Patent Application
20130302272
The present invention relates to therapeutic agents for diseases associated with skeletal muscle degeneration, especially therapeutic agents for muscular dystrophy. The therapeutic agents for diseases associated with skeletal muscle degeneration of the present invention comprise a granulocyte colony-stimulating factor (G-CSF) as an active ingredient.
Muscular dystrophy collectively refers to inheritable diseases characterized by main symptoms such as progressive muscle weakness and muscular atrophy caused by degeneration and necrosis of myofibers and currently classified by their mode of inheritance and clinical features into ten or more types including Duchenne, Becker, limb-girdle, congenital, distal, facioscapulohumeral, myotonic, etc. Among them, Duchenne patients are the most common, and previous studies have been focused on Duchenne type.
Duchenne muscular dystrophy (DMD) is inherited in an X-linked recessive pattern and predominately affects males. It is said to affect one in 3,500 male newborns. The patients show symptoms of muscle weakness during childhood, and once the disease develops, muscular atrophy proceeds relentlessly. Muscle tissue is gradually replaced by fat and fibrous tissue, and the patients lose the ability to walk at around 10 years of age, and die of progressive weakness, respiratory failure or heart failure at around 20 years of age on average.
It has been shown that DMD is caused by abnormality (deletion or mutation or the like) of the dystrophin gene located in the short arm of the X chromosome (Xp21) (non-patent document 1). The Dystrophin protein (Mw 427 kD), that is the gene product of the dystrophin gene, is localized just beneath the plasma membrane of myocytes and functions to maintain the cytoskeleton of myocytes by binding intracellularly to actin among proteins of which myofibrils are composed and also binding to laminin in the extracellular matrix through the dystrophin-associated glycoprotein complex at the plasma membrane (non-patent document 2). In DMD patients, no dystrophin exists in the myocyte membrane because normal dystrophin is not produced due to abnormality in the dystrophin gene. It is thought that this may be why myocytes cannot retain their shape and are more susceptible to necrosis by injury during contraction or the like.
At present, any effective therapy for DMD has not been found yet, and importance is placed on rehabilitation for retarding the progression of symptoms or respiratory management using mechanical ventilators or the like. Drug therapy includes corticosteroids (steroids), but they have strong side effects and have not produced sufficient therapeutic effect. Experimental therapies such as regenerative therapy (transplantation of stem cells and myoblasts) (non-patent document 3), gene therapy (functional dystrophin gene transfer, antisense morpholino-mediated skipping of mutated exons) (non-patent document 4), new drug therapy (read-through of nonsense mutations) (non-patent document 5) and the like have been tried, but have not been practically applied. Moreover, any immunosuppressants have not actually shown reliable effect except for glucocorticoids, which in turn have not been explained about their muscle strengthening mechanism and which should be further studied to verify their effects.
Thus, a drug acting suppressively on myofiber disruption in muscular dystrophy would be expected to be effective for treating or retarding the progression of muscular dystrophy.
The present invention aims to provide a therapeutic agent for a disease associated with skeletal muscle degeneration comprising a G-CSF, especially a therapeutic agent for muscular dystrophy. Specifically, it aims to elucidate the effect of G-CSF on injured muscles and the underlying mechanism and further to determine the route and frequency of administration and dose of G-CSF suitable for use as a therapeutic agent for muscular dystrophy, thereby providing a therapeutic agent that can be used practically for treating muscular dystrophy.
We studied the effect of G-CSF on degenerated muscles and the underlying mechanism. As a result, we found that muscle degeneration occurs at postnatal week 3-5 and the G-CSF receptor (G-CSFR) is expressed specifically in regenerated muscles at this stage in mdx mice known as one of DMD model mice and that significant muscle regeneration was observed when G-CSF was administered. Further, not only significant muscle regeneration but also long-term survival up to 200 days was observed when G-CSF was administered to mdx/utrn−/− mice known as DMD model mice showing severe symptoms similar to human DMD. The present invention was accomplished on the basis of these findings.
Accordingly, the present invention provides the following.
[1] A therapeutic agent for a disease associated with skeletal muscle degeneration comprising a granulocyte colony-stimulating factor (G-CSF) as an active ingredient.
[2] The therapeutic agent of [1] wherein the disease associated with skeletal muscle degeneration is muscular dystrophy.
[3] The therapeutic agent of [2] wherein the disease associated with skeletal muscle degeneration is Duchenne muscular dystrophy.
