Patent Application
20230149554
The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Sep. 27, 2022, is named U120270107US01-SEQ-JDH and is 10,591 bytes in size.
RNA is involved with a myriad of cellular roles beyond merely encoding and assembling proteins. The Encyclopedia of DNA Elements project and subsequent analyses showed that only 1-2% of our genome encodes for protein yet about 80% of it is transcribed into RNA (ENCODE, 2012). Although the majority of transcribed RNAs are non-coding, many non-coding RNAs are functionally involved in modulating cell activities and disease states.
The development of therapeutics that target RNA has mostly centered on using oligonucleotides. RNA is most commonly targeted with antisense oligonucleotide-based modalities (ASOs), a strategy developed in the late 1970's by Paul Zamecnik and co-workers.1,2 Since this landmark discovery, much activity in the area has shown that RNA biology can be affected by simple binding of the ASO or by recruiting endogenous RNase H to cleave the RNA strand in the RNA-DNA hybrid.3 RNA interference (RNAi) has also emerged as an important oligonucleotide-based approach that targets an RNA for destruction; that is triggering RNA degradation is RNAi's only mode of action.4 Both ASOs and RNAi have achieved success in the clinic as FDA-approved medicines.5 CRISPR-based strategies to target RNA are rapidly emerging and have potential to impact how diseases are treated.6
Each oligonucleotide-based approach recognizes RNA via sequence, and various studies have shown that unstructured regions are their ideal target sites.7 Approximately 50% of nucleotides in an RNA target are unstructured or non-canonically paired, leaving approximately half of its sequence unavailable for targeting purposes.8 Further, structured regions have been shown to regulate RNA function and processing9 and many directly mediate disease biology. Thus, a complement to the sequence-based recognition of oligonucleotides is structure-based recognition by using organic ligands.10 Indeed, various studies have shown that RNA can be targeted with structure-binding small molecules, compounds that can decipher biology and can be developed into preclinical candidates.11-13 A strategy for the sequence-based design of structure-specific ligands, named Inforna, has been developed for RNA targets.14,15 This approach has been deployed successfully to rescue phenotypes associated with various diseases, to exploit known biology, to provide chemical probes to understand novel RNA biology,16 and to develop lead medicines.17-20
It is therefore an object to develop structure specific ligands that target RNA structure modalities associated with cellular abnormalities, in particular oncogenic abnormalities. A further object is the development of ligands that target structure specific sites of RNA such as the Dicer processing sites. Yet another object is the development of ligands targeting such sites in the pri miR-17-92 cluster.
These and other objects are achieved through ligand targeting of the primary microRNA-17-92 (pri-miR-17-92) cluster which contains six microRNAs (miRNAs) that collectively act in several disease settings. Accordingly, the invention is directed to a sequence-based design of structure-specific ligands to target a common structure in the Dicer processing sites of certain pri-miRNA's and pre-miRNA's including one or more of pre-miR-17, pre-miR-18a, pre-19a, pre-19b-1, pre-miR-20a, pre-miR-92a and/or mixtures thereof. Among these embodiments of the invention are exemplary developments directed to a series of ligands which bind certain of the miRNAs of the cluster. More specifically, the exemplary developments are directed to the targeting of one or more of at least three pre-miRNAs whether embedded within the primary cluster transcript, which in preferred embodiments are pre-miRNA-Xs selected from one or more of pre-miR-17, pre-miR-18a and pre-miR-20a and/or mixtures thereof.1 The targeting binds the pri- and/or pre miRNA-x's through the targeting of the common structure of the Dicer processing sites of these miRNA-X's. The mature miRNA's are not targeted or bound. Thus, the targeting enables inhibition of the biogenesis of the miRNA-X's of the cluster as well as inhibiting individual pre-miRNAs. These structure-specific ligands are also imbued with substituents providing the ability to cleave the pri-miR-17-92, and/or pre-miR-17, pre-miR-18a, and pre-miR-20a and mixtures thereof, whether directly or through nuclease recruitment. 1In this specification, the notations miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1 in the context of targeting and binding by embodiments of the binding compound according to the invention mean the pre-miRNA-X's and/or their embedment within the pri-miRNA complex and not the mature miRNA's resulting from cytoplasmic Dicer ribonuclease cleavage of the pre-miRNA's to yield mature miRNA's as short (20-24 nucleotide) non-coding miRNA's.
Thus, embodiments of the invention are directed to methods for targeting the above identified pri-miRNA cluster and pre-miRNA-X's including one or more of the pri-miR-17-92 cluster and pre-miRNA-X's including one or more of pre-miR-17, pre-miR-18a, and/or pre-miR-20a and/or mixtures thereof. According to the invention, embodiments of the methods for targeting enable the compound embodiments including Compound 1D, Compound 2, Compound 5, Compound 4FL and Compound 7, the structures of which are set forth in the following paragraphs, and any combination thereof to bind with the corresponding pre-miRNA-X's as well as mixtures thereof and pri-miR-17-92. In addition, the compound embodiment, Compound 1D, constitutes an agent or instrument to enable determination of appropriate ligand binding, the most potent of which is Compound 2. Preferably, the binding is selective so that Compounds 1D, 2, 5, 4FL and 7 do not bind with pre-miRNA's or pri-miRNA's that are not one or more of the pre-miRNA-X's or pri-miR17-92.
Embodiments of the invention are also directed to methods for targeting the pri-miR-17-92 and pre-miRNA-Xs at cellular level including such cell lines as TNBC breast cancer cell line, the MDA-MD-231 breast cancer cell line, the DU-145 prostate cancer cell line, and the WT 9-12 polycystic kidney cell line. The targeting is accomplished with the compounds disclosed in the following paragraphs. The targeting enables Compound 1D, Compound 2, Compound 5, Compound 4FL and Compound 7 to bind with the pri-miR17-92, one or more of the pre-miRNA-X's, or mixtures thereof. The binding demonstrates a very low dissociation constant Kd and selectivity. Based on the selectivity and binding capability of these compounds, their inhibitory effects upon ordinary, non-oncogenic cells such as normal human cells and cell lines are believed to be sufficiently minimal so that such non-oncogenic cells do not succumb as a result of toxicity and/or apoptosis.
Embodiments of the invention are also directed to methods for treatment of MDA-MD-231 breast cancer cells, TNBC breast cancer cells, DU-145 prostate cancer cells, or WT 9-12 polycystic kidney cells present in a host such as a laboratory animal or present as the corresponding disease in a human. The treatment enables Compound 2, Compound 5 and/or Compound 7 and any combination thereof to bind with the pre-miRNA-Xs and/or the pri-miR-17-92 of the cells. According to the invention, the binding inhibits the oncogenic and cystic formation capabilities of the pri-miR-17-92 and/or pre-miRNA-Xs. The inhibition accordingly retards and/or inhibits invasion, apoptosis, or cyst formation correspondingly.
Embodiments of the invention directed to targeting of oncogenic cell lines with Compound 2, Compound 5 and/or Compound 7 and/or any combination thereof also enable a decrease or diminishment of the invasive characteristic of TNBC cell lines, anti-apoptotic characteristic of prostate cancer cells, and the cyst formation characteristic of cystic kidney cells. The first two aspects dampen and/or inhibit oncogenic seed cell transfer from an ongoing oncogenic cell site to a new site within a host having the oncogenic cells.
Embodiments of the invention as well target the pri-miR-17-92 cluster with compound 2, compound 5 and/or compound 7. The targeting enables Compound 2, 5 and/or 7 and/or any combination thereof to bind with the pri-miR-17-92 cluster and inhibit, retard and/or repress the oncogenic and cyst formation activity of this cluster.
Yet another embodiment of the invention is directed to methods for treatment of breast cancer, prostate cancer and/or polycystic kidney disease in humans by administration of an effective dose of Compound 2, Compound 5 and/or Compound 7 and/or any combination thereof alone or as a pharmaceutical composition in which the selected compound is combined with a pharmaceutically acceptable carrier.
Compositional embodiments of the invention are directed to dimeric moiety peptidylmimetic compounds that are capable of targeting and binding one or more of the pri-miR-17-92 or pre-miRNA-X's including one or more of the three above identified pre-miRNA's and/or their mixture embedded in the cluster. A sequence-based design known as the lead identification strategy, Inforna, enabled development of these compositional embodiments. The Inforna strategy is disclosed in Velagapudi, S. P.; Gallo, S. M.; Disney, M. D., Sequence-based design of bioactive small molecules that target precursor microRNAs. Nat. Chem. Biol. 2014, 10 (4), 291-7 and Disney, M. D.; Winkelsas, A. M.; Velagapudi, S. P.; Southern, M.; Fallahi, M.; Childs-Disney, J. L., Inforna 2.0: a platform for the sequence-based design of small molecules targeting structured RNAs. ACS Chem. Biol. 2016, 11 (6), 1720-8.
In particular, the Inforna technology enabled development of compound embodiments such as Compound 1D based upon the precursor active compound, Compound 1. For the depiction of compound 1D with subscript n, n is 0 or an integer of 1 to 7 (e.g., n=0-7).
Compound 1D is a spaced dimer of Compound 1 in which the azido group of Compound 1 is coupled with an alkynyl group of the peptoid 1P by click chemistry to form a triazole ring which joins compound 1 to the peptoid 1P.
The inforna technology also enabled optimization of compound 1D to produce dimeric molecule, compound 2, that binds the Dicer processing site and an adjacent bulge, affording a 100-fold increase in potency over the investigatory compound, compound 1. Compound 2 has two forms: an amide at the tag binding site and a carboxylic acid at the tag binding site.
Further embodiments of the invention are directed to extension of the dimer Compound 2 mode of action from simple binding to a direct cleavage moiety by conjugation at the tag binding site to bleomycin A5 to yield Compound 5. The embodiment incorporating compound 5 imparts RNA-selective cleavage.
Additional embodiment extensions are directed to extension of the dimer Compound 2 by conjugation at the tag binding site to a RNase L recruiter to yield Compound 7. Compound 7 initiates indirect cleavage by recruiting an endogenous nuclease, or a ribonuclease targeting chimera (RIBOTAC).
