The presently-disclosed subject matter relates to temperature-responsive polymer compositions. In particular, the presently-disclosed subject matter relates to compositions that can deliver cells, therapeutics, and other bioactive agents to heart and other tissue.
Coronary artery disease (CAD)-mediated heart failure remains one of the leading causes of death and disability in America. The occluded coronary artery impairs blood supply to heart muscle and gradually leads to severe consequences including ischemic heart attack, myocardial infarction, and congestive heart failure. The efficacy of intravenous, intracoronary, and intramyocardial injection of human stem cells to restore heart functions has been attempted, however, the quick loss of injected cells in the beating and ischemic environment significantly limits clinical outcomes.
For example, others have utilized phosphate buffered saline (PBS) to deliver cells to the heart. Cells in PBS are quickly washed out of the heart due to the lack of a bulk material to retain the cells in tissue. People have therefore attempted to utilize other natural materials, such as collagen, fibrin, and chitosan, to embed cells. Others have also attempted to use decellularized animal tissue to embed and deliver cells to the heart in a similar way to injections. However, the immune response towards these materials and their quick degradation can lead to significant issues after being implanted in the heart. Synthetic injectable polymers for delivering cells have also experienced similar problems.
Hence, there remains a need for compositions and methods for delivering cells, therapeutics, and other agents to tissue, and particularly heart tissue. Such compositions and methods should achieve a sustained release of cells and therapeutics, be biodegradable and biocompatible, and encapsulate cells for extended time periods without unduly affecting cell viability.
The details of one or more embodiments of the presently-disclosed subject matter are set forth in this document. Modifications to embodiments described in this document, and other embodiments, will be evident to those of ordinary skill in the art after a study of the information provided in this document. The information provided in this document, and particularly the specific details of the described exemplary embodiments, is provided primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom. In case of conflict, the specification of this document, including definitions, will control.
The presently-disclosed subject matter includes compositions that comprise a temperature-responsive polymer and one or more bioactive agents (e.g., cells and therapeutics). Embodiments of the temperature-responsive (thermo-responsive) polymers include injectable polymers which are soluble in aqueous solutions at room temperature so that they can be mixed with one or more bioactive agents. Such polymers undergo a solution-to-gel transition at a transition temperature (Ts). In some embodiments the composition comprises a copolymer, and in certain embodiments the copolymer is a monomethoxypoly(ethylene glycol)-co-poly(ε-caprolactone) (mPEG-PCL) copolymer.
In some embodiments the transition temperature of a composition can be tuned to a predetermined temperature by varying the relative concentration of components within a composition. For example, for compositions comprising a mPEG-PCL copolymer, the transition temperature of the composition can be tuned by adjusting the relative concentrations of mPEG and PCL. In some embodiments the transition temperature is about 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., or 50° C. In certain embodiments the transition temperature is about body temperature (i.e., about 37° C.).
Other embodiments include a microgel system that employs a peptide combination to achieve the dual therapeutic effects, promoting angiogenesis and minimizing inflammatory responses in an uncoupled fashion. “As used herein, the term microgel is a gel formed from a network of filaments of polymer.”
Exemplary compositions can further comprise one or more cells or bioactive agents (e.g., therapeutics). The type of cells are not particularly limited, but can be stem cells in some embodiments. For instance, the cells may include human induced-pluripotent stem cells (iPSC)-derived cardiomyocyes. Furthermore, the term “bioactive agent” as used herein refers to any compound or entity that alters, promotes, speeds, prolongs, inhibits, activates, or otherwise affect biological or chemical events in a subject. Bioactive agents may include, but are not limited, anti-HIV substances, anti-cancer substances, antibiotics, immunosuppressants, anti-viral agents, enzyme inhibitors, neurotoxins, opioids, hypnotics, anti-histamines, lubricants, tranquilizers, anti-convulsants, muscle relaxants, anti-Parkinson agents, anti-spasmodics and muscle contractants including channel blockers, miotics and anti-cholinergics, anti-glaucoma compounds, anti-parasite agents, anti-protozoal agents, and/or anti-fungal agents, modulators of cell-extracellular matrix interactions including cell growth inhibitors and anti-adhesion molecules, vasodilating agents, inhibitors of DNA, RNA, or protein synthesis, anti-hypertensives, analgesics, anti-pyretics, steroidal and non-steroidal anti-inflammatory agents, anti-angiogenic factors, angiogenic factors, anti-secretory factors, anticoagulants and/or antithrombotic agents, local anesthetics, ophthalmics, prostaglandins, anti-depressants, anti-psychotics, targeting agents, chemotactic factors, receptors, neurotransmitters, proteins, cell response modifiers, cells, peptides, polynucleotides, viruses, and vaccines. In certain embodiments, the bioactive agent is a drug and/or a small molecule.
In some embodiments the composition is conjugated to a peptide. The peptide can be a functional peptides that enhances the ability of the composition to adhere to fibrous tissue. In specific embodiments the functional polypeptide is a decorin-derived peptide, which can bind to collagenous tissue to make the composition self-adhesive onto fibrotic tissues in vivo. The adhesion enhancement due to the presence of a functional peptide can be desirable for cell integration and tissue regeneration. Indeed, fibrotic tissues are usually formed at a site of injury and/or ischemia with inflammatory responses.
