Patent Application
20110160123
Mycobacterium tuberculosis (Mtb) has infected about two billion people and causes the death of about two million people every year, more than any other pathogenic bacterium. Since the lungs of an infected patient contain more than a billion bacilli, poor treatment compliance selects for multi drug resistant (MDR) strains. Mtb is intrinsically resistant to many drugs mainly due to an impermeable outer membrane (OM) in combination with the activities of multidrug efflux pumps. All current first and many second line Tuberculosis (TB) drugs are substrates of one or several drug efflux pumps. TB caused by Mtb strains resistant to the few available TB drugs increases both the treatment time and the cost of treatment dramatically.
Provided herein are methods of reducing drug resistance in Mycobacterium tuberculosis (Mtb). The methods comprise contacting Mtb with an agent, wherein the agent inhibits the activity of an efflux complex.
Also provided are methods of treating Mtb in a subject. The methods comprise administering to the subject an agent that inhibits the activity of an efflux complex and administering to the subject a tuberculosis treating agent.
Further provided is a method of screening for an agent that reduces drug resistance in Mtb. The methods comprise providing an Mtb with a mutant efflux complex and contacting the Mtb with an agent to be tested and a tuberculosis treating agent. Reduced resistance to the tuberculosis treating agent in the presence of the agent to be tested, as compared to a control, indicates the agent to be screened reduces drug resistance in Mtb.
Efficient drug efflux systems in gram-negative bacteria share a common outer membrane channel protein. Elimination of the outer membrane (OM) component increases the susceptibility to most drugs and helps to prevent the emergence of antibiotic resistance in other bacteria. Mycobacteria also have an outer membrane. Inhibition of the OM component in Mtb is useful to inactivate multi-drug efflux systems directly without the need to cross the OM permeability barrier (“channel blocker”). This avoids permeability problems and reduces the frequency of resistance mutations in Mtb. Thus, such OM protein inhibitors enable the use of established, but so far inefficient, antibiotics for TB chemotherapy.
The genome of Mtb encodes 69 putative drug efflux pumps. See De Rossi et al., FEMS Microbiol. Rev. 30:36-52 (2006), which is incorporated by reference herein at least for the putative drug efflux pumps and related methods. Drug efflux is essential in other bacteria for the emergence of antibiotic resistance. Only efflux of drugs across both membranes is an effective resistance mechanism in gram-negative bacteria. This process is mediated by tripartite efflux systems consisting of an inner membrane pump, an OM channel protein, and periplasmic adapter proteins.
Rv1698 is an OM channel protein of Mtb. A mutant of M. smegmatis lacking the Rv1698 homologue is very sensitive to copper because it accumulates 10-fold more copper than the wild-type. These and other results show that Rv1698 is part of a copper efflux system. Metal and drug-efflux systems share the same tripartite architecture in gram-negative bacteria.
Tap, Rv1634, Rv1258c and Stp of the Major Facilitator Superfamily (MFS) confer resistance to aminoglycosides, tetracycline, fluoroquinolones, rifampicin, ofloxacin, spectinomycin and tetracycline, respectively. MmR of the Small Multidrug Resistance (SMR) family provides resistance to different antiseptics, drugs, and intercalating dyes). The ATP-Binding Cassette (ABC) transporters DrrAB and Rv2686c-2687c-2688c confer resistance to hydrophobic drugs and to fluoroquinolones, respectively. The genome of Mtb also encodes 15 putative transporters of the Resistance, Nodulation and Cell Division (RND) family called MmpL proteins. It was shown that MmpL7 is indeed a drug efflux pump and provides high resistance to isoniazid.
Efflux pumps are inner membrane transporter proteins which use energy (ATP hydrolysis or proton gradient) to export solutes either into the periplasm or into the medium. The majority of the efflux pumps of Gram-negative bacteria connect to an OM protein and are especially effective, because they traverse both membranes and pump out drugs directly into the external medium. For example, transporters of the MFS, the ABC superfamily, and the RND superfamily require an OM channel for function. AcrB of E. coli belongs to the RND family and is one of the best examined efflux pumps. AcrB is part of a tripartite system consisting also of the OM channel TolC and the membrane fusion protein AcrA, which is anchored in the inner membrane by an N-terminal lipid moiety. Deletion of TolC alone increased the susceptibility of E. coli to multiple drugs in a manner similar to AcrAB.
TolC is an important, low-abundance protein in the OM of gram-negative bacteria. Although TolC of E. coli and its homologs such as OprM of P. aeruginosa share only little sequence similarities (40%), they have similar structures and functions. Planar lipid bilayer experiments showed that TolC and its homologs form water-filled channels with similar levels of conductance (approximately 80 pS in 1M KCl). Crystallography revealed that TolC and OprM share the same homo-trimeric structure, which spans the OM and periplasm of these bacteria as a channel-tunnel. These trimers form a 12-stranded β-barrel that lodges in the OM and a coiled α-helical barrel that spans the periplasm and forms a complex with inner membrane transport proteins such as AcrB of E. coli. The presence of the membrane fusion proteins AcrA/MexA appears to be required for opening of the tunnel. TolC functions as a component of multi-drug resistance (MDR) efflux systems in the removal of a broad range of toxic chemicals from the cell. Type I-dependent secretion of certain virulence-associated proteins also requires TolC. TolC is important for virulence and survival in the host of the pathogenic E. coli, Vibrio cholerae, Salmonella enterica serovar Enteritidis, and Serratia marcescens.
Mycobacteria produce mycolic acids which are α-branched β-hydroxy fatty acids consisting of up to 90 carbon atoms and the longest fatty acids known in nature. In addition, the mycobacterial cell envelope contains a fascinating diversity of other lipids, many of which are unique to mycobacteria. Minnikin originally proposed that the mycolic acids, which are covalently bound to the arabinogalactan-peptidoglycan co-polymer, form the inner layer of an unique OM (Minnikin, Lipids: Complex lipids, their chemistry, biosynthesis and roles. In: Ratledge, C., and Stanford, J. (eds). The biology of the mycobacteria: Physiology, identification and classification, Academic Press, London (1992)). Experimental evidence for this model was provided by X-ray diffraction studies, which showed that the mycolic acids are oriented in parallel and perpendicular to the plane of the cell envelope. The analysis of spin-labeled fatty acids inserted into isolated mycobacterial cell walls by electron paramagnetic resonance supported the existence of a moderately fluid outer leaflet while the inner leaflet consisting of mycolic acids has an extremely low fluidity. This interpretation is consistent with observations that mutants with defects in the production of some of the major extractable lipids (glycopeptidolipids, phthiocerol dimycocerosate) showed an increased OM permeability to hydrophobic solutes. Thus, the mycobacterial OM constitutes a supported asymmetric lipid bilayer and provides an extraordinarily efficient permeability barrier, which is 100-1,000-fold less permeable than that of E. coli.
The discovery of the MspA porin of M. smegmatis showed that OM proteins exist in mycobacteria and that they fulfil essential transport functions such as diffusion of small and hydrophilic nutrients in the case of porins. OM proteins are also needed for other transport processes such as multidrug efflux or protein secretion. The X-ray analysis of crystals revealed that the structure of MspA is completely different from those of porins of gram-negative bacteria.
Provided herein are methods of reducing drug resistance in Mycobacterium tuberculosis (Mtb). The methods comprise contacting the Mtb with an agent, wherein the agent inhibits the activity of an efflux complex. The efflux complex, for example, comprises an efflux channel and an efflux pump. The efflux channel can comprise Rv1698 (MctB) or a TolC-like efflux channel. The efflux pump can comprise Rv0194. The efflux complex can comprise a TolC-like efflux channel and Rv0194.
Optionally, the agent is selected from a group consisting of a small molecule, a polypeptide, a nucleic acid, or a peptidomimetic. The agent can, for example, inhibit the activity of the efflux channel. Optionally, the agent is an efflux channel inhibitor or blocker. Optionally, the efflux channel inhibitor or blocker comprises Ru(II)quaterpyridinium complex or a derivative thereof. The agent can, for example, inhibit the activity of the efflux pump.
Also provided herein are methods of treating or preventing Mycobacterium tuberculosis (Mtb) in a subject. The methods comprise administering to the subject an agent that inhibits the activity of an efflux complex and administering to the subject a tuberculosis treating agent. The tuberculosis treating agent, for example, comprises an antibiotic (e.g., isoniazid, ethambutol, rifampicin, norfloxacin, erythromycin, pyrazinamide, capreomycin, kanamycin, chloramphenicol, tetracycline, streptomycin, and vancomycin), or it comprises derivatives thereof (e.g., derivatives of penicillin, cephalosporin, macrolide, tetracycline, fluoroquinolone, nitroimidazole, aminoglycoside, sulfonamide, monobactams, carbapenems classes or rifampicin, diarylquinoline, isoniazid, ethambutol, linezolid, PA-824 and 8207910 derivatives).
