Patent Application
20130252950
mTOR is an evolutionarily conserved ser/thr protein kinase that controls many critical cellular processes including growth, protein translation, metabolic flux, and cell survival. mTOR functions as the core catalytic component of two structurally and functionally distinct signaling complexes. mTOR complex 1 (mTORC1) regulates cell growth and is responsible for the well-characterized role of mTOR in controlling protein translation whereas mTOR complex 2 (mTORC2) regulates cell survival and the actin cytoskeleton (1-3). The mechanisms responsible for modulating mTORC1 and mTORC2 activity in response to upstream inputs such as growth factors, energetic status, and amino acid levels have been well studied (1). In contrast, relatively few direct substrates of mTOR have been identified and in many cases the mechanisms underlying mTOR's ability to regulate important aspects of cell biology are not known.
Misregulated mTOR activity is a common feature of most cancers (2). Despite great interest, clinical trials for evaluating the selective mTORC1 inhibitor rapamycin as an anti-cancer agent have met with limited success (3). Rapamycin resistance has emerged as a major challenge to its clinical use (4) and is caused in part by feedback loops that activate the PI3K and MAPK signaling pathways in rapamycin-treated cells through poorly understood mechanisms (5, 6).
Functional characterization of the mTOR signaling pathways has been hampered by the paucity of substrates that have been identified to date. Identifying novel substrates of mTORC1 and mTORC2 is important for making progress toward our general understanding how mTOR signals to downstream effectors and to specifically define components of the feedback loops involved in rapamycin resistance. The best-characterized mTORC1 substrates include p70S6K and 4EBP, whereas mTORC2 phosphorylates several members of the AGC kinase family, including Akt, SGK, and PKC.
The present invention is based in part on large-scale quantitative phospho-proteomics experiments that were performed to define the entire signaling networks downstream of both mTORC1 and mTORC2. Novel mTORC1 substrates identified herein include, but are not limited to Grb10, FOXK1, ZEB2, NDRG3, LARP1, SRPK2, CDK12, MIB1, and IBTK.
Extensive characterization of a novel mTORC1 substrate, the growth factor receptor-bound protein 10 (Grb10), shows that mTORC1-mediated phosphorylation stabilizes Grb10, leading to feedback inhibition of the PI3K and MAPK pathways. In addition, Grb10 expression was shown to be frequently downregulated in a variety of cancers. Interestingly, loss of Grb10 and the well-established tumor suppressor PTEN are mutually exclusive events. Grb10 has been found to be both a novel mTORC1 substrate and a tumor suppressor with relevance across a broad spectrum of cancer subtypes.
In some aspects, the invention provides methods for determining mTOR kinase activity in a cell, the method comprising obtaining a cancer cell from a subject diagnosed to have a cancer, determining the level of Grb10 phosphorylation in the cell, and comparing the level of Grb10 phosphorylation to a reference level, wherein if the level of Grb10 phosphorylation in the cell is higher than the reference level, then the cell is determined to exhibit an elevated level of mTOR kinase activity. In some embodiments, the cell is a normal or healthy cell. In some embodiments, the cell is a cell obtained from a subject not diagnosed with a neoplastic disease. In some embodiments, the cell is a cell obtained from a subject not diagnosed with a cancer. In some embodiments, the cell is a neoplastic cell. In some embodiments, the cell is a cancer cell. In some embodiments, the cell is a cell obtained from a subject diagnosed with a neoplastic disease, for example, with a cancer.
In some aspects, the invention provides methods for selecting a treatment of a neoplastic disease, for example, of a cancer, in a subject, the method comprising obtaining a cell from a subject diagnosed to have a neoplastic disease, for example, a cancer, exhibiting an elevated level of mTOR activity; determining the level of Grb10 expression in the cell; and comparing the level of Grb10 expression to a reference level, wherein if the level of Grb10 expression in the cell is higher than the reference level, then the cell is determined to exhibit a high likelihood of expressing an elevated level of PI3K, Akt, and/or MAPK activity upon being contacted with an mTORC1 inhibitor.
Other aspects of this invention provide methods for determining mTOR kinase activity in a cell by determining the level of phosphorylation of a phosphorylation site disclosed in Table 1, 2, 3, 7, 8, or 11 in the cell, and comparing the level of phosphorylation to a reference level, wherein if the level of phosphorylation is higher than the reference level, then the cell is determined to exhibit an elevated level of mTOR kinase activity, or if the level of phosphorylation is equal or lower than the reference level, then the cell is determined to not exhibit an elevated level of mTOR kinase activity. In certain embodiments, if a phosphorylation site determined to exhibit a higher level of phosphorylation in the cell as compared to the reference level is a class I phosphorylation site, then the cell is determined to exhibit an elevated level of rapamycin-sensitive mTORC1 activity. In certain embodiments, if a phosphorylation site determined to exhibit a higher level of phosphorylation in the cell as compared to the reference level is a class II phosphorylation site, then the cell is determined to exhibit an elevated level of rapamycin-insensitive mTORC1 and/or mTORC2 activity. In some embodiments, if a phosphorylation site determined to exhibit a higher level of phosphorylation in the cell as compared to the reference level is a class III phosphorylation site, then the cell is determined to exhibit an elevated level of rapamycin-sensitive mTOR activity, or an elevated level of rapamycin-insensitive mTOR activity, or both.
In some embodiments, the methods provided herein further comprise selecting a method of treatment of the subject based on the level of phosphorylation of the phosphorylation site. In some embodiments, if the cell is determined to exhibit an elevated level of mTOR kinase activity, then a method of treatment is selected that includes administering an effective amount of an mTOR kinase inhibitor to the subject. In some embodiments, if the cell is determined to not exhibit an elevated level of mTOR kinase activity, then a method of treatment is selected that does not include administering an mTOR kinase inhibitor. In some embodiments, if the cell is determined to exhibit an elevated level of rapamycin-sensitive mTORC1 activity, then a method of treatment is selected that comprises administering an effective amount of an inhibitor of rapamycin-sensitive mTORC1 kinase activity (e.g., rapamycin or a rapamycin analog) to the subject. In some embodiments, if the cell is determined to exhibit an elevated level of rapamycin-insensitive mTORC1 and/or mTORC2 activity, then a method of treatment is selected that comprises administering an effective amount of an inhibitor of rapamycin-insensitive mTORC1 kinase activity to the subject. In some embodiments, if the cell is determined to exhibit an elevated level of rapamycin-sensitive mTOR kinase activity, or an elevated level of rapamycin-insensitive mTOR kinase activity, or both, then a method of treatment is selected that comprises administering an effective amount of an inhibitor of rapamycin-sensitive and rapamycin-insensitive mTOR kinase activity or a combination of an inhibitor of rapamycin-sensitive mTOR kinase activity and an inhibitor of rapamycin-insensitive mTOR kinase activity to the subject.
In some embodiments, the method of treatment further comprises administering to the subject an effective amount of a compound that stabilizes Grb10 or that inhibits the degradation of Grb10. In some embodiments, the method of treatment further comprises administering an effective amount of an inhibitor of PI3K, Akt, or MAPK to the subject.
Some aspects of this invention provide a phosphoproteomics array that includes a plurality of phosphosensitive antibodies or antibody fragments each of which specifically binds to phosphorylation site disclosed in Table 1, 2, 3, 7, 8, or 11. In some aspects, the invention also provides a method of using a phosphoproteomics array to determine mTOR activity in a cell by contacting a proteinaceous sample derived from a cell, for example, from a cancer cell, with a phosphoproteomics array as described herein under conditions suitable for a protein expressed in the cell to bind to an antibody or antibody fragment of the array, determining the level of phosphorylated protein bound to an antibody or antibody fragment of the array, and comparing the level of phosphorylated protein bound to an antibody or antibody fragment of the array to a reference level. If the level phosphorylated protein in the sample derived from the cell is higher than the reference level, then the cell is determined to exhibit an elevated level of mTOR kinase activity.
In other aspects, the invention provides methods of identifying an mTOR kinase inhibitor by contacting an mTOR kinase with a polypeptide with a phosphorylation site disclosed in Table 1, 2, 3, 7, 8, or 11 under conditions suitable for the mTOR kinase to phosphorylate the phosphorylation site in the presence of a candidate agent, determining the level of phosphorylation at the phosphorylation site, and comparing the level of phosphorylation to a reference level. If the level of phosphorylation is lower than the reference level, then the candidate agent is identified as an mTOR kinase inhibitor.
In some embodiments involving a phosphorylation site disclosed in Table 1, 2, 3, 7, 8, or 11, the phosphorylation site is not a phosphorylation site previously known to be an mTOR target.
The subject matter of this application may involve, in some cases, interrelated products, alternative solutions to a particular problem, and/or a plurality of different uses of a single method or agent. Other advantages, features, and uses of the invention will become apparent from the following detailed description of non-limiting embodiments of the invention when considered in conjunction with the accompanying drawings.
In the tables and the database, *, @, ̂ and # denote phosphorylation (Ser, Thr and Tyr), heavy Lys, heavy Arg and oxidation (Met), respectively. International Protein Index (IPI) reference numbers are given in some of the tables and the database provided herein. The IPI database can be accessed at the European Bioinformatics Institute homepage (www.ebi.ac.uk/), for example, at (www.ebi.ac.uk/IPI/IPIhelp.html). Each IPI database entry provided by accession number is incorporated herein by reference for disclosure of the respective proteins amino acid sequence and accompanying protein information.
The term “antibody,” as used herein, refers to an immunoglobulin, whether natural or wholly or partially synthetically produced. All derivatives thereof which maintain specific binding ability are also included in the term. The term also covers any protein having a binding domain which is homologous or largely homologous to an immunoglobulin binding domain. These proteins may be derived from natural sources, or partly or wholly synthetically produced. An antibody may be monoclonal or polyclonal. The antibody may be a member of any immunoglobulin class, including any of the human classes:IgG, IgM, IgA, IgD, and IgE. Derivatives of the IgG class, however, are preferred in the present invention.
The term “antibody fragment,” as used herein, refers to any derivative of an antibody which is less than full-length. Preferably, the antibody fragment retains at least a significant portion of the full-length antibody's specific binding ability. Examples of antibody fragments include, but are not limited to, Fab, Fab′, F(ab′)2, scFv, Fv, dsFv, diabody, and Fd fragments. The antibody fragment may be produced by any means. For instance, the antibody fragment may be enzymatically or chemically produced by fragmentation of an intact antibody or it may be recombinantly produced from a gene encoding the partial antibody sequence. Alternatively, the antibody fragment may be wholly or partially synthetically produced. The antibody fragment may optionally be a single chain antibody fragment. Alternatively, the fragment may comprise multiple chains which are linked together, for instance, by disulfide linkages. The fragment may also optionally be a multimolecular complex. A functional antibody fragment will typically comprise at least about 50 amino acids and more typically will comprise at least about 200 amino acids.
Single-chain Fvs (scFvs) are recombinant antibody fragments consisting of only the variable light chain (VL) and variable heavy chain (VH) covalently connected to one another by a polypeptide linker. Either VL or VH may be the NH2-terminal domain. The polypeptide linker may be of variable length and composition so long as the two variable domains are bridged without serious steric interference. Typically, the linkers are comprised primarily of stretches of glycine and serine residues with some glutamic acid or lysine residues interspersed for solubility.
Diabodies are dimeric scFvs. The components of diabodies typically have shorter peptide linkers than most scFvs, and they show a preference for associating as dimers.
An Fv fragment is an antibody fragment which consists of one VH and one VL domain held together by noncovalent interactions. The term dsFv is used herein to refer to an Fv with an engineered intermolecular disulfide bond to stabilize the VH-VL pair.
A F(ab′)2 fragment is an antibody fragment essentially equivalent to that obtained from immunoglobulins (typically IgG) by digestion with an enzyme pepsin at pH 4.0-4.5. The fragment may be recombinantly produced.
A Fab fragment is an antibody fragment essentially equivalent to that obtained by reduction of the disulfide bridge or bridges joining the two heavy chain pieces in the F(ab′)2 fragment. The Fab′ fragment may be recombinantly produced.
A Fab fragment is an antibody fragment essentially equivalent to that obtained by digestion of immunoglobulins (typically IgG) with the enzyme papain. The Fab fragment may be recombinantly produced. The heavy chain segment of the Fab fragment is the Fd piece.
The term “binding agent”, as used herein, refers to an agent binding a target molecule, for example, a polypeptide comprising a phosphorylation site provided herein, with high specificity. Examples of binding agents are antibodies, antibody fragments, aptamers, and adnectins.
The term “phosphosensitive”, as used herein in the context of a binding agent, refers to a binding agent that specifically binds to a phosphorylation site, for example, a phosphorylation site provided herein, in either the phosphorylated or non-phosphorylated state. In some embodiments, a phosphosensitive binding agent provided herein binds to the phosphorylation site in its phosphorylated state, but does not significantly bind the phosphorylation site in a non-phosphorylated state. Phosphosensitive binding agents, for example, phosphosensitive antibodies or antibody fragments, accordingly, allow for the detection of phosphorylation at a specific phosphorylation site.
The term “cancer”, as used herein, refers to a malignant neoplastic disease. Most cancers are characterized by hyperproliferation of a cell population. In some embodiments, a cancer manifests as a solid tumor. In some embodiments, a cancer manifests as a liquid tumor. Non-limiting examples of cancers include carcinomas (derived from epithelial cells, e.g., some forms of breast, prostate, lung and colon cancer), sarcomas (derived from connective tissue or mesenchymal cells), lymphoma and leukemia (derived from hematopoietic cells) and seminomas (derived from germ cells).
The term “cancer cell”, as used herein, refers to a malignant neoplastic cell. In some embodiments, a cancer cell is part of a neoplastic cell population. In some embodiments, a cancer cell is a cell of a solid tumor. In some embodiments, a cancer cell is a cell of a liquid tumor. In some embodiments, a cancer cell carries a mutation that affects regulation of cell cycle control. In some embodiments, a cancer cell is a cell obtained from a tumor in a subject.
The term “candidate agent”, as used herein refers to a molecule to be tested for a specific property, for example, for its ability to inhibit mTOR kinase activity. In some embodiments, a candidate agent is a small molecule. In some embodiments, a candidate agent is a polypeptide or protein. In some embodiments, a candidate agent is a binding agent. In some embodiments, a candidate agent is a nucleic acid.
The term “determining a level of expression”, as used herein, refers to performing an assay to determine the level of a gene product expressed in a cell or tissue, for example, in a cancer cell or tumor tissue. In some embodiments, the assay includes obtaining a cell from a subject, for example, by biopsy. In some embodiments, the gene product is a transcript, for example, an mRNA. In other embodiments, the gene product is a protein, for example, an mTOR substrate disclosed herein, or a protein comprising a phosphorylation site disclosed herein. In some embodiments, the gene product is a protein that is phosphorylated at a specific phosphorylation site. In some embodiments, the gene product is a protein that is not phosphorylated at a specific phosphorylation site. Methods, assays, and reagents to determine the level of a gene product in a cell or tissue are described herein and are well known to those of skill in the art. See, for example, Sambrook et al., Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, N.Y.; (1989), or Ausubel et al., Current Protocols in Molecular Biology, Current Protocols (1989), and DNA Cloning: A Practical Approach, Volumes I and II (ed. D. N. Glover) IREL Press, Oxford, (1985); each of which is incorporated herein by reference.
Methods to determine transcript levels include, for example, RT-PCR, northern blot, in situ hybridization, microarray assays, and massive parallel sequencing assays. Methods to determine protein levels include, for example, western blot, immunohistochemistry, ELISA, protein array assays, and mass spectrometry.
