Patent Application
20180243382
The invention generally relates to the treatment and prevention of cancer by expression of nucleic acids encoding MDA-5 or functional derivatives thereof. The therapeutic agent according to the invention induces regression of pre-established cancers and development of long-lasting antitumor immune memory
Cancer is one of the leading causes of death and is responsible for increasing health costs. Traditionally, cancer has been treated using chemotherapy, radiotherapy and surgical methods. Tumor cell plasticity and heterogeneity, however, remain challenges for effective treatments of many cancers. In addition, traditional therapies may have drawbacks, e.g. insufficient specificity, intolerable toxicity and too low efficacy.
In recent years molecular therapies have been developed, which eliminate cancer cells and prolong the survival time of affected patients or cure said patients. One area of interest in the field of cancer therapy is directed to the induction of apoptosis in cancer cells. Frequently, constitutive activation of signalling pathways in those cells results in the induction of resistance to apoptosis. To target and reverse anti-apoptotic mechanisms is an attractive example of molecularly-targeted therapy. For example, members of the bcl-2 gene family and the “inhibitor of apoptosis protein”-families have been successfully targeted to render tumor cells more susceptible to apoptosis.
However, despite recent progress, there is an ongoing need to provide new and improved cancer therapies that can exploit both innate and adaptive immune responses.
Provided herein are compositions and methods for targeting the evolutionarily conserved MDA-5-IPS-1 antiviral pathway in tumors to provoke parallel tumoricidal and immunostimulatory effects that bridge innate and adaptive immune responses for the therapeutic treatment of cancer.
An aspect of the present invention provides a method of treating and preventing recurrence of cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a MDA-5-encoding polynucleotide or a MDA-5 polypeptide, or a functional-conservative derivative thereof. In some embodiments, the cancer is prostate cancer. In particular embodiments, the MDA-5 includes one N-terminal caspase-recruitment domain (CARD) domain. In other embodiments, the MDA-5 does not include a CARD domain.
In some embodiments, the step of administering is performed by directly contacting tumor cells of said cancer with said MDA-5-encoding polynucleotide or a MDA-5 polypeptide, or a functional-conservative derivative thereof. In some embodiments, the method of the invention further comprises a step of simultaneously or sequentially administering one or more active agents selected from the group consisting of a MDA-7/IL-24-encoding polynucleotide, a MDA-7/IL-24 polypeptide, glucose-regulated protein 170 (grp170), grp170-flagellin hybrid chaperone (Flagrp170), and an immune checkpoint inhibitor. In some embodiments, the method of the invention further comprises a step of simultaneously or sequentially administering one or more chemotherapeutic or radiotherapeutic agents. In some embodiments, the MDA-5-encoding polynucleotide is regulated by a cancer selective promoter.
Another aspect of the invention provides a method of inducing an immune-mediated response in a subject in need thereof, comprising administering to the subject a MDA-5-encoding polynucleotide or a MDA-5 polypeptide, or a functional-conservative derivative thereof in an amount sufficient to activate tumor-reactive cytotoxic T lymphocytes and/or natural killer cells in said subject.
A further aspect of the invention provides a method of preventing recurrence of a cancer in a subject in remission, comprising administering to the subject a therapeutically effective amount of a Melanoma Differentiation-Associated gene 5 (MDA-5)-encoding polynucleotide or a MDA-5 polypeptide, or a functional-conservative derivative thereof.
Innate pattern recognition receptors (PRRs), such as RIG-I-like receptor and toll-like receptors, are specialized for recognizing pathogen-associated molecular patterns and play essential roles in host immunity (1). Melanoma differentiation associated gene-5 (mda-5) or Helicard, initially identified as a type I interferon (IFN)-inducible gene in human melanoma by subtraction hybridization (2), is a cytoplasmic RIG-I-like receptor and now considered as a first line of defense against viral infection by sensing viral double-stranded RNA (dsRNA) (3). The MDA-5 protein consists of two N-terminal tandem caspase-recruitment domains (CARDs), the central DExD/H-box motif helicase domain, and C-terminal domain. Upon recognition of viral dsRNA, MDA-5 binds to the adapter protein IFN-β promoter stimulator 1 (IPS-1), which is tethered to the outer mitochondrial membrane (4). This interaction via CARD domains triggers a complex signaling cascade involving transcription factors, NF-κB and IFN regulatory factor 3 (IRF-3) in particular, resulting in expression of the type I IFNs and IFN-stimulated genes to initiate antiviral immune responses (5-8). MDA-5 can also execute its antiviral activity by inducing apoptosis of virus-infected cells in a type I IFN-independent manner (9, 10). In this context, cleavage of the MDA-5 protein and subsequent nuclear translocation of the helicase domain further accelerates DNA fragmentation (11).
Aspects of the invention relate to compositions and methods useful for the treatment of cancer. As described in Example 1, the biological effects of MDA-5, via ectopic expression of human or mouse MDA-5 protein, on selective induction of prostate cancer cell death and activation of type I IFN response have been investigated. The Example provides new insight into the structural domains of MDA-5 that confer direct tumoricidal or type I IFN-promoting effect upon its expression in cancer cells. In particular, it was found that MDA-5 without either of the two N-terminal CARD domains or with only one of the CARD domains is sufficient for its pro-apoptotic effects. However, MDA-5 or variants containing either one of the two CARD domains was required to stimulate IFN signaling.
Moreover, the present invention demonstrates for the first time the superior antitumor efficacy of in situ MDA-5 therapy in eradicating established prostate cancers. Without being bound by theory, the mechanistic studies reveal that this enhanced tumor control is mediated primarily by engaging type I IFN response in the tumor site via MDA-5-IPS-1 axis, which results in systemic mobilization of both innate and adaptive components of the immune system.
The human mda-5 DNA (SEQ ID NO:1) and amino acid (SEQ ID NO:2) sequences are found at GenBank #NM_022168. The mouse mda-5 DNA (SEQ ID NO:3) and amino acid (SEQ ID NO:4) sequences are found at GenBank accession #NM_027835.
A “coding sequence” or a sequence “encoding” an expression product, such as a RNA, polypeptide, protein, or enzyme, is a nucleotide sequence that, when expressed, results in the production of that RNA, polypeptide, protein, or enzyme, i.e., the nucleotide sequence encodes an amino acid sequence for that polypeptide, protein or enzyme.