Further provided herein are methods of screening for an agent that reduces drug resistance in Mycobacterium tuberculosis (Mtb). The methods comprise providing an Mtb with a mutant efflux complex and contacting the Mtb with an agent to be tested and a tuberculosis treating agent. Reduced resistance to the tuberculosis treating agent in the presence of the agent to be tested, as compared to a control, indicates the agent to be screened reduces drug resistance in Mtb. A mutant efflux complex can comprise a mutant efflux channel and/or a mutant efflux pump. An efflux channel can, for example, comprise Rv1698 (MctB) or a TolC-like efflux channel. An efflux pump can, for example, comprise Rv0194. An agent to be tested can, for example, be an agent available in a library. The agent to be tested can be an agent that blocks function or expression of the OM protein and can include, for example, small molecules, polypeptides, nucleic acids, or peptidomimetics.
Determining whether reduced resistance to the tuberculosis treating agent occurs in the presence of the agent to be tested involves comparison to a control. A control can include, for example, treating the same mutant Mtb with the tuberculosis treating agent but no agent to be tested. Comparisons of growth characteristics between the two samples determines whether a reduced resistance to the tuberculosis treating agent occurs in the presence of the agent to be tested. If the mutant Mtb treated with the agent to be tested exhibits slower growth characteristics or, alternatively, does not grow at all, as compared to the other mutant Mtb, then the agent to be tested reduces drug resistance in Mtb.
Mtb mutants can be made using methods known in the art. For example, plasmid mediated transposon insertion can be used to create a library of Mtb mutants. See, e.g., Pelicic et al., Proc. Natl. Acad. Sci. USA 94:10955-60 (1997). Using transposon mediated insertional mutagenesis can lead to Mtb mutants that overexpress a protein (e.g., mutations in the promoter that increase expression of the protein), that decreases expression a protein (e.g., mutations in the promoter or start codon that decreases or prevents expression of the protein), that does not affect the function of the protein (e.g., intergenic mutations), or that expresses a mutant form of a protein (e.g., a truncated form of the protein).
There are a variety of sequences that are disclosed on Genbank, at www.pubmed.gov and these sequences and others are herein incorporated by reference in their entireties as are individual subsequences or fragments contained therein. Rv1698 (MctB) copper efflux channel and homologs, variants, mutants, and isoforms thereof are provided herein. For example, the nucleotide and amino acid sequences of Rv1698 (MctB) can be found at GenBank Accession Nos. NC—000962.2 (from nucleotide 191,488 to 192,432) and NP—216214, respectively. Rv0194 efflux pump and homologs, variants, mutants, and isoforms thereof, are also provided herein. The nucleotide and amino acid sequences of Rv0194 can be found at GenBank Accession Nos. NC—000962.2 (from nucleotide 226,877 to 230,461) and NP—214708.1, respectively. Thus provided are the nucleotide sequences of Rv1698 (MctB) and Rv0194 comprising a nucleotide sequence at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more identical to the nucleotide sequence of the aforementioned GenBank Accession Numbers. Also provided are amino acid sequences of Rv1698 (MctB) and Rv0194 comprising an amino acid sequence at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more identical to the sequences of the aforementioned GenBank Accession Numbers. As with all peptides, polypeptides, and proteins, including fragments thereof, it is understood that additional modifications in the amino acid sequence of the Rv1698 (MctB) and Rv0194 polypeptides can be selected to alter the nature or function of the peptides, polypeptides, or proteins.
Nucleic acids that encode the polypeptide sequences, variants, mutants, and fragments thereof are disclosed. These sequences include all degenerate sequences related to a specific protein sequence, i.e., all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants, mutants, and derivatives of the protein sequences. Thus, while each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequences.
The polypeptides provided herein have a desired function. Rv1698 (MctB) is a copper efflux channel, responsible for channeling excess copper out of Mycobacterium tuberculosis to achieve a proper homeostasis for the bacteria. Rv0194 is an efflux pump responsible for pumping antibiotics out of Mycobacterium tuberculosis to ensure survival of the bacteria. The polypeptides are tested for their desired activity using the in vitro assays described herein. For example, Mtb mutants used for screening have decreased activity of the efflux complex. The Mtb mutant can have decreased activity of an efflux channel, an efflux pump, or a combination thereof.
The polypeptides described herein can be further modified and varied resulting in maintenance of the desired function, or alternatively, inhibition or dis-inhibition of the desired function. It is understood that one way to define any known modifications and derivatives or those that might arise, of the disclosed genes and proteins herein is through defining the modifications and derivatives in terms of identity to specific known sequences. Specifically disclosed are polypeptides which have at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent identity to Rv1698 (MctB) and Rv0194 and variants provided herein. Those of skill in the art readily understand how to determine the identity of two polypeptides. For example, the identity can be calculated after aligning the two sequences so that the identity is at its highest level.
Another way of calculating identity can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local identity algorithm of Smith and Waterman, Adv. Appl. Math, 2:482 (1981), by the identity alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection.
The same types of identity can be obtained for nucleic acids by, for example, the algorithms disclosed in Zuker, Science 244:48-52 (1989); Jaeger et al., Proc. Natl. Acad. Sci. USA 86:7706-7710 (1989); Jaeger et al., Methods Enzymol. 183:281-306 (1989), which are herein incorporated by reference for at least material related to nucleic acid alignment. It is understood that any of the methods typically can be used and that in certain instances the results of these various methods may differ, but the skilled artisan understands if identity is found with at least one of these methods, the sequences would be said to have the stated identity and to be disclosed herein.
Protein modifications include amino acid sequence modifications. Modifications in amino acid sequence may arise naturally as allelic variations (e.g., due to genetic polymorphism) or may be produced by human intervention (e.g., by mutagenesis of cloned DNA sequences), such as induced point, deletion, insertion, and substitution mutants. These modifications can result in changes in the amino acid sequence, provide silent mutations, modify a restriction site, or provide other specific mutations. Amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional, or deletional modifications. Insertions include amino and/or terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues unless chimeric polypeptides are desired. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Optionally, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule unless entire domains are deleted. Amino acid substitutions are typically of single residues but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. Substitutional modifications are those in which at lease one residue has been removed and a different residue inserted in its place. Such substitutions can be made in accordance with the following Table 1 and are referred to as conservative substitutions. Alternatively, when changes in function are desired, nonconservative substitutions can be selected (e.g., proline for glycine).
Modifications, including the specific amino acid substitutions, are made by known methods. By way of example, modifications are made by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the modification, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example M13 primer mutagenesis and PCR mutagenesis.
Provided herein are methods of treating or preventing infection from Mycobacterium tuberculosis (Mtb) in a subject. Such methods include administering an effective amount of an agent that inhibits the activity of an efflux complex. The agent can, for example, comprise a small molecule, a polypeptide, a nucleic acid molecule, a peptidomimetic or a combination thereof. Optionally, the small molecules, polypeptides, nucleic acid molecules, and/or peptidomimetics are contained within a pharmaceutical composition.
Provided herein are compositions containing the provided small molecules, polypeptides, nucleic acid molecules, and/or peptidomimetics and a pharmaceutically acceptable carrier described herein. The herein provided compositions are suitable of administration in vitro or in vivo. By pharmaceutically acceptable carrier is meant a material that is not biologically or otherwise undesirable, i.e., the material is administered to a subject without causing any undesirable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained. The carrier is selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject.
Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005). Typically, an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic. Examples of the pharmaceutically-acceptable carriers include, but are not limited to, sterile water, saline, buffered solutions like Ringer's solution, and dextrose solution. The pH of the solution is generally about 5 to about 8 or from about 7 to 7.5. Other carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the immunogenic polypeptides. Matrices are in the form of shaped articles, e.g., films, liposomes, or microparticles. Certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered. Carriers are those suitable for administration of the agent, e.g., the small molecule, polypeptide, nucleic acid molecule, and/or peptidomimetic, to humans or other subjects.
The compositions are administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. The compositions are administered via any of several routes of administration, including topically, orally, parenterally, intravenously, intra-articularly, intraperitoneally, intramuscularly, subcutaneously, intracavity, transdermally, intrahepatically, intracranially, nebulization/inhalation, or by installation via bronchoscopy. Optionally, the composition is administered by oral inhalation, nasal inhalation, or intranasal mucosal administration. Administration of the compositions by inhalant can be through the nose or mouth via delivery by spraying or droplet mechanism. For example, in the form of an aerosol.
Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives are optionally present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
Formulations for topical administration include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners and the like are optionally necessary or desirable.
Compositions for oral administration include powders or granules, suspension or solutions in water or non-aqueous media, capsules, sachets, or tables. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders are optionally desirable.
Optionally, the nucleic acid molecule or polypeptide is administered by a vector comprising the nucleic acid molecule or a nucleic acid sequence encoding the polypeptide. There are a number of compositions and methods which can be used to deliver the nucleic acid molecules and/or polypeptides to cells, either in vitro or in vivo via, for example, expression vectors. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based deliver systems. Such methods are well known in the art and readily adaptable for use with the compositions and methods described herein.
As used herein, the terms peptide, polypeptide, or protein are used broadly to mean two or more amino acids linked by a peptide bond. Protein, peptide, and polypeptide are also used herein interchangeably to refer to amino acid sequences. It should be recognized that the term polypeptide is not used herein to suggest a particular size or number of amino acids comprising the molecule and that a peptide of the invention can contain up to several amino acid residues or more.