The foregoing Compounds may be formulated as pharmaceutically acceptable salts, typically using a pharmaceutically acceptable acid. The Compounds alone or as pharmaceutically acceptable salts may also be combined with a pharmaceutically acceptable carrier to produce a Pharmaceutical Composition. The Compounds and/or salts alone and/or as Pharmaceutical Compositions may be used in the foregoing methods to target as set forth above.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art.
The term “about” as used herein, when referring to a numerical value or range, allows for a degree of variability in the value or range, for example, within 10%, or within 5% of a stated value or of a stated limit of a range.
All percent compositions are given as weight-percentages, unless otherwise stated.
All average molecular weights of polymers are weight-average molecular weights, unless otherwise specified.
The term “may” in the context of this application means “is permitted to” or “is able to” and is a synonym for the term “can.” The term “may” as used herein does not mean possibility or chance.
The term “and/or” in the context of this application means either one alone as well as both together, for example a substance including A and/or B means a substance including A alone, a substance including B alone and a substance including A and B together. Any one of the three choices standing alone may be made as well as any combination such as A alone as well as A and B together or B alone as well as A and B together or A alone, B alone and A and B together (e.g., all three choices).
It is also to be understood that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise, and the letter “s” following a noun designates both the plural and singular forms of that noun. In addition, where features or aspects of the invention are described in terms of Markush groups, it is intended, and those skilled in the art will recognize, that the invention embraces and is also thereby described in terms of any individual member and any subgroup of members of the Markush group, and the right is reserved to revise the application or claims to refer specifically to any individual member or any subgroup of members of the Markush group.
The expression “effective amount”, when used to describe therapy to an individual suffering from a disorder, refers to the amount of a drug, pharmaceutical agent or compound of the invention that will elicit the biological or medical response of a cell, tissue, system, animal or human that is being sought, for instance, by a researcher or clinician. Such responses include but are not limited to amelioration, inhibition or other action on a disorder, malcondition, disease, infection or other issue with or in the individual's tissues wherein the disorder, malcondition, disease and the like is active, wherein such inhibition or other action occurs to an extent sufficient to produce a beneficial therapeutic effect. Furthermore, the term “therapeutically effective amount” means any amount which, as compared to a corresponding subject who has not received such amount, results in improved treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder. The term also includes within its scope amounts effective to enhance normal physiological function.
“Substantially” as the term is used herein means completely or almost completely; for example, a composition that is “substantially free” of a component either has none of the component or contains such a trace amount that any relevant functional property of the composition is unaffected by the presence of the trace amount, or a compound is “substantially pure” is there are only negligible traces of impurities present.
“Treating” or “treatment” within the meaning herein refers to an alleviation of symptoms associated with a disorder or disease, or inhibition of further progression or worsening of those symptoms, or prevention or prophylaxis of the disease or disorder, or curing the disease or disorder.
Similarly, as used herein, an “effective amount” or a “therapeutically effective amount” of a compound of the invention refers to an amount of the compound that alleviates, in whole or in part, symptoms associated with the disorder or condition, or halts or slows further progression or worsening of those symptoms, or prevents or provides prophylaxis for the disorder or condition. In particular, a “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount is also one in which any toxic or detrimental effects of compounds of the invention are outweighed by the therapeutically beneficial effects.
Phrases such as “under conditions suitable to provide” or “under conditions sufficient to yield” or the like, in the context of methods of synthesis, as used herein refers to reaction conditions, such as time, temperature, solvent, reactant concentrations, and the like, that are within ordinary skill for an experimenter to vary, that provide a useful quantity or yield of a reaction product. It is not necessary that the desired reaction product be the only reaction product or that the starting materials be entirely consumed, provided the desired reaction product can be isolated or otherwise further used.
By “chemically feasible” is meant a bonding arrangement or a compound where the generally understood rules of organic structure are not violated; for example a structure within a definition of a claim that would contain in certain situations a pentavalent carbon atom that would not exist in nature would be understood to not be within the claim. The structures disclosed herein, in all of their embodiments are intended to include only “chemically feasible” structures, and any recited structures that are not chemically feasible, for example in a structure shown with variable atoms or groups, are not intended to be disclosed or claimed herein.
An “analog” of a chemical structure, as the term is used herein, refers to a chemical structure that preserves substantial similarity with the parent structure, although it may not be readily derived synthetically from the parent structure. A related chemical structure that is readily derived synthetically from a parent chemical structure is referred to as a “derivative.” In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. For example, if X is described as selected from the group consisting of bromine, chlorine, and iodine, claims for X being bromine and claims for X being bromine and chlorine are fully described. Moreover, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any combination of individual members or subgroups of members of Markush groups. Thus, for example, if X is described as selected from the group consisting of bromine, chlorine, and iodine, and Y is described as selected from the group consisting of methyl, ethyl, and propyl, claims for X being bromine and Y being methyl are fully described.
If a value of a variable that is necessarily an integer, e.g., the number of carbon atoms in an alkyl group or the number of substituents on a ring, is described as a range, e.g., 0-4, what is meant is that the value can be any integer between 0 and 4 inclusive, i.e., 0, 1, 2, 3, or 4.
In various embodiments, the compound or set of compounds, such as are used in the inventive methods, can be any one of any of the combinations and/or sub-combinations of the above-listed embodiments.
In various embodiments, a compound as shown in any of the Examples, or among the exemplary compounds, is provided. Provisos may apply to any of the disclosed categories or embodiments wherein any one or more of the other above disclosed embodiments or species may be excluded from such categories or embodiments.
At various places in the present specification substituents of compounds of the invention are disclosed in groups or in ranges. It is specifically intended that the invention include each and every individual subcombination of the members of such groups and ranges. For example, the term “C1-C6 alkyl” is specifically intended to individually disclose methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, etc. For a number qualified by the term “about”, a variance of 2%, 5%, 10% or even 20% is within the ambit of the qualified number. Standard abbreviations for chemical groups such as are well known in the art are used; e.g., Me=methyl, Et=ethyl, i-Pr=isopropyl, Bu=butyl, t-Bu=tert-butyl, Ph=phenyl, Bn=benzyl, Ac=acetyl, Bz=benzoyl, and the like.
A “salt” as is well known in the art includes an organic compound such as a carboxylic acid, a sulfonic acid, or an amine, in ionic form, in combination with a counterion. For example, acids in their anionic form can form salts with cations such as metal cations, for example sodium, potassium, and the like; with ammonium salts such as NH4+ or the cations of various amines, including tetraalkyl ammonium salts such as tetramethylammonium, or other cations such as trimethylsulfonium, and the like. A “pharmaceutically acceptable” or “pharmacologically acceptable” salt is a salt formed from an ion that has been approved for human consumption and is generally non-toxic, such as a chloride salt or a sodium salt. A “zwitterion” is an internal salt such as can be formed in a molecule that has at least two ionizable groups, one forming an anion and the other a cation, which serve to balance each other. For example, amino acids such as glycine can exist in a zwitterionic form. A “zwitterion” is a salt within the meaning herein. The compounds of the present invention may take the form of salts. The term “salts” embraces addition salts of free acids or free bases which are compounds of the invention. Salts can be “pharmaceutically-acceptable salts.” The term “pharmaceutically-acceptable salt” refers to salts which possess toxicity profiles within a range that affords utility in pharmaceutical applications. Pharmaceutically unacceptable salts may nonetheless possess properties such as high crystallinity, which have utility in the practice of the present invention, such as for example utility in process of synthesis, purification or formulation of compounds of the invention.
Suitable pharmaceutically acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid. Examples of inorganic acids include hydrochloric, hydrobromic, hydriodic, nitric, carbonic, sulfuric, and phosphoric acids. Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, trifluoromethanesulfonic, 2-hydroxyethanesulfonic, p-toluenesulfonic, sulfanilic, cyclohexylaminosulfonic, stearic, alginic, β-hydroxybutyric, salicylic, galactaric and galacturonic acid. Examples of pharmaceutically unacceptable acid addition salts include, for example, perchlorates and tetrafluoroborates. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, laurylsulphonate salts, and amino acid salts, and the like. (See, for example, Berge et al. (1977) “Pharmaceutical Salts”, J. Pharm. Sci. 66: 1-19.)
Suitable pharmaceutically acceptable base addition salts of compounds of the invention include, for example, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N,N′-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. Examples of pharmaceutically unacceptable base addition salts include lithium salts and cyanate salts. Although pharmaceutically unacceptable salts are not generally useful as medicaments, such salts may be useful, for example as intermediates in the synthesis of Formula (I) compounds, for example in their purification by recrystallization. All of these salts may be prepared by conventional means from the corresponding compound according to Formula (I) by reacting, for example, the appropriate acid or base with the compound according to Formula (I). The term “pharmaceutically acceptable salts” refers to nontoxic inorganic or organic acid and/or base addition salts, see, for example, Lit et al., Salt Selection for Basic Drugs (1986), Int J. Pharm., 33, 201-217, incorporated by reference herein.
Each of the terms “halogen,” “halide,” and “halo” refers to —F, —Cl, —Br, or —I.
The term “azide” or “azido” can be used interchangeably and refers to an —N3 group (—N═N═N) which is bound to a carbon atom and is zwitterionic (carries a + and − charge respectively on the middle nitrogen and the terminal nitrogen). The azide group is a reactant in “click chemistry” which is a copper catalyzed azide-alkyne 1,3 dipolar cycloaddition (Sharpless et al., Angewandte Chemie, 41, 2596 et seq. (2002).
A “hydroxyl” or “hydroxy” refers to an —OH group.
