Patent Application
20180003699
Full length active α1 proteinase inhibitor (α1PI, α1 antitripsin) is composed of 394 amino acids (aa) having a mass of approximately 55 kDa when fully glycosylated (Berninger, 1985). Hepatocytes are the primary source of α1PI, and in normal, healthy individuals, the range of circulating α1PI is 20-53 μM between the 5th and 95th percentiles (Brandy et al., 1991; Bristow et at., 1998). However, during the acute phase of the inflammatory response, α1PI may increase as much as 4-fold to 200 μM (Kushner, 1982). There are four common alleles of α1PI, and these are synthesized and secreted principally by hepatocytes (OMIM, 2000). However, there are more than a hundred genetic variants, some of which produce a molecule that prohibits secretion, and affected individuals manifest with 10-15% of the normal level of α1PI in blood (Berninger, 1985), Individuals with this inherited form of α1PI deficiency, especially males, are notably susceptible to respiratory infections and emphysema, and 80% who survive to adulthood succumb to respiratory failure between the fourth and sixth decades of life (Berninger, 1985). Prevalence is 0.03%, and α1PI augmentation therapy in affected individuals is the only approved therapeutic application of α1PI. (OMIM, 2000).
Traditionally, α1PI has been characterized as a proteinase inhibitor which has highest affinity for soluble granule-released elastase (HLEG). Evidence now suggests α1PI also interacts with cell surface HLE (HLEcs) (Bristow et al., 2003; Tavor. S. et al., 2005). Both HLEcs and HLEG are synthesized and processed as a single molecular protein; however, HLE is targeted exclusively for the cell surface early in ontogeny and for granule compartmentalization later in ontogeny (Gullberg et al., 1995; Garwicz et al., 2005). Mutations in the HLE encoding gene that result in decreased HLE expression produce periodic cycling in hematopoiesis that affect monocytes in the opposite phase to neutrophils (Horwitz et al., 1999; Horwitz et al., 2004). Mutations that result in increased HLE produce twice fewer absolute numbers of circulating CD4+ and CD8+ lymphocytes, and 7 times more monocytic cells (Person et al., 2003).
The proteinases and proteinase inhibitors that govern cell motility and hematopoiesis have evolved a different functional pattern in mice from man, but there are many parallels. For example, in mice, it has been shown that high concentrations of HLE accumulate in bone marrow following granulocyte colony-stimulating factor (G-CSF) induced stem cell mobilization (Winkler et al., 2005). This accumulation was found to result from the down-regulation of α1PI expression. In man, the liver is the primary source of both α1PI and stem cells. As opposed to its function to inhibit the enzymatic activity of HLEG, α1PI binding to HLEcs induces cell migration in a manner that does not appear to involve enzymatic activity (Wolf et al., 2003). The effect of α1PI on cell motility is especially profound during migration of stem cells and early progenitor cells. Hematopoiesis begins with stem cell migration from fetal liver through the periphery to the stromal area of hematopoietic tissue, retention, differentiation, and release of maturing progenitor cells back into the periphery. Migration of stem cells to, and myeloid-committed progenitor cells from bone marrow is controlled by HLEcs, the chemokine stromal cell-derived factor-1 (SDF-1), and the SDF-1 receptor CXCR4 (Tavor. S. et al., 2005; Lapidot and Petit, 2002). Cell migration is dependent on the localization of HLEcs into podia formation at the leading edge of the cell (Tavor. S. et al., 2005; Cepinskas et al., 1999), and podia formation is induced by binding of active α1PI to HLEcs in a manner that includes co-localization of HLEcs with CD4 and CXCR4 (Bristow et al., 2003). The current method for therapeutic mobilization of myeloid-committed progenitor cells from bone marrow is by the action of G-CSF, and it has been shown that G-CSF mediates this activity by antagonizing CXCR4 and HLEcs (Lapidot and Petit, 2002). The molecular mechanisms that mobilize lymphoid-committed progenitors from hematopoietic tissue are not known. Evidence described in this application now suggests active α1PI mediates this activity (Examples 1-3 below). Following treatment with α1PI in animal models, the migration of transplanted human leukemia cells into circulation is decreased, but the migration of stem cells to hematopoietic tissue is increased (Tavor. S. et al., 2005). These results suggest that α1PI influences the migration of cells into and out of circulation depending, in part, on the stage of differentiation of the cell.
When bone marrow-derived erythroid progenitors cells (burst-forming units-erythroid) are incubated with α1PI in vitro, growth of immature cells is significantly suppressed (42.5%±5.5%) (Graziadei et al., 1994). In contrast, growth of mature cells is unaffected by α1PI (3.6%±3.4%). These results demonstrate that in addition to myeloid- and lymphoid-committed progenitors, α1PI influences the genesis of erythroid-committed progenitor cells dependent on their stage of differentiation.
Previous therapeutic application of α1PI has been restricted to augmentation in patients diagnosed with inherited α1PI deficiency for the purpose of ameliorating respiratory distress such as occurs in emphysema and chronic obstructive pulmonary disease (COPD). Considerable interest in producing recombinant α1PI has resulted in development of several successful expression systems including bacterial and plant cell expression as well as viral vector and oral delivery (Chowanadisai et al., 2003; Luisetti and Travis, 1996). Recombinant α1PI is in phase I clinical trials for augmentation in individuals with inherited α1PI deficiency (Flotte et al, 2004), and is in phase II clinical trials for treatment of atopic dermatitis. Recombinant α1PI has been tested for preventing the onset of type I diabetes in genetically predisposed mice (Song et al., 2004). Nevertheless, there is a need in the art for developing recombinant α1PI with due consideration of its conformation-dependent function to mobilize either lymphoid-lineage or myeloid-lineage maturing cells. As recognized by the inventor herein, because α1PI induces cell motility depending on its active or proteolytically modified conformation, various active and modified α1PI's provide powerful new therapeutics for mobilizing targeted cell subsets through tissue.
This invention is directed to the use of α1PI and modified α1PI to control the phenotypic composition of circulating and tissue-associated cells derived from hematopoietic stem cells. Various modified α1PI's are also provided. Screening methods and treatment for abnormalities in the phenotypic profile of blood cells are also provided. Such abnormalities are associated with, e.g., HIV-1 infection, microbial infection, leukemia, solid tumor cancers, atherosclerosis, autoimmunity, stem cell transplantation, organ transplantation, and other diseases affected by cells of the immune system. The invention is based, in part, on a previously unrecognized fundamental property of α1PI to regulate the phenotypic composition of circulating and tissue-associated cells derived from hematopoietic stem cells.