As used throughout, subject can be a vertebrate, more specifically a mammal (e.g. a human, horse, cat, dog, cow, pig, sheep, goat, mouse, rabbit, rat, and guinea pig), birds, reptiles, amphibians, fish, and any other animal. The term does not denote a particular age or sex. Thus, adult and newborn subjects, whether male or female, are intended to be covered. As used herein, patient or subject may be used interchangeably and can refer to a subject with a disease or disorder (e.g. tuberculosis). The term patient or subject includes human and veterinary subjects.
A subject at risk of developing a disease or disorder can be predisposed to the disease or disorder, e.g., live, work, or socially come into contact with a subject infected with Mycobacterium tuberculosis. A subject currently with a disease or disorder has one or more than one symptom of the disease or disorder and may have been diagnosed with the disease or disorder.
The methods and agents as described herein are useful for both prophylactic and therapeutic treatment. For prophylactic use, a therapeutically effective amount of the agents described herein are administered to a subject prior to onset (e.g., before infection with Mycobacterium tuberculosis) or during early onset (e.g., upon initial signs and symptoms of tuberculosis). Prophylactic administration can occur for several days to years prior to the manifestation of symptoms of tuberculosis. Prophylactic administration can be used, for example, in the preventative treatment of subjects likely to be exposed to other subjects currently afflicted with tuberculosis. Therapeutic treatment involves administering to a subject a therapeutically effective amount of the agents described herein after diagnosis or development of tuberculosis.
According to the methods taught herein, the subject is administered an effective amount of the agent. The terms effective amount and effective dosage are used interchangeably. The term effective amount is defined as any amount necessary to produce a desired physiologic response. Effective amounts and schedules for administering the agent may be determined empirically, and making such determinations is within the skill in the art. The dosage ranges for administration are those large enough to produce the desired effect in which one or more symptoms of the disease or disorder are affected (e.g., reduced or delayed). The dosage should not be so large as to cause substantial adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex, type of disease, the extent of the disease or disorder, route of administration, or whether other drugs are included in the regimen, and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosages can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
As used herein the terms treatment, treat, or treating refers to a method of reducing the effects of a disease or condition or symptom of the disease or condition. Thus in the disclosed method, treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of an established disease or condition or symptom of the disease or condition. For example, a method for treating a disease is considered to be a treatment if there is a 10% reduction in one or more symptoms of the disease in a subject as compared to a control. Thus the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition.
As used herein, the terms prevent, preventing, and prevention of a disease or disorder refers to an action, for example, administration of a therapeutic agent, that occurs before or at about the same time a subject begins to show one or more symptoms of the disease or disorder, which inhibits or delays onset or exacerbation of one or more symptoms of the disease or disorder. As used herein, references to decreasing, reducing, or inhibiting include a change of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater as compared to a control level. Such terms can include but do not necessarily include complete elimination.
Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutations of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to a number of molecules including the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.
Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entireties.
All of the bacterial strains used in this study are listed in Table 2. Mycobacterial strains were grown at 37° C. in Middlebrook 7H9 liquid medium (Difco Laboratories of Becton Dickinson (BD); Franklin Lakes, N.J.) supplemented with 0.2% glycerol, 0.05% Tween 80 or on Middlebrook 7H10 agar (Difco Laboratories) supplemented with 0.2% glycerol unless indicated otherwise. E. coli DH5a was used for all cloning experiments and was routinely grown in Luria-Bertani medium at 37° C. The following antibiotics were used when required at the following concentrations: ampicillin (100 μg/ml for E. coli), kanamycin (30 μg/ml for E. coli; 30 μg/ml for M. smegmatis), and hygromycin (200 μg/ml for E. coli, 50 μg/ml for M. smegmatis).
M. smegmatis strains were grown in a 4-ml culture for 2 days at 37° C. to an A600 of 0.6-0.8. The cultures were diluted in Middlebrook 7H9 medium to yield ˜5,000 colony-forming units (cfu)/ml. Approximately 500 cfu were streaked out on plates containing the appropriate antibiotic concentrations. As a reference 500 cfu were also plated onto plates without any antibiotic. The number of surviving cells was normalized to the number of cells counted on plates without antibiotic for each strain and expressed as relative colony forming units (% cfu). Colony counts were carried out after 3 days of incubation at 37° C. The concentrations of the antibiotics were: ampicillin, 32 μg/ml; cephaloridin, 3 μg/ml; and chloramphenicol, 6 μg/ml.
The experiments were carried out as previously described (Stahl et al., Mol. Microbiol. 40:451-64 (2001)). To reduce aggregation and clumping, M. smegmatis strains were grown first in 4-ml cultures for 2 days at 37° C. and then filtered through a 5-μm pore size filter (Sartorius; Goettingen, Germany). The filtrates were grown for 2 days at 37° C. and then used to inoculate 100-ml cultures that were grown to an A600 of 0.5. The cells were harvested by centrifugation (4° C., 3000 rpm, 10 min), washed once in 2 mM PIPES, pH 6.5, 0.05 mM MgCl2, and resuspended in the same buffer. The 14Ct-labeled compounds and their non-labeled analogs were mixed and added to the cell suspensions to obtain a final concentration of 20 μM with 106 cpm. The mixtures were incubated at 37° C., and 1 ml-samples were removed at the indicated times. The cells were filtered through a 0.45-μmpore size filter (Sartorius) and washed with 0.1 M LiCl, and their radioactivity was determined using a liquid scintillation counter. The mean dry weight of the cells in these samples was 1.4±0.4 mg. The uptake rate was expressed as nmol/mg cells.
Construction of Overexpression Vectors for rv1698 for Mycobacteria and E. coli
The gene rv1698 of M. tuberculosis and its homologous gene msmeg13 3747 of M. smegmatis were amplified by PCR using chromosomal DNA and the oligonucleotide pairs 1698fwd/1698rev and mpoS_SDopt—1/mspTSDrev (Table 2) introducing the restriction sites Pad and Swal. The genes were cloned into pMN016 under the control of the psmyc promoter by using those restriction sites (Stephan et al., Mol. Microbiol. 58:714-30 (2005)) to give the expression vectors pMN035 and pMN451, respectively (Table 2). To purify Rv1698 from mycobacteria, the protein was C-terminally tagged with six histidine residues by PCR using the primer 1698fwd and the 5′-phosphorylated primer mpoTHis (Table 2). The resulting PCR product was digested with Pad and cloned into the backbone of pMN016 digested with Pad and Swal to give pML911. To overexpress and analyze the pore forming activity of recombinant Rv1698, the truncated gene lacking the putative signal sequence of 30 amino acids was fused to a C-terminal His tag by cloning it into the vector pET28+ (Novagen; Gibbstown, N.J.). The gene without its putative leader sequence was amplified from pMN035 by using the oligonucleotides pMS-Seq1 and his rv1698fwd (Table 2). Both, the PCR fragment and pET28b+were digested with restriction endonucleases NdeI and HindIII and ligated to give pML122 (Table 2).
A vector for expression of untagged Rv1698 without the predicted signal peptide in E. coli was constructed using the oligonucleotides mat-rv1698fwd and mat-rvrev introducing the two restriction sites NcoI and NdeI (Table 2). The digested fragment was cloned into the vector pET-16b, which was treated with the same restriction endonucleases to obtain pML141.
E. coli DH5α
E. coli
M. smegmatis
M. smegmatis mc2155; SmR (Sander et al., Mol. Microbiol. 16:991-
M. smegmatis
M. smegmatis
M. bovis BCG
Overexpression, Purification, and Renaturation of Recombinant Rv1698His from E. coli
Cultures of E. coli Rosetta carrying the overexpression vectors pML122 were grown at 37° C. When the culture reached an A600 of 1, isopropylthio-β-D-galactosidase was added to a final concentration of 0.5 mM to induce gene expression. After a further 4 hours of incubation, the bacteria were harvested and resuspended in 20 ml of lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 0.5% Triton X-100). The cell suspension was sonicated four times for 20 seconds with 12 watts in 30-s intervals. 0.01 mg/ml DNase and 0.1 mg/ml lysozyme were added and incubated at room temperature for 20 minutes. The broken cells were harvested by centrifugation and resuspended in lysis buffer followed by sonication as described above. This step was repeated twice. Then the broken cells were resuspended in washing buffer (50 mM Tris-HCl, 100 mM NaCl) and sonicated again. Because rRv1698His formed inclusion bodies, the proteins in the pellet were dissolved with 8 M urea, separated from cell debris by centrifugation, and purified using nickel-nitrilotriacetic acid columns (nickel-nitrilotriacetic acid spin kit; Qiagen). The bound proteins were washed and eluted from the column by using a four-step pH gradient with TPU buffer (6 M urea, 0.1 M NaH2PO4, 0.01 M Tris) at different pH levels (pH 6.3/5.9/4.8/4.5) according to the recommendations of the manufacturer. The protein fraction at pH 4.5 contained most of the rRv1698His protein. Purified rRv1698His (180 μg/ml) was diluted 100-fold in 25 mM sodium-phosphate buffer (pH 7.5) containing 0.5% n-octylpolyethylene oxide (OPOE) at room temperature to remove urea and renature the protein. The resulting protein was directly used in black lipid bilayer experiments to determine single channel conductance and ion selectivity of the pore as described below. The BCA kit (Pierce; Rockford, Ill.) was used routinely to determine protein concentrations.