Compounds described herein can exist in various isomeric forms, including configurational, geometric, and conformational isomers, including, for example, cis- or trans-conformations. The compounds may also exist in one or more tautomeric forms, including both single tautomers and mixtures of tautomers. The term “isomer” is intended to encompass all isomeric forms of a compound of this disclosure, including tautomeric forms of the compound. The compounds of the present disclosure may also exist in open-chain or cyclized forms. In some cases, one or more of the cyclized forms may result from the loss of water. The specific composition of the open-chain and cyclized forms may be dependent on how the compound is isolated, stored or administered. For example, the compound may exist primarily in an open-chained form under acidic conditions but cyclize under neutral conditions. All forms are included in the disclosure.
Some compounds described herein can have asymmetric centers and therefore exist in different enantiomeric and diastereomeric forms. A compound of the invention can be in the form of an optical isomer or a diastereomer. Accordingly, the disclosure encompasses compounds and their uses as described herein in the form of their optical isomers, diastereoisomers and mixtures thereof, including a racemic mixture. Optical isomers of the compounds of the disclosure can be obtained by known techniques such as asymmetric synthesis, chiral chromatography, simulated moving bed technology or via chemical separation of stereoisomers through the employment of optically active resolving agents.
Unless otherwise indicated, the term “stereoisomer” means one stereoisomer of a compound that is substantially free of other stereoisomers of that compound. Thus, a stereomerically pure compound having one chiral center will be substantially free of the opposite enantiomer of the compound. A stereomerically pure compound having two chiral centers will be substantially free of other diastereomers of the compound. A typical stereomerically pure compound comprises greater than about 80% by weight of one stereoisomer of the compound and less than about 20% by weight of other stereoisomers of the compound, for example greater than about 90% by weight of one stereoisomer of the compound and less than about 10% by weight of the other stereoisomers of the compound, or greater than about 95% by weight of one stereoisomer of the compound and less than about 5% by weight of the other stereoisomers of the compound, or greater than about 97% by weight of one stereoisomer of the compound and less than about 3% by weight of the other stereoisomers of the compound, or greater than about 99% by weight of one stereoisomer of the compound and less than about 1% by weight of the other stereoisomers of the compound. The stereoisomer as described above can be viewed as composition comprising two stereoisomers that are present in their respective weight percentages described herein.
If there is a discrepancy between a depicted structure and a name given to that structure, then the depicted structure controls. Additionally, if the stereochemistry of a structure or a portion of a structure is not indicated with, for example, bold or dashed lines, the structure or portion of the structure is to be interpreted as encompassing all stereoisomers of it. In some cases, however, where more than one chiral center exists, the structures and names may be represented as single enantiomers to help describe the relative stereochemistry. Those skilled in the art of organic synthesis will know if the compounds are prepared as single enantiomers from the methods used to prepare them.
As used herein, and unless otherwise specified, the term “compound” is inclusive in that it encompasses a compound or a pharmaceutically acceptable salt, stereoisomer, and/or tautomer thereof. Thus, for instance, a compound of Formula I includes a pharmaceutically acceptable salt of a tautomer of the compound.
The terms “prevent,” “preventing,” and “prevention” refer to the prevention of the onset, recurrence, or spread of the disease in a patient resulting from the administration of a prophylactic or therapeutic agent.
A “patient” or “subject” includes an animal, such as a human, cow, horse, sheep, lamb, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit or guinea pig. In accordance with some embodiments, the animal is a mammal such as a non-primate and a primate (e.g., monkey and human). In one embodiment, a patient is a human, such as a human infant, child, adolescent or adult.
The term miRNA means a micro RNA sequence that is non-coding for peptides and functions at least for mRNA silencing and post-translational regulation of gene expression. Complementary base pairing of miRNA with messenger RNA molecules manages translation of the mRNA by up and/or down regulation, inhibition, repression and similar translation effects. Typical pre- and pri-miRNA sequences include structured and unstructured motifs. A structured motif is a segment of a pre-miRNA and its embedment within a pri-miRNA having a stable three-dimensional structure that is not wholly dependent upon the particular nucleotide sequence of the structure motif. Hairpin stem, bulge and/or terminal loop regions of pre-miRNA's are typical structured motifs. Groups of miRNAs often cooperate to manage mRNA function. An example is the pri-miRNA-17-92 cluster and the resulting pre-miRNA's and mature miRNA's produced by nuclease action on the cluster and pre-miRNA's respectively.
The terms pri-miRNA and pre-miRNA are the precursor RNA transcripts from which mature miRNA is produced. Transcription of DNA in the cell nucleus produces among other RNA molecules, pri-miRNA, a long RNA sequence which is capped and polyadenylated. Cleavage of the pri-miRNA and RNA chain processing in the nucleus produces the shorter pre-miRNA for export to the cellular cytoplasm. Pre-miRNA is further processed in the cytoplasm by RNAase Dicer to produce double stranded short RNA and one of the two strands becomes mature, single strand miRNA for interaction with messenger RNA.
The lead binding molecular strategy known as Inforna (cited above) was used to design a ligand that targets the primary microRNA-17-92 cluster (pri-miR-17-92), a direct transcriptional target of c-MYC.21 This non-coding RNA encodes six different microRNAs (miRNAs): miR-17, -18a, -19a, -19b-1, -20a, and -92a-1. Upregulation of the miR-17-92 cluster has been observed in numerous diseases, from various cancers22-25 to fibrosis.26 Furthermore, the downstream effects are disease-dependent and linked to which members of the cluster are aberrantly expressed.27 Indeed, the miRNAs produced can act individually or synergistically to affect multiple pathways.21,28 Thus, this cluster and the pre-miRNAs that comprise it are important targets of chemical probes and lead medicines.
The Inforna sequence-based design approach afforded a single compound (compound 2) that inhibits the biogenesis of three mature miRNAs (miRNA-X's) from the pre-miRNA's embedded in the pri-miRNA-17-92 cluster that share structural similarities, pre-miR-17, pre-miR-18a, and pre-miR-20a. Extension strategies enable a change the compound's mode of action from simple binding to cleavage provided two cleavage strategies: (i) direct, oxidative cleavage and ii) cleavage by recruitment of endogeneous nuclease or a ribonuclease targeting chimera. The first strategy was accomplished by conjugation of bleomycin A5 to the lead compound 2, to produce compound 5. Targeting the pre-miRNA-X's with compound 5 improved potency by ˜10-fold. Compound 5 also degraded the entire pre-miR-17-92 cluster and hence rescued miR-17-92-mediated phenotypes in prostate and triple negative breast cancer (TNBC) cells. The second strategy was accomplished by conjugation of compound 2 with a recruiting moiety for an endogenous nuclease, or a ribonuclease targeting chimera (RIBOTAC). Interestingly, the RIBOTAC inhibited biogenesis of miR-17, -18a, and -20a by binding and cleaving their pre-miRNAs, not the entire cluster, traced to the co-localization of the RIBOTAC, targets, and the endogenous nuclease.
Since the discovery of the miR-17-92 cluster,29 its role in disease has become increasingly apparent and diverse. Upregulation of the miR-17-92 cluster is associated with more than 14 different cancers,27 including osteosarcomas,23,30 and retinoblastoma.22,31 Elevated levels of one member of the cluster, miR-92a, inhibits angiogenesis in ischemic cardiovascular endothelia,32 while its upregulation in CD4+ T cells stimulates an autoimmune response.33 Consequently, the miR-17-92 cluster is a high priority target for therapeutic intervention. Efforts focused on designing compounds that inhibit the biogenesis of the miR-17-92 cluster by inspecting the structures found at the Drosha and Dicer processing sites of each encoded pre-miRNA. It was previously shown that binding these functional sites inhibits pre-miRNA processing in situ and in vivo.3,15,17,18,34,35 Fortuitously, three pre-miRNAs in the pre-miR-17-92 cluster have the same U bulge (5′G_U/3′CUA) in their Dicer sites, pre-miR-17, pre-miR-18a, and pre-miR-20a (
A previous study that explored the RNA-binding capacity of various ligands showed that compound 12 (
To identify an optimal dimer that displays the RNA-binding modules that most potently targets the pre-miRNAs, the library was screened for activity in a cell-based luciferase reporter assay. It is known that peroxisome proliferator-activated receptor alpha (PPAR-α) mRNA is translationally repressed by miR-17.39 Thus, a construct with luciferase fused to PPAR-α's 3′ untranslated region (UTR)39 was used to assess inhibition of miR-17 biogenesis in HEK293T cells (
As 2 showed optimal activity amongst the dimers, it was further characterized in vitro and in situ. The affinity of 2 for a model RNA was measured wherein the model contains the two bulges in and adjacent to pre-miR-17's and pre-miR-20a's Dicer site. A 250-fold boost in affinity relative to 1 was observed, affording a Kd of 120(±20) nM (
Since 2 bound model constructs of pre-miR-17, pre-miR-18a, and pre-miR-20a with similar affinity, its ability to inhibit Dicer processing of all three pre-miRNAs in vitro was studied. As expected, 2 inhibited Dicer processing of each to a similar extent, with an IC50 of ˜1 M (
In the TNBC cell line MDA-MB-231, miR-17 and miR-20a are highly expressed and together silence zinc finger and BTB domain containing 4 (ZBTB4) mRNA, thereby triggering an invasive phenotype (
Compound 2 has a significant effect on pri-miR-17-92, pre-miR-17, and pre-miR-20a levels. Depending on its cellular localization, 2 could engage the pri-miRNA or the pre-miRNAs to reduce mature miRNA levels. It is known that the 17-92 cluster folds into a compact tertiary structure, and that alterations in this structure affects the processing of the pri-miR-17-92 transcript.41,42 Although 2 localized mainly to the cytoplasm, fluorescence was also detected in the nucleus, suggesting that it could inhibit processing of the pri-miRNA as well as pre-miR-17, -18a, and 20a (
If 2 only engaged pri-miR-17-92 and inhibited its biogenesis, then a decrease in pre-miRNA levels is expected. If, however, 2 directly binds and inhibits processing of both the pri- and pre-transcripts, two outcomes are possible: (i) no change in pre-miRNA levels are observed. That is, the reduction in pre-miRNA levels due to inhibition of pri-miRNA processing and the boost in pre-miRNA levels due to inhibition of Dicer processing are similar and thus cancel each other out; or (ii) an increase in pre-miRNA levels is observed because Dicer processing is inhibited to a greater extent than Drosha processing. In accordance with the last possibility and its presence in the cytoplasm (
Compound 2 also has an effect on miR-17 and -20a's downstream target ZBTB4.24 Indeed, 2 increased Zbtb4 mRNA levels by 1.4(±0.2)-fold at 500 nM (p<0.05) (
Autosomal dominant polycystic kidney disease is the most common genetically-defined kidney disease, ultimately leading to renal failure.39 Recent studies have shown that miR-17, -19a, -19b-1, and -20a from the miR-17-92 cluster are upregulated in cystic kidneys, which in turn repress PPAR-α and aggravate cyst growth (
The pri-miR-17-92 cluster, particularly by the overexpression of miR-18a, promotes prostate cancer.45 Consequently it is expected that compound 2 will exhibit an inhibitory effect on the biogenesis of the miR-17-92 cluster in the prostate cancer cell line DU-145. As expected, based on its in vitro binding affinity and activity, application of 2 inhibited the biogenesis of miR-17, -18a, and -20a biogenesis, decreasing mature miRNA levels of each (
Consistent with studies in MDA-MB-231 TNBC cells, 2 increased levels of pri-miR-17-92 by 51(±6)% and pre-miR-18a by 23(±0.05)% (
In DU-145 cells, miR-18a translationally represses serine/threonine-protein kinase 4 (STK4).45 A previous study showed that an antagomir directed against miR-18a increased STK4 protein levels and triggered apoptosis via STK4-mediated dephosphorylation of protein kinase B [also known as AKT serine/threonine kinase (AKT)]. Treatment of DU-145 cells with 2 increased levels of Stk4 mRNA by 22(±7)% (
To confirm that 2 triggered apoptosis by the miR-18a-STK4 circuit, we (i) overexpressed pri-miR-17-92 via a plasmid and (ii) knocked down STK4 via an shRNA. As expected, both overexpression of the cluster and knock down of its downstream target (STK4) reduced 2's ability to trigger apoptosis (
Collectively, these studies show that 2's inhibition of the processing of three pre-miRNAs derived from the pri-miR-17-92 de-represses their downstream targets to alleviate oncogenic phenotypes in two different cellular models of disease, prostate cancer and breast cancer. Compound 2 also shows promising activity in an ADPKD model and will be the subject of further investigation.