Accordingly, this invention provides a method for identifying a modified α1PI as suitable for use in treating a disease, disorder or condition in a subject, comprising: (a) producing the modified α1PI; and (b) measuring a biological activity of the modified α1PI in a biological assay for predicting effectiveness in treating the disease, disorder or condition in the subject, wherein the modified α1PI is identified as suitable for treating the disease, disorder or condition from a change in the biological activity relative to a control activity measured for a wild-type α1PI. In one embodiment, the modified α1PI is produced by site-directed mutagenesis, proteolysis, or both. In another embodiment, the disease, disorder or condition is selected from the group consisting of HIV-1 infection, bacterial infection, leukemia, a solid tumor, atherosclerosis, an autoimmune disease, organ transplantation, and stem cell transplantation. In another embodiment, the stem cell transplantation is autologous stem cell transplantation.
In another embodiment, the biological assay is selected from the group consisting of an elastase inhibition assay, a receptor co-capping assay, a cell motility assay, a lymphoid-committed progenitor cell mobilization assay, an HIV-1 gp120 antibody cross-reactivity assay, and an HIV-1 infectivity facilitation assay. In another embodiment, the subject is a human or a non-human animal. In another embodiment, proteolysis comprises contacting a wild-type or a recombinant α1PI with a protease selected from the group consisting of elastase, stromelysin-3, matrix metalloproteinase, collagenase, gelatinase, pepsin, plasmin, urokinase, chymotrypsin, thrombin, CD26, complement component C1, and complement component C3.
In another embodiment, site-directed mutagenesis comprises changing at least two wild-type amino acid residues selected from the group consisting of residues 370-374 and 385 to a non-wild-type residue, wherein one changed residue is at position 385. In another embodiment, at least one amino acid selected from the group consisting of residues 370-374 and 385 is changed from wild-type to glycine, threonine, or a hydrophobic amino acid. In another embodiment, the hydrophobic amino acid is selected from the group consisting of isoleucine, leucine, phenylalanine, tyrosine and valine.
This invention provides a modified human α1PI comprising a change in a wild-type amino acid residue selected from the group consisting of residues 370-374 and 385. In one embodiment, the genetically modified α1PI further comprises modification by proteolysis. In another embodiment, the wild-type amino acid residue is changed to glycine, threonine, or a hydrophobic amino acid. In another embodiment, the hydrophobic amino acid is selected from the group consisting of isoleucine, leucine, phenylalanine, tyrosine and valine. In another embodiment, the modified human α1PI comprises at least two changes in wild-type amino acid residues comprising a change at position 385 and a change at a position selected from the group consisting of positions 370-374. In another embodiment, the methionine at position 385 is changed to a non-methionine amino acid. In another embodiment, the non-methionine amino acid is selected from the group consisting of glycine, isoleucine, leucine, phenylalanine, threonine, and valine. In another embodiment, the modified human α1PI is capable of a reduced binding activity in an HIV-1 gp120 antibody cross-reactivity assay, relative to a wild-type α1PI. In another embodiment, the residue changes in the modified human α1PI comprise the following three amino acid substitutions: Phe372Gly; Leu373Gly; and Met 385Val. In another embodiment, the residue changes in the modified human α1PI consist of the following three amino acid substitutions: Phe372Gly; Leu373Gly; and Met 385Val.
This invention provides a method of treating a disease, disorder or condition in a subject in need of said treatment, comprising administering an effective amount of an unmodified or modified α1PI to the subject. In one embodiment, the modified α1PI is produced by site-directed mutagenesis, proteolysis, or both. In another embodiment, the disease, disorder or condition is selected from the group consisting of HIV-1 infection, bacterial infection, leukemia, a solid tumor, atherosclerosis, an autoimmune disease, organ transplantation, and stem cell transplantation. In another embodiment, the subject is a human or a non-human animal. In another embodiment, the modified α1PI comprises a change in a wild-type amino acid residue selected from the group consisting of residues 370-374, and further comprises a change in methionine at position 385. In another embodiment, methionine at position 385 is changed to a non-methionine amino acid selected from the group consisting of glycine, isoleucine, leucine, phenylalanine, threonine, and valine. In another embodiment, the modified α1PI is capable of a reduced binding activity in an HIV-1 gp120 antibody cross-reactivity assay, relative to a wild-type α1PI. In another embodiment, the amino acid changes in the modified α1PI comprise the following three amino acid substitutions: Phe372Gly; Leu373Gly; and Met385Val. In another embodiment, the amino acid changes in the modified α1PI consist of the following three amino acid substitutions: Phe372Gly; Leu373Gly; and Met385Val. In another embodiment, the treatment method further comprises administration of HIV-1 antiretroviral therapy. In another embodiment, the effective amount of modified α1PI is a dose equivalent to about 42 mg/kg of active wild-type α1PI.
This invention provides a method of treating a disease, disorder or condition in a subject in need of said treatment, comprising administering an effective amount of an active α1PI to the subject, wherein the disease, disorder or condition is selected from the group consisting of HIV-1 infection, bacterial infection, leukemia, a solid tumor, atherosclerosis, an autoimmune disease, organ transplantation, and stem cell transplantation. In one embodiment, the stem cell transplantation is autologous stem cell transplantation.
This invention provides a method of treating a disease, disorder or condition in a subject in need of said treatment, comprising administering an effective amount of an active α1PI to the subject, wherein the subject is characterized as having an abnormal or ineffective number of lymphocytes, monocytes, or dendritic cells.
This invention provides a method of treating a disease, disorder or condition in a subject in need of said treatment, comprising administering an effective amount of an inactive α1PI to the subject, wherein the disease, disorder or condition is selected from the group consisting of bacterial infection, neutropenia and immunosuppression.
This invention provides a method of treating a disease, disorder or condition in a subject in need of said treatment, comprising administering an effective amount of an inactive α1PI to the subject, wherein the subject is characterized as having an abnormal or ineffective number of granulocytes, monocytes, dendritic cells, eosinophils, or basophils. In one embodiment, the subject is a human or a non-human animal.