The term “high risk of expressing an elevated level of PI3K, Akt, and/or MAPK activity”, as used herein in the context of cells, refers to a condition in a cell that is likely to result in upregulation of PI3K, Akt, and/or MAPK kinase activity, when the cell is contacted with a therapeutic agent, for example, with an mTOR inhibitor. The term “risk” is used interchangeably with the term “likelihood” in this context. Such risk can be conferred through feedback-relief triggered by the therapeutic target. For example, in some embodiments, a cell, for example, a cell derived from a tumor in a subject, is determined to have a high likelihood of expressing an elevated level of PI3K, Akt, and/or MAPK, if it is established that the cell highly expresses a feedback-mediator, for example, phosphorylated Grb10, that limits PI3K, Akt, and/or MAPK expression. If the feedback-mediator is a known substrate of an oncogenic kinase, for example, if the feedback-mediator is the mTOR kinase substrate Grb10, then the cell is likely to exhibit feedback relief upon administration of an inhibitor of the kinase, for example, an mTOR kinase inhibitor, which, in turn, may increase the cell's proliferation and/or survival capacity.
The term “inhibitor” as used herein in the context of kinases, refers to a molecule that inhibits the activity of a kinase. In some embodiments, an inhibitor diminishes the catalytic activity of a kinase. In some embodiments, an inhibitor abolishes the catalytic activity of a kinase. In some embodiments, the inhibitor is a small molecule. In some embodiments, the inhibitor is a nucleic acid or a polypeptide. In some embodiments, the inhibitor is a binding agent. In some embodiments, a kinase inhibitor effects inhibition by down-regulating expression of the kinase. In some embodiments, a kinase inhibitor effects inhibition by binding the kinase and interfering with the kinase reaction. In some embodiments, a kinase inhibitor is an allosteric kinase inhibitor. The term “allosteric kinase inhibitor” refers to a kinase inhibitor, for example, a small molecule, that binds its target kinase, wherein the binding of the inhibitor results in an allosteric change in the kinase molecule, leading to diminished kinase activity. Allosteric changes leading to diminished kinase activity can be changes resulting in a reduction of the kinase's ability to bind a substrate molecule, or changes resulting in a reduction of the kinases ability to transfer a phosphate group to a substrate molecule. In some embodiments, the kinase inhibitor is a catalytic kinase inhibitor. In some embodiments, a catalytic inhibitor, which itself cannot partake in a kinase reaction, competes with a kinase substrate for binding. In some embodiments, a catalytic kinase inhibitor is an ATP-competitive inhibitor.
The term “effective amount”, as used herein in the context of kinase inhibitors, refers to an amount of kinase inhibitor sufficient to achieve a measurable inhibition of kinase activity, or an amount of kinase inhibitor sufficient to achieve a clinically desirable outcome. For example, an effective amount of the mTOR inhibitor rapamycin is, in some embodiments, an amount of rapamycin that, when administered to a cell or tissue, results in a measurable decrease in mTOR kinase activity in the cell or tissue. In some embodiments, an effective amount of a kinase inhibitor is an amount that is effective to reduce the activity of the target kinase in a cell or tissue to less than 75%, less than 50%, less than 40%, less than 30%, less than 25%, less than 20%, less than 10%, less than 5%, less than 2.5%, less than 2%, or less than 1% of the activity in the cell or tissue not treated with the inhibitor. Assays for measuring kinase activity are well known in the art and described in more detail elsewhere herein. In some embodiments, an effective amount of a kinase inhibitor, for example, of rapamycin, is an amount that, when administered to a subject, for example, a subject having a cancer with elevated mTOR activity, results in a clinically desirable outcome. In some embodiments, a clinically desirable outcome is reversal of a disease, for example, a decrease in neoplastic or malignant cell number, tumor size, or cell proliferation rate, for example, in a subject having a proliferative disease, e.g., a neoplastic disease or a cancer, or a delay in the progression of a disease, for example a progression from one tumor stage to the next, or from a benign to a malignant neoplastic disease.
The term “mTOR kinase inhibitor” as used herein, refers to a molecule inhibiting a kinase activity of the mTOR kinase. Examples of mTOR kinase inhibitors are mTORC1 kinase inhibitors and mTORC1/2 inhibitors. Examples of mTORC1 kinase inhibitors are rapamycin and rapamycin analogs (e.g., Ridaforolimus, Sirolimus or Everolimus). Examples of mTORC1/2 inhibitors are PP242, PP30, AZD8055, OSI-027, WYE354, INK-128, XL388, and torin1. Further examples of mTOR inhibitors are inhibitors that target mTOR and an additional kinase or additional kinases, for example, dual PI3K/mTOR kinase inhibitors (e.g., NVP-BEZ235, BGT-226, XL-765, GSK2126458, or SF1126).
The term “PI3K kinase inhibitor”, as used herein, refers to a molecule that inhibits PI3K kinase activity. Examples of PI3K inhibitors are ZSTK474, TGX221, GDC0941, LY294002, XL147, PX147, BKM120, GSK 615, CAL101, and PX-866.
The term “mutation”, as used herein, refers to a change in a gene sequence, for example, a deletion, insertion, inversion, transposition, or substitution. In some embodiments, the mutation results in a change of the expression level of the gene product encoded by the respective gene. In some embodiments, a mutation is a mutation in a gene involved in an mTOR signaling pathway, for example, a gene encoding a protein that regulates, directly or indirectly, mTOR kinase activity. Examples of genes involved in an mTOR signaling pathway are Ras, Raf, MAPK, RSK, receptor tyrosine kinases, PI3K (Phosphoinositide 3-kinase), PTEN (phosphatase and tensin homolog), Akt (Protein Kinase B), TSC1/2 (Tuberous sclerosis protein 1, Tuberous sclerosis protein 2, respectively), MEK (Dual specificity mitogen-activated protein kinase kinase 1, MAPK21), LKB (, and NF2 (Neurofibromatosis 2). Methods to determine whether a cell carries a mutation in a gene are well known to those of skill in the related arts.
The term “phosphoproteomic profile”, as used herein, refers to a dataset comprising information regarding the level of phosphorylation of a plurality of phosphorylation sites in a biological sample, for example, a proteinaceous sample derived from a cell or tissue sample. Phosphoproteomic profiles of multiple samples can be compared and similarities and dissimilarities in such profiles can be detected and quantified by methods well known to those of skill in the art, including, but not limited to, supervised and non-supervised learning, hierarchical clustering, nearest neighbor analysis. In some embodiments, a phosphoproteomics profile of a clinical sample, for example, of a sample derived from a malignant cell or tissue sample of a subject is compared to a reference sample from healthy cells or tissue, for example, to determine aberrations in protein phosphorylation in the malignant cell or tissue sample. In some embodiments, a phosphoproteomics profile of a clinical sample at issue is compared to phosphoproteomics profiles of clinical samples of known character, for example, to classify the clinical sample at issue. Phosphoproteomic profiles can be classified by methods well known in the art, including the building and application of predictors for the classification.
The term “phosphorylation level”, as used herein, refers to the proportion of phosphorylated polypeptides carrying a certain phosphorylation site in a sample relation to all polypeptides carrying the phosphorylation site in the sample. For example, if the total number of polypeptides carrying a specific phosphorylation site in a sample is 10, and 3 of these proteins are phosphorylated at that site, while 7 are not, then the phosphorylation level of this phosphorylation site in the sample would be 30%. Phosphorylation levels can be detected and quantified by methods known to those in the art, for example, by protein detection using phosphosensitive binding agents, e.g., phosphosensitive antibodies or antibody fragments. Most protein quantitation methods known to those of skill in the art do not allow for precise molecule counting, so phosphorylation levels are often approximated based on estimations of the number or fractions of phosphorylated proteins in a sample, for example, after western blot or protein microarray analysis using phosphosensitive antibodies or antibody fragments.
The term “phosphorylation site”, as used herein, refers to an amino acid residue within an amino acid sequence, or motif, that can be phosphorylated, for example, by a kinase targeting the respective site. A phosphorylation site is a substrate of a kinase if it can be phosphorylated by that kinase. For example, 5421 and S432 are phosphorylation sites in Grb10 isoform 3 within the motif MSNILSS*QS*PLHPSTLNAVIHR (SEQ ID NO: 4), and are both mTOR substrates, as described elsewhere herein. mTOR phosphorylation sites can further be classified into three classes, as used herein. The term “class I phosphorylation site”, as used herein, refers to a phosphorylation site that is targeted by rapamycin-sensitive mTORC1 activity. The term “class II phosphorylation site,” as used herein, refers to a phosphorylation site that is targeted by rapamycin-insensitive mTORC1 and/or mTORC2 activity. The term “class III phosphorylation site,” as used herein, refers to a phosphorylation site that is targeted by rapamycin-sensitive mTOR activity, rapamycin-insensitive mTOR activity, or both.
The term “proliferative disease,” as used herein, refers to any disease in which cell or tissue homeostasis is disturbed in that a cell or cell population exhibits an abnormally elevated proliferation rate. Proliferative diseases include hyperproliferative diseases, such as pre-neoplastic hyperplastic conditions and neoplastic diseases. Neoplastic diseases are characterized by an abnormal proliferation of cells and include both benign and malignant neoplasias. Malignant neoplasia is also referred to a s cancer.
The term “reference”, interchangeably used with the term “control” herein, refers to a value, sample, or parameter that serves as a baseline for comparing a value, sample, or parameter of interest to. The use of a reference can be of value in many methods that allow for the detection of absolute levels, for example, of expression, phosphorylation, or protein binding, and is essential in methods that yield semi-quantitative or relative results. Comparing an assay result obtained for a cell or tissue in question, for example, a cell or tissue obtained from a tumor in a subject, to a reference result allows a determination whether the result is abnormal. Depending on their nature, abnormal results can support the inference of specific molecular or cellular aberrations and, in some embodiments, a selection of a course of treatment over another. In some embodiments, a reference value is obtained from cells of the same cell type or the same tissue of origin as the cell in question. For example, in some embodiments, a diseased and a healthy cell is obtained from a subject, and the cells are assayed by methods provided herein in parallel. The value observed in the healthy cell, for example, a level of phosphorylation of a protein then typically serves as the reference level to which the level observed in the cell in question is compared. In other embodiments, the reference level is an average level observed or expected in normal cells. In some embodiments, the reference level is a range typically observed in healthy cells. A suitable reference depends, of course, on the type of assay and sample involved. A suitable reference for a given assay or sample will readily be apparent to those of skill in the art. The following list of exemplary references is for illustration only, since the invention is not limited in this respect.
In some embodiments, a suitable reference level, for example, a suitable reference phosphorylation or expression level, is a level observed or expected in a healthy cell or tissue of the same type as the cell or tissue in question. In some embodiments, for example, in some embodiments where a tumor biopsy is assayed, a suitable reference level is a level observed or expected in healthy cells or tissue of the same tissue the tumor originated from, or in cells or tissue adjacent to the tumor. In some embodiments, for example, in some embodiments where a cell is assayed, a reference cell is a healthy cell that is of the same cell type or tissue of origin as the cell in question. In some embodiments, a reference cell is a cell exhibiting normal mTOR kinase activity. In some embodiments, a reference cell is a malignant cell of known phenotype, for example, a malignant cell known to exhibit elevated mTOR kinase activity, a cell known to exhibit elevated mTORC1 kinase activity, or a cell known to exhibit elevated mTORC1/2 kinase activity. In some embodiments, a reference cell is a malignant cell of known phenotype, for example, a rapamycin-sensitive cancer cell or a rapamycin-sensitive cancer cell.
In some embodiments, a suitable reference level is an average level calculated or approximated from historic data. In some embodiments, a reference level is a level obtained from a reference cell or tissue assayed in parallel to the cell or tissue in question. In some embodiments, a level obtained from a cell or tissue sample is determined to be different (higher or lower) than the reference level, if it is statistically significantly different (higher or lower) than the reference level. In some embodiments, a level obtained from a cell or tissue sample is determined to be higher than the reference level, if the level is at least about 1.25-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 5-fold, or at least about 10-fold the reference level. In some embodiments, a level obtained from a cell or tissue sample is determined to be lower than the reference level, if it is less than about 0.75-fold, less than about 0.70-fold, less than about 0.60-fold, less than about 0.50-fold, less than about 0.40-fold, less than about 0.30-fold, less than about 0.25-fold, less than about 0.10-fold, less than about 0.05-fold, or less than about 0.01-fold the reference level. In some embodiments, a level obtained from a cell or tissue is determined to be substantially similar to the reference level, if it is not statistically significantly different from the reference level. In some embodiments, a level obtained from a cell or tissue is determined to be substantially similar to a reference level, if it is within the range of 0.75-fold to 1.25-fold of the reference level. In some embodiments, a profile comprising a plurality of levels obtained from a cell or tissue sample is determined to be substantially similar to a reference profile, if the profiles cluster together in a clustering analysis. In some embodiments, a multi-value profile obtained from a cell or tissue is determined to be substantially similar to a reference profile, if the correlation coefficient between the profiles is at least 0.75, at least 0.8, at least 0.85, at least 0.9, at least 0.91, at least 0.92, at least 0.93, at least 0.94, at least 0.95, at least 0.96, at least 0.97, at least 0.98, or at least 0.99.
The term “sample”, as used herein, refers to a biological sample. A biological sample typically comprises a cell or tissue, or biological material derived from a cell or tissue. Examples of biological samples are cell samples and tissue samples obtained from a subject, for example, from a subject having a cancer, cell or tissue cultures, and extracts or preparations obtained from any such samples, for example, protein extracts, isolated proteins or isolated nucleic acids obtained from such samples.
A “proteinaceous” sample is a sample comprising proteins or fragments of proteins. In some embodiments, a proteinaceous sample is a sample derived from a cell that includes proteins or fragments of proteins expressed in the cell. In some embodiments, the sample includes a lysed cell. In some embodiments, the sample includes proteins isolated from a cell. In some embodiments, the sample includes an isolated, enriched, or purified protein fraction from a cell, for example, a protein fraction obtained by methods described herein or known to those of skill in the art to separate nucleic acids, carbohydrates, and/or lipids from proteins or fractions of proteins. In some embodiments, the sample is prepared under conditions suitable for obtaining native proteins from a cell. In some embodiments, the sample is prepared under conditions that do not significantly affect native protein phosphorylation patterns. In some embodiments, the sample is prepared under conditions that do not significantly affect the antigenic structure of a phosphorylation site identified herein, for example, a phosphorylation site identified herein to be a target of mTOR kinase activity. In some embodiments, the sample is prepared under conditions suitable for obtaining denatured or fragmented proteins.
The term “subject,” as used herein, refers to an individual mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a rodent. In some embodiments, the subject is a sheep, a goat, a cattle, a cat, or a dog. In some embodiments, the subject is a subject diagnosed to have a cancer. In some embodiments, the subject is a subject diagnosed to have a cancer that exhibits an elevated level of mTOR kinase activity. In some embodiments, the subject is a subject not diagnosed with a cancer.
The term “target,” as used herein in the context of kinases, refers to a substrate of a kinase. The term can, accordingly, refer to a protein (e.g., Grb10 is a target of mTOR kinase), to an amino acid sequence comprising a phosphorylation site (e.g., MNILSS*QS*PLHPSTLNAVIHR (SEQ ID NO: 5) or MNILGS*QS*PLHPSTLSTVIHR (SEQ ID NO: 6) are target sequences of mTOR), or to an amino acid residue (e.g. S421 and S423 of mouse Grb10, isoform 3, are targets of mTOR).
The term “tumor,” as used herein, refers to a neoplasm or a solid lesion formed by neoplastic cells. A tumor can be benign, pre-malignant, or malignant. In some embodiments, the tumor is a malignant tumor.