By “purified” and “isolated” it is meant, when referring to a polypeptide or a polynucleotide sequence, that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type. The term “purified” as used herein preferably means at least 75% by weight, more preferably at least 85% by weight, still preferably at least 95% by weight, and most preferably at least 98% by weight, of biological macromolecules of the same type are present. An “isolated” nucleic acid molecule which encodes a particular polypeptide refers to a nucleic acid molecule which is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may include some additional bases or moieties which do not deleteriously affect the basic characteristics of the composition.
The terms “subject” and “patient” are used interchangeably herein, and refer to an animal such as a mammal, which is afflicted with or suspected of having, at risk of, or being pre-disposed to cancer. The terms may refer to a human. The terms also include domestic animals bred for food, sport, or as pets, including horses, cows, sheep, poultry, fish, pigs, cats, dogs, and zoo animals, goats, apes (e.g. gorilla or chimpanzee), and rodents such as rats and mice. Typical subjects include persons susceptible to, suffering from or that have suffered from cancer.
As used herein, the terms “cancer”, “hyperproliferative” and “neoplastic” refer to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. Hyperproliferative and neoplastic disease states may be categorized as pathologic, i.e., characterizing or constituting a disease state, or may be categorized as non-pathologic, i.e., a deviation from normal but not associated with a disease state. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The terms “cancer” or “neoplasms” include malignancies of the various organ systems, such as malignancies affecting lung, breast, skin, thyroid, lymphoid tissues, gastrointestinal, and genito-urinary tracts, that include, but are not limited to, adenocarcinomas of the colon, prostate, lung and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and of the esophagus.
The term “cancer metastasis” has its general meaning in the art and refers to the spread of a tumor from one organ or part to another non-adjacent organ or part.
The polypeptides of the invention may be produced by any technique known per se in the art, such as, without limitation, any chemical, biological, genetic or enzymatic technique, either alone or in combination. The invention thus provides an isolated, synthetic or recombinant MDA-5 polypeptide or a functional-conservative derivative thereof.
Knowing the amino acid sequence of the desired sequence, one skilled in the art can readily produce said polypeptides, by standard techniques for production of polypeptides. For instance, they can be synthesized using well-known solid phase methods, preferably using a commercially available peptide synthesis apparatus (such as that made by Applied Biosystems, Foster City, Calif.) and following the manufacturer's instructions.
Alternatively, the polypeptides of the invention can be synthesized by recombinant DNA techniques as is now well-known in the art. For example, these fragments can be obtained as DNA expression products after incorporation of DNA sequences encoding the desired (poly)peptide into expression vectors and introduction of such vectors into suitable eukaryotic or prokaryotic hosts that will express the desired polypeptide, from which they can be later isolated using well-known techniques.
Polypeptides of the invention can be used in an isolated (e.g., purified) form or contained in a membrane or lipid vesicle (e.g. a liposome).
Functional-conservative derivatives or variants may result from modifications and changes that may be made in the structure of the polypeptides of the invention (and in the DNA sequences encoding it), and still obtain a functional molecule with desirable characteristics (e.g. tumoricidal and/or immunostimulatory effects).
Accordingly, functional-conservative derivatives or variants are those in which a given amino acid residue in a protein has been changed without altering the overall conformation and function of the polypeptide, including, but not limited to, replacement of an amino acid with one having similar properties (such as, for example, polarity, hydrogen bonding potential, acidic, basic, hydrophobic, aromatic, and the like). Amino acids other than those indicated as conserved may differ in a protein so that the percent protein or amino acid sequence similarity between any two proteins of similar function may vary and may be, for example, from 70% to 99% as determined according to an alignment scheme such as by the Cluster Method, wherein similarity is based on the MEGALIGN algorithm. A functional-conservative derivative also includes a polypeptide which has at least 60% amino acid identity as determined by BLAST or FASTA algorithms, preferably at least 75%, more preferably at least 85%, still preferably at least 90%, and even more preferably at least 95%, and which has the same or substantially similar properties or functions as the native or parent protein to which it is compared. Two amino acid sequences are “substantially homologous” or “substantially similar” when greater than 80%, preferably greater than 85%, preferably greater than 90% of the amino acids are identical, or greater than about 90%, preferably greater than 95%, are similar (functionally identical). Preferably, the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wis.) pileup program, or any of sequence comparison algorithms such as BLAST, FASTA, etc.
The amino acid changes may be achieved by changing codons in the DNA sequence, according to Table 1.
For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of tumoricidal effects. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and, of course, in its DNA encoding sequence, and nevertheless obtain a protein with like properties. It is thus contemplated that various changes may be made in the polypeptide sequences of the invention, or corresponding DNA sequences which encode said polypeptides, without appreciable loss of their biological activity. Said tumoricidal activity and immunostimuolatory activity can be assessed by various techniques well-known in the art, such as for instance the assays referred in the Example.
As outlined above, amino acid substitutions are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.
In specific embodiments, it is contemplated that polypeptides according to the invention may be modified in order to improve their therapeutic efficacy. Such modification of therapeutic compounds may be used to decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity of potentially important therapeutic compounds can be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution.
A strategy for improving drug viability is the utilization of water-soluble polymers. Various water-soluble polymers have been shown to modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers; and modify the rate of clearance from the body. To achieve either a targeting or sustained-release effect, water-soluble polymers have been synthesized that contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain. For example, Pegylation is a well established and validated approach for the modification of a range of polypeptides. Therefore, the polypeptides of the invention may be covalently linked with one or more polyethylene glycol (PEG) group(s).
In another embodiment the polypeptides of the invention are covalently coupled to a tumor targeting agent as well known in the art. Non limiting examples include but are not limited to antibodies directed against the EDB domain of fibronectin, antibodies or agents binding Vascular endothelial growth factor receptor 2, antibodies or molecules binding fibroblast growth factor receptor-1, antibodies or agents that interact with CD31, antibodies or agents interacting with tumor lymphatic endothelium (Podoplanin, Lyve-1), or antibodies or agents binding to αVβ3 integrin such as RGD peptides, or antibodies or agents interacting with tumor membrane-bound and intracellular targets.
Another aspect of the invention relates to an isolated, synthetic or recombinant nucleic acid encoding for a MDA-5 polypeptide according to the invention. Typically, said nucleic acid is a DNA or RNA molecule, which may be included in any suitable vector, such as a plasmid, nanoparticle, cosmid, episome, artificial chromosome, phage or a viral vector. The terms “vector”, “cloning vector” and “expression vector” mean the vehicle by which a DNA or RNA sequence (e.g. a foreign gene) can be introduced into a host cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence.