The compositions described herein therefore have the superior and unexpected advantage of having tunable transition temperatures and of being biodegradable and biocompatible. In this regard, the term “biodegradable” as used herein generally refers to materials that degrade under physiological conditions to form a product that can be metabolized or excreted without damage to the subject. In certain embodiments, the product is metabolized or excreted without permanent damage to the subject. Biodegradable materials may be hydrolytically degradable, may require cellular and/or enzymatic action to fully degrade, or both. Biodegradable materials also include materials that are broken down within cells. Degradation may occur by hydrolysis, oxidation, enzymatic processes, phagocytosis, or other processes.
The term “biocompatible” as used herein generally refers to materials that, upon administration in vivo, do not induce undesirable side effects. In some embodiments, the material does not induce irreversible, undesirable side effects. In certain embodiments, a material is biocompatible if it does not induce long term undesirable side effects.
The presently-disclosed subject matter further relates to methods of treating tissue in a subject, such as heart tissue, by administering an effective amount of the present composition to the subject. The compositions may be administered by injection. The compositions and methods therefore provide a minimally invasive way to deliver cells and/or other bioactive agents to tissue for tissue regeneration.
The term “subject” refers to a target of administration, which optionally displays symptoms related to a particular disease, pathological condition, disorder, or the like. The subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. A patient refers to a subject afflicted with a disease or disorder. The term “subject” includes human and veterinary subjects.
Embodiments of compositions that adhere to collagenous tissue (e.g., scar tissue, fibrotic tissue) can permit the delivered components (e.g., cells and bioactive agents) to be retained in the tissue for a relatively long period of time. In some embodiments the delivered components can be retained in a viable state for about 1 day, 5 days, 10 days, 15 days, 20 days, 25 days, 30 days, or longer. Thus, for example, delivered cells can be retained in a viable state within the composition until the cells migrate and integrate into the tissue. This can be particularly desirable for the extended delivery and regeneration of wounded or otherwise damaged tissue.
Some embodiments of compositions and methods are for treating heart tissue. This includes ischemic or otherwise damaged heart tissue. Causes for heart tissue damage include myocardial infarction. Thus, embodiments of methods can regenerate wounded heart tissue by promoting angiogenesis in the damaged heart tissue.
Thus, one embodiment of the present invention is a polymeric compound a co-polymer microgel at least one bioactive agent. In other embodiments, the microgel may comprise monomethoxypoly(ethylene glycol)-co-poly(ε-caprolactone) (mPEG-PCL). In other embodiments, the mPEG is about 750 Da. In other embodiments, the microgel comprises about 21% PEG-b-79% PCL.
Examples of the bioactive agent include at least one pro-angiogenic peptide and at least one anti-inflammatory peptide. In embodiments of the invention, the pro-angiogenic peptide is C16 (Lys-Ala-Phe-Asp-Ile-Thr-Tyr-Val-Arg-Leu-Lys-Phe) and the anti-inflammatory peptide is Ac-SDKP (N-acetyl-Ser-Asp-Lys-Pro).
In other examples, the bioactive agent selectively binds to fibrous tissue. In yet other examples, the bioactive agent includes a decorin-derived functional peptide. In others, bioactive agent is at least one cell, optionally including stem cells.
In other examples, the microgel comprises a co-polymer of the following formula:
wherein x is 10-50% and y is 90-50%, and R is the bioactive agent.
In embodiments of the present invention, the composition includes a transition temperature of about 20° C. to about 50° C. In other embodiments, transition temperature is about mammalian body temperature.
Another embodiment of the present invention is a composition comprising a polymeric compound described herein and a pharmaceutically acceptable carrier.
Another embodiment of the present invention is a method for treating damaged tissue to a patient in need thereof, comprising providing a composition of the present invention, and administering by injection an effect amount of the composition.
The following is an example of a synthetic scheme of mPEG-PCL and the modification with collagen-binding peptide.
The presently-disclosed subject matter is further illustrated by the following specific but non-limiting examples. The following examples may include compilations of data are representative of data gathered at various times during the course of development and experimentation related to the presently-disclosed subject matter.
While the terms used herein are believed to be well understood by one of ordinary skill in the art, the definitions set forth herein are provided to facilitate explanation of the presently-disclosed subject matter.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the presently-disclosed subject matter belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently-disclosed subject matter, representative methods, devices, and materials are now described.
Following long-standing patent law convention, the terms “a”, “an”, and “the” refer to “one or more” when used in this application, including the claims. Thus, for example, reference to “a composition” includes a plurality of such compositions, and so forth.
Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about”. Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently-disclosed subject matter.
As used herein, the term “about,” when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±50%, in some embodiments ±40%, in some embodiments ±30%, in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.
As used herein, ranges can be expressed as from “about” one particular value, and/or to “about” another particular value. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
This Example demonstrates microgels of the present invention from a combination of polyethylene glycol (PEG) and poly-ε-caprolactone (PCL), and embodiments of the present invention where the polymer microgels of the present invention are C16 and/or Ac-SDKP loaded and injected to increase collateral vessel formation without inflammatory exacerbation. This example is also described in Zachman et al., Biomaterials 35 (2014) 9635-9648, the contents of which are incorporated herein by reference.