Purification of Rv1698His from M. bovis BCG
M. bovis BCG carrying the plasmid pML911 was grown in Middlebrook 7H9 liquid medium supplemented with 10% oleic acid albumin dextrose complex, 0.05% Tween 80, and hygromycin. At an A600 of 1, the bacteria were harvested, incubated in a rotatory shaker (200 rpm) with lysozyme 1 mg/ml in phosphate-buffered saline (PBS; 137 mM NaCl, 10 mM potassium phosphate, 2.7 mM KCl, pH 7.4) for 2 hours at 37° C. and disrupted at 4° C. using a Sonicator 3000 ultrasonic liquid processor (Misonix; Farmingdale, N.Y.) in 2 steps of 30 minutes (micro tip, pulsar cycle of 1 second, 9 Watts delivered per cycle). The proteins were solubilized by incubation with 1% SDS in PBS for 18 hours (37° C., 200 rpm). Nonsoluble material was removed by centrifugation (10,000×g, 4° C.) before purifying Rv1698His on nickel-nitrilotriacetic acid-agarose (Qiagen; Valencia, Calif.) using a batch procedure. The bound His-tagged protein was washed and eluted from the resin by using a three-step imidazole gradient (5/20/250 mM) in sodium phosphate buffer (50 mM NaH2PO4, pH 7.6, 0.3 M NaCl) according to the recommendations of the manufacturer. The His-tagged protein was eluted with 250 mM imidazole. Because of the high imidazole concentration, the BCA assay was not used, and the purified Rv1698His protein was quantified by using the Bradford protein assay (Bio-Rad; Hercules, Calif.) according to the manufacturer's recommendations. In addition, a calibration curve of band intensities was established with known amounts of bovine serum albumin in Coomassie stained SDS-polyacrylamide gels using image analysis software (LabWorks 4.6, UVP; Upsland, Calif.). Then the amount of Rv1698 was determined relative to the bovine serum albumin reference. Both methods yielded the similar values.
The single channel conductance of Rv1698 protein was analyzed on a custom-made lipid bilayer apparatus as described previously (Heinz and Niederweis, Anal. Biochem. 285:113-120 (2000)). Briefly, the Ag/AgCl electrodes were bathed in a solution of 1 M KCl, 10 mM HEPES, pH 7.0. The lipid membranes were painted from a solution of 1% diphytanoylphosphatidylcholine (DPhPC; Avanti Polar Lipids; Alabaster, Ala.) in n-decane. Before adding the protein, current traces of at least three or more membranes were recorded with the appropriate detergent (0.5% OPOE or 0.1% SDS in 25 mM sodium phosphate, pH 7.5) to exclude any contamination with channel forming activity and to demonstrate that the detergents did not affect the membrane. Then protein was added to both sides of the cuvette. Single channel conductances for more than 100 pores/sample were digitally recorded. The raw data were analyzed using IGOR Pro 5.03 program (WaveMetrics; Colorado Springs, Colo.). These data were further analyzed in SigmaPlot 9.0 (Systat Software; Chicago, Ill.) to generate the figures shown here. The ion selectivity of R1698His was measured as described previously (Niederweis et al., Mol. Microbiol. 33:933-45 (1999)).
Preparation of RNA from M. tuberculosis and RT-PCR Experiments
Total RNA of M. tuberculosis H37Rv was isolated by the Trizol method as recommended by the manufacturer. Briefly, the cultures were grown in 100 ml of 7H9 medium supplemented with 10% oleic acid albumin dextrose complex and 0.05% Tween 80 to log phase. Thirty five ml of the GTC buffer (5 M guanidium thiocyanate, 0.5% sarcosyl, 0.5% Tween 80, 1% β-mercaptoethanol) was added, and the culture was centrifuged at 10,000×g for 10 minutes at 4° C. The pellet was resuspended in 1.5 ml of TRIzol and lysed by agitation with glass beads (FastRNA Tubes-Blue) in a FastPrep® FP120 bead beater apparatus (Bio-101; Qbiogene; Carlsbad, Calif.) for 3×45 seconds at level 6.5. The suspensions were cooled on ice for 5 minutes between agitation steps. 500 μl of chloroform was added, and centrifugation was done for 5 minutes at 14,000×g. The upper phase was transferred to a new tube containing an equal volume of isopropanol. The tubes were incubated for 20 minutes at −80° C. and centrifuged at 14,000×g for 20 minutes at 4° C. The pellet was washed with 70% ethanol, dried, and resuspended in 100 μl of diethylpyrocarbonatetreated water (Ambion; Austin, Tex.). Further purification of samples was performed using Nucleospin→RNAII kit (Macherey-Nagel; Bethlehem, Pa.) following the instructions of the manufacturer. RNA was sonicated to render DNA accessibility to DNase degradation (2×20 seconds at 20% power), 5 minutes on ice between sonications (Stephan et al., BMC Microbiol. 4:45 (2004)). 5-10 μg of sonicated DNA was used for Turbo DNase treatment, which was done according to the manufacturer protocol (Ambion). cDNA synthesis was performed using SuperScript III first strand synthesis system for RT-PCR (Invitrogen; Carlsbad, Calif.) according to the manufacturer protocol using random primers. AccuPrime Pfx SuperMix (Invitrogen) was employed for the PCR. Primers used were RT-rv1698fwd and RT-rv1698rev (Table 2). Thirty five cycles (30 seconds at 95° C., 30 seconds at 58° C., 30 seconds at 68° C.) were run to amplify the cDNA. The PCR products were analyzed using 1% agarose gels, which were stained with ethidium bromide. Primers specific for 16 S rRNA were used as a positive control for RT-PCR.
Experiments to examine the surface accessibility of Rv1698 were carried out as described previously (Delogu et al., Mol. Microbiol. 52:725-33 (2004)) with minor modifications. M. smegmatis strains carrying the plasmids pMN437, pML911, pML451, and pMV61015.1 were grown in 20 ml of Middlebrook 7H9 medium and harvested as culture reached an A600 of about 3.5. The cells were washed once with Tris-buffered saline buffer (0.5 M Tris-HCl, pH 7.2, 150 mM NaCl, 3 mM KCl) and then resuspended in 1 ml of the same buffer. Two aliquots of 150 μl were taken, and proteinase K (Sigma-Aldrich; St. Louis, Mo.) was added to one of the aliquots to a final concentration of 100 μg/ml. After 30 min at 4° C. the reaction was stopped by adding Complete™ EDTA-free protease inhibitor mixture (Roche Applied Science; Indianapolis, Ind.) from a 7-fold stock solution. The samples were immediately centrifuged, washed once in 250 μl of Tris-buffered saline, and resuspended in 75 μl of Tris-buffered saline plus 25 μl of 4× protein loading buffer (160 mM Tris-HCl pH 7.0, 12% SDS, 32% glycerol, 0.4% bromphenol blue). Finally, the samples were boiled for 20 minutes to allow cell lysis and centrifuged again to remove insoluble debris, and 50 μl of the protein extracts were separated on a 10% polyacrylamide gel and analyzed in Western blots using standard protocols (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (1987)). The program LabWorks 4.6 (UVP) was used for quantitative image analysis to determine the amount of detected Rv1698 protein in treated and untreated samples.
Secondary structures of Rv1698 and reference proteins were predicted using the JPred 3 server (Cuff et al., Bioinformatics 14:892-3 (1998); Cuff and Barton, Proteins 34:508-19 (1999)) and the Network Protein Sequence Analysis server. SignalP3.0 (Bendsten et al., J. Mol. Biol. 340:783-95 (2004)) was accessed to examine the presence of signal peptides for Rv1698. The TMHMM2.0 program (Krogh et al., J. Mol. Biol. 305:567-80 (2001); Melen et al., J. Mol. Biol. 327:735-44 (2003)) was used for prediction of hydrophobic transmembrane α-helices. All of the algorithms were used with standard settings unless otherwise noted. The hydrophobicity profile of Rv1698 was calculated using an algorithm that was developed to detect repetitive oscillations of the hydropathy profile (Rauch and Moran, Comput. Methods Programs Biomed. 48:193-200 (1995)) and the Eisenberg hydrophobicity scale of amino acids (Eisenberg et al., J. Cell. Biochem. 31:11-7 (1986)).
The two-dimensional structures of ampicillin (Compound ID 2174), chloramphenicol (Compound ID 5959), and glucose (Compound ID 5793) were downloaded from PubChemCompound data base at NCBI. The Chem3D Pro 8.0 software (Cambridge-Soft; Cambridge, Mass.) was used to obtain three-dimensional structures of these molecules and to minimize their energy using the MOPAC algorithm. Using the program Chimera (Pettersen et al., J. Comput. Chem. 25:1605-12 (2004)), the molecules were oriented along their longest axis, and the length of the second longest axis was measured between the nuclei of the most distant atoms along this axis. These values were taken as the widths of the molecules and used for a minimal estimate of the pore size of Rv1698.
