Test for Microbial Blood Infections

Information

  • Patent Application
  • 20170349937
  • Publication Number
    20170349937
  • Date Filed
    July 25, 2015
    11 years ago
  • Date Published
    December 07, 2017
    8 years ago
Abstract
The invention relates to methods for detecting microbial blood infections including sepsis in a subject, preferably a neonate or a non-neonate such as an adult, the method comprising real-time PCR reactions for detection of specific microorganisms. Said methods preferably include treatment of a subject following detection of a specific microorganism or group of microorganisms. The invention further relates to a kit of parts adapted for performing a method of the invention, a set of at least one forward or re verse primer or probe and a method for monitoring sepsis or for determining the efficacy of an anti-sepsis treatment.
Description
1. FIELD OF THE INVENTION

The present invention relates to methods and compositions for diagnosing or predicting for microbial blood infections and/or stages of progression in a subject. The invention also relates to methods and compositions for treatment of microbial blood infections and to methods and compositions for monitoring the efficacy of anti-sepsis treatment.


2. BACKGROUND OF THE INVENTION

Microbial blood infections such as sepsis are a major and increasing cause of in-hospital morbidity and mortality. In terms of (additional) hospitalisations, it accounts for patient numbers comparable to those for breast and lung cancer. The mortality rate associated with septic shock (i.e. patients with sepsis complicated by strongly reduced blood pressure) is as high as 45%. There is therefore an urgent need to improve diagnosis and therapy planning for microbial blood infections such as sepsis.


Patients are diagnosed as suffering from sepsis when they develop clinical signs of infections or systemic inflammation. A list of signs and symptoms are used in order to make a diagnosis of sepsis, including abnormalities of body temperature, heart rate, respiratory rate, and white blood cell count.


There are different types of sepsis characterized by the type of infecting organism. Sepsis caused by gram-negative pathogens is considered as the most frequent, whereby the majority of gram-negative sepsis is caused by Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa. Gram-positive pathogens such as Staphylococci and Streptococci are the second major cause of sepsis, but their incidence is rising in the last decade. A third major group includes fungi, with fungal infections causing a relatively small percentage of sepsis cases, but with a high mortality rate.


Blood culture is currently the gold standard for diagnosis but its diagnostic impact is negatively affected by considerable turnaround time and a suboptimal sensitivity (Squire et al. 1979. Pediatrics 64: 60-4; Pierce et al. 1984. Pediatr Infect Dis 3: 510-3). A confirmed diagnosis as to the type of infection traditionally requires microbiological analysis involving inoculation of blood cultures, incubation for 18-24 hours, plating the causative microorganism on solid media, another incubation period, and final identification 1-2 days later. Even with immediate and aggressive treatment, some patients can develop multiple organ dysfunction syndrome and eventually die before treatment becomes effective. Since half of all deaths occur within the first three days after blood cultures are obtained, faster and more sensitive identification of the causative pathogen could be of great value to allow an early diagnosis and faster guidance of therapy (Stoll et al. 2002. Pediatrics 110: 285-91).


In addition, the sensitivity is mainly affected by the small volume of blood inoculated in blood cultures, previous administration of antibiotics and presence of low or intermittent bacteremia (Schelonka et al. 1996. J Pediatr 129: 275-8; Connell et al. 2007. Pediatrics 119: 891-6). The effect of blood volume was clearly demonstrated in a study which showed that blood cultures containing an adequate blood volume were twice more likely to yield a positive result compared to blood cultures with an inadequate blood volume (Connell et al. 2007).


Hence, there remains a strong need for improved techniques for diagnosis and treatment of patients with infectious diseases, blood-borne infections, sepsis, or systemic inflammatory response syndrome. The ability to rapidly detect infectious pathogens would have great value for preventing infections and especially sepsis in the population.


3. SUMMARY OF THE INVENTION

The present invention provides methods and kits for diagnosing microbial blood infections such as sepsis in mammals, preferably humans, including neonatals and adults. These methods and kits provide rapid and accurate information about the organism that is responsible for the infection. These near patient tools are easy to use, at or close to the patient's bedside, and will provide rapid information to the physician about how to treat each individual patient in the best way.


The invention therefore provides a method for detecting microbial blood infections comprising the steps of a) performing on a blood sample from a subject suspected of suffering from microbial blood infections, or on a sample of nucleic acids isolated therefrom, a nucleic acid amplification reaction, b) determining the presence and/or the amount of amplified nucleic acid produced by said nucleic acid amplification reaction, wherein said nucleic acid amplification reaction comprises the amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., and/or the tuf gene or tuf gene product, or a part thereof, of Staphylococcus spp.


In a preferred method of the invention, the nucleic acid amplification for the indicated gene or gene product, or a part thereof, is a PCR reaction using a forward primer and a reverse primer comprising a primer sequence as listed beneath, or a part thereof. In a preferred method of the invention, the nucleic acid amplification for the indicated gene or gene product, or a part thereof, is a PCR reaction using parts of a forward primer and a reverse primer sequence as listed beneath.


In a preferred method of the invention, the nucleic acid amplification for the indicated gene or gene product, or a part thereof, is a PCR reaction using a probe comprising the probe sequence as listed beneath, the complement of the probe sequence as listed beneath; or a part thereof.


In a preferred method of the invention, the nucleic acid amplification for the indicated gene or gene product, or a part thereof, is a PCR reaction using a probe comprising parts of a probe sequence as listed beneath, the complement of the probe sequence as listed beneath; or a part thereof.


In a preferred method of the invention, the nucleic acid amplification reaction of the phzE gene or phzE gene product, or a part thereof, is a PCR reaction using as a forward primer the sequence 5′-GCCGAGGTCATGGAATTC-3′ (SEQ ID NO: 1), using as a reverse primer the sequence 5′-ATCCGCGCCATCATCTTC-3′ (SEQ ID NO: 2), and using as a probe the sequence 5′-CGACAACCGCAAGGAAGCCGA-3′ (SEQ ID NO: 3); the nucleic acid amplification reaction of the rhaA gene or rhaA gene product, or a part thereof, is a PCR reaction using as a forward primer the sequence 5′-AACCAGGCGTCGATAAT-3′ (SEQ ID NO: 4), using as a reverse primer the sequence 5′-GTTTACGGCGCAATCC-3′ (SEQ ID NO: 5), and using as a probe the sequence 5′-ACAGGAAAGACAAGACTATGCAGACC-3′ (SEQ ID NO: 6); and the nucleic acid amplification reaction of the tuf gene or tuf gene product, or a part thereof, is a PCR reaction using as a forward primer the sequences 5′-CCAACTCCAGAACGTGATTCTG-3′ (SEQ ID NO: 7), 5′-CCAACTCCAGAACGTGACTCTG-3′ (SEQ ID NO: 8) and 5′-CCAACACCAGAACGTGATTCTG-3′ (SEQ ID NO: 9), using as reverse primers the sequences 5′-GTTGTCACCAGCTTCAGCGTAGT-3′ (SEQ ID NO: 11), 5′-GTTATCACCAGCTTCAGCGTAAT-3′ (SEQ ID NO: 12), and 5′-GTTGTCACCAGCTTCAGCATAGT-3′ (SEQ ID NO: 13), and using as a probe the sequence 5′-ACAGGCCGTGTTGAACGTGGKCAAATCAA-3′ (SEQ ID NO: 14).


The invention further provides a method for detecting microbial blood infections comprising the steps of: a) performing on a blood sample from a subject suspected of suffering from microbial blood infections, or on a sample of nucleic acids isolated therefrom, a nucleic acid amplification reaction, b) determining the presence and/or amount of amplified nucleic acid produced by said nucleic acid amplification reaction, and c) determining that said subject is suffering from microbial blood infections when said amount of amplified nucleic acid is higher than that produced in a control sample, wherein said nucleic acid amplification reaction comprises the amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, preferably wherein said nucleic acid amplification reaction is a PCR reaction using as a forward primer the sequence 5′-GCCGAGGTCATGGAATTC-3′ (SEQ ID NO: 1), using as a reverse primer the sequence 5′-ATCCGCGCCATCATCTTC-3′ (SEQ ID NO: 2), and using as a probe the sequence 5′-CGACAACCGCAAGGAAGCCGA-3′ (SEQ ID NO: 3).


A nucleic acid amplification reaction comprising the amplification of the phzE gene or phzE gene product is new and was shown to provide adequate performance in silico as well as in vitro, meaning high sensitivity with a lower detection limit of about 1-5 colony forming unit-equivalents of P. aeruginosa microorganisms per real time PCR reaction, and high specificity. No positive PCR results were obtained when this test was performed on DNA isolates from 44 different, non-P. aeruginosa cultures. The sensitive nucleic acid amplification provides a detection sensitivity of about 5-7 micro-organisms per ml of blood. This approaches the sensitivity of blood culturing, the current gold standard for sepsis diagnosis. Moreover, the results from this method for detecting sepsis can be available within 4 hours, while the classical blood cultures take 2-3 days. This fast detection enables fast, adequate antibiotic treatment which will significantly reduce mortality (Kumar et al., 2006. Crit Care Med 34: 1589-96).


The invention further provides a method for detecting microbial blood infections comprising the steps of: a) performing on a blood sample from a subject suspected of suffering from microbial blood infections, or on a sample of nucleic acids isolated therefrom, a nucleic acid amplification reaction, b) determining the presence and/or amount of amplified nucleic acid produced by said nucleic acid amplification reaction, and c) determining that said subject is suffering from microbial blood infections when said amount of amplified nucleic acid is higher than that produced in a control sample, wherein said nucleic acid amplification reaction comprises the amplification of the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp. This test shows high sensitivity, with a lower detection limit of about 1 colony forming unit-equivalents of Klebsiella spp. microorganisms per real time PCR reaction, and high specificity. Preferably said nucleic acid amplification of the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp reaction is a real-time PCR reaction using as a forward primer the sequence 5′-AACCAGGCGTCGATAAT-3′ (SEQ ID NO: 4), using as a reverse primer the sequence 5′-GTTTACGGCGCAATCC-3′ (SEQ ID NO: 5), and using as a probe the sequence 5′-ACAGGAAAGACAAGACTATGCAGACC-3′ (SEQ ID NO: 6).


The invention further provides a method for detecting microbial blood infections comprising the steps of: a) performing on a blood sample from a subject suspected of suffering from microbial blood infections, or on a sample of nucleic acids isolated therefrom, a nucleic acid amplification reaction, b) determining the presence and/or amount of amplified nucleic acid produced by said nucleic acid amplification reaction, and c) determining that said subject is suffering from microbial blood infections when said amount of amplified nucleic acid is higher than that produced in a control sample, wherein said nucleic acid amplification reaction comprises the amplification of the tuf gene or tuf gene product, or a part thereof, of Staphylococcus spp., preferably wherein said nucleic acid amplification reaction is a PCR reaction using as a forward primer the sequences 5′-CCAACTCCAGAACGTGATTCTG-3′ (SEQ ID NO: 7), 5′-CCAACTCCAGAACGTGACTCTG-3′ (SEQ ID NO: 8) and 5′-CCAACACCAGAACGTGATTCTG-3′ (SEQ ID NO. 9), using as reverse primers the sequences 5′-GTTGTCACCAGCTTCAGCGTAGT-3′ (SEQ ID NO: 11), 5′-GTTATCACCAGCTTCAGCGTAAT-3′ (SEQ ID NO: 12), and 5′-GTTGTCACCAGCTTCAGCATAGT-3′ (SEQ ID NO: 13), and using as a probe the sequence 5′-ACAGGCCGTGTTGAACGTGGKCAAATCAA-3′ (SEQ ID NO: 14).


A method of the invention preferably further comprises the amplification of a gene or gene product, or a part thereof, of at least one microorganism selected from the group consisting of Enterococcus faecalis, Escherichia coli, and Staphylococcus aureus, as part of the same or a separate nucleic acid amplification reaction.


In one embodiment of a method of the invention, the subject is a neonate, and a method of the invention further comprises the amplification of a gene or gene product, or a part thereof, of at least one microorganism selected from the group consisting of Streptococcus agalactiae and Serratia marcescens, as part of the same or a separate nucleic acid amplification reaction.


A preferred method for neonatal analysis comprises performing 3 separate multiplex PCR assays, wherein a first amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus aureus, Enterococcus faecalis, Klebsiella spp., and Streptococcus agalactiae;


wherein a second amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Escherichia coli, Pseudomonas aeruginosa, and Serratia marcescens; and wherein a third amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus spp.


Said gene of Serratia marcescens preferably is the gyrB gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GACCGTGAAGACCACTTCCATTAC-3′ (SEQ ID NO: 15), using as reverse primers the sequences 5′-ACGCCGATGTCGTCTTTCAC-3′ (SEQ ID NO: 16) and 5′-CACGCCGATATCGTCTTTCAC-3′ (SEQ ID NO: 17), and using as a probe the sequence 5′-CGATCCACCCGAACGTGTTCTACTTCTC-3′ (SEQ ID NO: 18).


Said gene of Enterococcus faecalis preferably is the 16S rRNA gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CGCTTCTTTCCTCCCGAGT-3′ (SEQ ID NO: 19), using as reverse primer the sequence 5′-GCCATGCGGCATAAACTG-3′ (SEQ ID NO: 20), and using as a probe the sequence 5′-CAATTGGAAAGAGGAGTGGCGGACG-3′ (SEQ ID NO: 21).


Said gene of Escherichia coli preferably is the 16S rRNA gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCGCGTGTATGAAGAA-3′ (SEQ ID NO: 22), using as reverse primer the sequence 5′-CGGGTAACGTCAATGAGCAAA-3′ (SEQ ID NO.: 23), and using as a probe the sequence 5′-TATTAACTTTACTCCCTTCCTCCCCGCTGAA-3′ (SEQ ID NO: 24).


Said gene of Staphylococcus aureus preferably is the Sa442 genetic fragment and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATCGGAAACATTGTGTTCTGTATG-3′ (SEQ ID NO: 25), using as reverse primer the sequence 5′-TTTGGCTGGAAAATATAACTCTCGTA-3′ (SEQ ID NO: 26), and using as a probe the sequence 5′-AAGCCGTCTTGATAATCTTTAGTAGTACCGAAGCTGGT-3′ (SEQ ID NO: 27).


Said gene of Streptococcus agalactiae preferably is the cfb gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-TTCACCAGCTGTATTAGAAGTACATGC-3′ (SEQ ID NO: 28), using as reverse primer the sequence 5′-CCCTGAACATTATCTTTGATATTTCTCA-3′ (SEQ ID NO: 29), and using as a probe the sequence 5′-CAAGCCCAGCAAATGGCTCAAAAGCT-3′ (SEQ ID NO: 30).


In a further embodiment of a method of the invention, especially wherein the subject is an non-neonate, preferably an adult, a method involving amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, amplification of the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., and/or amplification of the tuf gene or gene product, or a part thereof, of Staphylococcus spp., amplification of a gene or gene product, or a part thereof, of at least one microorganism selected from the group consisting of Enterococcus faecalis, Escherichia coli, and Staphylococcus aureus, further comprises the amplification of a gene or gene product, or a part thereof, of at least one of the following targets: a microorganism selected from the group consisting of Acinetobacter baumannii, Enterococcus faecium, Streptococcus pneumoniae, Enterococcus spp., Candida spp., Candida albicans, Candida glabrata, Candida krusei, Aspergillus spp, Gram positive bacteria, Gram negative bacteria, or a gene or gene product selected from mecA, vanA, and ctxM as part of the same or separate nucleic acid amplification reactions.


This method preferably comprises performing 5 separate multiplex PCR assays, wherein a first amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Aspergillus spp, Gram positive bacteria, Gram negative bacteria, Candida spp. and Candida glabrata; wherein a second amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Escherichia coli, Enterococcus faecium, Acinetobacter baumannii, and the mecA gene; wherein a third amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus aureus, Enterococcus faecalis, Pseudomonas aeruginosa, Candida krusei, and Streptococcus pneumoniae; wherein a fourth amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus spp., Enterococcus spp., Klebsiella spp. and Candida albicans, and wherein a fifth amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of vanA and ctxM, preferably ctxM-1 and/or ctxM-9.


In this embodiment, said gene of Escherichia coli preferably is the gadA and/or gadB gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GGCTTCGAAATGGACTTTGCT-3′ (SEQ ID NO: 31), using as reverse primer the sequence 5′-TGGGCAATACCCTGCAGTTT-3′ (SEQ ID NO: 32), and using as a probe the sequence 5′-CTGTTGCTGGAAGACTACAAAGCCTCCCTG-3′ (SEQ ID NO: 33).


Said gene of Acinetobacter baumannii preferably is the 23S rDNA gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CGCTGTTGTTGGTGATGGAACT-3′ (SEQ ID NO: 34), using as reverse primer the sequence 5′-AACAGTTGCAGCGGCCTG-3′ (SEQ ID NO: 35), and using as a probe the sequence 5′-CTTCCTGAGCTGACGACAGCCGC-3′ (SEQ ID NO: 36).


Said gene of Enterococcus faecium is a hypothetical protein encoding ORF gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GCCAAAGGACCGCTTATTACG-3′ (SEQ ID NO: 37), using as reverse primer the sequence 5′-GCTTTTCGCTGTTTTTTTAATGACT-3′ (SEQ ID NO: 38), and using as a probe the sequence 5′-TTCGCAAGCGACAACAAGCACAAGC-3′ (SEQ ID NO: 39).


In this embodiment, said gene of Staphylococcus aureus is the hsdM gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-AAGGCGGAGGAATCACATGTC-3 (SEQ ID NO: 40)′, using as reverse primer the sequence 5′-TTCGCAATCGACCATAATTTTTT-3′ (SEQ ID NO: 41), and using as a probe the sequence 5′-TTACTGAAAAACAACGTCAGCA-3′ (SEQ ID NO: 42).