The term “treatment”, interchangeably used herein with the term “therapy,” as used herein, refers to a clinical intervention aimed to prevent or to ameliorate a disease or condition in a subject. In some embodiments, a treatment is aimed to ameliorate an existing condition, for example, a cancer in a subject. In some embodiments, a treatment is aimed to prevent a condition from occurring or from recurring. For example, in some embodiments, an mTOR kinase inhibitor is administered to a subject having a cancer exhibiting an elevated level of mTOR activity in order to inhibit cell proliferation in the malignant cells. For another example, in some embodiments, an mTOR kinase inhibitor is administered to a subject having a cancer exhibiting an elevated level of mTOR activity after a malignant tumor has been removed from the subject, in order to prevent or delay recurrence of the disease. The foregoing examples are non-limiting, and those of skill in the art will readily envision further scenarios of treatment as the invention is not limited in this respect. Some embodiments include a choice of treatment, referring to a selection of a clinical intervention from a number of alternatives, or to a design of a clinical intervention to meet the specific needs of an individual subject. In some embodiments, a choice of treatment involves the design of a personalized therapeutic approach for a subject having a cancer exhibiting elevated mTOR activity based on the results from diagnostic methods provided herein. For example, in some embodiments, a choice of treatment includes administering to a subject having cancer a specific mTOR inhibitor in combination with an additional kinase inhibitor targeting an mTOR feedback-inhibited pathway based on a determination that cancer cells in the subject exhibit high mTOR activity and elevated levels of a feedback-inhibitor targeted by mTOR in order to avoid feedback relief. In some embodiments, a choice of treatment includes the determination of an appropriate treatment. Some embodiments further include carrying out the selected treatment.
This invention relates to the identification of proteins and sites on those proteins that are phosphorylated by mTOR kinase. Some aspects of this invention relate to the surprising discovery that some proteins that are substrates of mTOR kinase regulate mTOR upstream signaling pathways, thus providing feedback regulatory circuits. Some aspects of this invention relate to methods of classifying cells, for example, neoplastic cells or cancer cells, based on the phosphorylation status of mTOR targets. Some aspects of this invention relate to methods of personalized treatment of subjects having a proliferative disease, for example, a neoplastic disease or a cancer, exhibiting elevated mTOR signaling based on the phosphorylation status of mTOR targets in the diseased cells. Other aspects of this invention relate to methods and materials for the generation of phosphoproteomics profiles that include phosphorylation data for a plurality of mTOR targets. Some aspects of this invention relate to classification of cells or tissues, for example, tumor cells or tissues, based on phosphoproteomic data, for example, based on phosphoproteomic profiles of the cells or tissues. Some aspects of this invention relate to methods of identifying mTOR kinase inhibitors by identifying compounds able to interfere with mTOR kinase activity towards one or more of the mTOR targets provided herein. Some aspects of this invention relate to the identification of Grb10 as a target of mTOR kinase activity, and to methods for determining the level of mTOR activity in a cell based on Grb10 phosphorylation status. Some aspects of this invention relate to the surprising discovery that Grb10 is not only a target of mTOR kinase activity, but also an inhibitor of PI3K kinase activity. Since PI3K is a positive regulator of mTOR kinase activity, Grb10 has been identified as a mediator of mTOR feedback inhibition herein. Other aspects of this invention relate to the surprising discovery that Grb10 and PTEN mutations are mutually exclusive in certain types of tumor cells. Accordingly, some aspects of this invention relate to the surprising discovery that Grb10 is a tumor suppressor and that Grb10 phosphorylation is a useful biomarker for determining mTOR kinase activity in cells, and particularly in tumor cells. Other aspects of this invention relate to methods and reagents useful for determining the phosphorylation status of a protein or phosphorylation site identified to be an mTOR target herein. For example, some aspects of this invention provide phosphosensitive antibodies or antibody fragments specifically binding an mTOR kinase target site identified herein in either the phosphorylated or the non-phosphorylated state, thus allowing for a determination of the phosphorylation state of such a site in a cell.
mTOR Target Proteins and Sites
Identification of mTOR Target Sites
Some aspects of this invention relate to the identification of proteins and phosphorylation sites thereon as downstream targets of mTOR kinase activity. Targets of mTOR kinase activity are provided in Tables 1 and 2.
Classification of mTOR Targets
Some aspects of this invention relate to the classification of mTOR target phosphorylation sites provided herein as class I (targets of rapamycin-sensitive mTORC1 kinase signaling), class II (targets of rapamycin-insensitive mTORC1 or mTORC2 signaling), and class III (targets of both rapamycin-sensitive and rapamycin-insensitive mTOR signaling) phosphorylation sites.
This classification is useful to determine the type(s) of mTOR signaling exhibited by a cell or tissue and can support a classification of cells that are targeted for therapy, for example, of cancer cells. For example, in some embodiments, the phosphorylation status of an mTOR target is determined in a cancer cell obtained from a subject with a cancer exhibiting elevated mTOR kinase activity. Classification of the type of mTOR signaling can, in some embodiments, be a basis for the selection of an appropriate therapeutic approach. For example, if it is determined that a class I target of mTOR signaling is phosphorylated, then the elevated mTOR kinase activity is rapamycin-sensitive mTORC1 kinase activity. In some such embodiments, a method of treatment is then typically selected that includes administration of an inhibitor of rapamycin-sensitive mTORC1 signaling, for example, rapamycin or a rapamycin analog.
To give but another example: if it is determined that a class II target of mTOR signaling is phosphorylated, then the elevated mTOR kinase activity is rapamycin-insensitive mTORC1 or mTORC2 kinase activity. In some such embodiments, a method of treatment is then typically selected that includes administration of an mTORC1/2 inhibitor as provided herein. In some embodiments where class I targets of mTOR signaling are found to not be phosphorylated, a method of treatment is typically selected that does not include administration of an mTORC1 inhibitor.
To give a third example: if it is determined that a class III target of mTOR signaling is phosphorylated, then a method of treatment is selected that includes administration of an mTORC1 inhibitor and an mTORC1/2 inhibitor as provided herein. In some embodiments, a method of treatment that includes administering an mTORC1 inhibitor or an mTORC1/2 inhibitor alone may be inappropriate.
Further, some aspects of this invention provide methods to analyze gene ontology distributions in sets of mTOR targets, for example, in order to determine whether a specific signaling pathway is targeted by mTOR in a given cell, or a given therapeutic or experimental scenario.
Exemplary Proteins Identified in the Rapamycin Phosphoproteomic Screen as Targets of mTORC1 Signaling.
The phosphoproteomic screen described herein identified numerous proteins as mTOR targets, for example, as mTORC1 targets. As described in more detail elsewhere herein, the expression, expression level, phosphorylation, or phosphorylation level of one or more of such mTOR target proteins, for example, the proteins described in any of tables 1-3, or the level of phosphorylation of their respective phosphorylation sites, is employed, in some embodiments, as a biomarker for monitoring or diagnosing disease. In some embodiments, the mTOR target proteins disclosed herein, for example, the mTORC1 target proteins described in any of tables 1-3, are used in pharmaceutical screens as drug targets for the development of drugs modulating mTOR pathway downstream effects. Some exemplary mTORC1 target proteins identified herein are described in more detail below. These descriptions of exemplary mTOR target proteins are for illustration of some aspects of this disclosure and are not meant to limit the scope of the invention. Grb10, one of the mTORC1 protein targets identified in the phosphoproteomics screen, is described in more detail elsewhere herein. Briefly, Grb10, also known as growth factor receptor-bound protein 10, is stabilized by mTORC1-mediated phosphorylation, which, in turn, results in feedback inhibition of the PI3K and MAPK pathways. This is consistent with Grb10 expression being frequently downregulated in a variety of cancers. Grb10 is a tumor suppressor with relevance across a broad spectrum of cancer subtypes, and the identification of Grb10 as an mTORC1 substrate links mTORC1 activity to cancers with aberrantly low Grb10 expression or stability. Accordingly, some embodiments provide Grb10 phosphorylation as a biomarker for mTORC1 activity in a cell, tissue, or sample of interest. Methods of using Grb10 expression or phosphorylation assays to monitor mTORC1 activity in a cell, tissue, or sample of interest are also provided. For example, some embodiments provide a method of monitoring the efficacy of a drug on mTORC1 activity in a cell, tissue, or sample, by measuring Grb10 expression or phosphorylation levels. In some embodiments, such assessments are used to diagnose or monitor a disease associated with aberrant levels of mTORC1 activity, for example, cancer, or to adjust a drug dosage, for example, to the minimal dosage necessary to achieve a target mTORC1 activity level, or to choose a suitable drug modulating mTORC1 activity from a plurality of drugs, for example, the drug that shows the highest efficacy at a given dose.
Some of the mTORC1 protein targets identified herein are potential regulators of gene expression. For example, FOXK1 (Forkhead box protein K1), also known to those of skill in the art as MNF, or MNF (myocyte nuclear factor)-beta, is a winged-helix protein expressed selectively and transiently in myogenic precursor cells of the heart and skeletal muscles, and collaborates with proteins of the mammalian Sin3 (mSin3) family to repress transcription. Mutated forms of MNF-beta that fail to bind mSin3 are defective in transcriptional repression and in negative growth regulation, an overexpression phenotype revealed in oncogenic transformation assays. These phenotypic traits associated with MNF-beta dysfunction are consistent with the mTORC1 phenotype.
For another example, ZEB2 (Zinc finger E-box-binding homeobox 2) belongs to the ZEB family of zinc finger transcription factors, which are essential regulators of gene expression during normal embryonic development. ZEB proteins induce epithelial to mesenchymal transition (EMT), a process in which epithelial cells become migratory mesenchymal cells. E-cadherin is a major target gene of ZEB transcriptional repressors, and e-cadherin downregulation is considered a hallmark of EMT. In recent years, the involvement of the ZEB proteins in pathological contexts has been documented as well. For example, ZEB proteins play an important role in mediating Ras-induced EMT in breast epithelial cells. Mutations in ZEB encoding genes cause severe syndromic malformations, and are implicated in malignant tumor progression. Without wishing to be bound by theory, ZEB2 is believed to be a critical target in lymphangioleiomyomatosis (LAM) that represents the point of convergence of the mTORC1 and ERK-MAP kinase pathways that are critical to this disease.
For another example, NDRG3 is the downstream target of N-Myc. Phosphorylation of NDRG3 links mTOR signaling pathway to Myc activity as an oncogenic transcription factor.
Accordingly, some embodiments provide FOXK1, ZEB2, and/or NDRG3 phosphorylation as a biomarker for mTORC1 activity in a cell, tissue, or sample of interest. Methods of using FOXK1, ZEB2, and/or NDRG3 expression or phosphorylation assays and levels useful for monitoring mTORC1 activity in a cell, tissue, or sample of interest are also provided. For example, some embodiments provide a method of monitoring the efficacy of a drug on mTORC1 activity in a cell, tissue, or sample, by measuring FOXK1, ZEB2, and/or NDRG3 expression or phosphorylation levels. In some embodiments, such assessments are used to monitor or diagnose a disease associated with aberrant mTORC1 activity, as manifest by aberrant FOXK1, ZEB2, and/or NDRG3 phosphorylation level(s), and/or to adjust a drug dosage, for example, to the minimal dosage necessary to achieve a target mTORC I activity level, or to choose a suitable drug modulating mTORC1 activity from a plurality of drugs, for example, the drug that exhibits the highest efficacy at a given dose.
Some of the mTORC1 protein targets identified herein are regulators of mRNA synthesis, mRNA processing, and protein synthesis. This is consistent with the role mTORC1 activity plays in the control of cell growth, which, if improperly regulated, can contribute to tumor genesis and/or growth. For example, LARP1 binds mRNA in vitro via both the La motif and the LARP1 domain. LARP-1 also down-regulates the Ras-MAPK pathway. Accordingly, without wishing to be bound by any particular theory, LARP1 phosphorylation represents an mTORC1-dependent regulation of this feedback loop. The LARP-1 protein colocalizes with P bodies, which function in RNA degradation, and it is believed that the cluster of LARP-1 homologs functions to control the expression of key developmental regulators. Without wishing to be bound by any particular theory, some aspects of this invention provide that LARP-1 functions in P-bodies to attenuate the abundance of Ras-MAPK pathway-regulated mRNAs.
For another example, EDC3 is associated with an mRNA-decapping complex required for removal of the 5′-cap from mRNA prior to its degradation from the 5″-end.
For another example, SRPK2 is involved in SR protein phosphorylation, which influences other aspects of mRNA metabolism, such as splice site selection (alternative splicing), mRNA export, nonsense-mediated decay (NMD), and translation efficiency. Accordingly, some aspects of this disclosure provide that SRPK2 links mTOR/S6K signaling to SR protein activity.
Another example of an MTORC1 target identified herein that regulates mRNA synthesis and processing is CDK12-(CDC2-related kinase, arginine/serine-rich). CDK12 is involved in the regulation of alternative mRNA splicing. Without wishing to be bound by any particular theory, it is believed that, similar to SRPK2, CDK12 is also involved in regulating mRNA splicing by mTOR signaling. A CDK12-binding partner, cyclin-L1 (CCNL1), is also identified as an mTORC1 target protein herein. Without wishing to be bound by any particular theory, similar to SRPK and CDK12, CCNL1 may contribute to mRNA biogenesis and cell proliferation.
Accordingly, some embodiments provide LARP1, SRPK2, and/or CDK12 phosphorylation as a biomarker for mTORC1 activity in a cell, tissue, or sample of interest. Methods of using LARP1, SRPK2, and/or CDK12 expression or phosphorylation levels to monitor mTORC1 activity in a cell, tissue, or sample of interest are also provided. For example, some embodiments provide a method of monitoring the efficacy of a drug on mTORC1 activity in a cell, tissue, or sample, by measuring LARP1, SRPK2, and/or CDK12 expression or phosphorylation levels. In some embodiments, such assessments are used to monitor or diagnose a disease associated with aberrant mTORC1 activity, as manifest by aberrant LARP1, SRPK2, and/or CDK12 phosphorylation level(s), and/or to adjust a drug dosage, for example, to the minimal dosage necessary to achieve a target mTORC1 activity level, or to choose a suitable drug modulating mTORC1 activity from a plurality of drugs, for example, the drug that exhibits the highest efficacy at a given dose.
Another example of an mTORC1 target protein identified herein is MIB1, an E3 ubiquitin-protein ligase that has been reported to ubiquinate Notch, which leads to the degradation of Notch. Accordingly, some aspects of this disclosure provide that mTORC1 activity is linked to Notch signaling via phosphorylation of MIB1. Yet another example of an mTORC1 target protein identified herein is IBTK (Isoform 2 of Inhibitor of Bruton tyrosine kinase), which is a protein tyrosine kinase implicated in the primary immunodeficiency disease X-linked agammaglobulinemia (Bruton agammaglobulinemia). IBTK is activated upon binding to PIP3 generated as a result of PI3K activation. Without wishing to be bound by any particular theory, phosphorylation of IBTK affects IBTK's ability to inhibit PI3K kinase activity. Accordingly, some embodiments of this invention are based on the recognition that there is a link between the mTORC1 signaling system and the regulation of tyrosine phosphorylation.
Accordingly, some embodiments provide MIB1 and/or IBTK phosphorylation as a biomarker for mTORC1 activity in a cell, tissue, or sample of interest. Methods of using MIB1 and/or IBTK expression or phosphorylation assays to monitor mTORC1 activity in a cell, tissue, or sample of interest are also provided. For example, some embodiments provide a method of monitoring the efficacy of a drug on mTORC1 activity in a cell, tissue, or sample, by measuring MIB1 and/or IBTK expression or phosphorylation levels. In some embodiments, such assessments are used to monitor or diagnose a disease associated with aberrant mTORC1 activity, as manifested by aberrant MIB1 and/or IBTK phosphorylation level(s), and/or to adjust a drug dosage, for example, to the minimal dosage necessary to achieve a target mTORC1 activity level, or to choose a suitable drug modulating mTORC1 activity from a plurality of drugs, for example, the drug that exhibits the highest efficacy at a given dose.