The therapeutic agents for diseases associated with skeletal muscle degeneration of the present invention were shown to be especially effective as therapeutic agents for muscular dystrophy and to act suppressively on myofiber disruption in muscular dystrophy. They can be expected to be used for treating muscular dystrophy that is an intractable disease for which no efficacious therapy has been available so far.
a. A comparison of the gross appearances of wild-type mice (WT) and mdx mice (mdx) known as muscular dystrophy model mice is shown. Unlike human DMD, no physical abnormality is observed in mdx mice.
b. Images of ME stained sections of tibialis anterior (TA) muscles from mdx mice at 2-20 weeks of age are shown. Centrally nucleated cells (regenerated muscles) increase at 4-5 weeks of age, showing that muscles are repeatedly injured and regenerated at this stage.
c. The total number of myocytes in TA muscle sections from mdx mice is shown. It is observed that the total number of the cells decreases at 2-4 weeks of age and then recovers.
d. The proportion of centrally nucleated myocytes to the total number of myocytes in mdx mice is shown.
e. Images of TA muscle sections from mdx mice fluorescently stained with an anti-G-CSFR antibody, an anti-laminin-2α antibody and DAPI, respectively, and an image formed by superimposing these images (MERGE) are shown. It is observed that G-CSFR is expressed specifically in cells having nuclei stained with DAPI (regenerating muscles).
a. A schedule of G-CSF administration to mdx mice is shown. G-CSF is administered at the stage during which muscles are acutely injured and regenerated (at 3-5 weeks of age).
b. Images of TA muscle sections from mdx mice at 5 weeks of age fluorescently stained with an anti-laminin-2α antibody are shown (the lower panels show enlarged images of the upper panels). Laminin-2α is a protein found in the basement membrane of myofibers so that the size of each myofiber can be observed by staining with an anti-laminin-2α antibody.
c. The proportion of centrally nucleated myofibers (regenerated myofibers) in TA muscles of mdx mice at 5 weeks of age is shown (left bar: control group, right bar: G-CSF-treated group). In the G-CSF-treated group, muscle regeneration was significantly promoted.
d. Immunostainings with RNMy2/9D2, laminin and DAPI at 4 weeks of age are shown (upper panel: control group, lower panel: G-CSF-treated group).
e. The proportion of regenerating myocytes is shown as the proportion of RNMy2/9D2-positive cells in TA muscles at 4 weeks of age (left bar: control group, right bar: G-CSF-treated group).
f. The distribution of the cross sectional areas of myofibers in TA muscles of mdx mice at 5 weeks of age is shown (left bars: control group, right bars: G-CSF-treated group). The proportion of small myofibers (regenerated myofibers) significantly increased in the G-CSF-treated group.
g. The perimeters of TA muscles of mdx mice at 5 weeks of age are shown (left bar: control group, right bar: G-CSF-treated group). A significant increase was observed in the G-CSF-treated group.
h. The results of an exercise tolerance test in mdx mice at 5 weeks of age (the distribution of the number of individuals vs. tolerance time) are shown (left bars: control group, right bars: G-CSF-treated group). Improvements in tolerance were observed in the G-CSF-treated group.
i., j. The results of measurements of tetanic force (i) and specific force (j) in extensor digitorum longus muscles of mdx mice at 5 weeks of age are shown (left bars: control group, right bars: G-CSF-treated group).
a. The survival curves of csf3r+/− mice, mdx mice, and mdx/csf3r+/− are shown. In mdx/csf3r+/− mice, a biphasic death response was observed immediately after birth and at postnatal week 3-5 (the stage during which muscles are acutely degenerated and regenerated).
b., c. The photographs (b) and body weights (c) of csf3r+/− mice, mdx mice, and mdx/csf3r+/− mice at postnatal day 2 are shown. As compared with mdx mice, mdx/csf3r+/− had significantly lower body weights.
d. Images of diaphragms of csf3r+/− mice, mdx mice, and mdx/csf3r+/− mice at postnatal day 2 stained with Evans blue are shown. In mdx/csf3r+/− mice, necrosis and degeneration of diaphragms were observed.
e. Images of diaphragms of csf3r+/− mice, mdx mice, and mdx/csf3r+/− mice at postnatal day 2 stained with hematoxylin and eosin (H&E stained) are shown. In mdx/csf3r+/− mice, necrosis and degeneration of diaphragms were observed.
f. The thicknesses of diaphragms of csf3r+/− mice, mdx mice, and mdx/csf3r+/− mice are shown.
g. The body weight curves of csf3r+/− mice and mdx/csf3r+/− mice are shown.
a. The gross appearances of mdx mice, mdx/csf3r+/− mice and mdx/csf3r−/− mice at postnatal day 7, and the gross appearances of mdx/csf3r+/− mice and mdx/csf3r−/− mice at postnatal day 13 are shown.
b. H&E stainings of TA muscles of mdx/csf3r ice at 2-8 weeks of age are shown (lower panels: low magnification; upper panels: high magnification).
c. The number of regenerated myocytes is shown as the number of centrally nucleated myocytes in TA muscles of mdx mice and mdx/csf3r+/− mice at 5 weeks of age.
d. The perimeters of TA muscles of mdx mice and mdx/csf3r+/− mice at 5 weeks of age are shown.
e. The tetanic forces determined ex vivo in TA muscles of mdx mice and mdx/csf3r mice at 5 weeks of age are shown.
f. The specific forces determined ex vivo in TA muscles of mdx mice and mdx/csf3r+/− mice at 5 weeks of age are shown.