In this embodiment, said gene of Enterococcus faecalis preferably is the ref12A gene wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-ATGCGTCTCGTCACAGTA-3′ (SEQ ID NO: 43), using as reverse primer the sequence 5′-GGTACGATGATTTCATCTGT-3′ (SEQ ID NO: 44), and using as a probe the sequence 5′-AGTTGCGATGTTTCACTGTGAAGCA-3′ (SEQ ID NO: 45).


Said gene of Streptococcus pneumoniae preferably is the comX gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GGTCTCTGGCTAGATGATTATTATCTCTT-3′ (SEQ ID NO: 46), using as reverse primer the sequence 5′-ATAGTAAACTCCTTAAACACAATGCGTAA-3′ (SEQ ID NO: 47), and using as a probe the sequence 5′-CGCCCTCGAAATCGTTCATTGCTTAAGA-3′ (SEQ ID NO: 48).


Said gene of Aspergillus spp preferably is the 18S-28S rRNA ITS region and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GCGTCATTGCTGCCCTCAAGC-3′ (SEQ ID NO: 49), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 50), and using as a probe the sequence 5′-CCTCGAGCGTATGGGGC-3′ (SEQ ID NO: 51).


Said gene of Gram positive bacteria preferably is the 16S rDNA gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-TGGAGCATGTGGTTTAATTCGA-3′ (SEQ ID NO: 52), using as reverse primer the sequence 5′-TGCGGGACTTAACCCAACA-3′ (SEQ ID NO: 53), and using as a probe the sequence 5′-TGGTGCATGGTTG-3′ (SEQ ID NO: 54).


Said gene of Gram negative bacteria preferably is the 16S rDNA gene and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-TGGAGCATGTGGTTTAATTCGA-3′ (SEQ ID NO: 55), using as reverse primer the sequence 5′-TGCGGGACTTAACCCAACA-3′ (SEQ ID NO: 56), and using as a probe the sequence 5′-TGCTGCATGGCTGT-3′ (SEQ ID NO: 57).


Said gene of Candida spp. preferably is the 18S-28S rRNA ITS region and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCTGTTTGAGCGTCRTTT-3′ (SEQ ID NO: 58), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 59), and using as a probe the sequence 5′-TCGTATTGCTCAACACCAAACCC-3′ (SEQ ID NO: 60).


Said gene of Candida glabrata preferably is the 18S-28S rRNA ITS region and said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCTGTTTGAGCGTCRTTT-3′ (SEQ ID NO: 61), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 62), and using as a probe the sequence 5′-ATCAGTATGTGGGACACGAGCG-3′ (SEQ ID NO: 63).


A nucleic acid amplification reaction comprising said mecA gene or a part thereof preferably is a real-time PCR reaction using as a forward primer the sequence 5′-GATCGCAACGTTCAATTTAATTTT-3′ (SEQ ID NO: 64), using as reverse primer the sequence 5′-GCTTTGGTCTTTCTGCATTCCT-3′ (SEQ ID NO: 65), and using as a probe the sequence 5′-AATGACGCTATGATCCCAATCTAACTTCCACAT-3′ (SEQ ID NO: 66).


Said gene of Candida krusei preferably is the 18S-28S rRNA ITS region and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCTGTTTGAGCGTCRTTT-3′ (SEQ ID NO: 67), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 68), and using as a probe the sequence 5′-ACGACGTGTAAAGAGCGTCGG-3′ (SEQ ID NO: 69).


Said gene of Enterococcus spp. preferably is the 23S rDNA gene and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-TGCGGGGATGAGGTGTG-3′ (SEQ ID NO: 70), using as reverse primer the sequence 5′-CAAACAGTGCTCTACCTCCATCAT-3′ (SEQ ID NO: 71), and using as a probe the sequence 5′-TAGCCCTAAAGCTATTTCGGAGAGAACCA-3′ (SEQ ID NO: 72).


Said gene of Candida albicans preferably is the 18S-28S rRNA ITS region and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCTGTTTGAGCGTCRTTT-3′ (SEQ ID NO: 73), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 74), and using as a probe the sequence 5′-TAAGGCGGGATCGCTTTGACA-3′ (SEQ ID NO: 75).


A nucleic acid amplification reaction comprising said vanA gene or a part thereof, preferably is a real-time PCR reaction using as a forward primer the sequence 5′-CGGTTTCACGTCATACAGTCGTT-3′ (SEQ ID NO: 76), using as reverse primer the sequence 5′-CAGTTCGGGAAGTGCAATACC-3′ (SEQ ID NO: 77), and using as a probe the sequence 5′-TCCCCGTATGATGGCCGCTGC-3′ (SEQ ID NO: 78).


A nucleic acid amplification reaction comprising ctxM-1 gene or a part thereof, preferably is a real-time PCR reaction using as a forward primer the sequence 5′-ATGTGCAGYACCAGTAARGTKATGGC-3′ (SEQ ID NO: 79), using as reverse primer the sequence 5′-ATCACKCGGRTCGCCNGGRAT-3′ (SEQ ID NO: 80), and using as a probe the sequence 5′-CCCGACAGCTGGGAGACGAAACGT-3′ (SEQ ID NO: 81).


A nucleic acid amplification reaction comprising the ctxM-9 gene or a part thereof, preferably is a real-time PCR reaction using as a forward primer the sequence 5′-ATGTGCAGYACCAGTAARGTKATGGC-3′ (SEQ ID NO: 82), using as reverse primer the sequence 5′-ATCACKCGGRTCGCCNGGRAT-3′ (SEQ ID NO: 83), and using as a probe the sequence 5′-CTGGATCGCACTGAACCTACGCTGA-3′ (SEQ ID NO: 84).


The invention further provides a kit of parts adapted for performing a method of the invention, said kit preferably comprising at least one forward or reverse primer or probe as defined herein, preferably wherein at least one of said at least one forward or reverse primer or probe comprises a detectable label, preferably a fluorescent label.


The invention further provides at least one forward or reverse primer or probe as defined herein, preferably wherein at least one of said at least one forward or reverse primer or probe comprises a detectable label, preferably a fluorescent label.


The invention further provides a method for monitoring sepsis or for determining the efficacy of an anti-sepsis treatment, said method comprising performing a method according to the invention on at least two samples, wherein said samples are obtained at different time points in the course of the sepsis or at different time points in the course of an anti-sepsis treatment.





4. BRIEF DESCRIPTION OF THE FIGURES


FIG. 1


Performance of monoplex PCR assays for detection of DNA from individual bacteria as spiked into blood samples or derived from pure culture and supplied in standard phosphate buffered saline (PBS).


Bacteria were spiked in two concentrations (1000 and 100 cfu/reaction).


Grey curves=bacterial DNA derived from blood. Black curves=bacterial DNA derived from pure culture.

  • 1A: Pseudomonas aeruginosa
  • 1B: Klebsiella genus
  • 1C: Enterococcus faecalis
  • 1D Staphylococcus aureus
  • 1E: Staphylococcus genus



FIG. 2


PCRs of Gram-positive and Gram-negative bacteria show background signals (as seen in the curves for the negative control samples) probably due to DNA present in PCR reagents. However, the a-specific signals obtained upon addition of bacterial DNA are always lower than the negative control samples, meaning they will not be unjustly be interpreted as positive.

  • 2A: Gram-positive PCR
  • 2B: Gram-negative PCR



FIG. 3


Real-time PCR curves, corrected for fluorescence bleed through using the Color Compensation module of software version LightCycler 1.5.0 (Roche) for the indicated micro-organisms. The lowest concentration of pathogen DNA detected in the Multiplex BloodStream Infection (BSI) PCR is indicated in the graphs as cfu/PCR.

  • 3A: P. aeruginosa; Limit of detection: 1 cfu/PCR.
  • 3B: Klebsiella spp.; Limit of detection: 1 cfu/PCR.
  • 3C: E. coli; limit of detection: 1 cfu/PCR.



FIG. 4


Sensitivity of the pan-Aspergillus PCR was tested by adding DNA obtained from pure Aspergillus cultures to the PCR reactions. Red curves: monoplex PCR. Blue curves: multiplex PCR.

  • 4A: Aspergillus candida
  • 4B: Aspergillus terreus





5. DETAILED DESCRIPTION OF THE INVENTION
5.1 Definitions

The term “microbial blood infections”, as used herein, refers to the presence of one or more microorganisms in blood of a subject. Said subject not necessarily has clinical signs and/or symptoms of disease. However, the term microbial blood infection includes sepsis.


The term “sepsis”, as used herein, refers to an infection-induced syndrome resulting in tissue injury that involves two or more of the following features of systemic inflammation: fever or hypothermia, leukocytosis or leukopenia, tachycardia, and tachypnea or a supranormal minute ventilation. Sepsis is often characterized by signs of inflammation (vasodilation, leukocyte accumulation, increased microvascular permeability) occurring in tissues that are remote from the infection.


The term “blood sample”, as is used herein, refers a sample of blood that is obtained from a mammal, preferably a human. The term blood sample includes both blood plasma, which is prepared by removing red and white blood cells, for example by centrifugation, and blood serum, which is prepared by formation of a blood clot, and removal of the clot using, for example, a centrifuge.


The term “control sample” as used herein, refers to a negative control sample, for example a blood sample that does not comprise the indicated microorganism or microorganisms, or a sample of nucleic acids isolated therefrom, or a buffer control, for example 10 mM Tris, pH 8.0, 1 mM ethylenediaminetetraacetic acid (EDTA).


The term “amplification”, as is used herein, refers to the in vitro amplification of a specific nucleic acid sequence, such as to test for presence of a given fungus or bacteria in a sample. In vitro amplification methods include amplification of a target nucleic acid sequence using, for example, ligase chain reaction (LCR), isothermal ribonucleic acid amplification such as nucleic acid sequence-based amplification (NASBA) and cleavage-based signal amplification of RNA, transcription mediated amplification, strand displacement amplification and, preferably, polymerase chain reaction (PCR).


The term “nucleic acid amplification reaction”, as is used herein, refers to a specific amplification reaction or a combination of specific amplification reactions that is performed in a reaction chamber such as a vial or a well of a microtiter plate, or a fluidic chamber of a cartridge system. A nucleic acid amplification reaction is preferably specific, meaning that only the region between two primers in a target nucleic acid template is amplified.


The term “PCR reaction”, as is used herein, refers to an amplification reaction that is characterized by repeated cycles of denaturation of target nucleic acid template, annealing of primers, and extension (synthesis) of new nucleic acid strand. The specificity of a PCR reaction is substantially determined by the % identity of the primers to the target nucleic acid template and the annealing temperature.


The term “real-time PCR reaction”, as is used herein, refers to a PCR amplification reaction to which a labeled probe or a dye is added to generate a signal. The intensity of the signal is a measure for the amount of product that is generated. Detection of the signal in real-time allows quantification of the amount of starting material. A real-time PCR reaction is performed in specialized thermal cyclers with detection systems that detect the signal, for example a LightCycler 48011 (Roche Diagnostics, Almere, The Netherlands), a Mastercycler Realplex Ep Real-Time PCR System (Eppendorf A.G., Hamburg, Germany), or a StepOne™ Plus (Thermo Fisher Scientific Inc., Waltham, Mass. USA). However, a separate probe does not need to be present. Some real-time PCR reactions incorporate a dye in the primer (e.g. Scorpion® primers; Premier Biosoft, Palo Alto, Calif., USA) and are comprised in the scope of the present invention.


The terms “forward primer” and “reverse primer”, as are used herein, refer to a single-stranded oligonucleotide or oligonucleotide mimic of 15-50 bases, preferably 16-30 bases, that is complementary to nucleic acid sequences flanking the region to be amplified. The sequence of the forward primer and reverse primer determine the specificity of the amplification reaction. Preferred primers are preferably about 100% identical to a region on a target nucleic acid template such that only the region between two primers in a target nucleic acid template is amplified. The distance between the primer binding sites on the target nucleic acid template will determine the size of the amplified product.


The term “probe”, as is used herein, refers to a single-stranded oligonucleotide or oligonucleotide mimic of 15-50 bases, preferably 16-30 bases, that is complementary to a nucleic acid sequence within the region to be amplified. A preferred probe is about 100% identical to a region on a target nucleic acid template.


The terms “target DNA molecule”, “target nucleic acid template” and “template DNA molecule”, as are used herein, refer to nucleic acid of which a region between two primers, preferably a forward primer and a reverse primer, is amplified. A target nucleic acid template is a gene or a gene product, such as a RNA product, or a part of the gene or part of the gene product.


The term “amplicon”, as is used herein, refers to a region on a target nucleic acid template that is amplified using said two primers, preferably a forward primer and a reverse primer. An amplicon preferably comprises a nucleic acid sequence that is complementary to a nucleic acid sequence of a probe that specifically recognizes said amplicon.


The term “Ct value”, as used herein, refers to the cycle threshold in real time PCR, which is the number of cycles required for a fluorescent signal to cross a background level. Ct levels are inversely proportional to the amount of target nucleic acid in the sample, meaning that a lower Ct level indicates a higher amount of target nucleic acid template in the sample. In general, for a real time PCR assay undergoing 40 cycles of amplification, a Ct value of <29 is indicative of abundant target nucleic acid template in a sample, a Ct value of 30-37 is indicative of a moderate amount of target nucleic acid template, while a Ct value of 38-40 is indicative of a low amount of target nucleic acid template.


The term “gene”, as is used herein, refers to genomic DNA sequence that encodes a gene product. The term “gene” includes enhancer, promoter, intronic and exonic sequences.


The term “gene product”, as is used herein, refers to a nucleic acid product, preferably a messenger RNA, that is encoded by a gene. When a gene product such as RNA is to be amplified, the RNA is preferably converted into copy DNA by a RNA-dependent DNA polymerase, also termed reverse-transcriptase, prior to amplification. The term “oligonucleotide mimic”, as is used herein, refers to a modified oligonucleotide comprising, for example, locked nucleic acid (LNA®), synthetic peptide nucleic acid, mimics comprising 2′O-Me modified nucleotides or phosphonoacetate modified oligonucleotides, and/or mimics comprising phosphodiester-, phosphonocarboxylate-, methylphosphonate- or phosphorothioate internucleotide bonds.


The term “detectable label”, as is used herein, refers to a label that is detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radioactive labels, fluorescent labels, electron-dense reagents, enzymes (as commonly used in ELISAs), biotin, or haptens and proteins for which antisera or monoclonal antibodies are available.


The term “colony forming unit-equivalent”, as is used herein, refers to an amount of a micro-organism that is detected in a real-time PCR reaction according to the invention, when compared to a standard blood culture test. A cell of a micro-organism will in principle give rise to a colony in an appropriate standard blood culture test, and detection of this amount of a micro-organism in a real-time PCR reaction according to the invention will result in detection of a colony forming unit-equivalent.


The term “multiplex PCR assay”, as is used herein, refers to the simultaneous amplification of different nucleic acid fragments in a single amplification reaction.


The term “separate multiplex PCR assays”, as is used herein, refers to the amplification of different nucleic acid fragments in multiple separate amplification reactions. The term “neonate”, as is used herein, refers to a mammal, preferably a human, preferably up to three months after birth.


The term “non-neonate”, as is used herein, refers to a mammal, preferably human, that is older than three months after birth. A preferred non-neonate is an adult of 18 years or older.


5.2 Sample Preparation

Early detection of the causing microorganism and timely therapeutic intervention are crucial for improved outcome of patients with microbial blood infections such as sepsis. The early detection of specific pathogens will allow the discrimination between patients with SIRS and patients with microbial blood infections such as sepsis, and will have a positive impact on therapy. The present inventors have developed Polymerase Chain Reaction (PCR)-based tests that identify microorganisms and provide information about their resistance to antibiotics. The tests can be applied to biological fluids, particularly blood samples.


Efforts to introduce molecular methods for diagnosis of microbial blood infections such as sepsis, especially neonatal sepsis, have evolved around broad-range PCR targeting the 16S rRNA gene for universal bacterial or gram-specific detection (McCabe et al. 1995. Pediatrics 95: 165-9; Jordan et al. 2006. J Mol Diagn 8: 357-63; Wu et al. 2008. J Clin Microbiol 46: 2613-9; Chan et al. 2009. Crit Care Med 37: 2441-7). A recent systematic review with meta-analysis evaluating these assays showed a mean sensitivity of 90% and specificity of 96% compared to blood culture indicating that such assays currently offer a promising potential as add-on tests (Pammi et al. 2011. Pediatrics 128: e973-85).


However, an important limitation of these broad-range assays is that additional processing steps such as sequencing or hybridization are required for species identification thereby prolonging the turnaround time significantly. Also, they are particularly prone to false-positive results coming from exogenous bacterial DNA present in PCR reaction components (e.g. Taq polymerase preparation) or from contamination during processing steps. These issues reduce both sensitivity and applicability of these assays (Corless et al. 2000. J Clin Microbiol 38: 1747-52). A species-specific PCR assay could overcome these drawbacks, but should be applied in a multiplexed format to provide sufficient coverage of etiologic pathogens. The implementation of real-time multiplex assays in the diagnostic process is rapidly growing and recent studies report sensitivities equal to monoplex assays (Wittwer et al. 2001. Methods 25: 430-42; Molenkamp et al. 2007. J Virol Methods 141: 205-11; Bahrdt et al. 2010. Anal Bioanal Chem 396: 2103-1). As such, these type of assays may as well provide a good option for diagnosis of microbial blood infections such as neonatal sepsis.