A previously developed method named Chemical Cross-Linking and Isolation by Pull-down (Chem-CLIP) was used to assess the direct target engagement of 2 (
DU-145 cells were treated with 500 nM of 3, followed by isolation of 3-RNA adducts. A 2.4-fold enrichment of pri-miR-17-92 was observed, as compared to its levels in the lysate prior to pull-down, while no significant enrichment was observed for cells treated with 4 (
Based on cellular localization, RT-qPCR, and Chem-CLIP analyses, 2 inhibited the biogenesis of only those miRNAs that it bound, namely miR-17, miR-18a, and miR-20a. Since all members of the miR-17-92 cluster are implicated in disease, it would be desirable to have a compound that inhibits generation of all mature miRNAs in the cluster (
Compound 5 was assessed for its ability to cleave pre-miR-17 in vitro. As expected, based on our in vitro binding and Dicer processing studies (
Compound 5 was delivered to MDA-MB-231 cells to assess its ability to cleave both pri-miR-17-92 and its cognate pre-miRNAs. Notably, cellular localization studies showed that 5 can be found throughout the cells, with enhanced fluorescence observed in the perinuclear space (
Reduction of miR-17-92 levels de-repressed both ZBTB4 mRNA and protein, by 36(±16)% and 62(±11)%, respectively, (500 nM of 5;
To assess 5's selectivity, miRNAs were identified that contain the same motifs as those targeted by 2 in the miR-17-92 cluster and those predicted by Inforna to bind 2 [dubbed RNA isoforms (n=30); Table 2 with identifier SEQ ID NO:'s]. All 30 miRNAs only contain a single binding site for 1, four of which are located in a Dicer site and one in a Drosha site (Table 2). Treatment of 5, did not affect the levels of any of these miRNA isoforms, underscoring 5's selectivity for the cluster (
Treatment of DU-145 cells with 5 decreased the levels of pri-miR-17-92 dose-dependently, with significant cleavage observed with as little as 10 nM of compound. No change in pri-miR-17-92 levels were observed with control compound 6 up to the highest concentration tested (500 nM), indicating selective cleavage of the cluster by 5 (
The effect of the 5 on the levels of miR-18a's downstream target (STK4) in DU-145 cells and on phenotype was also assessed. Indeed, application of 5 (500 nM) increased levels of Stk4 mRNA by 19(±4)% (
Similar to the studies completed for 2 (
To assess the selectivity of 5 cleavage on the miRNome, the levels of all expressed miRNAs in DU-145 cells (n=373) were measured upon treatment with 500 nM of 5 by RT-qPCR. As shown in
Next, it was assessed whether 5 has selective effects on the proteome. Global proteomics analysis showed that only 9/3730 (0.24%) proteins were significantly affected by 5 treatment (
Design and Evaluation of a Pri-miR-17-92 Cluster and Pre-miR-17-, miR-18a-, and miR-20a-Targeting RIBOTAC.
An alternative strategy was developed to target members of the miR-17-92 cluster for destruction by recruiting an endogenous nuclease via a ribonuclease targeting chimera (RIBOTAC).3,57,58 A RIBOTAC comprises an RNA-binding small molecule, in this case 2, conjugated to an RNase L-recruiting module, in this case a recently discovered heterocycle, affording RIBOTAC 7 (
Therefore, a study was conducted to determine whether the pri-miRNA, pre-miRNAs, or both are targeted for degradation by RIBOTAC 7. Interestingly, fluorescence microscopy showed that 7 was dispersed throughout the cell, but notably in the cytoplasm where the pre-miRNA targets and RNase L also reside (
To study if this is indeed the case, the levels were measured for mature miRNAs, pre-miRNAs, and the primary transcript of the 17/92 cluster in MDA-MB-231 TNBC cells upon treatment with 7. Indeed, 7 reduced the levels of mature miR-17, miR-18a, and miR-20a dose dependently, with no effect on the levels of the other three mature miRNAs in the cluster (
In certain embodiments, the invention is directed to methods of inhibiting, suppressing, derepressing and/or managing biolevels of the miRNA-X's, pre-miRNA-X's (X being a designator for group of specific numbers of the miRNA's encompassed according to the invention such as miR-17 and miR-20a), and/or the corresponding pri-miR-17-92 cluster, pre-miR-17, pre-miR-18a and/or pre-miR-20a and/or any mixture thereof as well as these RNA entities present in oncologic cell lines and in animals and humans having such oncologic cells and present in polycystic cell lines and in animals and humans have polycystic disease. The Compounds 1, 1D, 2, 5, and/or 7 as embodiments of the invention for use in the methods disclosed herein bind to the above identified RNA entities as well in the above identified cell lines, animals and humans.
Embodiments of the Compounds applied in methods of the invention and their pharmaceutical compositions are capable of acting as “inhibitors”, suppressors and or modulators of the above identified RNA entities which means that they are capable of blocking, suppressing or reducing the expression of the RNA entities. An inhibitor can act with competitive, uncompetitive, or noncompetitive inhibition. An inhibitor can bind reversibly or irreversibly.
The compounds useful for methods of the invention and their pharmaceutical compositions function as therapeutic agents in that they are capable of preventing, ameliorating, modifying and/or affecting a disorder or condition. The characterization of such compounds as therapeutic agents means that, in a statistical sample, the compounds reduce the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the severity of one or more symptoms of the disorder or condition relative to the untreated control sample.
The ability to prevent, ameliorate, modify and/or affect in relation to a condition, such as a local recurrence (e.g., pain), a disease known as a polycystic disease including but not limited to polycystic kidney disease or an oncologic disease such as but not limited to breast cancer and/or prostate cancer or any other neoplastic and/or oncologic disease or condition, especially having etiology similar to breast and/or prostate cancer may be accomplished according to the embodiments of the methods of the invention and includes administration of a composition as described above which reduces, or delays or inhibits or retards the oncologic medical condition in a subject relative to a subject which does not receive the composition.
The compounds of the invention and their pharmaceutical compositions are capable of functioning prophylactically and/or therapeutically and include administration to the host/patient of one or more of the subject compositions. If it is administered prior to clinical manifestation of the unwanted condition (e.g., disease or other unwanted state of the host animal/patient) then the treatment is prophylactic, (i.e., it protects the host against developing the unwanted condition), whereas if it is administered after manifestation of the unwanted condition, the treatment is therapeutic, (i.e. it is intended to diminish, ameliorate, or stabilize the existing unwanted condition or side effects thereof).
The compounds of the invention and their pharmaceutical compositions are capable of prophylactic and/or therapeutic treatments. If a compound or pharmaceutical composition is administered prior to clinical manifestation of the unwanted condition (e.g., disease or other unwanted state of the host animal) then the treatment is prophylactic, (i.e., it protects the host against developing the unwanted condition), whereas if it is administered after manifestation of the unwanted condition, the treatment is therapeutic, (i.e., it is intended to diminish, ameliorate, or stabilize the existing unwanted condition or side effects thereof). As used herein, the term “treating” or “treatment” includes reversing, reducing, or arresting the symptoms, clinical signs, and underlying pathology of a condition in manner to improve or stabilize a subject's condition.
The compounds of the invention and their pharmaceutical compositions can be administered in “therapeutically effective amounts” with respect to the subject method of treatment. The therapeutically effective amount is an amount of the compound(s) in a pharmaceutical composition which, when administered as part of a desired dosage regimen (to a mammal, preferably a human) alleviates a symptom, ameliorates a condition, or slows the onset of disease conditions according to clinically acceptable standards for the disorder or condition to be treated, e.g., at a reasonable benefit/risk ratio applicable to any medical treatment.