a. The gross appearances of mdx mice (mdx) and dystrophin/utrophin double knockout (mdx/utrn−/−) mice are shown. As compared with mdx mice, mdx/utrn−/− mice show a significantly smaller body size and a considerably curved spine.
b. Images of H&E stained TA muscle sections from mdx/utrn−/− mice at 3-12 weeks of age are shown. More acute muscle injury and regeneration are observed as compared with mdx mice (
c. The total number of myocytes in TA muscle sections from mdx/utrn−/− mice is shown.
d. The proportion of centrally nucleated cells in TA muscles of mdx/utrn−/− mice is shown.
e. Images of TA muscle sections from mdx/utrn−/− mice fluorescently stained with an anti-G-CSFR antibody, an anti-laminin-2α antibody and DAPI, respectively, and an image formed by superimposing these images (MERGE), and an enlarged image of the latter image are shown. More remarkable expression of G-CSFR in regenerating muscles is observed as compared with mdx mice (
a. A schedule of G-CSF administration to mdx/utrn−/− mice is shown. G-CSF is administered at the stage during which muscles are acutely injured and regenerated (at 3-5 weeks of age).
b. H&E stainings of TA muscle sections from mdx/utrn−/− mice are shown (left panel: control group, right panel: G-CSF-treated group).
c. The perimeters of TA muscles of mdx/utrn−/− mice are shown (left bar: control group, right bar: G-CSF-treated group).
d. The ratio of muscle wet weight to body weight of mdx/utrn−/− mice is shown (TA: tibialis anterior muscle, Gas: gastrocnemius muscle, Quad: quadriceps muscle) (left bars: control group, right bars: G-CSF-treated group). In the G-CSF-treated group, a significant increase in gastrocnemius muscles and quadriceps muscles was found.
e. The number of regenerated myocytes is shown as the number of centrally nucleated myocytes in TA muscles of mdx/utrn−/− mice (left bar: control group, right bar: G-CSF-treated group).
f. The number of myofibers in TA muscles of mdx/utrn−/− mice is shown (left bar: control group, right bar: G-CSF-treated group).
g. The distribution of the cross sectional areas of myofibers in TA muscles of mdx/utrn−/− mice is shown (left bars: control group, right bars: G-CSF-treated group).
h. The tetanic forces determined ex vivo in TA muscles of mdx/utrn−/− mice are shown (left bar: control group, right bar: G-CSF-treated group).
i. The specific forces determined ex vivo in TA muscles of mdx/utrn−/− mice are shown (left bar: control group, right bar: G-CSF-treated group).
j. The Kaplan-Meyer survival curves of mdx/utrn−/− mice when G-CSF was administrated or not are shown.
k. The tidal volumes per body weight at 8 weeks of age are shown (left bar: control group, right bar: G-CSF-treated group).
Skeletal muscles are composed of long thin cells called myofibers and connective tissue filling the gaps between the cells to hold them together. The myofibers are each one cell called myocyte. The myocyte is a multinuclear cell having multiple nuclei. An assembly of myofibers forms a muscle bundle, and an assembly of muscle bundles forms a skeletal muscle.
As used herein, the treatment of a disease associated with skeletal muscle degeneration refers to any of inhibiting degeneration of muscles and promoting their regeneration; inhibiting the progression of muscle weakness; inhibiting myofiber disruption; increasing the ratio of regenerated myofibers; increasing muscles; or enhancing the muscle's ability to move.
The disease associated with skeletal muscle degeneration is not specifically limited, but typically muscular dystrophy including Duchenne, Becker, limb-girdle, congenital, distal, facioscapulohumeral and myotonic types. The therapeutic agents of the present invention are especially useful for Duchenne muscular dystrophy (DMD).
The therapeutic agents for diseases associated with skeletal muscle degeneration of the present invention comprise a granulocyte colony-stimulating factor (G-CSF) as an active ingredient.
The G-CSF used as an active ingredient of the therapeutic agents for diseases associated with skeletal muscle degeneration of the present invention can be any G-CSF, but preferably a highly purified G-CSF, more specifically having biological activities substantially identical to those of mammalian G-CSFs, especially human G-CSF. The source from which the G-CSF is derived is not specifically limited, and naturally derived or genetically engineered G-CSFs or the like can be used, preferably genetically engineered G-CSFs. The genetically engineered G-CSFs may have an amino acid sequence identical to those of naturally derived G-CSFs or may have a variant of such an amino acid sequence in which one or more amino acids are modified by deletion, substitution, addition or the like while retaining similar biological activities to those of naturally derived G-CSFs. The amino acid deletion, substitution, addition or the like can be made by a method known to those skilled in the art. For example, a polypeptide functionally comparable to a G-CSF can be prepared by those skilled in the art by introducing an amino acid variation into the G-CSF as appropriate using site-directed mutagenesis (Gotoh, T. et al. (1995) Gene 152, 271-275; Zoller, M. J. and Smith, M. (1983) Methods Enzymol. 100, 468-500; Kramer, W. et al.