Representative protein sequences of Grb10, FOXK1, ZEB2, NDRG3, LARP1, SRPK2, CDK12, MIB1, IBTK, and other proteins identified herein to be mTORC1 substrates, can be found under the respective database entries provided in the tables and the database provided herein, and, for example, in the NCBI database under accession numbers NP—001171100.1 (growth factor receptor-bound protein 10 (Grb10) isoform 2, Mus musculus, SEQ ID NO: 1720), NP—034475.2 (growth factor receptor-bound protein 10 (Grb10) isoform 1, Mus musculus, SEQ ID NO: 1721), NP—001001550.1 (growth factor receptor-bound protein 10 (Grb10) isoform c, SEQ ID NO: 7), NP—005302.3 (Grb10 isoform a, SEQ ID NO: 8) and NP—001001549.1 (Grb10 isoform b, SEQ ID NO: 9); NP—001032242.1 (FOXK1, SEQ ID NO: 10); NP—001165124.1 and NP—055610.1 (ZEB2, SEQ ID NO: 11 and SEQ ID NO: 12, respectively); NP—071922.2 and NP—114402.1 (NDRG3, SEQ ID NO: 13 and SEQ ID NO: 14, respectively); NP—056130.2 (LARP1, SEQ ID NO: 15); NP—872633.1 and NP—872634.1 (SRPK2, SEQ ID NO: 16 and SEQ ID NO: 17, respectively); NP—055898.1 and NP—057591.2 (CDK12, SEQ ID NO: 18 and SEQ ID NO: 19, respectively); NP—065825.1 (MIB1, SEQ ID NO: 20); and NP—056340.2 (IBTK, SEQ ID NO: 21). These database entries are incorporated herein by reference for disclosure of representative sequences of the respective proteins.
Feedback Circuitry Involving mTOR Targets
Some aspects of this invention relate to the surprising discovery that some mTOR target proteins are involved in feedback loops of mTOR signaling, for example, by inhibiting upstream modulators of mTOR signaling, such as PI3K, Akt, and MAPK, after being phosphorylated as a result of mTOR kinase activity. Some aspects of this invention relate to the surprising discovery that relief of feedback inhibition of cellular pro-survival, pro-proliferation signaling by mTOR downstream targets, for example, by Grb10, can contribute to rapamycin resistance or even clinically detrimental outcome in the treatment of neoplastic disease (e.g., cancer) with mTOR inhibitors. Some aspects of this invention relate to the identification, for the first time, of Grb10 as a target of mTOR kinase activity. Grb10, growth factor receptor-bound protein 10, is a protein well known to those of skill in the art. Representative protein sequences of Grb10 can be found under the respective database entries provided in the tables and the database provided herein, and, for example, in the NCBI database under accession numbers NP—001001550.1 (growth factor receptor-bound protein 10 isoform c), NP—005302.3 (isoform a) and NP—001001549.1 (isoform b). These database entries are incorporated by reference for disclosure of representative Grb10 sequences.
Some aspects of this invention relate to the surprising discovery that Grb10 is not only a target of mTOR kinase activity, but also a mediator of mTOR feedback inhibition and, thus, a tumor suppressor gene. As described in more detail elsewhere herein, mTOR-mediated phosphorylation of Grb10 results in stabilization and/or prevention of degradation of Grb10. Grb10, in turn, inhibits PI3K kinase activity. PI3K kinase activity targets mTOR and activates mTOR signaling. Accordingly, as provided by some aspects of this invention, treatment of a cancer exhibiting an elevated level of Grb10 phosphorylation can lead to relief of the Grb10-mediated feedback inhibition of PI3K. PI3K signaling, however, promotes proliferation and survival, and aberrant PI3K activity is known to contribute to carcinogenesis. The discovery that some mTOR targets identified herein, for example, Grb10, mediate a feedback inhibition of pro-survival and pro-proliferation signaling (e.g. PI3K, Akt, and MAPK signaling) in cancer cells, could explain why some types of cancer exhibiting elevated levels of mTOR activity do not respond favorably to treatment with an mTORC1 inhibitor (e.g., rapamycin) alone. The mTORC1 inhibitor may cause relief of the feedback inhibition which may, in turn result in sustained survival and proliferation, and even an increase or acceleration in disease progression or recurrence, as observed in some clinical trials of cancer treatment with mTOR inhibitors.
Also provided herein are methods of treating a cancer determined to exhibit an elevated level of Grb10 phosphorylation. In some embodiments, the method comprises administering to the subject an mTOR inhibitor and, additionally, an agent that stabilizes Grb10 or that inhibits the degradation of Grb10. In some embodiments, the method comprises effecting an inhibition of Grb10 degradation by administering a compound that inhibits Grb10 degradation. In some embodiments, the compound that inhibits Grb10 degradation is a ubiquitin ligase inhibitor, for example, a ubiquitin E3 ligase inhibitor. In some embodiments, the method comprises administering to the subject an mTOR inhibitor and, additionally, a PI3K inhibitor. PI3K inhibitors are known to those of skill in the art and described in more detail elsewhere herein.
Some aspects of this invention provide methods for the classification of a neoplastic disease, for example, a cancer, based on the phosphorylation status of Grb10. In some embodiments, a method is provided that includes obtaining a neoplastic cell from a subject diagnosed to have a cancer, determining the level of Grb10 phosphorylation in the cell, and comparing the level of Grb10 phosphorylation to a reference level. In some embodiments, if the level of Grb10 phosphorylation in the cell is higher than the reference level, then the cell is determined to exhibit an elevated level of mTOR kinase activity. In some embodiments, the cell is determined to exhibit an elevated level of mTORC1 kinase activity based on an elevated level of Grb10 phosphorylation.
Methods of determining a level of protein phosphorylation, for example, of Grb10 phosphorylation, are well known to those of skill in the art. Exemplary methods as well as materials useful for such methods are described, for example, in Marjo de Graauw (Editor), Phospho-Proteomics: Methods and Protocols (Methods in Molecular Biology), Humana Press; 1 edition (2009), ISBN-10: 1603278338. Phosphosensitive binding agents, for example, phosphosensitive antibodies, are provided herein, are commercially available, or can be obtained by those of skill in the art with no more than routine experimentation.
Such methods include, for example, detection of phosphorylated protein with a phosphosensitive antibody and comparison of the amount of phosphorylated protein detected to the total amount of the protein in a sample. Other methods for quantitative or semi-quantitative detection of phosphorylated protein will be apparent to those of skill in the art and the invention is not limited in this respect.
In some embodiments, a method is provided that includes selecting a method of treatment of a neoplastic disease, for example, a cancer based on a cell from a subject having the disease exhibiting an elevated level of Grb10 phosphorylation. In some embodiments, an elevated level of Grb10 phosphorylation is indicative of an elevated level of rapamycin-sensitive mTORC1 kinase activity in the cell. In some embodiments, a method of treatment is chosen based on the cell exhibiting an elevated level of Grb10 phosphorylation that includes administration of an mTORC1 inhibitor, for example, a rapamycin or a rapamycin analog.
Classification of Cancer Cells Known to Exhibit Elevated Levels of mTOR Activity
Some aspects of this invention relate to the discovery that the mTOR target Grb10 is an inhibitor of the mTOR upstream regulators, PI3K, Akt, and MAPK, and, thus, can be characterized as a tumor suppressor gene and an mTOR feedback inhibitor. Some aspects of this invention provide a method for selecting a treatment of a cancer known to exhibit an elevated mTOR kinase activity based on the expression level of the mTORC1 target Grb10. In some embodiments, the method comprises obtaining a cancer cell from a subject diagnosed to have a cancer exhibiting an elevated level of mTOR activity, determining the level of Grb10 expression in the cell, and comparing the level of Grb10 expression to a reference level. In some embodiments, if the level of Grb10 expression in the cancer cell is higher than the reference level, then the cell is determined to exhibit a high likelihood of expressing an elevated level of PI3K, Akt, and/or MAPK activity upon being contacted with an mTORC1 inhibitor. In some embodiments, elevated expression of Grb10 supports the conclusion that upon treatment of the cell or a population of cells of the same type, mTORC1-dependent phosphorylation of Grb10 will be decreased or abolished, resulting in rapid ubiquitination and degradation of Grb10 protein, and, subsequently, in a relief of the Grb10-mediated feedback inhibition of PI3K, as described herein. This relief of feedback inhibition may, in some embodiments, result in elevated PI3K signaling. In some embodiments, elevated PI3K in a cancer cell is an undesirable response to treatment of a subject because it can lead to increased cell proliferation and/or survival, thus offsetting or even outweighing the beneficial effect of the administered mTORC1 inhibitor.
Measuring the expression level of an mTOR target protein can be achieved by using methods well known to those of skill in the art, including, but not limited to, protein expression assays, for example, immunostaining methods (e.g., western blot, protein microarray, immunohistochemistry, phosphoproteomic assays using phosphosensitive binding agents), ELISA, transcript expression assays, for example, RT-PCR, massive parallel sequencing assays, microarray assays, northern blot, or in situ hybridization. Other suitable methods will be apparent to those of skill in the art and the invention is not limited in this respect. See, for example, Sambrook et al., Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, N.Y.; (1989); Ausubel et al., Current Protocols in Molecular Biology, Current Protocols (1989), and DNA Cloning: A Practical Approach, Volumes I and II (ed. D. N. Glover) IREL Press, Oxford, (1985); and Current Protocols in Molecular Biology, Wiley Publishing, accessible at www.currentprotocols.com; each of which is incorporated herein by reference.
In some embodiments, after a cancer cell is classified, a method of treatment of the subject from which the cell was obtained is selected based on the cancer cell exhibiting a high likelihood of expressing an elevated level of PI3K, Akt, and/or MAPK activity upon being contacted with an mTORC1 inhibitor. In some embodiments, the method of treatment comprises administering an effective amount of an mTOR kinase inhibitor and, additionally, an effective amount of an IGF1R, EGFR, PI3K, Akt, MEK, or RSK inhibitor, or a combination thereof. In some embodiments, the method of treatment comprises administering an effective amount of an mTOR kinase inhibitor and, additionally, of a compound stabilizing Grb10 to the subject. In some embodiments, the mTOR kinase inhibitor is an mTORC1 inhibitor, for example, rapamycin or a rapamycin analog. In some embodiments, the selected method of treatment is communicated to the subject, to a physician or other health care professional treating the subject. In some embodiments, the selected method of treatment is carried out.
Determining and Classifying mTOR Activity in a Cell Based on Phosphoproteomics
Some aspects of this invention provide methods for determining the level of mTOR activity in a cell based on analysis of the phosphorylation state of one or more mTOR targeted phosphorylation sites as provided herein. Some aspects of this invention provide methods to determine a class of mTOR signaling, for example, rapamycin-sensitive mTORC1 signaling, rapamycin-insensitive mTORC1 or mTORC2 signaling, or rapamycin-sensitive and/or rapamycin-insensitive mTOR signaling, in a cell based on an analysis of the phosphorylation state of a phosphorylation site as provided herein.
Methods useful for the determination of the phosphorylation level of a phosphorylation site in a cell are known to those of skill in the art. In some embodiments, such methods comprise obtaining a proteinaceous extract from the cell under conditions that allow for protein phosphorylation to be preserved with high fidelity. In some embodiments, such methods comprise contacting the cell extract with a phosphosensitive binding agent or with a plurality of phosphosensitive binding agents, for example, phosphosensitive antibodies or antibody fragments.
The invention provides phosphosensitive antibodies and antibody fragments to the phosphorylation sites described in the tables and the database. For example, phosphosensitive mTORC1 downstream effector antibodies, including, but not limited to, anti-phospho-NDRG3 (Ser331), anti-phospho-S501/503-Grb10, Anti-CDC2-related Kinase, Arg/Ser-Rich (Ser437), In some embodiments, antibodies provided herein are developed in rabbits. Other phosphosensitive antibodies are described elsewhere herein.
Phosphosensitive antibodies are useful in some embodiments to determine the phosphorylation level of one or more phosphorylation sites disclosed herein. One non-limiting example of such an embodiment is a phosphosensitive protein microarray assay. In some embodiments, the cell extract is contacted with a single phosphosensitive binding agent. In some embodiments, the cell extract is contacted with a plurality of binding agents in parallel. In some such embodiments, the cell is contacted with a microarray comprising a plurality of phosphosensitive binding antibodies or antibody fragments immobilized on a solid surface, for example, a glass surface. Phosphoproteomic assays, arrays, binding agents, and methods for sample preparation and analysis are well known in the art, and exemplary methods are described, for example, in Marjo de Graauw (Editor), Phospho-Proteomics: Methods and Protocols (Methods in Molecular Biology), Humana Press; 1 edition (2009), ISBN-10: 1603278338. The foregoing reference is incorporated herein by reference in its entirety for disclosure of methods and materials useful for the determination of the phosphorylation state of a phosphorylation site on a protein in a cell, tissue, or biological sample.
In some embodiments, the method comprises determining the level of phosphorylation of a phosphorylation site of a protein disclosed in Tables 1 or 2, and comparing the level of phosphorylation to a reference level. If the level of phosphorylation in the cell is higher than the reference level, then the cell is determined to exhibit an elevated level of mTOR kinase activity. If the level of phosphorylation in the cell is equal or lower than the reference level, then the cell is determined to not exhibit an elevated level of mTOR kinase activity. Methods of determining a level of phosphorylation are provided herein, and additional suitable methods will be apparent to those of skill in the art. The invention is not limited in this respect.
Suitable reference levels and methods of determining a reference level will be apparent to those of skill in the art. For example, if the cell is a neoplastic cell or cancer cell obtained from a subject, for example form a biopsy of a solid tumor in the subject, a suitable reference level may be obtained, in some embodiments, from a cell obtained from healthy or non-malignant tissue adjacent to the solid tumor, or a healthy cell of the same tissue of origin as the tumor cells from the same subject or from a different subject. If the cell is obtained from a healthy subject, a suitable reference level may be obtained from a cell of the same cell type obtained from another healthy subject. In some embodiments, a suitable reference level may be an average level or a range of levels observed or expected in cells obtained from healthy subjects that are of the same cell type of the same tissue of origin as the cell in question. In some embodiments, a reference level is a historical level, based on experience or prior experiments, or a level published or otherwise known in the art. Other suitable reference levels are described elsewhere herein and additional reference levels and methods to obtain such levels will be apparent to those of skill in the art.
In some embodiments, a plurality of phosphorylation sites are assayed including a Grb10 phosphorylation site, a pNDRG3 phosphorylation site, a CDK12 phosphorylation site, a FOXK1 phosphorylation site, a ZEB2 phosphorylation site, a LARP I phosphorylation site, an MIB1 phosphorylation site, an IBTK phosphorylation site, and/or a SRPK2 phosphorylation site. In some embodiments, a group of phosphorylation sites of proteins involved in a specific biological pathway are assayed, for example, of proteins known to those of skill in the art to be involved in a biological pathway disclosed in Table 10. In some embodiments, the plurality of phosphorylation sites includes mTOR target sites that were previously known. In some embodiments, the plurality of phosphorylation sites comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 1. In some embodiments, the plurality of phosphorylation sites comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 2. In some embodiments, the plurality of phosphorylation sites comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 3 or in replicate described therein. In some embodiments, the plurality of phosphorylation sites comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 7 or in replicate described therein. In some embodiments, the plurality of phosphorylation sites comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 8. In some embodiments, the plurality of phosphorylation sites comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 11, or in any Rapa or Ku replicate therein
In some embodiments, if a phosphorylation site determined to exhibit a higher level of phosphorylation in a cell in question, for example, a cancer cell obtained from a subject, as compared to a reference level is a class I phosphorylation site, then the cell is determined to exhibit an elevated level of rapamycin-sensitive mTORC1 activity. In some embodiments, if a phosphorylation site determined to exhibit a higher level of phosphorylation in the cell as compared to the reference level is a class II phosphorylation site, then the cell is determined to exhibit an elevated level of rapamycin-insensitive mTORC1 and/or mTORC2 activity. In some embodiments, if a phosphorylation site determined to exhibit a higher level of phosphorylation in the cell as compared to the reference level is a class III phosphorylation site, then the cell is determined to exhibit an elevated level of rapamycin-sensitive mTOR activity, or an elevated level of rapamycin-insensitive mTOR activity, or both. In some embodiments, if a cell is determined to exhibit a higher level of phosphorylation at phosphorylation sites of more than one class, then the cell is determined to exhibit a combination of elevated levels of mTOR signaling of the respective type.