The Rv1698 Protein Increases the Susceptibility of an M. smegmatis Porin Mutant to Hydrophilic Antibiotics
A genome-wide secondary structure prediction of all exported proteins identified Rv1698 as a putative outer membrane protein of M. tuberculosis (Song et al., Tuberculosis 88:526-44 (2008)). The genomes of all mycobacteria including M. smegmatis (Msmeg—3747) and Mycobacterium leprae (ML1362) and other closely related bacteria such as Nocardia and Corynebacteria encode a single homolog of Rv1698. This indicated that Rv1698 and its homologs might perform a function specific for the mycolic acid-containing outer membrane of these bacteria.
To examine whether this protein might be a porin, the strain M. smegmatis MN01, which lacks the major porin gene mspA, was used. The outer membrane permeability of the ΔmspA mutant to hydrophilic β-lactam antibiotics was decreased 9-fold (Stahl et al., Mol. Microbiol. 40:451-64 (2001)). This resulted in a 16-fold increased resistance toward ampicillin compared with wild-type M. smegmatis (Stephan et al., Antimicrob. Agents Chemother. 48:4163-70 (2004)). Constitutive expression of mspA restored the susceptibility of the ΔmspA mutant MN01 to ampicillin and cephaloridine to wildtype levels as determined by using an agar dilution assay (
Rv1698 Partially Complements the Permeability Defect of Porin Mutants of M. smegmatis
Porin-mediated permeation through the outer membrane is the rate-limiting step for uptake of glucose by M. smegmatis (Stahl et al., Mol. Microbiol. 40:451-64 (2001); Stephan et al., Mol. Microbiol. 58:514-30 (2005)). For example, the minimal permeability coefficient of the ΔmspA ΔmspC mutant ML10 for glucose is 50-fold lower than that of wild-type M. smegmatis (Stephan et al., Mol. Microbiol. 58:514-30 (2005)). Therefore, whether rv1698 could complement the slow uptake of glucose by the porin double mutant ML10 was examined. Glucose at a concentration of 20 μM was taken up by the ML10 strain carrying the empty vector pMS2 with an average rate of 42 μmol/min/mg cells. This rate was increased 5-fold to 224 μmol/min/mg cells in the presence of the rv1698 expression vector pMN035 (Table 2), demonstrating that Rv1698 indeed increased the outer membrane permeability of the porin double mutant ML10 (
Lipid bilayer experiments provide direct evidence regarding whether a particular protein forms channels within lipid membranes (Niederweis et al., Mol. Microbiol. 33:933-45 (1999)). To this end, a truncated rv1698 gene encoding a protein with an N-terminal histidine tag replacing the predicted signal peptide (amino acids 1-30) was cloned under the control of the T7 promoter in the plasmid pML122 (Table 2). After induction of E. coli Rosetta containing pML122 with isopropylthio-β-D-galactosidase, the bacteria were harvested and disrupted by sonication. Because rRv1698His was insoluble (
To exclude that the N-terminal histidine tag modified the channel activity, an rv1698 gene encoding for a rRv1698 protein without the predicted signal peptide and without histidine tag was expressed in E. coli Rosetta using the vector pML141 (Table 2). This truncated rRv1698 protein was exclusively found in inclusion bodies. The single channel conductance of the purified truncated rRv1698 in 1 M KCl was 4.3 nS as determined from 16 reconstitution events in five membranes. Taken together, these experiments showed that (i) recombinant Rv1698 is an integral channel-forming membrane protein, (ii) the predicted signal peptide is not necessary for channel formation in vitro, and (iii) the N-terminal histidine tag does not impair the channel activity of Rv1698. Thus, it is concluded that Rv1698 is a channel-forming protein of M. tuberculosis. It should be noted that reconstitution of the Rv1698 pore in lipid bilayers occurred exclusively in a step-like fashion as shown in
To further characterize the pore formed by Rv1698 and to identify properties that might distinguish the Rv1698 and MspA channels, the ion selectivity of purified rRv1698His was determined by lipid bilayer experiments. To this end, single channel conductance experiments were done in the presence of 1 M solutions of chloride salts with different cations and potassium salts with different anions.
Another interesting result was the significant reduction of the single channel conductance in 1 M Tris-HCl at pH 6 compared with pH 8 (Table 3). This may either indicate pH gating of the Rv1698 channel or a proton-induced conformational change of the constriction zone that causes a decreased conductivity for Tris-HCl. Both mechanisms were observed for porins of Gram-negative bacteria (Liu and Delcour, FEBS Lett. 434:160-4 (1998); varma et al., Biophys. J. 90:112-23 (2006)).
To quantify the ion selectivity of rRv1698His, zero current potentials of membranes containing several hundred rRv1698 pores were measured in the presence of salt gradients. A 3-fold KCl gradient resulted in a potential of 16.0±0.15 mV, which was positive at the more dilute side. Using the Goldman-Hodgkin-Katz equation (Benz et al., Biochim. Biophys. Acta 551:238-47 (1979)), this is equivalent to a permeability ratio of cations over anions Pc/Pa of 2.5±1.6. This weak preference of cations over anions is consistent with the results of the single channel experiments in different electrolytes. It is concluded that the rRv1698His channel has little charge preference in contrast to the marked cation preference of the MspA pore, which shows a permeability ratio of cations over anions Pc/Pa of 6.6±0.3 (Niederweis et al., Mol. Microbiol. 33:933-45 (1999)). These results also demonstrated that the channel activity observed with purified rRv1698His is indeed a genuine activity of the rRv1698His protein and does not result from contamination with the extremely stable MspA pores.
The rv1698 Gene and its Homologs are Expressed in Mycobacteria
Reverse transcription PCR(RT-PCR) was employed to examine whether rv1698 is expressed in M. tuberculosis grown under standard conditions. Total mRNA was purified from wild-type M. tuberculosis H37Rv. As shown in
Channel Forming Activity of Rv1698His Purified from M. bovis BCG
To examine whether the native Rv1698 protein has the same channel activity as the recombinant protein purified from E. coli and to exclude that the channel activity originated from folding artifacts or contaminations from E. coli porins, Rv1698 was purified from M. bovis BCG. To this end, the rv1698 gene encoding a C-terminal histidine tag was expressed from the plasmid pML911 (Table 2) in M. bovis BCG. The proteins were extracted from cell lysates by 1% SDS, and the SDS extract was purified by nickel affinity chromatography (
Lipid bilayer experiments were done to examine whether Rv1698 protein isolated from M. bovis BCG also has channel forming activity. No insertion events were detected when buffer was added to the DPhPC membrane. When 300 ng of purified Rv1698His was added to the same membrane, a rapid stepwise current increase was observed (
A significant number of Rv1698His channels with smaller conductances of ˜2-2.5 nS and 1.0-1.5 nS were also recorded (
Insertion of large, open, water-filled channel proteins such as porins (Guilvout et al., EMBO J. 25:5241-9 (2006)) or colicins (Cascales et al., Microbiol. Mol. Biol. Rev. 71:158-229 (2007)) into the inner membrane of bacteria is a lethal event, most likely because of the immediate breakdown of the proton gradient. Considering its channel characteristics, it was believed that Rv1698 is an outer membrane protein. To determine the subcellular localization of Rv1698 and to examine whether the Rv1698 protein has surface-exposed loops, protease accessibility was employed as previously described for the surface protein PE_PGRS33 encoded by the rv1818c gene of M. tuberculosis (Delogu et al., Mol. Microbiol. 52:725-33 (2004)). Proteinase K cleaves Msmeg—3747 in 160 and Rv1698 in 158 positions evenly distributed along the entire protein molecule. Thus, in principle, even small surface-exposed loops should be cleaved if Rv1698 is accessible to the protease in whole cells. Green fluorescent protein and PE_PGRS33HA were used as controls for a cytoplasmic protein and as a surface-exposed protein (Delogu et al., Mol. Microbiol. 52:725-33 (2004)), respectively. The signal for green fluorescent protein is identical in both samples, indicating that the cell envelope was intact during proteinase K treatment (
Hygromycin B was purchased from Calbiochem (Gibbstown, N.J.). All other chemicals were purchased from Merck (Whitehouse Station, N.J.), Roth (Watertown, N.Y.), or Sigma (St. Louis, Mo.) at the highest purity available. Enzymes for DNA restriction and modification were from New England Biolabs (Ipswich, Mass.) and Invitrogen (Carlsbad, Calif.). Oligonucleotides were obtained from IDT (Coralville, Iowa).
Escherichia coli DH5a was used for cloning experiments and was routinely grown in Luria-Bertani broth at 37° C. Mycobacterium smegmatis strains were grown at 37° C. in Middlebrook 7H9 medium (Difco Laboratories of Becton Dickinson (BD); Franklin Lakes, N.J.) supplemented with 0.2% glycerol and 0.05% Tween 80 or on Middlebrook 7H10 plates supplemented with 0.5% glycerol. M. bovis BCG was grown in Middlebrook 7H9 medium (Difco) supplemented with 0.2% glycerol, 0.05% Tween 80, and 10% oleic acid-albumindextrose-catalase (OADC; Remel) or on Middlebrook 7H10 plates supplemented with 0.5% glycerol and 10% OADC (Remel). Antibiotics were used when required at the following concentrations: hygromycin, 200 μg/ml for E. coli and 50 μg/ml for mycobacteria; kanamycin, 30 μg/ml.
