown in SEQ ID NO: 8, an amino acid sequence of the His-tag as shown in SEQ ID NO: 9, an amino acid sequence of the c-myc-tag as shown in SEQ ID NO: 11, an amino acid sequence of the V5-tag as shown in SEQ ID NO: 12, or an amino acid sequence of the C9-tag as shown in SEQ ID NO: 13.
An exemplary amino acid sequence of a Flag-tag to be used herein is an amino acid sequence of the 1×Flag-tag as shown in SEQ ID NO: 10 or an amino acid sequence of the 3×Flag-tag as shown in SEQ ID NO: 14.
The use of epitope tags is primarily envisaged herein, such as a hemagglutinin (HA) tag, His-tag, Flag-tag, c-myc-tag, V5-tag and/or C9-tag. Epitope tags are short peptide sequences which are chosen because high-affinity antibodies can be reliably produced in many different species. These tags are often derived from viral genes, which explain their high immunoreactivity. These tags are particularly useful for western blotting, immunofluorescence, immunohistochemistry, immunoaffinity chromatography and immunoprecipitation experiments. They are also used in antibody purification. Such epitope tags are particularly useful, because known and commercially available antibodies specifically binding to these tags can be used in accordance with the present invention.
Affinity tags are appended to proteins so that they can be purified from their crude biological source using an affinity technique. These include chitin binding protein (CBP), maltose binding protein (MBP), and glutathione-S-transferase (GST). The poly (His) tag is a widely used protein tag; it binds to metal matrices.
Chromatography tags are used to alter chromatographic properties of the protein to afford different resolution across a particular separation technique. Often, these consist of polyanionic amino acids, such as FLAG-tag.
Essentially any tag can be used herein. The nucleic acid encoding the tag as comprised in the nucleic acid molecule to be used herein should be able to support hepadnavirus DNA replication, cccDNA formation, and cccDNA-dependent tagged hepadnavirus antigen e production and secretion. This capacity can easily be validated using the assays provided herein e.g. the assays provided in the experiments. For example, it has been demonstrated herein that HA-tag insertion led to the wild-type level HBV DNA replication and the production of HA-tagged HBeAg from cccDNA in stable cell lines. These capacities can readily be confirmed and tested for other tags. His-tag and Flag-tag insertion do, for example, not affect viral DNA replication in transient transfection assays.
Further tags can be used without deferring from the gist of the present invention.
For example, reporter proteins can be used as tags herein, like luciferase (e.g. Firefly Luciferase, Renilla Luciferase, Gaussia Luciferase, etc), green fluorescent protein (GFP) and the like. These reporter proteins allow for an easy assessment of the level of the tagged hepadnavirus, e.g. by visual inspection, fluorescence measurements etc. Fluorescence tags are used to give visual readout on a protein. GFP and its variants are the most commonly used fluorescence tags.
Exemplary reporter proteins that can be used in the screening methods of the invention are, inter alia, luciferase, (green/red) fluorescent protein and variants thereof, EGFP (enhanced green fluorescent protein), RFP (red fluorescent protein, like DsRed or DsRed2), CFP (cyan fluorescent protein), BFP (blue green fluorescent protein), YFP (yellow fluorescent protein), β-galactosidase or chloramphenicol acetyltransferase.
Luciferase is a well known reporter; see, for example, Jeffrey (1987) Mol. Cell. Biol. 7(2), 725-737. A person skilled in the art can easily deduce further luciferase nucleic and amino acid sequences to be used in context of the present invention from corresponding databases and standard text books/review.
The reporter protein may allow the detection/assessment of a candidate molecule to inhibit cccDNA by inducing a change in the signal strength of a detectable signal. Said detectable signal can be a fluorescence resonance energy transfer (FRET) signal, a fluorescence polarization (FP) signal or a scintillation proximity (SP) signal. The detectable signal may be associated with a reporter protein as defined herein above. For example, GFP can be derived from Aequorea victoria (U.S. Pat. No. 5,491,084). A plasmid encoding the GFP of Aequorea victoria is available from the ATCC Accession No. 87451. Other mutated forms of this GFP including, but not limited to, pRSGFP, EGFP, RFP/DsRed, DSRed2, and EYFP, BFP, YFP, among others, are commercially available from, inter alia, Clontech Laboratories, Inc. (Palo Alto, Calif.).
The cultured cells/tissues comprising nucleic acid molecules comprising a nucleic acid sequence encoding a hepadnavirus e antigen fused to a reporter gene (like luciferase, GFP etc.) can be monitored for evidence of transcription of the reporter gene as a function of the concentration of test compound/candidate molecule in the culture medium. The variation in transcription levels of the reporter gene as a function of the concentration of test compound indicates the capacity of test compound/candidate molecule to inhibit cccDNA.
Reporter proteins are usually larger than the herein above described tags of low molecular weight, like epitope tags. Due to the longer insertion of, for example, a nucleic acid molecule comprising a nucleic acid sequence encoding luciferase compared to a nucleic acid sequence encoding smaller (epitope) tags (like an HA-tag), the expression of downstream viral core and pol from the recombinant pregenomic RNA can be reduced, so that transcomplement of core/pol may be required to restore the viral replication. For example, cell(s)/cell line(s) that constitutively express hepadnaviral core protein and hepadnaviral polymerase (core/pol) can be used in accordance with the present invention in particular in this context.
The use of a tagged hepadnavirus e antigen containing two or more tags is envisaged herein. The use of two or more tags can allow an even more reliable, and hence advantageous, assessment of the tagged hepadnavirus e antigen. For example, if the two or more tags are different tags (e.g. one tag is an HA-tag, the second tag is a His-tag), antibodies specifically binding to both tags can be employed. Such an assay can accordingly use e.g two epitope antibodies for example for ELISA detection to further increase the assay specificity.
It was found herein that the insertion of a 22 amino acid 3×FLAG tag insertion supports efficient HBV replication. Accordingly, it is believed that the use of e.g. tandem chimeric epitope tags, such as HA-linker-FLAG, can also be employed herein.
In accordance with the above, one tag may consist of 6 to 22 amino acids, when two or more tags are used (e.g. two or more different tags). It is particularly envisaged herein that the overall length of the tags (i.e. the sum of the amino acid residues of the two or more stages) to be used herein does not exceed a maximum of about 22 amino acids, because the expression of downstream viral core and pot from the recombinant pregenomic RNA might be reduced, as described in context of reporter proteins (like luciferase) above. If such a reduced expression of downstream viral core and pol occurs, e.g. when the overall length of the two or more tags exceeds about 22 amino acids, transcomplement of core/pol may be required to restore the viral replication. For example, cell(s)/cell line(s) that constitutively express hepadnaviral core protein and hepadnaviral polymerase (core/pol) can be used in accordance with the present invention in particular in this context.
Like a nucleic acid encoding only one tag, a nucleic acid encoding two or more tags can be fused to the 5′-end of the nucleic acid encoding a hepadnavirus e antigen, inserted within the nucleic acid encoding a hepadnavirus e antigen and/or fused to the 3′-end of the nucleic acid encoding a hepadnavirus e antigen. The tags can be separated by a linker: tag-linker-tag if two tags are used, tag-linker-tag-linker-tag, if three tags are used and so on.
Thus, the resulting fusion protein can comprise two or more tags at the N-terminus, internally (i.e. within the hepadnavirus e antigen/as internal epitope), and/or at the C-terminus. As shown herein, an internal epitope tag can be used for reliable assessment of the level of a tagged hepadnavirus e antigen and is therefore preferred. The use of resulting fusion protein with one tag e.g. at the N-terminus and e.g. a second internal tag and/or e.g a third at the C-terminus is envisaged herein. Further combinations are readily apparent and encompassed without deferring from the gist of this invention.
The two or more tags can be two or more of a hemagglutinin (HA)-tag, His-tag, Flag-tag, c-myc-tag, V5-tag and/or C9-tag. The Flag-tag can be 1×Flag-tag or 3×Flag-tag.
In the following, the nucleic acid molecule to be used in accordance with the present invention is described in more detail.
The nucleic acid molecule can comprise a nucleic acid sequence encoding a hepadnavirus precore protein, like a HBV precore protein. An exemplary nucleic acid sequence encoding a hepadnavirus precore protein is shown in SEQ ID NO: 15 and an exemplary amino acid sequence of a hepadnavirus precore protein is shown in SEQ ID NO: 17.
The nucleic acid molecule can comprise a nucleic acid sequence encoding the one or more tag as defined and explained herein above. The sequence encoding the one or more tag can be (inserted) 3′ downstream of the nucleic acid sequence encoding the N-terminal signal peptide and the linker of the hepadnavirus precore protein.
In relation to Hepatitis B virus the N-terminal signal peptide and the linker constitute the N-terminal 29 amino acids of the precore protein as shown, for example, in SEQ ID NO. 17. Accordingly, the nucleic acid sequence encoding the one or more tag can be (inserted) 3′ downstream of the nucleic acid sequence encoding the N-terminal 29 amino acids of a hepatitis B virus precore protein. In other words, the nucleic acid sequence encoding the one or more tag can be (inserted) 3′ downstream of the nucleic acid sequence constituting the 87 nucleic acid residues from the 5′ end of the nucleic acid encoding the HBV precore protein (the nucleic acid encoding the HBV precore protein being shown, for example, in SEQ ID NO. 15). On the protein level, the one or more tag can be inserted C-terminal of the amino acid residue corresponding to position 29 of a hepatitis B virus precore protein (the amino acid of a precore protein being shown, for example, in SEQ ID NO. 17).
In relation to HBeAg the linker constitutes the N-terminal 10 amino acids of the HBeAg as shown, for example, in SEQ ID NO. 18. With regard to HBeAg, the nucleic acid sequence encoding the one or more tag can be (inserted) 3′ downstream of the nucleic acid sequence encoding the N-terminal 10 amino acids of HBeAg. In other words, the nucleic acid sequence encoding the one or more tag can be (inserted) 3′ downstream of the nucleic acid sequence constituting the 30 nucleic acid residues from the 5′ end of the nucleic acid encoding the HBV HBeAg (the nucleic acid encoding the HBeAg being shown, for example, in SEQ ID NO. 16). On the protein level, the one or more tag can be inserted C-terminal of the amino acid residue corresponding to position 10 of HBeAg (the amino acid of an HBeAg being shown, for example, in SEQ ID NO. 18).
More precisely, the nucleic acid sequence encoding the one or more tag can be (inserted) between nucleotides corresponding to positions 87 and 88 of a nucleic acid sequence encoding a HBV precore protein (the nucleic acid sequence encoding a HBV precore protein being shown e.g. in SEQ ID NO. 15). These positions delimit in the epsilon structure of pgRNA of a hepadnavirus or in the epsilon as encoded by a hepadnavirus genome the coding sequence of a linker and the ORF start codon of a nucleic acid sequence encoding the hepadnavirus core protein. In relation to HBV, position 87 is the last 3′ nucleotide of a sequence encoding a linker and position 88 is the first nucleotide of a sequence encoding the core protein.
On the protein level, the one or more tag can be inserted between amino acid residues corresponding to positions 29 and 30 of a hepatitis B virus precore protein (the amino acid of a precore protein being shown, for example, in SEQ ID NO. 17).
Likewise, the nucleic acid sequence encoding the one or more tag can be (inserted) between nucleotides corresponding to positions 30 and 31 of a nucleic acid sequence encoding HBeAg (the nucleic acid sequence encoding HBeAg being shown e.g. in SEQ ID NO. 16). On the protein level, the one or more tag can be inserted between amino acid residues corresponding to positions 10 and 11 of an HBeAg (the amino acid of HBeAg being shown, for example, in SEQ ID NO. 18).