Therefore, an easy-to-use, fast and sensitive multiplex PCR assay was developed that detects the most prevalent bacterial pathogens in a species-specific manner and which requires only small input blood volumes


Blood samples are preferably collected in tubes that are coated with anticoagulants such as EDTA, sodium citrate, and heparin. Heparin is preferably avoided when RNA is isolated, because heparin may inhibit the synthesis of copy DNA by a reverse transcriptase. Preferred amounts of biological fluids, particularly blood samples, that are collected are between 0.1 and 10 ml, preferably between 1 and 5 ml.


The biological fluid, preferably blood sample, is preferably pre-treated to induce selective lysis of human cells and degradation of non-target human DNA, which results in increased sensitivity and specificity of the subsequent analysis of pathogens. Kits for the removal of human cells and the degradation of non-target human DNA are known in the art. Very suitable systems have been described, such as the Polaris system (WO2011/070507 and WO2012/168003) and/or are commercially available, such as the MolYsis pretreatment kit (Molzym GmbH & Co. KG, Bremen, Germany). These methods allow larger sample volumes to be processed. This will result in increased sensitivity, rendering the molecular detection of bloodstream infections clinically applicable. The Polaris method is preferred as it is more reproducible, less labour intensive, and faster compared to the MolYsis method.


PCR is a process in which DNA sample is amplified. DNA samples may be obtained by using generally known techniques for DNA isolation. Methods and compositions for isolation of genomic DNA from biological fluids, particularly blood, preferably employ aqueous solvents without use of organic solvents and chaotropic salts. The isolated genomic DNA is preferably free of polymerase inhibitors.


Total genomic DNA may be purified from blood samples, or from pretreated blood samples as is indicated herein above, using, for instance, a combination of physical and chemical methods. Very suitably commercially available systems for DNA isolation are used, such as the QIAamp blood mini kit columns (Qiagen, Venlo, The Netherlands), the NucliSENS® easyMAG® nucleic acid extraction system (bioMérieux, Marcy l'Etoile, France) or the MagNA Pure 96 System (Roche Diagnostics, Almere, The Netherlands).


As an alternative, a gene product such as ribonucleic acid (RNA) may be isolated from a blood sample, or from a pretreated blood sample as is indicated herein above, using, for example, the Ambion Ribopure™ kit or the Qiagen RNeasy kit. RNA is preferably converted into complementary DNA (cDNA) prior to amplification using a RNA-dependent DNA polymerase or reverse transcriptase. Methods for the conversion of RNA into cDNA are known in the art and include recombinant M-MuLV reverse transcriptase or AMV reverse transcriptase. Suitable commercially available systems for cDNA synthesis include commercially available systems for DNA isolation are used, such as the gScript™ cDNA synthesis kit (Quanta Biosciences, Gaithersburg, Md.) and the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc., Waltham, Mass.). It is preferred that random primers, for example hexamers or nonamers, or gene-specific primers are used for cDNA synthesis.


5.3 Amplification Reaction

Different amplification methods, known to a skilled artisan, can be employed for amplification, including but not limited to Polymerase Chain Reaction (PCR), rolling circle amplification, nucleic acid sequence-based amplification, transcription mediated amplification, and linear RNA amplification. A preferred amplification method is PCR, especially real-time PCR.


PCR is a technology that relies on thermal cycling, consisting of cycles of repeated heating and cooling of a reaction for DNA melting and enzymatic replication of the DNA. Primers containing sequences that specifically hybridizes to the target region, and a DNA polymerase are key components to enable selective and repeated amplification. As PCR progresses, the amplified DNA product that is generated is itself used as a template for replication, resulting in a chain reaction in which the DNA template is exponentially amplified.


A preferred DNA polymerase is a thermo stable polymerase, preferably a thermo stable recombinant polymerase. Preferred commercially available DNA polymerases include AptaTaq Fast DNA Polymerase and LightCycler® FastStart Enzyme (Roche Diagnostics, Almere, The Netherlands).


Real-time PCR, also called quantitative PCR (qPCR), is a technique which is used to amplify and simultaneously quantify a template DNA molecule. The detection of the amplification products can in principle be accomplished by any suitable method known in the art. The amplified products may be directly stained or labelled with radioactive labels, antibodies, luminescent dyes, fluorescent dyes, or enzyme reagents. Direct DNA stains include for example intercalating dyes such as acridine orange, ethidium bromide, ethidium monoazide or Hoechst dyes.


Alternatively, the amplified product may be detected by incorporation of labelled dNTP bases into the synthesized DNA fragments. Detection labels which may be associated with nucleotide bases include, for example, fluorescein, cyanine dye and BrdUrd.


When using for example Scorpion primers or a probe-based detection system, a primer or the probe is preferably labelled with a detectable label, preferably a fluorescent label. Preferred labels for use in this invention comprise fluorescent labels, preferably selected from Atto425 (ATTO-TEC GmbH, Siegen, Germany), Atto 647N (ATTO-TEC GmbH, Siegen, Germany), YakimaYellow (Epoch Biosciences Inc, Bothell, Wash., USA), Ca1610 (BioSearch Technologies, Petaluma, Calif., USA), Ca1635 (BioSearch Technologies, Petaluma, Calif., USA), FAM (Thermo Fisher Scientific Inc., Waltham, Mass. USA), TET (Thermo Fisher Scientific Inc., Waltham, Mass. USA), HEX ((Thermo Fisher Scientific Inc., Waltham, Mass. USA), cyanine dyes such as Cy5, Cy5.5, Cy3, Cy3.5, Cy7 (Thermo Fisher Scientific Inc., Waltham, Mass. USA), Alexa dyes (Thermo Fisher Scientific Inc., Waltham, Mass. USA), Tamra (Thermo Fisher Scientific Inc., Waltham, Mass. USA), ROX (Thermo Fisher Scientific Inc., Waltham, Mass. USA), JOE (Thermo Fisher Scientific Inc., Waltham, Mass. USA), fluorescein isothiocyanate (FITC, Thermo Fisher Scientific Inc., Waltham, Mass. USA), and tetramethylrhodamine (TRITC, Thermo Fisher Scientific Inc., Waltham, Mass. USA). A probe is preferably labeled at the 5′ end with a detectable label, preferably a fluorescent label.


A primer such as a Scorpion primer, or a probe preferably has a fluorescent label at one end and a quencher of fluorescence at the opposite end of the probe. The close proximity of the reporter to the quencher prevents detection of its fluorescence; breakdown of the probe by the 5′ to 3′ exonuclease activity of polymerase breaks the reporter-quencher proximity and thus allows unquenched emission of fluorescence, which can be detected after excitation with a laser. An increase in the product targeted by the reporter probe at each PCR cycle therefore causes a proportional increase in fluorescence due to the breakdown of the probe and release of the reporter. Quenchers, for example tetramethylrhodamine TAMRA, dihydrocyclopyrroloindole tripeptide minor groove binder, are known in the art.


Preferred quenchers are Black Hole Quencher®-1 (BHQ1) and BHQ2, which are available from Biosearch Technologies, Petaluma, Calif., USA). The BHQ1 dark quencher has strong absorption from 480 nm to 580 nm, which provides excellent quenching of fluorophores that fluoresce in this range, such as FAM, TET, CAL Fluor® Gold 540, JOE, HEX, CAL Fluor Orange 560, and Quasar® 570 dyes. The BHQ2 dark quencher has strong absorption from 599 nm to 670 nm, which provides excellent quenching of fluorophores that fluoresce in this range, such as Quasar® 570, TAMRA, CAL Fluor® Red 590, CAL Fluor Red 610, ROX, CAL Fluor Red 635, Pulsar® 650, Quasar 670 and Quasar 705 dyes. BHQ1 and BHQ2 may quench fluorescence by both FRET and static quenching mechanisms.


The term “specifically hybridizing” refers to a nucleic acid molecule that is capable of hybridizing specifically under stringent hybridization conditions to a target nucleic acid template that is obtained or derived from Pseudomonas aeruginosa, Klebsiella species, Escherichia coli, Acinetobacter baumannii, Enterococcus faecalis, Enterococcus faecium, Staphylococcus species, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus agalactiae, Serratia marcescens, Candida albicans, Candida glabrata, Candida krusei, Pan-Aspergillus, pan-Candida, Gram-positive bacteria, Gram-negative bacteria, MecA, VanA, CTXM-1, and/or CTXM-9.


The terms “stringency” and “stringent hybridization” refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, and the like. These conditions are empirically optimised to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence. The terms as used include reference to conditions under which a probe or primer will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions may be sequence dependent and will be different in different circumstances. Longer sequences hybridise specifically at higher temperatures. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe or primer. Hybridization procedures are well known in the art and are described by e.g. Ausubel et al., 1998. Current Protocols in Molecular Biology, John Wiley, New York; and Sambrook et al., 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York.


An oligonucleotide primer or probe, or an oligonucleotide mimic primer or probe, is able to hybridize to a target nucleic acid template when the length of the molecule is or resembles at least 15 bases. The length of the primer or probe is preferably less than 100 bases. A preferred length of a primer or probe is between 15 and 50 bases, preferably between 16 and 30 bases.


In general, a primer or probe is able to hybridize to a target nucleic acid template when the percentage of sequence identity of the molecule is at least 90% over substantially the whole length, more preferred at least 91%, more preferred at least 92%, more preferred at least 93%, more preferred at least 94%, more preferred at least 95%, more preferred at least 96%, more preferred at least 97%, more preferred at least 98%, more preferred at least 99%, more preferred 100% identical to a nucleic acid that is obtained or derived from said target nucleic acid template over substantially the whole length of the primer or probe. The term “substantially the whole length” is used to indicate that the probe may comprise additional nucleotide sequences, for example at the 5′ and/or 3′ ends that are not present in the gene or region described herein above.


Efficient real-time PCR reactions are dependent upon high quality primer and probe design. Rules of thumbs for the design of primers include the selection of primers having a Tm between 58° C. and 65° C. while keeping the annealing temperatures of the primers as close as possible, having no more than two G's or C's in the last 5 bases at the 3′ end, and the selection of primer pairs with minimal number of potential primer dimers and primer hairpins.


Rules of thumbs for the design of probes include the selection of probes that have a Tm between 68° C. and 72° C., have no Gs on the 5′ end, resemble a strand that has more C than G bases, and are as short as possible, without being shorter than 13 nucleotides.


Methods for the design of primers and probes are known in the art. For example, Premier Biosoft (Palo Alto, Calif., USA) offers AlleleID® and Beacon Designer™ to design probes for real-time PCR assays that are free of dimers, repeats and runs and ensure signal fidelity. In addition, Primer3 (http://primer3.sourceforge.net) and Integrated DNA Technologies, Inc. (www.idtdna.com/Scitools/Applications/Primerquest) provide online tools for the design of primers and probes for real-time PCR assays. Hence, the skilled person is able to design primers and probes for real-time PCR analyses of one or more target nucleic acid templates.


The primers and probes are preferably tested in single nucleic acid amplification reactions (monoplex) and combined nucleic acid amplification reactions (multiplex) to determine optimal combinations of specific nucleic acid amplification reactions.


Specific tests have been developed for the identification of species and resistance markers based on their prevalence in blood cultures of patients suffering from sepsis. Genus- and species-specific real-time PCR assays were developed using MultiMPrimer3 (available at http://bioinfo.ut.ee/multimprimer3/) or from alignments of gene sequences retrieved from GenBank (Koressaar et al., 2009. Bioinformatics 25: 1349-55). Sequences with adequate in silico coverage and specificity were used for primer and probe design for real-time PCR assays using Primer Express 149 Software 3.0 (Life Technologies, Bleiswijk, The Netherlands).


Optimized primers and probes for multiplex real-time PCR are provided in Tables 1 and 2. The most common infections underlying microbial blood infections such as sepsis are caused by Pseudomonas aeruginosa, Escherichia coli, Klebsiella species, Enterococcus faecalis, Staphylococcus spp. and Staphylococcus aureus.


A preferred test for microbial blood infections such as sepsis comprises detection of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., and/or the tuf gene or tuf gene product, or a part thereof of Staphylococcus spp.


The term phzE gene refers to a gene of which the encoded protein product plays a role in the biosynthesis of pyocyanin and phenazine-1-carboxamide from chorismic acid. PhzE catalyses the transfer of an amide nitrogen from glutamine to chorismic acid, creating 2-amino-2-deoxyisochorismic acid. PhzE resembles a class I glutamine amidotransferase (GATase). PhzE is part of a seven-gene phenazine biosynthetic locus comprising the operons phzABCDEFG. A complete sequence of this locus is provided, for example, in GenBank accession number AF005404.2. Preferred primers and probe are indicated in Table 1 and Table 2.


The term rhaA gene, as used herein, refers to a gene that encodes a rhamnulose-1-phosphate aldolase (EC 4.1.2.19), which catalyzes the chemical reaction L-rhamnulose 1-phosphatecustom-characterglycerone phosphate+(S)-lactaldehyde. A sequence of this gene of Klebsiella spp. is provided, for example, in GenBank accession number CP006923.1. Preferred primers and probe are indicated in Table 1 and Table 2.


Said tuf gene of Staphylococcus spp., is a gene of Staphylococcus spp. that encodes an elongation factor EF-Tu, which is involved in the elongation phase of polypeptide synthesis on ribosomes. The coding region of the tuf gene is located in a genomic region between nucleotides 580338 and 581522 of the complete genome of Staphylococcus aureus subsp. aureus SA957, as provided in GenBank accession number CP003603.1. Preferred primers and probes are indicated in Table 1 and Table 2.


A further preferred test comprises detection of the phzE gene or phzE gene product, or a part thereof, of P. aeruginosa, the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp, detection of Staphylococcus spp., preferably by detection of a tuf gene, and detection of Enterococcus faecalis, preferably by detection of a 16S rRNA gene or of a ref12A gene, detection of Escherichia coli, preferably by detection of a 16S rRNA gene or of a gad and/or gadB gene, and detection of Staphylococcus aureus, preferably by detection of a SA442 gene or of a hsdM gene.


The 16S rRNA gene of E. faecalis and the 16S rRNA gene of E. coli encode a 16S ribosomal RNA (or 16S rRNA), which is a component of the 30S small subunit of prokaryotic ribosomes. The 16S rRNA gene is highly conserved between different species of bacteria. 16S rRNA gene sequences contain hypervariable regions that can provide species-specific signature sequences useful for bacterial identification. The Ribosomal Database Project (RDP) provides annotated ribosomal rRNA sequences along with related programs and services and is available at http://rdp.cme.msu.edu. Preferred primers and probe sequences are indicated in Table 1.


Said ref12A gene of Enterococcus faecalis is a member of a complex family of palindromic repeat sequences that is located, for example, between nucleotides 690164 and 690257, between nucleotides 1382699 and 1382792, between nucleotides 1755360 and 1755453, and between nucleotides 2895546 and 2895639 of the genomic sequence of Enterococcus faecalis DENG1, as depicted in GenBank accession number CP004081.1. Preferred primers and probe are indicated in Table 2.


Said gadA and/or gadB gene of E. coli, is a gene that encodes 2 biochemically identical isoforms of glutamate decarboxylase (GAD). Coding sequences of the gadA and gadB genes of E. coli strain DEC 1a are provided in GenBank accession numbers EF547386.1 and EF551351.1, respectively. These two sequences are 86% identical over the complete nucleotide sequences, with subregions showing 100% identity. Preferred primers and probe are indicated in Table 2.


Said SA442 gene of S. aureus is a genetic fragment that encodes a glutamate synthase domain-containing putative membrane protein. The gene is located between nucleotides 2685975 to 2687552 in the genomic sequence of S. aureus subsp. aureus Z172 having GenBank accession numberCP006838.1. Preferred primers and probes are indicated in Table 1.


Said hsdM gene of S. aureus is a gene with locus tag ER16_01940 that encodes a site-specific DNA-methyltransferase activity. This gene is located, for example, in a genomic region between nucleotides 437403 and 438959 of the genomic sequence of S. aureus subsp. aureus strain H-EMRSA-15, as depicted in GenBank accession number CP007659.1. Preferred primers and probes are indicated in Table 2.


Neonatal sepsis is the single most important cause of neonatal deaths, accounting for over 50% of all incidences, especially in preterm infants. If diagnosed early and treated aggressively with antibiotics and good supportive care, it is possible to save most cases of neonatal sepsis. Late-onset septicemia is caused by the organisms thriving in the external environment of the home or the hospital. The infection is often transmitted through the hands of care-providers, resulting in late onset sepsis (LOS), whereby the onset of symptoms is usually delayed beyond 72 hours after birth. The associated factors of LOS include low weight, lack of breastfeeding, superficial infections, aspiration of feeds, disruption of skin integrity with needle pricks and use of intravenous fluids. A preferred assay detects the eight most prevalent bacterial pathogens that cause LOS in preterm and very low birth weight (VLBW) infants.


A preferred neonatal sepsis test comprises detection of the phzE gene or phzE gene product, or a part thereof, of P. aeruginosa, the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp, and detection of Enterococcus faecalis, preferably by detection of a 16S rRNA gene, Escherichia coli, preferably a 16S rRNA gene, Staphylococcus spp., preferably a tuf gene, Staphylococcus aureus, preferably a SA442 gene, Streptococcus agalactiae, preferably a cfb gene, and Serratia marcescens, preferably a gyrB gene. This assay has a high analytical sensitivity and specificity for detection of bacterial DNA in blood.


Said cfb gene of S. agalactiae is a Christie Atkins Munch-Petersen (CAMP) factor gene of group B streptococci. CAMP factor b enhances hemolysis as a result of the production of a heat stable, filterable agent produced by only group B streptococci such as S. agalactiae. A coding sequence of the cfb gene of S. agalactiae strain ZQ0908 is provided in GenBank accession number HQ148672.1. Preferred primers and probes are indicated in Table 1.