Previous expression vectors were based on transcriptional fusions in which the Shine-Dalgarno sequence had to be included in the forward primer (Kaps et al., Gene 278:115-24 (2001)). To provide an alternative cloning strategy with much shorter forward primers, a Pad restriction site which is not present in the M. tuberculosis genome was used, making cloning with this enzyme very convenient, and was engineered between the gene and the Shine-Dalgarno sequence in this vector backbone. To this end, the mspA gene was amplified by PCR using pMN006 (Stahl et al., Mol. Microbiol. 40:451-64 (2001)) as a template with the oligonucleotides pMS-Seq1 and MspA_SD (Table 4) that introduced SphI and Pad restriction sites and a synthetic Shine-Dalgarno sequence which efficiently initiates translation of gfp. The PCR fragment was digested with SphI and HindIII and cloned into the plasmid pMN013 (Kaps et al., Gene 278:115-24 (2001)) digested with the same restriction endonucleases. This cloning step yielded the vector pML653 in which the Shine-Dalgarno sequence was separated from the translation start site by a Pad restriction site. In this expression vector, genes can be cloned as translational fusions using the restriction sites PacI/HindIII. Promoters can be exchanged using the SpeI and SphI sites.
Then, the rv0194 gene was amplified from genomic DNA of M. tuberculosis H37Rv using the oligonucleotides rv0194 F4 and rv0194_Hind2, which introduced the HindIII restriction site at the 3′-end (Table 4). The rv0194 PCR fragment was digested with HindIII and cloned into pML653 digested with Pad. The 5′-overhanging ends of the Pad sites were removed by T4 DNA polymerase following HindIII restriction digestion to obtain a 5-bp distance between the Shine-Dalgarno sequence and the rv0194 translation start site in the overexpression vector pML655. In addition the rv0194 expression cassette, pML655, features the pAL5000 origin for replication in mycobacteria, the ColE1 origin for replication in E. coli, and a hyg resistance gene.
CTAATACGACTCACTATAGGGAGACGGCAGAGGTCGGGTCGTCC
CTAATACGACTCACTATAGGGAGACGCTTCCGGTACGGCTACCT
Construction and Analysis of a Transposon Library of M. bovis BCG.
The suicide plasmid vector pPR32, containing IS1096::Km, was used to generate a transposon insertion mutant library of M. bovis BCG as described previously (Pelicic et al., Proc. Natl. Acad. Sci. USA 94:10955-60 (1997)). The vector pPR32 was electroporated into M. bovis BCG. After recovery at 32° C., the bacteria were plated on 7H10 agar containing kanamycin and incubated at 32° C. for 5 to 7 weeks. The colonies were streaked on plates containing kanamycin and gentamicin to prevent the premature loss of the plasmid. Clones were picked from five Kmr/Gmr candidates and transferred into 7H9 liquid medium supplemented with kanamycin and gentamicin. Incubation was at 32° C. for 3 to 4 weeks. The cultures were filtered through a filter with a pore size of 5-μm (Sartorius; Goettingen, Germany) to remove cell clumps. The filtrate was grown for two further weeks until an optical density at 600 nm (OD600) of 0.4 to 0.5 was achieved. Approximately 107 cells were plated on 7H10 agar containing kanamycin and 2% sucrose. Incubation of the plates occurred at 39° C. for 3 weeks. Counterselection against the vector pPR32 and selection with kanamycin resulted in approximately 7,500 transposon mutants. This corresponds to a transposon efficiency of 1.5×10−3. Ten colonies were arbitrarily picked, and chromosomal DNA was prepared and analyzed by Southern blotting as described elsewhere (Stahl et al., Mol. Microbiol. 40:451-64 (2001)) to examine the randomness of the IS1096::Km insertions. To select for ampicillin-resistant mutants, the library was washed from the plates, passed through a 5-μm filter, and plated on 7H10 plates supplemented with 100 μg/ml of ampicillin. To identify the insertion sites of the transposon, ligation-mediated PCR was employed as described previously (Prod'hom et al., FEMS Microbiol. Lett. 158:75-81 (1998)). Chromosomal DNA was prepared and used as a template for PCR with the primers Salgd and Tn_mut_seq2 or Tn_mut_seq4 and IS2; primers Salgd and IS2 were used for sequencing (Table 4). The resulting sequences were compared with the M. bovis BCG genome sequence using Blast analysis (http://genolist.pasteur.fr/BCGList).
Total RNA of M. bovis BCG was isolated by the Trizol method as recommended by the manufacturer (Invitrogen). Briefly, cultures were grown in 30 to 60 ml of corresponding medium until late log phase. A 35-ml volume of GTC buffer (5 M guanidium thiocyanate, 0.5% sarcosyl, 0.5% Tween 80, 1% β-mercaptoethanol) was added and centrifuged at 10,000×g for 10 minutes at 4° C. The pellet was resuspended in 1.5 ml Trizol and lysed by agitation with glass beads (FastRNA Tubes-Blue) in a FastPrep FP120 bead beater apparatus (Bio-101) three times for 45 seconds at level 6.5. Suspensions were cooled on ice for 5 minutes between agitation steps. A 500-μl volume of chloroform was added, and centrifugation was done for 5 minutes at 14,000×g. The upper phase was transferred to a new tube containing an equal volume of isopropanol. Tubes were incubated for 20 minutes at −80° C. and centrifuged at 14,000×g for 20 minutes at 4° C. The pellet was washed with 70% ethanol, dried, and resuspended in 100 μl distilled water. Further purification of samples was performed using a Nucleospin→RNAII kit (Macherey-Nagel; Bethlehem, Pa.) following the instructions of the manufacturer.
The probe for the rv0194 gene was amplified from pML655 by PCR using the primers Rv0194_F1 and Rv0194_rev_T7 (Table 4). The probe for the 16S rRNA gene was amplified from chromosomal DNA of M. bovis BCG using the primers 16SNbfw and 16SrevT7Prom (Table 4). A recognition site for T7 RNA polymerase was added to the 5′-ends of the reverse primers (Table 4). The probes were labeled with digoxigenin by in vitro transcription. The dot blot experiments were carried out as described previously (Hillman et al., J. Bacteriol. 189:958-67 (2007)). The amount of RNA was quantified photometrically. A 7.2-μg aliquot of RNA was spotted in triplicate onto the blot for each sample. To obtain a visible signal for the bcg0231 mRNA in comparison to the standard 16S rRNA, the exposure time of the blot was increased to 700 s. The LabWorks 4.6 software (UVP; Upsland, Calif.) was used for image analysis of the dot blot. The lane profile of the dots was analyzed to examine saturation of the signals. The amount of RNA in the dots was quantified using integrated optical density analysis. The signals for the bcg0231 transcripts were normalized to those of 16S rRNA in the same sample.
To determine MICs of M. smegmatis and M. bovis BCG strains, a microplate Alamar blue assay (MABA) was used as described previously (Franzblau et al., J. Clin. Microbiol. 36:362-6 (1998)) with some modifications. Final drug concentrations for M. smegmatis were as follows: ampicillin, 62.5 to 2,000 μg/ml; erythromycin and vancomycin, 0.3125 to 10 μg/ml; chloramphenicol and novobiocin, 2 to 64 μg/ml; tetracycline, 0.01875 to 0.6 μg/ml; kanamycin, 0.156 to 5 μg/ml; ciprofloxacin, ofloxacin, and levofloxacin, 0.8 to 25.6 μg/ml. Final drug concentrations for M. bovis BCG were as follows: ampicillin, 62.5 to 2,000 μg/ml; vancomycin, 1.25 to 40 μg/ml; streptomycin, 0.25 to 8 μg/ml; chloramphenicol, 4 to 128 μg/ml; tetracycline, 0.5 to 16 μg/ml. The MICs were defined as the lowest concentration of antibiotic which reduced the viability of the culture by at least 90% as determined by fluorescence measurements at room temperature in top-reading mode at an excitation wavelength of 530 nm and an emission wavelength of 590 nm using a Synergy HT reader (Bio-Tek; Winooski, Vt.).
The β-lactamase activity of M. bovis BCG was determined by measuring the hydrolysis of nitrocefin by whole cells as described elsewhere (Danilchanka et al., Antimicrob. Agents Chemother. 52:3127-34 (2008)). Briefly, cells of M. bovis BCG strains were grown to saturation (OD600, 2.0 to 4.0). Culture supernatants were filtered through 0.2-μm filters (Pall Corporation; East Hills, N.Y.) twice to obtain cell-free culture filtrates. To obtain lysates, cells were pelleted and washed in ice-cold 1× phosphate-buffered saline (PBS) buffer (pH 7.4). The cell pellets were resuspended in a 1/30 volume of 1×PBS containing corresponding amounts of protease inhibitor cocktail (Sigma) and DNase I (New England Biolabs). Cells were disrupted by agitation with glass beads (FastRNA Tubes-Blue) in a FastPrep FP120 bead beater apparatus (Bio-101) twice for 30 seconds at level 6.0 with 5 minutes of rest on ice between agitations. Cell debris was removed by centrifugation and filtered twice through 0.2-μm filters. Protein concentrations were determined using a bicinchoninnic acid protein assay kit (Pierce; Rockford, Ill.). Nitrocefin was added to a final concentration of 200 μM in 1×PBS (pH 7.4), and hydrolysis was monitored as a change in absorbance at 490 nm using a microplate reader (Synergy HT; Bio-Tek). The activities of β-lactamases for each strain were determined as the A490 min−1 mg of total protein−1.