In some embodiments, a method is provided comprising selecting a method of treatment based on the level of phosphorylation of the phosphorylation site(s) assayed. In some embodiments, if the cell is determined to exhibit an elevated level of mTOR kinase activity, then a method of treatment is selected that comprises administering an effective amount of an mTOR kinase inhibitor to the subject. In some embodiments, if the cell is determined to not exhibit an elevated level of mTOR kinase activity, then a method of treatment is selected that does not include administering an mTOR kinase inhibitor. In some embodiments, a method is provided that comprises selecting a method of treatment based on the classification of mTOR target sites that are determined to exhibit an elevated level of phosphorylation in the cell. For example, in some embodiments, if the cell is determined to exhibit an elevated level of rapamycin-sensitive mTORC1 activity, then a method of treatment is selected that comprises administering an effective amount of an inhibitor of rapamycin-sensitive mTORC1 kinase activity to the subject. In some embodiments, if the cell is determined to exhibit an elevated level of rapamycin-insensitive mTORC1 and/or mTORC2 activity, then a method of treatment is selected that comprises administering an effective amount of an inhibitor of rapamycin-insensitive mTORC1 kinase activity to the subject. In some embodiments, if the cell is determined to exhibit an elevated level of rapamycin-sensitive mTOR kinase activity, or an elevated level of rapamycin-insensitive mTOR kinase activity, or both, then a method of treatment is selected that comprises administering an effective amount of an inhibitor of rapamycin-sensitive and rapamycin-insensitive mTOR kinase activity or a combination of an inhibitor of rapamycin-sensitive mTOR kinase activity and an inhibitor of rapamycin-insensitive mTOR kinase activity to the subject.
Classification of a Cancer Based on Grb10 and/or PTEN Expression Levels
Some aspects of this invention relate to the surprising discovery that mutations leading to loss of function of the tumor suppressor Grb10 and mutations leading to loss of function of the tumor suppressor PTEN, are mutually exclusive. Loss of function of either tumor suppressor leads to elevated PI3K activity, which is thought to significantly contribute to carcinogenesis in certain types of cancer. In some embodiments, a method is provided that allows for the classification of a cancer based on Grb10 or PTEN expression levels. In some embodiments, the method comprises determining the level of expression of Grb10 in a cancer cell. In some embodiments, the method comprises determining the level of expression of PTEN in a cancer cell. In some embodiments, the method comprises determining the level of expression of Grb10 and PTEN in a cancer cell.
Expression levels of Grb10 and PTEN can be determined by various methods known to those of skill in the art including, for example methods for determining a level of protein, methods for determining a level of mRNA. Since phosphorylation affects protein stability, for example, stability of Grb10, methods for determining a level of protein phosphorylation may also be useful in assessing protein expression levels. Some such methods for expression analysis are provided herein, and additional methods will be apparent to those of skill in the art. The invention is not limited in this respect.
In some embodiments, the level of expression determined for Grb10 or PTEN is compared to a reference level, for example, to a level observed or expected in a healthy cell of the same cell type or of the same tissue of origin. In some embodiments, if the level of expression of Grb10 or of PTEN in the cell is lower than the reference level, then the cell is likely to exhibit an elevated level of PI3K activity. In some embodiments, if the cell is a neoplastic cell in a subject, a method of treatment with a combination of an mTOR inhibitor and a PI3K inhibitor or with a dual mTOR/PI3K inhibitor is indicated.
Phosphosensitive binding agents that specifically bind mTOR targets are also provided by the present invention. For example, some aspects of this invention provide antibodies and antibody fragments to each of the mTOR-targeted phosphorylation site disclosed in any of the Tables provided herein, for example, in any of Tables 1, 2, 3, 7, 8, or 11, and each such antibody is within the scope of the present invention. For example, some aspects of this invention provide aptamers and/or adnectins that specifically bind mTOR-targeted phosphorylation sites disclosed in Table 1, 2, 3, 7, 8, or 11, and each such aptamer or adnectin is within the scope of the present invention. In some embodiments, a kit is provided that comprises such phosphosensitive binding agents. A kit may also include a buffer, a container, control samples, or instructions.
Some embodiments provide a phosphoproteomics array that includes a plurality of phosphosensitive binding agents, for example, antibodies or antibody fragments, aptamers or adnectins, each of which specifically bind to a phosphorylation site disclosed in Table 1, 2, 3, 7, 8, or 11. In some embodiments the phosphosensitive binding agents are immobilized on a solid substrate, for example, on the surface of a glass slide, a bead, or a microtiter plate. In some embodiments, the plurality of phosphosensitive binding agents comprises binding agents that specifically bind to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 1. In some embodiments, the plurality of phosphosensitive binding agents comprises binding agents that specifically bind to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 2. In some embodiments, the plurality of phosphosensitive binding agents comprises binding agents that specifically bind to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 3. In some embodiments, the plurality of phosphosensitive binding agents comprises binding agents that specifically bind to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 7. In some embodiments, the plurality of phosphosensitive binding agents comprises binding agents that specifically bind to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 8. In some embodiments, the plurality of phosphosensitive binding agents comprises binding agents that specifically bind to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 phosphorylation sites disclosed in Table 11.
In some embodiments, an anti-phospho-S501/503-Grb10, anti-mTOR, anti-phospho-mTOR(S2481), anti-Grb10 (human), anti-phospho-Akt (Ser473), anti-Akt, anti-S6K, anti-phospho-S6K (T389), anti-IRS2, anti-PARP, anti-caspase 3, anti-4EBP, anti-4EBP (Ser37/46), anti-phospho-ribosomal protein S6 (Ser235/236), anti-ribosomal protein S6, anti-phospho-ERK1/2, anti-phospho-IRS (Y612), anti-p85 and anti-p110 of PI3K, and/or an anti ERK1/2 antibody or antibody fragment is provided. In some embodiments, phosphosensitive antibodies or antibody fragments are provided for mTOR upstream regulators, including, but not limited to anti-phospho-Akt (Ser473), anti-phospho-ERK1/2, anti-phospho-IRS (Y612), anti-p85, and anti-p110 of PI3K. In some embodiments, phosphosensitive antibodies or antibody fragments are provided for mTOR downstream effectors including, but not limited to anti-phospho-mTOR(S2481), anti-phospho-Akt (Ser473), anti-phospho-S6K (T389), anti-4EBP (Ser37/46), and anti-phospho-ribosomal protein S6 (Ser235/236).
In some embodiments, antibodies against mTORC1 downstream effectors identified for the first time herein are provided, including, anti-phospho-NDRG3 (Ser331), anti-phospho-S5011503-Grb10, and anti-CDC2-related kinase, Arg/Ser-Rich (Ser437).
Phosphosensitive binding agents, their generation and purification, and their use in assays, arrays, and methods for phosphoproteomics analyses of biological samples are well known in the art, and exemplary methods are described, for example, in Marjo de Graauw (Editor), Phospho-Proteomics: Methods and Protocols (Methods in Molecular Biology), Humana Press; 1 edition (2009), ISBN-10: 1603278338, incorporated herein by reference in its entirety. The foregoing reference is incorporated herein by reference in its entirety for disclosure of phosphosensitive binding agents, their generation and purification, and their use in assays, arrays, and methods for phosphoproteomics analyses of biological samples.
Methods of using a microarray comprising a plurality of phosphosensitive binding agents that specifically bind mTOR targets are also provided. In some embodiments, methods of using a phosphoproteomics array to determine mTOR activity in a cell, for example, in a cancer cell, are provided. In some embodiments, the method comprises contacting a proteinaceous sample derived from the cell with the phosphoproteomics array under conditions suitable for a protein expressed in the cell to bind to an antibody or antibody fragment of the array. Such conditions are well known to those of skill in the art and exemplary protocols for phosphoprotein microarrays are described in Marjo de Graauw (Editor), Phospho-Proteomics: Methods and Protocols (Methods in Molecular Biology), Humana Press; 1 edition (2009), ISBN-10: 1603278338, incorporated herein by reference for the disclosure of such methods and conditions. In some embodiments, the method further comprises determining a level of phosphorylated protein bound to a binding agent, for example, an antibody or antibody fragment of the array. In some embodiments, this step includes quantification, absolute or relative to a reference level, of the amount of protein bound to a specific binding agent. In some embodiments, the method includes comparing the level of phosphorylated protein bound to an antibody or antibody fragment of the array to a reference level, wherein if the level phosphorylated protein in the sample derived from the cell is higher than the reference level, then the cell is determined to exhibit an elevated level of mTOR kinase activity.
In some embodiments, methods are provided that include generating a phosphoproteomic profile of the cell. In some embodiments, the profile includes phosphorylation levels of a plurality of proteins, for example, mTOR targets expressed in the cell. In some embodiments, the method further includes comparing the phosphoproteomic profile of the cell with a phosphoproteomic profile of a control cell. In some embodiments, if the phosphoproteomic profile of the cell is similar to that of the control cell, then the cell is determined to exhibit a level of mTOR kinase activity similar to that of the control cell. Methods for comparing phosphoprotein profiles are well known in the art and include, for example, hierarchical clustering methods, supervised and unsupervised learning methods, classification methods, for example class predictor building methods based on phosphoproteomics profiles from cells of known character, and calculation of correlation parameters, such as distance analysis or correlation coefficient calculations. Useful similarity ranges are also known to those of skill in the art and the invention is not limited in this respect. For non-limiting examples of disclosures of such methods and algorithms, see Lim, Y. (2005) Mining the tumor phosphoproteome for cancer markers. Clin Cancer Res 11(9): 3163-3169; Kalume, D. et al. (2003) Tackling the phosphoproteome: tools and strategies Current Opinion in Chemical Biology 7: 64-69; Schmelzle, K. & White, F. (2006) Phosphoproteomic approaches to elucidate cellular signaling networks. Current Opinion in Chemical Biology 17: 406-414; Olsen J V et al. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 2006 Nov. 3; 127(3):635-48; Mumby, M. & Brekken, D. (2005) Phosphoproteomics: new insights into cellular signaling. Genome Biology 6: 230.1-230.7; Zhang et al. J. Proteome Res. vol. 5 pp. 581-8 2006; Hoffert J D, et al. Quantitative phosphoproteomics of vasopressin-sensitive renal cells: regulation of aquaporin-2 phosphorylation at two sites. Proc Natl Acad Sci USA. 2006 May 2; 103(18):7159-64; Johnson, S & Hunter, T. (2004) Phosphoproteomics finds its timing. Nature Biotech 22(9): 1093-1094; and Marjo de Graauw (Editor), Phospho-Proteomics: Methods and Protocols (Methods in Molecular Biology), Humana Press; 1 edition (2009), ISBN-10: 1603278338; all incorporated herein by reference in their entirety
In some embodiments, the control cell is a healthy cell. In some embodiments, the control cell is a cell exhibiting normal mTOR kinase activity. In some embodiments, the control cell is a cancer cell. In some embodiments, the control cell is a rapamycin-sensitive cancer cell. In some embodiments, the control cell is a rapamycin insensitive cancer cell.
Identification of mTOR Kinase Inhibitors Based on mTOR Target Analysis
In some aspects, the invention provides methods of identifying an mTOR kinase inhibitors by analyzing the phosphorylation state of an mTOR target as provided herein after contacting a cell or test sample with a candidate agent. In some embodiments, mTOR phosphorylation efficiency directed towards a target disclosed in Table 1, 2, 3, 7, 8, or 11 is measured in the presence of a candidate agent. In some embodiments, the method includes contacting an mTOR kinase molecule with a polypeptide comprising a phosphorylation site disclosed in Table 1, 2, 3, 7, 8, or 11 under conditions suitable for the mTOR kinase to phosphorylate the phosphorylation site in the presence of a candidate agent. In some embodiments, the level of phosphorylation of the phosphorylation site is then determined and compared to a reference level. In some embodiments, if the level obtained in the presence of the candidate agent is lower than the reference level, then the candidate agent is identified as an mTOR kinase inhibitor.
In some embodiments, the phosphorylation site is a Grb10 phosphorylation site, a pNDRG3 phosphorylation site, a CDK12 phosphorylation site, a FOXK1 phosphorylation site, a ZEB2 phosphorylation site, a LARP1 phosphorylation site, an MIB1 phosphorylation site, an IBTK phosphorylation site, and/or a SRPK2 phosphorylation site. In some embodiments, the candidate agent is a polypeptide, an aptamer, an adnectin, or a small molecule. In some embodiments, the reference level is the level of phosphorylation of the phosphorylation site determined in the absence of the candidate agent. In some embodiments, the level determined in the presence of the candidate agent is lower than the reference level, if the level determined in the presence of the candidate agent is less than 75%, less than 50%, less than 40%, less than 30%, less than 25%, less than 20%, less than 10%, less than 5%, less than 2.5%, or less than 1% of the reference level.
In some embodiments, the contacting is performed in vitro. In some embodiments, the contacting is performed in vivo. In some embodiments, the reference level is a level observed or expected in the absence of the candidate agent. In some embodiments, the reference level is a level observed or expected in the absence of any candidate agent. In some embodiments, the reference level is a level observed or expected in the presence of a known agent. In some embodiments, the reference level is a level observed or expected in the presence of a control agent.
In some embodiments, the subject is an animal. In some embodiments, the subject is a domesticated animal. In some embodiments, the subject is a mammal. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a mouse, rat, or rabbit. In some embodiments, the subject is a sheep, goat, cattle, pig, horse, dog, or cat. In some embodiments, the subject is a human.
In some embodiments, the subject is a healthy subject. In some embodiments, the subject is a subject having a hyperproliferative disease. In some embodiments, the subject is a subject having a neoplastic disease. In some embodiments, the subject is a subject having a cancer. In some embodiments, the subject is a subject having a cancer characterized and/or diagnosed to exhibit an elevated level of mTOR activity. In some embodiments, the subject is a subject who had a tumor removed.
In some embodiments, the cell is a healthy cell. In some embodiments, the cell is any cell. In some embodiments, the cell is a bacterial cell. In some embodiments, the cell is an animal cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a cell of a cell line. In some embodiments, the cell is a transformed or immortalized cell. In some embodiments, the cell is a neoplastic cell. In some embodiments, the cell is a tumor cell. In some embodiments, the cell is a cancer cell. In some embodiments, the cell is obtained from a tumor in a subject, for example, by tumor biopsy. In some embodiments, the cell is a cell obtained from a tumor that has been removed from a subject.
In some embodiments, the cell is a cell known to exhibit an elevated level of mTOR activity. In some embodiments, the cell is a cell carrying a mutation in a gene involved in an mTOR signaling pathway. In some embodiments, the gene involved in an mTOR signaling pathway is a gene involved in IGF signaling, EGFR signaling, GF signaling, PI3K signaling, AKT signaling, MAPK signaling, Ras signaling, Raf signaling, or Rb signaling. In some embodiments, the gene is TSC1/2, a receptor tyrosine kinases (RTK), PI3K, PTEN, Akt, Ras, Raf, MEK, LKB, or NF2.