Such vectors may comprise regulatory elements, such as a promoter, enhancer, terminator and the like, to cause or direct expression of said polypeptide upon administration to a subject. The vectors may further comprise one or several origins of replication and/or selectable markers. The promoter region may be homologous or heterologous with respect to the coding sequence, and provide for ubiquitous, constitutive, regulated and/or tissue specific expression, in any appropriate host cell, including for in vivo use. Examples of promoters include bacterial promoters (T7, pTAC, Trp promoter, etc.), viral promoters (LTR, TK, CMV-IE, etc.), mammalian gene promoters (albumin, PGK, etc), and the like.
By using cancer-selective promoters, MDA-5 can be targeted directly in cancers resulting in cancer cell death and induction of interferon-beta, resulting in stimulation of an cancer-specific immune response. Examples of cancer-selective promoters include progression elevated gene-3, astrocyte elevated gene-1, survivin, telomerase, truncated CCN1, melanoma differentiation associated gene-9/syntenin-1, etc.
Examples of plasmids include replicating plasmids comprising an origin of replication, or integrative plasmids, such as for instance pUC, pcDNA, pBR, and the like. Examples of viral vectors include adenoviral, retroviral, herpes virus, vaccinia virus and AAV vectors. Such recombinant viruses may be produced by techniques known in the art, such as by transfecting packaging cells or by transient transfection with helper plasmids or viruses.
There are several ways in which vectors of the invention can be administered or “directly contacted” with target cells. The term “directly contacting” can refer to intratumoral delivery of the therapeutic agent. Approaches to define cancer-selective expression include using cancer-selective promoters to regulate expression, use of nanoparticles containing PEI to facilitate cell uptake and delivery in liposomes, ultrasound-targeted microbubble-destruction (UTMD) approach, or using cellular delivery vehicles (dendritic cells and T-cells).
For ex vivo somatic gene therapy, the target cells are removed from the body, cultured in the laboratory with a vector, and re-inserted into the body. This process is usually carried out using blood cells since it is simple to remove and return. For in situ somatic gene therapy, the vector is placed directly into the affected tissue. For in vivo somatic gene therapy, the vector is injected into the bloodstream, and is able to find and insert new genes only into the cells for which it was specifically designed. Vectors used in gene therapy can be classified as viral or non-viral.
For example, in one embodiment, the MDA-5 gene is administered to tumor sites for in situ therapy and induces systemic tumor-specific immune responses, resulting in efficient eradication of both treated primary tumors and distant cancer metastases.
In another embodiment, cancer cell lines or tumor cells derived from patients are genetically modified with MDA-5. MDA-5-expressing cancer cells are then irradiated and used as cell vaccines to immunize cancer patients for induction of cancer-specific immune responses.
In another embodiment, methods such as ultrasound-targeted microbubble-destruction (UTMD) allow for direct delivery of MDA-5 to tumors in a defined manner. By destroying targeted tumors, a systemic immune response resulting in eradication of metastasis will occur.
Thus, an embodiment, the invention provides a method for treating cancer comprising administering a subject in need thereof with a therapeutically effective amount of a polypeptide or nucleic acid of the invention.
The term “treating” or “treatment”, as used herein, means reversing, alleviating, inhibiting the progress of, or ameliorating the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
The term “prevent” or “prevention” refers to any success or indicia of success in the forestalling or delay of cancer recurrence/relapse in patients in clinical remission, as measured by any objective or subjective parameter, including the results of a radiological or physical examination. The patient may have cancer at the time of treatment (and thus future recurrence of the cancer is prevented) or may be in remission, e.g. after treatment with the agents of the invention and/or another course of therapy. Thus, the agents of the invention may be used as an anti-cancer vaccine.
By a “therapeutically effective amount” is meant a sufficient amount of the molecule to treat a cancer, (for example, to limit tumor growth or to slow or block tumor metastasis) at a reasonable benefit/risk ratio applicable to any medical treatment. It will be understood, however, that the total daily usage of the molecules and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific polypeptide employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific polypeptide employed; the duration of the treatment; drugs used in combination or coincidental with the specific polypeptide employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
In a particular embodiment the polypeptide or nucleic acid of the invention may be administered sequentially or concomitantly with one or more active agents selected from the group consisting of a Melanoma Differentiation-Associated gene 7 (MDA-7)-encoding polynucleotide, a MDA-7 polypeptide, glucose-regulated protein 170 (grp170), grp170-flagellin hybrid chaperone (Flagrp170), or a functional-conservative derivative thereof, and an immune checkpoint inhibitor, such as a PD-1, PD-L1, B7-1/B7-2, or CTLA-4 inhibitor. An important part of the immune system is its ability to tell between normal cells in the body and those it sees as “foreign.” This lets the immune system attack the foreign cells while leaving the normal cells alone. To do this, it uses “checkpoints”—molecules on certain immune cells that need to be activated (or inactivated) to start an immune response. Cancer cells can use these checkpoints to avoid being attacked by the immune system and thus drugs that target these checkpoints can be used as a cancer treatment. Exemplary PD-1 inhibitors include, but are not limited to, Pembrolizumab and Nivolumab. An exemplary PD-L1 inhibitor includes, but is not limited to, Atezolizumab. In some embodiments, the polypeptide or nucleic acid of the invention works synergistically with an active agent of the invention.
The DNA and amino acid sequences of MDA-7 are represented by SEQ ID NO: 6 and SEQ ID NO: 7, respectively. A functional-conservative derivative of MDA-7 includes, but it not limited to, a “therakine”, which comprises a portion, or active component, of MDA-7 with a Flt-3 secretory motif, that has been shown to display properties similar to MDA-7. The portion of MDA-7 present in the therakine is termed M4 with the DNA and amino acid sequences represented by SEQ ID NO: 8 and SEQ ID NO: 9, respectively. A schematic diagram and structure prediction models of MDA-7 and M4 are shown in
In a particular embodiment the polypeptide or nucleic acid of the invention may be administered sequentially or concomitantly with one or more chemotherapeutic or radiotherapeutic agents.