The nucleic acid encoding the one or more tag can be (inserted) 5′ upstream of a nucleic acid encoding a hepadnavirus core protein, such as a HBV core protein. An exemplary nucleic acid encoding a HBV core protein is shown in SEQ ID NO: 23. An exemplary amino acid sequence of a HBV core protein is shown in SEQ ID NO: 24.
The above defined insertion site of the nucleic acid sequence encoding one or more tags can also be defined by positions of nucleotides in a hepadnavirus genome. In relation to a HBV genome the nucleic acid molecule comprising a sequence encoding the one or more tag can, in accordance with the above, be inserted between nucleotides corresponding to position C1902 and position A1903 of the HBV genome. These positions can be determined according to nomenclature, as described, for example, in Galibert, F., et al (1979), Nature 281:646-650. It is evident that the nucleotide (positions) “C1902” and “A1903” as employed herein refer to the last nucleotide of precore region coding sequence and the first nucleotide of the core AUG, respectively. They are conserved among the different HBV genotype (A-H) sequences (as also provided herein and shown in SEQ ID NOs: 27-34). Accordingly, exemplary, non-limiting nucleic acid sequences of HBV genomes to be used herein are shown in SEQ ID NO: 27, 28, 29, 30, 31, 32, 33 or 34. Yet, nucleotide “C”, but not the “A” in the core AUG, or their positions may be different in sequences from some rare (clinical) isolates. Such sequences are also comprised in this invention.
In accordance with the present invention, the nucleic acid sequence encoding one or more tags can be inserted between nucleotides corresponding to position C1902 and position A1903 of a hepadnavirus genome other than the HBV genome. These corresponding positions in hepadnavirus genomes (i.e. the positions in a hepadnavirus genome that correspond to position C1902 and position A1903 of the HBV genome) can be determined readily. In other words, the nucleic acid sequence encoding the one or more tag can be inserted between an epsilon structure of a hepadnavirus pgRNA, preferably of HBV pgRNA, or an epsilon encoded by a hepadnavirus genome (preferably, an HBV genome) and an ORF start codon of a nucleic acid sequence encoding the hepadnavirus core protein.
For example, if the nucleic acid molecule comprises a nucleic acid sequence encoding a hepadnavirus precore protein, the sequence encoding the one or more tag can be (inserted) 3′ downstream of the nucleic acid sequence encoding the N-terminal signal peptide and the linker of the hepadnavirus precore protein. The nucleic acid sequence encoding the N-terminal signal peptide and the linker of the hepadnavirus precore protein can readily be determined. The sequence starts at (and hence includes) an ORF start codon of the nucleic acid sequence encoding the hepadnavirus precore protein and ends prior to an ORF start codon of the nucleic acid sequence encoding the hepadnavirus core protein (i.e. the coding sequence of the core protein is excluded). On the protein level, the one or more tag can be inserted C-terminal of the amino acid residue corresponding to the C-terminal final amino acid of the linker (the linker following the N-terminal signal peptide).
Accordingly, the nucleic acid sequence encoding the one or more tag can be (inserted) 3′ downstream of the nucleic acid sequence encoding the N-terminal amino acids of a hepadnavirus e antigen. These N-terminal amino acids constitute the “linker” in a hepadnavirus precore protein. On the protein level, the one or more tag can be inserted C-terminal of the final C-terminal amino acid residue of the linker.
More precisely, the nucleic acid sequence encoding the one or more tag can be (inserted) between nucleotides corresponding to positions 87 and 88 of a nucleic acid sequence encoding a HBV precore protein (the nucleic acid sequence encoding a HBV precore protein being shown e.g. in SEQ ID NO. 15). On the protein level, the one or more tag can be inserted between amino acid residues corresponding to positions 29 and 30 of a hepatitis B virus precore protein (the amino acid of a precore protein being shown, for example, in SEQ ID NO. 17). These positions delimit in the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or in the epsilon structure as encoded by a hepadnavirus genome, preferably HBV genome, the coding sequence of a linker and the ORF start codon of a nucleic acid sequence encoding the hepadnavirus core protein. In relation to HBV, position 87 is the last 3′ nucleotide of a sequence encoding a linker and position 88 is the first nucleotide of a sequence encoding the core protein. The corresponding positions in hepadnavirus HBV precore protein (i.e. the positions in a hepadnavirus genome that correspond to positions 87 and 88 of a nucleic acid sequence encoding a HBV precore protein) can be readily determined.
Likewise, the nucleic acid sequence encoding the one or more tag can be (inserted) between a nucleic acid sequence encoding the N-terminal signal peptide and linker of a hepadnavirus precore protein and a nucleic acid sequence encoding a hapadnavirus core protein.
For example, the nucleic acid sequence can be (inserted) between nucleotides corresponding to positions 30 and 31 of a nucleic acid sequence encoding HBeAg (the nucleic acid sequence encoding HBeAg being shown e.g. in SEQ ID NO. 16). On the protein level, the one or more tag can be inserted between amino acid residues corresponding to positions 10 and 11 of an HBeAg (the amino acid of HBeAg being shown, for example, in SEQ ID NO. 18). These positions delimit the coding sequence of the N-terminal hepadnavirus linker in the precore protein (or the coding sequence of the N-terminal hepadnavirus linker in a hepadnavirus e antigen) and the ORF start codon of a nucleic acid sequence encoding the hepadnavirus core protein. In relation to HBV, position 30 is the last 3′ nucleotide of a sequence encoding a linker in a nucleic acid sequence encoding HBeAg. Position 31 is the first nucleotide of a sequence encoding the core protein. The corresponding positions in a nucleic acid sequence encoding hepadnavirus e antigen (i.e. the positions in a hepadnavirus e antigen that correspond to position 30 and 31 of a nucleic acid sequence encoding HBeAg) can be readily determined.
The nucleic acid encoding the one or more tag can be (inserted) 5′ upstream of a nucleic acid encoding a hepadnavirus core protein, preferably a HBV core protein. An exemplary nucleic acid encoding a HBV core protein is shown in SEQ ID NO: 23. An exemplary amino acid sequence of a HBV core protein is shown in SEQ ID NO: 24. In other words, the nucleic acid encoding the one or more tag can be inserted between an epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or between an epsilon structure as encoded by a hepadnavirus genome, (preferably a HBV genome) and an ORF start codon of nucleic acid sequence encoding the hepadnavirus core protein, preferably a HBV core protein.
As mentioned above, the nucleic acid molecule to be used/provided herein can comprise a sequence encoding the one or more tag wherein said sequence is inserted into the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or into an epsilon structure as encoded by a hepadnavirus genome, preferably an HBV genome. An exemplary epsilon structure encoded by the HBV genome is shown in
As described herein above, the nucleic acid molecule comprising a sequence encoding the one or more tag can be inserted into the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or as encoded by a hepadnavirus genome, preferably a HBV genome. An exemplary lower stem of an epsilon structure as encoded by a HBV genome is shown in
It is envisaged and preferred herein that the nucleic acid molecule comprises 5′ of the sequence encoding the one or more tag a sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or the lower stem of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome. It is believed that the experiments and teaching described and provided herein in relation to hepatitis B virus/tagged hepatitis B virus e antigen is generally applicable to hepadnaviruses/tagged hepadnavirus e antigen. The only modification to the insertion sequence used for HBV can relate to the modification of the 5′ flanking sequence of the nucleic acid sequence encoding the (epitope) tag to maintain the base pairing of epsilon of a hepadnavirus pgRNA, preferably HBV pgRNA, or epsilon as encoded by a hepadnavirus genome, preferably a HBV genome, for each specific hepadnavirus, preferably HBV. Based on the teaching of the present invention, a person skilled in the art is readily capable of designing and preparing a nucleic acid sequence 5′ of the nucleic acid sequence encoding the tag to maintain the base pairing with epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome. In particular in terms of duck hepatitis B virus (DHBV), since the start codon of its core ORF is located downstream of epsilon it thus not even be necessary to introduce a 5′ flanking sequence of the nucleic acid sequence encoding the (epitope) tag to maintain the base pairing of epsilon for DHBV.
As shown in
It is an important and preferred aspect of the present invention that the nucleic acid sequence encoding the one or more tag as defined herein and/or to be inserted as described herein above further comprises a nucleic acid sequence that is capable of forming base pairs with the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome, particularly the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome. By using a nucleic acid sequence that are capable of forming base pairs with the epsilon structure, it is aimed to preserve the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome. The epsilon structure is, in turn thought to be important for replication, production of cccDNA and expression/production of (tagged) hepadnavirus e antigen, preferably HBV e antigen.
Preferably, the sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome, is capable of forming base pairs with nucleotides corresponding preferably to positions T1849 to A1854 or, optionally, corresponding to positions T1849 to T1855 of the HBV genome. Typically, the formation of base pairs in pgRNA occurs between matching ribonucleotides, like A-U, G-C, and wobble base pair G-U. If the epsilon structure is maintained, replication, production of cccDNA and/or expression/production of (tagged) hepadnavirus e antigen is/are not hampered in the nucleic acid molecules to be used/provided herein.
It should be noted that the left arm of the epsilon structure is part of the nucleic acid sequence encoding the signal peptide of hepadnavirus e antigen (like HBeAg) and, thus, should be kept unchanged. The designed insertion at the right arm of the epsilon as described should not alter the base pairing of the lower stem. In the exemplified insertion shown in
The 5′ flanking sequence of the epitope tag that is capable of forming base pairs with the (lower stem of the) epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome, of a hepadnavirus genome consists of up to 3, 6 or 9 nucleotides, typically of 9 nucleotides.
An exemplary sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome consists of the sequence shown in SEQ ID No. 26. An exemplary sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome encodes a polypeptide as shown in SEQ ID NO. 40.
The nucleic acid molecule to be used/provided herein can further comprise 3′ of the sequence encoding the one or more tag a nucleic acid sequence encoding a linker. The linker can consist of one or more amino acid residues. Preferably, the linker consists of only one amino acid residue, such as a glycine residue.
For example, the nucleic acid sequence encoding the linker consists of the sequence GGC; or the nucleic acid sequence encodes a glycine residue. The GGC is copied from the original 3 nucleotides in front of the AUG of core ORF, which, together with the AUG, assemble a typical Kozak motif for optimal translation initiation. Thus, the linker that can be used/inserted is preferably and suitably selected so as to keep the authentic Kozak motif of the core start codon.
For example, the nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen can comprise a nucleic acid sequence as shown in SEQ ID NO. 41. For example, the nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen can comprise a nucleic acid sequence encoding an amino acid sequence as shown in SEQ ID NO. 42. The exemplary nucleic acid sequence as shown in SEQ ID NO. 41 consists of a nucleic acid sequence capable of forming base pairs with the (lower stem) of the epsilon structure (GTGGACATC; particularly the nucleotides GTGGACAT form base pairs with nucleotides corresponding to positions T1849 to T1855 of the HBV genome), a nucleic acid sequence encoding a HA-tag and a nucleic acid sequence encoding a glycine residue as linker (the latter nucleic acid sequence is primarily useful to keep the authentic Kozak motif of core start codon).
It is envisaged herein that the one or more tag is fused in frame into the hepadnavirus c antigen, preferably the Hepatitis B virus e antigen (HBeAg). Likewise it is envisaged herein that the nucleic acid sequence encoding the one or more tag (with a potential 5′ flanking nucleic acid sequence capable of forming base pairs with the (lower stem of the) epsilon structure and/or with a potential 3′ nucleic acid sequence keeping the authentic Kozak motif of core start condon or encoding a linker) is fused in frame to the nucleic acid sequence encoding the hepadnavirus e antigen, preferably the Hepatitis B virus e antigen (HBeAg).