(1984) Nucleic Acids Res. 12, 9441-9456; Kramer, W. and Fritz, H. J. (1987) Methods Enzymol. 154, 350-367; Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. USA. 82, 488-492; Kunkel (1988) Methods Enzymol. 85, 2763-2766) or the like. Amino acid variations may also occur in nature. Generally, an amino acid residue is preferably substituted by another amino acid whose side chain has a conserved property. For example, amino acids are classified by the properties of their side chains into hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino acids having aliphatic side chains (G, A, V, L, I, P), amino acids having hydroxyl-containing side chains (S, T, Y), amino acids having sulfur-containing side chains (C, M), amino acids having carboxylate- and amide-containing side chains (D, N, E, Q), amino acids having base-containing side chains (R, K, H), and amino acids having aromatic-containing side chains (H, F, Y, W) (examples are shown by one-letter amino acid codes in each set of parentheses). It has already been known that polypeptides having a variant of an amino acid sequence in which one or more amino acid residues are deleted, added and/or substituted by another amino acid retain their biological activities (Mark, D. F. et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666; Zoller, M. J. & Smith, M. Nucleic Acids Research (1982) 10, 6487-6500; Wang, A. et al., Science 224, 1431-1433; Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413).
Fusion proteins of a G-CSF with another protein can also be used. To create a fusion protein, the DNA encoding a G-CSF can be linked in-frame with the DNA encoding another protein and inserted into an expression vector and then expressed in a host, for example. The another protein to be fused with a G-CSF of the present invention is not specifically limited.
Chemically modified G-CSFs can also be used. Examples of chemically modified G-CSFs include, for example, G-CSFs manipulated to change the conformation of or add or remove a carbohydrate chain, G-CSFs conjugated to polyethylene glycol, vitamin B12 or a compound such as an inorganic or organic compound and the like.
The G-CSFs that can be used in the present invention may be those prepared by any process and include, for example, G-CSFs extracted and isolated/purified by various methods from cultures of a cell line of a human tumor cell or a human G-CSF-producing hybridoma or G-CSFs produced by genetic engineering techniques in E. coli, yeast, Chinese Hamster Ovary cells (CHO cells), C127 cells, COS cells, myeloma cells, BHK cells, insect cells or the like and extracted and isolated/purified by various methods. The G-CSFs used in the present invention are preferably G-CSFs prepared by genetic engineering techniques, preferably G-CSFs prepared by using mammalian cells (especially CHO cells) (e.g., see JPB H-1-44200, JPB H-2-5395, JPA S-62-129298, JPA S-62-132899, JPA S-62-236488, and JPA S-64-85098).
The therapeutic agents for diseases associated with skeletal muscle degeneration of the present invention can optionally contain suspending agents, solubilizers, stabilizers, isotonizing agents, preservatives, adsorption inhibitors, surfactants, diluents, excipients, pH modifiers, soothing agents, buffers, sulfur-containing reducing agents, antioxidants and the like as appropriate depending on the mode of administration or dosage form.
Examples of suspending agents include methylcellulose, Polysorbate 80, Polysorbate 20, hydroxyethylcellulose, gum acacia, gum tragacanth powder, sodium carboxymethylcellulose, polyoxyethylene sorbitan monolaurate, etc.
Solubilizers include polyoxyethylene hardened castor oil, Polysorbate 80, Polysorbate 20, nicotinic acid amide, macrogols, castor oil fatty acid ethyl esters, etc.
Stabilizers include dextran 40, methylcellulose, gelatin, sodium sulfite, sodium metasulfite, etc.
Isotonizing agents include e.g., D-mannitol, sorbitol, etc.
Preservatives include e.g., methyl paraoxybenzoate, ethyl paraoxybenzoate, sorbic acid, phenol, cresol, chlorocresol, etc.
Adsorption inhibitors include e.g., human serum albumin, lecithin, dextran, ethylene oxide/propylene oxide copolymers, hydroxypropyl cellulose, methylcellulose, polyoxyethylene hardened castor oil, polyethylene glycol, etc.