Human α1PI—Alpha1-Proteinase Inhibitor (Human) is a sterile, stable, lyophilized preparation of highly purified human alpha1-proteinase inhibitor (α1PI) also known as alpha1-antitrypsin derived from human plasma. There are three products of alpha1-Proteinase Inhibitor (Human) that are currently FDA approved for treatment. Prolastin® (www.prolastin.com) produced by Talecris Biotherapeutics (www.talecris.com), Zemaira® (www.zemaira.com) produced by ZLB Behring (www.zlbbehring.com), and Aralast™ (www.aralast.com) produced by Baxter Healthcare Corp.
Active α1PI—the fraction of α1PI in plasma or other fluids that has the capacity to inhibit elastase activity.
Inactive α1PI—the fraction of α1PI in plasma or other fluids that does not have the capacity to inhibit elastase activity. Active α1PI may be inactivated by proteolytic cleavage, proteinase complexing, antibody complexing, or oxidation.
Genetically modified α1PI—active α1PI synthesized from the cDNA encoding human α1PI which has been modified by site-directed mutagenesis. There are no current recombinant products that have been FDA approved for treatment.
Proteolytically modified α1PI—active or genetically modified human π1PI which has been further modified by limited proteolysis to generate fragments. Proteolytic modification inactivates α1PI.
Pharmaceutical Composition—When formulated in a pharmaceutical composition, the therapeutic compound of the invention can be admixed with a pharmaceutically acceptable carrier or excipient. The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are “generally regarded as safe”, e.g., that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a statement government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and, more particularly, in humans. The term“carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.
The specific activity of Zemaira® is 70%, Prolastin® is 35%, and Aralast™ is 55% where specific activity is defined as inhibition of porcine pancreatic elastase (PPE) as described in the package insert. Thus, the recommended dose of Zemaira® α1PI may be stated as 42 mg/kg active α1PI, Prolastin® as 21 mg/kg, and Aralast™ as 33 mg/kg active α1PI. Conversely, the inactive fraction of Zemaira® is 30% or 18 mg/kg, of Prolastin® is 65% or 39 mg/kg, and of Aralast is 45% or 27 mg/kg
The dosage of genetically modified α1PI is determined by its capacity to inhibit PPE as described in Section 6 of the Detailed Description (see also, U.S. Pat. No. 6,887,678). In accordance with the recommended treatment regimen using wild-type α1PI, subjects are infused with genetically modified α1PI at a dosage that is in the range of 1 to 420 mg/kg active α1PI, with a target blood threshold of 35 μM genetically modified α1PI. In some cases, either active or genetically modified α1PI are further modified by limited proteolytic cleavage to generate fragments that are chemotactic for myeloid-lineage cells. For example, in microbial infections that attend neutropenia, proteolytically modified α1PI is used to recruit neutrophils into infected tissue. In this case, individuals are infused with proteolytically modified α1PI at the concentration that is equivalent to 39 mg/kg inactive α1PI. In addition to being monitored for PPE inhibitory activity, proteolytically modified α1PI is screened as described in Section 3.2 of the Detailed Description for its capacity of to induce receptor capping and cell motility of myeloid-lineage blood cells such as neutrophils.
3.1 Structural features of α1PI: The following represents the full length amino acid sequence for α1PI (accession # K01396) including the 24 aa signal peptide:
The known Asn-linked carboxylation sites (denoted in bold underlined letters) are found at aa 46, 83, and 247 (Nukiwa et al., 1986; Jeppsson et al., 1985). The oligosaccharide structure at each site is either tri-antenary or bi-antenary, and the various combinations give the protein a characteristic electrophoretic charge denoted as phenotypic subtypes of the four common genotypic alleles, M1A, M1V, M2, and M3.
The frequencies in US Caucasians of M1A, M1V, M2, and M3 are 0.20-0.23, 0.44-0.49, 0.1-0.11, and 0.14-0.19, respectively, accounting for 95% of this population (Jeppsson et al., 1985). M1A is thought to be the oldest variant, and M1V has a single aa substitution, at position 213, Ala to Val. The M3 allele has a single aa difference with M1V, Glu to Asp at position 376. The M2 allele has a single aa difference with M3, Arg to His at position 101.
More than a hundred genotypic alleles have been identified, but except for the S and Z alleles, most of them are exceedingly rare (OMIM, 2000). The S allele, frequency 0.02-0.04, has a single aa substitution at position 264, Glu to Val, and individuals homozygous for this allele manifest 60% normal α1PI blood levels, but are not at risk for emphysema or other known diseases except in combination with the Z allele (Brantly et al., 1991; Sifers et al., 1988), The Z allele, frequency 0.01-0.02, has a single aa substitution at position 342, Glu to Lys, and individuals homozygous for this allele manifest 1.0% normal α1PI blood levels, and are at risk for emphysema and autoimmunity.
3.2 Functional properties of α1PI: There are three distinct activities of α1PI that are determined by sites in the C-terminal region of α1PI defined herein as aa 357-394,
PMSI PPEVKFNKPF VFLMIEQNTK SPLFMGKVVN PTQK.
The crystal structure for active α1PI (1HP7, NIH NCBI Molecular Modeling DataBase mmdbId:15959) is depicted in
The first activity of α1PI is its well characterized proteinase inhibition which is a property only of active, uncleaved α1PI. The reactive site for this activity is Met (aa 358) contained in the domain Pro-Met-Ser-Ile-Pro (PMSIP, aa 357-361). Active α1PI may be inactivated by proteinase complexing, cleavage, or oxidation of Met (aa 358). Interaction at the scissile bond Met-Ser (aa 358-359) may be mediated by many proteinases including HLEG. The two cleavage products of α1PI may dissociate under some circumstances, but may remain associated in a new, rearranged configuration that may irreversibly incorporate HLEG, but may not incorporate other proteinases, for example metalloproteinases (Perkins et al., 1992).
The tertiary structure for the rearranged α1PI configuration has not been solved (Mellet et al., 1998); however, X-ray diffraction and kinetic analyses of cleaved α1PI suggest that the strand SIPPEVKFNKP (aa 359-369) may separate 70A° from its original position and insert into the β-sheet formation on the opposite face of the molecule (β-sheet A) in a manner that would significantly alter proteinase and receptor recognition (Elliott et al., 2000). Thus, four configurations of the C-terminal region of α1PI are thought to occur (Table 1).
Because the cleaved configuration of α1PI lacks proteinase inhibitory activity, in deficient concentrations of active α1PI, the result is emphysema and respiratory-related infections which are facilitated by the presence of certain environmental factors, cigarette smoke, microbial factors, and inherited mutations that prohibit successful production of active α1PI.