The nucleic acid molecule to be used and provided in the present invention can comprise a hepadnavirus genome, preferably a Hepatitis B virus (HBV) genome. For example, the HBV genome is the genome of HBV genotype A, B, C, D, E, F, G or H. Exemplary, non-limiting nucleic acid sequences of HBV genomes to be used herein are shown in SEQ ID NO: 27, 28, 29, 30, 31, 32, 33 or 34. The HBV genome can be the genome of HBV genotype D, particularly a genome of HBV subgenotype ayw (like the HBV genome shown in SEQ ID NO: 27).
In accordance with the present invention only those nucleic acid molecules, such as hepadnavirus genomes, are to be used that allow (substantial) expression/production of (tagged) hepadnavirus e antigen. For example, some clinical HBV variants are known that to do not allow substantial expression/production of hepadnavirus e antigen. In some clinical HBV variants, the HBeAg negativity is due to either basal core promoter (BCP) double mutation (A1764T/G1766A in genotype D) or a precore (pC) mutation (G1898A in genotype D). While the BCP mutations reduce HBeAg through downregulation of precore mRNA transcription, the pC mutation introduces a premature stop codon to stall precore translation. Such hepadnavirus variants are less suitable for the herein provided methods.
In a preferred embodiment of the present invention, tagged HBeAg comprises or consists of an amino acid sequence as shown in SEQ ID NO: 22. The corresponding nucleic acid sequence encoding the tagged HBeAg is shown in SEQ ID NO: 20. These sequences are particularly useful in context of this invention but are merely examples of preferred embodiments.
A nucleic acid sequence encoding a HA-tagged precore protein, i.e. a precursor of the tagged HBeAg, is shown in SEQ ID NO: 19. Because this nucleic acid sequence encodes a precursor of the tagged HBeAg, it may be considered as a nucleic acid sequence encoding tagged HBeAg. The corresponding amino acid sequence is shown in SEQ ID NO: 21.
The following relates in more detail to the production of tagged hepadnavirus e antigen and the use thereof in the assessment of the capacity of a candidate molecule to inhibit cccDNA of a hepadnavirus.
The nucleic acid to be used/provided herein can be transcriptable into pregenomic (pg) hepadnavirus RNA, in particular pregenomic (pg) HBV RNA.
It is envisaged herein that the said nucleic acid can be designed to prevent the translation of the tagged hepadnavirus e antigen. For example, the nucleic acid does not contain a start codon ATG 5′ upstream of the nucleic acid encoding a tagged hepadnavirus e antigen. In relation to HBV, the start codon of the nucleic acid encoding the precore protein can be deleted or mutated. For example, such a start codon (that is to be deleted/mutated) can correspond to nucleotides at (and including) position 1816 to (and including) position 1818 of a HBV genome; see for example
Avoiding the translation of the tagged hepadnavirus e antigen can be advantageous, to avoid production/expression thereof at the start of the assay. It is the aim of the present invention that tagged hepadnavirus e antigen is used as a surrogate marker for cccDNA. If tagged hepadnavirus e antigen is produced all the time, its expression/production does not necessarily correlate with the production of cccDNA. As shown in
For example, a start codon ATG 5′ upstream of the nucleic acid encoding a tagged hepadnavirus e antigen as defined and described herein above can be replaced by the nucleic acids TG. Accordingly, the nucleic molecule to be used and provided herein can be modified e.g. by point mutation in order to prevent the translation of a tagged hepadnavirus e antigen.
Step (a) of the method to be used in accordance with the present invention, can further comprises a step (aa) that comprises culturing a cell comprising a nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen in conditions allowing
The restoration of conditions allowing the translation of the tagged hepadnavirus e antigen can relate to or be the restoration of the start codon as defined and explained above.
The nucleic acid molecule comprising a nucleic acid sequence encoding the tagged hepadnavirus e antigen can be comprised in a vector, in particular an expression vector.
The vector can, for example, comprise a sequence as shown in SEQ ID NO: 35.
The nucleic acid molecule comprising a nucleic acid sequence encoding the tagged hepadnavirus e antigen, preferably Hepatitis B virus e antigen (HBeAg), can be under control of an inducible promoter. (An) exemplary, non-limiting inducible promoter(s) to be used herein (is) are (a) tetracycline-inducible promoter(s), (a) doxycline-inducible promoter(s), (an) antibiotic-inducible promoter(s), (a) copper-inducible promoter(s), (an) alcohol-inducible promoter(s), (a) steroid-inducible promoter(s), or (a) herbicide-inducible promoter(s). The tetracycline inducible promoter (commercially available from e.g. Clontech) used in the herein provided experiments works in a tet-off manner. It is believed that a tetracycline inducible promoter working in a tet-on manner can likewise be used herein. tet-on/off system are, for example, available from Clontech and Invitrogen, either in plasmid or viral (retro-, adeno) backbones. Besides tetracycline/doxycline inducible promoter, as described above other inducible promoters that respond e.g. to antibiotics, copper, alcohol, steroids, or herbicides, among other compounds, are also suitable. For example, the inducible promoter is a CMV promoter. The inducible promoter can be a tet-EF-1 alpha promoter.
Further, one or more stop codons can be introduced into the coding region of one or more hepadnavirus envelope proteins, like one or more hepadnavirus envelope proteins is/are one or more HBV envelope proteins. The one or more hepadnavirus (HBV) envelope protein can be one or more of large surface protein (L), middle surface protein (M) and small surface protein (S). In one embodiment, the HBV envelope protein is small surface protein (S). (An) exemplary coding region(s) of the one or more HBV envelope proteins (is) are shown in SEQ ID NO: 36 (L), SEQ ID NO: 37 (M) and/or SEQ ID NO: 38 (S). In HBV nucleotides 217 to 222 (TTGTTG) of SEQ ID NO: 38 (S) can be mutated to e.g. TAGTAG to prevent the expression of envelope proteins.
A candidate molecule is determined to be capable of inhibiting cccDNA of a hepadnavirus, if the (expression) level of the surrogate marker of cccDNA, tagged hepadnavirus e antigen, is decreased compared to a control.
It is to be understood that the assessed (expression) level of a tagged hepadnavirus e antigen is compared to a control, like a standard or reference value, of the (expression) level of a tagged hepadnavirus e antigen. The control (standard/reference value) may be assessed in a cell, tissue, or non-human animal as defined herein, which has not been contacted with a candidate molecule. Alternatively, the control (standard/reference value) may be assessed in a cell, tissue, or non-human animal as defined herein prior to the above contacting step. The decrease in the (expression) level of a tagged hepadnavirus e antigen upon contacting with (a) candidate molecule(s) may also be compared to the decrease of the (expression) level of a tagged hepadnavirus e antigen induced by (a) routinely used reference compound(s), like a compound known to be unable to inhibit cccDNA. A skilled person is easily in the position to determine/assess whether the (expression) level of a tagged hepadnavirus e antigen is decreased.
Vice versa, and without deferring from the gist of the present invention, a positive control can be used, for example a reference compound(s), like a compound known to be capable of inhibiting cccDNA. If the (expression) level of the surrogate marker of cccDNA, tagged hepadnavirus e antigen, is equivalent to or even increased compared to such a (positive) control, a candidate molecule is determined to be capable of inhibiting cccDNA of a hepadnavirus.
In accordance with this invention, in particular the screening or identifying methods described herein, a cell, tissue or non-human animal to be contacted with a candidate molecule comprises a nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen as defined herein.
For example said cell, tissue or non-human animal can be capable of expressing a tagged hepadnavirus e antigen as defined herein. As explained herein, the capability of a candidate molecule to inhibit/antagonize cccDNA can, accordingly, be detected by measuring the expression level of such gene products, particular the protein expression level, of a nucleic acid sequence encoding a tagged hepadnavirus e antigen. A low(er) (protein) expression level (compared to a control (standard or reference value)) is indicative for the capacity of the candidate molecule to act as inhibitor/antagonist.
Due to the reduced transcript/expression level also the level of the translated gene product (i.e. the protein level) will be decreased. The (protein) level of the above described tagged hepadnavirus e antigen proteins typically correlates with the signal strength of a detectable signal associated with the tagged hepadnavirus e antigen proteins. Exemplary tagged hepadnavirus e antigen proteins comprise can comprise a reporter as described above (e.g. luciferase, (green/red) fluorescent protein and variants thereof, EGFP (enhanced green fluorescent protein), and the like).
Accordingly, a decrease in reporter signal upon contacting the cell/tissue/non-human animal with a candidate molecule will indicate that the candidate molecule is indeed a cccDNA inhibitor/antagonist and, thus, capable of inhibiting cccDNA. The candidate molecules which decrease the level of tagged hepadnavirus e antigen as defined herein above are selected out of the candidate molecules tested, wherein those molecules are preferably selected which strongly decrease the level of tagged hepadnavirus e antigen (reflected, for example, in a decrease in the reporter signal).
It is envisaged in the context of the present invention (in particular the screening/identifying methods disclosed herein) that also cellular extracts can be contacted (e.g. cellular extracts comprising a nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen as described and defined herein). For example, these cellular extracts may be obtained from the (transgenic/genetically engineered) cell(s), tissue(s) and/or non-human animal(s) to be used herein, in particular to be contacted with the candidate molecule.
The use of such cellular extracts is particular advantageous since it allows the assessment of the activity of a candidate molecule in vitro. The assessing/screening methods taking advantage of such (cellular) extracts can, for example, be used in prescreening candidate molecules, wherein the molecules selected in such a prescreen are then subject to subsequent screens, for example in the cell-based methods disclosed herein, in particular in methods wherein a (transgenic) cell(s), tissue(s) and/or non-human animal(s) are contacted with a candidate molecule. In this context, it is accordingly preferred that the candidate molecule has been selected in the in vitro pre-screening method, described herein above and below.
Thus, the term “cell” as used herein encompasses (transgenic/genetically engineered) cell(s), (transgenic/genetically engineered) tissue(s) and/or non-human (transgenic/genetically engineered) animal(s) and also cellular extracts derived therefrom.
It is to be understood that in a high throughput screening routinely, many (often thousands of candidate molecules) are screened simultaneously. Accordingly, in a (first) screen candidate molecules are selected, which decrease the level of tagged hepadnavirus e antigen.
Step (a) of the screening methods of the present invention, i.e. the “contacting step” may also be accomplished by adding a (biological) sample or composition containing said candidate molecule or a plurality of candidate molecules (i.e. various different candidate molecules) to the cell to be analyzed ((a) cell(s)/tissue(s)/non-human animal comprising a nucleic acid molecule comprising a nucleic acid sequence encoding tagged hepadnavirus e antigen).
Generally, the candidate molecule(s) or a composition comprising/containing the candidate molecule(s) may for example be added to a (transfected) cell, tissue or non-human animal comprising a nucleic acid molecule comprising a nucleic acid sequence encoding tagged hepadnavirus e antigen. As defined and disclosed herein, the term “comprising a nucleic acid molecule comprising a nucleic acid sequence encoding tagged hepadnavirus e antigen” implies the use of reporters. Also reporter constructs comprising a promoter and/or enhancer region of can be used herein.
The cell(s), tissue(s) and/or non-human animals to be used or provided in the present invention, in particular in context of the screening/identifying methods, can be stably or transiently transfected with nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen disclosed herein.
The compounds/molecules capable of inhibiting cccDNA (as reflected in a decreased level of tagged hepadnavirus e antigen), are expected to be beneficial as agents in pharmaceutical settings disclosed herein and to be used for medical purposes, in particular, in the treatment of the diseases related to hepadnaviruses, in particular chronic diseases related to hepadnaviruses, such as chronic hepatitis and in particular chronic hepatitis B.