Materials and Methods
Chemicals and reagents for injectable polymer microgel: Tin (II) ethyl hexanoate (Sn(Oct)2), ε-caprolactone, monomethoxypoly(ethylene glycol) (mPEG) (Mn=750 Da), anhydrous tetrahydrofuran (THF), anhydrous toluene, dichloromethane, and diethyl ether were purchased from Sigmae Aldrich (St. Louis, Mo., USA). ε-Caprolactone was dried and distilled over CaH2 (Alfa Aesar, Ward Hill, Mass., USA) immediately before polymerization. Tin (II) ethyl hexanoate was distilled under high vacuum.
Synthesis and characterization of injectable polymer microgels: The injectable polymer is presented as 21% PEGe 79% PCL (individual mole percentage) (
In vitro biocompatibility assay: HUVECs (ATCC) were seeded at a density of 1×105 cells/mL in MesoEndo media (Cell Applications) on top of pre-gelled injectable polymer microgels and cultured for 1 or 3 days at 37 C with 5% CO2 and stained with LIVE/DEAD® Viability/Cytotoxicity Kit (Invitrogen) according to the supplier's protocol (n=4 per condition).
Mouse model of hind limb ischemia: Wild type A/J mice were used to develop a model of PAD as described previously, by ligating the femoral artery and vein at one ligation below the epigastric artery and a second ligation around the artery and vein at a distal location just proximal to the deep femoral branch. The femoral artery and vein were then cut between these two sutures. A 13% by weight solution of injectable polymers in H2O 2O was mixed with 75 mg Ac-SDKP, C16, or the combination of Ac-SDKP and C16 at 25° C. In order to control the hydrogel size considering the possibility that the hydrogel size may change peptide release and therefore inflammatory responses a single, 10 mL bulk injection or ten, 1 mL injections of peptide-loaded polymer were made into the thigh muscle adjacent to the femoral artery ligations. The surgical incision was then closed with non-degradable sutures. As controls, femoral artery ligation surgery was performed on animals without any microgels or peptide treatment or with peptide in PBS injections into the subcutaneous tissue adjacent to femoral artery ligations. The left hind limb (unoperated) was also used as a surgical control.
In vivo peptide release from injectable microgels: A 13% by weight solution of injectable polymers in H2O 2O was mixed with 75 mg of FITC-labeled SDKP (GenScript) at 25 C. A single, 10 mL bulk injection or ten, 1 mL injections of peptide-loaded polymer were made into the thigh muscle adjacent to the femoral artery ligations. After 7 days, mice were sacrificed by CO2 inhalation and death was verified by cervical dislocation. The skin on the ischemic hind limb was removed and the adductor muscle was imaged on an IVIS 200 pre-clinical in vivo imaging system (Perkin Elmer, Waltham, Mass.) to visualize peptide retention in the tissue (n=4 mice per treatment).
Non-Invasive Imaging of Ischemia
LDPI: LDPI was performed on the footpad region of the hind limb of the mice using a Periscan PIM II device. This technique images surface perfusion by measuring Doppler changes in the reflectance of light due to blood flow. During imaging, ambient light and temperature were carefully controlled to avoid background variations in LDPI measurements. Three scans were performed per mouse at each time point: days 0, 3, 7 and 14 after femoral artery ligation and microgel injection (n=6 mice per treatment). The perfusion ratio was calculated by normalizing the average perfusion value of the ischemic footpad (right) to the average perfusion value of the control, un-operated footpad (left) using Image J (NIH).
Optical coherence tomography: Doppler OCT and speckle-variance OCT were used to non-invasively image blood vessels in the ischemic gastrocnemius muscle of mice on days 1 and 13 after femoral artery ligation, as previously described. Doppler OCT detects frequency shifts in the phase-sensitive OCT signal due to flowing blood, while speckle-variance OCT tracks variation in laser speckle over time due to red blood cell movement. Doppler OCT cross-sectional scans (B-scans) were used to quantify blood flow changes over time in the hind limb, while volume intensity projections from speckle-variance OCT image volumes (C-scans) presented vessel morphology differences between groups. The OCT system uses an 860 nm center wavelength, 51 nm bandwidth laser, and has an axial resolution of 6.4 mm in air and lateral resolution of 25 mm. Prior to imaging, mice were anesthetized and hair on the hind limb was removed. To track the imaged area over time, glass microscope slides were marked with the placement of the mouse during imaging day 1 and used to correctly position the mouse leg during imaging on day 13. To avoid bulk motion artifacts, OCT scans of the calf muscle were gated between breaths of the mouse. Six Doppler OCT B-scans (4 mm, 800 A-scans, Doppler number of 9) were performed per mouse at each time point and perfusion was quantified by calculating the ratio of the number of blood vessel pixels per scan over the total imaged area per scan (n=6 mice per time point).