A second activity of α1PI is the stimulation of cell migration, and this activity is a property of both cleaved and uncleaved α1PI. Cleaved α1PI is recognized by LRP, and stimulates migration of myeloid-lineage cells including neutrophils and monocytic cells (Joslin et al., 1992). Active, uncleaved α1PI is recognized by HLEcs and stimulates migration of lymphoid-lineage cells and myeloid-committed progenitor cells (Bristow et al., 2003). Cell migration is initiated by α1 PI-induced co-capping of receptors such as HLEcs, CXCR4, and CD4 into podia formation (Cepinskas et al., 1999; Banda et al., 1988). In addition to the participation of podia formation during cell migration, this configuration is also the preferred binding site for HIV-1 (Bristow et al., 2003). The reactive site in α1PI for this activity is Phe-Val-Phe-Leu-Met (FVFLM, aa 370-374).
A third non-physiologic activity of α1PI is binding to antibodies reactive with HIV-1 envelope protein gp120, and this activity results in inactivation of α1PI and blocking of the other two activities described above. The anti-gp120 monoclonal antibodies 1C1 (Repligen, inc., Cambridge, Mass.) and 3F5 (hybridoma culture supernatant, 0085-P3F5-D5-F8, Dr. Larry Arthur, NCI-Frederick) were previously shown to be reactive with an epitope near the gp120 C5 domain (Moore et al., 1994). The antibody cross-reactive site of human α1PI is contained in the domain Phe-Leu-Met-Ile-Glu-Gln-Asn-Thr-Lys-Ser-Pro-Leu-Phe-Met-Gly-Lys-Val-Val (FLMIEQNTKSPLFMGKVV, aa 372-389) (Bristow et al., 2001) Chimpanzee α1PI, which differs from human α1PI by a single amino acid, Val (aa 385), does not bind anti-gp120, consistent with the ability of chimpanzees to resolve HIV-1 infection and regain normal CD4+ lymphocyte levels. This suggests that the anti-gp120 cross-reactive site in human α1PI is determined primarily by the Met residue (aa 385).
3.3 Expression of recombinant α1PI: Any method known in the art may be used for producing genetically modified α1PI's according to the invention. Two preferred methods are briefly described below for producing such recombinant α1PI's; one method allows expression of α1PI in rice cells and the other allows bacterial expression. The cDNA encoding human α1PI is obtained from a human cDNA bank by and amplification of the fragment in accession number K01396 using two PCR primers: N-terminal primer 5′ GAGGATCCCCAGGGAGATGCTGCCCAGAA 3′ and C-terminal primer 5′CGCGCTCGAGTTATTTTTGGGTGGGATTCACCAC 3′ as previously described (Courtney et al., 1984; Terashima et al., 1999; Jean et al., 1998).
For expression in rice cells, expression cassettes are prepared by using a 1.1. kb Nhei-PstI fragment, derived from p1AS1.5, is cloned into the vector pGEM5zf- (Promega, Madison, Wis.): ApaI, AatII, SphI, NcoI, SstII, EcoRV, SpeI, NotI, PstI, SalI, NdeI, SacI, MluI, NsiI at the SpeI and PstI sites to form pGEM5zf-(3D/NheI-PstI). The GEM5zf-(3D/NheI-PstI) is digested with PstI and SacI and ligated in two nonkinased 30 mers with the complementary sequences 5′ GCTTG ACCTG TAACT CGGGC CAGGC GAGCT 3′ and 5′ CGCCT AGCCC GAGTT ACAGG TCAAG CAGCT 3′ to form p3DProSig. A 5-kb BamHI-KpnI fragment from lambda clone λOSg1 A is used as a terminator. Hygromycin resistance is obtained from the 3-kb BamHI fragment containing the 35 S promoter-Hph-NOS of the plasmid pMON410.
Microprojectile bombardment is applied for transforming a Japonica rice variety TP309. The bombarded calli are then transferred to NB medium containing 50 mg/l hygromycin and incubated in the dark at 25° C. for 10±14 days. Rice cells are cultured at 28° C. (dark) using a shaker with rotation speed 115 rpm in the AA(+sucrose) media. The medium is changed every 5 days to maintain cell lines. AA(−sucrose) is used for α1PI expression. A bioreactor is used for 2-1-scale culture. The reactor is operated at 28° C. (dark) at agitation speed 30±50 rpm with aeration rate 100 ml/min. During the growth phase (10 days), the pH of the media is controlled at pH 5.7, while in the production phase the PH is 5.7±6.3 (un-controlled).
Recombinant α1PI is purified using polyclonal anti-human α1PI antibody (Enzyme Research Laboratories, South Bend, Ind.) immobilized to CNBr-activated Sepharose 4B with a concentration of 1.5 mg/ml gel. The gel (3.5 ml) is packed in a column (inner diameter 1.26 cm), and equilibrated with 50 mM Tris-HCl buffer (pH 7.6). Crude medium is applied to the column at 1.0 ml/min. Absorbance at 280 nm is monitored at the outlet of the column. After washing with the equilibrium buffer, α1PI is eluted with 0.1N HCl solution. A peak fraction is collected, and its pH is immediately adjusted with 1M Tris-HCl buffer (pH 8.0). These methods yield an estimated 5.7 mg α1PI/g dry Cell.
Alternatively, the α1PI cDNA are expressed in Escherichia coli strain BL21. transformed with pDS56α1PI/hf (Invitrogen, Carlsbad, Calif.). Protein expression is induced by addition of 1 mM isopropyl b-D-thiogalactoside, and cultures are grown overnight at 31° C. The cells are washed in metal-chelation chromatography binding buffer (5 mM imidazole/0.5M NaCl/20 mM Tris, pH 7.9) and disrupted by cavitation. The clarified and filtered supernatants containing soluble α1PI variants are applied to a Ni2+-agarose column, and bound proteins are eluted with 100 mM EDTA. The eluates are adjusted to 3.5M NaCl and applied to a phenyl-Sepharose column. The bound α1PI/hf is eluted with 20 mM Bis-Tris, pH 7.0 and concentrated (4 mg/ml final) by diafiltration in the same buffer.