The accumulation of ethidium bromide by mycobacteria was measured as described previously with some modifications (Margolles et al., Biochemistry 38:16298-306 (1999)). M. smegmatis was grown to early exponential phase (OD600, 0.6 to 1.0). The cells were pelleted by centrifugation at room temperature, resuspended in uptake buffer (50 mM KH2PO4 [pH 7.0], 5 mM MgSO4), diluted to an OD600 of 0.5, and preenergized with 25 mM glucose for 5 minutes. One hundred microliters of cells was added per well of black, clear-bottomed 96-well microplates (Greiner Bio-One; Monroe, N.C.). Ethidium bromide was added to a final concentration of 20 μM, and its entry was measured at room temperature in top-reading mode at an excitation wavelength of 530 nm and an emission wavelength of 590 nm using a Synergy HT reader (Bio-Tek). When required, reserpine was added after 8 minutes of incubation with ethidium bromide at a final concentration of 0.1 mM.
Susceptibility of M. smegmatis to Ethidium Bromide.
The susceptibility of M. smegmatis to ethidium bromide was tested as described previously (Farrow and Rubin, J. Bacteriol. 190:1783-91 (2008)). Briefly, M. smegmatis was grown overnight in Middlebrook 7H9 medium supplemented with 0.05% Tween 80 and 50 μg/ml hygromycin and filtered through a 5-μm filter (Sartorius) to remove cell clumps. Cells were diluted in the same medium to an approximate OD600 of 0.04. Bacterial growth was monitored by measuring the optical density of the cultures at 600 nm. Ethidium bromide was added to the cultures at final concentrations from 1.56 μM to 12.5 μM. When required reserpine was added at a final concentration of 8 mM.
Isolation of M. bovis BCG Mutants Resistant to Ampicillin.
To identify molecular mechanisms of resistance of slowly growing mycobacteria such as M. tuberculosis to β-lactam antibiotics, M. bovis BCG was used as a model organism and generated a transposon library. The transposon IS1096::Km was chosen, which inserts randomly with a high frequency into mycobacterial genomes (McAdam et al., Infect. Immun. 63:1004-12 (1995)). A culture of a clone from M. bovis BCG containing pPR32 with the transposon IS1096::Km (Pelicic et al., Proc. Natl. Acad. Sci. USA 94:10955-60 (1997)) was plated under conditions nonpermissive for replication of the vector, and this yielded approximately 7,500 kanamycin-resistant clones. To examine the uniqueness of the insertions, chromosomal DNA was prepared from 10 randomly selected clones from the library. Southern blot analysis showed the presence of the transposon in all clones at different positions in the chromosome. This indicated a random transposition of IS1096::Km into the chromosome of M. bovis BCG. To select mutants with a high resistance to β-lactam antibiotics, the library was washed from the plates and filtered to remove cell clumps. Serial dilutions were plated on 7H10 agar with 100 μg/ml ampicillin, on which wild-type (wt) M. bovis BCG did not grow. Seventy-eight ampicillin-resistant mutants were obtained. MICs of ampicillin for all transposon mutants were higher than 62.5 μg/ml for wt M. bovis BCG as determined in a MABA. Twenty-one mutants were completely resistant to ampicillin (≧2,000 μg/ml), while 11 mutants showed a moderate resistance with MICs of 250 to 500 μg/ml (Table 5). Twenty mutants with MICs lower than 250 μg/ml were excluded from further analysis.
M. bovis
M. tuber-
culosis
To determine the insertion sites of the transposon, chromosomal DNA was prepared from all mutants and was analyzed by ligation-mediated PCR (Prod'hom et al., FEMS Microbiol. Lett. 158:75-81 (1998)). Thirty-three unique insertion sites in M. bovis BCG were determined that conferred a medium or high level of resistance to ampicillin (Table 5). The mutants were grouped into four functional classes based on the predicted or known functions of the disrupted genes (Table 5). The vast majority of the disrupted genes (11/31) encode proteins involved in cell wall biosynthesis or assembly (Table 5, group A). Other mutant classes included genes involved in general metabolism and genes of unknown function. Six of the sequenced mutants had insertions in intergenic regions (Table 5).
In the ML1034 mutant, the transposon had inserted 54 base pairs in front of the predicted start codon of the open reading frame bcg0231 in M. bovis BCG, which is almost identical to rv0194 from M. tuberculosis (Table 5;
To examine whether the resistance of this mutant was specific for ampicillin, its sensitivity to several structurally unrelated antibiotics was determined in a MABA (Franzblau et al., J. Clin. Microbiol. 36:362-6 (1998)) (Table 6). The resistance to the small antibiotics chloramphenicol and tetracycline was 64- and more than 8-fold increased, respectively, compared to wt M. bovis BCG. Resistance to streptomycin, one of the first-line drugs used for the treatment of tuberculosis, was increased by 32-fold compared to wt M. bovis BCG. A fourfold increase in the resistance to the large and hydrophilic antibiotic vancomycin was also observed for the ML1034 mutant (Table 6), therefore suggesting that this mutant is highly resistant to multiple antibiotics.
Insertion of the Transposon Increases Transcription of bcg0231 in the ML1034 Mutant.
In case of insertion of the transposon in front of a gene, two possibilities exist: the transposon can inactivate the gene by inactivating the promoter or other signals required for transcription, or alternatively, gene expression can be upregulated or the gene can be expressed constitutively from a promoter inside the transposon. To distinguish between these two possibilities, total RNA was prepared from wt M. bovis BCG and the ML1034 mutant grown to late logarithmic phase. Dot blot experiments were used to quantify the relative amount of bcg0231 mRNA in both strains. While bcg0231 mRNA was barely detectable in wt M. bovis BCG, it was clearly more visible in the ML1034 mutant (
The β-Lactamase Activities of wt M. bovis BCG and the Mutant ML1034 are Identical.
To examine whether altered expression of β-lactamases contributed to the high resistance of the ML1034 mutant to ampicillin, the β-lactamase activity of M. bovis BCG was measured using the nitrocefin hydrolysis assay. The vast majority of the β-lactamase activity of wt M. bovis BCG was cell associated and was approximately 10-fold higher than the activity of the culture filtrate (
Rv0194 Confers Multidrug Resistance to M. smegmatis.
To examine whether the multidrug-resistant phenotype of the ML1034 mutant was directly associated with overexpression of the ABC transporter, the rv0194 expression vector pML655 was transformed into M. smegmatis SMR5 and M. bovis BCG. In several attempts, colonies were only obtained for M. smegmatis, and not for M. bovis BCG. Importantly, overexpression of rv0194 increased the MICs of ampicillin, vancomycin, novobiocin, and erythromycin for M. smegmatis (Table 7). Similar resistance factors were obtained when rv0194 was overexpressed in M. smegmatis mc2155. These results confirmed that the multidrug resistance of the ML1034 mutant was directly associated with overexpression of rv0194.
Rv0194 Reduces Accumulation of Ethidium Bromide in M. smegmatis.
An obvious experiment to examine the function of Bcg0231/Rv0194 would be to measure accumulation of antibiotics whose MICs are increased drastically for the ML1034 mutant. However, uptake by slow-growing mycobacteria is very slow (Mailaender et al., Microbiology 150:853-64 (2004)), and interpretation of the uptake experiments is complicated by the high amount of surface-adsorbed compounds. This problem is even more pronounced for antibiotics which are substrates of drug efflux pumps (De Rossi et al., FEMS Microbiol. Rev. 30:36-52 (2006)). Therefore, ethidium bromide was chosen as a model compound whose uptake can be measured continuously. This assay is based on the increased fluorescence of ethidium bromide by binding to nucleic acids after entry into the bacterial cell (Margolles et al., Biochemistry 38:16298-306 (1999)) and does not, therefore, suffer from surface adsorption as all radiolabeled compounds. Importantly, expression of rv0194 reduced accumulation of ethidium bromide in M. smegmatis compared to the wt strain (
M. smegmatis Lacking Ms3747 is Hypersensitive to Copper Ions.
Rv1698 and its homolog M. smegmatis Ms3747 share 62% identical amino acids. To examine the physiological functions of these proteins, we inactivated the ms3747 gene in an unmarked mutant of M. smegmatis. Western blot experiments demonstrated the absence of Ms3747 protein in detergent extracts of ML77 (
To test the hypothesis that the OM channel protein Rv1698 of Mtb and its homolog Ms3747 of M. smegmatis are involved in copper efflux, copper accumulation in cells of wt M. smegmatis and the ms3747 mutant ML77 was examined. These strains were grown in the absence or presence of 6.3 or 25 μM copper in self-made 7H9 medium. Their copper content was analyzed after cell lysis by measuring the absorption of the Cu2′-dithizone complex as described (Kumar et al., Microchima Acta 105:79-87 (1991)). The copper content of wt M. smegmatis did not change regardless of the external Cu2+ concentration (
Rv1698 is not a General Porin of M. tuberculosis
Since Rv1698 partially complemented the slower uptake of glucose by a porin mutant of M. smegmatis, the permeability of wt M. smegmatis and ML77 for glucose was compared. No difference was observed for the uptake of 20 μM glucose at 37° C. by both strains demonstrating that the lack of ms3747 did not alter the OM permeability of M. smegmatis for this solute. This result is consistent with the fact that ML77 still expresses wt levels of the porin MspA, which is the major determinant of the OM permeability of M. smegmatis for hydrophilic solutes. It was concluded that Ms3747 and Rv1698 do not play a role in uptake, but are involved in efflux of copper. Efflux is a known copper resistance mechanism in other bacteria. These proteins have been named MctB (mycobacterial copper transport).