Angiogenesis and phagocytosis assays: Fourteen days after femoral artery ligation, mice were sacrificed and tissue and microgels were harvested for analysis. Immediately before sacrificing the mice, functional fluorescence micro-angiography was performed to visualize angiogenesis in and around peptide-loaded microgels, as described previously. As a result of fluorescence microangiography, only the functional capillaries with a perfusion capacity, including those around injected micro-gels, show red fluorescence in the mouse body. Excised tissue from the site of microgel injections was imaged using an Olympus FV100 confocal microscope. For quantification of vessel perfusion capacity, the red fluorescence intensity was quantified using Image J software (n=6 images per mouse, n=6 mice per treatment).
A phagocytosis assay was performed in harvested microgels using Vybrant Phagocytosis Assay kit according to the manufacturer's protocol. Green fluorescence from internalized Escherichia coli particles in excised microgels and surrounding tissue was visualized through confocal imaging. The intensity of green fluorescence in each image was quantified using Image J (n=6 images per mouse, n=6 mice per treatment).
Histological analysis of angiogenesis and inflammation: After sacrificing mice, ischemic muscle samples were prepared for histological analysis as described elsewhere. Briefly, hind limbs were detached and placed in methanol overnight after removal of skin. Adductor muscle samples adjacent to the micro-gels were cut from the limb and placed in 10% phosphate buffered formalin for 24 h, embedded in paraffin, sectioned (5 mm sections), mounted on slides, antigen retrieval, and stained with either he-matoxylin and eosin (H&E), or biotinylated rat anti-mouse F4/80 antibodies by the Vanderbilt Translational Pathology Shared Resource Core. Immunohistochemical (IHC) staining to identify activated inflammatory cells by F4/80 expression was quantified by normalizing the total F4/80 positive area (indicated by brown staining) to the total cell number (determined by hema-toxylin nuclear staining) using Image J.
Cell Culture: RAW 264.7 macrophages (ATCC) were cultured in DMEM (Gibco) supplemented with 10% FBS and 1% penicillin/strepto-mycin. Mouse aortic endothelial cells (mAECs) were a generous gift from Dr. Ambra Pozzi at Vanderbilt University Medical Center. mAECs were cultured in EGM-2 Basal Media supplemented with BulletKit (Lonza, Allendale, N.J.) and 10 units/mLIFN-g (Sigma). RAW 264.7 mouse macrophage cells (Sigma) were cultured in DMEM with 10% FBS and 1% penicillin/streptomycin. For cell culture studies with peptides, 75 mg/mL of Ac-SDKP or C16 peptides was used. For inhibition studies, 5 mM of MMP-9 inhibitor-1 (CTK8G1150; AG-L-66085, Santa Cruz Biotechnology, Dallas, Tex.) or 5 mg/mL of LEAF Purified Mouse TNF-a antibody (BioLegend) was used.
In vitro peptide uptake: mAECs or RAW 264.7 cells were incubated with DilC12 (BD Biosciences) for 2 h; washed two times with PBS; and seeded 3×105 cells/mL on pre-gelled injectable polymer microgels loaded with FITC-tagged Ac-SDKP or C16 peptides (75 mg peptide/mL media, GenScript). After 72 h, cells were washed with PBS and imaged using Zeiss LSM 710 confocal microscope for visualization of peptide uptake (n=4 per treatment).
Gene expression: mAECs or RAW 264.7 cells were seeded at a density of 3×105 cells/mL on TCPS with 75 mg/mL of Ac-SDKP, C16, or the combination of C16 and Ac-SDKP peptides. After 3 days, RNA was extracted from homogenized tissue using Trizol reagent and RNA easy columns. After dissolving RNA in RNase-free water, the concentration and purity of isolated RNA was measured using TECAN plate reader Nanoquant (company info). At least 1.2 mg of RNA was reverse transcribed using iScriptReverse transcription Supermix for RT-qPCR on a BioRad thermocycler (company info). 50 ng/well cDNA was then amplified using SYBR green Supermix and fluorescence signal was measured on a BioRAD real time PCR machine. TGF-b1 forward: GCTGAACCAAGGAGACGGAA, reverse: AGAAGTTGGCATGGTAGCCC. NF-kb forward: ATGTAGTTGCCACG-CACAGA, reverse: GGGGACAGCGACACCTTTTA. TIMP1 forward: AGACACACCAGAGATACCATGA, reverse: GAGGACCTGATCCGTC-CACA. FGF-1 forward: TCTGAAGAGTGGGCGTAGGA, reverse: GGCTATTTGGGGCCATCGTA. FGF-2: MMP-9: TTGAGTCCGGCAGA-CAATCC, reverse: CCTTATCCACGCGAATGACG. MMP-2 forward: GAGTTGGCAGTGCAATACCT, reverse: GCCGTCCTTCTCAAAGTTGT. TNF-a: forward: ACGGCATGGATCTCAAAGAC, reverse: AGA-TAGCAAATCGGCTGACG. VEGF forward: ATGCGGATCAAACCT-CACCA, reverse: CCGCTCTGAACAAGGCTCAC. GAPDH forward: TGAAGCAGGCATCTGAGGG, reverse: CGAAGGTGGAAGAGTGGGAG. TIMP-2 forward: CTCGCTGGACGTTGGAGGAA, reverse: CACGCG-CAAGAACCATCACT. Expression was calculated using the 2 method and normalized to GAPDH expression (n=8).