The genetic modifications of interest are described in Section 4.1 of the Detailed Description. Site-directed mutagenesis of active α1PI is performed using standard procedures which are well known in the art (e.g., Parfrey et al., 2003; Current Protocols in Molecular Biology, 2002). For example, the DNA sequence encoding the human α1PI signal peptide in pDS56α1PI/hf is replaced with sequences encoding the epitope (FLAG)-tag by insertion of the annealed complimentary oligos 5′ CTAGAGGATCCCATGGACTACAAGGACGACGATGACAAGGAA 3′ and 5′GATCTTCCTTGTCATCGTCGTCCTTGTAGTCCATGGGATCCT 3′. The resulting cDNA is subcloned into pDS56-6 His to generate pDS56α1PI/hf. To generate pDS56α1Pl/hf carrying an amino acid substitution, the DNA sequences encoding the wild-type amino acid are replaced by the complimentary oligos ending for the amino acids described in Section 4.1 of the Detailed Description. The resulting ORFs directed cytosolic expression of the recombinant proteins initiating with a Met followed by the His and FLAG tags and the mature sequences of mutant α1PI.
4.1 Genetic modification within the domain that determines cell migration (FVFLM, aa 370-374) is prepared by site-directed mutagenesis of specific amino acids:
4.2 Modification within the domain that determines HIV-1 gp120 antibody recognition is prepared by site-directed mutagenesis of Met (aa 385) to Phe, Thr, Ile, Leu, Val, or Gly.
Cleavage of α1PI producing inactive α1PI maybe accomplished using a variety of proteinases. Cleavage by elastase is between Met-Ser (aa 358-359) (Berninger, 1985), and by stromelysin-3, a stromal cell-derived matrix metalloproteinase (MMP), between Ala-Met (aa 350-351) (Pei et al., 1994). Cleavage of α1PI by neutrophil collagenase or gelatinase is between Phe-Leu (aa 352-353) producing inactive α1PI (Desrochers et al., 1992). Other MMPs have also been shown to cleave α1PI (Mast et al., 1991). Significantly, α1PI is cleaved by proteinase derived from pathogenic organisms such as Pseudomonas elastase (Barbey-Morel and Perlmutter, 1991).
The C-terminal α1PI proteolytic fragments acquire attributes that allow interaction with the LDL receptor-related protein (LRP) (Poller et al., 1995) and other receptors that recognize a pentapeptide sequence FVFLM (aa 370-374) (Joslin et al., 1992) in a manner that produces, chemotaxis of neutrophils, increased LDL binding to monocytes, upregulated LDL receptors, increased cytokine production, and α1PI synthesis (Banda et al., 1988; Janciauskiene et al., 1999; Janciauskiene et al., 1999). It has been shown that fibrillar aggregates of the C-terminal fragment of α1PI facilitate uptake of LDL by LRP on the hepatolastoma cell line HepG2 (Janciauskiene and Lindgren, 1999), and these fragments participate in atherosclerosis (Dichtl et al., 2000).
Specifically, active or recombinant α1Pl are incubated at the relevant optimal conditions with one or a combination of pepsin, plasmin, urokinase, chymotrypsin, thrombin, CD26, matrix metalloproteinases, complement components C1 or C3, and other proteinases that facilitate the generation of chemotactic fragments of α1PI (Methods in Enzymology, 1970; Hooper, 2002). Cleavage of α1PI is then terminated by changing the optimal conditions in the proteinase mixture to conditions that prevent proteinase activity, for example at temperature or pH extremes (Methods in Enzymology, 1970; Hooper, 2002).
6.1 inhibit elastase: The procedures for measuring the capacity of α1PI to inhibit soluble forms of porcine pancreatic elastase (PPE) or HLEG are well established (U.S. Pat. No. 6,887,678) (Bristow et al., 1998). Briefly, PPE is incubated for 2 min with α1PI, and to this mixture is added, the elastase substrate succinyl-L-Ala-L-Ala-L-Ala-p-nitroanilide (SA3NA). Results are detected by measuring the color change at 405 nm.
In complex mixtures, α1PI competes for binding to PPE with other proteinase inhibitors or ligands present in the mixture. For example, PPE has higher affinity for α2macroglobulin (α2M) than for α1PI, and when complexed with α2M, PPE retains the ability to cleave small substrates. In the presence of α2M, PPE binds α2M and is protected from inhibition by α1PI, and the complexation of PPE with α2M can be measured by detecting the activity of PPE using SA3NA. To measure the inhibitory capacity of α1PI in complex mixtures such as serum, two-fold serial dilutions of serum are incubated with a constant, saturating concentration of PPE. The added PPE is bound by α2M and α1PI in the diluted serum dependant on their concentrations, the greater the concentration of serum, the greater the concentration of α2M and α1PI. Since there is more α1PI in serum than α2M, as serum is diluted, α2M is diluted out, and in the absence of α2M, PPE is bound and inhibited by α1PI. The complexation of PPE with α1PI can be measured by detecting the loss of activity of PPE using SA3NA. As serum is further diluted, α1PI is also diluted out, and the loss of complexation of PPE with α1PI can be measured by detecting the gain in activity of PPE using SA3NA. The plot of PPE activity versus serum dilution makes a V shaped curve, PPE activity first decreasing as serum is diluted, and then increasing as serum is further diluted. The nadir of PPE activity is used to calculate the precise concentration of active α1PI in the mixture (Bristow et al., 1998).
6.2 Induce receptor co-capping and cell motility: The procedures for inducing receptor capping have been described (Bristow et al., 2003). The cells of interest (monocytes, lymphocytes, neutrophils, or other blood cells, e.g. leukemic cells) are isolated from blood or tissue using standard techniques (Messmer et al., 2002) and examined for reactivity with α1PI.
To examine receptor capping, cells are incubated with active or modified α1PI for 15 min in humidified 5% CO2 at 37° C. Cells are applied to the sample chambers of a cytospin apparatus (Shandon Inc. Pittsburgh, Pa.), and slides are centrifuged at 850 rpm for 3 min. Slides are fixed by application of 500 μl 10% formalin to the sample chambers of the cytospin apparatus followed by an additional centrifugation at 850 rpm for 5 min. Slides are incubated for 90 min at 20° C. with fluorescently-labeled monoclonal antibodies having specificity for the receptors of interest and examined by microscopy.