The mctB Mutant of M. tuberculosis is More Susceptible to Copper
To examine the function of mctB in Mtb, unmarked mctB mutant ML256 was constructed and complemented with the mctB expression plasmid pML955 that integrates at the attB site of mycobacteriophage L5. Analysis of the SDS-extracts of these strains in a Western blot showed that wt Mtb expressed MctBMtb, the mctBMtb mutant ML256 did not, and integration of pML955 restored mctBMtb expression in the mutant (
Copper as a Defensive Weapon of Macrophages Against M. tuberculosis
The minimal inhibitory concentration of copper for M. tuberculosis on Hartmans de Bond medium is less than 24 μM and much lower than that of E. coli (≈3 mM) or other bacteria (Franke et al., J. Bacteriol. 185:3804-12 (2003)). The extraordinary susceptibility of M. tuberculosis to copper appears surprising considering the extreme resistance of M. tuberculosis to many toxic solutes (Brennan and Nikaido, Annu Rev. Biochem. 64:29-63 (1995)). The high susceptibility of M. tuberculosis to copper probably has been overlooked because of the use of albumin in culture media in previous experiments (Ward et al., J. Bacteriol. 190:2939-46 (2008)) which sequesters copper ions (Suzuki et al., Arch. Biochem. Biophys. 273:572-7 (1989) and thereby strongly increases the tolerance of M. tuberculosis. Importantly, copper concentrations of 17 to 25 μM have been determined in M. tuberculosis-containing phagosomes of macrophages by microprobe X-ray fluorescence (Wagner et al., J. Immunol. 174:1491-1500 (2005)). Further, phagosomal copper concentrations appeared to increase upon stimulation of the macrophages with IFN-γ. Thus, activated macrophages appear to deliver copper at concentrations sufficient to inhibit or kill M. tuberculosis. These findings suggest that macrophages may utilize copper as a defensive weapon against M. tuberculosis.
Fourty BALB/c mice per strain were infected in the aerosol chamber with Mtb H37Rv and the mctB mutant ML256. The inoculum was adjusted to implant 500-1000 bacteria in the lungs. Four mice per group were sacrificed on the day following infection. Then, four mice per group were sacrificed on weeks 1, 2, 4, 8, 12 and 16. Lungs were removed from the mice and the colony-forming units (CFU) were obtained by plating the appropriate dilutions of homogenized lungs on Middlebrook 7H11 agar plates. In the first two weeks after infection, the mctB mutant replicated as well as wt Mtb in mice (
The existence in mycobacteria of such OM-spanning channel proteins that interact with efflux pumps has been recently demonstrated: Rv1698 (MctB) is an OM channel protein of Mtb (above) (Siroy et al., J. Biol. Chem. 283:17827-37 (2008)). Mutants of M. smegmatis and M. tuberculosis lacking MctB are more susceptible to copper because they accumulate large amounts of copper in contrast to the wild-type. OM channel proteins could in principle also be required for uptake of solutes. However, in such a case, the lack of these proteins would cause an increased resistance to the toxic effects of such compounds as shown for example for porin mutants. Therefore, these results indicate that MctB is part of a novel copper efflux system in mycobacteria (
E. coli mutants which lack TolC are highly susceptible to many drugs because efflux through the tripartite systems has been abolished (Sulavik et al., Antimicrob. Agents Chemother. 45:1126-36 (2001)). Thus, screening of a mutant library for increased susceptibility to multiple drugs should yield clones that lack an essential part of important drug efflux systems such as a TolC-like protein. This assumption has been tested using an ordered library of 20,000 transposon mutants of M. smegmatis. An initial robotic screen yielded 398 clones that were susceptible to 8 μg/mL chloramphenicol in contrast to wt M. smegmatis. A second screen on agar plates showed that 27 out of these 398 clones were more susceptible than wt M. smegmatis to chloramphenicol, ampicillin, erythromycin and norfloxacin (
A high-density mutant library of the avirulent Mtb mc26230 strain (ΔRD1 ΔpanCD) is constructed using a plasmid-based IS1096::Km transposon as published (Danilchanka et al., Antimicrob. Agents Chemother. 52:2503-11 (2008)). This library comprises approximately 20,000 mutants and is ordered in microplates and screened for clones with increased sensitivity to isoniazid, ethambutol, rifampicin, pyrazinamide, norfloxacin and erythromycin at half of their inhibitory concentration (IC50). These drugs are structurally diverse and are exported by drug efflux pumps of Mtb (DeRossi et al., FEMS Micrbiol. Rev. 30:36-52 (2006)).
The transposon library of the avirulent Mtb mc26230 strain is ordered into approximately 55 384-well plates, and frozen as glycerol stocks. On each 384-well plate 20 cultures of the parent strain are included as internal controls. All cultures are inoculated in fresh Middlebrook 7H9 liquid media, using a robotic liquid handler (Staccato ALH, Caliper Life Sciences). Each culture of these freshly grown ‘source’ is transferred to arrays and destination arrays are created that are comprised of agar media (a single slab of media, with the same external footprint of a micro-well plate; see
Crosslinking of Proteins that Interact with the Novel Drug Efflux Pump Rv0194 of Mtb
Overexpression of the recently discovered inner membrane drug efflux pump Rv0194 in M. bovis BCG confers complete resistance to ampicillin. Since the target of β-lactam antibiotics is in the periplasm, a mechanism must exist of how transport across the OM is coupled with the Rv0194 pump in the inner membrane. This strongly suggests that Rv0194 is connected with an OM channel protein. Two-hybrid systems are often used to identify protein-protein interactions. However, these systems are based on interactions of protein fragments which assemble to a cytoplasmic protein. Therefore, they are not useful for analyzing interactions of OM proteins. Direct purification of protein complexes and analysis of their composition appears to be difficult because solubilization by detergents often leads to dissociation of interacting proteins. Therefore, in vivo crosslinking experiments and mass spectroscopy are employed to identify proteins that interact with Rv0194. This is an alternative approach to identify a TolC-like protein of Mtb.
Crosslinking experiments have been done with the novel OM channel protein MctB, which most likely connects to an IM copper efflux pump in a protein complex, which, at least in Gram-negative bacteria, is very similar to the TolC-containing drug efflux system which spans two membranes (Li and Nikaido, Drugs 64:159-204 (2004); Murakami et al., Nature 419:587-593 (2002)). This novel copper efflux system of Mtb provides a paradigm for the drug efflux system. Crosslinking in whole cells of M. smegmatis revealed that MctB forms several complexes with other proteins (
To identify proteins that interact with Rv0194, water-soluble and hydrophobic, membrane-permeable cross-linking reagents including formaldehyde, Dithiobis (succinimidyl) propionate (DSP), 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC), and 3,3″-Dithiobis[sulfosuccinimidylpropionate] (DTSSP) are screened. First, a combined histidine/HA tag is added to the C-terminus of Rv0194 in order to purify and identify crosslinked protein complexes. Then, in vivo cross-linking reactions are performed using different reagents in an Mtb strain which expresses the Rv0194His/HA protein following a published protocol (Husain et al., J. Bacteriol. 186:8533-6 (2004)). After crosslinking, membrane proteins are solubilized by detergents and analyzed in Western blots using an HA antibody. A comparison of the electrophoretic mobility with that of the Rv0194His/HA protein labeled in vitro using the same cross-linking reagents reveals whether Rv0194His/HA is bound by other proteins. Crosslinked proteins are purified by exploiting the His-tag of Rv0194His/HA by Ni2+ affinity chromatography. The protein complexes are cleaved by trypsin. The peptides of crosslinked proteins are identified by mass fingerprinting using a top-of-the-line Fourier transform ion cyclotron resonance mass spectrometer (FT-ICR-MS; Thermo-Finnegan LTQ-FT). FTICR-MS has the ability to measure peptide masses at low ppm levels and also provides high mass accuracy and is, therefore, ideal to identify interactions of low-abundance proteins.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US09/44707 | 5/20/2009 | WO | 00 | 11/29/2010 |
| Number | Date | Country | |
|---|---|---|---|
| 61054759 | May 2008 | US |