Compounds of the invention and their pharmaceutical compositions prepared as described herein can be administered according to the methods described herein through use of various forms, depending on the disorder to be treated and the age, condition, and body weight of the patient, as is well known in the art. As is consistent, recommended and required by medical authorities and the governmental registration authority for pharmaceuticals, administration is ultimately provided under the guidance and prescription of an attending physician whose wisdom, experience and knowledge control patient treatment.
For example, where the compounds are to be administered orally, they may be formulated as tablets, capsules, granules, powders, or syrups; or for parenteral administration, they may be formulated as injections (intravenous, intramuscular, or subcutaneous), drop infusion preparations, or suppositories. For application by the ophthalmic mucous membrane route or other similar transmucosal route, they may be formulated as drops or ointments.
These formulations for administration orally or by a transmucosal route can be prepared by conventional means, and if desired, the active ingredient may be mixed with any conventional additive or excipient, such as a binder, a disintegrating agent, a lubricant, a corrigent, a solubilizing agent, a suspension aid, an emulsifying agent, a coating agent, a cyclodextrin, and/or a buffer. Although the dosage will vary depending on the symptoms, age and body weight of the patient, the gender of the patient, the nature and severity of the disorder to be treated or prevented, the route of administration and the form of the drug, in general, a daily dosage of from 0.0001 to 2000 mg, preferably 0.001 to 1000 mg, more preferably 0.001 to 500 mg, especially more preferably 0.001 to 250 mg, most preferably 0.001 to 150 mg of the compound is recommended for an adult human patient, and this may be administered in a single dose or in divided doses. Alternatively, a daily dose can be given according to body weight such as 1 nanogram/kg (ng/kg) to 200 mg/kg, preferably 10 ng/kg to 100 mg/kg, more preferably 10 ng/kg to 10 mg/kg, most preferably 10 ng/kg to 1 mg/kg. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect.
The precise time of administration and/or amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given patient will depend upon the activity, pharmacokinetics, and bioavailability of a particular compound, physiological condition of the patient (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), route of administration, etc. However, the above guidelines can be used as the basis for fine-tuning the treatment, e.g., determining the optimum time and/or amount of administration, which will require no more than routine experimentation consisting of monitoring the subject and adjusting the dosage and/or timing.
The phrase “pharmaceutically acceptable” is employed herein to refer to those excipients, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The pharmaceutical compositions of the invention incorporate embodiments of Compounds 1, 1D, 2, 5 and/or 7 useful for methods of the invention and a pharmaceutically acceptable carrier. The compositions and their pharmaceutical compositions can be administered orally, topically, parenterally, by inhalation or spray or rectally in dosage unit formulations. The term parenteral is described in detail below. The nature of the pharmaceutical carrier and the dose of these Compounds depend upon the route of administration chosen, the effective dose for such a route and the wisdom and experience of the attending physician.
A “pharmaceutically acceptable carrier” is a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch, potato starch, and substituted or unsubstituted (3-cyclodextrin; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
Wetting agents, emulsifiers, and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring, and perfuming agents, preservatives and antioxidants can also be present in the compositions. Examples of pharmaceutically acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
Formulations suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert matrix, such as gelatin and glycerin, or sucrose and acacia) and/or as mouthwashes, and the like, each containing a predetermined amount of a compound of the invention as an active ingredient. A composition may also be administered as a bolus, electuary, or paste.
In solid dosage form for oral administration (capsules, tablets, pills, dragees, powders, granules, and the like), a compound of the invention is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following:
(1) fillers or extenders, such as starches, cyclodextrins, lactose, sucrose, glucose, mannitol, and/or silicic acid;
(2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose, and/or acacia;
(3) humectants, such as glycerol;
(4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate;
(5) solution retarding agents, such as paraffin;
(6) absorption accelerators, such as quaternary ammonium compounds;
(7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate;
(8) absorbents, such as kaolin and bentonite clay;
(9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and
(10) coloring agents. In the case of capsules, tablets, and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols, and the like.
A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered inhibitor(s) moistened with an inert liquid diluent.
Tablets, and other solid dosage forms, such as dragees, capsules, pills, and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes, and/or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. A compound of the invention can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents, and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols, and fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming, and preservative agents.
Suspensions, in addition to the active inhibitor(s) may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
Formulations for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more inhibitor(s) with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active agent.
Formulations which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams, or spray formulations containing such carriers as are known in the art to be appropriate.
Dosage forms for the topical or transdermal administration of an inhibitor(s) include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. The active component may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
The ointments, pastes, creams, and gels may contain, in addition to a compound of the invention, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, and zinc oxide, or mixtures thereof.
Powders and sprays can contain, in addition to a compound of the invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
A compound useful for application of methods of the invention can be alternatively administered by aerosol. This is accomplished by preparing an aqueous aerosol, liposomal preparation, or solid particles containing the composition. A nonaqueous (e.g., fluorocarbon propellant) suspension could be used. Sonic nebulizers are preferred because they minimize exposing the agent to shear, which can result in degradation of the compound.
Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or suspension of a compound of the invention together with conventional pharmaceutically acceptable carriers and stabilizers. The carriers and stabilizers vary with the requirements of the particular composition, but typically include nonionic surfactants (Tweens, Pluronics, sorbitan esters, lecithin, Cremophors), pharmaceutically acceptable co-solvents such as polyethylene glycol, innocuous proteins like serum albumin, oleic acid, amino acids such as glycine, buffers, salts, sugars, or sugar alcohols. Aerosols generally are prepared from isotonic solutions.
Transdermal patches have the added advantage of providing controlled delivery of a compound of the invention to the body. Such dosage forms can be made by dissolving or dispersing the agent in the proper medium. Absorption enhancers can also be used to increase the flux of the inhibitor(s) across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the inhibitor(s) in a polymer matrix or gel.
Pharmaceutical compositions of this invention suitable for parenteral administration comprise one or more compounds of the invention in combination with one or more pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to isotonic with the blood of the intended recipient or suspending or thickening agents. Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include tonicity-adjusting agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
In some cases, in order to prolong the effect of a compound useful for practice of methods of the invention, it is desirable to slow the absorption of the compound from subcutaneous or intramuscular injection. For example, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of inhibitor(s) in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.
The pharmaceutical compositions may be given orally, parenterally, topically, or rectally. They are, of course, given by forms suitable for each administration route. For example, they are administered in tablets or capsule form, by injection, inhalation, eye lotion, ointment, suppository, infusion; topically by lotion or ointment; and rectally by suppositories. Oral administration is preferred.
The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection, and infusion.
The pharmaceutical compositions of the invention may be “systemically administered” “administered systemically,” “peripherally administered” and “administered peripherally” meaning the administration of a ligand, drug, or other material other than directly into the central nervous system, such that it enters the patient's system and thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
The compound(s) useful for application of the methods of the invention may be administered to humans and other animals for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracisternally, and topically, as by powders, ointments or drops, including buccally and sublingually.
Regardless of the route of administration selected, the compound(s) useful for application of methods of the invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
Actual dosage levels of the compound(s) useful for application of methods of the invention in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
The concentration of a compound useful for application of methods of the invention in a pharmaceutically acceptable mixture will vary depending on several factors, including the dosage of the compound to be administered, the pharmacokinetic characteristics of the compound(s) employed, and the route of administration.
In general, the compositions useful for application of methods of this invention may be provided in an aqueous solution containing about 0.1-10% w/v of a compound disclosed herein, among other substances, for parenteral administration. Typical dose ranges are those given above and may preferably be from about 0.001 to about 500 mg/kg of body weight per day, given in 1-4 divided doses. Each divided dose may contain the same or different compounds of the invention. The dosage will be an effective amount depending on several factors including the overall health of a patient, and the formulation and route of administration of the selected compound(s).
General Methods. Synthetic RNAs were obtained from Dharmacon. They were deprotected according to the manufacturers protocol and de-salted using PD-10 sephadex columns (GE Healthcare) per the manufacturers protocol. DNA templates and primers were obtained from IDT and used without further purification. Locked Nucleic Acid inhibitors were purchased from Exiqon and resuspended in TE buffer directly. HEK 293T, MDA-MB-231 and DU145 cells were obtained from ATCC and used directly. HEK-293T and WT-9-12 cells were maintained in 1×DMEM (Corning) supplemented with 1×glutaGRO (Corning-) Penicillin/Streptomycin (50 U/mL) and 10% (v/v) fetal bovine serum (Sigma) [growth medium]. Proper adherence of WT-9-12 cells required coating of dishes with PurCol Bovine collagen 3 mg/mL (Corning) at 37° C. for 30 min before seeding cells. MDA-MB-23 and DU145 cells were maintained in 1×RPMI 1640 (Corning) supplemented with Penicillin/Streptomycin (50 U/mL) and 10% Fetal Bovine Serum (Sigma) [growth medium]. All cells were grown at 37° C. with 5% CO2. Chemicals were purchased from the following commercial sources: Combi blocks, Advanced Chem Tech, and Alfa Aesar.
Luciferase assays. HEK 293T cells were plated in six-well dishes (2×105 cells per well) and co-transfected with 0.4 mg of pLS-Renilla-30-UTR plasmids and with 0.04 mg of the pGL3-Control plasmid using jetPrime per the manufacture's protocol for 4 h. Then, the cells were trypsinized and plated into 96-well plates (2*104 cells per well) and allowed to adhere for 12 h after which, they were treated with the Dimer library or vehicle (DMSO) for 24 h. After treatment, Firefly and Renilla luciferase activities were measured by using the Dual-Luciferase Reporter Assay System (Promega Corp) according to the manufacturer's directions. Luminescence was measured on a Molecular Devices M5 plate reader with an integration time of 500 ms.