In one embodiment said chemotherapeutic or radiotherapeutic agents are a therapeutic active agent used as anticancer agent. For example, said anticancer agents include but are not limited to fludarabine, gemcitabine, capecitabine, methotrexate, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, platinum complexes such as cisplatin, carboplatin and oxaliplatin, mitomycin, dacarbazine, procarbazine, epipodophyllotoxins such as etoposide and teniposide, camptothecins such as irinotecan and topotecan, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, L-asparaginase, doxorubicin, epirubicin, 5-fluorouracil and 5-fluorouracil combined with leucovorin, taxanes such as docetaxel and paclitaxel, levamisole, estramustine, nitrogen mustards, nitrosoureas such as carmustine and lomustine, vinca alkaloids such as vinblastine, vincristine, vindesine and vinorelbine, imatinib mesylate, hexamethylmelamine, kinase inhibitors, phosphatase inhibitors, ATPase inhibitors, tyrphostins, protease inhibitors, inhibitors herbimycin A, genistein, erbstatin, and lavendustin A. In one embodiment, additional anticancer agents may be selected from, but are not limited to, one or a combination of the following class of agents: alkylating agents, plant alkaloids, DNA topoisomerase inhibitors, anti-folates, pyrimidine analogs, purine analogs, DNA antimetabolites, taxanes, podophyllotoxins, hormonal therapies, retinoids, photosensitizers or photodynamic therapies, angiogenesis inhibitors, antimitotic agents, isoprenylation inhibitors, cell cycle inhibitors, actinomycin, bleomycin, anthracyclines, MDR inhibitors and Ca2+ ATPase inhibitors.
Additional anticancer agents may be selected from, but are not limited to, cytokines, chemokines, growth factors, growth inhibitory factors, hormones, soluble receptors, decoy receptors, monoclonal or polyclonal antibodies, mono-specific, bi-specific or multi-specific antibodies, monobodies, polybodies.
Further therapeutic active agents may be an antiemetic agent. Suitable antiemetic agents include, but are not limited to, metoclopramide, domperidone, prochlorperazine, promethazine, chlorpromazine, trimethobenzamide, ondansetron, granisetron, hydroxyzine, acetylleucine, alizapride, azasetron, benzquinamide, bietanautine, bromopride, buclizine, clebopride, cyclizine, dimenhydrinate, diphenidol, dolasetron, meclizine, methallatal, metopimazine, nabilone, pipamazine, scopolamine, sulpiride, tetrahydrocannabinols, thiethylperazine, thioproperazine and tropisetron. In a preferred embodiment, the antiemetic agent is granisetron or ondansetron.
In still another embodiment, the other therapeutic active agent can be an opioid or non-opioid analgesic agent. Suitable opioid analgesic agents include, but are not limited to, morphine, heroin, hydromorphone, hydrocodone, oxymorphone, oxycodone, metopon, apomorphine, buprenorphine, meperidine, loperamide, ethoheptazine, betaprodine, diphenoxylate, fentanyl, sufentanil, alfentanil, remifentanil, levorphanol, dextromethorphan, phenazone, pemazocine, cyclazocine, methadone, isomethadone and propoxyphene. Suitable non-opioid analgesic agents include, but are not limited to, aspirin, celecoxib, rofecoxib, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, ketoprofen, indomethacin, ketorolac, meclofenamate, mefenamic acid, nabumetone, naproxen, piroxicam and sulindac.
In yet another embodiment, the further therapeutic active agent can be an anxiolytic agent. Suitable anxiolytic agents include, but are not limited to, buspirone, and benzodiazepines such as diazepam, lorazepam, oxazapam, clorazepate, clonazepam, chlordiazepoxide and alprazolam.
The term “radiotherapeutic agent” as used herein, is intended to refer to any radiotherapeutic agent known to one of skill in the art to be effective to treat or ameliorate cancer, without limitation. For instance, the radiotherapeutic agent can be an agent such as those administered in brachytherapy or radionuclide therapy. Such methods can optionally further comprise the administration of one or more additional cancer therapies, such as, but not limited to, chemotherapies, and/or another radiotherapy.
Another aspect of the invention relates to a pharmaceutical composition comprising a polypeptide or nucleic acid according to the invention and a pharmaceutically acceptable carrier. Typically, polypeptides or nucleic acids according to the invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions.
“Pharmaceutically” or “pharmaceutically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a subject, such as a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
In the pharmaceutical compositions of the present invention for oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, local or rectal administration, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings. Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.
Preferably, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.
The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
Solutions comprising compounds of the invention as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the active polypeptides in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
The preparation of more, or highly concentrated solutions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small tumor area.
Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed.
For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
The polypeptide may be formulated within a therapeutic mixture to comprise about 0.0001 to 1.0 milligrams, or about 0.001 to 0.1 milligrams, or about 0.1 to 1.0 milligrams, or about 1 to 10 milligrams or even about 10 to 100 milligrams per dose or so. Multiple doses can also be administered.
In addition to the compounds of the invention formulated for parenteral administration, such as intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g. tablets or other solids for oral administration; liposomal formulations; time release capsules; and any other form currently used.
It is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
It is noted that, as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
The invention is further described by the following non-limiting examples which further illustrate the invention, and are not intended, nor should they be interpreted to, limit the scope of the invention.
Melanoma differentiation-associated gene 5 (MDA-5, IFIH1), a cytosolic innate pattern recognition receptor, functions as a first line of defense against viral infection by sensing double-stranded RNA (dsRNA). Ectopic expression of MDA-5 has been shown to induce cancer cell death, but the mechanism of action by which MDA-5 exerts these cytotoxic effects is unclear. Here, we demonstrate that ectopic expression of MDA-5 via replication incompetent adenovirus (Ad.Mda-5) initiates multiple signaling cascades, culminating in cytotoxicity and type I interferon (IFN) production in mouse and human prostate cancer cells. This intrinsic dual activity of MDA-5 required the adaptor protein IFN-β promoter stimulator 1 (IPS-1, MAV) and could be functionally uncoupled. MDA-5 lacking N-terminal caspase-recruitment domains (CARDs) engaged an intracellular death program in cancer cells, but was unable to efficiently stimulate expression of IFN-β. In contrast to cancer cells susceptible to MDA-5-mediated cytotoxicity, normal cells were highly resistant and instead developed a robust type I IFN response. Strikingly, intratumoral delivery of Ad.Mda-5 led to regression of pre-established prostate cancers and development of long-lasting antitumor immune memory, which was primarily attributed to the activation of tumor-reactive cytotoxic T lymphocytes and/or natural killer cells. Using the CARDs-truncated MDA-5 mutant, silencing of IPS-1, and antibody blockade of the IFN-α/β-receptor, we further demonstrate that type I IFN signaling was crucial for in situ MDA-5-induced protective antitumor immunity. Therefore, deliberately targeting the evolutionarily conserved MDA-5-IPS-1 antiviral pathway in tumors can provoke parallel tumoricidal and immunostimulatory effects that bridge innate and adaptive immune responses for the therapeutic treatment of cancer.