Said gyrB gene of Serratia marcescens is a gene that encodes a DNA gyrase, a type II DNA topoisomerase, which is an enzyme capable of transforming relaxed closed circular DNA into a negatively supercoiled form. The enzyme contains two protein subunits, subunits A and B. The B subunit, encoded by gyrB, mediates energy transduction and ATP hydrolysis during the topological transformation of DNA. A partial sequence of this gene of S. marcescens is provided, for example, by GenBank accession number AJ300536.1. Preferred primers and probes are indicated in Table 1.


A preferred non-neonatal, preferably adult, sepsis test comprises detection of the phzE gene or phzE gene product, or a part thereof, of P. aeruginosa, the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp, and detection of Escherichia coli, preferably gadA and gadB gene, Acinetobacter baumannii, preferably a 23S rRNA gene, Enterococcus faecium, preferably a gene encoding hypothetical protein, Streptococcus pneumoniae, preferably a comX gene, Enterococcus spp., preferably a 23S rRNA gene, Candida albicans, preferably a 18S-28S rRNA ITS region, Candida glabrata, preferably a 18S-28S rRNA ITS region, Candida krusei, preferably a 18S-28S rRNA ITS region, Aspergillus spp, preferably a 18S-28S rRNA ITS region, Gram positive bacteria, preferably a 16S rRNA gene, Gram negative bacteria, preferably a 16S rRNA gene, Candida spp. preferably a 18S-28S rRNA ITS region, and/or a gene or gene product selected from mecA, vanA, and ctxM, preferably ctxM-1 and/or ctxM-9.


A most preferred non-neonatal sepsis test comprises detection of all indicated genes or regions.


Said 23S rRNA gene of Acinetobacter baumannii or of Enterococcus spp., is a gene that encodes a 23S ribosomal RNA (or 23S rRNA), which is a component of the 50S large subunit of prokaryotic ribosomes. The 23S rRNA gene is highly conserved between different species of bacteria. 23S rRNA gene sequences contain hypervariable regions that can provide species-specific signature sequences useful for bacterial identification. Annotated 23S ribosomal rRNA sequences are available at http://www.arb-silva.de. Preferred primers and probes for detection of a 23S rRNA gene of Acinetobacter baumannii or of Enterococcus spp., are indicated in Table 2.


Said hypothetical protein-encoding ORF gene of Enterococcus faecium is a hypothetical protein that is encoded by a gene with locus tag EFAU085_00469 that is, for example, located in a genomic region between nucleotides 489869 and 490153 of the genome of Enterococcus faecium Aus0085, as provided in GenBank accession number CP006620.1. Preferred primers and probes for detection of this ORF gene are indicated in Table 2.


Said comX gene of Streptococcus pneumoniae is an early response gene that is involved in a quorum-sensing system mediated by a peptide pheromone called competence-stimulating peptide (CSP), which acts to coordinate transient activation of genes required for competence. A coding sequence of the comX gene of Streptococcus pneumoniae is provided, for example, by GenBank accession number AF161701.1. Preferred primers and probes for detection of the comX gene are indicated in Table 2.


Said 18S-28S rRNA ITS region refers to the internal transcribed spacer region that is located in between the 18S and 5.8 S rRNA genes and/or between the 5.8 S and 28S rRNA genes. The ITS regions vary greatly in size and sequence in eukaryotic genomes, including fungi such as Candida spp. and Aspergillus spp. Said sequence preferably comprises the ITS2 region in between the 5.8 S rDNA gene sequence and the 28 S rDNA gene sequence of Aspergillus spp., or the ITS2 region in between the 5.8 S rDNA gene sequence and the 28 S rDNA gene sequence of Candida spp., including C. albicans, C. glabrata and C. krusei. Preferred primers and probes for detection of the 18S-28S rRNA ITS region in the indicated species are indicated in Table 2.


Said 16S rRNA gene of Gram positive and/or Gram negative bacteria is a gene that encodes a 16S ribosomal RNA (or 16S rRNA), which is a component of the 30S small subunit of prokaryotic ribosomes. The 16S rRNA gene is highly conserved between different species of bacteria. 16S rRNA gene sequences contain hypervariable regions that can provide species-specific signature sequences useful for bacterial identification. The Ribosomal Database Project (RDP) provides annotated ribosomal rRNA sequences along with related programs and services and is available at http://rdp.cme.msu.edu. Preferred primers and probes for detection of the Said 16S rRNA gene of Gram positive and/or Gram negative bacteria are indicated in Table 2.


Said mecA gene is a gene that confers resistance to antibiotics such as methicillin, penicillin and other penicillin-like antibiotics. In Staphylococcus species, mecA is spread on a SCCmec genetic element. Carriers of this genetic element are termed methicillin-resistant S. aureus or MRSA. A mecA coding sequence of S. aureus strain 13101 is provided in GenBank accession number JQ582126.1. Preferred primers and probes for detection of the mecA gene are indicated in Table 2.


Said vanA gene is a gene that confers resistance to vancomcin. In Staphylococcus species, vanA is encoded within a Tn1546 transposon located on a plasmid that is carried by vancomcin-resistant isolates. This transposon confers vanA-type vancomycin resistance in enterococci. A partial vanA coding sequence of Enterococcus faecalis strain VRE44 is provided in GenBank accession number JN207933.1. Preferred primers and probes for detection of the vanA gene are indicated in Table 2.


Said ctxM gene is a gene that encodes an extended spectrum □-lactamase. Coding sequence of three ctxM genes from three different E. coli isolates are provided in GenBank accession numbers EU935738, EU935739 and EU935740 (Woodford et al., 2009. Antimicrob Agents Chemother 53: 4472-4482). Preferred ctxM genes are ctxM-1 and ctxM-9 genes. A sequence comprising a ctxM-1 gene is provided in GenBank accession number KJ802720.2. A sequence encoding a ctxM-9 gene is provided in GenBank accession number JN676841.1. Preferred primers and probes for detection of the ctxM-1 and ctxM-9 genes are indicated in Table 2.









TABLE 1







Primers and probes for neonatal multiplex real-time PCR






















Probe
Probe




PCR
PCR



label
label



Species
no
target
Primer 1
Primer 2
Probe
5′
3′





1

Escherichia 

2
16S
CATGCCGCGTGT
CGGGTAACGTC
TATTAACTTTA
Atto425
BHQ1




coli


rDNA
ATGAAGAA
AATGAGCAAA
CTCCCTTCCTC








(SEQ ID
(SEQ ID
CCCGCTGAA








NO: 22)
NO: 23)
(SEQ ID










NO: 24)







2

Pseudomonas

2
phzE
GCCGAGGTCATG
ATCCGCGCCAT
CGACAACCGCA
Yakima
BHQ1




aeruginosa


gene
GAATTC
CATCTTC
AGGAAGCCGA
Yellow







(SEQ ID
(SEQ ID
(SEQ ID








NO: 1)
NO: 2)
NO: 3)







3

Klebsiella

1
rhaA
AACCAGGCGTCG
GTTTACGGCGC
ACAGGAAAGA
Yakima
BHQ1




species


gene
ATAAT
AATCC
CAAGACTATGC
Yellow







(SEQ ID
(SEQ ID
AGACC








NO: 4)
NO: 5)
(SEQ ID










NO: 6)







4

Serratia

2
gyrB
GACCGTGAAGAC
ACGCCGATGTC
CGATCCACCCG
ROX
BHQ2




marcescens


gene
CACTTCCATTAC
GTCTTTCAC
AACGTGTTCTA








(SEQ ID
(SEQ ID
CTTCTC








NO: 15)
NO: 16)
(SEQ ID










NO: 18)







5

Staphylococcus

3
tuf gene
CCAACTCCAGAA
GTTGTCACCAG
ACAGGCCGTGT
Atto425
BHQ1




species



CGTGATTCTG
CTTCAGCGTAGT
TGAACGTGGKC








(SEQ ID
(SEQ ID
AAATCAA








NO: 7)
NO: 11)
(SEQ ID










NO: 14)











CCAACTCCAGAA
GTTATCACCAG









CGTGACTCTG
CTTCAGCGTAAT









(SEQ ID
(SEQ ID









NO: 8)
NO: 12)












CCAACACCAGAA
GTTGTCACCAG









CGTGATTCTG-
CTTCAGCATAGT









(SEQ ID
(SEQ ID









NO: 9)
NO: 13)








6

Staphylococcus

1
SA442
CATCGGAAACAT
TTTGGCTGGAA
AAGCCGTCTTG
Atto425
BHQ1




aureus



TGTGTTCTGTAT
AATATAACTCTC
ATAATCTTTAG








G
GTA
TAGTACCGAAG








(SEQ ID
(SEQ ID
CTGGT








NO: 25)
NO: 26)
(SEQ ID










NO: 27)







7

Enterococcus

1
16S
CGCTTCTTTCCTC
GCCATGCGGCA
CAATTGGAAAG
FAM
BHQ1




faecalis


rDNA
CCGAGT
TAAACTG
AGGAGTGGCG








(SEQ ID
(SEQ ID
GACG








NO: 19)
NO: 20)
(SEQ ID










NO: 21)







8

Streptococcus

1
cfb gene
TTCACCAGCTGT
CCCTGAACATT
CAAGCCCAGCA
ROX
BHQ2




agalactiae



ATTAGAAGTACA
ATCTTTGATATT
AATGGCTCAAA








TGC
TCTCA
AGCT








(SEQ ID
(SEQ ID
(SEQ ID








NO: 28)
NO: 29)
NO: 30)
















TABLE 2







Primers and probes for non-neonatal multiplex real-time PCR






















Probe
Probe




PCR
PCR



label
label



Species
no
target
Primer 1
Primer 2
Probe
5′
3′





 1

Escherichia

2
gadA +
GGCTTCGAAATG
TGGGCAATACC
CTGTTGCTGGAAG
Atto425
BHQ1




coli


gadB
GACTTTGCT
CTGCAGTTT
ACTACAAAGCCTC








(SEQ ID
(SEQ ID
CCTG








NO: 31)
NO: 32)
(SEQ ID










NO: 33)







 2

Acinetobacter

2
23S rDNA
CGCTGTTGTTGG
AACAGTTGCAG
CTTCCTGAGCTGA
HEX
BHQ1




baumannii



TGATGGAACT
CGGCCTG
CGACAGCCGC








(SEQ ID
(SEQ ID
(SEQ ID








NO: 34)
NO: 35)
NO: 36)







 3

Enterococcus

2
hyp. 
GCCAAAGGACCG
GCTTTTCGCTGT
TTCGCAAGCGACA
FAM
BHQ1




faecium


protein 
CTTATTACG
TTTTTTAATGAC
ACAAGCACAAGC







encoding
(SEQ ID
T
(SEQ ID







ORF
NO: 37)
(SEQ ID
NO: 39)









NO: 38)








 4

Staphylococcus

3
hsdM 
AAGGCGGAGGA
TTCGCAATCGA
TTACTGAAAAACA
Atto425
BHQ1




aureus


gene
ATCACATGTC
CCATAATTTTTT
ACGTCAGCA








(SEQ ID
(SEQ ID
(SEQ ID








NO: 40)
NO: 41)
NO: 42)







 5

Enterococcus

3
ncRNA
ATGCGTCTCGTC
GGTACGATGAT
AGTTGCGATGTTT
FAM
BHQ1




faecalis



ACAGTA
TTCATCTGT
CACTGTGAAGCA








(SEQ ID
(SEQ ID
(SEQ ID








NO: 43)
NO: 44)
NO: 45)







 6

Pseudomonas

3
phzE 
GCCGAGGTCATG
ATCCGCGCCAT
CGACAACCGCAAG
HEX
BHQ1




aeruginosa


gene
GAATTC
CATCTTC
GAAGCCGA








(SEQ ID
(SEQ ID
(SEQ ID








NO: 92)
NO: 93)
NO: 94)







 7

Streptococcus

3
comX 
GGTCTCTGGCTA
ATAGTAAACTC
CGCCCTCGAAATC
Cal635
BHQ2




pneumoniae


gene
GATGATTATTAT
CTTAAACACAA
GTTCATTGCTTAA








CTCTT
TGCGTAA
GA








(SEQ ID
(SEQ ID
(SEQ ID








NO: 46)
NO: 47)
NO: 48)







 8

Staphylococcus

4
tuf 
CCAACTCCAGAA
GTTGTCACCAG
ACAGGCCGTGTTG
Atto425
BHQ1




species


gene
CGTGATTCTG
CTTCAGCGTAGT
AACGTGGKCAAAT








(SEQ ID
SEQ ID
CAA








NO: 7)
NO: 11)
(SEQ ID










NO: 14)











CCAACTCCAGAA
GTTATCACCAG









CGTGACTCTG
CTTCAGCGTAAT









(SEQ ID
(SEQ ID









NO: 8)
NO: 12)












CCAACACCAGAA
GTTGTCACCAG









CGTGATTCTG-
CTTCAGCATAGT









(SEQ ID
(SEQ ID









NO: 9)
NO: 13)








 9

Klebsiella

4
rhaA 
AACCAGGCGTCG
GTTTACGGCGC
ACAGGAAAGACA
HEX
BHQ1




species


gene
ATAAT
AATCC
AGACTATGCAGAC








(SEQ ID
(SEQ ID
C








NO: 4)
NO: 5)
(SEQ ID










NO: 6)







10

Enterococcus

4
23S 
TGCGGGGATGAG
CAAACAGTGCT
TAGCCCTAAAGCT
FAM
BHQ1




genus


rDNA
GTGTG
CTACCTCCATCA
ATTTCGGAGAGAA








(SEQ ID
T
CCA








NO: 70
(SEQ ID
(SEQ ID









NO: 71)
No: 72)







11

Candida

4
ITS 
CATGCCTGTTTG
ATATGCTTAAGT
TAAGGCGGGATCG
Cal610
BHQ2




albicans


region
AGCGTCRTTT
TCAGCGGGT
CTTTGACA








(SEQ ID
(SEQ ID
(SEQ ID








NO: 73)
NO: 74)
NO: 75)







12

Candida

1
ITS 
CATGCCTGTTTG
ATATGCTTAAGT
ATCAGTATGTGGG
Cal635
BHQ2




glabrata


region
AGCGTCRTTT
TCAGCGGGT
ACACGAGCG








(SEQ ID
(SEQ ID
(SEQ ID








NO: 61)
No: 62)
NO: 63)







13

Candida 

3
ITS 
CATGCCTGTTTG
ATATGCTTAAGT
ACGACGTGTAAAG
Cal610
BHQ2




krusei


region
AGCGTCRTTT
TCAGCGGGT
AGCGTCGG








(SEQ ID
(SEQ ID
(SEQ ID








NO: 67)
NO: 68)
NO: 69)







14

Pan-

1
ITS 
GCGTCATTGCTG
ATATGCTTAAGT
CCTCGAGCGTATG
Atto425
BHQ1




Aspergillus


region
CCCTCAAGC
TCAGCGGGT
GGGC








(SEQ ID
(SEQ ID
(SEQ ID








NO: 49)
NO: 50)
NO: 51)







15
Gram-
1
16S 
TGGAGCATGTGG
TGCGGGACTTA
TGGTGCATGGTTG
FAM
BHQ1



positive

rDNA
TTTAATTCGA
ACCCAACA
(SEQ ID








(SEQ ID
(SEQ ID
NO: 54)








NO: 52)
NO: 53)








16
Gram-
1
16S 
TGGAGCATGTGG
TGCGGGACTTA
TGCTGCATGGCTG
HEX
BHQ1



negative

rDNA
TTTAATTCGA
ACCCAACA
T








(SEQ ID
(SEQ ID
(SEQ ID








NO: 55)
NO: 56)
NO: 57)







17

pan-Candida

1
ITS 
CATGCCTGTTTG
ATATGCTTAAGT
TCGTATTGCTCAA
Cal610
BHQ2





region
AGCGTCRTTT
TCAGCGGGT
CACCAAACCC








(SEQ ID
(SEQ ID
(SEQ ID








NO: 58)
NO: 59)
NO: 60)







18
MecA
2
mecA 
GATCGCAACGTT
GCTTTGGTCTTT
AATGACGCTATGA
Cal610
BHQ2





gene
CAATTTAATTTT
CTGCATTCCT
TCCCAATCTAACT








(SEQ ID
(SEQ ID
TCCACAT








NO: 64)
NO: 65)
(SEQ ID










NO: 66)







19
VanA
5
vanA 
CGGTTTCACGTC
CAGTTCGGGAA
TCCCCGTATGATG
HEX
BHQ1





gene
ATACAGTCGTT
GTGCAATACC
GCCGCTGC








(SEQ ID
(SEQ ID
(SEQ ID








NO: 76)
NO: 77)
NO: 78)







20
CTXM
5
ctxm-1 
ATGTGCAGYACC
ATCACKCGGRT
CCCGACAGCTGGG
FAM
BHQ1


a


gene
AGTAARGTKATG
CGCCNGGRAT
AGACGAAACGT








GC
(SEQ ID
(SEQ ID








(SEQ ID
NO: 80)
NO: 81)








NO: 79)









20
CTXM
5
ctxm-9 
ATGTGCAGYACC
ATCACKCGGRT
CTGGATCGCACTG
FAM
BHQ1


b


gene
AGTAARGTKATG
CGCCNGGRAT
AACCTACGCTGA








GC
(SEQ ID
(SEQ ID








(SEQ ID
NO: 83)
NO: 84)








NO: 82)









Inhibition of PCR can result in false negative results, and can seriously hamper the identification of specific micro-organisms in a sample. Inhibition can be assessed by using an internal control and primers that are specific for that internal control. If the internal control is not amplified to its normal levels, it can be deduced that the PCR reaction was inhibited.