Candidate molecules/compounds which may function as specific an “antagonist” or “inhibitor” of cccDNA of a hepadnavirus may be small binding molecules such as small (organic) compounds.
The term “small molecule” in the context of drug discovery is known in the art and relates to medical compounds having a molecular weight of less than 2,500 Daltons, preferably less than 1,000 Daltons, more preferably between 50 and 350 Daltons. (Small) binding molecules comprise natural as well as synthetic compounds. The term “compound” (or likewise “molecule”) in context of this invention comprises single substances or a plurality of substances. Said compounds/molecules may be comprised in, for example, samples, e.g., cell extracts from, e.g., plants, animals or microorganisms. Furthermore, said compound(s) may be known in the art but hitherto not known to be capable of (negatively) influencing cccDNA of a hepadnavirus. The plurality of compounds may be, e.g., added to a sample in vitro, to the culture medium or injected into the cell.
Candidate agents may also comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise carbocyclic or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
Exemplary classes of candidate agents may include heterocycles, peptides, saccharides, steroids, and the like. The compounds may be modified to enhance efficacy, stability, pharmaceutical compatibility, and the like. Structural identification of an agent may be used to identify, generate, or screen additional agents. For example, where peptide agents are identified, they may be modified in a variety of ways to enhance their stability, such as using an unnatural amino acid, such as a D-amino acid, particularly D-alanine, by functionalizing the amino or carboxylic terminus, e.g. for the amino group, acylation or alkylation, and for the carboxyl group, esterification or amidification, or the like. Other methods of stabilization may include encapsulation, for example, in liposomes, etc.
As mentioned above, candidate agents are also found among other biomolecules including amino acids, fatty acids, purines, pyrimidines, nucleic acids and derivatives, structural analogs or combinations thereof. Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
It is also envisaged in the present invention that compounds/molecules including, inter alia, peptides, proteins, nucleic acids (including cDNA expression libraries), small organic compounds, ligands, PNAs and the like can be assessed for the capacity to inhibit cccDNA. Said compounds can also be functional derivatives or analogues.
Methods for the preparation of chemical derivatives and analogues are well known to those skilled in the art and are described in, for example, Beilstein, “Handbook of Organic Chemistry”, Springer Edition New York, or in “Organic Synthesis”, Wiley. N.Y. Furthermore, said derivatives and analogues can be tested for their effects, i.e. their antagonistic effects on cccDNA in according with the present invention.
Furthermore, peptidomimetics and/or computer aided design of appropriate antagonists or inhibitors of cccDNA can be used. Appropriate computer systems for the computer aided design of, e.g., proteins and peptides are described in the art, for example, in Berry (1994) Biochem. Soc. Trans. 22:1033-1036; Wodak (1987), Ann. N. Y. Acad. Sci. 501:1-13; Pabo (1986), Biochemistry 25:5987-5991. The results obtained from the above-described computer analysis can be used in combination with the method of the invention for, e.g., optimizing known compounds, substances or molecules. Appropriate compounds can also be identified by the synthesis of peptidomimetic combinatorial libraries through successive chemical modification and testing the resulting compounds, e.g., according to the methods described herein. Methods for the generation and use of peptidomimetic combinatorial libraries are described in the prior art, for example in Ostresh (1996) Methods in Enzymology 267:220-234 and Dorner (1996) Bioorg. Med. Chem. 4:709-715. Furthermore, the three-dimensional and/or crystallographic structure of antagonists of cccDNA can be used for the design of (peptidomimetic) antagonists of cccDNA (Rose (1996) Biochemistry 35:12933-12944; Rutenber (1996) Bioorg. Med. Chem. 4:1545-1558).
The identification/assessment of candidate molecules which are capable of inhibiting cccDNA may be, inter alia, performed by transfecting an appropriate host with a nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen and contacting said host with (a) candidate molecule(s).
The cell(s)/host(s) to be used herein is(are) preferably (a) eukaryotic cell(s), in particular (a) eukaryotic cell(s) of hepatocyte origin. The eukaryotic cell(s) is(are) preferably (a) hepatoma cell(s) or (a) hepatic cell(s). The eukaryotic cell(s) may also be derived from (a) hepatoma cell(s) or (a) hepatic cell(s). A preferred cell to be used herein is eukaryotic cell HepG2 (ATCC #HB-8065). HepG2 cells are known to support functional HBV cccDNA formation and transcription. The use of other cells is envisaged herein, like hepatocyte-derived cells (e.g. Huh7). Also (a) non-hepatic cell(s)/host(s) may be used in accordance with the invention, provided that they support hepadnavirus cccDNA formation (or, in a wider sense, hapadnavirus DNA replication). For example, such (a) non-hepatic cell(s)/hosts(s) can be modified to support hepadnavirus cccDNA formation (or hepadnavirus DNA replication) if viral pregenomic RNA is introduced into the cells, or transcribed from the DNA template by an exogenous promoter. cccDNA transcription may work if liver specific transcription factors are transcomplemented in such nonhepatic cells. The nucleic acid molecule of the invention or the vector comprising same can be stably integrated in the genome of the cell(s).
The nucleic acid molecule to be used in accordance with the present invention (i.e. the nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen) or the vector comprising same preferably consists (essentially) of DNA.
The explanations given herein above in respect of “cells” also apply to and encompass tissues/non-human animals comprising or derived from these cells. A cell to be used herein may be comprised in a sample, for example, a biological, medical or pathological sample. For example, the use of fluids that comprise cells, tissues or cell cultures is envisaged. Such a fluid may be a body fluid or also excrements and may also be a culture sample. The body fluids may comprise but are not limited to blood, serum, plasma, urine, saliva, synovial fluid, spinal fluid, cerebrospinal fluid, tears, stool and the like.
Likewise, the candidate molecule(s) may be comprised in a (biological) sample or composition. The (plurality of) candidate molecule(s) are often subject to a first screen. The samples/compositions tested positive in the first screen can be subject to subsequent screens in order to verify the previous findings and to select the most potent inhibitors/antagonists. Upon multiple screening and selection rounds those candidate molecules can be selected which show a pronounced capacity to inhibit/antagonize cccDNA as defined and disclosed herein. For example, batches (i.e. compositions/samples) containing many candidate molecules will be rescreened and batches with no or insufficient inhibitory activity of candidate molecules be discarded without re-testing.
For example, if a (biological) sample or composition with many different candidate molecules is tested and one (biological) sample or composition is tested positive, then it is either possible in a second screening to screen, preferably after purification, the individual molecule(s) of the (biological) sample or composition. It may also be possible to screen subgroups of the (biological) sample or composition of the first screen in (a) subsequent screen(s). The screening of compositions with subgroups of those candidate molecules tested in previous screening rounds will thus narrow in on (an) potential potent cccDNA inhibitor(s). This may facilitate and accelerate the screening process in particular when a large number of molecules is screened. Accordingly, the cycle number of screening rounds is reduced compared to testing each and every individual candidate molecule in (a) first (and subsequent) screen(s) (which is, of course, also possible). Thus, depending on the complexity or the number of the candidate molecules, the steps of the screening method described herein can be performed several times until the (biological) sample or composition to be screened comprises a limited number, preferably only one substance which is indicative for the capacity of screened molecule to decrease the level of tagged hepadnavirus e antigen.
Herein envisaged is the use of optical measurement techniques that allow a resolution of e.g fluorescence on the level of single cells or single cells of a tissue, for example at the subcellular level. These techniques can involve fluorescence, for example confocal microscopy, digital image recording, like a CCD camera and suitable picture analysis software. For example, step (b) is carried out after the measurement of a standard response by performing a control experiment. For example, the level of tagged hepadnavirus e antigen is determined in a cell, tissue or a non-human animal comprising tagged hepadnavirus e antigen without contacting a candidate molecule in a first screen. In a second screen, after contacting the candidate molecule, the level of tagged hepadnavirus e antigen is measured/assessed. A difference in the level indicates whether the tested candidate molecule is indeed an antagonist/inhibitor of a cccDNA.
The level of tagged hepadnavirus e antigen can be quantified by measuring, for example, the level of gene products (particularly the protein level of tagged hepadnavirus e antigen) by any of the herein described methods, in particular protein measuring/detecting/assessing techniques.
For example, the expression can be determined on the protein level by taking advantage of immunoagglutination, immunoprecipitation (e.g. immunodiffusion, immunoelectrophoresis, immune fixation), western blotting techniques (e.g. (in situ) immunohistochemistry, (in situ) immunocytochemistry, affinity chromatography, enzyme immunoassays), and the like. Amounts of purified polypeptide in solution can be determined by physical methods, e.g. photometry. Methods of quantifying a particular polypeptide in a mixture rely on specific binding, e.g. of antibodies. Specific detection and quantitation methods exploiting the specificity of antibodies comprise for example immunohistochemistry (in situ). For example, concentration/amount of the level of tagged hepadnavirus e antigen proteins in a cell, tissue or a non-human animal can be determined by enzyme linked-immunosorbent assay (ELISA).
It is envisaged herein that assessing the level of the tagged hepadnavirus e antigen according to step (b) can be performed by ELISA, CLIA or AlphaLISA.
The herein provided methods take advantage of the use of established tags (like HA-tags, or His-tag, Flag-tag, c-myc-tag, V5-tag or C9-tag that can be used in the place of an HA-tag or in addition thereto). These tags can be used in the purification and detection of tagged hepadnavirus e antigen. By using antibodies specifically binding to the tag (e.g. via ELISA assays, like chemiluminescence ELISA (CLIA) and AlphaLISA), the level of tagged hepadnavirus e antigen can be reliably and rapidly assessed and cross-reactions with core protein be avoided.
Assessing the level of the tagged hepadnavirus e antigen according to step (b) of the herein provided method can comprise the use of an antibody specifically recognizing said hepadnavirus e antigen, preferably hepatitis B virus e antigen, (like, but not limited to Anti-HBe: clone 29, Lot 20110305, Autobio Diagnostics) and one or more antibodies specifically recognizing the one or more tags (like, but not limited to, Anti-HA: cat# A01244-100, Genscript).
The following antibodies specifically recognize hepatitis B virus e antigen and may be used in accordance with the present invention:
Alternatively, Western Blot analysis or immunohistochemical staining can be performed. Western blotting combines separation of a mixture of proteins by electrophoresis and specific detection with antibodies. Electrophoresis may be multi-dimensional such as 2D electrophoresis. Usually, polypeptides are separated in 2D electrophoresis by their apparent molecular weight along one dimension and by their isoelectric point along the other direction.
A skilled person is capable of determining the amount of polypeptides/proteins, in particular the gene products described herein above, by taking advantage of a correlation, preferably a linear correlation, between the intensity of a detection signal and the amount of, for example, polypeptides/proteins to be determined. Accordingly, the level of tagged hepadnavirus e antigen can be quantified based on the protein level of the tagged hepadnavirus e antigen. A skilled person is aware of standard methods to be used in determining the amount/concentration of the level of tagged hepadnavirus e antigen protein expression product in a sample or may deduce corresponding methods from standard textbooks (e.g. Sambrook, 2001).
A candidate molecule(s) is (are) selected, if the level of tagged hepadnavirus e antigen (or of a corresponding reporter signal) is strongly decreased, preferably is very low or non-dectable. For example, the level of tagged hepadnavirus e antigen (or of a corresponding reporter signal) may be decreased by at least 50%, 60%, 70%, 80%, more preferably by at least 90% compared to the (control) standard value.
Methods for transfecting cells or tissues are known in the art. Accordingly, calcium phosphate treatment or electroporation may be used for transfecting cells or tissues to express said reporter constructs (see Sambrook (2001), loc. cit.). Furthermore, nucleic acid molecules expressing said reporter constructs can be reconstituted into liposomes for delivery to target cells. As a further alternative, cells may be transduced to express specific reporter construct using genetically engineered viral vectors.