Early work found that ectopic expression of mda-5 gene induces death of cancer cells (12, 13). We and others recently showed that activation of MDA-5 via intracellular delivery of polyinosinic:polycytidylic acid or poly(I:C), a synthetic mimetic of viral dsRNA, stimulates intrinsic cell death program involving the pro-apoptotic molecules NOXA and Caspases in cancer cells, but not healthy cells (14-16). While MDA-5-induced susceptibility of cancer cells to apoptosis shares the features observed during the elimination of virus-infected cells upon MDA-5 activation, the underlying basis of MDA-5 action in engaging the cancer cell death pathway remains less understood. Given the critical role of MDA-5 in priming type I IFN response and antiviral immunity, the therapeutic potential of MDA-5 in enhancing immune activation against established tumors has yet to be determined.
Male wild-type (WT) C57BL/6 mice were obtained from National Cancer Institute (Bethesda, Md.). IPS-1-deficient mice (IPS-1−/−), athymic nude mice were purchased from Jackson Laboratory (Bar Harbor, Me.). Mice were maintained under specific pathogen-free conditions. All experiments and procedures involving mice were approved by the Institutional Animal Care and Use Committee of Virginia Commonwealth University.
TRAMP-C2 cell line was derived from a prostate tumor that arose in a TRAMP (Transgenic Adenocarcinoma of Mouse Prostate) mouse on a C57BL/6 background (17, 18). TRAMP-C2 cells-expressing ovalbumin (C2-OVA) were generated in our laboratory (19). Human prostate adenocarcinoma line LNCaP and normal human prostate epithelial cell line RWPE-1 (CRL-11609) were from the American Type Culture Collection (ATCC). Cell line authentication was performed using short tandem repeat profiling DNA analysis and electrophoresis automatic sequencing by DDC Medical (Fairfield, Ohio). Mouse bone marrow-derived dendritic cells (BMDCs) were prepared as we previously described (20).
Human mda-5 (GenBank #NM_022168) and mouse mda-5 (GenBank accession # NM_027835) cDNAs were obtained by RT-PCR from THP1-derived macrophages and poly(I:C)-stimulated BMDCs, respectively. The replication-deficient adenovirus (Ad) encoding human influenza hemagglutinin (HA)-tagged human MDA-5 (hMDA-5), mouse MDA-5 (mMDA-5), CARD domains truncated forms of mouse or human MDA-5 (amino acid 252-1025, mMDA-5HC or hMDA-5HC retaining the helicase and CTD domains), 1st CARD domain truncated mouse MDA-5 (amino acid 101-1025, mMDA-5ΔC1), 2nd CARD domain truncated mouse MDA-5 (amino acid 101-200 deleted, mMda-5ΔC2) and control virus Ad. CMV were constructed using AdEasy™ system and packaged in HEK293A cells as previously described (18). Lentiviruses (LV) encoding mouse IPS-1 shRNA for gene knockdown (LV-IPS-1/KD, GCAACCAGACTGGACCAAATA; SEQ ID NO:5) and scrambled control shRNA (LV-SC) were packaged using Phoenix cells as previously described (21).
Cell death was assessed using the Annexin V-FITC apoptosis detection kit (Roche Molecular Biochemicals, Germany) and analyzed by FACSCaliber flow cytometer (Becton Dickinson Biosciences, Franklin Lakes, N.J.). Cell proliferation after Ad infection was measured using MTT assay as previously described (19).
TRAMP-C2 or C2-OVA tumor cells (2×106) were injected subcutaneously (s.c.) in the right flank area of 6-8 weeks-old male C57BL/6 mice. 9-10 days after tumor implantation (approximately 3-5 mm in diameter), mice were randomly divided into groups and treated intratumorally (i.t.) with 1×108p.f.u. of Ads. in 50 μL of PBS every 3 days for a total of 5 doses. LNCaP cells (1×107/mL) in 50 μL cold PBS were mixed with an equal volume of Matrigel and injected s.c. into the right flanks of male athymic nude mice. In some experiments, CD8+, CD4+ T cells, NK cells were depleted by intraperitoneal (i.p.) injection of 2.43, GK1.5, or PK136 antibodies, respectively, as described previously (18). For IFN-γ neutralization or blockade of type I IFN-α/β receptor, 200 μg anti-IFN-γ (clone XMG1.2) or 1 mg anti-IFNAR1 (clone MAR1-5A3) antibodies from Bio X Cell (West Lebanon, N.H.) were administrated i.p. five times at 3-days intervals, beginning one day prior to therapy.
Tumor tissues were processed by enzymatic digestion into single cell suspension as we previously described (18). Splenocytes from C2-OVA tumor bearing mice were stimulated with 1 μg/mL OVA254-267 peptide for 4 days. Tumor-infiltrating leukocytes from tumor tissues, freshly isolated or peptide-stimulated splenocytes were stained with antibodies to CD8a, NK1.1, CD3, and analyzed with a flow cytometer. Intracellular staining of IFN-γ and Granzyme B was performed as previously described (22).
qRT-PCR
Real time PCR was performed using TaqMan primers and carboxyfluorescein (FAM)-labeled probe sets from Life Technologies as we described previously (21). Target gene expression was normalized to Bactin and analyzed using the 2(−ΔΔCT) relative quantification method.
The cytolytic activity of cytotoxic T cell (CTL) and natural killer (NK) cells was determined based on lactate dehydrogenase (LDH) release assay using a CytoTox 96 Non-Radioactive Cytotoxicity Assay Kit (Promega, Madison, Wis.).
Experiments were repeated two or three times. Quantitative data are expressed as mean±S.D. for all figure panels in which error bars are shown. Statistical significance between groups within experiments was determined by the Student's t-test or ANOVA test. A p value of less than 0.05 was considered statistically significant.