MMP-9 activity: After 72 h culture in serum-free media, culture media from mAECs or RAW 264.7 cells (3×105 cells/mL, with/without peptides or TNF-a/MMP-9 inhibitors) was collected, concentrated, and analyzed by zymography, as described previously. Concentrated protein samples were incubated with non-reducing buffer at a ratio of 1:1. 9.5 mg total protein per lane were loaded onto a 7.5% polyacrylamide gel containing 0.1%(w/v) gelatin (Sigma). Gels were washed in dH2O containing 3.3% (v/v) Triton X-100, followed by 12e 48 h incubation in reaction buffer at 37 C. After incubation, gels were placed in fixative (30% methanol, 10% acetic acid, and 60% dH2O) for 1 h before staining with 4 parts Coomassie brilliant blue R-250 (Sigma) and 1 part methanol for 12 h. Gels were destained in 25% methanol for 1 h. The gelatinolytic activity of pro-MMP-9 was determined by densitometry of the 97 KDa white band on a blue background using Image J(n=4 per treatment). MMP-9 expression was then normalized to the expression from the no inhibitor, no peptide treated group.
Phagocytic activity: RAW 264.7 cells (3×105 cells/mL) were cultured with Ac-SDKP, C16, or the combination of C16 and Ac-SDKP peptides (75 mg/mL) in the presence or absence of TNF-a inhibitor or MMP-9 inhibitor for 72 h. Vybrant phagocytosis assays were used to evaluate the inflammatory activity, as described above in the in vivo section. (n=4 per treatment).
Tubulogenesis: mAECs (3×105 cells/mL) were cultured on growth factor reduced Matrigel (200 mL, BD Biosciences) for 6 h before imaging for tube formation using a Nikon Eclipse Ti microscope (n=4 per treatment).
ELISA: To verify TNF-a inhibition with antibodies, an ELISA was performed using Mouse TNF-a ELISA MAXTM Deluxe (Biolegend) according to the supplier's protocol. Secreted TNF-a in RAW 264.7 cell culture supernatant was measured by reading absorbance at 450 nm using a TECAN M1000 plate reader and quantified against a standard curve (n=4 per treatment).
Statistics: To determine if statistical significance existed between groups, one-way ANOVA was performed between groups followed by Tukey's range tests for comparisons between groups. For all experiments, p<0.05 was considered statistically significant and results were presented as means±standard error of the mean.
Results
Injectable polymer fabrication and characterization: The co-polymer of 21% PEGe 79% PCL (%: molar ratio) was synthesized by reacting 8-caprolactone with methoxyPEG (mPEG) using tin(II) ethyl hexanoate as a catalyst (
Cell viability with injectable polymer microgels: To determine the biocompatibility of injectable polymer microgels, human coronary artery endothelial cells (HCAECs) were cultured on pre-gelled polymer microgels for three days. HCAECs maintained viability (green by calcein AM) with few dead cells (red by ethidium homodimer). Of note, some larger areas of red fluorescence are from the polymer itself due to auto-fluorescence, and not necessarily indicative of dead cells.
Peptide uptake by macrophages and endothelial cells: Fluorescein isothiocyanate (FITC)-tagged C16 and Ac-SDKP peptides were used in mouse aortic endothelial cells (mAECs) and macrophages (RAW 264.7 cells) cultures to examine cellular uptake of peptides. Both cell types internalized Ac-SDKP and C16 peptides where C16 was confined in punctuate, distinct areas in the cells, while Ac-SDKP was diffusely present throughout the cells.
In vivo peptide release from injectable polymer microgels: To evaluate the ability of these peptide loaded-microgels to regulate angiogenesis and inflammation in PAD, a mouse model of hind limb ischemia was used. The A/J mouse strain was chosen due to its prolonged time course recovery from hind limb ischemia to mimic the delayed recovery seen in human PAD. When polymer solutions were injected into the muscle at the site of femoral artery ligation, they rapidly formed a stable gel (
Macrophage recruitment with peptide-loaded injectable polymer microgels: To investigate inflammatory responses to our peptide-loaded microgels at fourteen days after ligation and injection of micro-gels, the adductor muscle tissue adjacent to the microgels was sectioned and stained with hematoxylin and eosin (H&E) (FIG. 2Ae F) and mouse macrophage marker F4/80 (FIG. 2Ge I). Without peptide treatment, bulk injection of microgel resulted in muscle hypertrophy as indicated by varying muscle fiber size, replacement with fibrous and adipose tissues, and inflammatory cell infiltration (
Even with this co-treatment of the peptides in bulk injection (
The recruitment of inflammatory cells also followed similar trends when the peptide-loaded implantable polymer scaffolds were compared to the injectable polymer microgels (FIG. 2Ce F), with C16 augmenting macrophage infiltration while Ac-SDKP diminished macrophage infiltration. The low level of macrophage infiltration observed under treatment of Ac-SDKP alone (
Perfusion recovery with peptide-loaded microgels: Laser Doppler perfusion imaging (LDPI) and optical coherence tomography (OCT) were used to monitor blood perfusion to the ischemic hind limb over the course of 14 days. LDPI was conducted on the foot pads of the mouse hind limbs on 1, 3 7, and 14 days after femoral artery ligation. To quantify perfusion recovery in the ischemic hind limb, the perfusion in the right foot, in which the femoral artery and vein were ligated, was compared to perfusion in the left foot, which was left un-operated as an internal control. Without peptide or microgel treatment, perfusion in the ischemic right foot slightly increased over the course of 14 days, indicating minimal spontaneous recovery of function to the hind limb (