In another embodiment, the non-human animal comprising said reporter construct for detecting cccDNA inhibition is a transgenic non-human animal. The non-human organism to be used in the described screening assays can be selected from the group consisting of C. elegans, yeast, drosophila, zebrafish, guinea pig, rat and mouse. The generation of such a transgenic animal is within the skill of a skilled artisan. Corresponding techniques are, inter alia, described in “Current Protocols in Neuroscience” (2001), John Wiley&Sons, Chapter 3.16.
Accordingly, the invention also relates to a method for the generation of a non-human transgenic animal comprising the step of introducing a nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen as disclosed herein into an ES-cell or a germ cell. The non-human transgenic animal provided and described herein is particular useful in screening methods and pharmacological tests described herein above. The non-human transgenic animal described herein may be employed in drug screening assays as well as in scientific and medical studies wherein antagonists/inhibitors of cccDNA for the treatment of a disease associated with hepadnaviruses are tracked, selected and/or isolated.
The transgenic/genetically engineered cell(s), tissue(s), and/or non-human animals to be used in context of the present invention, in particular, the screening/identifying methods, comprise the herein described and defined nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen.
The present invention relates to the use of a cell, tissue or a non-human animal for screening and/or validation of a compound suspected of being an inhibitor of cccDNA of a hepadnavirus.
The term “transgenic non-human-animal”, “transgenic cell” or “transgenic tissue” as used herein refers to an non-human animal, tissue or cell, not being a human that comprises different genetic material of a corresponding wild-type animal, tissue or cell. The term “genetic material” in this context may be any kind of a nucleic acid molecule, or analogues thereof, for example a nucleic acid molecule, or analogues thereof as defined herein. The term “different” means that additional or fewer genetic material in comparison to the genome of the wild type animal or animal cell. An overview of different expression systems to be used for generating transgenic cell/animal refers for example to Methods in Enzymology 153 (1987), 385-516, in Bitter et al (Methods in Enzymology 153 (1987), 516-544) and in Sawers et al. (Applied Microbiology and Biotechnology 46 (1996), 1-9), Billman-Jacobe (Current Opinion in Biotechnology 7 (1996), 500-4), Hockney (Trends in Biotechnology 12 (1994), 456-463), Griffiths et al., (Methods in Molecular Biology 75 (1997), 427-440).
The present invention relates to a nucleic acid molecule as defined herein above, i.e. a nucleic acid molecule comprising a nucleic acid sequence encoding a tagged hepadnavirus e antigen. The explanations and definitions given herein above apply mutatis mutandis here. The hepadnavirus e antigen is preferably Hepatitis B virus e antigen (HBeAg).
The tagged hepadnavirus e antigen can contain only one tag. The tag can consist of 6 to 22 amino acids A typical and herein preferred (epitope) tag consists of 8, 9, 10 or 11 amino acids. 6×His is a minimal epitope tag that can be used herein. It is possible that an insertion of less than 6 amino acids may assemble into a new epitope together with the adjacent HBeAg amino acids, so that also such an insertion results in a tagged hepadnavirus. The tag can be a hemagglutinin (HA) tag, His-tag, Flag-tag, c-myc-tag, V5-tag or C9-tag. The Flag-tag can be a 1×Flag-tag or a 3×Flag-tag.
The tagged hepadnavirus e antigen can contain two or more tags. The two or more tags are preferably different tags. The entire length of said two or more tags can be from about 12 to about 31 amino acids. For example, the entire length of the two or more tags can be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 amino acids. The two or more tag can be two or more of a hemagglutinin (HA) tag, His-tag, Flag-tag, c-myc-tag, V5-tag and/or C9-tag. The Flag-tag can be a 1×Flag-tag or a 3×Flag-tag.
Exemplary nucleic acid sequences encoding the tag(s) are a nucleic acid sequence encoding the HA tag as shown in SEQ ID NO: 1, a nucleic acid sequence encoding the His-tag as shown in SEQ ID NO: 2, a nucleic acid sequence encoding the c-myc-tag as shown in SEQ ID NO: 4, a nucleic acid sequence encoding the V5-tag as shown in SEQ ID NO: 5, and/or a nucleic acid sequence encoding the C9-tag as shown in SEQ ID NO: 6.
Exemplary nucleic acid sequences encoding a Flag-tag are a nucleic acid sequence encoding the 1×Flag-tag as shown in SEQ ID NO: 3, or a nucleic acid sequence encoding the 3×Flag-tag as shown in SEQ ID NO: 7.
Exemplary amino acid sequences of the tag(s) are an amino acid sequence of the HA tag as shown in SEQ ID NO: 8, an amino acid sequence of the His-tag as shown in SEQ ID NO: 9, an amino acid sequence of the c-myc-tag as shown in SEQ ID NO: 11, an amino acid sequence of the V5-tag as shown in SEQ ID NO: 12, and/or an amino acid sequence of the C9-tag as shown in SEQ ID NO: 13.
Exemplary amino acid sequences of the Flag-tag are an amino acid sequence of the 1×Flag-tag as shown in SEQ ID NO: 10 or an amino acid sequence of the 3×Flag-tag as shown in SEQ ID NO: 14.
An exemplary nucleic acid sequence encoding the HBeAg is shown in SEQ ID NO: 16. An exemplary amino acid sequence of the HBeAg is shown in SEQ ID NO: 18.
The nucleic acid molecule can comprise a nucleic acid sequence encoding a hepadnavirus precore protein. An exemplary nucleic acid sequence encoding a hepadnavirus precore protein is shown in SEQ ID NO: 15. An exemplary amino acid sequence of the hepadnavirus precore protein is shown in SEQ ID NO: 17.
The nucleic acid molecule can comprise a nucleic acid sequence encoding the one or more tag, wherein said sequence is (inserted) 3′ downstream of the nucleic acid sequence encoding the N-terminal signal peptide and linker of the hepadnavirus precore protein.
The nucleic acid sequence encoding the one or more tag can be (inserted) 3′ downstream of the nucleic acid sequence encoding the N-terminal 29 amino acids of a hepatitis B virus precore protein.
The nucleic acid molecule can comprise a hepadnavirus genome. Preferably, the hepadnavirus genome is a Hepatitis B virus (HBV) genome. The HBV genome can be the genome of HBV genotype A, B, C, D, E, F, G or H. The HBV genome can be the genome of HBV genotype D. Preferably, the HBV genome is a genome of HBV genotype D, subgenotype ayw.
The nucleic acid encoding the one or more tag can be (inserted) 5′ upstream of the nucleic acid encoding a hepadnavirus core protein, preferably a HBV core protein. An exemplary nucleic acid sequence encoding a HBV core protein is shown in SEQ ID NO: 23. The core protein can be a HBV core protein. An exemplary amino acid sequence of a HBV core protein is shown in SEQ ID NO: 24.
The nucleic acid molecule comprising a sequence encoding the one or more tag can be inserted into the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome as defined herein. An exemplary nucleic acid sequence of the epsilon structure as encoded by a HBV genome is shown in SEQ ID NO: 25. The nucleic acid molecule comprising a sequence encoding the one or more tag can be inserted into the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome.
The nucleic acid molecule comprising a sequence encoding the one or more tag can be inserted between nucleotides corresponding to position C1902 and A1903 of the HBV genome.
The nucleic acid molecule can comprise 5′ of the sequence encoding the one or more tag a sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome. The sequence that is capable of forming base pairs with the lower stem of the epsilon structure of (or encoded by) a hepadnavirus genome, preferably HBV, is primarily capable of forming base pairs with nucleotides preferably corresponding to positions T1849 to A1854, or optionally, corresponding to positions Ti 849 to T1855 of the HBV genome. The sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus genome can consist of (up to) 9 nucleotides.
An exemplary sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome consists of the sequence shown in SEQ ID No. 26. An exemplary sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably a HBV genome, encodes a polypeptide as shown in SEQ ID NO. 40.
The nucleic acid molecule can comprise 3′ of the sequence encoding the one or more tag a sequence encoding a linker. The linker can consist of one or more amino acid residues. Preferably, the linker consists of only one amino acid residue, such as a glycine residue. The sequence encoding a linker can consist of the sequence GGC. The sequence encoding a linker can encode a glycine residue. The sequence encoding can be useful and appropriately selected to keep the authentic Kozak motif of core start codon.
The nucleic acid molecule can comprise a nucleic acid sequence encoding a tagged hepadnavirus e antigen that comprises a nucleic acid sequence as shown in SEQ ID NO. 41. The nucleic acid molecule can comprise a nucleic acid sequence encoding a tagged hepadnavirus e antigen comprises a nucleic acid sequence encoding an amino acid sequence as shown in SEQ ID NO. 42.
The one or more tag is preferably fused in frame in the hepadnavirus e antigen (or into the hepadnavirus e precore protein), preferably a Hepatitis B virus e antigen (HBeAg) (or into the Hepatitis B virus precore protein).
An exemplary nucleic acid sequence encoding the tagged HBeAg is shown in SEQ ID NO: 20. A preferred amino acid sequence of the tagged HBeAg is shown in SEQ ID NO: 22.
An exemplary nucleic acid sequence nucleic acid sequence encoding a tagged Hepatitis B virus precore protein is shown in SEQ ID NO: 19. An exemplary nucleic acid sequence amino acid sequence of the tagged Hepatitis B virus precore protein is shown in SEQ ID NO: 21.
Exemplary nucleic acid sequences of the HBV genome are shown in SEQ ID NO: 27, 28, 29, 30, 31, 32, 33 or 34.
The nucleic acid can be transcriptable into pregenomic (pg) hepadnavirus RNA. The hepadnavirus RNA is preferably HBV RNA.
The nucleic acid molecule comprising a nucleic acid sequence encoding the tagged hepadnavirus e antigen can be comprised in a vector, such as an expression vector. Preferably, the hepadnavirus e antigen is Hepatitis B virus e antigen (HBeAg).
The nucleic acid generally allows the translation of the tagged hepadnavirus e antigen, preferably Hepatitis B virus e antigen (HBeAg). The nucleic acid can be comprised in a vector that comprises a sequence as shown in SEQ ID NO: 39.
In certain embodiments the nucleic acid is designed to prevent the translation of the tagged hepadnavirus e antigen. For example, the nucleic acid does not contain a start codon ATG 5′ upstream of the nucleic acid encoding a tagged hepadnavirus e antigen. For example, a start codon ATG 5′ upstream of the nucleic acid encoding a tagged hepadnavirus e antigen can be replaced by the nucleic acids TG. The nucleic can be modified by point mutation in order to prevent the translation of a tagged hepadnavirus e antigen. The vector can comprise a sequence as shown in SEQ ID NO: 35.
The nucleic acid molecule comprising a nucleic acid sequence encoding the tagged hepadnavirus e antigen, preferably Hepatitis B virus e antigen (HBeAg), can be under control of an inducible promoter.
The inducible promoter can be a tetracycline-inducible promoter, a doxycline-inducible promoter, an antibiotic-inducible promoter, a copper-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, or a herbicide-inducible promoter.
The inducible promoter can preferably be a CMV promoter. The inducible promoter can be a tet-EF-1 alpha promoter.
One or more stop codons can be introduced into the coding region of one or more hepadnavirus envelope proteins, preferably one or more HBV envelope proteins.
The one or more HBV envelope protein can be one or more of L, M and/or S. The HBV envelope protein can be S.