The proteolytic cleavage and separation of the N-terminal CARD domains from helicase domain of MDA-5 has been shown to accelerate apoptotic stimuli, such as virus infection and FasL treatment (11). To confirm the pro-apoptotic effect of ectopic expression of MDA-5, we infected mouse prostate cancer cells (i.e., TRAMP-C2) with an adenovirus encoding human MDA-5, mouse MDA-5, or mMDA-5HC (i.e., the CARD domains-truncated form of mouse MDA-5). Both mouse and human homologues of MDA-5 as well as mMDA-5HC were comparable in engaging intracellular death pathway, indicated by the cleavage of Caspase 3 and its main target poly (ADP-ribose) polymerase (PARP) (
Taking into consideration that MDA-5 contains two N-terminal CARD domains, we constructed two additional truncated mouse MDA-5 mutants lacking either the first CARD (i.e., mMDA-5ΔC1) or the second CARD (i.e., mMDA-5ΔC2) to further dissect their roles in MDA-5-induced type I IFN response. As shown in
Given the documented role of the adaptor protein IPS-1 in RIG-I-like receptor-induced type I IFN response (6), we examined the potential involvement of IPS-1 in MDA-5 expression-induced cancer cell death and type I IFN production. Lentiviral-mediated IPS-1 knockdown in TRAMP-C2 cells conferred substantial protection from MDA-5-induced cell death, as shown by reduced frequency of Annexin V+ cells (
The mitochondrial localization of IPS-1, disruption of mitochondria membrane potential, and cell death are important cellular responses to viral infection (23, 24). Confocal microscopy imaging showed a major cytoplasmic localization of ectopically expressed MDA-5 in Ad.mMda-5 infected TRAMP-C2 cells. MDA-5 protein lacks putative mitochondrial targeting sequence based on conventional prediction algorithms (TargetP, MitoProt). However, a small portion of HA-tagged MDA-5 were clearly visible in the mitochondria compartment when co-staining with the mitochondrial marker MitoTracker (
A Previous study reported that deficiency of IPS-1 abolished type I IFN response in various cell types upon viral infection (26). We found that genetically ablating IPS-1 in TRAMP-C2 tumor cells nearly completely blocked MDA-5 overexpression-induced IFN-β production. However, MDA-5HC failed to stimulate IFN-β production in TRAMP-C2 cells, suggesting the CARD domain is essential for MDA-5-IPS-1 signaling-triggered type I IFN response (
We next examined the effects of MDA-5 overexpression in dendritic cells (DCs), which play a pivotal role in responding to viral infection and in shaping host immunity (28). In contrast to cancer cells, ectopic expression of MDA-5 or MDA-5HC had little effect on viability of BMDCs (
Previous studies showed that intracellular delivery of synthetic dsRNA poly(I:C) using cationic liposome polyethylenimine (pIC-PEI) induces type I IFN-independent apoptosis in cancer cells via activation of MDA-5 (14-16). The concurrent upregulation of anti-apoptotic molecule Bcl-xL in normal cells is believed to render these cells less susceptible to pIC-PEI induced apoptosis (15). Similarly, primary BMDCs or normal human prostate epithelial cell line RWPE-1 were resistant to MDA-5 expression-induced apoptosis as compared with mouse (i.e., TRAMP-C2) or human (i.e., LNCaP) prostate cancer cells (
Interestingly, ectopic expression of MDA-5 stimulated much higher levels of IRF3 activation in mouse TRAMP-C2 tumor cells than did pIC-PEI (
To test the hypothesis that tumoricidal activity of MDA-5 and concurrent induction of type I IFNs drives antitumor immunity in vivo, we exploited OVA-expressing TRAMP-C2 tumor line (C2-OVA) that permits immunomonitoring of antigen-specific immune response (19). Mice established with C2-OVA tumors (average size 50 mm3) received i.t. treatment with Ad.CMV, Ad.mMda-5, and Ad.mMda-5HC. While Ad.CMV had little effect, Ad.mMda-5HC that is impaired in inducing type I IFNs partially delayed tumor growth. However, four out of five mice that had been treated with Ad.mMda-5 rejected their tumors (
Upon stimulation with tumor cell lysates, splenocytes or draining lymph node cells from Ad.mMda-5-treated mice showed enhanced production of IFN-γ and IL-2 (
In the C2-OVA tumor model, approximately 80% of mice receiving in situ MDA-5 therapy showed tumor regression. These tumor-free mice were protected from tumor re-challenge two months later with either C2-OVA or parental TRAMP-C2 cells. Despite no tumor development in these mice upon secondary challenge, we showed strong induction of IFN-γ in the spleens or splenocytes stimulated with MHC I-restricted OVA254-267 peptide (
Since NK cells are involved in the antitumor activity of MDA-5 therapy in immune competent mice, we further examined its potential role for controlling human prostate cancer (i.e., LNCaP) in athymic nude mice, which have a functional NK cell compartment. As predicted, Ad.hMda-5 therapy induced NK cell activation, as shown by intracellular cytokine staining for IFN-γ-expression in tumor-infiltrating NK cells (
Considering the robust induction of IFN-β in the tumor environment following MDA-5 treatment, we sought to define the contribution of type I IFN response to MDA-5 expression-generated antitumor immunity. In vivo blockade of IFN-β function using antibodies against IFN-α/β receptor subunit 1 (IFNAR-1) abolished the therapeutic effect of Ad.mMda-5 treatment in C2-OVA tumor model, whereas neutralization of endogenous IFN-γ only partially attenuated the antitumor activity of MDA-5 (
Considering that IPS-1 mediates type I IFN production by ectopic expression of MDA-5, we down-regulated the IPS-1 levels in the tumor sites by intra/peritumoral injection of lentivirus-encoding IPS-1 shRNA (
The critical role of the innate PRR MDA-5 has been well recognized in the host antiviral response by sensing cytoplasmic dsRNA and initiating a well-synchronized signaling cascade resulting in upregulation of type I IFNs and an array of IFN-stimulated genes. Emerging evidence shows that ectopic expression of MDA-5 (2, 12, 13) or viral dsRNA mimetic (14-16, 32) directly induces a type I IFNs-independent tumoricidal effect in human melanoma cancer cells (15). Considering the therapeutic potential of MDA-5, the current study provides new insight into the molecular basis of MDA-5 function in provoking cancer cell death and type I IFN signaling. Moreover, we dissect the impact of these two features of MDA-5 on its therapeutic capacity in immune competent mouse model and demonstrate, for the first time, that MDA-5 activation elicited type I IFN signaling and consequent priming of innate and adaptive immune responses are essential for the antitumor potency of MDA-5-targeted therapy.