The gB gene of Phocine herpesvirus 1 (PhHV-1) was used as internal control in multiplex amplification assays, as described in van Doornum et al. 2003 (van Doornum et al. 2003. J Clin Microbiol 41: 576-80). Said internal control is preferably added as virus to a blood sample prior to or during the step of isolating DNA. The amount of an internal control that is added to a real time PCR reaction is preferably such that amplification of the internal control does not influence the pathogen-specific amplification reactions. The amount is preferably such that the resulting Ct value of the internal control is about 37 cycli.


A preferred forward primer for the gB gene comprises the sequence 5′-GGGCGAATCACAGATTGAATC-3′ (SEQ ID NO: 85), a preferred reverse primer comprises the sequence 5′-GCGGTTCCAAACGTACCAA-3′ (SEQ ID NO: 86), and a preferred probe comprises the sequence 5′-TTTTTATGTGTCCGCCACCATCTGGATC-3′ (SEQ ID NO: 87). Said probe is preferably labelled with Atto647N. The amplified fragment using the preferred primers is 89 bp.


Multiplex real-time PCR employs several primer sets and probes in the same reaction tube. The presence of multiple primers may lead to cross hybridization with each other and the possibility of mis-priming with other templates, which is to be avoided. The individual amplification products in a multiplex reaction may differ in size by at least 15 bp to allow sufficient fragment length resolution for size discrimination by gel electrophoresis.


It is preferred to design the internal control (IC) probe for detection of the gB gene of PhHV-1 to emit in the channel with the highest wavelength, as fluorescence is usually lower at higher wavelengths. This ensures that the IC assay will suffer most from any inhibition of the amplification reaction. It is further preferred to place the assay for detection of Staphylococcus species in a separate amplification reaction as the sensitivity of this assay was reduced in multiplexed format.


As an alternative, or in addition, to the internal control, internal amplification controls (IAC) may be used for each multiplex. IAC are constructed such that a forward primer from one reaction and a reverse primer from another reaction will produce an amplified region comprising an artificial sequence. This artificial sequence, or a part thereof, preferably serves as a probe sequence. Said amplified region preferably is greater in length than the amplified regions of the indicated micro-organisms. The reason for this is that the IAC preferably does not impact the pathogen-specific detection amplification reactions. A greater length of the amplified region of the IAC will result in an optimal amplification of the pathogen-specific detection amplification reactions, while amplification of the IAC may be less optimal when more micro-organisms are present in the blood sample that are detected by use of the forward primer and/or the reverse primer.


The amplified region of an IAC is preferably cloned into a vector. It is preferred that said vector comprises an amplified region comprising an artificial sequence that is amplified by at least two different primer pairs. Such IAC may than be used in separate multiplex PCR assays using the same labelled probe. For example, an Escherichia coli reverse primer for the gadAlgadB gene having the sequence 5′-TGGGCAATACCCTGCAGTTT (SEQ ID NO: 32) (See Table 2) may be used together with a A. baumanii forward primer 5′-CGCTGTTGTTGGTGATGGAACT (SEQ ID NO: 34)(See Table 2) to amplify an artificial sequence comprising the nucleotide sequence 5′-TCTGGCGAAAGATTTGGCGGATGTGCATT (SEQ ID NO: 88). A probe comprising the sequence 5′-TCTGGCGAAAGATTTGGCGGATGTGCATT (SEQ ID NO: 88) that is labelled at its 5′ end with Atto647N may be used as a probe for detection of the internal amplification control. It is preferred that 10-1000, preferably 100-200, preferably about 150 copies of an IAC, preferably as a plasmid, are added to a sample prior to a multiplex PCR reaction. An IAC probe is preferably added at 50-500 nM, more preferred at about 200 nM, per PCR reaction.


If required, a specific blocker oligonucleotide might be added to an amplification reaction that prevents hybridization of a primer to a specific conflicting target sequence, for example a target sequence on a related micro-organism. The blocker oligonucleotide does not prevent the hybridization of the primer to the specific target DNA molecule or the internal amplification control. A blocker oligonucleotide is preferably used when there is a highly taxonomically related species that preferably should not function as a target DNA molecule or when a specific sequence negatively influence the amplification of a specific target DNA molecule.


A preferred blocker oligonucleotide comprises one or more modifications that prevent its use as an amplification primer. For example, the 3′-end of a blocker oligonucleotide may be phosphorylated, thereby preventing DNA elongation. Other modifications, including but not limited to the incorporation of modified nucleotides, such as LNAs, or an increased size as compared to the primer and/or probe, are possible, DNA elongation from the blocking oligonucleotide is hampered or prevented, and hybridization of the primer to a specific conflicting target sequence is prevented. This will result in a normal exponential amplification of the specific target DNA molecule.


The indicated sepsis tests may be performed as individual single template PCR assays, also termed monoplex assays. Most real-time PCR platforms are able to detect fluorescence at at least 6 different emission wavelength windows (channels). Therefore, it is preferred to combine a maximum of 6 single template PCR reactions in one multiplex PCR assay. This will reduce the amounts of reagents including the amount of target nucleic acid template and preparation time, compared to individual single template PCR reactions.


Each multiplex PCR assay preferably includes at least one internal control, preferably the gB gene of PhHV-1 as is indicated herein above. Further control reactions include at least one negative control, internal amplification controls and quantitative controls, as defined herein, which are preferably run in separate multiplex PCR assays that are preferably set up and run in parallel to the pathogen detecting multiplex PCR assays using the same batches of primers, probes, enzymes and buffer systems.


It is additionally preferred to design probes detecting the most prevalent bacteria (E. coli, S. aureus, Staphylococcus spp.) to emit in the lowest wavelength channels. This positions them in separate multiplex PCR assays.


Typical reaction conditions for use on a LightCycler 48011 instrument included 12.5 μl of 2× LightCycler 480 Probes Master mix (Roche Diagnostics, Almere, The Netherlands), 2.5 μl primers and probe(s) and 10 μl DNA input, resulting in a final reaction volume of 25 μl. It is additionally preferred to use primers at a concentration between 100 and 1200 nM, preferably between 300 nM to 900 nM, more preferred about 900 nM, and to use probes at a concentration between 100 and 500 nM, preferably between 150 nM and 200 nM, since this was found to result in high fluorescence.


The LightCycler Master mix may be replaced by the 2× QuantiFast Multiplex PCR Master Mix (Qiagen, Venlo, The Netherlands) to reduce background signals. Routine cycling conditions were 10 min at 95° C. followed by 45 cycles of 95° C. for 15 sec and 60° C. for 1 min


As is known to a person skilled in the art, color compensation may be applied to correct for fluorescent bleed-through.


5.4 Primers and Probes

The invention additional provides at least one forward or reverse primer or probe as defined herein, preferably wherein at least one of said at least one forward or reverse primer or probe comprises a detectable label, preferably a fluorescent label. The forward or reverse primer or probe as defined herein are preferably used for detection of at least one microorganism as is described herein, preferably in a method for detecting sepsis according to the present invention.


Said at least one forward or reverse primer or probe preferably comprises a set of primers, comprising a forward and reverse primer that can be used to amplify a region on a target DNA molecule. The set of primers preferably further includes a probe, preferably a fluorescently labelled probe, that recognizes the amplified region on the target DNA molecule.


It is preferred that the probe is labeled, preferably at the 5′ end, with a fluorescent label, preferably selected from Atto425, YakimaYellow, ROX, Cal610, Cal635, FAM, TET, HEX, Cy5, Cy5.5, Cy3, Cy3.5, Cy7, Alexa dyes Tamra, ROX, JOE, FITC, and TRITC.


The invention further provides a kit of parts adapted for performing a method of the invention, said kit comprising at least one forward or reverse primer or probe as defined herein, preferably wherein at least one of said at least one forward or reverse primer or probe comprises a detectable label, preferably a fluorescent label.


A preferred kit comprises a forward and reverse primer that can be used to amplify a region on a target DNA molecule. The kit preferably further includes a probe, preferably a fluorescently labelled probe, that recognizes the amplified region on the target DNA molecule.


A preferred kit comprises at least primers and probe for amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, preferably wherein a forward primer comprises the sequence 5′-GCCGAGGTCATGGAATTC-3′ (SEQ ID NO: 92), a reverse primer comprises the sequence 5′-ATCCGCGCCATCATCTTC-3′ (SEQ ID NO: 93), and a probe comprises the sequence 5′-CGACAACCGCAAGGAAGCCGA-3′ (SEQ ID NO: 94).


A preferred kit comprises at least primers and probe for amplification of the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., preferably wherein a forward primer comprises the sequence 5′-AACCAGGCGTCGATAAT-3′ (SEQ ID NO: 4), a reverse primer comprises the sequence 5′-GTTTACGGCGCAATCC-3′ (SEQ ID NO: 5), and a probe comprises the sequence 5′-ACAGGAAAGACAAGACTATGCAGACC-3′ (SEQ ID NO: 6).


A further preferred kit, especially for determining sepsis in neonatals, comprises at least primers and probe for amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, primers and probe for amplification of the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., and primers and probe for detection of at least one microorganism selected from the group consisting of Enterococcus faecalis, Escherichia coli, Staphylococcus spp. Streptococcus agalactiae, Serratia marcescens and Staphylococcus aureus.


A preferred neonatal sepsis kit preferably includes instructions for setting up three multiplex amplification reactions, wherein a first amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus aureus, Enterococcus faecalis, Klebsiella spp., and Streptococcus agalactiae; a second amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Escherichia coli, Pseudomonas aeruginosa, and Serratia marcescens; and wherein a third amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus spp.


A further preferred kit, especially for determining sepsis in non-neonatals, preferably adults, comprises at least primers and probe for amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, primers and probe for amplification of the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., and primers and probe for detection of at least one microorganism selected from the group consisting of Enterococcus faecalis, Escherichia coli, Staphylococcus spp., Staphylococcus aureus, and primers and probe for detection of at least one microorganism selected from the group consisting of Acinetobacter baumannii, Enterococcus faecium, Streptococcus pneumoniae, Enterococcus spp., Candida spp., Candida albicans, Candida glabrata, Candida krusei, Aspergillus spp, Gram positive bacteria, Gram negative bacteria, or a gene or gene product selected from mecA, vanA, and ctxM.


A preferred non-neonatal sepsis detection kit preferably comprises primers and probe for amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, for amplification of the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., for detection of Enterococcus faecalis, Escherichia coli, Staphylococcus spp., Staphylococcus aureus, Acinetobacter baumannii, Enterococcus faecium, Streptococcus pneumoniae, Enterococcus spp., Candida spp., Candida albicans, Candida glabrata, Candida krusei, Aspergillus spp, Gram positive bacteria, Gram negative bacteria, and mecA, vanA, and ctxM.


Said preferred non-neonatal sepsis detection kit includes instructions for setting up five multiplex amplification reactions, wherein a first amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Aspergillus spp, Gram positive bacteria, Gram negative bacteria, Candida spp. and Candida glabrata; a second amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Escherichia coli, Enterococcus faecium, Acinetobacter baumannii, and the mecA gene; a third amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus aureus, Enterococcus faecalis, Pseudomonas aeruginosa, Candida krusei, and Streptococcus pneumoniae; a fourth amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus spp., Enterococcus spp., Klebsiella spp. and Candida albicans, and a fifth amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of vanA and ctxM.


Control reactions, preferably including at least one negative control, an internal control and internal amplification controls are preferably included in a preferred neonatal and/or non-neonatal sepsis detection kit.


5.5 Treatment

The methods and kits for diagnosing sepsis in mammals are preferably succeeded by prompt and effective treatment of the active infection, which is essential to the successful treatment of severe sepsis and septic shock. Intravenous antibiotic therapy should be initiated as soon as possible, preferably within the first hours after obtaining results from a sepsis test according to this invention, since early initiation of antibiotic therapy is associated with lower mortality. The choice of antibiotics can be complex and should consider the patient's history, for example whether the patient recent received antibiotics, comorbidities, and clinical context (for example, community- or hospital-acquired).


It is an aspect of this invention to provide products and methods for determining the presence of microbial contaminants in blood (i.e. microbial blood infections), preferably in a near-patient situation, whereby the results of the methods for determining said presence are preferably available within 4 hrs, preferably within 3 hrs, more preferably within 2 hrs, even more preferably within 1 hr from the moment that a blood sample from a patient is provided. Such a near-patient test represents a system for assisting a physician to assign to a human patient an appropriate antimicrobial therapy.


This will reduce the occurrence of inadequate antimicrobial treatment, i.e. infections that are not being effectively treated. The emergence of antibiotic-resistant bacteria is for an important part due to inadequate antimicrobial treatment, which is itself due, in part, to the use of broad specterum antibiotics


In order to reduce the risk of inadequate antimicrobial treatment, it is preferred that a system according to the present invention is used, wherein said system comprises means for performing a method for determining the presence of microbial contaminants in blood as described herein above. In highly preferred embodiments, the method comprises the step of performing on a blood sample from a subject suspected of suffering from a microbial contaminant in blood, or on a sample of nucleic acids isolated therefrom, a nucleic acid amplification reaction, wherein said nucleic acid amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of at least the following targets:

    • Gram-positive bacteria,
    • Gram-negative bacteria,
    • at least one genus of fungi, and
    • at least one antibiotic resistance gene, preferably of a multidrug-resistant microorganism.


The terms “Gram-positive” and “Gram-negative” bacteria as used in this aspect of the invention, and, unless otherwise indicated, also in other aspects of this invention, should be understood herein as referring to a class of bacteria that do or do not, respectively, retain the crystal violet stain used in the Gram staining method of bacterial differentiation. The two different bacterial classes can be detected individually using the class-specific PCR detection methods as described herein.


The term “fungi” as used in this aspect of the invention, and, unless otherwise indicated, also in other aspects of this invention, should be understood herein as referring to a group of eukaryotic organisms that includes yeasts, molds and mushrooms. These organisms are classified as a kingdom, Fungi. The at least one genus of fungi can be detected at any suitable taxonomic level higher than the individual species level, including the level of multiple species of said genus using genus-level PCR detection methods. Preferably, a method of the invention comprises the detection of at least one genus of fungi. Alternatively, 2, 3, 4, or more genera of fungi may be detected. The term genus is meant to refer to multiple microbial species of a single taxonomic genus, such as 2, 3, 4, 5, 6, or more species belonging to a single genus, including all species of a genus. Since genus-level detection is sometimes hampered by the absence of common primer-binding sequences in the target amplification region in some species of a genus, primers and probes for genus level detection may generally include ambiguous bases to facilitate hybridization to species having a number of divergent bases in the primer and/or probe target sequence. A set of amplification primers and detection probe(s) for genus-level detection specifically amplifies the target sequence from at least 2, preferably 3, 4, 5 or more, preferably all, species of said genus. Genus-level detection, including detection of multiple species of a single genus (indicated herein by the term “<genus name> spp.”), or even multiple-genera, such as family level detection, the contents of which should be understood as being incorporated in the term genus-level detection, is advantageous in that only a single PCR amplification reaction needs to be performed the establish the presence or absence of a large number of microorganisms simultaneously. Thus, this system of genus detection in methods of this invention is very suitable also for detection of certain genera of bacterial blood contaminant as indicated herein. In order to determine the presence, or absence, of a multitude of species as part of the genus-level detection format described herein, preferably at least those microbial species that are known blood contaminants or sepsis-causing organisms are included in the genus-specific detection format. Preferred embodiments of a method of the invention as described herein for detection of at least one fungal genus comprise the genus-level detection of Candida spp. or Aspergillus spp., preferably Candida spp. and Aspergillus spp. using the genus-level PCR detection methods as described herein. In preferred embodiments, genus level is genus-specific.


The term “antibiotic resistance gene”, refers to a gene that confers antibiotic resistance to a micro-organism. The gene may encode an enzyme which degrades or excretes an antibiotic, or that prevents antibiotics from entering the cell, thereby conferring resistance. Preferably the antibiotic resistance gene is a gene from a multidrug-resistant microorganism.


The detection system for detecting microbial blood infections of this invention in preferred embodiments outlined above has the advantage of having very broad species-coverage, while still providing information on the taxonomic identity of the contaminant that is useful for immediate commencement of antimicrobial therapy, without having to resort to a broad-spectrum antibiotic. Preferably, in aspects of the invention, the method for determining the presence of microbial contaminants in blood therefore further comprises the provision of listing of a number of candidate antimicrobials, not being broad-spectrum antibiotics, that may stop the propagation of the microbial contaminant that is detected in the blood.


In preferred embodiments of a method of detecting microbial infections in blood, the method further comprises the detection of a number of species-specific microbial detection tests including Pseudomonas aeruginosa, Klebsiella species, Escherichia coli, Acinetobacter baumannii, Enterococcus faecalis, Enterococcus faecium, Staphylococcus species, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus agalactiae, Serratia marcescens, Candida albicans, Candida glabrata, and Candida krusei, as described herein above. Very suitable, the species-specific detection in methods of this invention includes the specific detection of some 5, 7, 10, 12, 15, or 20 species of micro-organisms, including, preferably, known microbial blood contaminants, preferably including known sepsis-causing microorganisms. It is an advantage of the present invention of including a detection of microbial species at a higher-taxonomic level of detection as provided by the Gram-positive, Gram-negative, and Fungal genus detection, that the failure to detect a specific species of a micro-organisms does not result in a negative test. The microbial contaminant in the patient's blood may still be detected at a higher taxonomic level of identification as indicated above, thereby preventing false negative results. At the same time, even though no specific species identification of the microbial contaminant could be made in the case the contaminant is not covered by the species-specific sets of primers provided, the result of the test performed in accordance with a method of this invention still allows the commencement of an appropriate antimicrobial therapy, without having to use broad-spectrum antibiotics.