Exemplary coding regions of (or exemplary nucleic acid sequences encoding) the one or more HBV envelope proteins is shown in SEQ ID NO: 36 (L), 37 (M) or 38 (S). The HBV nucleotides 217 to 222 (TTGTTG) of SEQ ID NO: 38 (S) can be mutated to TAGTAG to prevent the expression of envelope proteins.
The present invention relates to a protein encoded by the nucleic acid molecule as defined and provided herein above.
The protein comprises a tagged hepadnavirus e antigen, preferably a tagged Hepatitis B virus e antigen (HBeAg).
The Hepatitis B virus e antigen (HBeAg) can comprise an amino acid sequence as shown in SEQ ID NO: 18. Preferably, the tagged hepadnavirus e antigen contains only one tag.
The tag can consist of 6 to 22 amino acids. The tag can be hemagglutinin (HA) tag, His-tag, Flag-tag, c-myc-tag, V5-tag or C9-tag. The Flag-tag can be a 1×Flag-tag or a 3×Flag-tag.
The tagged hepadnavirus e antigen can contain two or more tags. Preferably the two or more tags are different tags. The entire length of said two or more tags is from about 14 to about 31 amino acids. The two or more tag can be two or more of a hemagglutinin (HA) tag, His-tag, Flag-tag, c-myc-tag, V5-tag and/or C9-tag. The Flag-tag can be a 1×Flag-tag or a 3×Flag-tag.
Exemplary nucleic acid sequences encoding a tag are a nucleic acid sequence encoding the HA tag as shown in SEQ ID NO: 1, a nucleic acid sequence encoding the His-tag as shown in SEQ ID NO: 2, a nucleic acid sequence encoding the c-myc-tag as shown in SEQ ID NO: 4, a nucleic acid sequence encoding the V5-tag as shown in SEQ ID NO: 5, and/or a nucleic acid sequence encoding the C9-tag as shown in SEQ ID NO: 6.
Exemplary nucleic acid sequences encoding a Flag-tag are a nucleic acid sequence encoding a 1×Flag-tag as shown in SEQ ID NO: 3 or a nucleic acid sequence encoding a 3×Flag-tag as shown in SEQ ID NO: 7.
Exemplary amino acid sequences of a tag are an amino acid sequence of the HA tag as shown in SEQ ID NO: 8, an amino acid sequence of the His-tag as shown in SEQ ID NO: 9, an amino acid sequence of the c-myc-tag as shown in SEQ ID NO: 11, an amino acid sequence of the V5-tag as shown in SEQ ID NO: 12; and/or an amino acid sequence of the C9-tag as shown in SEQ ID NO: 13.
Exemplary amino acid sequences of a Flag-tag are an amino acid sequence of the 1×Flag-tag as shown in SEQ ID NO: 10 or an amino acid sequence of the 3×Flag-tag as shown in SEQ ID NO: 14.
The protein can comprise a hepadnavirus precore protein. An exemplary nucleic acid sequence encoding a hepadnavirus precore protein is shown in SEQ ID NO: 15. An exemplary amino acid sequence of the hepadnavirus precore protein is shown in SEQ ID NO: 17.
The protein can comprise an amino acid sequence of the one or more tag, wherein said sequence is C-terminal of the amino acid sequence of the sequence of the signal peptide and of the linker of the hepadnavirus precore protein. The protein can comprise an amino acid sequence of the one or more tag C-terminal of the amino acid sequence of the N-terminal 29 amino acids of a hepatitis B virus precore protein.
The protein can comprise an amino acid sequence of the one or more tag, wherein said sequence is N-terminal of an amino acid sequence of a hepadnavirus core protein, preferably N-terminal of an amino acid sequence of a HBV core protein. An exemplary nucleic acid encoding a HBV core protein is shown in SEQ ID NO: 23. An exemplary amino acid sequence of a HBV core protein is shown in SEQ ID NO: 24.
The amino acid sequence of the one or more tag can be inserted into an amino acid sequence encoded by the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably an HBV genome. An exemplary nucleic acid sequence of the epsilon structure as encoded by an HBV genome is shown in SEQ ID NO: 25. The amino acid sequence of the one or more tag can be inserted into an amino acid sequence encoded by the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably an HBV genome, preferably into an amino acid sequence encoded by the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably an HBV genome.
The amino acid sequence of the one or more tag can be inserted between amino acid residues corresponding to position G29 and position M30 of a HBV precore protein, such as the one as shown in SEQ ID NO. 17.
The protein can further comprise N-terminal to the amino acid sequence of the one or more tag an amino acid sequence of (up to) 3 amino acids, wherein said amino acid sequence of up to 3 amino acids is encoded by a nucleic acid sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably an HBV genome. The nucleic sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably an HBV genome, is primarily capable of forming base pairs with nucleotides preferably corresponding to positions T1849 to T1855 or, optionally, corresponding to positions T1849 to T1855 of the HBV genome. An exemplary nucleic acid sequence that is capable of forming base pairs with the lower stem of the epsilon structure of a hepadnavirus pgRNA, preferably HBV pgRNA, or of an epsilon structure as encoded by a hepadnavirus genome, preferably an HBV genome, consists of the sequence shown in SEQ ID No. 26. An exemplary amino acid sequence of (up to) 3 amino acids is shown in SEQ ID NO. 40.
The protein can further comprise C-terminal to the amino acid sequence of the one or more tag a linker. The linker can consist of one or more amino acid residues. Preferably, the linker consists of only one amino acid residue, such as a glycine residue.
The amino acid sequence of a tagged hepadnavirus e antigen can comprise an amino acid sequence encoded by a nucleic acid sequence as shown in SEQ ID NO. 41. The amino acid sequence of a tagged hepadnavirus e antigen can comprise an amino acid sequence as shown in SEQ ID NO. 42.
The one or more tag is preferably fused in frame into the hepadnavirus e antigen, preferably an Hepatitis B virus e antigen (HBeAg).
An exemplary nucleic acid sequence encoding the tagged HBeAg is shown in SEQ ID NO: 20. Preferably, the tagged HBeAg has an amino acid sequence as shown in SEQ ID NO: 22.
An exemplary nucleic acid sequence encoding a tagged HBV precore protein is shown in SEQ ID NO: 19. An exemplary amino acid sequence of a tagged HBV precore protein is shown in SEQ ID NO: 21.
The present invention relates to a host cell comprising the nucleic acid molecule as defined and provided herein and/or to a host cell comprising or the protein as defined and provided herein. The host cell can be a eukaryotic cell. The eukaryotic cell can be of hepatocyte origin. The eukaryotic cell can be a hepatoma cell or can be derived from a hepatoma cell. In a preferred embodiment, the eukaryotic cell is HepG2 (ATCC #HB-8065).
The present invention relates to a process for the production of the protein as defined herein above, said process comprising culturing a host as defined herein above under conditions allowing the expression of the protein and recovering the produced protein from the culture.
The present invention relates to a kit for use in the method of the present invention. Likewise, the present invention relates to the use of a kit for screening candidate molecules suspected to be capable of inhibiting covalently closed circular DNA of hepadnavirus. The explanations provided herein above in relation to the method for assessing the capacity of a candidate molecule to inhibit cccDNA of a hepadnavirus apply mutatis mutandis here.
The kit can comprise an antibody specifically recognizing a hepadnavirus antigen e as defined herein and one or more antibodies specifically recognizing one or more tags as defined herein.
The kit (to be prepared in context) of this invention or the methods and uses of the invention may further comprise or be provided with (an) instruction manual(s). For example, said instruction manual(s) may guide the skilled person (how) to assess the capacity of a candidate molecule to inhibit cccDNA and/or how to assess the level of tagged hepadnavirus e antigen in accordance with the present invention. Particularly, said instruction manual(s) may comprise guidance to use or apply the herein provided methods or uses.
The kit (to be prepared in context) of this invention may further comprise substances/chemicals and/or equipment suitable/required for carrying out the methods and uses of this invention. For example, such substances/chemicals and/or equipment are solvents, diluents and/or buffers for stabilizing and/or storing (a) compound(s) required for specifically determining the (protein (expression)) level of said tagged hepadnavirus e antigen as defined herein.
The present invention relates to the use of the nucleic molecule as defined and provided herein, the protein as defined and provided herein and/or the host cell as defined and provided herein for screening candidate molecules suspected to be capable of inhibiting covalently closed circular DNA of hepadnavirus. The explanations provided herein above in relation to the method for assessing the capacity of a candidate molecule to inhibit cccDNA of a hepadnavirus apply mutatis mutandis here.
As used herein, the terms “comprising” and “including” or grammatical variants thereof are to be taken as specifying the stated features, integers, steps or components but do not preclude the addition of one or more additional features, integers, steps, components or groups thereof. This term encompasses the terms “consisting of” and “consisting essentially of.” Thus, the terms “comprising”/“including”/“having” mean that any further component (or likewise features, integers, steps and the like) can be present.
The term “consisting of” means that no further component (or likewise features, integers, steps and the like) can be present.
The term “consisting essentially of” or grammatical variants thereof when used herein are to be taken as specifying the stated features, integers, steps or components but do not preclude the addition of one or more additional features, integers, steps, components or groups thereof but only if the additional features, integers, steps, components or groups thereof do not materially alter the basic and novel characteristics of the claimed composition, device or method.
Thus, the term “consisting essentially of” means that specific further components (or likewise features, integers, steps and the like) can be present, namely those not materially affecting the essential characteristics of the composition, device or method. In other words, the term “consisting essentially of” (which can be interchangeably used herein with the term “comprising substantially”), allows the presence of other components in the composition, device or method in addition to the mandatory components (or likewise features, integers, steps and the like), provided that the essential characteristics of the device or method are not materially affected by the presence of other components.
The term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, biological and biophysical arts.
As used herein, the term “isolated” refers to a composition that has been removed from its in-vivo location. Preferably the isolated compositions or compounds of the present invention are substantially free from other substances (e.g., other proteins or other compounds) that are present in their in-vivo location (i.e. purified or semi-purified compositions or compounds.)
As used herein the term “about” refers to ±10%.
The present invention is further described by reference to the following non-limiting figures and examples.
Unless otherwise indicated, established methods of recombinant gene technology were used as described, for example, in Sambrook, Russell “Molecular Cloning, A Laboratory Manual”, Cold Spring Harbor Laboratory, N.Y. (2001) which is incorporated herein by reference in its entirety.
The following example illustrates the invention:
The Figures show:
The ORF of HBV precore protein (genotype D, subtype ayw, nt 1816-2454) is depicted with the 5′ portion (nt 1816-1941) shown in nucleotide sequence. The sequence between nt 1941 and the stop codon of precore ORF is omitted. The start codon of precore ORF, direct repeat sequence 1 (DR1), and in-frame start codon of core ORF are boxed. The start codon of 5′ end precore ORF is mutated (ATG to TG) in plasmid pTREHBV-HAe. The authentic pgRNA transcription initiation site (nt 1820) is marked with arrow. The HBV nucleotide position is according to Galibert nomenclature (5). A critical stem-loop structure (epsilon, e), which serves as essential cis-element in HBV pgRNA for subsequent DNA replication, is illustrated with predicted internal structures (lower stem, bulge, upper stem, loop). To place an in-frame fused HA-tag sequence into precore ORF without altering the base paring of epsilon, an HA-tag-containing DNA sequence
is inserted into an in-frame upstream position adjacent to the start codon of core ORF (see the insert box). The sequence modification results in an in-frame fusion of HA-tag plus linker sequences into precore protein, and the intact ORF of core protein is maintained at the downstream of epsilon.
(A) Intracellular expression of wildtype and HA-tagged precore. HepG2 cells were transfected with plasmid pcHBe or pcHA-HBe, 5 days later, whole cell lysates were subjected to western blot analysis by using anti-HBc (top panel) and anti-HA (middle panel) antibodies. β-actin served as loading control. Wildtype precore and HA-tagged precore (HA-precore) are labeled.