Binding Affinity Measurements. An in-solution fluorescence-based assay was used to determine the binding affinities of the best dimer to miR-17 and -18a by monitoring the change in fluorescence intensity of 4-FL as a function of RNA concentration. Briefly, the RNA of interest was folded in 1× Folding Buffer (8 mM Na2HPO4, pH 7.0, 185 mM NaCl, and 1 mM EDTA) at 60° C. for 5 min and then slowly cooled to room temperature. Then, the 4-FL was added into the RNA solution to a final concentration of 100 nM. Serial dilutions were completed using 1× Folding Buffer supplemented with 100 nM 4-FL compound. The solutions were incubated at room temperature for 30 min and then transferred to a black 384-well plate. Fluorescence intensity was measured using a Bio-Tek FLx800 plate reader with an excitation bandpass filter of 485/20 nm and an emission band pass filter of 528/20 nm. The change in fluorescence intensity as a function of the concentration of RNA was fit to equation 1:
I=I
0+0.5Δε{([FL]0+[RNA]0+Kd)−(([FL]0+[RNA]0+Kd)2−4[FL]0[RNA]0)1/2} (1)
where I is the observed fluorescence intensity; I0 is the fluorescence intensity in the absence of RNA; Δε is the difference between the fluorescence intensity in the absence of RNA and in the presence of infinite RNA concentration; [FL]0 is the concentration of compound; [RNA]0 is the concentration of the selected RNA; and Kd is the dissociation constant. Competitive binding assays were completed by incubating the RNA of interest with 100 nM 4-FL and increasing concentrations of 2. The resulting curves were fit to equation 2:
θ=1/2[C][K_t+K_t/K_d[C_t]+[RNA]+[C]]−{(K_t+K_t/K_d+[C_t]+[RNA]+[C])−4[C][RNA]} (2)
where θ is the percentage of 4-FL bound, [4-FL] is the concentration of 4-FL, Kt is the dissociation constant of RNA and 4-FL, [RNA] is the concentration of RNA, Ct is the concentration of 4-FL, Kd is the dissociation constant for 4, and A is a constant.
Dicer Inhibition assay. The RNA was folded in 1× Reaction Buffer (Genlantis) by heating at 60° C. for 5 min and slowly cooling to room temperature. The samples were then supplemented with 1 mM ATP and 2.5 mM MgCl2. Serially diluted concentrations of 2 were added, and the samples were incubated at room temperature for 15 min. Next, 7 ng/μL of recombinant human Dicer was added followed by incubation at 37° C. overnight. Reactions were stopped by adding the manufacturer's supplied stop solution (Genlantis). A T1 ladder (cleaves G residues) was generated by heating the RNA in 1×RNA Sequencing Buffer (20 mM sodium citrate, pH 5.0, 1 mM EDTA, and 7 M urea) at 55° C. for 10 min followed by slowly cooling to room temperature. RNase T1 was then added to a final concentration of 10 U/μL, and the solution was incubated at room temperature for 20 min. An RNA hydrolysis ladder was generated by incubating RNA in 1×RNA Hydrolysis Buffer (50 mM NaHCO3, pH 9.4, and 1 mM EDTA) at 95° C. for 5 min the sample was then snap cooled on ice. In all cases, the cleavage products were separated on a 0.7 mm denaturing 15% polyacrylamide gel and imaged using a Bio-Rad PMI phosphorimager.
RT-qPCR in DU145, MDA-MB-231, and WT-9-12 cells. DU145 cells were seeded into 12-well plates at ˜50% confluency (≈200,000 cells/well) and allowed to adhere for 12 h. After adhering, the cells were treated with compounds 2, 5, 6, or 7 (10, 100, and 500 nM) for 24 h. Total RNA was then harvested using a Zymo-Quick RNA Mini prep kit (Zymo Research) with DNase treatment according in the manufacturers protocol. Reverse transcription (RT) for mature miRNAs was done using the miScript II RT kit (Qiagen) with 200 ng of total RNA. To measure precursor and mRNA levels, RT was done using qScript (Quanta Bio) according to the manufacturers protocol on 1000 ng of total RNA. RT-qPCR was carried out on an Applied Biosystems 7900HT cycler under standard conditions (2 step PCR; 60° C. annealing/elongation, 95° C. melt) using the Power Sybr Master Mix (Applied Biosystems). Data were normalized to RNU6 for mature miRNAs and 18S ribosomal RNA for precursor miRNA's and mRNAs, with expression levels calculated using the ΔΔCt method.6 Similar to what was done in DU145 cells, MDA-MB-231 and WT-9-12 cells were cultured in 6 well or 12-well plates and treated with compounds 2, 5, 6, or 7 for 24 h. Total RNA was extracted in a similar manner and subjected to RT-qPCR as described above. RT for precursor and mRNAs in MDA-MB-231 cells was done using the High Flex buffer in the miScript II RT kit.
Western blotting. Cells were grown in 6-well plates to ˜50% confluency in complete growth medium and then incubated with 500 nM of 2 or 5 for 48 h. Total protein was extracted using M-PER Mammalian Protein Extraction Reagent (Pierce Biotechnology) supplemented with 1× Protease Inhibitor cocktail (Roche). Extracted total protein was quantified using a Micro BCA Protein Assay Kit (Pierce Biotechnology). Approximately 10 μg of total protein was resolved using an 8% SDS-polyacrylamide gel and then transferred to a PVDF membrane for 80 min at 350 mA current (25 mM Tris, pH 8.5, 200 mM glycine and 20% (v/v) Methanol). The membrane was briefly washed with 1× Tris-buffered saline (TBS; 50 mM Tris-Cl, pH 7.5. 150 mM NaCl) and blocked with 5% milk in 1×TBST (1×TBS containing 0.05% Tween-20) for 1 h at room temperature. The membrane was then incubated with 1:1000 ZBTB4 primary antibody (Life Technologies) in 1×TBST containing 5% milk overnight at 4° C. The membrane was washed with 1× Tris Buffered a Saline with 0.1% Tween-20 (TBST: 20 mM Tris-Base pH 7.6; 150 mM NaCl, 0.1% (v/v) Tween-20) and incubated with 1:2000 antirabbit IgG horseradish-peroxidase (Cell Signaling) secondary antibody conjugate in 1×TBST for 1 h at room temperature. After washing with 1×TBST, protein expression was quantified using SuperSignal West Pico Chemiluminescent Substrate (Pierce Biotechnology) per the manufacturer's protocol and exposed to X-Ray film. The membrane was then stripped using 1× Stripping Buffer (200 mM glycine, 1% Tween-20, and 0.1% SDS, pH 2.2) followed by washing in 1×TBST. The membrane was blocked and probed for β-actin following the same procedure described above using 1:5000 3-actin primary antibody (Cell Signaling) in 1×TBST containing 5% milk overnight at 4° C. The membrane was washed with 1×TBST and incubated with 1:10,000 anti-rabbit IgG horseradish-peroxidase secondary antibody conjugate (Cell Signaling) in 1×TBST for 1 h at room temperature. ImageJ software from the National Institutes of Health was used to quantify band intensities.
Using a similar method as mentioned above, STK4 (MST-1) levels were investigated in DU145 cells. Approximately 10 μg of protein was resolved on a 12.5% Bis-Tris polyacrylamide gel pH 6.8 with a 4% Bis-Tris pH 6.8 stacking layer at 150 V in 1× Running Buffer (50 mM MOPS, 50 mM Tris, pH 7.7, 1 mM EDTA, and 1% (w/v) SDS). The proteins were transferred to a PVDF membrane using the wet transfer method at 350 mA for 1 h. Membranes were blocked with 1×TBST containing 5% milk and then probed with 1:400 of Rabbit anti-Human STK4 (Cell Signaling—D889Q) overnight in TBST with 5% Milk followed by washing and probing with 1:5000 anti-rabbit-HRP (Cell Signaling) for 2 h at room temp. Bands were visualized as mentioned earlier. After stripping, j-Actin was probed as described earlier, and imaged. PD-L1 was probed in a similar manner using 1:1000 Rabbit anti-Human PD-L1 (Cell Signaling-E1L3N®) and 1:5000 anti-rabbit HRP.
Caspase 3/7 Glo Assay. DU145 cells were seeded into 96-well black clear bottom plates (Corning—89091-014) at 50% confluency (≈20,000 cells/well) and allowed to adhere overnight. The cells were then treated with 2, 5, or 6 at 1, 10, 100, and 500 nM or LNAs targeting the cluster and a Scrambled LNA at 50 nM for 24 h. LNAs were obtained from Qiagen with the miRCURY Power LNA backbone and uptake tag, and were treated to the cells directly without transfection. Caspase 3/7 activity was measured by using the Caspase 3/7 glow reagent (Promega) according to the manufacturers protocol. Luminescence was measured on a Molecular Devices M5 plate reader with an integration time of 500 ms.
Invasion assay. A Boyden chamber assay was used to assess invasion of MDA-MB-231 cells. Transwell inserts were coated with 100 μL of 0.5 mg/mL Matrigel (Fisher Scientific: CB40234) diluted with serum free growth media at 37° C. for 30 min. MDA-MB-231 cells (5×104) pre-treated with vehicle, LNA, Scramble 2 or 5 in serum free growth medium were seeded at the upper chamber with complete growth medium at the bottom. After incubating at 37° C. for 16 h, medium in the bottom wells and inserts was removed. The inserts and bottom wells were washed twice with PBS and excess liquid was removed with cotton swabs. To the bottom well was added 400 μL of 4% paraformaldehyde and incubated at room temperature for 20 min. The wells and inserts were washed twice with PBS and then stained for 20 min by adding 400 μL of 0.1% (w/v) crystal violet solution (dissolved in 4% aqueous MeOH). The wells and inserts were washed twice with water and twice with 1×PBS. After drying, the invaded cells were imaged using a Leica DMI3000 B upright fluorescent microscope and counted manually.