Our data show that ectopic expression of mouse or human MDA-5 in prostate cancer cells triggers two distinct and functionally independent pathways, i.e., induction of cell death and production of type I IFNs. Both mouse and human MDA-5 are comparable in engaging these two cellular processes, probably due to their sequence homology and evolutionarily conservative function in the host viral defense. Intriguingly, while tandem CARD domain-truncated MDA-5 (i.e., mouse or human MDA-5HC, mMDA-5ΔC1, or mMDA-5ΔC2) is fully competent in inducing cancer cell death, it lacks the ability to stimulate type I IFN production (
We demonstrate that MDA-5 overexpression-induced cell death is specific for cancer cells (e.g., mouse or human prostate cancer), not normal cells (e.g., prostate epithelial cells, primary myeloid DCs), which is generally consistent with our previous finding in pIC-PEI-transfected human melanoma (14) and human pancreatic cancer (16) cells. However, ectopic expression of MDA-5 appears to more efficiently induce type I IFN production in both prostate cancer cells and normal cells. In addition, pIC-PEI transfection displays some cytotoxic effects on normal cells compared to adenovirus-mediated infection for MDA-5 overexpression that exhibits little normal cell toxicity, which may be caused by the activation of multiple PRRs (e.g., RIG-I, TLR3 or TLR5) in response to the pIC-PEI stimulation (34). Furthermore, compared to pIC-PEI, MDA-5 overexpression induces stronger activation of IRF3 as well as much more robust and sustained IFN-β production that may potentially support immune-mediated tumor destruction.
A striking finding of our study is that, in addition to its direct tumoricidal effect, tumor-targeted MDA-5 therapy potentiates highly potent antitumor immune responses and demonstrates superior antitumor activity (
Type I IFNs are critical for functional activation of NK cells and antigen-presenting cells (e.g., DCs) as well as cross-priming of CD8+ CTLs in immune surveillance or tumor immunotherapy (35-37). We have provided compelling evidence supporting a crucial role of type I IFN pathway in MDA-5 therapy-induced antitumor immunity. First, deletion of CARDs that are critical for type I IFN production in cancer cells substantially reduced the antitumor efficacy of MDA-5, which coincides with decreased activation and infiltration of cytotoxic effector cells in the TME (
Collectively, we demonstrate that ectopic expression of MDA-5 selectively induces two distinct pathways, i.e., cancer cell death and type I IFN response, both of which is mediated by the adaptor molecule IPS-1. In situ MDA-5-targeted therapy generates superior antitumor immune response that is critically dependent on type I IFN response, highlighting a previously unappreciated role of MDA-5 in antitumor immunity. Since the immunosuppressive tumor microenvironment presents a major challenge for successful cancer immunotherapy, strategically engaging this ancient viral sensing MDA-5-IPS-1 pathway (38) in the TME represents a novel approach to efficiently reprogramming or restoring protective antitumor immunity for cancer treatment.
Tumor xenografts were established subcutaneously in left flank of C57BL/6 mice by injecting 0.5*106 cells of B16 cells mixed with matrigel in 1:1 ratio. Once tumors reached a palpable size, the mice were divided into different groups (four different groups and 3 mice for each group were used for survival and received virus either alone or in combination (108vp for 8 doses). The mice were sacrificed as the tumor reached the maximum allowable limit. The survival curve was plotted which was calculated from the tumor plantation to the day of sacrifice. The day of sacrifice is the day when the tumor approaches the maximum allowable limit. As shown in
Tumor xenografts were established subcutaneously in the left flank of C57BL/6 mice by injecting 0.5*106 cells of B16 cells mixed with matrigel in 1:1 ratio. Once tumors reached a palpable size, the mice were divided into different groups (four different groups and 3 mice per group) and received virus either alone or in combination (108vp for 8 doses). The size of tumors were measured on each alternate day and the graph was plotted. As shown in
Tumor xenografts were established subcutaneously in left flank of C57BL/6 mice by injecting 0.5*106 cells of B16 cells mixed with matrigel in 1:1 ratio. Once tumors reached a palpable size, the mice were divided into different groups (four different groups and 3 mice per group) and received virus either alone or in combination (108vp for 8 doses). The weight of tumors were measured at the end point and the graph was plotted. As shown in
A transgenic mouse model that develops prostate cancer was developed. A Hi-myc prostate tumor was isolated in culture (termed a murPDX). This tumor cell line was xenografted into Hi-myc mice and the tumor was infected with Ad.CTV. This caused tumor suppression in the infected xenograft as well as in the endogenous developing prostate tumor. As shown in
Prostate cancer (CaP) is the most prevalent cancer and the second leading cause of cancer-related death in American men.1 The therapeutic options for patients with prostate cancer include radiotherapy and treatment with cytotoxic chemotherapeutic agents. Despite a palliative benefit, these approaches do not engender a long-term beneficial effect on the overall survival of patients. Late stage prostate cancer patients may benefit from hormone therapy, or androgen deprivation therapy. Unfortunately, virtually all patients eventually progress to hormone-refractory disease after a short duration of response, resulting in therapy-resistant disease and patient death. Given that cancer is a highly heterogeneous disease resulting from genetic changes with histopathological variation, multi-functional strategies may be mandatory to promote improved treatment outcomes. One potential solution is to exploit novel therapeutic agents capable of beneficially and effectively promoting immunostimulatory prostate cancer death. A systemic and sustained antitumor immune response generated at the time of initial molecular-targeted therapy would provide significant clinical benefits in cancer patients.
The cytoplasmic RIG-I-like receptor MDA-5, a helicase now considered as a first line of defense against viral double-stranded RNA (dsRNA),2 was initially identified as a melanoma differentiation-associated gene by our group.3 Upon recognition of viral dsRNA or its mimetic, e.g., poly(I:C), MDA-5 triggers a complex signal transduction cascade resulting in the activation of transcription factors, NF-κB and IFN regulatory factor 3 (IRF-3) in particular, and the production of cytokines including class I IFNs.4,5 Surprisingly, others and we revealed that ectopic expression of MDA-56 or stimulation of MDA-57,8 selectively led to induction of cell death in tumor cells, but not healthy cells. Therefore, ‘danger’ sensing MDA-5 represents a unique target for therapeutic intervention that may help overcome the characteristic resistance of prostate cancer to apoptosis.