Kinase inhibitors useful for some aspects of this invention include, but are not limited to, mTOR inhibitors, PI3K inhibitors, Akt inhibitors, and MAPK inhibitors. Further, inhibitors useful for some methods provided herein include, for example, inhibitors of mTOR target degradation, for example, inhibitors of Grb10 degradation. In some embodiments, a kinase inhibitor, for example, an mTOR inhibitor, as provided herein, is an allosteric mTOR kinase inhibitor or a catalytic mTOR kinase inhibitor. In some embodiments, the allosteric mTOR kinase inhibitor is rapamycin or a rapamycin analog. In some embodiments, the catalytic mTOR kinase inhibitor is an ATP-competitive mTOR kinase inhibitor. Other allosteric and catalytic mTOR kinase inhibitors are well known to those of skill in the art, and the invention is not limited in this respect.
In some embodiments, an mTOR kinase inhibitor as provided herein is an mTORC1 inhibitor. In some embodiments, an mTOR kinase inhibitor as provided herein is an mTORC1/2 inhibitor. In some embodiments, an mTOR kinase inhibitor as provided herein is rapamycin or a rapamycin analog. In some embodiments, the rapamycin analog is Ridaforolimus, Sirolimus or Everolimus. In some embodiments, an mTOR kinase inhibitor as provided herein is PP242, PP30, AZD8055, OSI-027, WYE354, INK-128, XL388, torin1, rapamycin (sirolimus), FK506 (tacrolimus), CCI779 (temsirolimus), RAD001 (everolimus), AP23573 (deforolimus, ridaforolimus), S-trans,trans-farnesyl thiosalicylic acid (FTS), FKBP38, PX-866, Theophylline, Caffeine, LY303511, PI-103, 2-(morpholin-1-yl)pyrimido[2,1-aplpha]isoquinolin-4-one, or BEZ235 (NVP-BEZ235)
In some embodiments, an mTOR kinase inhibitor as provided herein is a dual PI3K/mTOR kinase inhibitor. In some embodiments, the dual PI3K/mTOR kinase inhibitor is NVP-BEZ235, BGT-226, XL-765, GSK2126458 or SF1126. Some of the mTOR kinase inhibitors listed immediately above are in various stages of clinical trials. Additional mTOR inhibitors will be apparent to the skilled artisan as they are well known in the art, and it should be appreciated that the invention is not limited in this respect.
In some embodiments, a PI3K inhibitor is provided that is useful in a therapeutic method provided by aspects of this invention. In some embodiments, a PI3K inhibitor as provided herein is ZSTK474, TGX221, GDC0941, or LY294002, XL147, PX147, BKM120, GSK 615, CAL101, PX-866, Quercetin, Tetrodotoxin citrate, Thioperamide maleate, IC87114, PI-103, BEZ235 (NVP-BEZ235), TGX-115, (−)-Deguelin, NU 7026, Myricetin, Tandutinib, SF1126, XL765, D-87503, D-106669, or GSK615. In some embodiments, a PI3K inhibitor provided herein is a dual PI3K/mTOR kinase inhibitor, for example, NVP-BEZ235, BGT-226, XL-765, GSK2126458 or SF1126. In some embodiments, an Akt inhibitor is provided that is useful in a therapeutic method provided by aspects of this invention. In some embodiments, the Akt inhibitor is perifosine, GSK690693, A443654 or MK2206.
In some embodiments, a compound is provided that inhibits the degradation of an mTOR target, for example, of Grb10, NDRG3, CDK12, FOXK1, ZEB2, LARP1, MIB1, IBTK, and/or SRPK2. In some embodiments, the compound that inhibits the degradation of an mTOR target is a ubiquitin ligase inhibitor. In some embodiments, the ubiquitin ligase inhibitor is an E3 ubiquitin ligase inhibitor.
In some embodiments, pharmaceutical compositions are provided that comprise an mTOR kinase inhibitor, a PI3K, Akt, or MAPK inhibitor, and/or an agent that inhibits the degradation of an mTOR target, for example, Grb10, NDRG3, CDK12, FOXK1, ZEB2, LARP1, MIB1, IBTK, and/or SRPK2. Pharmaceutical compositions provided herein preferably are sterile and contain an effective amount of one or more therapeutic agents as described herein for producing the desired response in a unit of weight or volume suitable for administration to a patient. If the desired response is amelioration of a hyperproliferative disease, neoplastic disease, or cancer, then the response can, for example, be measured by determining the proliferation of neoplastic or cancer cells in a subject after treatment by, for example, measuring tumor volume, evaluating regression, relapse, or disease symptoms, or by obtaining a cell sample and perform cell counting, flow cytometry, FACS, and other methods well known in the art to be suitable to determine cell proliferation.
In some embodiments, the pharmaceutical compositions as described herein may contain suitable buffering agents, for example, acetic acid in a salt form, citric acid in a salt form, boric acid in a salt form, and/or phosphoric acid in a salt form. The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as ascorbic acid, benzalkonium chloride, benzyl alcohol, m-cresol, chlorobutanol, parabens, EDTA, EGTA, and/or thimerosal. The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy.
In some embodiments, a therapeutic method or a method of formulating a kinase inhibitor into a medicament for therapeutic use may include the step of bringing the active agent, for example, a kinase inhibitor as described herein, into association with a carrier which constitutes one or more accessory ingredients. In general, compositions are prepared by uniformly and intimately bringing the active compound(s) into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
In some therapeutic embodiments, a composition or pharmaceutic preparation provided herein is administered orally to a subject having a cancer. In some embodiments, compositions as described herein that are suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other examples of compositions include suspensions in aqueous liquids or non-aqueous liquids, such as a syrup, elixir, or an emulsion. Examples of compositions for parenteral administration include, without being limited to, sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Examples of aqueous carriers are water, alcoholic/aqueous solutions, emulsions or suspensions, for example, saline and buffered media. Examples of parenteral vehicles are sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, and lactated Ringer's or fixed oils. Examples for intravenous vehicles are fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases, and the like.
In some embodiments, a composition comprising a compound or a combination of compounds, useful in this invention, may further comprise an antioxidant to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by a preservative such as an antibacterial and antifungal agent, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
The compounds useful in the invention, for example the mTOR, PI3K, Akt or MAPK inhibitors provided herein, may be derivatized in various ways. As used herein “derivatives” of the compounds (e.g., small molecule JAK2 and other kinase inhibitors) include salts (e.g., pharmaceutically acceptable salts), any complexes (e.g., inclusion complexes or clathrates with compounds such as cyclodextrins, or coordination complexes with metal ions such as Mn2+ and Zn2+), esters such as in vivo hydrolysable esters, free acids or bases, polymorphic forms of the compounds, solvates (e.g., hydrates), prodrugs or lipids, coupling partners and protecting groups. By “prodrugs” is meant for example any compound that is converted in vivo into a biologically active compound.
The term “pharmaceutically acceptable salt” in this respect refers to the relatively non-toxic, inorganic or organic acid addition salts of agents of the present invention. These salts can be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting a purified agent of the invention with a suitable organic or inorganic acid, and isolating the salt thus formed during subsequent purification. Representative salts include the bromide, chloride, sulfate, bisulfate, phosphate, phosphonate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, laurylsulphonate salts, and the like. See, for example, Berge et al. (1977) J. Pharm. Sci. 66:1-19.
The pharmaceutically acceptable salts of the subject agents include the conventional nontoxic salts or quaternary ammonium salts of the compounds, e.g., from non-toxic organic or inorganic acids. For example, such conventional nontoxic salts include those derived from inorganic acids such as hydrochloride, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, and the like.
As set out herein, certain compounds may contain a basic functional group, such as amino or alkylamino, and are, thus, capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable acids. The term “pharmaceutically acceptable salts” in this respect refers to the relatively non-toxic, inorganic or organic acid addition salts of compounds of the present invention. These salts can be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting a purified compound of the invention in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed during subsequent purification. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, phosphonate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like. See, for example, Berge et al. (1977) J. Pharm. Sci. 66:1-19.
The pharmaceutically acceptable salts of the compounds useful in the present invention include the conventional nontoxic salts or quaternary ammonium salts of the compounds, e.g., from non-toxic organic or inorganic acids. For example, such conventional nontoxic salts include those derived from inorganic acids such as hydrochloride, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, and the like.
In other cases, the compounds may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable bases. The term “pharmaceutically acceptable salts” in these instances refers to the relatively non-toxic, inorganic and organic base addition salts of compounds of the present invention. These salts can likewise be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting the purified compound in its free acid form with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, and the like. See, for example, Berge et al. (1977) J. Pharm. Sci. 66:1-19.
In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes), and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example, hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be advisable to include isotonic agents, such as, for example, sugars, sodium chloride, or combinations thereof.
Some aspects of this invention provide therapeutic methods, for example, methods for the treatment of subjects having a hyperproliferative disease, a neoplastic disease, or a cancer. In some embodiments, a method of treatment is personalized to a specific subject by taking into account the phosphorylation level of at least one an mTOR target site in the subject. In some embodiments, therapeutic methods disclosed herein include administration of an mTOR inhibitor, for example, of an mTORC1 or an mTORC1/2 inhibitor. In some embodiments, therapeutic methods described herein include administration of an mTOR inhibitor and an additional kinase inhibitor, for example, a PI3K inhibitor, a MAPK inhibitor, MEKIERK inhibitor, or an AKT/PKB inhibitor. In some embodiments, therapeutic methods provided herein include administration of a dual mTOR/PI3K inhibitor, or of a combination of an mTOR inhibitor and a PI3K inhibitor.
In some therapeutic embodiments, a composition disclosed herein, for example, a composition comprising an mTOR inhibitor or a composition comprising an mTOR inhibitor and a PI3K inhibitor is administered to a subject having a cancer in an effective amount. An effective amount, in some embodiments, is an amount sufficient to elicit a desired clinical response in the subject. In some embodiments, the desired response is a slowing or inhibiting of the progression of a disorder, for example, of a malignant neoplastic disorder. In some embodiments, this involves slowing the progression of the disease temporarily, although, in more preferable embodiments, it involves halting the progression of the disease permanently.
In some embodiments, the desired response is a permanent reduction of cancer cell proliferation, for example, to a level comparable to a level found in healthy individuals. In some embodiments, a desired response is the induction of cell death in a cancer cell, in a population of cancer cells, or in all cancer cells in a subject. In some embodiments, the desired response is delaying or preventing the manifestation of clinical symptoms characteristic of the disease or condition.
The effect of administering an mTOR inhibitor, either alone or in combination with an additional compound, for example, a PI3K inhibitor, as provided herein, can be monitored by routine methods well known to those of skill in the related medical arts, for example, by methods involving assessment of cancer cell proliferation.
What constitutes an effective amount will depend on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size, and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health care professional treating the subject. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a lower dose or tolerable dose may be used for medical reasons.
In general, an effective amount of a therapeutic agent, for example, an mTOR inhibitor or a combination of an mTOR inhibitor with a PI3K, Akt, or MAPK inhibitor, as provided herein, for the treatment of a cancer exhibiting an elevated level of mTOR kinase activity is a dose that achieves an alleviation of the specific neoplastic disease or disorder being treated, for example, by prevention, inhibition, amelioration, delay, or elimination of a symptom of such a disease or disorder.
Some embodiments provide a method of inducing cell death and/or inhibiting proliferation in a neoplastic cell exhibiting elevated mTOR kinase activity by contacting the cell with an mTOR kinase inhibitor or a combination of an mTOR kinase inhibitor and another kinase inhibitor, for example, a PI3K, Akt, or MAPK inhibitor, chosen based on the determination of the type of mTOR kinase signaling active in the cell. In some embodiments, the neoplastic cell is contacted in vivo by administering a composition disclosed herein to a subject carrying the cell. In some embodiments, the neoplastic cell is contacted ex vivo. In some embodiments, the cell is contacted in vitro.
In some embodiments, a neoplastic cell is contacted in vivo, ex vivo, or in vitro, with an effective amount of an mTOR inhibitor or a combination of an mTOR inhibitor and an additional kinase inhibitor, for example, a PI3K, Akt, or MAPK inhibitor, as provided herein. An effective amount, in some embodiments, is an amount sufficient to elicit a desired response in the contacted cell. In some embodiments involving contacting a neoplastic cell exhibiting elevated mTOR activity, for example, because of a mutation in an mTOR upstream pathway, the desired response is a slowing or inhibiting of the proliferation of the cell. In some embodiments, this decreases the proliferation rate and/or cell viability and/or life span, although, in more preferable embodiments, it involves the induction of cell death in the contacted cell or cells.
In some embodiments, the therapeutic methods provided herein further involve the administration of an additional antiproliferative agent to a cancer cell or to a subject carrying a cancer cell, for example, as part of a malignant tumor. Additional antiproliferative agents useful in the methods described herein are well known in the art and include, but are not limited to chemotherapeutic agents (e.g., cytostatic, and cytotoxic agents). Cytotoxic and cytostatic drugs are drugs that kill malignant cells, or inhibit their proliferation, respectively. Examples of cytotoxic and cytostatic drugs include, for example, alkylating agents, antimetabolites, antitumor antibiotics, vinca alkaloids, taxanes, topoisomerase-I compounds, anthrapyrazoles, and epidophylotoxins. In addition, angiogenesis inhibiting drugs, including, for example, compounds that block growth promoting receptors (e.g., PDGF-R and VEGF-R) such as sunitinib (Sutent®) may be used as additional antiproliferative agents. Non-limiting examples of additional antiproliferative agents include Cytoxan® (Cyclophosphamide), Methotrexate, 5-Fluorouracil (5-FU), Adriamycin® (Doxorubicin), Prednisone, Nolvadex® (Tamoxifen), Taxol® (Paclitaxel), Leucovorin, Oncovin® (Vincristine), Thioplex® (Thiotepa), Arimidex® (Anastrozole), Taxotere® (Docetaxel), Navelbine®, (Vinorelbine), Gemzar® (Gemcitabine), Ifex® (Ifosfamide), Pemetrexed, Topotecan, Melphalan (L-Pam®), Cisplatin (Cisplatinum®, Platinol®), Carboplatin (Paraplatin®), Carmustine (BCNU; BiCNU®), Methotrexate, Edatrexate, Mitomycin C (Mutamycin®), Mitoxantrone (Novantrone®), Vincristine (Oncovin®), Vinblastine (Velban®), Vinorelbine (Navelbine®), Fenretinide, Topotecan, Irinotecan, 9-amino-camptothecin (9-AC); Biantrazole, Losoxantrone, Etoposide, and Teniposide.
Administration schedules, formulations, dosages, and administration routes of antiproliferative agents and compositions are well known to those in of skill in the art. Exemplary administration routes, schedules, and dosages of commonly used chemotherapeutic drugs are described in Perry, The Chemotherapy Source Book, 4th Edition, Lippinkott Williams & Wilkins, 2008, incorporated herein by reference. Such administration schedules may comprise the administration of a single antiproliferative drug or the administration of a combination of such drugs, for example, one of the following, commonly administered combinations: CMF (cyclophosphamide, methotrexate, and 5-fluorouracil); classic CMF (oral cyclophosphamide plus methotrexate and 5-fluorouracil); CAF or FAC (cyclophosphamide, Adriamycin® (doxorubicin), and 5-fluorouracil); AC (Adriamycin® and cyclophosphamide); ACT (Adriamycin® plus cyclophosphamide and tamoxifen); AC taxol (Adriamycin® plus cyclophosphamide and paclitaxel (Taxol®); FACT (5-fluorouracil plus Adriamycin®, cyclophosphamide, and tamoxifen); A-CMF or Adria/CMF (4 cycles of Adriamycin® followed by 8 cycles of CMF); CMFP (CMF plus prednisone); CMFVP (CMF plus vincristine and prednisone); CAFMV (CAF plus methotrexate and vincristine); CMFVATN (CMF plus vincristine, Adriamycin®, thiotepa, and tamoxifen); MF (methotrexate plus 5-fluorouracil and leucovorin). The administration of such combinations of antiproliferative drugs and agents in addition to the administration of an mTOR kinase inhibitor with or without an additional kinase inhibitor, for example, a PI3K, Akt, or MAPK inhibitor, is also envisioned to be embraced by some embodiments.