Hence, it is an aspect of the invention to provide a method of treating a subject suffering from microbial blood contaminants, wherein said method, in addition to the microbial detection methods as outlined above, comprises the administration of an antibiotic to a subject in need thereof, said antibiotic preferably not being a broad-spectrum antibiotic. The term “broad spectrum antibiotic”, as used herein, refers to an antimicrobial agent that is effective against both gram-positive and gram-negative bacteria.


Aspects of the methods of the present invention wherein treatment is performed following the specific detection formats as outlined herein include embodiments wherein the treatment is started within 4 hrs, preferably within 3 hrs, still more preferably within 2 hrs after blood retreival.


In contrast to methods of the prior art wherein species-specific detection formats are taught for diagnosis of sepsis, and wherein the aim is to determine the exact taxonomic position of the microbial blood contaminant in order to then determine the most suitable antimicrobial treatment scheme, it is an aim and advantage of the methods of this invention that the exact taxonomic position of the microorganism does not need to be precisely determined, but that an effective antimicrobial treatment strategy, not including the use of broad spectrum antibiotics but comprising the administration of one or more selected narrow-spectrum antimicrobials, can be ascertained from the test results within a very short timespan and with a high level of certainty. The narrow-spectrum antibiotic is active against a selected group of microbial types or groups including, for instance, Gram-negative bacteria, Gram-positive bacteria, fungi, or multi-resistant bacterial strains.


The invention further provides a method of treating a subject suffering or suspected of suffering from sepsis, the method comprising determining an amount of amplified nucleic acid with a method according to the invention and treating said subject with a specific antibiotic if one or more of Pseudomonas aeruginosa, Klebsiella species, Escherichia coli, Acinetobacter baumannii, Enterococcus faecalis, Enterococcus faecium, Staphylococcus species, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus agalactiae, Serratia marcescens, Candida albicans, Candida glabrata, Candida krusei, Pan-Aspergillus, pan-Candida, Gram-positive bacteria, Gram-negative bacteria, MecA, VanA, and/or CTXM, is detected.


If Pseudomonas aeruginosa is found to be a cause of sepsis with a method of the invention, treatment preferably includes a beta-lactam/beta-lactamase inhibitor such as imipenem for a neonatal subject. A non-neonatal subject is preferably treated with a cephalosporin such as ceftazidime and/or with an extended-spectrum beta-lactam antibiotic of the ureidopenicillin class such as, for example, piperacillin. Said extended-spectrum beta-lactam antibiotic is preferably combined with a beta-lactamase inhibitor, preferably tazobactam.


If Klebsiella spp. is found to be a cause of sepsis with a method of the invention, treatment preferably includes a beta-lactam/beta-lactamase inhibitor such as imipenem for a neonatal subject. A non-neonatal subject is preferably treated with a cephalosporin such as ceftriaxon.


A neonatal subject is preferably treated with imipenem if said subject is suffering from sepsis that is caused by E. coli, Acinetobacter baumanii, and/or Serratia marcescens, as determined with a method of the invention.


A neonatal subject is preferably treated with a narrow spectrum beta-lactam antibiotic such as flucloxacillin if said subject is suffering from sepsis that is caused by S. aureus, as determined with a method of the invention; with a moderate-spectrum, beta-lactam antibiotic such as amoxicillin if said subject is suffering from sepsis that is caused by Enterococcus faecalis, as determined with a method of the invention; with a glycopeptide antibiotic such as vancomycin if said subject is suffering from sepsis that is caused by Staphylococcus spp. or by E. faecium, as determined with a method of the invention; with a lipopeptidic antifungal drug such as caspofungin if said subject is suffering from sepsis that is caused by Candida species; with a glycopeptide antibiotic such as vancomycin if said subject is suffering from sepsis that is caused by E. faecium, as determined with a method of the invention; with a beta-lactam antibiotic such as penicillin if said subject is suffering from sepsis that is caused by Streptococcus agalactiae or S. pneumonia, as determined with a method of the invention;


A non-neonatal subject, preferably an adult, is preferably treated with a narrow spectrum beta-lactam antibiotic such as flucloxacillin if said subject is suffering from sepsis that is caused by S. aureus, as determined with a method of the invention; with a cephalosporin such as ceftriaxon if said subject is suffering from sepsis that is caused by E. coli; with a moderate-spectrum, beta-lactam antibiotic such as amoxicillin if said subject is suffering from sepsis that is caused by Enterococcus faecalis, as determined with a method of the invention; with a cephalosporin such as ceftazidime if said subject is suffering from sepsis that is caused by A. baumanii, as determined with a method of the invention; with a glycopeptide antibiotic such as vancomycin if said subject is suffering from sepsis that is caused by E. faecium, as determined with a method of the invention; with a semisynthetic echinocandin such as anidulafungin if said subject is suffering from sepsis that is caused by Candida species, as determined with a method of the invention; with a broad-spectrum quinoline such as ciprofloxacin or with a combination of antifolate substances such as trimethoprim/sulfamethoxazole (co-trimoxazole) if said subject is suffering from sepsis that is caused by Serratia marcescens, as determined with a method of the invention; with a glycopeptide antibiotic such as vancomycin if said subject is suffering from sepsis that is caused by Staphylococcus spp., as determined with a method of the invention; with a beta-lactam antibiotic such as penicillin if said subject is suffering from sepsis that is caused by Streptococcus agalactiae or S. pneumonia, as determined with a method of the invention.


Therefore, the invention also provides a method of treating a subject suffering or suspected of suffering from sepsis, the method comprising determining an amount of amplified nucleic acid with a method for detecting sepsis according to the invention, and providing an antimicrobial compound, preferably an antimicrobial compound as is indicated herein above, if the if said subject is suffering from sepsis that is caused by one of the specified microorganisms.


The methods of the invention provide a fast diagnostic tool for monitoring the course of sepsis. Said methods are very well suited to monitor the course of anti-sepsis treatment by taking blood samples from a patient at different time points, for example every 4 hours, every 8 hours, every 12 hours or, preferably every 24 hours after start of a treatment with an antibiotic, and quantitatively determining the amount of one or more of the indicated micro-organisms in the sample. A decrease in the amount of said one or more of the indicated micro-organisms over time, for example within 2-6 days, preferably within 2-4 days, is indicative of a successful treatment resulting in clearance of the infection. No decrease in the amount of said one or more of the indicated micro-organisms over time is indicative of a persistent infection. The finding of a persistent infection is an indication that treatment may be altered, for example by addition of a second antibiotic, or by selection of another antibiotic.


Systemic inflammatory response syndrome (SIRS) is clinical syndrome that resembles sepsis. However, SIRS is not associated with an infection but complicates a noninfectious insult such as acute pancreatitis or pulmonary contusion. It is thought that dysregulation of the inflammatory response, including an uncontrolled release of pro-inflammatory mediators, initiates a chain of events that lead to widespread tissue injury. This response can lead to multiple organ dysfunction syndrome (MODS), which is the cause of high mortality associated with both sepsis and SIRS.


The invention provides a method for differentiating between patients suffering from sepsis and patients suffering from systemic inflammatory response syndrome (SIRS), said method comprising performing a method according to the invention. The identification of a microorganism selected from Pseudomonas aeruginosa, Klebsiella spp., Enterococcus faecalis, Escherichia coli, Staphylococcus spp., Staphylococcus aureus, Acinetobacter baumannii, Enterococcus faecium, Streptococcus pneumoniae, Enterococcus spp., Streptococcus agalactiae, Serratia marcescens, Candida spp., Candida albicans, Candida glabrata, Candida krusei, Aspergillus spp, Gram positive bacteria, or Gram negative bacteria indicates that the patient is suffering from sepsis.


EXAMPLES
Example 1
Materials and Methods
Bacterial Strains

A panel of 38 bacterial and 3 fungal species that are either known to cause neonatal sepsis or are regular contaminants of blood culture was selected (Table 3). Strains were obtained from the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen and Zellkulturen (DSMZ), Center for Disease Control (CDC) and the culture collections of the microbiology laboratories of the VU University Medical Center (Amsterdam, The Netherlands), University Medical Center Utrecht (Utrecht, The Netherlands) and Radboud University Nijmegen Medical Centre (Nijmegen, The Netherlands). Clinical strains were identified using standard phenotypic and genotypic laboratory procedures, 16S rDNA sequencing (Nijmegen), Phoenix Automated Microbiology System (Utrecht) and MALDI111 TOF VitekMS (bioMérieux) or amplified fragment length polymorphism (AFLP) (Amsterdam).


DNA Isolation from Pure Cultures and Blood


To obtain microbial DNA from pure cultures, microorganisms from fresh plate cultures were suspended into tryptic soy culture broth (enriched with 10% horse serum and 6 pgram/ml nicotinamide adenine dinucleotide) and grown at 37° C. to an optical density (OD) of 0.5 McFarland or directly suspended in phosphate-buffered saline (PBS) to an OD of 0.5 McFarland. Cells were collected from 200 μl of the 0.5 McFarland suspension after centrifugation (10 min at 14,000×g) and subsequently lysed by incubation for 10 minutes at 95° C. whilst shaking (800 rpm) in 200 μl of bacterial lysis buffer (BLB) (Biocartis, Mechelen, Belgium). After addition of 20 μl neutralization buffer (Biocartis, Mechelen, Belgium), microbial DNA was extracted with the QIAamp DNA mini kit (Qiagen, Venlo, The Netherlands). DNA quantity is given as colony forming unit equivalents (cfu eq), e.g. 10 cfu eq represents DNA isolated from 10 cfu. Measurement of OD and bacterial plate counts were used to determine cfu.


For isolation of microbial DNA from blood, 200 μl of EDTA anticoagulated-blood was treated twice with 1 ml of TTE (1% Triton X-100, 20 mM Tris-HCl pH 8.3 and 1 mM EDTA) to lyse erythrocytes and remove hemoglobin as described (Peters et al. 2007. J Clin Microbiol 45: 3641-6). The resulting bacterial pellet was lysed with BLB as described earlier. Subsequently, DNA was purified with the NucliSENSEasyMAG device (bioMérieux, Zaltbommel, The Netherlands) using protocol “Specific A” in an elution volume of 110 μl. The manufacturer's instructions were followed except that 1 ml AL buffer (Qiagen, Venlo, The Netherlands) plus 1 ml easyMAG Lysis buffer (bioMérieux, Zaltbommel, The Netherlands) were used instead of 2 ml easyMAG Lysis buffer during DNA binding to the beads. The AL buffer was spiked with Phocine Herpesvirus 1 (PhHV-1) as extraction and amplification control (internal control) (van Doornum et al. 2003. J Clin Microbiol 41: 576-80). Successful bacterial lysis and subsequent DNA extraction was verified with a broad-range or pathogen-specific PCR.


Primer and Probe Design

A literature search was conducted to identify species- and genus-specific real-time PCR assays. These assays were re-evaluated for coverage and specificity in silico using the amplicons as queries in BLAST searches in the nucleotide collection (nr/nt) and whole genome shotgun (wgs) databases at NCBI. PCRs were discarded when homologies at the probe sequence or at the 3′ end of the primer sequences were >90% in a non-target organism. Acceptable PCRs were then tested for coverage of all available sequences of the target organism. New PCR targets were selected using MultiMPrimer3 (http://bioinfo.ut.ee/multimprimer3/) or from alignments of gene sequences retrieved from GenBank (Koressaar et al., 2009. Bioinformatics 25: 1349-55). Sequences with adequate in silico coverage and specificity were used for primer and probe design for real-time PCR assays using Primer Express Software 3.0 (Life Technologies, Bleiswijk, The Netherlands).


Real-Time PCR Assay

All PCR reactions were performed on a LightCycler 48011 (Roche Diagnostics, Almere, The Netherlands). Reaction mixtures contained 12.5 μl of 2× LightCycler 480 Probes Master (Roche Diagnostics, Almere, The Netherlands), 2.5 μl primers and probe(s) and 10 μl DNA input, resulting in a final reaction volume of 25 μl. The optimal primer and probe concentrations were found to range between 300 nM to 900 nM for the primers and 150 and 200 nM for the probes. For the E. coli specific assay the LightCycler Master mix was replaced by the 2× QuantiFast Multiplex PCR Master Mix (Qiagen, Venlo, The Netherlands) since this mix resulted in lower background signals [unpublished data].


Cycling conditions were as follows: 10 min at 95° C. followed by 45 cycles of 95° C. for 15 sec and 60° C. for 1 min. Results were analyzed with the LightCycler Software version 1.5.0. For the multiplex assays, color compensation was applied to each analysis as described in the LightCycler Operator Manual to correct for fluorescent bleed-through. Each experiment included a no-template control (NTC) (PCR grade water) and a positive control (1000 cfu eq of DNA) for control of contamination and amplification. The primer sets and dual labeled hydrolysis probes were 165 obtained from Isogen (De Meern, The Netherlands) and Macrogen (Amsterdam, The Netherlands).


Analytical Performance Characteristics of the Monoplex Assays

The analytical specificity of the monoplex assays was verified using genomic DNA from a panel of bacteria and fungi obtained from pure cultures (Table 3) at a concentration of approximately 1000 cfu eq per reaction for bacteria and 10000 cfu eq for fungi. A total of 15 strains of each target species or genus were used to evaluate the coverage of the assays. The limit of detection (LOD) was determined by testing serial dilutions (10000, 1000, 100, 50, 10, 1 cfu eq/reaction) of purified genomic DNA from two isolates, each performed in duplicate (i.e. 4 reactions per concentration). The LOD was defined as the lowest concentration that was detected in all four reactions. For E. coli a sample was regarded positive when the Cq value (quantification cycle) of the sample was at least two values lower than that of the NTC. The analytical performance of the assays was further explored by calculating the efficiency and linearity (R2179) from these dilution series with the LightCycler software.


To evaluate the performance of the assays for blood-derived bacterial DNA, bacteria were spiked in 200 μl EDTA anticoagulated-blood from healthy adult volunteers such that 1000, 100, 10 and 1 cfu eq per PCR could be evaluated (this equals 50000, 5000, 500 and 50 cfu/ml blood). Results


183 were compared to DNA isolated from bacteria suspended in PBS for 1000 and 100 cfu eq per PCR.


Analytical Performance Characteristics of the Multiplex Assay

The sensitivity of the assays in multiplex and monoplex format was compared using serial dilutions of genomic DNA from pure cultures (1000, 100, 50, 10, 5, 1 cfu eq/reaction) performed in triplicate (fivefold at 1 cfu eq/reaction). Pooled blood samples (200 μl EDTA anticoagulated-blood) from 10 healthy adult volunteers were subjected to the multiplex PCR assay to test for aspecific amplification signals.


Performance of the Multiplex Assay on Clinical Samples

Whole blood samples (200 μl collected aseptically in EDTA-tubes) obtained together with blood culture from 20 subsequent episodes of suspected LOS in preterm infants admitted to the NICU of our hospital were tested with the multiplex assay. Results were compared to blood culture. Approval was obtained from the local medical ethics committee and written informed consent was obtained from the parents or legal guardians of the neonates.









TABLE 3





List of bacterial strains used to evaluate the specificity of the PCR assays


















Sepsis pathogens





Acinetobacter spp.

Clinical straina




Acinetobacter baumannii

ATCC 19606




Bacteroides fragilis

ATCC 25282




Bacillus cereus

ATCC 11145




Candida albicans

ATCC 90028




Candida glabrata

ATCC 15545




Candida parapsilosis

ATCC 22019




Citrobacter freundii

ATCC 8090




Eikenella corrodens

DSM 8340




Enterobacter aerogenes

ATCC 13048




Enterobacter cloacae

ATCC 13047




Enterobacter asburiae

Clinical strainb




Enterococcus faecalis

ATCC 29212




Enterococcus faecium

CDC NY2




Escherichia coli

ATCC 11775




Escherichia coli

ATCC 25922




Gardnerella vaginalis

ATCC 14018




Haemophilus influenzae

ATCC 49247




Klebsiella pneumoniae

ATCC 13883




Klebsiella oxytoca

ATCC 13182




Listeria monocytogenes

ATCC 15313




Morganella morganii

Clinical straina




Moraxella catarrhalis

Clinical straina




Neisseria meningitidis

Clinical straina




Pseudomonas aeruginosa

ATCC 27853




Pseudomonas aeruginosa

ATCC 10145




Serratia marcescens

ATCC 13880




Serratia marcescens

DSM 12481




Staphylococcus aureus

ATCC 12600




Staphylococcus aureus

ATCC 25923




Staphylococcus epidermidis

ATCC 14990




Stenotrophomonas maltophilia

ATCC 13637




Streptococcus agalactiae

DSM 2134




Streptococcus pneumoniae

ATCC 49619




Streptococcus pyogenes

ATCC 19615




Streptococcus oralis

DSM 206267




Streptococcus parasanguinis

DSM 6778



Contaminants of blood culture



and skin microbiota




Clostridium bifermentans

DSM 14994




Corynebacterium xerosis

ATCC 373




Lactobacillus acidophilus

DSM 20079




Propionibacterium acnes

DSM 16379




Veillonella parvula

DSM 2008



Additional strains used to



evaluate the Streptococcus




agalactiae PCR





Abiotrofia defectiva

Clinical strainb




Lactococcus lactis

DSM 20481




Streptococcus dysgalactiae

Clinical strainc




Streptococcus bovis

Clinical strainc




Streptococcus salivarius

Clinical strainc



Additional strains used to



evaluate the E. coli, Klebsiella



spp., P. aeruginosa, S. marcescens



PCR




Cronobacter spp.