Cell motility results from selective and sequential adherence and release produced by activation and deactivation of receptors (Wright and Meyer, 1986; Ali et al., 1996), consequent polar segregation of related membrane proteins to the leading edge or trailing uropod, and both clockwise and counterclockwise propagation of Ca++ waves which initiate from different locations in the cell (Kindzelskii and Petty, 2003). Thus, several aspects of the complex process may be quantitated. The most direct and most easily interpreted method for quantitating cell motility is the enumeration of adherent cells in response to a chemotactic agent such as α1PI.
For detecting adherence, sterile coverslips are washed in endotoxin-free water, and to each coverslip is delivered various dilutions of active or modified α1PI. Cells are subsequently delivered to the coverslips, mixed to uniformity with α1PI, and incubated for 30 min in humidified 5% CO2 at 37° C. without dehydration. After stringently washing the coverslips free of non-adherent cells, adherent cells are fixed by incubation for 10 min at 20° C. with 4% paraformaldehyde containing 2.5 μM of the nuclear staining fluorescent dye, acridine orange (3,6-bis[dimethylamino]acridine. Slides are examined by microscopy, and means and standard deviations are determined by counting adherent cells in at least three fields/coverslip.
6.3 Mobilize lymphoid-committed progenitor cells: In the nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mouse model, bone marrow-engrafted human cells can be mobilized by G-CSF (Petit et al., 2002). This model is adapted to assess the capacity of active or modified α1PI to mobilize human lymphoid- or myeloid-lineage cells, respectively.
NOD/SCID mice are housed under defined flora conditions in. individually ventilated (HEPA-filtered air) sterile micro-isolator cages. Human chimeric mice are obtained after sublethal irradiation (375 cGy at 67 cGy/min) and injection of 2×107 human cord blood mononuclear cells. Four to five weeks post transplantation, mobilization is performed by application of either G-CSF or α1PI. For mobilization of myeloid-committed progenitors, mice receive daily subcutaneous injections of 300 μg/kg G-CSF (Filgrastim, Neupogen® or Neulasta®, Amgen, Inc) in 250 μl of 0.9% NaCl, 5% fetal calf serum for 4-5 days. Alternatively, mice receive twice weekly infusion via the dorsal tail vein of inactive or modified α1PI (39 mg/kg) at a rate of 0.08 ml/kg/minute. For mobilization of lymphoid-committed progenitors, mice receive twice weekly infusion via the dorsal tail vein of active or modified α1PI (42 mg/kg) at a rate of 0.08 ml/kg/minute. Mice are asphyxiated with dry ice, peripheral blood is collected by cardiac aspiration into heparinized tubes, and bone marrow is harvested, and cells are flushed from femurs and tibias into single-cell suspensions. Peripheral blood and bone marrow cells are analyzed by flow cytometry for the presence of myeloid and lymphoid markers including CD34 CD38, CD10, CD11b, CD11c, CD13, CD14, CD19, CD3, CD4, CD8, CD45, CD184 (CXCR4), CD66, and HLEcs (U.S. Pat. No. 6,858,400).
6.4 Bind anti-HIV-1 gp120: Active or modified α1PI are incubated in fluid phase with monoclonal antibodies reactive with HIV-1 gp120. The anti-gp120 monoclonal antibodies 3F5 (hybridoma culture supernatant, 0085-P3F5-D5-F8) is reactive with an epitope near the gp120 C5 domain (Moore et al., 1994). Clone α70 (ICN Biochemicals, Aurora, Ohio) is reactive with the V3-loop of gp120, a domain that is identical to the HLE ligand inter-α-trypsin inhibitor (Pratt et al., 1987). Immune complexes are captured by incubating mixtures in wells of a microtiter plate pre-coated with chicken anti-human α1PI IgG. Binding is detected using horse radish peroxidase-conjugated rabbit anti-mouse IgG followed by substrate, orthophenylene diamine HCl.
6.5 Facilitate HIV-1 infectivity: Primary non-syncytium inducing HIV-1 clinical isolates (Advanced Biotechnologies, Rivers Park, Ill.) are used to infect peripheral blood mononuclear cells maintained in wells of a 96 well tissue culture plate at 2×106cells/ml in RPMI-1640 containing 20% autologous serum and 10% IL-2 (Cellular Products, Buffalo, N.Y.). Prior to addition of HIV-1, cells are incubated with active or modified α1PI for 0 min or 60 min at 37° C., 5% CO2. In vitro infectivity outcome is determined in triplicate by p24 accumulation or by RT activity as previously described (Bristow, 2001). Cell counts and viability are determined at the final time point.
7.1 To determine the effectiveness of treatment on elastase inhibitory capacity, individuals are monitored weekly for active and inactive α1PI blood levels (Bristow et al., 1998) (U.S. Pat. No. 6,887,678). Briefly, a constant amount of active site-titrated PPE is allowed to incubate with serial dilutions of serum for 2 min at 37° C. after which a PPE substrate is added. Determination of the molecules of substrate cleaved by residual, uninhibited PPE is used to calculate the molecules of active and inactive α1PI in blood.
7.2 To determine the effectiveness of treatment on inducing changes in levels of targeted blood cell populations, treated individuals are monitored weekly for changes in complete blood count and differential, as well as for changes in specific subsets of blood cells such as CD4+ cells and HLEcs+ cells using flow cytometry (Bristow et al 2001; Bristow, 2001) (U.S. Pat. No. 6,858,400). Briefly, 100 μl of whole blood is incubated with a panel of fluorescently-labeled monoclonal antibodies approved by the FDA for medical diagnostics. These antibodies are selected to specifically recognize the cell receptors that uniquely identify the cell population of interest. Identification and enumeration of the cells in blood that are bound to the monoclonal antibodies is performed using flow cytometry.
7.3 To determine the influence of treatment on disease progression, individuals are monitored for the specific pathologic determinants of disease which are well known in the art for the various indications, e.g. in stem cell transplantation, organ transplantation, autoimmunity, diabetes, leukemia, cancer, HIV-1 infection, atherosclerosis, and other diseases influenced by blood cells. For example, in HIV-1 disease, individuals are monitored for changes in CD4+ lymphocyte levels and HIV levels (Bristow et al., 2001; Bristow, 2001). In leukemia or cancer, individuals are monitored for changes in the presence of leukemic or cancerous cells (Tavor. S. et al., 2005). In stem cell transplantation, individuals are monitored for changes in normal blood cells (Jansen et al., 2005). In organ transplantation, individuals are monitored for organ rejection (Kirschfink, 2002). In autoimmunity, individuals are monitored for the presence of autoantibodies and specific functions of the affected organs (Marinaki et al., 2005). In diabetes and atherosclerosis, individuals are monitored for changes in total cholesterol, LDL, HDL, and triglyceride levels (Talmud et al., 2003).