The therapeutic inhibitors and compositions can be administered in a single dose comprising an effective amount of the individual agents. Multiple doses of the compounds of the invention are also contemplated. When a plurality of inhibitors are used together, they may be administered individually or sequentially, either in a single medicament or in separate units to provide therapeutic doses of the individual compounds. Many mTOR inhibitors, PI3K inhibitors, Akt inhibitors and MAPK inhibitors described herein are in clinical studies or even in clinical use. Therapeutic doses of such compounds are, accordingly, well known in the field of medicine. Dosages of compounds in clinical use are described in references such as Remington's Pharmaceutical Sciences, 18th ed., 1990; as well as many other medical references relied upon by the medical profession as guidance for the treatment of proliferation disorders.
A variety of administration routes are available for the kinase inhibitors and other therapeutic agents described herein. The particular mode selected will depend, of course, upon the particular compound selected, the particular condition being treated and the dosage required for therapeutic efficacy. The methods of this invention may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of compounds without causing clinically unacceptable adverse effects. Examples of modes of administration are parenteral routes. The term “parenteral” includes subcutaneous, intravenous, intramuscular, intraperitoneal, and intrasternal injection, or infusion techniques. Other routes include, but are not limited to, oral, nasal, dermal, sublingual, and local.
The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salts, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
According to the methods provided by aspects of the invention, the compounds described herein may be administered in a pharmaceutical composition. In some embodiments, a pharmaceutical composition comprises a compound provided by aspects of the invention and a pharmaceutically acceptable carrier. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.
Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials which are well known in the art. Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
The compounds used in the invention may be formulated into preparations in solid, semi-solid, liquid or gaseous forms such as tablets, capsules, powders, granules, ointments, solutions, depositories, inhalants and injections, and usual ways for oral, parenteral or surgical administration. Some aspects of the invention also embrace pharmaceutical compositions which are formulated for local administration, such as by implants.
Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, elixir or an emulsion. When the compounds described herein are used therapeutically, in certain embodiments a desirable route of administration may be by pulmonary aerosol.
In some embodiments, a compound provided by some aspects of the invention may be administered directly to a tissue. Direct tissue administration may be achieved by direct injection. A compound may be administered once or alternatively may be administered in a plurality of administrations. If administered multiple times, a compound may be administered via different routes. For example, the first (or the first few) administrations may be made directly into the affected tissue while later administrations may be systemic.
For oral administration, the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any carriers.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and/or dispersing agents.
Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Lower doses will result from other forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day are contemplated to achieve appropriate systemic levels of compounds.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compound, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the platelet reducing agent is contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152 and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
Therapeutic formulations useful in the invention may be prepared for storage by mixing a kinase inhibitor having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).
Two sets of large-scale, quantitative phospho-proteomics experiments were performed to fully define how mTOR-containing complexes signal to downstream effectors (
Global Quantitative Phosphoproteomics Defines the Signaling Networks Downstream of both mTORC1 and mTORC2
Two populations of TSC2−/− cells were grown in parallel, one in conventional media (“light”) and the other in media containing [13C615N2]lysine and [13C615N4]arginine (“heavy”) (
Based on the tight distribution of the quantified phosphopeptides, we considered phosphorylated peptides whose relative abundance decreased ≧2-fold as regulated in a rapamycin-sensitive fashion. Using this criteria, several hundred peptides (corresponding to 148 and 85 proteins respectively, in the two biological replicates, Table 11) were determined to contain rapamycin-sensitive phosphorylation sites. Table 11 identifies proteins with downregulated phosphorylation identified in the rapamycin and Ku-0063794 screen. Note that there are two biological replicate experiments for the rapamycin screen (“Table 11 Rapa Replicate 1,” and “Table 11 Rapa Replicate 2,” respectively) and one Ku-0063749 replicate (“Table 11 Ku”). Treatment for the light and heavy cells in each experiment is described in
For the Ku-screen, wild-type MEFs were grown in light and heavy SILAC media and starved overnight for serum. The light cells were treated with 20 nM rapamycin for 2 hrs, while the heavy cells were treated in parallel with a combination of 20 nM rapamycin and 2 μM of Ku-0063794 for 2 hrs. Both the light and heavy cell were subsequently stimulated with insulin for 15 minutes and samples were pooled and analyzed by quantitative mass spectrometry. Ku-0063794 is a recently identified compound that competitively inhibits mTOR kinase activity by occupying the ATP-binding pocket (
Phosphorylation Specificity of the Downstream Effectors in the mTORC1 and mTORC2 Signaling Networks
Table 9 describes the classification of mTOR targets identified in the rapamycin and Ku-0063794 screens. Class I includes downstream effectors of rapamycin-sensitive mTORC1. Class II includes downstream effectors of rapamycin-insensitive mTORC1 or mTORC2. Class II includes the proteins downstream of both mTORC1 and mTORC2. Names of the genes and the sequences of the phosphopeptides are shown.
Class I sites represent phosphorylation events that are mediated by rapamycin-sensitive mTORC1/S6K signaling, (e.g. phospho-rpS6 S235/S236 phosphorylation).
Class II sites represent phosphorylation events mediated by rapamycin-insensitive mTORC1 or mTORC2 function. For example, 4EBP1 T36/T45 phosphorylation, previously characterized as a rapamycin insensitive mTORC1 substrate (12), only decreased slightly (20%) after rapamycin treatment, while phosphorylation at these sites decreased dramatically (7.2-fold) in the Ku-0063794 screen (
Class III represents phosphorylation sites that are both the rapamycin-sensitive and Ku-sensitive mTOR substrates. For example, GSK3β S9 phosphorylation is down-regulated by approximately 3.3-fold and 2.2-fold in the rapamycin and Ku-0063794 screens, respectively (
There were several surprising examples of phosphopeptides that are insensitive to both rapamycin and Ku-0063794 as identified by the two phosphoproteomics screens. The intensity of a T70 singly phosphorylated 4EBP 1 peptide did not change in either the rapamycin or the Ku-0063794 screen (
Linking Phosphorylation Events to the Biological Processes Regulated by mTORC1 and mTORC2
To assess the predicated effects of mTOR inhibition in cells as a result of either rapamycin or Ku-0063794 treatment, we mapped the downregulated proteins in the two screens to Gene Ontology (GO) terms with respect to Biological Process (BP) and also performed gene functional classification analysis of these proteins. Table 10 describes the results of GO analysis of the hits identified in the rapamycin and Ku-0063794 screens. Pathways that the rapamycin-sensitive and Ku-0063794-sensitive hits overrepresented are shown in “Table 10 Rapa pathways” and “Table 10 Ku pathways”, respectively. Also shown is the biological process that the rapamycin-sensitive and Ku-0063794-sensitive hits overrepresented (Table 10 Rapa BP GO, and Table 10 Ku BP GO, respectively). Interestingly, for the rapamycin screen, the top enriched BPs included negative regulation of macromolecule metabolic process (P=4.2×10−7), negative regulation of cellular biosynthetic process (P=4.2×10−6), response to insulin stimulus (P=2.6×10−4), negative regulation of transcription (P=2.7×10−4) and vesicle-mediated transport (P=6.0×10−4). By grouping the hits based on functional similarities, we also found that the downregulated proteins in the rapamycin screen were enriched for kinases (P=2.1×10−20), WD40-repeat containing proteins (P=8.9×10−12), proteins involved in transcription regulation (P=3.1×10−9) and proteins involved in RNA processing (P=3.3×10−5). The identification of many kinases in the downregulated proteins provides interesting points for potential signal integration and crosstalk. One example is the Ser/Thr kinase, unc-51-like kinase 1 (ULK1). Previously published research has demonstrated that ULK1 is positively involved in autophagy response (22). ULK1 has also been shown to interact with mTORC1 through binding to raptor (23). We identified three phosphorylation sites on ULK1 (S747/S757/T763) that showed a 4-fold downregulation after rapamycin treatment (Table 1), suggesting that ULK1 is likely a bona fide mTORC1 substrate. As mTORC1 is known to antagonize macroautophagy, it is tempting to speculate that mTORC1 negative regulates ULK1 either directly or indirectly via inhibitory phosphorylation events. Interestingly, in mammalian cells, knockdown of the related kinase ULK2 had no effect on the autophagic response (22). Interestingly, all three of the rapamycin-sensitive ULK1 phosphorylation sites are proline-directed (SP or TP), whereas two of the three comparable sites in ULK2 possess a C-terminal alanine, making it unlikely that these residues are similarly phosphorylated by mTORC1 (
For the downregulated proteins identified in the Ku-0063794 screen, the top enriched BPs included lamellipodium assembly (P=0.003), protein amino acid phosphorylation (P=0.007), the insulin receptor signaling pathway (P=0.01), actin filament-based process (P=0.015) and nucleocytoplasmic transport (P=0.015). Gene functional classification analysis revealed that the downregulated proteins were enriched for ATP-binding proteins (P=2.4×10−11) and zinc-finger domain containing proteins (P=2.1×10−4). Intriguingly, it has been suggested that mTORC2 promotes organization of the actin cytoskeleton upon growth factor stimulation through a mechanism that is poorly defined. The identification of a total of 10 proteins (CCDC88A, ARHGEF17, NCK1, myo9b, Mtap1b, Epb4.113, vel, Spnb2, FLNC, Npm1) in the Ku-0063794 screen that are related to cytoskeleton regulation provides an opportunity for the discovery of novel points of regulation. For example, we identified a peptide from filamin-C (FLNC) in the Ku-0063794 screen that was singly phosphorylated at S2234 (
The analysis identified 4,484 and 6,832 unique phosphorylation sites on 1,615 and 1,866 proteins from two biological replicate experiments, respectively, and achieved a high level of accuracy in quantitation (Table 5). Several hundred peptides corresponding to 148 and 85 proteins in the two replicates (Table 11) were determined to contain rapamycin-sensitive phosphorylation sites (defined as phosphorylated peptides whose relative abundance decreased ≧2-fold in response to rapamycin treatment). There was a substantial overlap in the downregulated proteins between the replicates, as 40 proteins were found in both experiments (
Rapamycin is an allosteric inhibitor that only partially inhibits mTORC1 signaling and has no effect on the activity of mTORC2 under short-term treatment conditions (3). In contrast, newly discovered ATP-competitive mTOR inhibitors block the activity of both mTORC1 and mTORC2 (2). To identify rapamycin-insensitive mTORC1, and mTORC2 substrates, we used the mTOR kinase inhibitor Ku-0063794 and performed a second SILAC experiment (Ku-0063794 screen) (
In this experiment, one hundred proteins were determined to contain down-regulated phosphorylation after Ku-0063794 treatment (Table 11). The identified phospho-proteins included many known downstream targets of mTORC2 (Table 6), including GSK313, Braf, Akt1s1 (Akt substrates) and NDRG1 (SGK substrate).
To identify the specific downstream effectors of the two mTOR complexes, we compared the fold-change in phospho-peptides identified in both the rapamycin and Ku-0063794 screens (
We performed pathway analysis using DAVID (10), to determine the signaling networks that are statistically overrepresented by the hits in the rapamycin and Ku-0063794 screens (
Interestingly, one of the enriched GO classes in the rapamycin screen is the transmembrane receptor protein tyrosine kinase (RTK) signaling pathway (P=0.01), suggesting that mTORC1 might inhibit proteins in the upstream PI3K and MAPK pathways through modulating the activities of these RTKs. In particular, we observed that phosphorylation of two sites on the growth factor receptor-bound protein 10 (Grb10, S501/S503, 496MNILSS*QS*PLHPSTLNAVIHR516 (SEQ ID NO: 24), mass error=2.32 ppm, Xcorr=4.39) was strongly inhibited by rapamycin (
Grb10 belongs to the growth factor receptor-bound (Grb) protein family, which contains Grb7, Grb10 and Grb14. Members of this protein family serve as cellular adaptor proteins that bind to activated receptor tyrosine kinases (11). Grb10 has an N-terminal Ras-associating (RA) domain, a PH domain, a C-terminal SH2 domain and a BPS (between PH and SH2) domain, in which the two rapamycin-sensitive phosphorylation sites reside (
We developed a phosphospecific antibody (
To determine whether the Grb10 S501/S503 sites can be phosphorylated by other kinases, we treated TSC2−/− cells with staurosporine, a broad-spectrum kinase inhibitor that does not suppress mTOR activity (12). No change in the phosphorylation level of Grb10 S501/S503 phosphorylation was observed in response to staurosporine treatment (
We further investigated the effects of growth factor stimulation and rapamycin-mediated inhibition on Grb10 phosphorylation in other cell types. Wild-type MEFs were serum-starved and then stimulated with either insulin or 10% serum, both of which led to a robust increase in Grb10 phosphorylation (
We next examined the in vivo interaction between Grb10 and the components of the mTOR complexes. We co-overexpressed HA-tagged Grb10 with Myc-tagged raptor or rictor in HEK293T cells. Grb10 was found to interact with raptor, but not rictor, suggesting Grb10 is a binding partner of mTORC1, but not mTORC2 (
We found long-term inhibition of mTORC1 by rapamycin led to a significant decrease in Grb10 protein levels (
To explore whether mTORC1-mediated Grb10 stabilization depends on phosphorylation on S501/S503, we transfected WT-Grb10, Grb10-S501A/S503A (AA) mutant and Grb10-S501D/S503D (DD) mutant into HEK293T cells. Exogenous wild type (WT) and DD mutant Grb10 proteins were expressed at equal levels, while expression of the AA mutant was markedly reduced, suggesting lower protein stability for the unphosphoryated form of Grb10 (
Grb10 has been suggested to function as a negative regulator of the insulin signaling pathway. In mice with genetically disrupted Grb10 function, overgrowth of both the embryo and placenta was observed, and these mice are approximately 30% larger than normal at birth (15). In addition, enhanced activity of the insulin-stimulated PI3K/Akt pathway was observed in insulin target tissues, including skeletal muscle and adipose tissue (16). We examined the role of mTORC1-mediated Grb10 protein stabilization and accumulation in mTORC1 mediated negative feedback on the PI3K/Akt pathway.
As expected from previous reports (5, 6), both the PI3K/Akt and MAPK pathways were highly suppressed in TSC2−/− cells due to constitutively elevated mTORC1 activity. In contrast, Akt was strongly activated in Grb10 knockdown cells under both serum-starved and insulin/IGF stimulation conditions (
The current model of the negative feedback loop from mTORC1 to PI3K involves S6K-mediated phosphorylation and subsequent degradation of IRS 1/2 (6). However, it has also been shown that overexpression of a dominant-negative, kinase-deficient S6K1 failed to completely recapitulate the hyperactivation of Akt induced by overexpression of kinase-dead mTOR, suggesting mTORC1 is directly involved in modulating this feedback inhibition loop (17). Our data clearly show that hyperactivation of mTORC1/S6K promotes feedback loop inhibition of PI3K through a two-prong mechanism: (1) mTORC1/S6K-mediated phosphorylation and degradation of a positive regulator of PI3K signaling, IRS, and (2) mTORC1-mediated phosphorylation and accumulation of a negative regulator of PI3K signaling, Grb10.