Typical examples of surfactants include:
nonionic surfactants, e.g., sorbitan fatty acid esters such as sorbitan monocaprylate, sorbitan monolaurate and sorbitan monopalmitate; glycerin fatty acid esters such as glycerin monocaprylate, glycerin monomyristate and glycerin monostearate; polyglycerin fatty acid esters such as decaglyceryl monostearate, decaglyceryl distearate and decaglyceryl monolinoleate; polyoxyethylene sorbitan fatty acid esters such as polyoxyethylene sorbitan monolaurate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monostearate, polyoxyethylene sorbitan monopalmitate, polyoxyethylene sorbitan trioleate and polyoxyethylene sorbitan tristearate; polyoxyethylene sorbitol fatty acid esters such as polyoxyethylene sorbitol tetrastearate and polyoxyethylene sorbitol tetraoleate; polyoxyethylene glycerin fatty acid esters such as polyoxyethylene glyceryl monostearate; polyethylene glycol fatty acid esters such as polyethylene glycol distearate; polyoxyethylene alkyl ethers such as polyoxyethylene lauryl ether; polyoxyethylene polyoxypropylene alkyl ethers such as polyoxyethylene polyoxypropylene glycol ether, polyoxyethylene polyoxypropylene propyl ether and polyoxyethylene polyoxypropylene cetyl ether; polyoxyethylene alkyl phenyl ethers such as polyoxyethylene nonyl phenyl ether; polyoxyethylene hardened castor oils such as polyoxyethylene castor oil and polyoxyethylene hardened castor oil (polyoxyethylene hydrogenated castor oil); polyoxyethylene beeswax derivatives such as polyoxyethylene sorbitol beeswax; polyoxyethylene lanolin derivatives such as polyoxyethylene lanolin; and polyoxyethylene fatty acid amides such as polyoxyethylene stearic acid amide having an HLB of 6-18;
anionic surfactants, e.g., alkyl sulfates having a C10-18 alkyl group such as sodium cetyl sulfate, sodium lauryl sulfate and sodium oleyl sulfate; polyoxyethylene alkyl ether sulfates having an average number of moles of ethylene oxide added of 2-4 and a C10-18 alkyl group such as sodium polyoxyethylene lauryl sulfate; and alkyl sulfosuccinic acid ester salts having a C8-18 alkyl group such as sodium laurylsulfosuccinate; and
natural surfactants, e.g., lecithin; glycerophospholipids; sphingophospholipids such as sphingomyelin; and sucrose fatty acid esters of C12-18 fatty acids. Formulations of the present invention can contain one or more of these surfactants in combination. Preferred surfactants are polyoxyethylene sorbitan fatty acid esters such as Polysorbate 20, 40, 60 or 80, especially Polysorbates 20 and 80. Polyoxyethylene polyoxypropylene glycols such as poloxamers (e.g. Pluronic F-68®) are also preferred.
Sulfur-containing reducing agents include e.g., sulfhydryl-containing compounds such as N-acetylcysteine, N-acetylhomocysteine, thioctic acid, thiodiglycol, thioethanolamine, thioglycerol, thiosorbitol, thioglycolic acid and salts thereof, sodium thiosulfate, glutathione, and thioalkanoic acids having 1 to 7 carbon atoms.
Antioxidants include e.g., erythorbic acid, dibutylhydroxytoluene, butylhydroxyanisole, α-tocopherol, tocopherol acetate, L-ascorbic acid and salts thereof, L-ascorbyl palmitate, L-ascorbyl stearate, sodium bisulfite, sodium sulfite, triamyl gallate, propyl gallate or chelating agents such as disodium ethylenediamine tetraacetate (EDTA), sodium pyrophosphate and sodium metaphosphate.
Other components commonly added may also be contained, e.g., inorganic salts such as sodium chloride, potassium chloride, calcium chloride, sodium phosphate, potassium phosphate and sodium bicarbonate; and organic salts such as sodium citrate, potassium citrate and sodium acetate.
The therapeutic agents of the present invention can be administered in dosage forms suitable as injectables for local administration (e.g., subcutaneous, intracutaneous, intramuscular, etc.). Especially preferred local administration is intramuscular administration.
Injectables are prepared by dissolving the components described above in an aqueous buffer known in the field of solution formulations such as a phosphate buffer (preferably a sodium monohydrogen phosphate/sodium dihydrogen phosphate system) and/or a citrate buffer (preferably sodium citrate buffer) and/or an acetate buffer to prepare a solution formulation. The concentration of the buffer is normally 1-500 mM, preferably 5-100 mM, more preferably 10-20 mM. Injectables may be solution formulations or freeze-dried formulations.
The dose and the time and frequency of administration of the therapeutic agents for diseases associated with skeletal muscle degeneration containing a G-CSF as an active ingredient of the present invention can be determined as appropriate by those skilled in the art based on the pathological condition of the patient with a disease to be treated.
In order to obtain the inhibitory effect against muscle degeneration of the present invention, the therapeutic agents for diseases associated with skeletal muscle degeneration of the present invention are preferably administered at a dose of 0.1 to 500 μg/kg/day, more preferably 1 to 50 μg/kg/day when they are administered to humans.
However, the present invention is not limited by the G-CSF doses to humans.
The therapeutic agents for diseases associated with skeletal muscle degeneration of the present invention may also be used in combination with other drugs.
As shown in the following Examples, it was shown first that G-CSF is obviously effective for muscle regeneration and functional recovery in DMD model mice carrying a dystrophin mutation. Further, mice not only carrying a dystrophin mutation but also haploinsufficient for G-CSFR (abnormal expression of one copy of the gene) tend to die early, showing that G-CSF, which is a ligand for G-CSFR, is critical for inhibiting the progression of DMD. Moreover, G-CSF administration dramatically improved the muscle regeneration, functional recovery and survival of dystrophin/utrophin double knockout mice known as another type of DMD model mice showing severe symptoms similar to human DMD and resulting in early death. These results strongly suggest that G-CSF plays an important role in the skeletal muscle regeneration and survival of the DMD model mice and open the way to future clinical applications.