In vitro Bleomycin cleavage assay. The template used for pre-miR-17 (SEQ ID NO:1 TCAAAGTGCTTACAGTGCAGGTAGTGATATGTGCATCTACTGCAGTGAAGGCACTTG TAGC) was PCR-amplified in 1×PCR Buffer, 2 μM forward primer (SEQ ID NO:2 GGCCGGATCCTAATACGACTCACTATAGGTCAAAGTGCTTACAGTGCAGG), 2 μM reverse primer(SEQ ID NO:3 GCTACAAGTGCCTTCACTG), 4.25 mM MgCl2, 330 μM dNTPs, and 2 μL of Taq DNA polymerase in a 50 μL reaction. Cycling conditions were 95° C. for 30 s, 55° C. for 30° C., and 72° C. for 60 s. Pre-miR-17 was folded in 5 mM NaH2PO4 at 60° C. for 5 min and then cooled down slowly to room temperature on the benchtop. Different concentrations (10, 20, 50, 100, 200, 500 or 1000 nM) of 5 were preincubated with Fe2+ and added to the folded RNA. After the first addition, a second and third aliquot of Fe2+ was added at 30 and 60 min of incubation respectively at 37° C. The mixture was then incubated at 37° C. for 24 h and the final cleavage products were separated on a 15% denaturing polyacrylamide gel and imaged using a Bio-Rad PMI phosphorimager.
In vitro Bleomycin cleavage of DNA plasmid. Compound 5, 6 or bleomycin A5 (0, 10, 100, 500 or 1000 nM) were pre-activated with 1 eq of (NH4)2Fe(SO4)2.6H2O and then 500 ng of a plasmid was added to a final volume of 20 μL. Another equivalent of (NH4)2Fe(SO4)2.6H2O was added after 30 min and 60 min respectively. The mixture was loaded on 1% agarose with 6× loading dye and stained with ethidium bromide. Bands were quantified using ImageJ image analysis software.
Overexpression of the miR-17-92a-1 cluster. DU145 or MDA-MB-231 cells were grown to 80% confluency in a 100 mm dish followed by transfection with 2000 ng of a pcDNA-miR-17-92a-1 or empty pcDNA vector as described previously.7 After transfection, cells were seeded into 6-well or 12-well plates and allowed to adhere for 12 h before being treated with 2 or 5 for 24 h for analysis of RNA expression. Total RNA was extracted and analyzed as described above.
Lentiviral transduction of MDA-MB-231 or DU145 cells with shRNAs. DU145 or MDA-MB-231 cells were transduced to express shRNAs targeting STK4 or ZBTB4 respectively. The lentiviral particles were generated by co-transfection of HEK 293T cells with (i) anti-STK4 (NM_020899.3—Genecopoeia) or anti-ZBTB4 (NM_006282.4—Genecopoeia); (ii) packaging plasmid (psPAX2-Addgene); and (iii) envelop plasmid (pmD2.G—Addgene) using Lipofectamine 3000 according to the manufacturers protocol in a ratio of (1.0:0.55:1.3 pmol). After removal of transfection media, media supernatants were harvested at 12, 24, and 48 h. Virus particles were concentrated using the Lenti-X Concentrator (Takara Biosciences) according to the manufacturers protocol. The viral pellet was resuspended in 1 mL of 1×DPBS and 300 μL was added to DU145 or MDA-MB-231 cells (˜50% confluency), which were allowed to grow for 48 h. Cells were split twice and then sorted using a BD-FACS Aria Fusion™ cell sorter to isolate mCherry positive cells. These cells were then grown for RT-qPCR, Western, and Caspase 3/7 analysis of shRNA expression's effect on compound efficacy and phenotype.
Chem-CLIP/Competitive-Chem-CLIP. DU145 cells were grown in 100 mm dishes to ˜80% confluency in complete growth medium. They were then treated with 3 or 4 for 6 h at 37° C. followed by washing once with 1×DPBS and then irradiated with 365 nm light for 10 min in ice fold DPBS. Cells were then scraped from the dish, pelleted, and the supernatants removed. Total RNA was extracted using the miRNeasy Mini kit (Qiagen) with DNase treatment according to the manufacturers protocol. To add a biotin handle onto RNA that has reacted with 3 or 4, 60 μg of total RNA was treated with 200 μL of Disulfide Azide Agarose beads (Click Chemistry Tools—1238-2) washed with 1×HEPES buffer (25 mM, pH 7) and 30 μL of (1:1:1) of 250 mM sodium ascorbate, 10 mM CuSO4, 50 mM THPTA added in that order to a 500 μL final volume in 1×HEPES buffer. Tubes were incubated at 37° C. for 2 h followed by centrifugation. The beads were then washed six times with 1×Wash Buffer (10 mM Tris-HCl, pH 7.0, 4 M NaCl, 1 mM EDTA, and 0.2% (v/v) Tween-20) followed by two washes with nano pure water. Bound RNA was cleaved by treating the beads with 200 μL of 1:1 TCEP (200 mM) pre-reduced with K2CO3 (600 mM) for 30 min at 37° C. followed by quenching with 1 volume of iodoacetamide (400 mM) for 30 min at room temperature. The supernatants were removed, and the beads washed once with Nano pure water and combined with the supernatants, which were then concentrated by vacuum to 100 μL and the RNA cleaned up using RNA clean XP beads per the manufacturer's protocol. This RNA was then subjected to RT-qPCR analysis to measure enrichment of pri-miR-17-92 and pre-miR-17, which was calculated as the ratio of levels after pulldown to before pulldown described previously.8
Proteomics analysis of DU145 cells treated with 5. DU145 cells were grown in 100 mm dishes in growth medium and treated with 5 at 500 nM or vehicle (DMSO) for 24 h. After the treatment period, the cells were scraped from the dish and pelleted. The cells were re-suspended in 1×DPBS and pelleted; this step was repeated. The cells were lysed in 1×DPBS by sonication using Digital Sonifier SFX 150 (Branson). Protein concentration in lysates was measured using the Bradford assay (BioRad). An equal amount of protein from each sample (30 μg) was then denatured in 6 M urea in 50 mM NH4HCO3 (pH 8), reduced with 10 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP) for 30 min, and alkylated with 25 mM iodoacetamide for 30 min; the alkylation step was completed in the dark. Samples were diluted to 2 M urea with 50 mM NH4HCO3, and digested with trypsin (Thermo Scientific, 1.5 μL of 0.5 μg/μL) in the presence of 1 mM CaCl2) for 12 h at 37° C. Samples were acidified with acetic acid to a final concentration of 5% (v/v), desalted over a self-packed C18 spin column, and dried using micro IR vacuum concentrator (CentriVap). Samples were analyzed by LC-MS/MS (see below), and the MS data were processed with MaxQuant (see below).
LC-MS/MS Analysis. Peptides were resuspended in water with 0.1% (v/v) formic acid (FA) and analyzed using EASY-nLC 1200 nano-UHPLC coupled to Q Exactive HF-X Quadrupole-Orbitrap mass spectrometer (Thermo Scientific). The chromatography column consisted of a 50 cm long, 75 μm i.d. microcapillary capped by a 5 μm tip and packed with ReproSil-Pur 120 C18-AQ 2.4 μm beads (Dr. Maisch GmbH). LC solvents were 0.1% FA in H2O (Buffer A) and 0.1% FA in 90% MeCN:10% H2O (Buffer B). Peptides were eluted into the mass spectrometer at a flow rate of 300 nL/min over a 240 min linear gradient (5-35% Buffer B) at 65° C. Data were acquired in data-dependent mode (top-20, NCE 28, R=7500) after full MS scan (R=60000, m/z 400-1300). Dynamic exclusion was set to 10 s, peptide match set to prefer, and isotope exclusion was enabled.
MaxQuant Analysis. The mass spectrometer data were analyzed with MaxQuant9 (V1.6.1.0) and searched against the human proteome (Uniprot) and a common list of contaminants (included in MaxQuant). The first peptide search tolerance was set at 20 ppm; 10 ppm was used for the main peptide search, and fragment mass tolerance was set to 0.02 Da. The false discovery rate for peptides, proteins, and sites identification was set to 1%. The minimum peptide length was set to six amino acids, and peptide re-quantification, label-free quantification (MaxLFQ), and “match between runs” were enabled. The minimal number of peptides per protein was set to 2. Methionine oxidation was searched as a variable modification, and carbamidomethylation of cysteines was searched as a fixed modification.
PD-L1 Overexpression Analysis. DU145 cells were seeded into 60 mm dishes and grown to a ˜70% confluency. Then, they were transfected with 200, 1000, 2000, or 4000 ng of the pGIPZ-PD-L1-EGFP plasmid to overexpress PD-L1 for 24 h. Total RNA was extracted to assess the change in mRNA levels required to alter surface PD-L1 expression. Cell surface expression was measured by scraping transfected cells from the 60 mm dish and then washing them once with 1×DPBS. They were then resuspended in Buffer 1 (1×DPBS containing 5% (v/v) FBS and 1% (w/v) NaN3) Next, 1 volume of 1×DPBS with 5% BSA was added, and the cells were incubated for 15 min followed by addition of anti-PD-L1-Alexa 647 conjugate (Cell Signaling-417265; final dilution of 1:50). The cells were incubated at room temperature in the dark with the antibody for 1.5 h followed by three washes with 1×DPBS before resuspension in Buffer 1 for Fluorescence Assisted Cell Sorting (FACS) analysis. Cells were analyzed on a BD-FACS LSRII using standard laser parameters for Alexa-647 expression. FACS data and plots were analyzed on FlowJo 6, and the mean at maximum intensity was used for plotting the data.
Cellular uptake analysis. DU145 and MDA-MB-231 cells were seeded into a 96-well white clear bottom plate at 10,000 cells/well and allowed to adhere overnight. Once adhered, the cells were grown to ˜50% confluency and then treated with 2, 5, or 7 at 5 μM for 24 h while also leaving untreated wells for generation of a standard curve. This concentration was chosen to allow for adequate signal above noise. After 24 h, cells were lysed in 100 μL of RNA lysis buffer (Zymo Research) for 5 min. Compound 2, 5, or 7 were spiked into untreated samples at 100, 10, 1, 0.1, and 0.01 nM to create a standard curve of compound fluorescence. Using a Biotek FLX-800 fluorescence plate reader (excitation: 360/340; emission 460/440; sensitivity=90) the fluorescence of 2, 5, and 7 was measured. Concentrations were determined by extrapolating from the standard curves mentioned above.