Doppler and speckle-variance OCT were also used to non-invasively image blood flow and vessel morphology in the hind limb, respectively. An increase in both the number and size of blood vessels in the ischemic calf muscle from 1 day to 13 days post-surgery with all treatment conditions was observed in cross-sectional Doppler OCT scans. Quantification of Doppler OCT scans with implantable scaffolds revealed a similar trend to LDPI measurements: treatment with C16 alone or the combination of C16 and Ac-SDKP resulted in a greater than two fold increase in the total area of vessels over the time course compared to treatment with Ac-SDKP or no treatment. No significant difference was observed between C16 alone and the co-treatment of C16 and Ac-SDKP, indicating the ability of this co-treatment to promote blood vessel formation. With injectable microgels, speckle-variance OCT volume scans of the calf muscle revealed Ac-SDKP or no peptide treatment formed few blood vessels with limited branching, while C16 or the combination of C16 and Ac-SDKP formed many vessels with a high degree of branching (
Angiogenesis and phagocytosis in peptide-loaded microgels: Fluorescence microangiography and a Vybrant phagocytosis assay were used to quantify angiogenesis and phagocytic activities, respectively in the tissue around microgels at the site of femoral artery ligations. We chose to measure phagocytosis because it is a crucial and potent indicator of inflammatory cell activation. C16-loaded microgels enhanced angiogenesis and macrophage activities in the ischemic hind limb, while Ac-SDKP-loaded micro-gels reduced both responses in comparison to microgels without peptide loading (FIG. 4Be C). Slightly increased angiogenesis was observed upon PBS injections of C16 peptides compared to PBS alone, while microgel-mediated C16 peptide delivery increased angiogenesis almost 1.5 fold vs. microgels without peptides (FIG. 4Be C). Unfortunately, C16 delivered via microgels stimulated the inflammatory response as evidenced by higher phagocytic activity than no peptide controls. However, the incorporation of Ac-SDKP peptides abated this inflammatory response, lessening the phagocytic activity to levels comparable to PBS only. Co-delivery of both Ac-SDKP and C16 peptides increased perfusion capacity 1.7 fold vs. microgels without peptides, while reducing phagocytosis to levels similar to no microgel controls, confirming our previous findings [12].
Inflammatory activation, as quantified by a Vybrant phagocy-tosis assay, was highest with bulk injection of microgels, and was attenuated remarkably with multiple, low volume injections of microgels (
TNF-a and MMP-9 inhibition: To further investigate these mechanisms, inhibitors of TNF-a and MMP-9 were used in cell culture studies. To verify TNF-a inhibition, an ELISA assay was performed. The use of TNF-a antibodies as natural TNF-a inhibitors successfully abrogated cellular production of TNF-a in all the test conditions (
MMP-9 activity was also investigated using a molecular inhibitor of MMP-9 [43]. In endothelial cells, MMP-9 inhibition was verified by the attenuation of MMP-9 activity as measured by zymography (FIG. 8Ae B). While TNF-a inhibition did not significantly influence MMP-9 activity or tubulogenesis in endothelial cells, these activities were significantly reduced when C16 and MMP-9 inhibitor were co-treated (FIG. 8Ae C). Without TNF-a inhibitors, MMP activation and expression, as well as tubulogenesis upon peptide treatments followed similar trends to angiogenesis in vivo. Particularly, C16 or the co-treatment of C16 and Ac-SDKP augmented MMP-9 activity and tubulogenesis, while these effects were diminished with Ac-SDKP treatment (
The present inventors first demonstrated the new therapeutic effect of combined C16 and Ac-SDKP on PAD when delivered via an injectable polymer scaffold system to mouse hind limb ischemia. This new therapeutic approach promotes angiogenesis while reducing inflammation in a mechanistically uncoupled manner, providing a new idea to the field of PAD therapy with high translational potential.
Although several surgical and non-surgical treatments are available for patients with PAD, there is an unmet need to restore blood flow to ischemic tissues while avoiding detrimental inflammation and other side effects in a minimally-invasive format for the 50% of patients with PAD that are ineligible for surgical interventions. While other studies have used VEGF, FGF, PDGF, GM-CSF, MCP-1, or bFGF in animal models of PAD, only bFGF has been used thus far in clinical trials. The first of these trials showed no adverse effects in the short term study; however, the second trial by Cooper et al., in 2001 found no positive effects with bFGF treatment and reported the negative side effect of severe proteinuria (excess proteins excreted in urine). For these reasons the study was terminated prematurely. The third clinical trial did report increased peak walking time without increased incidence of death or cardiac events in patients treated with bFGF, but also noted the high incidence of proteinuria.