Clinical straina




Proteus mirabilis

DSM 4479




Pseudomonas fluorescens

ATCC 13525




Pseudomonas putida

ATCC 12633




Salmonella enterica

ATCC13076




Shigella flexneri

ATCC 12022




Yersinia enterocolitica

ATCC 23715



Additional strains used to



evaluate the Serratia




marcescens




PCR




Serratia odorifera

DSM 4582




Streptococcus salivarius

Clinical strainc



Additional strains used to



evaluate the E. coli, Klebsiella



spp., P. aeruginosa, S. marcescens



PCR




Serratia odorifera

DSM 4582








aSpecies identification with standard laboratory methods and confirmed with MALDI- TOF VitekMS.





bKindly provided by dr. A. C. Fluit from the Department of Medical Microbiology, University Medical Center Utrecht. Identification of species was performed as described.(Paauw et al. 2008. PLoS One.3: e3018).





cKindly provided by Prof. Peter W. M. Hermans, Radboud University Nijmegen Medical Centre. Identification of species was performed by 16S rDNA sequencing.







Results
Design of the Pathogen Specific Assays

The most prevalent bacterial pathogens causing LOS in VLBW neonates admitted to the NICU were selected for inclusion in the multiplex assay (Table 4), designated the NeoSep-ID. Based on epidemiological data this selection covers almost 90% of sepsis cases caused by bacterial infections (Stoll et al. 1996. J Pediat 129: 63-7; Stoll et al. 2002. Pediatrics 110: 285-291; van den Hoogen et al. 2010. Neonatology. 97: 22-8; Hornik et al. 2012. Early Hum Dev. 88 Suppl 2: S69-74).


Available real-time PCR assays reported in the literature were used for species-specific detection of Enterococcus faecalis, Staphylococcus aureus and Escherichia coli because re-evaluation in silico of these assays yielded high coverage and specificity (Huijsdens et al. 2002. J Clin Microbiol. 40: 4423-7; Santo Domingo et al. 2003. Biotechnol Lett 25: 261-5; Peters et al. 2007. J Clin Microbiol 45: 3641-6). Searches with the Sa442 sequence (Martineau et al. 1998. J Clin Microbiol 36: 618-23) which has been extensively used for detection of S. aureus yielded only a few strains that would remain undetected due to sequence divergence (Klaassen et al. 2003. J Clin Microbiol 41: 4493). Since more than 350 strains showed perfect matches for primers and probe we decided to use the SA442 target for detection. Re-evaluation of the assay used for detection of E. coli revealed a 100% match with Shigella spp. Shigella spp. is rarely encountered in neonatal sepsis and therefore not likely to cause misidentification.









TABLE 4







Design of the NeoSep-ID multiplex PCR assay










Dye
Reaction 1
Reaction 2
Reaction 3





ATTO 425

Staphylococcus


Escherichia


Staphylococcus





aureus


coli

spp.


Fam

Enterococcus





faecalis



Yakima Yellow

Klebsiella spp.


Pseudomonas






aeruginosa



ROX

Streptococcus


Serratia





agalactiae


marcescens



ATTO 647N
Internal control



(PhHV)









A genus specific PCR to identify staphylococci at the genus level based on a previously published assay was adjusted to detect the most important species (S. epidermidis, S. hominis, S. haemolyticus, S. saprophyticus, S. capitis) (Rood et al. 2011. Transfusion 51: 2006-11). Samples positive with the genus PCR and negative for S. aureus specific testing were considered positive for coagulase negative staphylococci (CoNS). For Streptococcus agalactiae the highly specific cfb gene was selected and primers and probes were modified to suit our PCR protocol (Ke et al. 2000. Clin Chem 46: 324-31).


MultiMprimer3 was employed to identify novel targets for Pseudomonas aeruginosa and Klebsiella spp. (using genome sequences of K. pneumoniae and K. oxytoca) as no existing PCR assay with adequate in silico performance was available from literature. MultiMPrimer3 searches for multi-copy species-specific PCR targets by genome comparisons among assembled sequenced genomes. Since insufficient numbers of sequenced and assembled genomes were available for Serratia marcescens to use the MultiMPrimer3 tool, we designed specific primers and probes based on multiple alignments of gyrB sequences deposited in GenBank.


Selected targets with their primer and probe sequences are presented in Table 5.









TABLE 5







Oligonucleotides used in this study.
















Ampli-







con




Primer/

Target
size



Species
Probe
Sequence
sequence
(bp)
Reference






Enterococcus

Forward 
5′-CGCTTCTTTCCTCCCGAGT-3′
16S
143
(Santo



faecalis

primer
(SEQ ID NO: 89)
rRNA

Domingo et



Reverse 
5′-GCCATGCGGCATAAACTG-3′


al. (2003).



primer
(SEQ ID NO: 90)


Biotechnol



Probe
5′-CAATTGGAAAGAGGAGTGGCGGACG-3′


Lett. 25:




(SEQ ID NO: 91)


261-5)






Escherichia 

Forward 
5′-CATGCCGCGTGTATGAAGAA-3′
16S
 96
(Huijsdens 



coli

primer
(SEQ ID NO: 22)


et al.



Reverse 
5′-CGGGTAACGTCAATGAGCAAA-3′


 (2002).



primer
(SEQ ID NO: 23)


J Clin



Probe
5′-


Microbiol.




TATTAACTTTACTCCCTTCCTCCCCGCTGAA-


40: 4423-7)




3′ (SEQ ID NO: 24)









Klebsiella 

Forward 
5′-AACCAGGCGTCGATAAT-3′
rhaArhaD
107/




spp.

primer
(SEQ ID NO: 4)
operon
108




Reverse 
5′-GTTTACGGCGCAATCC-3′






primer
(SEQ ID NO: 5)






Probe
5′-ACAGGAAAGACAAGACTATGCAGACC-3′







(SEQ ID NO: 6)









Pseudomonas

Forward 
5′-GCCGAGGTCATGGAATTC-3′
phzE 
 89




aeruginosa

primer
(SEQ ID NO: 92)
gene





Reverse 
5′-ATCCGCGCCATCATCTTC-3′






primer
(SEQ ID NO: 93)






Probe
CGACAACCGCAAGGAAGCCGA-3′







(SEQ ID NO: 94)









Serratia

Forward 
5′-GACCGTGAAGACCACTTCCATTAC-3′
gyrB 
125




marcescens

primer
(SEQ ID NO: 15)
gene





Reverse 
5′-ACGCCGATGTCGTCTTTCAC-3′






primer
(SEQ ID NO: 16)






Probe
5′-CGATCCACCCGAACGTGTTCTACTTCTC-







3′ (SEQ ID NO: 18)









Staphylococcus

Forward 
5′-CCAACTCCAGAACGTGATTCTG-3′
tuf 
222
Adjusted


spp.
primers
(SEQ ID NO: 7)
gene

from Rood et




5′-CCAACTCCAGAACGTGACTCTG-3′


al. 2011.




(SEQ ID NO: 8)


Transfusion5




5′-CCAACACCAGAACGTGATTCTG-3′


1: 2006-11




(SEQ ID NO: 9)






Reverse 
5′-GTTGTCACCAGCTTCAGCGTAGT-3′






primers
(SEQ ID NO: 11)







5′-GTTATCACCAGCTTCAGCGTAAT-3′







(SEQ ID NO: 12)







5′-GTTGTCACCAGCTTCAGCATAGT-3′







(SEQ ID NO: 13)






Probe
5′-







ACAGGCCGTGTTGAACGTGGKCAAATCAA-







3′ (SEQ ID NO: 14)









Staphylococcus

Forward 
5′-CATCGGAAACATTGTGTTCTGTATG-3′
Sa442
 94
Peters et 



aureus

primer
(SEQ ID NO: 95)


al. (2007). 



Reverse 
5′-


J Clin




TTTGGCTGGAAAATATAACTCTCGTA-3′


Microbiol.



primer
(SEQ ID NO: 96)


45: 3641-6



Probe
5′-







AAGCCGTCTTGATAATCTTTAGTAGTACCGA







AGCTGGT-3′ (SEQ ID NO: 97)









Streptococcus

Forward 
5′-TTCACCAGCTGTATTAGAAGTACATGC-
cfb 
150
Adjusted



agalactiae

primer
3′
gene

from Ke et 




(SEQ ID NO: 28)


al. (2000).



Reverse 
5′-CCCTGAACATTATCTTTGATATTTCTCA-


Clin




3′


Chem. 46:



primer
(SEQ ID NO: 29)


324-31.



Probe
5′-CAAGCCCAGCAAATGGCTCAAAAGCT-







3′(SEQ ID NO: 30)








Internal 
Forward 
5′-GGGCGAATCACAGATTGAATC-3′
gB 
 89
van Doornum


Control
primer
(SEQ ID NO: 98)
gene

et all. 


PhHV-1
Reverse 
5′-GCGGTTCCAAACGTACCAA-3′


(2003).



primer
(SEQ ID NO: 99)


J Clin



Probe
5′-TTTTTATGTGTCCGCCACCATCTGGATC-


Microbiol 




3′


41:




(SEQ ID NO: 100)


576-80.









Analytical Performance of the Monoplex Assays

The specificity of the monoplex assays was assessed using a panel of bacteria and fungi that cause neonatal sepsis or that are regular contaminants of blood culture or skin bacteria (Table 3). In addition, phylogenetically related species and species with target sequence similarity observed with BLAST were tested Amplification signals were observed only for the target species except in case of the E. coli specific PCR. In the E. coli assay, amplification signals were observed for Shigella flexneri as anticipated from the in silico analysis. NTC signals were only present in the E. coli specific PCR probably resulting from residual E. coli DNA in the Taq polymerase preparation. This signal was reduced significantly (3 Cq values, which is the fractional cycle number (Cq) that is required to reach a quantification threshold) when using the QuantiFast Multiplex PCR Master Mix while the E. coli specific signal was not negatively affected [data not shown]. The observed Cq values of the NTC ranged from ±36 to undetectable. Hence all monoplex assays were regarded as specific.


Clinical strains, selected on the basis of differences in AFLP typing patterns and thus representing a set of highly divergent strains, were used to determine the coverage of the assays. For each assay 15 tested strains were successfully detected, resulting in 100% coverage. The LOD, the lowest concentration that was detected in all four reactions, ranged between 1 and 10 genome copies per reaction for all assays and linearity was observed in all assays up to 10 cfu eq/reaction (Table 6). The performance of the assays was further verified with bacteria spiked in whole blood at different concentrations.









TABLE 6







Performance characteristics of the monoplex assays.










Analytical sensitivity













LOD in cfu

Analytical
Accuracy













eq/reaction

specificity
Lin-




(median Cq
Coveragea
Cross
earityb
Effi-


Assay
value)
(%)
reactivity
(R2)
ciencyb
















E. faecalis

10 (37.6)
100

0.98
2.02



E. coli

10 (33.5)
100

Shigella

0.99
1.97






flexneri




Klebsiella spp.

10 (36.9)
100

0.98
1.99



P. aeruginosa

10 (36.7)
100

0.99
1.81



S. marcescens

10 (36.2)
100

0.92
2.07



Staphylococcus

10 (40.0)
100

0.98
1.98


spp.



S. aureus

10 (35.9)
100

0.98
2.07



S. agalactiae

 1 (38.1)


0.94
1.78






aCalculated from 15 strains




bMedian calculated from a dilution series of two strains







The observed detection limits were similar to those obtained with DNA obtained from pure cultures. The PCR curves of bacterial DNA isolated from PBS versus blood coincided virtually completely, demonstrating that no significant PCR-inhibiting factors are co-purified in the current procedure (FIG. 1).


Design & Validation of the Multiplex Assay

Since most real-time PCR platforms are able to detect fluorescence at 5 different emission wavelength windows (channels), we combined monoplex PCRs to a maximum of five. The sensitivity of the Staphylococcus genus assay was greatly reduced in any multiplexed format. This assay therefore was placed in a dedicated reaction, resulting in a total of three reactions (Table 4). The internal control (IC) probe, for detection of PhHV-1 DNA, was designed to emit in the channel with the highest wavelength, as fluorescence is usually lower at highest wavelengths. This ensures that the IC assay will suffer most from potential inhibition in the reaction. In the same vein, the probes detecting the most prevalent bacteria (E. coli, S. aureus, CoNS) causing LOS were designed to emit in the lowest wavelength channels. This also positions them in separate reactions (Table 4) reducing the chances that multiple targets will be amplified in a single reaction. In the multiplex assays primers were used at 900 nM and probes at 200 nM since this resulted in highest fluorescence. Color compensation was applied to correct for fluorescent bleed-through.


Comparison of monoplex (FIG. 1) and multiplex assays showed lower fluorescence levels and slightly more variable Cq values for the multiplex assays, but sensitivities were not negatively affected (Table 7). The LODs ranged between 1 and 10 cfu eq/reaction for all multiplex assays (except for E. coli, which was 1 cfu eq/reaction). The presence of specific amplification signals coming from blood (e.g. proteins, human leucocyte DNA) was evaluated using 10 pooled blood samples from healthy volunteers. None of the samples yielded positive PCR signals in the multiplex assay except for the IC signal.


Evaluation of the Multiplex Assay in Clinical Samples

As a proof of principle, EDTA blood samples from 20 subsequent episodes of suspected LOS in preterm neonates were tested in the multiplex assay and compared to blood culture. Nine episodes were positive with both tests (8 CoNS, 1 E. coli), 7 were negative; blood culture was positive in case of 3 CoNS infections where PCR was negative. In one episode blood culture detected CoNS and K. pneumoniae whereas PCR detected CoNS only. The Cq values ranged between 28.6 and 37.1. As such, concordance was 80% between blood culture and PCR, but there was no significant difference in yield between techniques (McNemar test p-value>0.05).









TABLE 7







Comparison between multiplex and monoplex PCR assays.













Assay
50 cfu
10 cfu
5 cfu
1 cfu


Target
format
eq
eq
eq
eq






E. faecalis

Multiplex
+++
+++
+++
+++++



Monoplex
+++
+++
+++
+++++



E. coli

Multiplex
+++
++*
***
*****



Monoplex
+++
+++
***
*****



Klebsiella spp.

Multiplex
+++
+++
+++
+++++



Monoplex
+++
+++
+++
++++−



P. aeruginosa

Multiplex
+++
+++
+++
++−−−



Monoplex
+++
+++
+++
++++−



S. marcescens

Multiplex
+++
+++
+++
++++−



Monoplex
+++
+++
+++
+++++



Staphylococcus

Multiplex
+++
+++
+++
+−−−−



aureus

Monoplex
+++
+++
+++
−−−−−−



S. agalactiae

Multiplex
+++
+++
+++
+−−−−



Monoplex
+++
++−
++−
++−−−









Different amounts of DNA, indicated on the top row in cfu eq/reaction, were tested in monoplex and multiplex assays. The outcome of individual assays is indicated by + (positive PCR signal); − (no PCR signal) or * (difference with negative control <2 Cq values).


Example 2
Materials and Methods

Species and resistance markers to be included were selected based on prevalence in blood cultures of a large group of patients of the AMC Amsterdam, UMC Utrecht and Radboud UMC Nijmegen. A literature search was conducted to identify species- and genus-specific real-time PCR assays. These assays were re-evaluated for coverage and specificity in silico using the amplicons as queries in BLAST searches in the nucleotide collection (mint) and whole 1 genome shotgun (wgs) databases at NCBI. PCRs were discarded when homologies at the probe sequence or at the 3′ end of the primer sequences were >90% in a non-target organism. Acceptable PCRs were then tested for coverage of all available sequences of the target organism. New PCR targets were selected using MultiMPrimer3 (http://bioinfo.ut.ee/multimprimer3/) or from alignments of gene sequences retrieved from GenBank (Koressaar et al. 2009. Bioinformatics 25: 1349-55). Sequences with adequate in silico coverage and specificity were used for primer and probe design for real-time PCR assays using Primer Express 149 Software 3.0 (Life Technologies, Bleiswijk, The Netherlands).


All PCR reactions were performed on a LightCycler 48011 (Roche Diagnostics, Almere, The Netherlands). Reaction mixtures contained 12.5 μl of Sensimixll (Bioline), 2.5 μl primers and probe(s) and 10 μl DNA input, resulting in a final reaction volume of 25 μl. The optimal primer and probe concentrations were determined and found to range between 300 nM to 900 nM for the primers and 150 and 200 nM for the probes. Cycling conditions were as follows: 10 min at 95° C. followed by 45 cycles of 95° C. for 15 sec and 60° C. for 1 min Results were analyzed with the LightCycler Software version 1.5.0. For the multiplex assays, color compensation was applied to each analysis as described in the LightCycler Operator Manual to correct for fluorescent bleed-through. Each experiment included a no-template control (NTC) (PCR grade water) and a positive control (1000 cfu eq of DNA) for control of contamination and amplification.


The sensitivity of the multiplex PCR was evaluated by spiking pathogens in different concentrations in blood. Pathogen DNA was isolated from 5 ml of blood using the Polaris procedure (Loonen et al., 2013. PLoS One 8, e72349) followed by easyMag automated DNA extraction. This DNA was used in multiplex and monoplex PCR formats to assess sensitivity.


Internal amplification controls (IAC) were constructed for each multiplex, such that a forward primer from one reaction and a reverse primer from another reaction will produce an amplicon that contains an artificial sequence serving as a hydrolysis probe sequence.


Results

As an example, results from tests Gram-positive and Gram-negative bacteria are shown in FIG. 2. As is indicated in this figure, a-specific signals obtained upon addition of Gram-negative bacterial DNA to the Gram-positive real time PCR reaction (FIG. 2A), or of Gram-positive bacterial DNA to the Gram-negative real time PCR reaction (FIG. 2B), are always lower than the negative control samples, meaning they will not be unjustly interpreted as positive.


The sensitivity of the multiplex PCR is shown in FIG. 3 and in Table 8. The limit of detection, indicated as the lowest concentration that was detected in a reaction, of most bacteria was found to be about 1 cfu-equivalent per PCR reaction. The limit of detection of Candida spp. was found to be about 10 cfu-equivalent per PCR reaction.