Cellular localization of 2, 5, and 7 in DU145 and MDA-MB-231 cells. DU145 and MDA-MB-231 cells were seeded into a poly-D-lysine coated glass bottom 35 mm dishes (MatTek). Cells were then treated with 2, 5, or 7 (5 μM) for 24 h. After incubation, cells were washed with PBS twice and the nucleus stained with Syto 82 for 20 min in 1× indicator free RPMI 1640 (Gibco). Images were taken on an Olympus FluoView 1000 confocal microscope at 100× magnification in 1× indicator free RPMI 1640 and images were overlayed in the Olympus FluoView software to determine co-localization of compounds with cellular compartments. Brightness and Contrast were adjusted to settings of 84 and −49, respectively, in Adobe Photoshop for all images.
Absolute quantification of pri-, pre-, and mature miRNAs. Transcripts of pre-miR-17, pre-miR-18a, and the corresponding 5p mature sequences were transcribed in vitro and purified as described above. Precursor miRNAs (1×1014 copies) were reverse transcribed using QScript RT (Quanta bio) in a total volume of 40 μL. Mature miRNAs (1×1014 copies) were reverse transcribed using the miScript II RT Kit (Qiagen) in a total volume of 40 μL reaction. Serial dilutions of the RT reactions (1:10) were used to create a standard curve of copy number versus Ct which was used to calculate copy numbers of each transcript in DU-145 and MDA-MB-231 cells.
DIEA: Diisopropyl ethyl amine
DMSO: Dimethyl sulfoxide
EDTA: Ethylenediaminetetraacetic acid
HATU: Hexafluorophosphate azabenzotriazole tetremethyl uronium
HOAt: 1-hydroxy-7-azabenzotriazole
General Protocol for Peptoid Synthesis: Peptoids were synthesized via standard resin-supported oligomerization protocol. Rink resin (555 mg, 0.6 mmol) was activated with 20% piperidine in DMF for 30 min. After that, solvent was removed and washed with DMF and DCM for 3 times respectively.
Coupling Step: To the resin was added 3 mL of 1 M bromoacetic acid in DCM (3 mmol, 5 eq) and DIC (3.0 mmol, 519 μL). The resin was shaken at room temperature for 2 h. Then the solvent was removed, and the resin was washed with DMF for three times.
Displacement step: To the resin was added 5 mL DMF and propargylamine. The resin was shaken at room temperature for 2 h. Then the solvent was removed, and the resin was washed with DMF for three times.
Peptoid Chain Extension: a) To the resin was added 5 mL DMF, bromoacetic acid and DIC. The resin was shaken at room temperature for 2 h. Then the solvent was removed, and the resin was washed with DMF for three times. b) To the resin was added 5 mL DMF and propyl amine. The resin was shaken at room temperature for 2 h. Then the solvent was removed, and the resin was washed with DMF for three times. Steps a) and b) were repeated for another 2-9 times.
Cleavage of the peptoid: The resin was treated with 30% TFA in DCM and shaken at room temperature for 30 min. The solution was collected and concentrated in vacuo. The residue was purified by HPLC.
General procedure for the click chemistry: A solution of the peptoid (1 eq), Monomer (2 eq), CuSO4.5H2O (2 eq) and ascorbic acid (2 eq) in DMF was stirred at room temperature overnight. The resulting mixture was purified by HPLC to afford the corresponding dimer.
General Protocol for Peptoid Synthesis: Peptoids were synthesized via standard resin-supported oligomerization protocol. Chloro trityl resin (555 mg, 0.6 mmol) was activated with 1 M HCl/dioxane in DCM (4 M HCl dioxane was diluted with DCM) for 30 min. After that, solvent was removed and washed with DMF and DCM for 3 times respectively.
Coupling Step: To the resin was added 3 mL of 1 M bromoacetic acid in DCM (3 mmol, 5 eq) and DIC (3.0 mmol, 519 μL). The resin was shaken at room temperature for 2 h. The solvent was removed, and the resin was washed with DMF for three times.
Displacement step: To the resin was added 5 mL DMF and propargylamine. The resin was shaken at room temperature for 2 h. Then the solvent was removed, and the resin was washed with DMF for three times.
Peptoid Chain Extension: a) To the resin was added 5 mL DMF, bromoacetic acid and DIC. The resin was shaken at room temperature for 2 h. Then the solvent was removed, and the resin was washed with DMF for three times. b) To the resin was added 5 mL DMF and propylamine. The resin was shaken at room temperature for 2 h. Then the solvent was removed, and the resin was washed with DMF for three times. Steps a) and b) were repeated twice.
Cleavage of the peptoid: The resin was treated with 30% TFA in DCM and shaken at room temperature for 30 min. The solution was collected and concentrated in vacuo. The residue was purified by HPLC.
The Dimer acid was obtained by the general click reaction as described above. The acid was preincubated with HATU (1.5 equiv.), HOAt (1.5 equiv.) and DIEA (1.5 equiv.) in DMF for 10 min. Then a solution of Bleomycin A5 (3 equiv.) in DMSO was added. The mixture was stirred at room temperature for 2 h and then the mixture was subjected to HPLC purification. After injection of the sample, the column was washed with 50 mM EDTA (pH 6.7) for 15 min to remove copper ion and then water for another 15 min to remove EDTA. 5 was purified with a linear gradient from 0 to 100% B (MeOH+0.1% TFA) in A (water+0.1% TFA) over 60 min at a flow rate of 5 mL/min. MALDI: [M+H]+ calculated: 3297.7249, [M+H]+ observed: 3298.9922. Synthesis of 2-FAM
A solution of the Dimer acid was incubated with HATU (1.5 equiv.) at room temperature for 10 min and then the FAM amine was added followed by the addition of 5 equiv. of DIEA and the mixture was stirred at room temperature for another 2 h. 2-FAM was purified by HPLC. MALDI: [M+K]+ calculated: 2316.9388, [M+K]+ observed: 2317.3967.
To a solution of the Dimer acid in DMSO (12 mM, 90 μL, 1.08 μmol) was added a mixture of HATU (0.62 mg, 1.5 μmol) and HOAt (0.22 mg, 1.5 μmol) in DMF (5 μL), and the solution was stirred for 10 min at room temperature. A mixture of C1-3 amine (1.2 mg, 2.02 μmol), synthesized as previously described,10 and DIPEA (0.94 μL, 5.4 μmol) in DMF (12 μL) was added to the solution and stirred overnight. After dilution with 30% MeOH/H2O (0.1% TFA), the product was purified by HPLC (70-90% MeOH/H2O in 30 min, 0.1% TFA) to give 7 (0.3 mg, 0.12 μmol, 11%). HR-MS (ESI) calculated. for C133H176N23O18S− [M−H]−: 2415.3290; observed: 2415.3236.
Compound 2 (also Compound 1D, n=1) HR MS=1834.0452; HPLC=42 min. (minutes, HPLC conditions described above)
Compound 1D, n=2; HR MS=1933.1505 mw; HPLC=43.4 min.
Compound 1D, n=3; HR MS=2032.2262 mw; HPLC=42.4 min.
Compound 1D, n=4; HR MS=2131.3394 mw; HPLC=42.2 min.
Compound 1D, n=5; HR MS=2230.2078 mw; HPLC=43.6 min.
Compound 1D, n=6; HR MS=2329.3686 mw; HPLC=44 min.
Compound 1D, n=7; HR MS=2428.3708 mw; HPLC=44 min.
Compound 7; FBF (Counts v. mass to charge) 2416.32755 mw; HPLC=46.0
Genes. Dev. 2011, 25 (16), 1734-45.
The inventions, examples, biological assays and results described and claimed herein have may attributes and embodiments include, but not limited to, those set forth or described or referenced in this application.
All patents, publications, scientific articles, web sites and other documents and material references or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced document and material is hereby incorporated by reference to the same extent as if it had been incorporated verbatim and set forth in its entirety herein. The right is reserved to physically incorporate into this specification any and all materials and information from any such patent, publication, scientific article, web site, electronically available information, textbook or other referenced material or document.
The written description of this patent application includes all claims. All claims including all original claims are hereby incorporated by reference in their entirety into the written description portion of the specification and the right is reserved to physically incorporated into the written description or any other portion of the application any and all such claims. Thus, for example, under no circumstances may the patent be interpreted as allegedly not providing a written description for a claim on the assertion that the precise wording of the claim is not set forth in haec verba in written description portion of the patent.
While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Thus, from the foregoing, it will be appreciated that, although specific nonlimiting embodiments of the invention have been described herein for the purpose of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Other aspects, advantages, and modifications are within the scope of the following claims and the present invention is not limited except as by the appended claims.
The specific methods and compositions described herein are representative of preferred nonlimiting embodiments and are exemplary and not intended as limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this specification and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. Thus, for example, in each instance herein, in nonlimiting embodiments or examples of the present invention, the terms “comprising”, “including”, “containing”, etc. are to be read expansively and without limitation. The methods and processes illustratively described herein suitably may be practiced in differing orders of steps, and that they are not necessarily restricted to the orders of steps indicated herein or in the claims.
The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by various nonlimiting embodiments and/or preferred nonlimiting embodiments and optional features, any and all modifications and variations of the concepts herein disclosed that may be resorted to by those skilled in the art are considered to be within the scope of this invention as defined by the appended claims.
This application is a national stage filing under 35 U.S.C. § 371 of International Patent Application Serial No. PCT/US2021/023976, filed Mar. 24, 2021, which claims the benefit under 35 U.S.C. § 119(e) of the filing date of U.S. Provisional Application Ser. No. 63/001,936, filed Mar. 30, 2020, the entire contents of each of which are incorporated herein by reference in their entirety.
This invention was made with Government support under grant number R01 GM097455 awarded by the National Institutes of Health. The Government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/023976 | 3/24/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63001936 | Mar 2020 | US |