(B) Detection of HA-tagged HBeAg in culture fluid. HepG2 cells were mock transfected or transfected with plasmid pcHBe or pcHA-HBe, supernatant samples were collected at indicated time point and cells were harvested at day 5 post transfection. The supernatant samples were subjected to immunoprecipitation (IP) using anti-HA antibody and the HA-tagged HBeAg (HA-HBeAg) were detected by Western blot with antibody against HA. The light chain (LC) of antibody is indicated. The intracellular expression of HA-precore was revealed by HA Western blot.
The established HA-tagged HBeAg stable expression cell lines, specifically HepHA-HBe4 and HepHA-HBe47 cells, were seeded into collagen-coated 12-well plates at confluent condition. The day when cells were seeded was set as day 0, and media were replenished every other day. The supernatant samples were collected at indicated time point and HA-HBeAg was detected by AlphaLISA analysis as described in Materials and Methods. The AlphaLISA signals (relative light unit) (Y-axis) were plotted in correspondence to the time points (X-axis) in the histogram.
HepG2 cells were cotransfected with pTREHBVDES or pTREHBV-HAe and plasmid pTet-off. Cells were harvested 5 days post transfection, and plasmid-based production of HBV RNA, core protein, encapsidated pgRNA, and viral DNA replication were analyzed by Northern blot, Western blot, and Southern blot hybridization, respectively. pgRNA: pregenomic RNA; sRNA: surface RNA; RC: relaxed circular DNA; SS: single stranded DNA.
In pTREHBV-HAe and pTet-off stably transfected cells, the transgene contains a 1.1 overlength HBV genome under the control of tet-CMV promoter. The start codon (ATG) of precore was mutated at the 5′ end of HBV DNA, with the second one unchanged at the 3′ redundancy. The HA-tag-containing fragment (shown in gray) was inserted into the precore ORF as described in the Materials and Methods. The transgene also contains two tandem stop codons in the small surface (S) ORF to prevent viral envelope protein expression. (B) Upon the removal of Tet, pgRNA is transcribed and core and polymerase are produced, resulting in pgRNA packaging and (C) reverse transcription of pgRNA to rcDNA. DNA Repair mechanisms convert (D) rcDNA to (E) the circular cccDNA template, in which the HA-precore ORF is restored, giving rise to HA-precore mRNA, and (F) pgRNA for de novo viral replication. (G) HA-precore translation from HA-precore mRNA and process into secreted HA-HBeAg, which can be detected by ELISA. preC, C, pol, L, M, S and X represent ORF start codons for precore, core, polymerase, large, middle and small s antigen, and X protein, respectively. DR represents direct repeat sequences. CTD represents C-terminal domain.
HepBHAe13 cells were seeded in 6-well-plates in the presence of tetracycline. When cell monolayer became confluent, tetracycline was removed from the culture medium and medium was changed every other day. Cells and supernatant samples were harvested at indicated time points. Intracellular core DNA (upper panel) and cccDNA (bottom panel) were extracted and analyzed by Southern blot hybridization. DP-rc represents the deproteinized (protein-free) RC DNA. The secreted HA-tagged HBeAg was detected by HA IP-Western blot as described above.
HepDES19 cells and the newly established HepBHAe cells with different clone numbers were seeded in 6-well-plates at the same density in the presence of tetracycline. When cells reached confluent, one set of cells were cultured in the presence of tetracycline, and another set of cells were cultured in the absence of tetracycline. 6 days later, cells were harvested and viral core DNA was analyzed by Southern blot.
cccDNA produced in HepDES19 cells and the indicated HepBHAe cells were extracted by Hirt extraction and subjected to gel electrophoresis and Southern blot hybridization (lanes 1, 5, 8, 11, 14). To further validate the authenticity of HBV cccDNA, the Hirt DNA samples were heated to 85° C. for 5 min before gel loading, a condition that denatures DP-rcDNA into SS DNA, while the cccDNA stays undenatured and its electrophoretic mobility remains unchanged (lanes 2, 6, 9, 12, 15). The heat denatured DNA samples were further digested with EcoRI, in which condition the cccDNA is linearized to a genome-length double-stranded DNA (lanes 3, 7, 10, 13, 16).
HepBHAe cells were seeded in plates in the presence of tetracycline. When cells became confluent, tetracycline was removed from the culture medium and medium was changed every other day. Supernatant samples were harvested at indicated time point and subjected to AlphaLISA for HA-HBeAg detection. The AlphaLISA readouts (relative light unit, RLU) were expressed as counts per second (CPS).
HepBHAe13 cells were cultured in 6-well-plate in the presence of tetracycline until confluent. One set of cells was maintained continually in the presence of tetracycline. The second set of cells was then switched to tetracycline-free medium. The third set of cells was then cultured in tetracycline-free medium containing 10 μM 3TC. The culture medium was replenished every other day, and the harvested supernatant samples at indicated time points were subjected to chemiluminescence immunoassay (CLIA) for HA-tagged HBeAg.
The indicated HepBHAe cells were seeded in 6-well-plates in the presence of tetracycline. When cell monolayer became confluent, tetracycline was removed from the culture medium and medium was changed every other day. Cells were harvested at indicated time points. Total viral RNA (upper panel), cytoplamic core DNA (middle panel) were extracted and analyzed by Northern and Southern blot hybridization, respectively. The extracted cccDNA was heat denatured at 85° C. for 5 min and then linearized by EcoR I, followed by Southern blot analysis (bottom panel).
The selected HepBHAe cells were cultured in 96-well-plate in the presence of tetracycline until confluent. One set of cells was maintained continually in the presence of tetracycline. The second set of cells was then switched to tetracycline-free medium. The third set of cells was then cultured in tetracycline-free medium containing 10 μM 3TC. The culture medium was replenished every other day, and the harvested supernatant samples at day 9 post treatment were subjected to chemiluminescence immunoassay (CLIA) for HA-tagged HBeAg detection.
The Example illustrates the invention.
In order to construct a tetracycline-inducible HBV replicating vector which contains a Human influenza hemagglutinin (HA) fused precore open reading frame with its start codon knockout, a DNA fragment containing the TATA box motif of CMV-IE promoter and downstream HBV fragment (genotype D, subtype ayw, nt 1805-2335) with a deletion of nt 1816(A) and the insertion of HA-tag sequence in precore ORF was chemically synthesized by Genscript Inc. Within this DNA fragment, a SacI restriction enzyme site is present at the 5′ end and an authentic BspEI restriction site exists at the 3′ terminus. The vector pTREHBV-HAe was constructed through insertion of the synthesized DNA fragment into the SacI/BspEI restriction sites in plasmid pTREHBVDES. The complete sequence of pTREHBV-HAe is shown in SEQ ID NO. 35.
To generate the HA-fused precore expression vector, a PCR fragment containing HBV nt 1816-2335 with HA sequence insertion was amplified from pTREHBV-HAe by using primers 5′-ATTGGATCCACCATGCAACTTITTCACCTCTGC-3′ and 5′-ACAGTAGTTTCCGGAAGTGTTGATAGGATAGGGG-3′. The PCR fragment was restricted with BamHI and BspEI and inserted into the same restriction sites in precore expression vector (pcHBe) to yield plasmid pcHA-HBe. The complete sequence of pcHA-HBe is shown in SEQ ID NO. 39.
HepG2 cell (ATCC® HB-8065™), a hepatoblastoma cell line which supports HBV replication, was obtained from ATCC. HepG2-derived HepDES19 cell line that inducibly expressed HBV DNA and cccDNA has been described previously (7). Cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM)-F12 medium (Cellgro) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin.
To establish HepBHAe cell line, HepG2 cells were transfected with plasmid pTet-off (Clontech) that expresses the Tet-responsive transcriptional activator and plasmid pTREHBV-HAe, in which the transcription of modified HBV pgRNA is controlled by a CMV-IE promoter with tetracycline-responsive elements. Transfected HepG2 cells were selected with 500 μg/ml G418 in the presence of 1 μg/ml tetracycline. G418-resistant colonies were picked and expanded into cell lines. HBV replication was induced by culturing cells in tetracycline-free medium, and the levels of viral DNA replicative intermediates were determined by Southern blot hybridization. The cell line with high levels of HBV replication were chosen and designated as HepBHAe with different clone numbers.
The HA-tagged HBeAg stable expression cell line HepHA-HBe was generated by transfection of HepG2 cells with pcHA-HBe plasmid, colonies were selected with 500 μg/ml G418 and positive colonies were identified by anti-HA western blot analysis.
HepBHAe and HepHA-HBe stable cell lines were cultured in the same way as HepG2, except for the addition of G418 at 500 μg/ml. For HepBHAe cells, tetracycline was routinely added at 1 μg/ml during maintenance to suppress HBV pgRNA transcription.
Cells (˜1.0×106) were seeded in a collagen coated 35-mm-diameter dish in antibiotics-free DMEM/F12 medium. After overnight incubation, each well was transfected with a total of 4 μg plasmids with Lipofectamine 2000 (Life Technologies) by following the manufacturer's directions. Transfected cells or supernatant samples were harvested at the indicated time points.
Total cellular RNA was extracted with TRIzol reagent (Life Technologies) by following the manufacturer's protocols. Encapsidated viral pgRNA was purified as follows, cells from one 12-well plate well were lysed in 250 μl of lysis buffer containing 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1% NP-40, and 50 mM NaCl at 37° C. for 10 min and the nuclei were removed by centrifugation. The sample was incubated with 6 U of micrococcal nuclease and 15 μl of 100 mM CaCl2 and incubated for 15 min at 37° C. to digest free nucleic acids. Encapsidated viral pgRNA was extracted by the addition of 750 μl TRIzol LS reagent (Invitrogen) according to the manufacturer's protocols. RNA samples were electrophoresed through 1.5% agarose gel containing 2.2 M formaldehyde and transferred onto Hybond-XL membrane (GE Healthcare) in 20×SSC buffer (1×SSC is 0.15 M NaCl plus 0.015 M sodium citrate).
Cytoplasmic viral core DNA was extracted as follows, cells from one 35-mm diameter dish were lysed with 0.5 ml of lysis buffer containing 10 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% NP40 and 2% sucrose at 37° C. for 10 min. Cell debris and nuclei were removed by centrifugation, and supernatant was incubated with 3 μl of 1 M Mg(OAc)2 and 5 μl of 10 mg/ml DNase I (Calbiochem) for 30 min at 37° C. The supernatant was then mixed with 15 μl of 0.5 M EDTA and 130 μl of 35% polyethylene glycol (PEG) 8000 containing 1.5 M NaCl for nucleocapsids precipitation. After incubation on ice for 1 h, viral nucleocapsids were pelleted by centrifugation at 10,000 rpm for 5 min at 4° C., followed by digestion at 37° C. for 1 h in 400 μl of digestion buffer containing 0.5 mg/ml pronase (Calbiochem), 0.5% sodium dodecyl sulfate (SDS), 100 mM NaCl, 25 mM Tris-HCl (pH 7.4), and 10 mM EDTA. The digestion mixture was extracted with phenol, and DNA was precipitated with ethanol and dissolved in TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) buffer. One-third of the core DNA sample from each plate was resolved by electrophoresis into a 1.2% agarose gel. The gel was then subjected to depurination in a buffer containing 0.2N HCl, denaturation in a solution containing 0.5 M NaOH and 1.5 M NaCl, and neutralization in a buffer containing 1 M Tris-HCl (pH 7.4) and 1.5 M NaCl. DNA was then blotted onto Hybond-XL membrane in 20×SSC buffer.