Numerous genetic alterations in cancers result in hyperactivation of the mTOR complexes. Based on these observations, rapamycin analogues are currently approved, or being assessed in various clinical trials, as targeted therapeutics against several cancer subtypes. However, with a few exceptions, the current results have been disappointing, as the clinical outcome of rapamycin treatment is unpredictable and rapamycin is largely ineffective as a monotherapy (3). In particular, it has been shown that post-surgical, maintenance rapamycin treatment led to PI3K/Akt activation in glioblastoma patients, and this activation was associated with shorter time-to-progression (4). We asked whether PI3K hyperactivation induced by Grb10 knockdown (which phenotypically mimics rapamycin-induced Grb10 depletion) would contribute to the survival of cells undergoing stress-induced apoptosis. In response to either staurosporine or etoposide, reduced caspase 3 cleavage was observed in Grb10 knockdown cells compared to control cells. These results indicate that Grb10 depletion is sufficient to protect cells from apoptosis (
To explore the role of Grb10 in cancer progression, we performed a comprehensive meta-analysis of GRB10 expression based on published microarray data. GRB10 expression is significantly down-regulated in many tumor types compared to their normal tissue counterparts (
Human embryonic kidney (HEK) 293E cells, immortalized wild-type mouse embryonic fibroblast (MEF) cells and TSC2−/− MEFs (a kind gift from David Kwiatkowski, Brigham and Women's Hospital) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum. In collaboration with Millipore Inc., we generated anti-phospho-5501/S503-Grb10 antibodies. Anti-mTOR, anti-phospho-mTOR (S2481), anti-Grb10 (human), anti-phospho-Akt (S473), anti-phospho-Akt (T308), anti-Akt, anti-S6K, anti-phospho-S6K (T389), anti-IRS2, anti-PARP, anti-caspase 3, anti-4EBP, anti-4EBP (T37/T46), anti-phospho-ribosomal protein S6 (S235/S236), and anti-ribosomal protein S6 antibodies were obtained from Cell Signaling Technology. Anti-phospho-ERK1/2 antibody, insulin, Phorbol Myristate Acetate (PMA), Epidermal Growth Factor (EGF) and polybrene were purchased from Sigma. Anti-Grb10 (mouse), anti-phospho-IRS (Y612), anti-p85 and anti-p110 of PI3K antibodies were purchased from Santa Cruz, Invitrogen, Millipore and BD, respectively. ERK1/2 antibody and anti-HA antibody were prepared in the lab. LY294002 and AktVIII inhibitor were purchased from Calbiochem. Lipofectamine 2000 was purchased from Invitrogen. Torin was kindly provided by Nathanael Gray (Dana Farber Cancer Institute).
TSC2−/− MEFs were used in the rapamycin screen due to constitutive hyperactivation of mTORC1 signaling in this cell line. Cells were grown in light ([12C614N2]Lys, [12C614N4]Arg) and heavy ([13C615N2]Lys, [13C615N4]Arg) DMEM (Cambridge Isotope Labs), respectively. Both light and heavy DMEM were supplemented with 10% dialyzed FBS (Invitrogen). Cells were serum-deprived for 17 hours and cells were cultured inheavy media were treated with 20 nM rapamycin for two hours. We performed two biological replicates of this experimental design with cross-labeling (swapping the labeled state of the rapamycin-treated cells). For the purposes of illustration, the data for biological replicate #2 is presented in
The Ku-0063794 screen was performed using wild-type (WT) MEFs. Cells were grown in the aforementioned SILAC media. Both the light and heavy cells were starved of serum for 17 hrs. The light cells were treated with 20 nM rapamycin for 2 hrs, while the heavy cells were treated with a combination of 20 nM rapamycin and 2 μM Ku-0063794 for 2 hrs. Both the light and heavy cells were then stimulated with 100 nM insulin for 15 min.
The heavy and light cells were lysed in urea buffer (8 M urea, 20 mM HEPES pH 7.0, 75 mM β-glycerolphosphate, 1 mM sodium vanadate, 1 mM DTT and 1.5 mM EGTA) and the lysates were combined at a 1:1 ratio. Lysates were reduced by adding DTT to a final concentration of 3 mM, followed by incubation at room temperature for 20 min. Cysteines were alkylated by adding iodoacetamide to a final concentration of 50 mM, followed by incubation in the dark for 20 min. The lysates were diluted to a final concentration of 2 M urea by addition of 100 mM NH4OAC and were digested overnight with sequencing-grade trypsin (Promega) at a 1:100 (enzyme:substrate) ratio. Digestion was quenched by addition of trifluoroacetic acid to a final concentration of 0.1% and precipitates were removed by centrifugation at 4,000 rpm for 30 min. Peptides were desalted on SepPak C18 columns (Waters) according to manufacturer's instructions.
Phosphopeptides were enriched by SCX-IMAC (27). Briefly, lyophilized peptides were resuspended in 500 μl SCX buffer A (5 mM KH2PO4, pH 2.65, 30% acetonitrile) and injected onto a SCX column (Polysulfoethyl aspartamide, 9.4 mm×200 mm, 5 μM particle size, 200 Å pore size, PolyLC). Gradient was developed over 35 min ranging from 0% to 21% buffer B (5 mM KH2PO4, pH 2.65, 30% acetonitrile, 350 mM KCl) at a flow rate of 2 ml/min. Twelve fractions were collected and lyophilized. Peptides were then desalted using SepPak C18 columns and were subjected to IMAC (Sigma) for phosphopeptide enrichment. The eluate was further desalted using STAGE tips (28) and lyophilized.
The rapamycin screen samples were analyzed by LC-MS/MS on an LTQ-Orbitrap mass spectrometer (Thermo, San Jose, Calif.) using the top ten method. The Ku-0063794 screen samples were analyzed on an LTQ-Velos mass spectrometer (Thermo Fischer Scientific, San Jose, Calif.) using the top twenty method. MS/MS spectra were searched against a composite database of the mouse IPI protein database (Version 3.60) and its reversed complement using the Sequest algorithm. Search parameters allowed for a static modification of 57.02146 Da for Cys and a dynamic modification of phosphorylation (79.96633 Da) on Ser, Thr and Tyr, oxidation (15.99491 Da) on Met, stable isotope (10.00827 Da) and (8.01420 Da) on Arg and Lys, respectively. Search results were filtered to include <1% matches to the reverse data base by the linear discriminator function (Huttlin et al., manuscript in preparation) using parameters including Xcorr, dCN, missed cleavage, charge state (exclude 1+ peptides), mass accuracy, peptide length and fraction of ions matched to MS/MS spectra. Phosphorylation site localization was assessed by the Ascore algorithm (29) based on the observation of phosphorylation-specific fragment ions and peptide quantification was performed by using the Vista algorithm (30, 31).
We further filter the peptides according to the following criteria for quantitation of the peptide abundance changes: (1) Vista confidence score must be at least 85, (2) signal to noise ratio (S/N)≧3 for both the heavy and light peptides, (3) in the cases where one of the isotopic species has an S/N of ≦3, S/N of the other was required to be ≧5, and (4) in the cases where only the heavy or light version of a peptide was found, we reported the peak S/N ratio, or its inverse, as a proxy for relative abundance measurement. For such peptides, we also required S/N of at ≧5 for the observed species.
The cDNA for human Grb10 (NCBI gene symbol GRB10; Gene ID: 2887) was obtained from Invitrogen and amplified by PCR. The product was subcloned into (1) the BamH I and EcoR I sites of pKH3, (2) the BamH I and EcoR I sites of pGEX-4T-3 or (3) the Hind III and EcoR I sites of pLPCX. The Grb10 point mutant constructs were generated using the QuickChange site-directed mutagenesis kit (Stratagene). pRK5-Myc-raptor andpRK5-Myc-Rictor were kindly provided by David Sabatini (MIT). Lentiviral plasmids (Δ8.9 and VSVG) were kind gifts from Andrew Kung (Dana Farber Cancer Institute) and David Baltimore (California Institute of Technology).
Cells were extracted with lysis buffer A (40 mM HEPES, pH 7.5, 120 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 50 mM NaF, 2 mM phenylmethylsulfonyl fluoride, 2 mg/ml aprotinin, 2 mg/ml leupeptin, and 1 mg/ml pepstatin, 1 mM DTT) containing 1% Triton X-100, 1% NP-40, or 0.2% CHAPS. After centrifugation, supernatants were collected and pre-cleared for 1 h with protein A- and G-Sepharose beads (GE Healthcare Biosciences). After centrifugation at 3,000 rpm for 5 min, the supernatants were incubated with the antibody at 4° C. for 2 h, and then incubated with protein A- and G-Sepharose for an additional hour. Beads were washed four times with the lysis buffer and eluted in 2× reducing sample buffer.
Mammalian Lentiviral shRNAs
Lentiviral short hairpin RNA (shRNA) expression vectors were a kind gift from William Hahn (Dana Farber Cancer Institute). To generate the lentiviruses, shRNA plasmids were co-transfected into HEK293TD cells along with packaging (Δ8.9) and envelope (VSVG) expression plasmids using lipofectamine 2000 (Invitrogen). Two days after transfection, viral supernatants were harvested and filtered. Recipient cells were infected in the presence of a serum-containing medium supplemented with 8 μg/ml polybrene. Following infection for 36 h, cells were treated with 2.0 μg/ml puromycin (Sigma) and cell lines that stably expressed the shRNAs were selected. Knockdown efficiencies were examined by immunoblot assay using antibodies against the target protein.
For immunoblot analysis, the cells were extracted in lysis buffer (20 mM HEPES (pH 7.5), 1% Triton X-100, 150 mM NaCl, 10 mM EDTA, 1 mM EGTA, 1 mM sodium orthovanadate, 1 mM NaF, 2 mM phenylmethylsulfonyl fluoride, 2 mg/ml aprotinin, 2 mg/ml leupeptin, and 1 mg/ml pepstatin), and extracts were mixed with the 5× reducing buffer (60 mM Tris-HCl, pH 6.8, 25% glycerol, 2% SDS, 14.4 mM 2-mercaptoethanol, 0.1% bromophenol blue). Samples were boiled for 5 min and subject to electrophoresis using the standard SDS-PAGE method. Proteins were then transferred to a nitrocellulose membrane (Whatman). The membranes were blocked with a TBST buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween 20) containing 3% nonfat dried milk, and probed overnight with primary antibodies at 4° C. and for 1 h at RT with peroxidase-conjugated secondary antibodies. Blots were developed using enhanced chemiluminescence, exposed on autoradiograph film and developed using standard methods.
For the purification of GST-tagged proteins, plasmids were transformed into Escherichia coli strain BL21 (DE3), and purified to homogeneity from crude lysates using glutathione-sepharose beads (GE Healthcare) according to the manufacture's protocol. Briefly, protein production was initiated by adding isopropyl-D-thiogalactopyranoside (Sigma) to the cultures. Bacteria were collected by centrifugation, resuspended in PBS and lysed by sonication. After centrifugation at 13,000 rpm for 15 min, the supernatant was incubated with glutathione-sepharose beads for 1 h. The beads were washed with PBS three times and the recombinant protein was eluted with PBS containing 20 mM reduced glutathione. Proteins were dialyzed against PBS and stored at −80° C. until use.
Total cellular RNA was purified from cultured cells using the RNeasy mini kit (Qiagen) following the manufacturer's protocol. For quantitative real-time PCR (qRT-PCR), RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's instructions. The resulting cDNA was analyzed by qRT-PCR using the QuantiTect SYBR Green qPCR System (Qiagen). A QuantiTect Primer Assay for mouse Grb10 was used to amplify the target gene, while the β-acting primers (β-actin forward, ACCCAGATCATGTTTGAGACCT (SEQ ID NO: 25); and β-actin reverse, GCAGTAATCTCCTTCTGCATCC (SEQ ID NO: 26)) were used as a normalization control. All reactions were run on an ABI 7900HT Fast Real-Time PCR instrument with a 15 min hot start at 95° C. followed by 40 cycles of a 3-step thermocycling program: denaturation: 15 s at 94° C., annealing: 30 s at 55° C. and extension: 30 s at 70° C. Melting curve analysis was performed at the end of every run to ensure that a single PCR product of the expected melting temperature was produced in a given well. A total of 3 biological replicates×4 technical replicates/biological replicate were performed for each treatment group. Data analysis utilized the comparative Ct method (ΔΔCt method).
Microarray expression data from six independent data sets corresponding to patient samples from bladder (GSE3167), glioblastoma (GSE4536), breast (GSE5764), myeloma (GSE5900), pancreatic (GSE1542) carcinoma and matching normal tissues were downloaded from Gene Expression Omnibus (www.nebi.nlm.nih.gov/geo/) and for prostate carcinoma from the Broad Institute cancer program datasets (www.broadinstitute.org/cgi-bin/cancer/datasets.cgi). The correlation in the gene expression between GRB10 and PTEN was performed using Pearson's correlation coefficient analysis and the samples were clustered using the Euclidean distance metric and Ward's linkage algorithm.
All publications, patents and sequence database entries mentioned herein, including those items listed below and in the databases and tables provided or referred to herein, are hereby incorporated by reference in their entirety for disclosure of the relevant subject matter indicated, as if each individual database entry, publication, or patent was specifically and individually indicated to be incorporated by reference. The specification provides a number of International Protein Index (IPI) accession numbers, starting with IPI followed by a number. International Protein Index database entries identified by IPI accession number in the specification are incorporated by reference for disclosure of the respective protein sequence and accompanying protein information. The IPI database can be accessed at the European Bioinformatics Institute homepage (www.ebi.ac.uk/), for example, at (www.ebi.ac.uk/IPI/IPIhelp.html). In case of conflict, the present application, including any definitions herein, will control.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is as set forth in the appended claims.
In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the claims or from relevant portions of the description is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Furthermore, where the claims recite a composition, it is to be understood that methods of using the composition for any of the purposes disclosed herein are included, and methods of making the composition according to any of the methods of making disclosed herein or other methods known in the art are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. For example, it is to be understood that any of the compositions of the invention can be used for vocal cord repair or other soft tissue repair or augmentation. It is also to be understood that any of the compositions made according to the methods for preparing compositions disclosed herein can be used for vocal cord repair or other soft tissue repair or augmentation. In addition, the invention encompasses compositions made according to any of the methods for preparing compositions disclosed herein.
Where elements are presented as lists, e.g., in Markush group format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It is also noted that the term “comprising” is intended to be open and permits the inclusion of additional elements or steps. It should be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, steps, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, steps, etc. For purposes of simplicity those embodiments have not been specifically set forth in haec verba herein. Thus for each embodiment of the invention that comprises one or more elements, features, steps, etc., the invention also provides embodiments that consist or consist essentially of those elements, features, steps, etc.
Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and/or the understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. It is also to be understood that unless otherwise indicated or otherwise evident from the context and/or the understanding of one of ordinary skill in the art, values expressed as ranges can assume any subrange within the given range, wherein the endpoints of the subrange are expressed to the same degree of accuracy as the tenth of the unit of the lower limit of the range.
In addition, it is to be understood that any particular embodiment of the present invention may be explicitly excluded from any one or more of the claims. Any embodiment, element, feature, application, or aspect of the compositions and/or methods of the invention, can be excluded from any one or more claims. For purposes of brevity, all of the embodiments in which one or more element, feature, purpose, or aspect is excluded are not set forth explicitly herein.
The Tables provided below are referred to in the specification and the claims. Because some of the tables are lengthy, they are provided in this subsection.
This application claims priority under 35 U.S.C. §119(e) to U.S. provisional patent application, U.S. Ser. No. 61/403,932, filed Sep. 23, 2010, which is incorporated herein by reference.
This invention was made with U.S. Government support under grant numbers GM051405 and HG3456 awarded by the National Institutes of Health. The U.S. Government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US11/53035 | 9/23/2011 | WO | 00 | 6/11/2013 |
| Number | Date | Country | |
|---|---|---|---|
| 61403932 | Sep 2010 | US |