1. Increased CD4+ lymphocytes are correlated with increased α1PI and decreased HLEcs+ lymphocytes in healthy individuals. In healthy individuals, circulating α1PI ranges from 18-53 μM between the 5th and 95th percentiles, and 90-100% of this protein is in its active form as determined by inhibition of porcine pancreatic elastase (Bristow et al., 2001). To investigate the relationship between active α1PI, HLEcs+, and CD4+ lymphocytes, 6 healthy HIV-1 seronegative adults, 3 males and 3 females, were specifically selected to represent a wide spectrum of α1PI (1.9-61.5 μM). Subjects were measured for CD4, CXCR4, CCR5, HLEcs, active and inactive α1PI levels, and α2-macroglobulin (α2M). Independently, neither active α1PI, HLEcs+ lymphocytes, α2M, CXCR4+ lymphocytes, nor CCR5+ lymphocytes were correlated with CD4+ lymphocytes. However, by multilinear regression analysis, it was found that higher numbers of CD4+ lymphocytes (% lymphocytes) were correlated (r2=0.937) with two counterbalancing variables together, higher active α1PI (p=0.008) and lower HLEcs+ lymphocytes (p=U.034) (
To investigate CD4+ lymphocyte levels in the general population, blood was collected from an additional 18 healthy, HIV-1 seronegative adults, 9 males and 9 females, who were measured for CD4, CXCR4, CCR5, SDP--1, active and inactive α1PI levels. HLEcs was measured in 16 of these individuals. Values for active α1PI (19-37 μM) and SDF-1 levels (191-359 pM) for these volunteers were found to be within normal ranges. Higher CD4+ lymphocytes (%) were again found to be correlated (rz=0.803) with higher active α1PI (p<0.007) and lower HLEcs+ lymphocytes (p<0.001) (
There was no statistical difference between the volunteers in
2. Monoclonal anti-gp120 binds human, but not chimpanzee chili. Two monoclonal antibodies (1C1 and 3F5) which bind a conformationally determined epitope near the C5 domain of gp120 (Moore et al., 1994) were found to also bind human α1PI (Bristow et al., 2001.). It was hypothesized that anti-gp120 mediated depletion of active α1PI might be pathognomonic for HIV-1 AIDS. If true, chimpanzee α1 PI should differ from human α1PI since HIV-1 infected chimpanzees survive infection and regain normal levels of CD4+ lymphocytes (Rutjens et al., 2003). Sequence comparison revealed that human α1PI differs from chimpanzee α1PI by one amino acid (aa 385) caused by a single nucleotide change (NCBI accession numbers BT019455 and XP_522938), and this aa difference lies in the gp120-homologous region of α1PI. To determine whether this sequence difference affects the binding of anti-gp120 to α1PI, 20 human and 20 chimpanzee sera were compared. Both 1C1 (data not shown) and 3F5 exhibited 8- to 14-fold greater binding to human, than chimpanzee α1PI in 6 repeat measurements (p<0.001) (
To examine the relationship between lower CD4+ lymphocyte levels and lower active α1PI levels HIV-1 in disease, blood from 38 HIV-1 infected patients was analyzed. Of these 38 patients, 29% had detectable IgG-α1PI immune complexes, 89% were on antiretroviral therapy, and 60% had <500 HIV-1 RNA copies/ml (
None of the sera from healthy chimpanzees, nor sera collected from 2 chimpanzees post-HIV-1 inoculation, had evidence of detectable IgG-α1PI immune complexes. The HIV-1 inoculated chimpanzees were confirmed to be HIV-1 infected, but had normal CD4+ lymphocytes (Girard et al., 1998). In addition, despite the presence of anti-gp120, we found no evidence of. IgG-α1PI immune complexes in 10 rhesus macaques following immunization with simian/human immunodeficiency virus (SHIV 89.6) gp120 or gp140, or in 3 macaques infected with SHIV (data not shown). Extensive in vitro analyses failed to demonstrate bi-molecular complexes between gp120 and α1PI (data not shown), and the absence of detection of IgG-α1PI immune complexes in sera from HIV-1 infected chimpanzees suggests gp120 and α1PI are not associated by aggregation in sera. These results suggest that IgG-α1PI immune complexes are unique to HIV-1 disease in humans.
Consistent with evidence from a previous patient study, active α1PI in the HIV-1 infected patients was significantly below normal (median 17 μM, p<0.001) (
To determine whether α1PI becomes inactivated after complexing with the 3F5 anti-gp120 monoclonal antibody, 3F5 was incubated with sera samples from five healthy individuals. In comparison to untreated sera, α1PI activity was significantly diminished to the same degree in all sera (mean difference=5.8±0.5 μM, p<0.001.) (
The gp120 epitope recognized by 1C1 and 3F5 is considered to be conformation-dependent (Moore et al., 1994). The gp120 peptide immunogen used to raise 1C1 and 3F5 (aa 300-321, GGGDMRDNWRSELYKYKVVK) (Ratner et al., 1985) contains both an α-helix (aa 306-313) and linear strand (aa 314-321) (
In α1PI, the sequence GKVV (aa 386-389) lies within 5A° of M-385, N-46, and the N-linked oligosaccharide in a space occupying 5A° by 5A° by 5A°. In gp120, in the same relative orientation as in etiPI, the sequence YKVV (aa 315-318) lies within 5A° of M-17 and 8A° of N-92 and the N-linked mannose-containing oligosaccharide (Leonard et al., 1987) in a space occupying 5A° by 5A° by 8A°. Evidence that α1PI polymorphisms may influence 3F5 binding (
In the 23 patients with <500 HIV-1 RNA copies/ml, higher CD4+ lymphocyte levels were correlated with higher active α1PI concentration (r2=0.927) and lower inactive α1PI concentration (r2=0.946) (
Patients with <500 HIV-1 RNA copies/ml and <200 CD4 cells/μl who are receiving antiretroviral therapy are treated using Zemaira® α1PI. Patients receive weekly infusions of Zemaira® at 60 mg/kg as described in Section 2 of the Detailed Description. Treatment outcome is monitored as described in Section 7.3 of the Detailed Description. Specifically, patients receiving Zemaira® are monitored weekly for changes in active and inactive α1PI levels as well as for CD4+ T lymphocytes and other subsets of circulating blood cells. Patients are also monitored for changes in HIV-1 RNA copies/ml, LDL, HDL, cholesterol, triglycerides, and the occurrence of infections designated by the CDC as parameters of HIV-1 disease progression (Castro et al., 1992). To determine possible adverse effects of immune complex disease, individuals are monitored for the presence of antibodies reactive with α1PI as well as for the occurrence of glomerulonephritis by measuring either proteinuria or serum creatinine levels (Bristow et al., 2001; Virella et al., 1981).