The present invention can be expected to be industrially applicable as therapeutic agents for muscular dystrophy against which any effective therapy has not existed so far.
The following Examples further illustrate the present invention without, however, limiting the scope of the invention thereto. Various changes and modifications can be made by those skilled in the art on the basis of the description herein, and such changes and modifications are also included in the present invention.
The experimental methods used in the Examples are as follows.
The mdx (C57/B6) mice and utrophin heterozygous (utrophin+/−) mice were a kind gift from Dr. Shin'ichi Takeda (the National Center of Neurology and Psychiatry of Japan). The csf3r−/− mice were a kind gift from Dr. Daniel C. Link (Washington University School of Medicine, St. Louis) (Richards, M. K., Liu, F., Iwasaki, H., Akashi, K. & Link, D. C. Pivotal role of granulocyte colony-stimulating factor in the development of progenitors in the common myeloid pathway. Blood 102, 3562-3568, doi:10.1182/blood-2003-02-0593 (2003)). All the experimental procedures and protocols were approved by the Institutional Animal Care and Use Committee at the Keio University and conformed to the NIH Guide for the Care and Use of Laboratory Animals. Knockout mice deficient in both dystrophin and csf3r were obtained by the following breeding program: male csf3r knockout mice were mated with female C57B/6 mdx mice (deficient in dystrophin) to produce F1 generation mice of all possible genotypes, i.e., heterozygous for csf3r (females and males) and either heterozygous for the mdx mutation (females) or hemizygous for the mdx mutation (males), and the resulting offspring were crossed among themselves. Knockout mice deficient in both dystrophin and utrophin were obtained by the following breeding program: male utrophin heterozygous mice were mated with female C57B/6 mdx mice to produce F1 generation mice heterozygous for utrophin (females and males) and either heterozygous for the mdx mutation (females) or hemizygous for the mdx mutation (males), and the resulting offspring were crossed among themselves (Deconinck, A. E. et al. Utrophin-Dystrophin-Deficient Mice as a Model for Duchenne Muscular Dystrophy. Cell 90, 717-727, doi:Doi: 10.1016/s0092-8674 (O) 80532-2 (1997)).
DNA was isolated from the tail of each mouse using the Easy-DNA Kit (Invitrogen). A forward primer (5′ CATAGTTATTAATGCATAGATATTCAG 3′) complementary to the mouse dystrophin and a reverse primer (5′ GTCACTCAGATAGTTGAAGCCATTTAG 3′) complementary to the wild-type allele or a reverse primer (5′GTCACTCAGATAGTTGAAGCCATTTAA3′) complementary to a mouse mutant dystrophin allele were used for PCR analysis to determine the mutant dystrophin allele. Both PCR reactions were performed under conditions of 95° C., 4 min; then 34 cycles of 95° C., 1 min, 55° C., 1 min and 72° C., 1 min followed by 72° C., 10 min. Each reaction yielded a 275 by product. All PCR reactions were performed by using the GoTaq DNA Polymerase kit (Promega, Madison, Wis., USA). A forward primer (5′ GTGAAGGATGTCATGAAAG 3′) complementary to exon 7 of the mouse utrophin and a reverse primer (5′ TGAAGTCCGAAAGAGATACC 3′) complementary to intron 7 or a reverse primer (5′ ACGAGACTAGTGAGACGTGC 3′) complementary to the PGK promoter located within the Neo-knockout cassette were used for PCR analysis to determine the utrophin-knockout status. PCR reactions were performed under conditions of 35 cycles of 94° C., 30 sec, 57° C., 30 sec and 72° C., 25 sec. A forward primer (5′ AGTTCACCAGGCAGGTGAGT 3′) complementary to the mouse csf3r and a reverse primer (5′ GTAGGCCTAGTTCATACCTG 3′) complementary to the wild-type allele or a reverse primer (5′ TCCAGACTGCCTTGGGAAAA 3′) complementary to a mouse mutant csf3r allele were used for PCR analysis to determine the mutant csf3r allele. Both PCR reactions were performed under conditions of 95° C., 4 mM; then 30 cycles of 95° C., 30 sec, 60° C., 30 sec and 72° C., 45 sec. Each reaction yielded a 275 by product. All PCR reactions were performed by using the Tag DNA Polymerase kit (TaKaRa, Japan).
G-CSF (Neutrogin™, 100 μg; Chugai Pharmaceutical Co., Ltd.) was diluted in 1 ml of saline. G-CSF was intraperitoneally administered to 3-week-old male mice at a dose of 5 μg/day for two weeks by using a 27-gauge needle. Mice of the G-CSF-treated group and control group were sacrificed at 5 weeks of age.