TABLE 8







Sensitivity of multiplex BSI PCR for blood-derived pathogen DNA










Detection limit in
Detection limit in


PCR target
monoplex
multiplex






Escherichia coli

1 cfu/PCR
1 cfu/PCR



Acinetobacter baumannii

1 cfu/PCR
1 cfu/PCR



Enterococcus faecium

1 cfu/PCR
1 cfu/PCR



Staphylococcus aureus

1 cfu/PCR
1 cfu/PCR



Enterococcus faecalis

1 cfu/PCR
1 cfu/PCR



Pseudomonas aeruginosa

1 cfu/PCR
10 cfu/PCR



Streptococcus pneumoniae

1 cfu/PCR
1 cfu/PCR



Staphylococcus species

1 cfu/PCR
10 cfu/PCR



Klebsiella species

1 cfu/PCR
1 cfu/PCR



Enterococcus species

10 cfu/PCR
10 cfu/PCR



Candida albicans

10 cfu/PCR
10 cfu/PCR



Candida glabrata

10 cfu/PCR
10 cfu/PCR



Candida krusei

10 cfu/PCR
10 cfu/PCR



Aspergillus

100 conidia/PCR
100 conidia/PCR









The sensitivity of the pan-Aspergillus PCR was tested by adding DNA obtained from pure Aspergillus cultures to the PCR reactions. Results are shown in FIG. 4. Besides positive detection of Aspergillus candida (FIG. 4A) and Aspergillus terreus (FIG. 4B) also Aspergillus nidulans, Aspergillus fumigatus, Aspergillus flavus, Aspergillus clavatus, and Aspergillus niger were detected using the pan-Aspergillus PCR assay.


Blood Culture Versus Multiplex BSI PCR

Clinical blood samples from critically ill patients admitted to the ICU were used to evaluate the multiplex BSI PCR. PCR results were compared to blood culture results. All PCRs performed in the multiplex format show sensitivities of detection between 1-10 cfu/PCR.


All positive blood cultures were confirmed by PCR (see Table 9). Additionally, 8 E. coli positive PCRs were found that were negative in blood culture. Three of these patients had other cultures (urine, sputum) indicating that these PCR results are not false-positives, and suggesting a higher sensitivity of the PCR, compared to the blood culture.


Given the fact that the time-to-result time for the PCR is only 3 hours, whereas the time-to-result time of the blood culture is at least 24 hours, the PCR test is superior since it would result in much more timely adequate treatment of the patient.













TABLE 9







Blood culture
Concordant
Discrepant



result
PCR result
PCR result










S. aureus 3x


S. aureus 3x






P. aeruginosa


P. aeruginosa






E. cloacae 2x

Gram-neg 2x




Negative 59x
Negative 51x

E. coli 8x











Example 3
Materials and Methods

Approximately 1300 clinical blood samples were taken simultaneously with blood culture samples from critically ill patients admitted to the ICU's of two different academic medical centers (AMC Amsterdam and UMC Utrecht). The samples were tested in the multiplex BSI PCR using the reactions and conditions indicated herein above. All PCR reactions were performed on a LightCycler 48011 (Roche Diagnostics, Almere, The Netherlands). PCR results were compared to standard blood culture results.


Results

About 800 samples were tested negative both by blood culture and by PCR. Other samples were positive in one or both tests. Table 10 shows an overview of the PCR results of samples with positive blood culture. Most pathogens are correctly detected by PCR. Low concordance may be caused by low pathogen loads which could be improved by increasing blood sample volume. Low concordance may also be caused by contamination of the blood culture, which is often the case for coagulase-negative staphylococci (CoNS).









TABLE 10







PCR results of samples with concomitant blood cultures positive for


pathogens included in the multiplex BSI PCR panel.














# of





# of PCR
PCR


BC result
# of BC
positive
negative
concordance















E. coli

5
5
0
100%



S. aureus

11
11
0
100%



E. faecium

21
13
8
62%



E. faecalis

8
6
2
75%



P. aeruginosa

9
9
0
100%



S. pneumoniae

2
2
0
100%



Acinetobacter

1
0
1
0%



Klebsiella

3
2
1
67%


CoNS
62
25
37
40%



C. albicans

9
0
9
0%



C. glabrata

7
1
6
14%



C. krusei

0



Candida spp.

1
1
0
100%



Aspergillus

0


Gram-positive
3
3
0
100%


Gram-negative
10
7
3
70%





BC: blood culture.


CoNS: coagulase-negative staphylococci






Table 11 shows samples with negative blood culture and positive PCR results. Clinical records of the patients were screened for culture results of other clinical samples, i.e. urine, pus, sputum, or blood cultures taken at other time-points. Whenever the PCR result was in accordance with any other culture result, it was scored in the culture+column. Most patients at the ICU will receive antibiotics which could prevent growth of pathogens in blood culture. In contrast, PCR will also detect dead pathogens. Positive PCRs likely reflect true infection, when the detected pathogen is also found in another clinical sample. Thus, PCR may be more sensitive than blood culture to detect infection.









TABLE 11







Positive PCR results of samples with concomitant negative blood cultures.











PCR result
Culture+
Culture−
















E. coli

29
33




S. aureus

28
24




E. faecium

19
13




E. faecalis

9
9




P. aeruginosa

3
36




S. pneumoniae

12
3




Acinetobacter

2
0




Klebsiella

1
2



CoNS
5
12




C. albicans

0
0




C. glabrata

0
0




C. krusei

0
0




Candida spp.

0
0




Aspergillus

5
5



Gram-positive
41
13



Gram-negative
13
6









Claims
  • 1. A method for detecting microbial blood infections comprising the steps of: a) performing on a blood sample from a subject suspected of suffering from microbial blood infections, or on a sample of nucleic acids isolated therefrom, a nucleic acid amplification reaction,b) determining the presence or the amount of amplified nucleic acid produced by said nucleic acid amplification reaction,wherein said nucleic acid amplification reaction comprises the amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., and/or the tuf gene or tuf gene product, or a part thereof, of Staphylococcus spp.
  • 2. The method according to claim 1, wherein the nucleic acid amplification reaction of the phzE gene or phzE gene product, or a part thereof, is a PCR reaction using as a forward primer the sequence 5′-GCCGAGGTCATGGAATTC-3′ (SEQ ID NO: 1), using as a reverse primer the sequence 5′-ATCCGCGCCATCATCTTC-3′ (SEQ ID NO: 2), and using as a probe the sequence 5′-CGACAACCGCAAGGAAGCCGA-3′ (SEQ ID NO: 3); the nucleic acid amplification reaction of the rhaA gene or rhaA gene product, or a part thereof, is a PCR reaction using as a forward primer the sequence 5′-AACCAGGCGTCGATAAT-3′ (SEQ ID NO: 4), using as a reverse primer the sequence 5′-GTTTACGGCGCAATCC-3′ (SEQ ID NO: 5), and using as a probe the sequence 5′-ACAGGAAAGACAAGACTATGCAGACC-3′ (SEQ ID NO: 6); and the nucleic acid amplification reaction of the tuf gene or tuf gene product, or a part thereof, is a PCR reaction using as a forward primer the sequences 5′-CCAACTCCAGAACGTGATTCTG-3′(SEQ ID NO. 7), 5′-CCAACTCCAGAACGTGACTCTG-3′ (SEQ ID NO: 8) and 5′-CCAACACCAGAACGTGATTCTG-3′ (SEQ ID NO. 9), using as reverse primers the sequences 5′-GTTGTCACCAGCTTCAGCGTAGT-3′(SEQ ID NO. 11), 5′-GTTATCACCAGCTTCAGCGTAAT-3′(SEQ ID NO. 12), and 5′-GTTGTCACCAGCTTCAGCATAGT-3′ (SEQ ID NO. 13), and using as a probe the sequence 5′-ACAGGCCGTGTTGAACGTGGKCAAATCAA-3′ (SEQ ID NO. 14).
  • 3. The method of claim 1 or 2, wherein said method further comprises the amplification of a gene or gene product, or a part thereof, of at least one microorganism selected from the group consisting of Enterococcus faecalis, Escherichia coli, and Staphylococcus aureus, as part of the same or a separate nucleic acid amplification reaction,
  • 4. The method of claim 1, wherein said subject is a neonate, and wherein said method further comprises the amplification of a gene or gene product, or a part thereof, of at least one microorganism selected from the group consisting of Streptococcus agalactiae and Serratia marcescens, as part of the same or a separate nucleic acid amplification reaction.
  • 5. The method of claim 4, wherein said method comprises performing 3 separate multiplex PCR assays, wherein a first amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus aureus, Enterococcus faecalis, Klebsiella spp., and Streptococcus agalactiae; wherein a second amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Escherichia coli, Pseudomonas aeruginosa, and Serratia marcescens; andwherein a third amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus spp.
  • 6. The method of claim 1, wherein said subject is an adult, and wherein said method further comprises the amplification of a gene or gene product, or a part thereof, of at least one of the following targets: a microorganism selected from the group consisting of Acinetobacter baumannii, Enterococcus faecium, Streptococcus pneumoniae, Enterococcus spp., Candida albicans, Candida glabrata, Candida krusei, Aspergillus spp, Gram positive bacteria, Gram negative bacteria, Candida spp. or a gene or gene product selected from mecA, vanA, and ctxM, as part of the same or a separate nucleic acid amplification reaction.
  • 7. The method of claim 6, wherein said method comprises performing 5 separate multiplex PCR assays, wherein a first amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Aspergillus spp, Gram positive bacteria, Gram negative bacteria, Candida spp. and Candida glabrata; wherein a second amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Escherichia coli, Enterococcus faecium, Acinetobacter baumannii, and the mecA gene;wherein a third amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus aureus, Enterococcus faecalis, Pseudomonas aeruginosa, Candida krusei, and Streptococcus pneumoniae; wherein a fourth amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of Staphylococcus spp., Enterococcus spp., Klebsiella spp. and Candida albicans, andwherein a fifth amplification reaction comprises the amplification of a gene or gene product, or a part thereof, of vanA, and ctxM.
  • 8. The method of claim 7, wherein said gene of Escherichia coli is the gadA and/or gadB gene and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GGCTTCGAAATGGACTTTGCT-3′ (SEQ ID NO: 31), using as reverse primer the sequence 5′-TGGGCAATACCCTGCAGTTT-3′ (SEQ ID NO. 32), and using as a probe the sequence 5′-CTGTTGCTGGAAGACTACAAAGCCTCCCTG-3′ (SEQ ID NO. 33).
  • 9. The method of claim 6, wherein said gene of Enterococcus faecium is the ref12A gene, and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-ATGCGTCTCGTCACAGTA-3′ (SEQ ID NO: 43), using as reverse primer the sequence 5′-GGTACGATGATTTCATCTGT-3′ (SEQ ID NO: 44), and using as a probe the sequence 5′-AGTTGCGATGTTTCACTGTGAAGCA-3′ (SEQ ID NO: 45).
  • 10. The method of claim 6, wherein said gene of Streptococcus pneumoniae is the comX gene and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GGTCTCTGGCTAGATGATTATTATCTCTT-3′ (SEQ ID NO: 46), using as reverse primer the sequence 5′-ATAGTAAACTCCTTAAACACAATGCGTAA-3′ (SEQ ID NO: 47), and using as a probe the sequence 5′-CGCCCTCGAAATCGTTCATTGCTTAAGA-3′ (SEQ ID NO: 48).
  • 11. The method of claim 6, wherein said gene of Aspergillus spp is the 18S-28S rRNA ITS region and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GCGTCATTGCTGCCCTCAAGC-3′ (SEQ ID NO: 49), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 50), and using as a probe the sequence 5′-CCTCGAGCGTATGGGGC-3′ (SEQ ID NO: 51); and/orwherein said gene of Gram positive bacteria is the 16S rDNA gene and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-TGGAGCATGTGGTTTAATTCGA-3′ (SEQ ID NO: 52), using as reverse primer the sequence 5′-TGCGGGACTTAACCCAACA-3′ (SEQ ID NO: 53), and using as a probe the sequence 5′-TGGTGCATGGTTG-3′ (SEQ ID NO: 54); and/orwherein said gene of Gram negative bacteria is the 16S rDNA gene and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-TGGAGCATGTGGTTTAATTCGA-3′ (SEQ ID NO: 55), using as reverse primer the sequence 5′-TGCGGGACTTAACCCAACA-3′ (SEQ ID NO: 56), and using as a probe the sequence 5′-TGCTGCATGGCTGT-3′ (SEQ ID NO: 57); and/orwherein said gene of Candida spp. is the 18S-28S rRNA ITS region and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCTGTTTGAGCGTCRTTT-3′ (SEQ ID NO: 58), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 59), and using as a probe the sequence 5′-TCGTATTGCTCAACACCAAACCC-3′(SEQ ID NO: 60); and/orwherein said gene of Candida glabrata is the 18S-28S rRNA ITS region and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCTGTTTGAGCGTCRTTT-3′ (SEQ ID NO: 61), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 62), and using as a probe the sequence 5′-ATCAGTATGTGGGACACGAGCG-3′ (SEQ ID NO: 63); and/orwherein said gene is the mecA gene or a part thereof, and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-GATCGCAACGTTCAATTTAATTTT-3′ (SEQ ID NO: 64), using as reverse primer the sequence 5′-GCTTTGGTCTTTCTGCATTCCT-3′ (SEQ ID NO: 65), and using as a probe the sequence 5′-AATGACGCTATGATCCCAATCTAACTTCCACAT-3′ (SEQ ID NO: 66); and/orwherein said gene of Candida krusei is the 18S-28S rRNA ITS region and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCTGTTTGAGCGTCRTTT-3′ (SEQ ID NO: 67), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 68), and using as a probe the sequence 5′-ACGACGTGTAAAGAGCGTCGG-3′ (SEQ ID NO: 69); and/orwherein said gene of Enterococcus spp. is the 23S rDNA gene and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-TGCGGGGATGAGGTGTG-3′ (SEQ ID NO: 70), using as reverse primer the sequence 5′-CAAACAGTGCTCTACCTCCATCAT-3′ (SEQ ID NO: 71), and using as a probe the sequence 5′-TAGCCCTAAAGCTATTTCGGAGAGAACCA-3′ (SEQ ID NO: 72); and/orwherein said gene of Candida albicans is the 18S-28S rRNA ITS region and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CATGCCTGTTTGAGCGTCRTTT-3′ (SEQ ID NO: 73), using as reverse primer the sequence 5′-ATATGCTTAAGTTCAGCGGGT-3′ (SEQ ID NO: 74), and using as a probe the sequence 5′-TAAGGCGGGATCGCTTTGACA-3′ (SEQ ID NO: 75); and/orwherein said gene is the vanA gene or a part thereof, and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-CGGTTTCACGTCATACAGTCGTT-3′ (SEQ ID NO: 76), using as reverse primer the sequence 5′-CAGTTCGGGAAGTGCAATACC-3′ (SEQ ID NO: 77), and using as a probe the sequence 5′-TCCCCGTATGATGGCCGCTGC-3′ (SEQ ID NO: 78); and/orwherein said gene is the ctxM-1 gene or a part thereof, and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-ATGTGCAGYACCAGTAARGTKATGGC-3′ (SEQ ID NO: 79), using as reverse primer the sequence 5′-ATCACKCGGRTCGCCNGGRAT-3′ (SEQ ID NO: 80), and using as a probe the sequence 5′-CCCGACAGCTGGGAGACGAAACGT-3′ (SEQ ID NO: 81); and/orwherein said gene is the ctxM-9 gene or a part thereof, and wherein said nucleic acid amplification reaction is a real-time PCR reaction using as a forward primer the sequence 5′-ATGTGCAGYACCAGTAARGTKATGGC-3′ (SEQ ID NO: 82), using as reverse primer the sequence 5′-ATCACKCGGRTCGCCNGGRAT-3′ (SEQ ID NO: 83), and using as a probe the sequence 5′-CTGGATCGCACTGAACCTACGCTGA-3′ (SEQ ID NO: 84).
  • 12. A kit of parts adapted for performing the method of claim 1, said kit comprising at least one forward or reverse primer or probe for the amplification of the phzE gene or phzE gene product, or a part thereof, of Pseudomonas aeruginosa, the rhaA gene or rhaA gene product, or a part thereof, of Klebsiella spp., and/or the tuf gene or tuf gene product, or a part thereof, of Staphylococcus spp wherein at least one of said at least one forward or reverse primer or probe comprises a detectable label.
  • 13. At least ono A forward or reverse primer or probe of claim 2 wherein at least one of said forward or reverse primer or probe comprises a detectable label.
  • 14. A method for monitoring sepsis or for determining the efficacy of an anti-sepsis treatment, said method comprising performing a method according to claim 1 on at least two samples, wherein said samples are obtained at different time points in the course of the sepsis or at different time points in the course of an anti-sepsis treatment.
  • 15. A method of treating a subject suffering or suspected of suffering from sepsis, the method comprising determining an amount of amplified nucleic acid with a method according to claim 1, and treating said subject with a specific antibiotic if one or more of Pseudomonas aeruginosa, Klebsiella species, Escherichia coli, Acinetobacter baumannii, Enterococcus faecalis, Enterococcus faecium, Staphylococcus species, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus agalactiae, Serratia marcescens, Candida albicans, Candida glabrata, Candida krusei, pan-Aspergillus, pan-Candida, Gram-positive bacteria, Gram-negative bacteria, MecA, VanA, and/or CTXM, is detected.
Priority Claims (1)
Number Date Country Kind
2013266 Jul 2014 NL national
PCT Information
Filing Document Filing Date Country Kind
PCT/NL2015/050548 7/25/2015 WO 00