Biomaterial systems have also been used to control the delivery of bFGF via gelatin microspheres in a phase 1 clinical trial. While this trial demonstrated promising results of improved perfusion and transcutaneous oxygen pressure, no placebo controls were used in this study to verify these findings. Other randomized clinical trials of bFGF administration in PAD patients have not demonstrated improvement vs. placebo controls. In addition, the synthesis of the gelatin microspheres required the use of glutaraldehyde e a highly cytotoxic crosslinking agent. The injectable microgel system used in our study avoids toxic agents and instead utilizes biocompatible polymer systems consisting of PEG and PCL which can be tuned for controlled peptide release without the need for chemical crosslinking Our study also reduces the cost of treatment by utilizing economical peptides in lieu of costly proteins such as bFGF. One explanation for the limited success of the use of single growth factors may be that PAD treatments are complicated by the interplay between angiogenesis and inflammation in this pathogenesis. Careful regulation of inflammation and angio-genesis is needed to treat PAD as some level of inflammation is needed for the initiation of angiogenesis to promote collateral vessel formation and restore blood flow to ischemic tissues. In this study we used small peptides proangiogenic C16 and anti-inflammatory Ac-SDKP e which take into consideration for controlling both angiogenic and inflammatory responses in PAD. The incorporation of this dual peptide treatment into an injectable polymer microgel proved to promote recovery of ischemic hind limbs in a mouse model of PAD while minimizing inflammatory responses.
The current study used LDPI and OCT imaging techniques to image blood flow and perfusion recovery in the model of PAD. These methods are advantageous over traditional imaging methods such as MRI and CT as they can be performed non-invasively in vivo and do not require a contrast agent. LDPI is non-invasive and semi-quantitative, with its ease of use making LDPI the gold standard for measuring recovery from hind limb ischemia. OCT is more sensitive than LDPI, with a higher resolution; however it is also depth limited. While LDPI could only accurately measure surface perfusion (within 200 mm) in the footpad, OCT can be used to image blood vessels up to 2 mm in depth of the ischemic calf muscle. According to results from LDPI, OCT, fluorescent microangiography, histological approaches, and Vybrant phagocy-tosis assays, the perfusion recovery and inflammatory activation with peptide-loaded implantable scaffolds were similar to trends seen with multiple 1 mL injections of peptide-loaded microgels. Specifically, C16 and C16 in combination with Ac-SDKP restored perfusion in the hind limb to the highest levels of all treatments tested. Ac-SDKP decreased perfusion compared to no peptide treatment. Phagocytic activity and macrophage infiltration also increased with C16 compared to no peptide treatment whereas Ac-SDKP decreased these inflammatory responses. The combination of C16 and Ac-SDKP maintained the low levels of phagocytic activity and macrophage infiltration observed with Ac-SDKP treatment alone.
Injectable polymer microgels provide an effective method for delivering functional peptides to the site of ischemia. Microgels were fabricated from biocompatible, biodegradable, combinatorial polymers PEG and PCL (
Peptides were used for this study in lieu of growth factors due to their lower cost. Without loading in microgels, peptides injected in PBS did not significantly alter any of the measured outcomes, indicating the need for microgels to sustain release of peptides to the surrounding tissue. When incorporated into polymer microgels, anti-inflammatory Ac-SDKP decreased phagocytic activity and macrophage infiltration, successfully minimizing the host inflammatory response to the polymer microgels and avoiding potential aggravation of inflammatory activated endothelium in occluded blood vessels. However, Ac-SDKP treatment alone slightly decreased angiogenesis or perfusion in the hind limb, suggesting the treatment of Ac-SDKP alone is not suitable for restoring function to ischemic limbs affected by PAD. Pro-angiogenic C16 loaded microgels increased angiogenesis and perfusion to the ischemic hind limb; however they also resulted in increased inflammation with increased phagocytic activity and macrophage infiltration compared to no peptide treatment. This high level of inflammatory response is concerning when considering translating these therapies to human patients with inflamed arteries. Therefore, a pro-angiogenic treatment without inflammatory exacerbation was sought. Microgels loaded with C16b Ac-SDKP resulted in increased blood perfusion to the ischemic hind limb, as evaluated by LDPI, OCT, and fluorescent microangiography, as well as limited inflammatory response as evaluated by Vybrant phagocytosis, histology, and F4/80 staining. The treatment with pro-angiogenic C16 in combination with anti-inflammatory Ac-SDKP provided optimal collateral angiogenesis without detrimental inflammation, suggesting an ideal treatment for PAD by regulating angiogenesis and inflammation independently. Quantification of perfusion capacity and phagocytic activity directly correlated with results obtained from peptide-loaded scaffolds in a subcutaneous model, which confirms our previous work. The site-specific delivery of these peptides prevents unintended vascularization or inflammatory reduction in other tissues e such as retinal neovascularization or reduction of alveolar macrophage activity. At the site of ischemia, however, blood flow was increased, fibrosis and detrimental inflammation (as measured by phagocytic activity and macrophage infiltration) were minimized, and tissue necrosis was prevented by our minimally-invasive, site-specific delivery of the therapeutic peptides.