α1PI is genetically modified as described in Section 4 of the Detailed Description with three substitutions, aa 385 (Met to Val), aa 372 (Phe to Gly), and aa 373 (Leu to Gly), and is designated α1PI.β.F372G.L373G.M385V (α1PI.β). The α1PI.β sequence with aa changes represented in bold underlined letters is as follows:
The functional capacity of α1PI.β depicted in Table 2 is determined as described in Section 6 of the Detailed Description.
The recommended dose of α1PI is 60 mg/kg. The specific activity of Zemaira® is 70%, where specific activity is defined as inhibition of PPE (Bristow et al., 1998). Thus, the recommended dose of Zemaira® α1PI may be stated as 42 mg/kg active α1PI. In accordance with the recommended Zemaira® treatment regimen, HIV-1 patients with <500 HIV-1 RNA copies/ml and <200 CD4 cells/μl who are receiving antiretroviral therapy are infused with the concentration of α1PI.β that is in the range of 1 to 420 mg/kg active α1PI with a target blood threshold of 35 μM α1PI.β. Treatment of HIV-1 infected patients with α1PI.β is indicated in patients who are simultaneously receiving one or a combination of the four currently known classes, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, HIV-1 aspartyl protease inhibitors, and fusion inhibitors. Treatment outcome is monitored as described in Section 7.3 of the Detailed Description. Specifically, patients receiving α1PI.β are monitored weekly for changes in active and inactive α1PI levels as well as for CD4+ T lymphocytes and other subsets of circulating blood cells. Patients are also monitored for changes in HIV-1 RNA copies/ml, LDL, HDL, cholesterol, triglycerides, and the occurrence of infections designated by the CDC as parameters of HIV-1 disease progression (Castro et al., 1992). To determine possible adverse effects of immune complex disease, individuals are monitored for the presence of antibodies reactive with α1PI as well as for the occurrence of glomerulonephritis by measuring either proteinuria or serum creatinine levels (Bristow et al., 2001; Virella et al., 1981).
A serious side effect of myelosuppressive chemotherapy for solid tumors, is neutropenia. G-CSF (Filgrastim, Neupogen® or Neulasta®, Amgen, Inc.) is currently used to mobilize neutrophils in patients on myelosuppressive chemotherapy. In combination with G-CSF, using active α1PI therapeutically to mobilize lymphoid-lineage cells in patients receiving myelosuppressive chemotherapy offers the additional benefit of controlling tumor metastasis. Patients receive active α1PI with a target blood threshold of 35 μM active α1PI and are monitored for active and inactive α1PI levels as well as for changes in the number of myeloid-lineage, lymphoid-lineage, and tumor cells in circulation using flow cytometry.
Patients undergoing stem cell transplantation are treated with G-CSF (Filgrastim, Neupogen® or Neulasta®, Amgen, Inc.) to mobilize progenitor cells into circulation, and these are primarily myeloid-committed progenitor cells (Cottler-Fox et al., 2003). Progenitor cells are harvested from blood and placed in culture in vitro for the purpose of proliferation before transplantation. Proliferation and differentiation is monitored using flow cytometry. Active α1PI is given therapeutically with a target blood threshold of 200 μM active α1PI to mobilize lymphoid-lineage cells into circulation. Mobilized lymphoid-committed progenitor cells are harvested from blood and placed in culture in Vitro for the purpose of proliferation before transplantation. Patients receiving mobilization treatment with active α1PI are monitored for active and inactive α1PI levels. Harvested lymphoid-committed progenitor cells are monitored for proliferation and differentiation using flow cytometry prior to reinjection.
Active α1PI is used to stimulate in vitro differentiation of lymphoid-lineage and myeloid-lineage blood cells into dendritic cells. Differentiation and function of dendritic cells is monitored using flow cytometry and cytokine secretion as described previously (Messmer et al., 2002). Dendritic cells are pulsed with antigen and reinjected into the patient. Patients receiving α1PI-induced dendritic cells are monitored for the presence of immunogen-specific lymphocytes.
Elliott, P. R., Pei, X. Y., Dafforn, T. R., and Lomas, D. A. (2000). Topography of a 2.0 A structure of alphal-antitrypsin reveals targets for rational drug design to prevent conformational disease [In Process Citation]. Protein Sci 9, 1274-1281.
Jeppsson, J. O., Lilja, H., and Johansson, M. (1985). Isolation and characterization of two minor fractions of alpha 1-antitrypsin by high-performance liquid chromatographic chromatofocusing. J. Chromatogr, 327, 173-177.
Joslin, G., Fallon, R. J., Bullock, J., Adams, S. P., and Perlmutter, D. H. (1991). The SEC receptor recognizes a pentapeptide neodomain of alpha-1- antitrypsin-protease. J. Biol. Chem. 266, 11282-11288.
Joslin, G., August, A. M., Adams, S., Fallon, R. J., Senior, R. M., and Perlmutter, D. H. (1992). The serpin-enzyme complex (SEC) receptor mediates the neutrophil chemotactic effect of α-1 antitrypsin-elastase complexes and amyloid-β peptide. J. Clin. Invest. 90, 1150-1154.
Kushner, I. (1982). The phenomenon of the acute phase response. Ann. N. Y. Acad. Sci. 389, 39-47.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will be apparent to those skilled in the art from the foregoing description and the accompanying figures.
Patents, patent applications, publications, product descriptions, and protocols are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes.
This application claims priority under 35 U.S.C. §119(e) from Provisional Application No. 60/748,137 filed Dec. 6, 2005.
| Number | Date | Country | |
|---|---|---|---|
| 60748137 | Dec 2005 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 13302821 | Nov 2011 | US |
| Child | 15478028 | US | |
| Parent | 11566903 | Dec 2006 | US |
| Child | 13302821 | US |