Frozen sections (10 μm) of tibialis anterior (TA) muscles were stained with hematoxylin and eosin (H&E stain). H&E staining was performed on the sections to determine the percentage of regenerated muscle. The fiber cross area (FSA) was determined on tibialis anterior sections (7 μm) immunofluorescently stained for laminin-2 alpha using software (BZ-HIC: KEYENE). Digital photographs of each section were taken with a digital camera (BIOREVO: KEYENCE) at a magnification of 20×. Evans blue purchased from Sigma was dissolved in phosphate buffered saline (PBS: 0.15 M NaCl, 10 mM phosphate buffer, pH 7.0). Using a 27-gauge needle, 0.05 mL of 1% Evans blue was intraperitoneally administered at postnatal day 2. The mice were sacrificed 3 hours later.
All immunofluorescence assays were performed on sections of 7 μm. The samples were incubated with Triton X-100 for 5 min at room temperature, then washed, and incubated with the following primary antibodies: an anti-G-CSFR antibody (Santa Cruz Biotechnology (sc-9173), 1:50 dilution), an anti-laminin-2α antibody (Sigma (L0663), 1:1000 dilution), an anti-laminin antibody (L9393, 1:1000 dilution) and RNMy2/9D2 (ab49457, 1:30 dilution, abeam). After incubation overnight, bound antibodies were visualized with a secondary antibody conjugated to Alexa 488 or Alexa 546 (Molecular Probes, Minato-ku, Tokyo). Nuclei were stained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen).
Extensor digitorum longus (EDL) muscles were isolated and removed from 5 week-old mice. The muscles were carefully mounted in a chamber filled with PSS buffer (95% O2, 5% CO2) and maintained at 30° C. One muscle tendon was attached to a steel hook in the chamber, and the other was tied with 5-0 surgical silk to the lever arm of a dual-mode servomotor system (Electronic Stimulator; NIHON KOHDEN CORPORATION, Tokyo, Japan). The muscles were stretched to the length at which the maximum single twitch and tetanic forces were produced (optimal length; Lo). The corresponding tetanic force was then measured at 150 Hz, 5 sec duration for 20 minutes with a rest period of 120 seconds for changing the buffer. The muscles were adjusted to the optimum length (Lo) before all the measurements. For comparative purposes, all the measurements were normalized to the muscle cross-sectional area (CSA), which was calculated by dividing the muscle mass by the product of the length and the mammalian skeletal muscle density (1.056 mg/mm3). The specific force (N/cm2) was calculated with muscle density assumed as 1.056 mg/mm3.
Mice were subjected to an exhaustion treadmill test. Each mouse was placed on the belt of a one-lane motorized treadmill (MK-680S TREADMILL for RATS &MICE; Muromachi). The test was run at an inclination of 0° initially at 5 m/min for 5 minutes, and the speed was then increased by 1 m/min every minute. The endpoint of the test was when the mouse remained in the electrical stimulus-applying zone for 20 seconds or more.
Animals were placed in a chamber where they can move freely. The chamber was connected to a high-gain differential pressure transducer (Valydine MP45, Validyne, North Ridge, Calif.). As the animals breathed, changes in pressure were converted to signals representing tidal volume (TV), which were amplified (BMA 830; CWE, Ardmore, Pa.), recorded on a strip-chart recorder (Dash 10; Astro-Med, West Warwick, R.I.), stored in a computer with respiratory acquisition software for analysis. Oxygen consumption and carbon dioxide production were determined by the open-circuit method using Beckman OM-14 and LB-2 analyzers. The parameter TV was analyzed in real time to calculate the average 5 times every 2 minutes for 3 consecutive hours. TV was normalized to body weight.
The data were analyzed using the StatView J-4.5 software. Values are reported as means±SD. Comparisons between groups were performed by one-way ANOVA. A Scheffe's F-test was used to determine the level of significance. The probability level accepted for significance was P<0.05.