A mechanism of uncoupling angiogenesis and inflammation by co-treatment of C16 and Ac-SDKP was investigated in vitro. The overall expression level of MMP-9 in Raw 264.7 was higher than that of mAECs (
These findings are consistent with a recent study by Camargo et al. which proved independent modulation of TNF-a without affecting NF-kb, a transcription factor for MMP-9. Many other factors are known to regulate MMP-9 besides TNF-a, including the inflammatory cytokines IL-1b and IL-1a. In fact, in a pivotal study by Bond et al., IL-1b was proven to be a more potent promoter of MMP-9 than TNF-a. Without the synergistic effects of PDGF or bFGF, TNF-a did not significantly stimulate MMP-9 activity, indicating the need for combined cytokines and growth factors to stimulate maximal MMP-9 secretion. However, IL-1a alone did stimulate low levels of MMP-9 activity, and even higher levels when combined with PDGF or bFGF. TNF-a and IL-1a activate NF-kb, whereas bFGF and PDGF activate the ERK-1/ERK-2 MAPK pathway resulting in activation of AP-1, another transcription factor of MMP-9. As explained by Bond et al., their results indicate that both AP-1 and NF-kb are required for MMP-9 activation. The binding regions of these promoters are proximal to each other, allowing for interaction. Therefore multiple signal transduction pathways are needed for MMP-9 expression, with either TNF-a or IL-b required for NF-kb activation. In our study, inflammation was modulated independently of angiogenesis. MMP-9 expression was maintained during inhibition of TNF-a, possibly due to alternate mechanisms of NF-kb activation by IL-1 and/or AP-1 stimulation by PDGF or bFGF. The independent control of angiogenesis and inflammation should contribute to clinical translation of our approach as an optimal PAD treatment.
This embodiment of the present invention relates to a temperature-sensitive, self-adhesive hydrogel to deliver iPSC-derived cardiomyocytes for tissue repair. The example is further described in Wang et al., International Journal of Cardiology 190 (2015) 177-180, the contents of which are incorporated herein by reference.
Induced pluripotent stem cells (iPSCs) from patients' somatic tissues provide a viable source to create autologous cardiomyocytes (CMs) for potential cardiac-related cell therapies. However, a gap between the generation of iPSC-derived cardiomyocytes (iPSC-CMs) and the successful intra-cardiac engraftment of the cells to restore heart function remains to be bridged. Clinical data reporting engraftment of cells within human heart tissue has not been without its challenges, with significant cell loss from the site of delivery due to the physical stress of the cardiac cycle and the hostile inflammatory response within the infarct zone. Hydrogels have been proven to support the survival of multiple cell types and have served as a platform for cell transplantation. Yet, the use of tissue-adhesive, temperature-sensitive hydrogels to deliver iPSC-derived cardiomyocytes to infarcted heart remains to be explored. Therefore, we developed a polymer hydrogel to encapsulate, deliver, and integrate iPSC-CMs into infarcted myocardium to restore heart function.
A temperature-sensitive biodegradable copolymer (polyethylene glycol-co-poly-8-caprolactone (PEG-PCL)) was synthesized and conjugated with a collagen-binding peptide (SYIRIADTNIT). The polymer was soluble in aqueous solutions at room temperature and underwent solution-to-gel transition at 37° C. (
Engraftment of iPSC-CMs to infarcted myocardium using the peptide-modified hydrogel and potential improvement on infarcted heart function and structure were assessed with a rat myocardial infarction (MI) model. All animal surgery and animal care were approved by the Institutional Animal Care and Use Committee (IACUC) at Vanderbilt University (protocol: M/12/074). The left anterior descending (LAD) coronary artery of nude rats was ligated to induce MI. 30 minutes post-MI, iPSC-CMs alone, or modified copolymer solution with or without iPSC-CMs (2-4 million/rat) were injected around the infarct border zone. A negative control group received the LAD ligation and phosphate-buffered saline (PBS) injection without cells or copolymer.
At two weeks post-injection, heart dimensions and functional output were assessed by echocardiography. All groups had ventricular dilation and reduced fractional shortening (FS) (
Histological examination of the hearts was performed and the LV wall thickness of each group was measured using ImageJ and averaged based on 3 randomly selected spots each rat. Result demonstrated that, in addition to LV chamber enlargement, the LAD ligation resulted in dramatic thinning and significant fibrosis of the LV anterior free wall at two weeks in control groups (
This Example shows a temperature-sensitive, collagen-binding hydrogel based system to deliver human iPSC-derived cardiomyocytes to improve cardiac structure and function in infarcted rat heart. Moreover, our studies indicate that the beneficial effects of encapsulating iPSC-CMs in hydrogel are mediated through enhanced survival of transplanted iPSC-CMs in vivo. While future studies are needed to demonstrate long-term functional engraftment of transplanted cells, our study illustrates a promising biomaterial-based approach to overcome a commonly recognized obstacle to the potentially revolutionary cell-based approaches to repair failing hearts: survival of donor cells in the infarcted heart.
Throughout this document, including references are mentioned. All such references are incorporated herein by reference, including the references set forth in the following list:
This application claims benefit to Patent Application No. 62/027,706, the contents of which are incorporated herein by reference.
This invention was made with government support under NIH HL091465, NSF DMR 1006558, and HL104040 awarded by The National Institutes of Health. The government has certain rights in the invention.
Number | Date | Country | |
---|---|---|---|
62027706 | Jul 2014 | US |