Extraction of protein-free viral DNA (cccDNA and protein-free rcDNA) was carried out by using a modified Hirt extraction procedure (4, 8). Briefly, cells from one 35-mm diameter dish were lysed in 3 ml of 10 mM Tris-HCl (pH 7.5), 10 mM EDTA, and 0.7% SDS. After 30-min incubation at room temperature, the lysate was transferred into a 15-ml tube, and this step was followed by the addition of 0.8 ml of 5 M NaCl and incubation at 4° C. overnight. The lysate was then clarified by centrifugation at 10,000 rpm for 30 min at 4° C. and extracted twice with phenol and once with phenol:chloroform:isoamyl alcohol (25:24:1). DNA was precipitated in ethanol at room temperature for overnight and dissolved in TE buffer. One-third of the protein-free DNA sample was then resolved in a 1.2% agarose gel and transferred onto Hybond-XL membrane.
For the detection of HBV RNA and DNA, membranes were probed with a [α-32P]UTP (800 Ci/mmol; Perkin Elmer)-labeled plus- or minus-strand-specific full-length HBV riboprobe. Hybridization was carried out in 5 ml of EKONO hybridization buffer (Genotech) with prehybridization at 65° C. for 1 h and overnight hybridization at 65° C., followed by wash in 0.1×SSC and 0.1% SDS at 65° C. for 1 h. The membrane was exposed to a phosphorimager screen, and hybridization signals were detected by Typhoon FLA-7000 system (GE Healthcare).
Cells in 35 mm dish were washed once with PBS buffer and lysed in 500 μl of 1×Laemmli buffer. A total of 50 μl of the cell lysate was resolved on an SDS-12% polyacrylamide gel and transferred onto polyvinylidene difluoride membrane (Millipore). The membranes were blocked with Western Breeze blocking buffer (Life Technologies) and probed with antibodies against HBcAg (aa170-183), HA-tag (Sigma-Aldrich, clone M2), β-actin (Sigma-Aldrich). Bound antibodies were revealed by IRDye secondary antibodies. The immunoblot signals were visualized and quantified with the Li-COR Odyssey system.
Cells from one 35-mm diameter dish were lysed with 0.5 ml of lysis buffer containing 10 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% NP40, 2% sucrose and 1×protease inhibitor cocktails (G-biosciences). After centrifugation to remove the cell debris, the clarified cell lysates were incubated with 50 μl of Ezview Red Anti-HA (Sigma-Aldrich) at 4° C. for overnight with gentle rotation. 0.5 ml of medium sample from one 35-mm diameter dish (1 ml in total) was subjected to immunoprecipitation directly. The beads were washed with TBS buffer (0.15 M NaCl, 0.05 M Tris-HCl [pH 7.4]) for three times at 4° C. The pelleted beads were subjected to protein sample preparation with Laemmli buffer. Immunoprecipitated HA-tagged proteins were detected by Western blot using antibodies against HA-tag (Sigma-Aldrich).
For chemiluminescence enzyme immunoassay (CLIA) detection of HA-tagged HBeAg, high sensitivity streptavidin coated plate (Black, cat#: 15525, Thermo Scientific) was washed by PBST (PBS plus 0.05% Tween 20) for 3 times, and then incubated with 50 μl of anti-HA-biotin (cat#: A00203, Genscript; 5 μg/ml in PBS) at RT for 30 min, followed by wash with 200 μl PBST for 3 times. After removal of the wash buffer, 50 μl of culture supernatant samples was added in the ELISA wells and incubated at RT for 30 min, followed by wash with 200 μl PBST for 3 times. Then 50 μl of horseradish peroxidase (HRP)-conjugated anti-HBe antibodies (from HBeAg CLIA kit, cat#: CL0312-2, Autobio Diagnostics) was added in the well and incubated at RT for 30 min. After wash with 200 μl PBST for 5 times, 25 μl of each substrate A and B from the CLIA kit were added and the plate was gently shaken for 10 sec. The plate was read on a luminometer.
For AlphaLISA detection of HA-tagged HBeAg, anti-HA-biotin (cat#: A00203, Genscript) was diluted to 2 μg/ml in 1× assay buffer (25 mM HEPES, 0.1M NaCl, 0.1% BSA, pH7.4) and dispensed 5 μl into each wells of Proxiplate-384 HS (cat#: 6008279, Perkin Elmer). 5 μl of culture fluid samples was then added in wells and mixed gently, followed by incubation at RT for 30 min. Subsequently, 5 μl of 0.2 μg/ml anti-HBe (clone 29, Lot 20110305, Autobio Diagnostics) was added and gently mixed, followed by incubation at RT for 30 min. Then, the assay solution was mixed with 5 μl of diluted Anti-mouse IgG AlphaLISA acceptor beads (cat#: AL105C, Perkin Elmer) (125 pig/ml) and incubated at RT for 30 min, followed by incubation with 5 μl of AlphaScreen Streptavidin donor beads (cat#: 6760002S, Perkin Elmer) (125 μg/ml) at RT for 1 h. After incubation, the plate was read on Envision 2104 Multilabel reader (Perkin Elmer).
Herein provided are two types of novel cell lines for expressing HA-tagged HBeAg (HA-HBeAg) from transgene and HBV cccDNA, respectively, and methods for detecting the recombinant HBeAg by chemiluminescence immunoassay and AlphaLISA assay. The cell lines and assays are suitable for high throughput screen of compounds that reduce HBV cccDNA level and/or silence cccDNA transcription.
The small compact HBV DNA genome size and the overlapped genomic organization restrict the insertion of reporter genes without affecting viral DNA replication and subsequent cccDNA formation in transfected cells.
Precore/HBeAg can be engineered into cccDNA-dependent manner in HepDE19 cells (3). In the art it is known that HBV genome has a highly compact gene organization which exhibits overlapped ORFs and multiple cis elements. Therefore, it was believed that gene insertion/deletion or sequence replacement would very likely affect viral DNA replication. Previous works have replaced HBV sequence, such as envelope coding region in most cases, by GFP to make recombinant HBV genome, but trans-complement of viral proteins was needed to support viral replication and virion assembly (Protzer, et al, PNAS (1999), 96: 10818-23.). Moreover, those reported recombinant HBV genome can only make first round cccDNA synthesis if used to infect permissive cells, intracellular amplification of cccDNA is blocked due to the defective viral DNA replication.
Despite the above prior art knowledge, it was attempted and reasoned herein that an in-frame fused short exogenous epitope tag in precore open reading frame (ORF) could be tolerated by HBV genome and expressed from cccDNA template, thus a pair of tag-specific antibody and HBeAg antibody would significantly improve the specificity of ELISA detection.
In order to construct a tetracycline-inducible HBV replicating vector with a Human influenza hemagglutinin (HA) fused precore open reading frame, an HA-tag-containing DNA sequence
was inserted into an in-frame upstream position adjacent to the start codon of core ORF in HBV expression vector pTREHBVDES, in which the HBV pgRNA expression is governed by a tetracycline (tet) regulated CMV-IE promoter in a Tet-off manner. The flanking sequences (in lower case) of HA-tag (in upper case) were designed to maintain the base pairing of the stem loop structure (epsilon, e) of HBV genome and the Kozak motif of core ORF start codon (
To test the feasibility of epitope-tagged HBV precore protein expression and HBeAg secretion, the HA-tag-containing DNA sequence was inserted into the same viral DNA position, as described above, in precore expression plasmid pcHBe and the construct was designated pcHA-HBe (SEQ ID NO: 39). Transfection of pcHA-HBe in HepG2 cells led to the intracellular expression of HA-tagged precore protein and extracellular accumulation of HA-tagged HBeAg (
In accordance with the above, a cell line that constitutively expresses HA-tagged HBeAg was established by stably transfecting pcHA-HBe into HepG2 cells. Two clones with the high levels of HA-tagged HBeAg expression were selected through AlphaLISA assay, and were designated HepHA-HBe4 and HepHA-HBe47, respectively (
The recombinant HBV plasmid pTREHBV-HAe was able to replicate HBV DNA to a comparable level as pTREHBVDES did in the transient transfection assay (
We have obtained 5 cell lines (HepBHAe1, HepBHAe13, HepBHAe34, HepBHAe45, HepBHAe82) that support high level of HBV DNA replication in a tetracycline-dependent fashion (
In the representative line HepBHAe13 cells, time-dependent kinetics of the synthesis and accumulation of viral products, including the replicative DNA intermediates and cccDNA, were observed upon tetracycline withdrawal. In the culture fluid of HepBHAe13 cells, the HA-tagged HBeAg was also detected by Western blot at day 6 after the removal of tetracycline and the antigen level gradually increased afterward. The level of HA-tagged HBeAg (HA-HBeAg) was proportional to the intracellular level of viral core DNA and cccDNA (
AlphaLISA assay on the supernatant samples from cultured HepBHAe cells demonstrated the increased levels of HA-tagged HBeAg in a 16-day time course study (
In addition, time course study of other HepBHAe cell lines, including HepBHAe1, HepBHAe45, and HepBHAe82, demonstrated a time-dependent accumulation of HBV mRNA, cytoplasmic core DNA, and nuclear cccDNA upon withdrawal of tetracycline (
Taken together, herein novel inducible cell lines have been established that express HBV cccDNA-dependent HA-tagged HBeAg, which can serve as a surrogate marker for HBV cccDNA in antiviral compound screen with the HA-HBeAg detection methods described herein.
The present invention refers to the following nucleotide and amino acid sequences:
The sequences provided herein are available in the NCBI database and can be retrieved from world wide web at ncbi.nlm.nih.gov/sites/entrez?db=gene; Theses sequences also relate to annotated and modified sequences. The present invention also provides techniques and methods wherein homologous sequences, and variants of the concise sequences provided herein are used. Preferably, such “variants” are genetic variants.
AGATTACGCTGGCATGGACATCGACCCTTATAAAGAATTTGGAGCTACTGTGGAG
AGATTACGCTGGCATGGACATCGACCCTTATAAAGAATTTGGAGCTACTGTGGAG
G
GACA
GTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATC
GACCCTTATAAAGAATTTGGAGCTACTGTGGAGTTACTCTCGTTTTTGGCTTCTGAC
TTCTTTCCTTCAGTACGAGATCTTCTAGATACCGCCTCAGCTCTGTATCGGGAAGCC
TTAGAGTCTCCTGAGCATTGTTCACCTCACCATACTGCACTCAGGCAAGCAATTCT
TTGCTGGGGGGAACTAATGACTCTAGCTACCTGGGTGGGTGTTAATTTGGAAGATC
CAGCATCTAGAGACCTAGTAGTCAGTTATGTCAACACTAATATGGGCCTAAAGTTC
AGGGAACTCTTGTGGTTTGAGATTTCTTGTCTCACTTTTGGAAGAGAAACCGTTATA
GAGTATTTGGTGTCTTTCGGAGTGTGGATTCGCACTCCTCCAGCTTATAGACCACC
AAATGCCCCTATCCTATCAACACTTCCGGAAACTACTGTTGTTAGACGACGAGGCA
GGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCG
TCGCAGAAGATCTCAATCTCGGGAACCTCAATGTTAGTATTCCTTGGACTCATAAG
All references cited herein are fully incorporated by reference. Having now fully described the invention, it will be understood by a person skilled in the art that the invention may be practiced within a wide and equivalent range of conditions, parameters and the like, without affecting the spirit or scope of the invention or any embodiment thereof.
In accordance with the above and as also laid down in the appended claims, the present invention relates in particular to the following items:
This invention was made with government support under Contract No. R01AI094474 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62014996 | Jun 2014 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 15309680 | Nov 2016 | US |
| Child | 15981316 | US |