The appearance of mdx mice was grossly normal in terms of body size, muscle size and body length (
However, pathological analyses show that muscle degeneration and regeneration evidently occurred in mdx mice between 3 and 5 weeks of age (
Generally, healthy myocytes are peripherally nucleated while centrally nucleated myocytes are regenerating or regenerated myocytes. In mdx mice, centrally nucleated myocytes were observed after 4 weeks of age and increased until 12 weeks of age (
To examine whether or not G-CSF signaling is involved in muscle degeneration in mdx mice, immunofluorescence staining for G-CSF receptor (G-CSFR) was performed. TA (tibialis anterior) muscle sections at different developing stages were observed to show that G-CSFR was highly expressed in a small round shape in centrally nucleated cells (regenerating muscles) (
Based on the fact that G-CSFR-expressing cells appear most frequently at 3 weeks to 5 weeks of age in regenerating myocytes in mdx mice, we verified whether or not skeletal muscle regeneration and skeletal muscle function can be improved in mdx mice by administering G-CSF. G-CSF was intraperitoneally administered to mdx mice daily between 3 weeks and 5 weeks of age (
RNMy2/9D2 recognizes a myosin heavy chain (MHC) present during the embryonic and neonatal period in the development of skeletal muscle and also occurring in newly formed adult regenerating myocytes (Bigard, et al. Changes in myosin heavy chain profile of mature regenerated muscle with endurance training in rat. Acta Physiologica Scandinavica 165, 185-192 (1999)). Immunostaining with RNMy2/9D2 at 4 weeks of age showed that G-CSF significantly increased the number of regenerating myocytes (
Muscle weakness is one of the most prominent features of muscular dystrophy (Bushby, K. et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology 9, 77-93, doi:Doi: 10.1016/s1474-4422 (09) 70271-6 (2010)). Thus, an exercise tolerance test was performed to evaluate in vivo muscle function. The results showed that G-CSF treatment significantly improved exercise tolerance at 5 weeks of age (
Moreover, tetanic force (
These data indicate that G-CSF significantly improves muscle function in mdx mice through regeneration.
To clarify the roles of G-CSF and G-CSFR in muscular dystrophy, G-CSFR-knockout (csf3r−/−) mice were used. The life span of the csf3r−/− mice was normal though they showed a mild hematological disorder.
We hypothesized that G-CSFR homozygous knockout mice further carrying an mdx mutation (mdx/csf3r−/−) would show severe injury in muscle function, but surprisingly, a biphasic death response was observed immediately after birth and at postnatal week 3 to 5 (the stage during which muscles are acutely degenerated/regenerated) even in G-CSF heterozygous mdx (mdx/csf3r+/−) mice (
To elucidate the cause of early lethality, we observed the gross appearances of diaphragms and lesions. The diaphragms of csf3r+/− mice, mdx mice, and mdx/csf3r+/− mice immediately after birth were stained with Evans blue. In mdx/csf3r+/− mice, necrosis and degeneration of diaphragms were evidently observed in contrast to mdx mice and csf3r+/− mice, both of which showed almost no degenerative lesion in their diaphragms (
In mdx mice, skeletal muscle degeneration and regeneration was prominent at around 3 to 5 weeks. Thus, we considered that muscle regeneration and muscle function would be further worsened in mdx/csf3r+/− mice and mdx/csf3r−/− mice. A comparison of the gross appearances of mdx mice, mdx/csf3r+/− mice and mdx/csf3r−/− mice shows that mdx/csf3r+/− mice and mdx/csf3r−/− mice were smaller than mdx mice in body size at postnatal day 7 and that mdx/csf3r−/− mice were evidently smaller at postnatal day 13 (
The absence of dystrophin in the myocyte membrane leads to the onset of Duchenne muscular dystrophy (DMD) in humans, which induces severe muscle weakness and muscular atrophy, resulting in death at a young age. However, dystrophin-deficient mdx mice appear physically normal despite of potential muscle degeneration and regeneration. Utrophin is a dystrophin-related protein sharing functional motifs with dystrophin. Mdx/utrn−/− mice that express neither dystrophin nor its homolog utrophin show severe dystrophy similar to human DMD patients so that they can be an animal model of DMD (Grady, R. M. et al. Skeletal and Cardiac Myopathies in Mice Lacking Utrophin and Dystrophin: A Model for Duchenne Muscular Dystrophy. Cell 90, 729-738, doi:Doi: 10.1016/s 0092-8674 (00) 80533-4 (1997); Deconinck, A. E. et al. Utrophin-Dystrophin-Deficient Mice as a Model for Duchenne Muscular Dystrophy. Cell 90, 717-727, doi:Doi: 10.1016/s 0092-8674 (00) 80532-2 (1997)). The mdx/utrn−/− mice show significantly small body size and abnormally curved spine as compared with mdx mice (
H&E stainings of TA muscle sections at 2-12 weeks of age show that muscle injury occurred more acutely in mdx/utrn−/− mice at 3 weeks/4 weeks/5 weeks of age as compared with mdx mice (
The total number of myocytes in TA muscles decreased at 2-5 weeks and then recovered (
Images of TA sections from mdx/utrn−/− mice fluorescently stained with an anti-G-CSFR antibody, an anti-laminin-2α antibody and DAPI, respectively, and an image formed by superimposing these images (MERGE), and an enlarged image of the latter are shown (
G-CSF was administered to mdx/utrn−/− mice according to the administration schedule described in
Photographs of H&E stained TA muscle sections (
The proportion of centrally nucleated myofibers (regenerated myofibers) (
Next, we tested whether or not long term G-CSF administration could contribute to the survival of mdx/utrn−/− mice. The mdx/utrn−/− mice started to die from 3 weeks of age and all died by the age of 180 days (
| Number | Date | Country | Kind |
|---|---|---|---|
| 2010-256873 | Nov 2010 | JP | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/JP2011/077113 | 11/17/2011 | WO | 00 | 5/17/2013 |