Studies by others and us have demonstrated stress proteins are capable of integrating both innate and adaptive immune responses, and can be utilized as physiological adjuvants to develop novel immunotherapeutic approaches9. Indeed, our extensive studies have shown that glucose-regulated protein 170 (grp170) is highly efficient in promoting antigen cross-presentation and tumor-specific immunity.10-16 The immune-modulating activity of grp170 may be attributed to its highly efficient chaperoning capacity, because molecular chaperoning function is essential for the high potency of grp170 as an immune adjuvant.13 To further improve the immunostimulatory activity of Grp170, We recently constructed a secretable grp170-flagellin hybrid chaperone (Flagrp170), which contains the defined NF-κB-activating region of flagellin.17 Flagellin is a major structural protein of bacterial flagella18 and a ligand for TLR5,19 which has been shown to serve as a potent systemic adjuvant.20,21 The control exerted by TLRs in linking innate and adaptive immunity is instrumental in the efficacy of vaccines containing TLR ligands. Many established and experimental vaccines incorporate agonists for TLRs, not only to protect against infectious diseases, but also in therapeutic immunization against cancer.22,23 This engineered novel hybrid chaperone is designed not only to facilitate cross-presentation of associated tumor antigens (signal-1), but also to provide TLR-engaging signal (signal-2) crucial for the functional activation of DC.
Based on the unique activities of MDA-5 and Flagrp170, simultaneous targeting of tumor cells for apoptotic destruction (MDA-5) and immune compartment for activation of tumor immunity (Flagrp170) will be advantageous when combined into one therapeutic regimen, which will more effectively eradicate prostate cancer and/or micrometastatic diseases. The studies we proposed were designed to interrogate and evaluate a novel gene-based therapy targeting ‘danger’ sensing innate PRRs in both tumor and immune compartments. The synergistic actions of these two therapeutic agents provide a powerful and convenient mode for inducing systemic antitumor immunity; therefore, leading to the best long-term protection against prostate cancer. Our studies present evidence supporting this novel concept of tumor-site-targeted vaccination and provide an improved understanding of the underlying immunological mechanisms.
To test whether combined administration of Ad. MDA-5/Flagrp170 results in additive and potentially synergistic tumor control, we evaluated the antitumor efficacy of the combinatorial therapy in comparison with treatment with MDA-5 or Flagrp170 alone in the therapeutic setting. We showed that combinatorial delivery of Ad.MDA5/Flagrp170 resulted in a profound inhibition of the growth of established TRAMP-C2 tumor, when compared to single therapy with Ad.MDA-5 or Ad.Flagrp170 (
As predicted, enhanced antitumor potency of the combinatorial therapy correlated with markedly increased activation of T lymphocytes. In vitro cytolytic assays indicate the involvement of both CD8+ cytotoxic T lymphocytes and cytotoxic NK cells in tumor destruction augmented by the combinatorial therapy. These findings support the hypothesis that the coordinated engagement of both innate and adaptive immune components contributes to the eradication of prostate cancer cells by the combinatorial therapy. In situ Flagrp170 therapy preferentially drives the Th1 polarization of the tumor microenvironment (TME), as evidenced by marked elevation of IL-12 and IFN-γ27. We carried out experiments to determine the immune remodeling effect of the MDA-5/Flagrp170 combination therapy in the TME. We showed that Intratumoral administration of Ad.MDA-5/Flagrp170 resulted in the highest level of Th1 cytokines (IL-12 and IFN-γ), CCL2 or chemoattractant monocyte chemoattractant protein-1 (MCP-1), and IFN-β in TRAMP-C2 prostate tumor tissues, as indicated by qRT-PCR (
Based on highly potent immunostimulatory activity of Flagrp170 in enhancing the cross-presentation of tumor antigens and provoking a strong tumor-specific CTL response27, we predicted that combined MDA-5/Flagrp170 therapy results in additive and potentially synergistic antitumor effects. Our previous work showed that combinatorial delivery of Ad.MDA5/Flagrp170 led to a profound inhibition of established TRAMP-C2 tumors, compared to treatment with either Ad.MDA-5 or Ad.Flagrp170. Analyses of tumor infiltrating lymphocytes demonstrated that combined MDA-5/Flagrp170 regimen resulted in highly efficient recruitment of CD8+ T cells (i.e., CTLs) and NK cells (
We also examined the effector functions of CTLs and NK cells using a different preclinical model (B16 tumor) after combined MDA-5/Flagrp170 therapy (
We have investigated the feasibility of delivering MDA-5/Flagrp170 carrying adenoviruses using the ultrasound-targeted microbubble-destruction (UTMD) approach and evaluated the therapeutic potency of this combination in PC transgenic Hi-myc mice (Details of experimental protocol provided in the Figure legend) (
Our research demonstrate that engineered chimeric chaperone Flagrp170 and MDA-5 represent two unique therapeutic agents for promoting therapeutic antitumor response. Rationally combined MDA-5/Flagrp170 treatment clearly shows therapeutic advantages over either single treatment, which we believe are attributed to the mobilization of multiple antitumor mechanisms, including direct cancer cell toxicity, immune activation and protective antitumor immunity. Mobilizing multivalent cancer-destroying pathways and establishing long-term protective immunity is anticipated to provide an optimal control of prostate cancer and metastases and to substantially reduce the risk of tumor escape. Our findings are expected to advance the field of cancer therapeutics, including those employing chemotherapy and immunotherapy, because our strategy offers a new approach to achieving in situ vaccination against the cancer and inducing antitumor immunity during initial molecular targeted therapy. The unique advantages of this rationally combined therapy provide significant benefits to prostate cancer patients. Moreover, our research on MDA-5 also revealed previously under-appreciated feature of this therapeutic molecule in promoting type I interferon response and innate immunity. This novel finding extends the previously reported role of MDA-5 in triggering cancer cell death and enhances our understanding of MDA-5 action as a therapeutic agent in engaging the host immune system. To facilitate the systemic delivery of Ad.mda-5/Flagrp170 we are pioneering the use of targeted (decorated) microbubbles (d-MBs) combined with focused ultrasound, the ultrasound-targeted microbubble-destruction (UTMD) approach, to facilitate delivery of therapeutics adenoviruses in in target organs (e.g., prostate tumors) more efficiently. To evaluate our novel in situ cancer vaccination approach, we have successfully developed a unique double transgenic mouse model in which we can follow cancer progression in the prostate using non-invasive bioluminescence imaging approaches. Our findings provide a scientific rationale for combining molecular-targeted therapy with immunotherapies to achieve durable and optimal control of prostate cancer and metastasis.
While the invention has been described in its preferred embodiments, those of skill in the art will recognize the invention can be practiced with variations within the spirit and scope of the appended claims.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US16/50900 | 9/9/2016 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62215887 | Sep 2015 | US |
